#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_tumor_sample
PRAMEF2	65122	broad.mit.edu	37	1	12921316	12921316	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr1:12921316C>G	ENST00000240189.2	+	4	1194	c.1107C>G	c.(1105-1107)atC>atG	p.I369M		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	369					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TCAGTGCCATCCTGCCTGGCC	0.562																																						uc001aum.1		NaN																	0					0						c.(1105-1107)ATC>ATG		PRAME family member 2							119.0	124.0	123.0					1																	12921316		2201	4295	6496	SO:0001583	missense	65122							g.chr1:12921316C>G		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.1107C>G	1.37:g.12921316C>G	ENSP00000240189:p.Ile369Met						p.I369M	NM_023014	NP_075390	O60811	PRAM2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	4	1194	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	369			LRR 2.			Missense_Mutation	SNP	ENST00000240189.2	37	c.1107C>G	CCDS149.1	.	.	.	.	.	.	.	.	.	.	C	6.996	0.553885	0.13374	.	.	ENSG00000120952	ENST00000240189	T	0.01192	5.2	0.824	-0.256	0.12984	.	0.839614	0.10515	N	0.665654	T	0.06962	0.0177	M	0.82823	2.61	0.09310	N	1	B	0.32365	0.367	P	0.62813	0.907	T	0.42120	-0.9470	10	0.72032	D	0.01	.	5.206	0.15291	0.0:0.6489:0.3511:0.0	.	369	O60811	PRAM2_HUMAN	M	369	ENSP00000240189:I369M	ENSP00000240189:I369M	I	+	3	3	PRAMEF2	12843903	0.013000	0.17824	0.083000	0.20561	0.000000	0.00434	-0.170000	0.09897	-0.160000	0.11002	-1.402000	0.01139	ATC		0.562	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1		NM_023014		7	187	0	0	0	0.00308	0	7	187		
KIAA0754	643314	broad.mit.edu	37	1	39878410	39878410	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr1:39878410G>C	ENST00000530275.1	+	1	2260	c.2065G>C	c.(2065-2067)Gag>Cag	p.E689Q	MACF1_ENST00000545844.1_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000317713.7_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	689										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACCAGTTTTAGAGGAATGGAT	0.493																																						uc009vvt.1		NaN																	0					0						c.(2473-2475)GAG>CAG		hypothetical protein LOC643314							34.0	34.0	34.0					1																	39878410		1899	4120	6019	SO:0001583	missense	643314							g.chr1:39878410G>C			1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.2065G>C	1.37:g.39878410G>C	ENSP00000431179:p.Glu689Gln					MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc010oiu.1_Intron	p.E825Q	NM_015038	NP_055853	O94854	K0754_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		1	3235	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	689					E9PMC2|Q6ZSB2	Missense_Mutation	SNP	ENST00000530275.1	37	c.2473G>C		.	.	.	.	.	.	.	.	.	.	G	26.3	4.728761	0.89390	.	.	ENSG00000255103	ENST00000530275	T	0.26810	1.71	4.14	3.2	0.36748	.	.	.	.	.	T	0.30386	0.0763	N	0.19112	0.55	0.18873	N	0.999983	D	0.71674	0.998	D	0.66351	0.943	T	0.05920	-1.0856	9	0.59425	D	0.04	.	7.9175	0.29827	0.1172:0.0:0.8828:0.0	.	689	O94854	K0754_HUMAN	Q	689	ENSP00000431179:E689Q	ENSP00000431179:E689Q	E	+	1	0	RP4-562N20.1	39650997	0.408000	0.25360	0.987000	0.45799	0.919000	0.55068	0.433000	0.21477	2.158000	0.67659	0.561000	0.74099	GAG		0.493	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392100.1		NM_015038		3	24	0	0	0	0.009096	0	3	24		
CTPS1	1503	broad.mit.edu	37	1	41471729	41471729	+	Missense_Mutation	SNP	A	A	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr1:41471729A>G	ENST00000372621.4	+	13	1767	c.1259A>G	c.(1258-1260)aAt>aGt	p.N420S	CTPS1_ENST00000372616.1_Missense_Mutation_p.N420S|CTPS1_ENST00000541520.1_Missense_Mutation_p.N189S	NM_001905.2	NP_001896.2			CTP synthase 1											endometrium(3)|lung(10)	13						TCAGATGCCAATTCTACAGAG	0.408																																						uc001cgk.3		NaN																	0					0						c.(1258-1260)AAT>AGT		CTP synthase	L-Glutamine(DB00130)						124.0	118.0	120.0					1																	41471729		2203	4300	6503	SO:0001583	missense	1503				CTP biosynthetic process|glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|response to drug	cytosol	ATP binding|CTP synthase activity|protein binding	g.chr1:41471729A>G	BC009408	CCDS459.1	1p34.1	2012-05-02	2012-05-02	2012-05-02	ENSG00000171793	ENSG00000171793	6.3.4.2		2519	protein-coding gene	gene with protein product		123860	"""CTP synthase"""	CTPS		1783378	Standard	XM_005270536		Approved		uc001cgk.4	P17812	OTTHUMG00000005712	ENST00000372621.4:c.1259A>G	1.37:g.41471729A>G	ENSP00000361704:p.Asn420Ser					CTPS_uc010ojo.1_Missense_Mutation_p.N189S|CTPS_uc001cgl.3_Missense_Mutation_p.N420S|CTPS_uc010ojq.1_Missense_Mutation_p.N264S|CTPS_uc009vwe.2_Missense_Mutation_p.N140S	p.N420S	NM_001905	NP_001896	P17812	PYRG1_HUMAN			13	1767	+	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	420			Glutamine amidotransferase type-1.			Missense_Mutation	SNP	ENST00000372621.4	37	c.1259A>G	CCDS459.1	.	.	.	.	.	.	.	.	.	.	A	18.43	3.622222	0.66787	.	.	ENSG00000171793	ENST00000372621;ENST00000541520;ENST00000372616	T;T;T	0.47869	0.88;0.83;0.88	5.95	5.95	0.96441	Glutamine amidotransferase type 1 (2);	0.000000	0.85682	D	0.000000	T	0.61540	0.2355	M	0.74467	2.265	0.80722	D	1	P;P	0.50156	0.593;0.932	P;P	0.51945	0.582;0.685	T	0.65973	-0.6038	10	0.66056	D	0.02	.	15.2399	0.73461	1.0:0.0:0.0:0.0	.	189;420	B4DR64;P17812	.;PYRG1_HUMAN	S	420;189;420	ENSP00000361704:N420S;ENSP00000442646:N189S;ENSP00000361699:N420S	ENSP00000361699:N420S	N	+	2	0	CTPS	41244316	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.692000	0.91284	2.279000	0.76181	0.533000	0.62120	AAT		0.408	CTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015629.1		NM_001905		3	119	0	0	0	0.004672	0	3	119		
C8B	732	broad.mit.edu	37	1	57409489	57409489	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr1:57409489G>C	ENST00000371237.4	-	8	1180	c.1114C>G	c.(1114-1116)Ctt>Gtt	p.L372V	C8B_ENST00000535057.1_Missense_Mutation_p.L310V|C8B_ENST00000543257.1_Missense_Mutation_p.L320V	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	372	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)				breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						ACGTTGTTAAGAGTATAATCT	0.443																																						uc001cyp.2		NaN																	0				central_nervous_system(2)|large_intestine(1)|ovary(1)	4						c.(1114-1116)CTT>GTT		complement component 8, beta polypeptide							137.0	123.0	128.0					1																	57409489		2203	4300	6503	SO:0001583	missense	732				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex		g.chr1:57409489G>C	M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.1114C>G	1.37:g.57409489G>C	ENSP00000360281:p.Leu372Val					C8B_uc010oon.1_Missense_Mutation_p.L310V|C8B_uc010ooo.1_Missense_Mutation_p.L320V	p.L372V	NM_000066	NP_000057	P07358	CO8B_HUMAN			8	1181	-			372			MACPF.		A1L4K7	Missense_Mutation	SNP	ENST00000371237.4	37	c.1114C>G	CCDS30730.1	.	.	.	.	.	.	.	.	.	.	G	10.52	1.372933	0.24857	.	.	ENSG00000021852	ENST00000371237;ENST00000543257;ENST00000535057	D;D;D	0.84589	-1.87;-1.87;-1.87	4.49	3.57	0.40892	Membrane attack complex component/perforin (MACPF) domain (3);	0.360984	0.27558	N	0.018835	D	0.83723	0.5316	M	0.81942	2.565	0.46028	D	0.99882	P;P;P	0.46859	0.767;0.86;0.885	B;B;P	0.45753	0.269;0.352;0.492	T	0.80484	-0.1362	10	0.28530	T	0.3	-17.4075	4.0526	0.09801	0.19:0.0:0.6225:0.1875	.	320;310;372	F5H7G1;F5GY80;P07358	.;.;CO8B_HUMAN	V	372;320;310	ENSP00000360281:L372V;ENSP00000442548:L320V;ENSP00000440113:L310V	ENSP00000360281:L372V	L	-	1	0	C8B	57182077	0.999000	0.42202	0.922000	0.36590	0.459000	0.32528	0.829000	0.27449	1.482000	0.48325	0.655000	0.94253	CTT		0.443	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2				6	112	0	0	0	0.021553	0	6	112		
LRRC7	57554	broad.mit.edu	37	1	70504020	70504020	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr1:70504020G>A	ENST00000035383.5	+	19	2429	c.2399G>A	c.(2398-2400)aGa>aAa	p.R800K	LRRC7_ENST00000415775.2_Missense_Mutation_p.R84K|LRRC7_ENST00000310961.5_Missense_Mutation_p.R805K	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	800						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TCGAAATCTAGAAGCACATCT	0.488																																						uc001dep.2		NaN																	0				ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						c.(2398-2400)AGA>AAA		leucine rich repeat containing 7							136.0	118.0	124.0					1																	70504020		2203	4300	6503	SO:0001583	missense	57554					centrosome|focal adhesion|nucleolus	protein binding	g.chr1:70504020G>A		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.2399G>A	1.37:g.70504020G>A	ENSP00000035383:p.Arg800Lys					LRRC7_uc009wbg.2_Missense_Mutation_p.R84K|LRRC7_uc001deq.2_Missense_Mutation_p.R41K	p.R800K	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN			19	2429	+			800					Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	c.2399G>A	CCDS645.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.589568	0.86851	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.56275	0.47;0.58;1.69	5.53	5.53	0.82687	.	0.116151	0.56097	D	0.000031	T	0.53578	0.1805	L	0.50333	1.59	0.53688	D	0.999971	D;D;D	0.69078	0.997;0.99;0.982	D;D;D	0.77557	0.99;0.979;0.952	T	0.50276	-0.8847	10	0.06494	T	0.89	.	18.4553	0.90718	0.0:0.0:1.0:0.0	.	84;800;800	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	K	805;800;84;623	ENSP00000309245:R805K;ENSP00000035383:R800K;ENSP00000394867:R84K	ENSP00000035383:R800K	R	+	2	0	LRRC7	70276608	1.000000	0.71417	0.897000	0.35233	0.942000	0.58702	9.405000	0.97313	2.614000	0.88457	0.467000	0.42956	AGA		0.488	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1		NM_020794		11	181	0	0	0	0.010729	0	11	181		
PSMD4	5710	broad.mit.edu	37	1	151238867	151238867	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr1:151238867G>C	ENST00000368884.3	+	8	927	c.847G>C	c.(847-849)Gag>Cag	p.E283Q	PSMD4_ENST00000368881.4_Missense_Mutation_p.E286Q	NM_002810.2	NP_002801.1	P55036	PSMD4_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 4	283					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, base subcomplex (GO:0008540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(7)	11	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CAGTATGACTGAGGAAGAGCA	0.552																																						uc001exl.2		NaN																	0					0						c.(847-849)GAG>CAG		proteasome 26S non-ATPase subunit 4							108.0	99.0	102.0					1																	151238867		2203	4300	6503	SO:0001583	missense	5710				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding|zinc ion binding	g.chr1:151238867G>C	U51007	CCDS991.1	1q21.2	2008-05-22			ENSG00000159352	ENSG00000159352		"""Proteasome (prosome, macropain) subunits"""	9561	protein-coding gene	gene with protein product		601648				8641424	Standard	XM_005245354		Approved	S5A, AF-1, AF, Rpn10	uc001exl.3	P55036	OTTHUMG00000012349	ENST00000368884.3:c.847G>C	1.37:g.151238867G>C	ENSP00000357879:p.Glu283Gln					PSMD4_uc001exn.2_Missense_Mutation_p.E286Q	p.E283Q	NM_002810	NP_002801	P55036	PSMD4_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)		8	909	+	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		283			UIM 2.		D3DV16|Q5VWC5|Q9NS92	Missense_Mutation	SNP	ENST00000368884.3	37	c.847G>C	CCDS991.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.7|27.7	4.854473|4.854473	0.91355|0.91355	.|.	.|.	ENSG00000159352|ENSG00000159352	ENST00000368884;ENST00000368881|ENST00000445776	.|.	.|.	.|.	5.23|5.23	5.23|5.23	0.72850|0.72850	Ubiquitin interacting motif (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.79246|.	0.4413|.	M|M	0.83774|0.83774	2.66|2.66	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|.	0.79654|.	-0.1713|.	9|.	0.56958|.	D|.	0.05|.	-32.2002|-32.2002	18.5873|18.5873	0.91194|0.91194	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	286;283|.	Q5VWC4;P55036|.	.;PSMD4_HUMAN|.	Q|S	283;286|98	.|.	ENSP00000357876:E286Q|.	E|X	+|+	1|2	0|2	PSMD4|PSMD4	149505491|149505491	1.000000|1.000000	0.71417|0.71417	0.948000|0.948000	0.38648|0.38648	0.974000|0.974000	0.67602|0.67602	8.585000|8.585000	0.90802|0.90802	2.716000|2.716000	0.92895|0.92895	0.655000|0.655000	0.94253|0.94253	GAG|TGA		0.552	PSMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034409.3		NM_002810		12	99	0	0	0	0.013537	0	12	99		
FLG	2312	broad.mit.edu	37	1	152275618	152275618	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr1:152275618G>C	ENST00000368799.1	-	3	11779	c.11744C>G	c.(11743-11745)tCt>tGt	p.S3915C	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3915	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TACAGGTGAAGACTGTACATG	0.498									Ichthyosis																													uc001ezu.1		NaN																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(11743-11745)TCT>TGT		filaggrin							117.0	113.0	114.0					1																	152275618		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152275618G>C	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11744C>G	1.37:g.152275618G>C	ENSP00000357789:p.Ser3915Cys						p.S3915C	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	11780	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		3915			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.11744C>G	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	9.162	1.019001	0.19355	.	.	ENSG00000143631	ENST00000368799	T	0.00717	5.79	3.52	0.301	0.15781	.	.	.	.	.	T	0.00845	0.0028	L	0.57536	1.79	0.09310	N	1	D	0.69078	0.997	D	0.70935	0.971	T	0.51293	-0.8724	9	0.72032	D	0.01	.	2.0764	0.03625	0.1187:0.1958:0.4842:0.2012	.	3915	P20930	FILA_HUMAN	C	3915	ENSP00000357789:S3915C	ENSP00000357789:S3915C	S	-	2	0	FLG	150542242	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	0.836000	0.27545	-0.037000	0.13646	0.655000	0.94253	TCT		0.498	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1		NM_002016		5	101	0	0	0	0.001984	0	5	101		
IQGAP3	128239	broad.mit.edu	37	1	156507074	156507074	+	Silent	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr1:156507074G>A	ENST00000361170.2	-	27	3331	c.3321C>T	c.(3319-3321)agC>agT	p.S1107S	IQGAP3_ENST00000498755.1_5'UTR	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1107	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCTCGGGGTGGCTCAAGGCCT	0.562																																						uc001fpf.2		NaN																	0				ovary(5)|skin(1)	6						c.(3319-3321)AGC>AGT		IQ motif containing GTPase activating protein 3							111.0	92.0	99.0					1																	156507074		2203	4300	6503	SO:0001819	synonymous_variant	128239				small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity	g.chr1:156507074G>A	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.3321C>T	1.37:g.156507074G>A							p.S1107S	NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN			27	3396	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		1107			Ras-GAP.		Q5T3H8	Silent	SNP	ENST00000361170.2	37	c.3321C>T	CCDS1144.1																																																																																				0.562	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1		NM_178229		3	36	0	0	0	0.004672	0	3	36		
PBX1	5087	broad.mit.edu	37	1	164761814	164761814	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr1:164761814G>A	ENST00000420696.2	+	3	537	c.349G>A	c.(349-351)Gtg>Atg	p.V117M	PBX1_ENST00000540246.1_Missense_Mutation_p.V12M|PBX1_ENST00000367897.1_Missense_Mutation_p.V117M|PBX1_ENST00000559240.1_Missense_Mutation_p.V117M|PBX1_ENST00000401534.1_Missense_Mutation_p.V117M|PBX1_ENST00000560641.1_Missense_Mutation_p.V12M|PBX1_ENST00000540236.1_Missense_Mutation_p.V117M	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	117					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						AGCGGAAGGCGTGGCGGGGCC	0.622			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																	uc001gct.2		NaN		Dom	yes		1	1q23	5087	T	pre-B-cell leukemia transcription factor 1			"""L, M"""	TCF3|EWSR1		pre B-ALL|myoepithelioma	EWSR1/PBX1(3)	0				soft_tissue(3)|lung(1)|skin(1)	5						c.(349-351)GTG>ATG		pre-B-cell leukemia homeobox 1							28.0	32.0	31.0					1																	164761814		2203	4300	6503	SO:0001583	missense	5087				negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr1:164761814G>A	M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.349G>A	1.37:g.164761814G>A	ENSP00000405890:p.Val117Met					PBX1_uc010pku.1_Missense_Mutation_p.V117M|PBX1_uc010pkv.1_Missense_Mutation_p.V34M|PBX1_uc001gcs.2_Missense_Mutation_p.V117M|PBX1_uc010pkw.1_Missense_Mutation_p.V7M	p.V117M	NM_002585	NP_002576	P40424	PBX1_HUMAN			3	607	+			117					B4DSC1|F5H4U9|Q5T488	Missense_Mutation	SNP	ENST00000420696.2	37	c.349G>A	CCDS1246.1	.	.	.	.	.	.	.	.	.	.	G	33	5.199362	0.94997	.	.	ENSG00000185630	ENST00000340699;ENST00000420696;ENST00000367897;ENST00000540236;ENST00000401534;ENST00000540246	T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76	5.5	5.5	0.81552	PBX (1);	0.000000	0.85682	D	0.000000	T	0.70037	0.3178	M	0.86953	2.85	0.09310	N	1.0	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.81914	0.99;0.994;0.994;0.995;0.994	T	0.75750	-0.3208	9	0.87932	D	0	-13.4663	18.9768	0.92740	0.0:0.0:1.0:0.0	.	12;117;117;117;117	B7Z774;A8K5V0;F5H4U9;P40424;Q53YC7	.;.;.;PBX1_HUMAN;.	M	117;117;117;117;117;12	ENSP00000341455:V117M;ENSP00000405890:V117M;ENSP00000356872:V117M;ENSP00000439943:V117M;ENSP00000384856:V117M;ENSP00000440869:V12M	ENSP00000341455:V117M	V	+	1	0	PBX1	163028438	1.000000	0.71417	0.954000	0.39281	0.927000	0.56198	9.276000	0.95745	2.555000	0.86185	0.563000	0.77884	GTG		0.622	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082864.4		NM_002585		3	18	0	0	0	0.004672	0	3	18		
PM20D1	148811	broad.mit.edu	37	1	205819093	205819093	+	Silent	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr1:205819093C>T	ENST00000367136.4	-	1	152	c.108G>A	c.(106-108)gcG>gcA	p.A36A	PM20D1_ENST00000460624.1_5'UTR	NM_152491.4	NP_689704.4	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1	36					negative regulation of neuron death (GO:1901215)|regulation of defense response to virus by host (GO:0050691)|regulation of viral process (GO:0050792)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|peptidase activity (GO:0008233)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)	28	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			GGATTCGCGACGCCCTTTGAT	0.592																																						uc001hdj.2		NaN																	0				skin(1)	1						c.(106-108)GCG>GCA		peptidase M20 domain containing 1 precursor							89.0	91.0	90.0					1																	205819093		2203	4300	6503	SO:0001819	synonymous_variant	148811					extracellular region	metal ion binding|peptidase activity	g.chr1:205819093C>T		CCDS1460.1	1q32.1	2008-02-05			ENSG00000162877	ENSG00000162877			26518	protein-coding gene	gene with protein product							Standard	NM_152491		Approved	FLJ32569, Cps1	uc001hdj.3	Q6GTS8	OTTHUMG00000035999	ENST00000367136.4:c.108G>A	1.37:g.205819093C>T						PM20D1_uc009xbr.2_RNA	p.A36A	NM_152491	NP_689704	Q6GTS8	P20D1_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0252)		1	153	-	Breast(84;0.201)		36					Q6P4E3|Q96DM4	Silent	SNP	ENST00000367136.4	37	c.108G>A	CCDS1460.1																																																																																				0.592	PM20D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087736.1		NM_152491		5	58	0	0	0	0.014758	0	5	58		
LAMB3	3914	broad.mit.edu	37	1	209789846	209789846	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr1:209789846C>T	ENST00000356082.4	-	22	3486	c.3352G>A	c.(3352-3354)Gag>Aag	p.E1118K	LAMB3_ENST00000391911.1_Missense_Mutation_p.E1118K|LAMB3_ENST00000367030.3_Missense_Mutation_p.E1118K	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	1118	Domain I.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		TCCATGGTCTCCCCAAACAGC	0.552																																						uc001hhg.2		NaN																	0				central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6						c.(3352-3354)GAG>AAG		laminin, beta 3 precursor							243.0	233.0	236.0					1																	209789846		2203	4300	6503	SO:0001583	missense	3914				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity	g.chr1:209789846C>T	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.3352G>A	1.37:g.209789846C>T	ENSP00000348384:p.Glu1118Lys					LAMB3_uc009xco.2_Missense_Mutation_p.E1118K|LAMB3_uc001hhh.2_Missense_Mutation_p.E1118K	p.E1118K	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0519)	21	3742	-			1118			Domain I.|Potential.		D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	ENST00000356082.4	37	c.3352G>A	CCDS1487.1	.	.	.	.	.	.	.	.	.	.	C	16.98	3.270418	0.59540	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030	T;T;T	0.36157	1.27;1.27;1.27	4.43	3.51	0.40186	.	0.492902	0.18940	U	0.126959	T	0.28200	0.0696	L	0.34521	1.04	0.31743	N	0.635598	P	0.48694	0.914	B	0.44044	0.439	T	0.22730	-1.0208	10	0.37606	T	0.19	.	8.9785	0.35950	0.0:0.8933:0.0:0.1067	.	1118	Q13751	LAMB3_HUMAN	K	1118	ENSP00000375778:E1118K;ENSP00000348384:E1118K;ENSP00000355997:E1118K	ENSP00000348384:E1118K	E	-	1	0	LAMB3	207856469	0.992000	0.36948	1.000000	0.80357	0.956000	0.61745	2.935000	0.48963	2.026000	0.59711	0.449000	0.29647	GAG		0.552	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2		NM_000228		9	183	0	0	0	0.013537	0	9	183		
KCNK2	3776	broad.mit.edu	37	1	215256745	215256745	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr1:215256745C>T	ENST00000444842.2	+	1	167	c.17C>T	c.(16-18)tCg>tTg	p.S6L	KCNK2_ENST00000391894.2_Intron|KCNK2_ENST00000391895.2_Intron	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	6					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)	p.S6W(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	CCCAGCGCCTCGCGGGAGAGA	0.547																																						uc001hkq.2		NaN																	2	Substitution - Missense(2)		urinary_tract(2)		0						c.(16-18)TCG>TTG		potassium channel, subfamily K, member 2 isoform	Dofetilide(DB00204)						67.0	76.0	73.0					1																	215256745		2203	4300	6503	SO:0001583	missense	3776						outward rectifier potassium channel activity	g.chr1:215256745C>T	AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.17C>T	1.37:g.215256745C>T	ENSP00000394033:p.Ser6Leu					KCNK2_uc001hko.2_Intron|KCNK2_uc009xdm.2_Intron|KCNK2_uc001hkp.2_Intron|KCNK2_uc010pua.1_RNA|KCNK2_uc001hkr.3_Intron	p.S6L	NM_001017425	NP_001017425	O95069	KCNK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	1	186	+			6			Cytoplasmic (Potential).		A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	ENST00000444842.2	37	c.17C>T	CCDS41467.1	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707250	0.48412	.	.	ENSG00000082482	ENST00000444842	T	0.21191	2.02	4.27	1.18	0.20946	.	0.933707	0.08889	N	0.878957	T	0.15609	0.0376	N	0.22421	0.69	0.23594	N	0.997333	P	0.44241	0.829	B	0.40134	0.32	T	0.23404	-1.0189	10	0.39692	T	0.17	.	11.786	0.52043	0.0:0.4634:0.5366:0.0	.	6	O95069	KCNK2_HUMAN	L	6	ENSP00000394033:S6L	ENSP00000394033:S6L	S	+	2	0	KCNK2	213323368	0.083000	0.21467	0.998000	0.56505	0.998000	0.95712	0.229000	0.17833	0.061000	0.16311	0.655000	0.94253	TCG		0.547	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2		NM_014217		9	79	0	0	0	0.008291	0	9	79		
ATAD1	84896	broad.mit.edu	37	10	89516664	89516664	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr10:89516664C>G	ENST00000308448.7	-	9	1225	c.847G>C	c.(847-849)Gac>Cac	p.D283H	ATAD1_ENST00000400215.3_Missense_Mutation_p.D195H|ATAD1_ENST00000328142.3_Missense_Mutation_p.D283H	NM_032810.2	NP_116199.2	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	283					ATP catabolic process (GO:0006200)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|positive regulation of receptor internalization (GO:0002092)	cell junction (GO:0030054)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			kidney(1)|large_intestine(4)|lung(4)|ovary(1)	10		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		TCTAGCAGGTCTACATGCCTA	0.353																																						uc001key.1		NaN																	0				large_intestine(1)|ovary(1)	2						c.(847-849)GAC>CAC		ATPase family, AAA domain containing 1							106.0	94.0	98.0					10																	89516664		2203	4300	6503	SO:0001583	missense	84896					peroxisome	ATP binding|nucleoside-triphosphatase activity	g.chr10:89516664C>G	AL834370	CCDS7386.1	10q23.31	2010-04-21		2007-02-08	ENSG00000138138	ENSG00000138138		"""ATPases / AAA-type"""	25903	protein-coding gene	gene with protein product		614452				12477932	Standard	NM_032810		Approved	FLJ14600	uc001kez.1	Q8NBU5	OTTHUMG00000018685	ENST00000308448.7:c.847G>C	10.37:g.89516664C>G	ENSP00000339017:p.Asp283His					ATAD1_uc010qmr.1_Missense_Mutation_p.D195H|ATAD1_uc009xth.1_RNA|ATAD1_uc001kez.1_Missense_Mutation_p.D283H	p.D283H	NM_032810	NP_116199	Q8NBU5	ATAD1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)	8	1130	-		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)	283					D3DR26|Q6DKG1|Q6P4B9|Q8N3G1|Q8WYR9|Q969Y3	Missense_Mutation	SNP	ENST00000308448.7	37	c.847G>C	CCDS7386.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.060102	0.76074	.	.	ENSG00000138138	ENST00000308448;ENST00000328142;ENST00000400215	D;D;D	0.98164	-4.76;-4.76;-4.76	5.28	4.36	0.52297	.	0.186372	0.56097	D	0.000024	D	0.98435	0.9479	M	0.71871	2.18	0.80722	D	1	D;D	0.62365	0.991;0.98	D;P	0.66351	0.943;0.808	D	0.97912	1.0309	9	.	.	.	-17.5616	13.6572	0.62346	0.0:0.9254:0.0:0.0746	.	195;283	B4E2J1;Q8NBU5	.;ATAD1_HUMAN	H	283;283;195	ENSP00000339017:D283H;ENSP00000339016:D283H;ENSP00000412968:D195H	.	D	-	1	0	ATAD1	89506644	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.837000	0.55820	2.624000	0.88883	0.655000	0.94253	GAC		0.353	ATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049235.1		NM_032810		6	99	0	0	0	0.021553	0	6	99		
MYOF	26509	broad.mit.edu	37	10	95147619	95147619	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr10:95147619G>A	ENST00000359263.4	-	19	1632	c.1633C>T	c.(1633-1635)Ctt>Ttt	p.L545F	MYOF_ENST00000371502.4_Missense_Mutation_p.L545F|MYOF_ENST00000358334.5_Missense_Mutation_p.L532F|MYOF_ENST00000371501.4_Missense_Mutation_p.L545F	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	545					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GTCTTCTCAAGAAAAGTGGCT	0.423																																						uc001kin.2		NaN																	0				ovary(3)|breast(1)	4						c.(1633-1635)CTT>TTT		myoferlin isoform a							160.0	148.0	152.0					10																	95147619		1873	4104	5977	SO:0001583	missense	26509				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding	g.chr10:95147619G>A	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.1633C>T	10.37:g.95147619G>A	ENSP00000352208:p.Leu545Phe					MYOF_uc001kio.2_Missense_Mutation_p.L532F	p.L545F	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN			19	1756	-			545			Cytoplasmic (Potential).		B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	c.1633C>T	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.609448	0.87258	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.85013	-1.91;-1.92;-1.92;-1.93	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	D	0.91761	0.7394	M	0.83118	2.625	0.58432	D	0.999998	D;D	0.63046	0.99;0.992	D;P	0.68621	0.959;0.851	D	0.91947	0.5568	10	0.52906	T	0.07	-18.147	13.5339	0.61638	0.0779:0.0:0.9221:0.0	.	532;545	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	F	532;545;545;545	ENSP00000351094:L532F;ENSP00000352208:L545F;ENSP00000360556:L545F;ENSP00000360557:L545F	ENSP00000351094:L532F	L	-	1	0	MYOF	95137609	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	5.297000	0.65704	2.583000	0.87209	0.655000	0.94253	CTT		0.423	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2		NM_013451		6	166	0	0	0	0.00308	0	6	166		
ARHGAP19	84986	broad.mit.edu	37	10	99025847	99025847	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr10:99025847G>C	ENST00000358531.4	-	2	120	c.92C>G	c.(91-93)tCt>tGt	p.S31C	ARHGAP19_ENST00000371027.1_Missense_Mutation_p.S22C|ARHGAP19-SLIT1_ENST00000453547.2_Missense_Mutation_p.S31C|ARHGAP19-SLIT1_ENST00000358308.3_Missense_Mutation_p.S31C|ARHGAP19_ENST00000355366.5_Missense_Mutation_p.S22C|ARHGAP19-SLIT1_ENST00000316676.8_Missense_Mutation_p.S31C	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19	31					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.S31F(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		TCGAAGGGAAGAATCATTGCA	0.393																																						uc001knb.2		NaN																	1	Substitution - Missense(1)		lung(1)		0						c.(91-93)TCT>TGT		Rho GTPase activating protein 19							81.0	80.0	81.0					10																	99025847		2203	4300	6503	SO:0001583	missense	84986				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|nucleus	GTPase activator activity	g.chr10:99025847G>C	AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.92C>G	10.37:g.99025847G>C	ENSP00000351333:p.Ser31Cys					ARHGAP19_uc001kmy.2_RNA|ARHGAP19_uc001kna.2_Missense_Mutation_p.S22C|ARHGAP19_uc009xvi.2_RNA|ARHGAP19_uc009xvj.2_Missense_Mutation_p.S31C|ARHGAP19_uc009xvk.2_Intron	p.S31C	NM_032900	NP_116289	Q14CB8	RHG19_HUMAN		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)	2	121	-		Colorectal(252;0.0854)	31					A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	Missense_Mutation	SNP	ENST00000358531.4	37	c.92C>G	CCDS7454.2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059231	0.76074	.	.	ENSG00000213390	ENST00000453547;ENST00000316676;ENST00000355366;ENST00000358531;ENST00000371027;ENST00000358308	T;T;T;T;T;T	0.10860	2.95;2.98;3.0;2.99;3.01;2.83	5.54	5.54	0.83059	.	0.573314	0.14996	U	0.286371	T	0.16811	0.0404	N	0.19112	0.55	0.39385	D	0.966319	D;P;D	0.56287	0.975;0.939;0.963	P;P;P	0.52856	0.639;0.518;0.711	T	0.07443	-1.0772	10	0.72032	D	0.01	-10.9662	19.4669	0.94946	0.0:0.0:1.0:0.0	.	31;31;22	Q14CB8-6;Q14CB8;Q14CB8-3	.;RHG19_HUMAN;.	C	31;31;22;31;22;31	ENSP00000414774:S31C;ENSP00000324468:S31C;ENSP00000347526:S22C;ENSP00000351333:S31C;ENSP00000360066:S22C;ENSP00000351058:S31C	ENSP00000324468:S31C	S	-	2	0	ARHGAP19	99015837	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.900000	0.56295	2.581000	0.87130	0.557000	0.71058	TCT		0.393	ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049647.2		NM_032900		5	84	0	0	0	0.014758	0	5	84		
CHUK	1147	broad.mit.edu	37	10	101978578	101978578	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr10:101978578C>T	ENST00000370397.7	-	8	780	c.694G>A	c.(694-696)Gag>Aag	p.E232K		NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	232	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	TTAATCTTCTCATGCCTATAA	0.328																																					Ovarian(159;52 1904 10536 35305 37148)	uc001kqp.2		NaN																	0				ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|breast(1)	7						c.(694-696)GAG>AAG		conserved helix-loop-helix ubiquitous kinase							100.0	93.0	95.0					10																	101978578		2203	4300	6503	SO:0001583	missense	1147				I-kappaB phosphorylation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|nucleus	ATP binding|identical protein binding|IkappaB kinase activity	g.chr10:101978578C>T	AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.694G>A	10.37:g.101978578C>T	ENSP00000359424:p.Glu232Lys						p.E232K	NM_001278	NP_001269	O15111	IKKA_HUMAN		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	8	749	-		Colorectal(252;0.117)	232			Protein kinase.		O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	ENST00000370397.7	37	c.694G>A	CCDS7488.1	.	.	.	.	.	.	.	.	.	.	C	10.94	1.494208	0.26774	.	.	ENSG00000213341	ENST00000370397	T	0.24538	1.85	5.92	5.92	0.95590	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.169329	0.56097	D	0.000029	T	0.14442	0.0349	N	0.05050	-0.12	0.45837	D	0.998708	B	0.33777	0.425	B	0.37508	0.252	T	0.05146	-1.0903	10	0.02654	T	1	-17.0729	17.8263	0.88666	0.0:1.0:0.0:0.0	.	232	O15111	IKKA_HUMAN	K	232	ENSP00000359424:E232K	ENSP00000359424:E232K	E	-	1	0	CHUK	101968568	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	2.195000	0.42677	2.805000	0.96524	0.655000	0.94253	GAG		0.328	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049836.1		NM_001278		8	93	0	0	0	0.00308	0	8	93		
OR52I2	143502	broad.mit.edu	37	11	4608745	4608745	+	Missense_Mutation	SNP	C	C	T	rs137965376		TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr11:4608745C>T	ENST00000312614.4	+	1	725	c.703C>T	c.(703-705)Ctt>Ttt	p.L235F		NM_001005170.2	NP_001005170.1	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I, member 2	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|pancreas(1)|skin(1)	19		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGTTCCTCTCTTATGGTGGG	0.488													c|||	1	0.000199681	0.0008	0.0	5008	,	,		23203	0.0		0.0	False		,,,				2504	0.0					uc010qyh.1		NaN																	0				pancreas(1)	1						c.(703-705)CTT>TTT		olfactory receptor, family 52, subfamily I,		C	PHE/LEU	5,4397	9.9+/-24.2	0,5,2196	155.0	155.0	155.0		703	1.6	1.0	11	dbSNP_134	155	0,8590		0,0,4295	yes	missense	OR52I2	NM_001005170.2	22	0,5,6491	TT,TC,CC		0.0,0.1136,0.0385	possibly-damaging	235/351	4608745	5,12987	2201	4295	6496	SO:0001583	missense	143502				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4608745C>T	BK004264	CCDS31355.1	11p15.4	2012-08-09			ENSG00000226288	ENSG00000226288		"""GPCR / Class A : Olfactory receptors"""	15221	protein-coding gene	gene with protein product							Standard	NM_001005170		Approved		uc010qyh.2	Q8NH67	OTTHUMG00000165721	ENST00000312614.4:c.703C>T	11.37:g.4608745C>T	ENSP00000308764:p.Leu235Phe						p.L235F	NM_001005170	NP_001005170	Q8NH67	O52I2_HUMAN		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	703	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	235			Helical; Name=5; (Potential).		B2RNJ5|B9EKV8|Q6IFJ8	Missense_Mutation	SNP	ENST00000312614.4	37	c.703C>T	CCDS31355.1	.	.	.	.	.	.	.	.	.	.	c	11.87	1.768035	0.31320	0.001136	0.0	ENSG00000226288	ENST00000312614	T	0.39056	1.1	4.18	1.64	0.23874	GPCR, rhodopsin-like superfamily (1);	0.151103	0.30446	N	0.009611	T	0.29588	0.0738	N	0.25286	0.73	0.09310	N	1	P	0.44006	0.824	P	0.46850	0.529	T	0.08432	-1.0722	10	0.27082	T	0.32	-9.9889	6.566	0.22513	0.4361:0.422:0.0:0.1419	.	235	Q8NH67	O52I2_HUMAN	F	235	ENSP00000308764:L235F	ENSP00000308764:L235F	L	+	1	0	OR52I2	4565321	0.000000	0.05858	0.995000	0.50966	0.303000	0.27691	-1.549000	0.02182	0.668000	0.31126	-0.274000	0.10170	CTT		0.488	OR52I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385946.1		NM_001005170		19	257	0	0	0	0.010504	0	19	257		
DEPDC7	91614	broad.mit.edu	37	11	33053051	33053051	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr11:33053051G>C	ENST00000241051.3	+	5	1002	c.910G>C	c.(910-912)Gat>Cat	p.D304H	DEPDC7_ENST00000311388.3_Missense_Mutation_p.D295H	NM_001077242.1	NP_001070710.1	Q96QD5	DEPD7_HUMAN	DEP domain containing 7	304					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	17						ACTTCTGTTTGATGCCATTGG	0.398																																						uc001mub.2		NaN																	0				ovary(1)|skin(1)	2						c.(910-912)GAT>CAT		novel 58.3 KDA protein isoform 1							116.0	110.0	112.0					11																	33053051		1868	4103	5971	SO:0001583	missense	91614				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr11:33053051G>C		CCDS41632.1, CCDS41633.1	11p13	2006-03-24			ENSG00000121690	ENSG00000121690			29899	protein-coding gene	gene with protein product		612294				10568747	Standard	NM_001077242		Approved		uc001mub.3	Q96QD5	OTTHUMG00000166242	ENST00000241051.3:c.910G>C	11.37:g.33053051G>C	ENSP00000241051:p.Asp304His					DEPDC7_uc001muc.2_Missense_Mutation_p.D295H	p.D304H	NM_001077242	NP_001070710	Q96QD5	DEPD7_HUMAN			5	1002	+			304					G5E941|Q8N602|Q8NCU9|Q9UGK5	Missense_Mutation	SNP	ENST00000241051.3	37	c.910G>C	CCDS41632.1	.	.	.	.	.	.	.	.	.	.	G	12.41	1.928751	0.34002	.	.	ENSG00000121690	ENST00000241051;ENST00000311388	T;T	0.65916	-0.18;-0.18	5.59	4.62	0.57501	.	0.405826	0.31233	N	0.008005	T	0.58104	0.2099	L	0.47716	1.5	0.39323	D	0.965272	B;P	0.45594	0.161;0.862	B;B	0.43360	0.038;0.417	T	0.61073	-0.7136	10	0.44086	T	0.13	-12.2975	13.2505	0.60050	0.0827:0.0:0.9173:0.0	.	295;304	G5E941;Q96QD5	.;DEPD7_HUMAN	H	304;295	ENSP00000241051:D304H;ENSP00000308971:D295H	ENSP00000241051:D304H	D	+	1	0	DEPDC7	33009627	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	3.360000	0.52299	1.233000	0.43693	0.650000	0.86243	GAT		0.398	DEPDC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388655.1		NM_139160		10	124	0	0	0	0.024245	0	10	124		
DEPDC7	91614	broad.mit.edu	37	11	33053080	33053080	+	Silent	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr11:33053080G>A	ENST00000241051.3	+	5	1031	c.939G>A	c.(937-939)agG>agA	p.R313R	DEPDC7_ENST00000311388.3_Silent_p.R304R	NM_001077242.1	NP_001070710.1	Q96QD5	DEPD7_HUMAN	DEP domain containing 7	313					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	17						ACAGTAGTAGGGAACCTCTGT	0.393																																						uc001mub.2		NaN																	0				ovary(1)|skin(1)	2						c.(937-939)AGG>AGA		novel 58.3 KDA protein isoform 1							105.0	100.0	102.0					11																	33053080		1852	4098	5950	SO:0001819	synonymous_variant	91614				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr11:33053080G>A		CCDS41632.1, CCDS41633.1	11p13	2006-03-24			ENSG00000121690	ENSG00000121690			29899	protein-coding gene	gene with protein product		612294				10568747	Standard	NM_001077242		Approved		uc001mub.3	Q96QD5	OTTHUMG00000166242	ENST00000241051.3:c.939G>A	11.37:g.33053080G>A						DEPDC7_uc001muc.2_Silent_p.R304R	p.R313R	NM_001077242	NP_001070710	Q96QD5	DEPD7_HUMAN			5	1031	+			313					G5E941|Q8N602|Q8NCU9|Q9UGK5	Silent	SNP	ENST00000241051.3	37	c.939G>A	CCDS41632.1																																																																																				0.393	DEPDC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388655.1		NM_139160		7	129	0	0	0	0.008291	0	7	129		
DEPDC7	91614	broad.mit.edu	37	11	33054239	33054239	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr11:33054239G>C	ENST00000241051.3	+	7	1255	c.1163G>C	c.(1162-1164)aGg>aCg	p.R388T	DEPDC7_ENST00000311388.3_Missense_Mutation_p.R379T	NM_001077242.1	NP_001070710.1	Q96QD5	DEPD7_HUMAN	DEP domain containing 7	388					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	17						GTTGTGAAAAGGATATTCTCA	0.259																																						uc001mub.2		NaN																	0				ovary(1)|skin(1)	2						c.(1162-1164)AGG>ACG		novel 58.3 KDA protein isoform 1							51.0	51.0	51.0					11																	33054239		1788	4050	5838	SO:0001583	missense	91614				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr11:33054239G>C		CCDS41632.1, CCDS41633.1	11p13	2006-03-24			ENSG00000121690	ENSG00000121690			29899	protein-coding gene	gene with protein product		612294				10568747	Standard	NM_001077242		Approved		uc001mub.3	Q96QD5	OTTHUMG00000166242	ENST00000241051.3:c.1163G>C	11.37:g.33054239G>C	ENSP00000241051:p.Arg388Thr					DEPDC7_uc001muc.2_Missense_Mutation_p.R379T	p.R388T	NM_001077242	NP_001070710	Q96QD5	DEPD7_HUMAN			7	1255	+			388					G5E941|Q8N602|Q8NCU9|Q9UGK5	Missense_Mutation	SNP	ENST00000241051.3	37	c.1163G>C	CCDS41632.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.960492	0.53400	.	.	ENSG00000121690	ENST00000241051;ENST00000311388	D;D	0.83419	-1.72;-1.72	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.91216	0.7232	M	0.75447	2.3	0.52501	D	0.999958	D;D	0.89917	1.0;0.999	D;D	0.78314	0.983;0.991	D	0.91099	0.4913	10	0.56958	D	0.05	-14.4156	19.7232	0.96151	0.0:0.0:1.0:0.0	.	379;388	G5E941;Q96QD5	.;DEPD7_HUMAN	T	388;379	ENSP00000241051:R388T;ENSP00000308971:R379T	ENSP00000241051:R388T	R	+	2	0	DEPDC7	33010815	1.000000	0.71417	1.000000	0.80357	0.387000	0.30353	7.488000	0.81441	2.634000	0.89283	0.557000	0.71058	AGG		0.259	DEPDC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388655.1		NM_139160		16	106	0	0	0	0.024245	0	16	106		
DEPDC7	91614	broad.mit.edu	37	11	33054490	33054490	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr11:33054490G>A	ENST00000241051.3	+	8	1411	c.1319G>A	c.(1318-1320)gGa>gAa	p.G440E	DEPDC7_ENST00000311388.3_Missense_Mutation_p.G431E	NM_001077242.1	NP_001070710.1	Q96QD5	DEPD7_HUMAN	DEP domain containing 7	440					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	17						ATACAGAACGGAAGAGATCCA	0.318																																						uc001mub.2		NaN																	0				ovary(1)|skin(1)	2						c.(1318-1320)GGA>GAA		novel 58.3 KDA protein isoform 1							120.0	116.0	117.0					11																	33054490		1826	4078	5904	SO:0001583	missense	91614				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr11:33054490G>A		CCDS41632.1, CCDS41633.1	11p13	2006-03-24			ENSG00000121690	ENSG00000121690			29899	protein-coding gene	gene with protein product		612294				10568747	Standard	NM_001077242		Approved		uc001mub.3	Q96QD5	OTTHUMG00000166242	ENST00000241051.3:c.1319G>A	11.37:g.33054490G>A	ENSP00000241051:p.Gly440Glu					DEPDC7_uc001muc.2_Missense_Mutation_p.G431E	p.G440E	NM_001077242	NP_001070710	Q96QD5	DEPD7_HUMAN			8	1411	+			440					G5E941|Q8N602|Q8NCU9|Q9UGK5	Missense_Mutation	SNP	ENST00000241051.3	37	c.1319G>A	CCDS41632.1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.231462	0.58777	.	.	ENSG00000121690	ENST00000241051;ENST00000311388	D;D	0.83419	-1.72;-1.72	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.91730	0.7385	M	0.80847	2.515	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.90702	0.4621	10	0.42905	T	0.14	-15.7928	19.8243	0.96610	0.0:0.0:1.0:0.0	.	431;440	G5E941;Q96QD5	.;DEPD7_HUMAN	E	440;431	ENSP00000241051:G440E;ENSP00000308971:G431E	ENSP00000241051:G440E	G	+	2	0	DEPDC7	33011066	1.000000	0.71417	0.996000	0.52242	0.176000	0.22953	7.309000	0.78937	2.678000	0.91216	0.460000	0.39030	GGA		0.318	DEPDC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388655.1		NM_139160		17	119	0	0	0	0.008871	0	17	119		
DEPDC7	91614	broad.mit.edu	37	11	33054924	33054924	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr11:33054924G>A	ENST00000241051.3	+	9	1551	c.1459G>A	c.(1459-1461)Gcc>Acc	p.A487T	DEPDC7_ENST00000311388.3_Missense_Mutation_p.A478T	NM_001077242.1	NP_001070710.1	Q96QD5	DEPD7_HUMAN	DEP domain containing 7	487					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	17						AAAACTTTCTGCCAAAGAGAA	0.333																																						uc001mub.2		NaN																	0				ovary(1)|skin(1)	2						c.(1459-1461)GCC>ACC		novel 58.3 KDA protein isoform 1							77.0	76.0	76.0					11																	33054924		1806	4060	5866	SO:0001583	missense	91614				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr11:33054924G>A		CCDS41632.1, CCDS41633.1	11p13	2006-03-24			ENSG00000121690	ENSG00000121690			29899	protein-coding gene	gene with protein product		612294				10568747	Standard	NM_001077242		Approved		uc001mub.3	Q96QD5	OTTHUMG00000166242	ENST00000241051.3:c.1459G>A	11.37:g.33054924G>A	ENSP00000241051:p.Ala487Thr					DEPDC7_uc001muc.2_Missense_Mutation_p.A478T	p.A487T	NM_001077242	NP_001070710	Q96QD5	DEPD7_HUMAN			9	1551	+			487					G5E941|Q8N602|Q8NCU9|Q9UGK5	Missense_Mutation	SNP	ENST00000241051.3	37	c.1459G>A	CCDS41632.1	.	.	.	.	.	.	.	.	.	.	G	6.413	0.444330	0.12164	.	.	ENSG00000121690	ENST00000241051;ENST00000311388	T;T	0.64991	-0.13;-0.13	5.13	2.0	0.26442	.	0.709813	0.14151	N	0.338000	T	0.41166	0.1147	N	0.25647	0.755	0.25325	N	0.989083	B;B	0.11235	0.004;0.001	B;B	0.13407	0.009;0.001	T	0.21075	-1.0256	10	0.11485	T	0.65	-8.6552	5.5352	0.17007	0.0723:0.2546:0.54:0.1332	.	478;487	G5E941;Q96QD5	.;DEPD7_HUMAN	T	487;478	ENSP00000241051:A487T;ENSP00000308971:A478T	ENSP00000241051:A487T	A	+	1	0	DEPDC7	33011500	0.993000	0.37304	1.000000	0.80357	0.962000	0.63368	0.925000	0.28791	0.659000	0.30945	0.460000	0.39030	GCC		0.333	DEPDC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388655.1		NM_139160		6	140	0	0	0	0.001984	0	6	140		
NAT10	55226	broad.mit.edu	37	11	34139781	34139781	+	Silent	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr11:34139781C>G	ENST00000257829.3	+	7	818	c.612C>G	c.(610-612)ctC>ctG	p.L204L	NAT10_ENST00000527971.1_Silent_p.L204L|NAT10_ENST00000531159.2_Silent_p.L132L	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	204						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				ATGACCAGCTCAACATCCTGC	0.557																																						uc001mvk.2		NaN																	0				ovary(1)|skin(1)	2						c.(610-612)CTC>CTG		N-acetyltransferase 10 isoform a							111.0	101.0	104.0					11																	34139781		2202	4298	6500	SO:0001819	synonymous_variant	55226					nucleolus	ATP binding|N-acetyltransferase activity|protein binding	g.chr11:34139781C>G	AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.612C>G	11.37:g.34139781C>G						NAT10_uc010ren.1_Silent_p.L132L	p.L204L	NM_024662	NP_078938	Q9H0A0	NAT10_HUMAN			7	856	+		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)	204					B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Silent	SNP	ENST00000257829.3	37	c.612C>G	CCDS7889.1																																																																																				0.557	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388693.1		NM_024662		10	60	0	0	0	0.016723	0	10	60		
PGM2L1	283209	broad.mit.edu	37	11	74056622	74056622	+	Silent	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr11:74056622C>T	ENST00000298198.4	-	9	1421	c.1110G>A	c.(1108-1110)aaG>aaA	p.K370K		NM_173582.3	NP_775853.2	Q6PCE3	PGM2L_HUMAN	phosphoglucomutase 2-like 1	370					glucose metabolic process (GO:0006006)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	glucose-1,6-bisphosphate synthase activity (GO:0047933)|intramolecular transferase activity, phosphotransferases (GO:0016868)			NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(11;3.32e-06)					ATTTATTTTTCTTCCAGCAAT	0.373																																						uc001ovb.1		NaN																	0				ovary(1)	1						c.(1108-1110)AAG>AAA		phosphoglucomutase 2-like 1							129.0	119.0	122.0					11																	74056622		2200	4293	6493	SO:0001819	synonymous_variant	283209				glucose 1-phosphate metabolic process	cytosol	glucose-1,6-bisphosphate synthase activity|phosphoglucomutase activity	g.chr11:74056622C>T	AB019210	CCDS8231.1	11q13.3	2008-12-01			ENSG00000165434	ENSG00000165434			20898	protein-coding gene	gene with protein product	"""glucose-1,6-bisphosphate synthase"""	611610				17804405	Standard	NM_173582		Approved	FLJ32029, BM32A	uc001ovb.1	Q6PCE3	OTTHUMG00000168132	ENST00000298198.4:c.1110G>A	11.37:g.74056622C>T							p.K370K	NM_173582	NP_775853	Q6PCE3	PGM2L_HUMAN			9	1406	-	Breast(11;3.32e-06)		370					Q96MQ7|Q9UIK3	Silent	SNP	ENST00000298198.4	37	c.1110G>A	CCDS8231.1																																																																																				0.373	PGM2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398324.1		NM_173582		5	108	0	0	0	0.021553	0	5	108		
MAP6	4135	broad.mit.edu	37	11	75298367	75298367	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr11:75298367G>C	ENST00000304771.3	-	4	2929	c.2179C>G	c.(2179-2181)Caa>Gaa	p.Q727E	CTD-2530H12.4_ENST00000527803.1_RNA|MAP6_ENST00000526689.1_5'Flank|MAP6_ENST00000526740.1_Missense_Mutation_p.Q398E	NM_033063.1	NP_149052.1	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6	727	Pro-rich.				dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|microtubule cytoskeleton organization (GO:0000226)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	19	Ovarian(111;0.11)					GTGGGGCCTTGATCCTTAACT	0.493																																					Esophageal Squamous(181;1115 2007 8647 17065 22697)	uc001owu.2		NaN																	0					0						c.(2179-2181)CAA>GAA		microtubule-associated protein 6 isoform 1							154.0	156.0	155.0					11																	75298367		2200	4293	6493	SO:0001583	missense	4135					Golgi apparatus|microtubule|perinuclear region of cytoplasm	calmodulin binding	g.chr11:75298367G>C	AK123340	CCDS31641.1, CCDS44686.1	11q13.5	2005-10-11			ENSG00000171533	ENSG00000171533			6868	protein-coding gene	gene with protein product		601783				10516426, 12231625	Standard	NM_207577		Approved	KIAA1878, STOP, FLJ41346	uc001owu.3	Q96JE9	OTTHUMG00000165343	ENST00000304771.3:c.2179C>G	11.37:g.75298367G>C	ENSP00000307093:p.Gln727Glu						p.Q727E	NM_033063	NP_149052	Q96JE9	MAP6_HUMAN			4	2244	-	Ovarian(111;0.11)		727			Pro-rich.		A7E2A1|Q6P3T0|Q6ZWB8	Missense_Mutation	SNP	ENST00000304771.3	37	c.2179C>G	CCDS31641.1	.	.	.	.	.	.	.	.	.	.	G	4.938	0.174270	0.09391	.	.	ENSG00000171533	ENST00000304771;ENST00000526740;ENST00000545476	T	0.54071	0.59	4.81	3.89	0.44902	.	0.612663	0.14683	N	0.304628	T	0.47710	0.1460	M	0.70595	2.14	0.28704	N	0.903905	B	0.25667	0.131	B	0.25140	0.058	T	0.48603	-0.9021	10	0.02654	T	1	-1.9466	12.8395	0.57793	0.0:0.0:0.8349:0.1651	.	727	Q96JE9	MAP6_HUMAN	E	727;398;398	ENSP00000307093:Q727E	ENSP00000307093:Q727E	Q	-	1	0	MAP6	74976015	0.020000	0.18652	0.059000	0.19551	0.015000	0.08874	1.164000	0.31810	1.329000	0.45376	-0.182000	0.12963	CAA		0.493	MAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383527.1		NM_033063		25	221	0	0	0	0.01892	0	25	221		
TSKU	25987	broad.mit.edu	37	11	76507357	76507357	+	Missense_Mutation	SNP	C	C	T	rs560780272		TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr11:76507357C>T	ENST00000527881.1	+	2	1723	c.697C>T	c.(697-699)Cac>Tac	p.H233Y	TSKU_ENST00000333090.4_Missense_Mutation_p.H233Y			Q8WUA8	TSK_HUMAN	tsukushi, small leucine rich proteoglycan	233					anterior commissure morphogenesis (GO:0021960)|ciliary body morphogenesis (GO:0061073)|corpus callosum morphogenesis (GO:0021540)|lateral ventricle development (GO:0021670)|negative regulation of Wnt signaling pathway (GO:0030178)|regulation of gene expression (GO:0010468)	extracellular space (GO:0005615)				NS(1)|large_intestine(4)|lung(6)|urinary_tract(1)	12	Ovarian(111;0.112)					AGGCCTTACACACCTGTCTCT	0.667													C|||	1	0.000199681	0.0	0.0	5008	,	,		17317	0.001		0.0	False		,,,				2504	0.0					uc001oxt.2		NaN																	0					0						c.(697-699)CAC>TAC		tsukushin precursor							60.0	65.0	63.0					11																	76507357		2200	4288	6488	SO:0001583	missense	25987					extracellular region		g.chr11:76507357C>T	AK075476	CCDS8246.1	11q13.5	2012-12-05	2012-12-05	2006-11-21	ENSG00000182704	ENSG00000182704			28850	protein-coding gene	gene with protein product		608015	"""leucine rich repeat containing 54"", ""tsukushin"", ""tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)"""	LRRC54		11085516, 19710929, 22880013	Standard	NM_001258210		Approved	E2IG4, TSK	uc031qcw.1	Q8WUA8		ENST00000527881.1:c.697C>T	11.37:g.76507357C>T	ENSP00000434847:p.His233Tyr						p.H233Y	NM_015516	NP_056331	Q8WUA8	TSK_HUMAN			2	869	+	Ovarian(111;0.112)		233			LRR 8.		B3KQT7|Q6UXK1|Q9UG10|Q9UJX9	Missense_Mutation	SNP	ENST00000527881.1	37	c.697C>T	CCDS8246.1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.600641	0.46423	.	.	ENSG00000182704	ENST00000333090;ENST00000439807;ENST00000527881	T;T	0.55760	0.5;0.5	4.88	4.88	0.63580	.	0.105579	0.64402	D	0.000005	T	0.29914	0.0748	N	0.04880	-0.145	0.58432	D	0.999992	B	0.30563	0.285	B	0.27262	0.078	T	0.17899	-1.0354	10	0.09590	T	0.72	-14.8873	16.5863	0.84728	0.0:1.0:0.0:0.0	.	233	Q8WUA8	TSK_HUMAN	Y	233;201;233	ENSP00000332668:H233Y;ENSP00000434847:H233Y	ENSP00000332668:H233Y	H	+	1	0	TSKU	76185005	1.000000	0.71417	0.900000	0.35374	0.889000	0.51656	4.675000	0.61619	2.253000	0.74438	0.561000	0.74099	CAC		0.667	TSKU-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382871.1		NM_015516		8	112	0	0	0	0.004482	0	8	112		
NPAT	4863	broad.mit.edu	37	11	108043955	108043955	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr11:108043955C>T	ENST00000278612.8	-	13	1861	c.1756G>A	c.(1756-1758)Gaa>Aaa	p.E586K	NPAT_ENST00000610253.1_5'UTR	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	586					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		ATAACTGGTTCTAACACATTA	0.299																																						uc001pjz.3		NaN																	0				ovary(2)	2						c.(1756-1758)GAA>AAA		nuclear protein,  ataxia-telangiectasia locus							105.0	103.0	104.0					11																	108043955		1826	4073	5899	SO:0001583	missense	4863				positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	protein C-terminus binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity	g.chr11:108043955C>T	X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.1756G>A	11.37:g.108043955C>T	ENSP00000278612:p.Glu586Lys					NPAT_uc001pka.2_Missense_Mutation_p.E381K	p.E586K	NM_002519	NP_002510	Q14207	NPAT_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)	13	1858	-		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	586					A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	ENST00000278612.8	37	c.1756G>A	CCDS41710.1	.	.	.	.	.	.	.	.	.	.	C	0.024	-1.387050	0.01194	.	.	ENSG00000149308	ENST00000278612	T	0.22945	1.93	6.08	-1.69	0.08186	.	1.414730	0.04299	N	0.346940	T	0.12263	0.0298	N	0.14661	0.345	0.09310	N	1	B;B	0.20368	0.021;0.044	B;B	0.18871	0.023;0.023	T	0.21449	-1.0245	10	0.06099	T	0.92	.	5.7676	0.18235	0.5028:0.2486:0.2486:0.0	.	586;586	B9EG70;Q14207	.;NPAT_HUMAN	K	586	ENSP00000278612:E586K	ENSP00000278612:E586K	E	-	1	0	NPAT	107549165	0.001000	0.12720	0.000000	0.03702	0.057000	0.15508	0.305000	0.19254	-0.552000	0.06167	-0.262000	0.10625	GAA		0.299	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2		NM_002519		14	231	0	0	0	0.020292	0	14	231		
EXPH5	23086	broad.mit.edu	37	11	108382830	108382830	+	Missense_Mutation	SNP	C	C	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr11:108382830C>A	ENST00000265843.4	-	6	3514	c.3404G>T	c.(3403-3405)gGa>gTa	p.G1135V	EXPH5_ENST00000443411.1_Missense_Mutation_p.G947V|EXPH5_ENST00000428840.1_Missense_Mutation_p.G1059V|EXPH5_ENST00000524840.1_5'Flank|EXPH5_ENST00000525344.1_Missense_Mutation_p.G1128V	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1135					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TCCTTCTCTTCCAGTTGAGGC	0.483																																						uc001pkk.2		NaN																	0				skin(3)|ovary(2)	5						c.(3403-3405)GGA>GTA		exophilin 5 isoform a							108.0	111.0	110.0					11																	108382830		2201	4298	6499	SO:0001583	missense	23086				intracellular protein transport		Rab GTPase binding	g.chr11:108382830C>A		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.3404G>T	11.37:g.108382830C>A	ENSP00000265843:p.Gly1135Val					EXPH5_uc010rvy.1_Missense_Mutation_p.G947V|EXPH5_uc010rvz.1_Missense_Mutation_p.G979V|EXPH5_uc010rwa.1_Missense_Mutation_p.G1059V	p.G1135V	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)	6	3515	-		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)	1135					Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	37	c.3404G>T	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.836743	0.50951	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000526312;ENST00000533052	T;T;T;T;T;T	0.07444	3.75;3.67;3.52;3.83;3.56;3.19	5.77	1.71	0.24356	.	0.212304	0.33875	N	0.004465	T	0.19287	0.0463	M	0.65975	2.015	0.09310	N	0.999998	D	0.76494	0.999	D	0.68192	0.956	T	0.03121	-1.1070	10	0.56958	D	0.05	-6.9511	5.2595	0.15565	0.0:0.5965:0.1474:0.2562	.	1135	Q8NEV8	EXPH5_HUMAN	V	1135;1059;947;1128;1059;947	ENSP00000265843:G1135V;ENSP00000391966:G1059V;ENSP00000411390:G947V;ENSP00000432546:G1128V;ENSP00000432683:G1059V;ENSP00000446434:G947V	ENSP00000265843:G1135V	G	-	2	0	EXPH5	107888040	0.000000	0.05858	0.026000	0.17262	0.037000	0.13140	0.332000	0.19751	0.340000	0.23745	-0.175000	0.13238	GGA		0.483	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1		NM_015065		8	129	1	0	7.48243e-07	0.006214	8.30922e-07	8	129		
A2ML1	144568	broad.mit.edu	37	12	9020914	9020914	+	Missense_Mutation	SNP	C	C	A	rs376705356		TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr12:9020914C>A	ENST00000299698.7	+	31	4202	c.4022C>A	c.(4021-4023)cCg>cAg	p.P1341Q	A2ML1_ENST00000539547.1_Missense_Mutation_p.P850Q	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1									p.P1341L(1)		NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						TGTGAGCAACCGACTTCACCT	0.488																																						uc001quz.3		NaN																	1	Substitution - Missense(1)		breast(1)	ovary(2)|skin(1)	3						c.(4021-4023)CCG>CAG		alpha-2-macroglobulin-like 1 precursor							162.0	158.0	159.0					12																	9020914		1959	4153	6112	SO:0001583	missense	144568					extracellular space	endopeptidase inhibitor activity	g.chr12:9020914C>A	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.4022C>A	12.37:g.9020914C>A	ENSP00000299698:p.Pro1341Gln					A2ML1_uc001qva.1_Missense_Mutation_p.P921Q|A2ML1_uc010sgm.1_Missense_Mutation_p.P841Q|A2ML1_uc001qvb.1_RNA	p.P1341Q	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN			31	4120	+			1185						Missense_Mutation	SNP	ENST00000299698.7	37	c.4022C>A	CCDS8596.2	.	.	.	.	.	.	.	.	.	.	C	0.160	-1.082571	0.01888	.	.	ENSG00000166535	ENST00000299698;ENST00000539161;ENST00000541459;ENST00000539547	T;T;T	0.41400	1.0;1.0;1.0	3.58	-6.72	0.01755	Alpha-macroglobulin, receptor-binding (2);	3.883010	0.00706	N	0.000806	T	0.26991	0.0661	L	0.39898	1.24	0.09310	N	1	B	0.17465	0.022	B	0.20767	0.031	T	0.13124	-1.0521	10	0.16420	T	0.52	.	1.9574	0.03379	0.3791:0.3163:0.0895:0.2151	.	1341	A8K2U0	A2ML1_HUMAN	Q	1341;1341;891;850	ENSP00000299698:P1341Q;ENSP00000443174:P891Q;ENSP00000438292:P850Q	ENSP00000299698:P1341Q	P	+	2	0	A2ML1	8912181	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-4.121000	0.00291	-1.753000	0.01323	-1.149000	0.01842	CCG		0.488	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3		NM_144670		17	254	1	0	1.15088e-07	0.028581	1.29233e-07	17	254		
STYK1	55359	broad.mit.edu	37	12	10780303	10780303	+	Silent	SNP	A	A	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr12:10780303A>C	ENST00000075503.3	-	7	1174	c.654T>G	c.(652-654)ggT>ggG	p.G218G		NM_018423.2	NP_060893.2	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	218	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	26						CATAGAGAAGACCATCCATAG	0.398										HNSCC(73;0.22)																												uc001qys.2		NaN																	0				central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8						c.(652-654)GGT>GGG		serine/threonine/tyrosine kinase 1							183.0	130.0	148.0					12																	10780303		2203	4300	6503	SO:0001819	synonymous_variant	55359					integral to membrane|plasma membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr12:10780303A>C	AF251059	CCDS8629.1	12p13.2	2005-01-21							18889	protein-coding gene	gene with protein product		611433				12841579	Standard	NM_018423		Approved	SuRTK106, DKFZp761P1010, NOK	uc001qys.2	Q6J9G0		ENST00000075503.3:c.654T>G	12.37:g.10780303A>C		HNSCC(73;0.22)					p.G218G	NM_018423	NP_060893	Q6J9G0	STYK1_HUMAN			7	1175	-			218			Protein kinase.		B2R9T2|Q52LR3|Q9BXY2|Q9NSH1	Silent	SNP	ENST00000075503.3	37	c.654T>G	CCDS8629.1	.	.	.	.	.	.	.	.	.	.	A	10.24	1.295781	0.23564	.	.	ENSG00000060140	ENST00000542924	.	.	.	5.11	-2.0	0.07433	.	.	.	.	.	T	0.50154	0.1599	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39272	-0.9622	4	.	.	.	-9.839	6.1262	0.20180	0.4464:0.0:0.4296:0.1239	.	.	.	.	G	62	.	.	V	-	2	0	STYK1	10671570	0.051000	0.20477	0.972000	0.41901	0.993000	0.82548	-0.643000	0.05421	-0.616000	0.05671	0.533000	0.62120	GTC		0.398	STYK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399622.1		NM_018423		9	72	0	0	0	0.016723	0	9	72		
TAS2R9	50835	broad.mit.edu	37	12	10962188	10962188	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr12:10962188C>G	ENST00000240691.2	-	1	579	c.487G>C	c.(487-489)Gaa>Caa	p.E163Q	TAS2R8_ENST00000240615.2_5'Flank	NM_023917.2	NP_076406.1	Q9NYW1	TA2R9_HUMAN	taste receptor, type 2, member 9	163					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	taste receptor activity (GO:0008527)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						GTAATGTTTTCTTCATGACTG	0.378																																						uc001qyx.2		NaN																	0				skin(1)	1						c.(487-489)GAA>CAA		taste receptor, type 2, member 9							54.0	55.0	54.0					12																	10962188		2203	4300	6503	SO:0001583	missense	50835				sensory perception of taste	integral to membrane	taste receptor activity	g.chr12:10962188C>G	AF227135	CCDS8633.1	12p13	2012-08-22			ENSG00000121381	ENSG00000121381		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14917	protein-coding gene	gene with protein product		604795				10761934, 10766242	Standard	NM_023917		Approved	T2R9, TRB6	uc001qyx.3	Q9NYW1	OTTHUMG00000168507	ENST00000240691.2:c.487G>C	12.37:g.10962188C>G	ENSP00000240691:p.Glu163Gln					TAS2R8_uc010shh.1_5'Flank	p.E163Q	NM_023917	NP_076406	Q9NYW1	TA2R9_HUMAN			1	580	-			163			Extracellular (Potential).		Q502V7|Q50KT0|Q50KT1|Q645W9	Missense_Mutation	SNP	ENST00000240691.2	37	c.487G>C	CCDS8633.1	.	.	.	.	.	.	.	.	.	.	C	10.69	1.422022	0.25639	.	.	ENSG00000121381	ENST00000240691	T	0.00745	5.75	4.28	-1.64	0.08318	GPCR, rhodopsin-like superfamily (1);	1.167460	0.06774	U	0.783964	T	0.00724	0.0024	N	0.17674	0.51	0.09310	N	1	P	0.42039	0.769	B	0.42245	0.381	T	0.50676	-0.8800	10	0.15499	T	0.54	.	8.6298	0.33913	0.0:0.4515:0.0:0.5485	.	163	Q9NYW1	TA2R9_HUMAN	Q	163	ENSP00000240691:E163Q	ENSP00000240691:E163Q	E	-	1	0	TAS2R9	10853455	0.000000	0.05858	0.001000	0.08648	0.045000	0.14185	-1.880000	0.01627	-0.442000	0.07190	-0.157000	0.13467	GAA		0.378	TAS2R9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399933.1				12	107	0	0	0	0.016723	0	12	107		
CMAS	55907	broad.mit.edu	37	12	22208488	22208488	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr12:22208488C>G	ENST00000229329.2	+	3	633	c.503C>G	c.(502-504)tCt>tGt	p.S168C		NM_018686.4	NP_061156.1	Q8NFW8	NEUA_HUMAN	cytidine monophosphate N-acetylneuraminic acid synthetase	168					lipopolysaccharide biosynthetic process (GO:0009103)|N-acetylneuraminate metabolic process (GO:0006054)	membrane (GO:0016020)|nucleus (GO:0005634)	N-acylneuraminate cytidylyltransferase activity (GO:0008781)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24						GGATATGATTCTGTTTTCTCT	0.353																																						uc001rfm.2		NaN																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(502-504)TCT>TGT		cytidine monophospho-N-acetylneuraminic acid							125.0	117.0	120.0					12																	22208488		2203	4300	6503	SO:0001583	missense	55907				lipopolysaccharide biosynthetic process	nucleus	N-acylneuraminate cytidylyltransferase activity	g.chr12:22208488C>G	AF271388	CCDS8696.1	12p12.1	2008-08-04			ENSG00000111726	ENSG00000111726			18290	protein-coding gene	gene with protein product	"""CMP-Neu5Ac synthetase"""	603316				8889549, 7566098	Standard	NM_018686		Approved		uc001rfm.4	Q8NFW8	OTTHUMG00000169097	ENST00000229329.2:c.503C>G	12.37:g.22208488C>G	ENSP00000229329:p.Ser168Cys					CMAS_uc001rfn.2_RNA	p.S168C	NM_018686	NP_061156	Q8NFW8	NEUA_HUMAN			3	582	+			168					Q96AX5|Q9NQZ0	Missense_Mutation	SNP	ENST00000229329.2	37	c.503C>G	CCDS8696.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.385058	0.82792	.	.	ENSG00000111726	ENST00000229329;ENST00000538498	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.75133	0.3808	M	0.71206	2.165	0.58432	D	0.999998	D	0.53745	0.962	P	0.54815	0.761	T	0.76340	-0.2995	9	0.56958	D	0.05	-28.1069	19.7284	0.96174	0.0:1.0:0.0:0.0	.	168	Q8NFW8	NEUA_HUMAN	C	168;9	.	ENSP00000229329:S168C	S	+	2	0	CMAS	22099755	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.099000	0.64554	2.668000	0.90789	0.591000	0.81541	TCT		0.353	CMAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402235.1		NM_018686		7	114	0	0	0	0.001984	0	7	114		
ACVRL1	94	broad.mit.edu	37	12	52309201	52309201	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr12:52309201G>A	ENST00000388922.4	+	7	1248	c.965G>A	c.(964-966)gGc>gAc	p.G322D	ACVRL1_ENST00000419526.2_Missense_Mutation_p.G148D|ACVRL1_ENST00000550683.1_Missense_Mutation_p.G336D	NM_000020.2	NP_000011.2	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	322	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|artery development (GO:0060840)|blood circulation (GO:0008015)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|blood vessel maturation (GO:0001955)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|cellular response to transforming growth factor beta stimulus (GO:0071560)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of focal adhesion assembly (GO:0051895)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of blood pressure (GO:0008217)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of DNA replication (GO:0006275)|regulation of endothelial cell proliferation (GO:0001936)|regulation of transcription, DNA-templated (GO:0006355)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|venous blood vessel development (GO:0060841)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	GGTACACAGGGCAAACCAGCC	0.642																																						uc001rzj.2		NaN																	0				lung(2)	2						c.(964-966)GGC>GAC		activin A receptor type II-like 1 precursor	Adenosine triphosphate(DB00171)						46.0	43.0	44.0					12																	52309201		2203	4300	6503	SO:0001583	missense	94	Hereditary_Hemorrhagic_Telangiectasia			blood vessel endothelial cell proliferation involved in sprouting angiogenesis|blood vessel maturation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of endothelial cell migration|negative regulation of focal adhesion assembly|positive regulation of BMP signaling pathway|positive regulation of transcription, DNA-dependent|regulation of blood pressure|regulation of blood vessel endothelial cell migration|regulation of DNA replication|regulation of endothelial cell proliferation|transforming growth factor beta receptor signaling pathway|wound healing, spreading of epidermal cells	cell surface|integral to plasma membrane	activin binding|activin receptor activity, type I|ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity	g.chr12:52309201G>A	L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567			175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2		8397373, 8640225	Standard	NM_000020		Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	ENST00000388922.4:c.965G>A	12.37:g.52309201G>A	ENSP00000373574:p.Gly322Asp					ACVRL1_uc001rzk.2_Missense_Mutation_p.G322D|ACVRL1_uc010snm.1_Missense_Mutation_p.G148D	p.G322D	NM_000020	NP_000011	P37023	ACVL1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0991)	7	1248	+			322			Cytoplasmic (Potential).|Protein kinase.		A6NGA8	Missense_Mutation	SNP	ENST00000388922.4	37	c.965G>A	CCDS31804.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.811969	0.90707	.	.	ENSG00000139567	ENST00000388922;ENST00000267008;ENST00000550683;ENST00000548659;ENST00000419526	D;D;D	0.93307	-3.2;-3.2;-3.2	5.09	5.09	0.68999	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45867	D	0.000327	D	0.96423	0.8833	M	0.71871	2.18	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.87578	0.99;0.998	D	0.96550	0.9407	10	0.87932	D	0	.	18.6856	0.91562	0.0:0.0:1.0:0.0	.	148;322	E7EN07;P37023	.;ACVL1_HUMAN	D	322;322;336;148;148	ENSP00000373574:G322D;ENSP00000447884:G336D;ENSP00000392492:G148D	ENSP00000267008:G322D	G	+	2	0	ACVRL1	50595468	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.505000	0.60421	2.826000	0.97356	0.563000	0.77884	GGC		0.642	ACVRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404520.2				3	25	0	0	0	0.014758	0	3	25		
GRASP	160622	broad.mit.edu	37	12	52404711	52404711	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr12:52404711G>C	ENST00000293662.4	+	3	423	c.343G>C	c.(343-345)Gag>Cag	p.E115Q	GRASP_ENST00000552049.1_5'UTR|GRASP_ENST00000552963.1_3'UTR|GRASP_ENST00000380039.2_5'Flank	NM_181711.2	NP_859062.1	Q7Z6J2	GRASP_HUMAN	GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein	115	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein localization (GO:0008104)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				central_nervous_system(1)|large_intestine(1)|lung(1)|skin(2)	5				BRCA - Breast invasive adenocarcinoma(357;0.0967)		CTTCGGCTTTGAGATCCAGGT	0.547																																						uc001rzo.1		NaN																	0				central_nervous_system(1)|skin(1)	2						c.(343-345)GAG>CAG		GRP1 (general receptor for phosphoinositides							144.0	139.0	141.0					12																	52404711		2203	4300	6503	SO:0001583	missense	160622					cell junction|perinuclear region of cytoplasm|postsynaptic membrane		g.chr12:52404711G>C	AC019244	CCDS8817.1, CCDS61124.1	12q13.13	2011-09-02			ENSG00000161835	ENSG00000161835			18707	protein-coding gene	gene with protein product		612027				10828067	Standard	NM_001271856		Approved		uc001rzo.2	Q7Z6J2	OTTHUMG00000169595	ENST00000293662.4:c.343G>C	12.37:g.52404711G>C	ENSP00000293662:p.Glu115Gln					GRASP_uc001rzp.1_5'UTR	p.E115Q	NM_181711	NP_859062	Q7Z6J2	GRASP_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0967)	3	399	+			115			PDZ.		Q6PIF8|Q7Z741	Missense_Mutation	SNP	ENST00000293662.4	37	c.343G>C	CCDS8817.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.629369	0.87660	.	.	ENSG00000161835	ENST00000293662	T	0.26957	1.7	4.91	4.91	0.64330	PDZ/DHR/GLGF (4);	0.198947	0.46758	D	0.000276	T	0.37652	0.1011	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.02789	-1.1110	10	0.24483	T	0.36	5.3156	15.1114	0.72359	0.0:0.0:1.0:0.0	.	115	Q7Z6J2	GRASP_HUMAN	Q	115	ENSP00000293662:E115Q	ENSP00000293662:E115Q	E	+	1	0	GRASP	50690978	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.841000	0.86834	2.549000	0.85964	0.561000	0.74099	GAG		0.547	GRASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404972.1				11	134	0	0	0	0.010729	0	11	134		
ESPL1	9700	broad.mit.edu	37	12	53662888	53662888	+	Silent	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr12:53662888G>A	ENST00000257934.4	+	3	253	c.162G>A	c.(160-162)ctG>ctA	p.L54L	ESPL1_ENST00000552462.1_Silent_p.L54L	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	54					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						ATGCCATCCTGAGGGCTTGCA	0.552																																					Colon(53;1069 1201 2587 5382)	uc001sck.2		NaN																	0				lung(1)|kidney(1)|skin(1)	3						c.(160-162)CTG>CTA		separase							84.0	78.0	80.0					12																	53662888		2203	4300	6503	SO:0001819	synonymous_variant	9700				apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding	g.chr12:53662888G>A	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.162G>A	12.37:g.53662888G>A						ESPL1_uc001scj.2_5'UTR	p.L54L	NM_012291	NP_036423	Q14674	ESPL1_HUMAN			3	253	+			54						Silent	SNP	ENST00000257934.4	37	c.162G>A	CCDS8852.1																																																																																				0.552	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2		NM_012291		6	91	0	0	0	0.001984	0	6	91		
NCKAP1L	3071	broad.mit.edu	37	12	54894397	54894397	+	Silent	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr12:54894397C>T	ENST00000293373.6	+	3	373	c.294C>T	c.(292-294)gtC>gtT	p.V98V	RP11-753H16.3_ENST00000550474.1_RNA|NCKAP1L_ENST00000545638.2_Silent_p.V48V	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	98					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						TTGTGGATGTCATGGAATTTC	0.398																																						uc001sgc.3		NaN																	0				ovary(3)|central_nervous_system(1)	4						c.(292-294)GTC>GTT		NCK-associated protein 1-like							157.0	146.0	150.0					12																	54894397		2203	4300	6503	SO:0001819	synonymous_variant	3071				actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity	g.chr12:54894397C>T	AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.294C>T	12.37:g.54894397C>T						NCKAP1L_uc010sox.1_5'UTR|NCKAP1L_uc010soy.1_Silent_p.V48V	p.V98V	NM_005337	NP_005328	P55160	NCKPL_HUMAN			3	373	+			98					B4DUT5|Q52LW0	Silent	SNP	ENST00000293373.6	37	c.294C>T	CCDS31813.1																																																																																				0.398	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1		NM_005337		13	181	0	0	0	0.016723	0	13	181		
NCKAP1L	3071	broad.mit.edu	37	12	54912718	54912718	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr12:54912718G>C	ENST00000293373.6	+	15	1520	c.1441G>C	c.(1441-1443)Gaa>Caa	p.E481Q	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.E431Q	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	481					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						AGAAAAATTTGAATTCTCAGG	0.403																																						uc001sgc.3		NaN																	0				ovary(3)|central_nervous_system(1)	4						c.(1441-1443)GAA>CAA		NCK-associated protein 1-like							121.0	129.0	126.0					12																	54912718		2203	4300	6503	SO:0001583	missense	3071				actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity	g.chr12:54912718G>C	AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.1441G>C	12.37:g.54912718G>C	ENSP00000293373:p.Glu481Gln					NCKAP1L_uc010sox.1_Missense_Mutation_p.E23Q|NCKAP1L_uc010soy.1_Missense_Mutation_p.E431Q	p.E481Q	NM_005337	NP_005328	P55160	NCKPL_HUMAN			15	1520	+			481					B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	37	c.1441G>C	CCDS31813.1	.	.	.	.	.	.	.	.	.	.	G	17.89	3.499077	0.64298	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.32753	1.44;1.44	5.94	5.94	0.96194	.	0.144295	0.64402	D	0.000012	T	0.20659	0.0497	N	0.08118	0	0.36930	D	0.891823	P	0.38440	0.631	B	0.37198	0.243	T	0.22906	-1.0203	10	0.87932	D	0	-8.208	17.8571	0.88767	0.0:0.0:1.0:0.0	.	481	P55160	NCKPL_HUMAN	Q	481;431	ENSP00000293373:E481Q;ENSP00000445596:E431Q	ENSP00000293373:E481Q	E	+	1	0	NCKAP1L	53198985	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.664000	0.83830	2.826000	0.97356	0.561000	0.74099	GAA		0.403	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1		NM_005337		8	72	0	0	0	0.004482	0	8	72		
C12orf66	144577	broad.mit.edu	37	12	64587993	64587993	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr12:64587993C>T	ENST00000398055.3	-	3	1020	c.967G>A	c.(967-969)Gag>Aag	p.E323K	C12orf66_ENST00000544871.1_Missense_Mutation_p.E270K|C12orf66_ENST00000311915.8_Missense_Mutation_p.E323K	NM_152440.4	NP_689653	Q96MD2	CL066_HUMAN	chromosome 12 open reading frame 66	323										central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)	5						TGAAAACTCTCAGAACCTCTG	0.473																																						uc001srw.3		NaN																	0				ovary(1)	1						c.(967-969)GAG>AAG		hypothetical protein LOC144577							89.0	84.0	85.0					12																	64587993		1866	4102	5968	SO:0001583	missense	144577							g.chr12:64587993C>T		CCDS41803.1, CCDS73490.1	12q14.2	2008-08-08			ENSG00000174206	ENSG00000174206			26517	protein-coding gene	gene with protein product						12477932	Standard	NM_152440		Approved	FLJ32549	uc001srw.4	Q96MD2	OTTHUMG00000168763	ENST00000398055.3:c.967G>A	12.37:g.64587993C>T	ENSP00000381132:p.Glu323Lys					C12orf66_uc009zql.2_Missense_Mutation_p.E270K	p.E323K	NM_152440	NP_689653	Q96MD2	CL066_HUMAN			3	1026	-			323					C9JX54|Q8IYA0	Missense_Mutation	SNP	ENST00000398055.3	37	c.967G>A	CCDS41803.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.104949	0.77096	.	.	ENSG00000174206	ENST00000311915;ENST00000544871;ENST00000398055	T;T;T	0.39406	1.08;1.08;1.08	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.67316	0.2880	M	0.74258	2.255	0.80722	D	1	D;D	0.67145	0.996;0.995	D;D	0.76071	0.987;0.963	T	0.63747	-0.6567	9	.	.	.	-32.2437	20.6593	0.99626	0.0:1.0:0.0:0.0	.	270;323	F5H2Q3;Q96MD2	.;CL066_HUMAN	K	323;270;323	ENSP00000311486:E323K;ENSP00000445481:E270K;ENSP00000381132:E323K	.	E	-	1	0	C12orf66	62874260	1.000000	0.71417	0.998000	0.56505	0.418000	0.31294	7.755000	0.85180	2.885000	0.99019	0.655000	0.94253	GAG		0.473	C12orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400921.1		NM_152440		12	174	0	0	0	0.016723	0	12	174		
C12orf66	144577	broad.mit.edu	37	12	64588249	64588249	+	Silent	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr12:64588249C>T	ENST00000398055.3	-	3	764	c.711G>A	c.(709-711)aaG>aaA	p.K237K	C12orf66_ENST00000544871.1_Silent_p.K184K|C12orf66_ENST00000311915.8_Silent_p.K237K	NM_152440.4	NP_689653	Q96MD2	CL066_HUMAN	chromosome 12 open reading frame 66	237										central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)	5						ACAGATGTTTCTTGGTCTCCC	0.493																																						uc001srw.3		NaN																	0				ovary(1)	1						c.(709-711)AAG>AAA		hypothetical protein LOC144577							92.0	90.0	90.0					12																	64588249		1981	4137	6118	SO:0001819	synonymous_variant	144577							g.chr12:64588249C>T		CCDS41803.1, CCDS73490.1	12q14.2	2008-08-08			ENSG00000174206	ENSG00000174206			26517	protein-coding gene	gene with protein product						12477932	Standard	NM_152440		Approved	FLJ32549	uc001srw.4	Q96MD2	OTTHUMG00000168763	ENST00000398055.3:c.711G>A	12.37:g.64588249C>T						C12orf66_uc009zql.2_Silent_p.K184K	p.K237K	NM_152440	NP_689653	Q96MD2	CL066_HUMAN			3	770	-			237					C9JX54|Q8IYA0	Silent	SNP	ENST00000398055.3	37	c.711G>A	CCDS41803.1																																																																																				0.493	C12orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400921.1		NM_152440		8	66	0	0	0	0.004482	0	8	66		
DNAH10	196385	broad.mit.edu	37	12	124362399	124362399	+	Silent	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr12:124362399C>T	ENST00000409039.3	+	47	7987	c.7962C>T	c.(7960-7962)ttC>ttT	p.F2654F		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2654	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		ATTACATCTTCAACCTTCGAG	0.443																																						uc001uft.3		NaN																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(7960-7962)TTC>TTT		dynein, axonemal, heavy chain 10							168.0	175.0	173.0					12																	124362399		2020	4181	6201	SO:0001819	synonymous_variant	196385				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr12:124362399C>T	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.7962C>T	12.37:g.124362399C>T							p.F2654F	NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	47	7987	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		2654			AAA 3 (By similarity).		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	37	c.7962C>T	CCDS9255.2																																																																																				0.443	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3				18	259	0	0	0	0.007413	0	18	259		
DNAJC3	5611	broad.mit.edu	37	13	96409943	96409943	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr13:96409943C>T	ENST00000602402.1	+	5	556	c.439C>T	c.(439-441)Caa>Taa	p.Q147*	DNAJC3_ENST00000376795.6_Intron	NM_006260.4	NP_006251.1	Q13217	DNJC3_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 3	147					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of protein kinase activity (GO:0006469)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum Sec complex (GO:0031205)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	protein kinase inhibitor activity (GO:0004860)			NS(1)|breast(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)			AGCACAGTCTCAACTTATAAA	0.343																																						uc001vmq.2		NaN																	0					0						c.(439-441)CAA>TAA		DnaJ (Hsp40) homolog, subfamily C, member 3							87.0	85.0	85.0					13																	96409943		2203	4300	6503	SO:0001587	stop_gained	5611				protein folding|response to unfolded protein|response to virus		heat shock protein binding|protein kinase inhibitor activity|unfolded protein binding	g.chr13:96409943C>T	U28424	CCDS9479.1	13q32	2013-01-10			ENSG00000102580	ENSG00000102580		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	9439	protein-coding gene	gene with protein product		601184		PRKRI		7511204, 8824806	Standard	NM_006260		Approved	P58, P58IPK, HP58	uc001vmq.3	Q13217	OTTHUMG00000017227	ENST00000602402.1:c.439C>T	13.37:g.96409943C>T	ENSP00000473631:p.Gln147*					DNAJC3_uc001vmr.2_Intron	p.Q147*	NM_006260	NP_006251	Q13217	DNJC3_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.126)		5	547	+	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		147					Q86WT9|Q8N4N2	Nonsense_Mutation	SNP	ENST00000602402.1	37	c.439C>T	CCDS9479.1	.	.	.	.	.	.	.	.	.	.	C	37	6.064373	0.97251	.	.	ENSG00000102580	ENST00000376795	.	.	.	5.8	5.8	0.92144	.	0.302554	0.36893	N	0.002357	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-1.706	18.2309	0.89934	0.0:1.0:0.0:0.0	.	.	.	.	X	147	.	ENSP00000365991:Q147X	Q	+	1	0	DNAJC3	95207944	1.000000	0.71417	0.769000	0.31535	0.963000	0.63663	7.154000	0.77437	2.736000	0.93811	0.591000	0.81541	CAA		0.343	DNAJC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045504.3				9	90	0	0	0	0.004482	0	9	90		
OR4K1	79544	broad.mit.edu	37	14	20404396	20404396	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr14:20404396G>A	ENST00000285600.4	+	1	630	c.571G>A	c.(571-573)Gat>Aat	p.D191N		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GGCTTGCATGGATACATATGA	0.443																																						uc001vwj.1		NaN																	0				skin(2)|ovary(1)	3						c.(571-573)GAT>AAT		olfactory receptor, family 4, subfamily K,							161.0	165.0	164.0					14																	20404396		2203	4300	6503	SO:0001583	missense	79544				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20404396G>A		CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.571G>A	14.37:g.20404396G>A	ENSP00000285600:p.Asp191Asn						p.D191N	NM_001004063	NP_001004063	Q8NGD4	OR4K1_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)	1	571	+	all_cancers(95;0.00108)		191			Extracellular (Potential).		B9EKV9|Q8NGD6|Q96R73	Missense_Mutation	SNP	ENST00000285600.4	37	c.571G>A	CCDS32025.1	.	.	.	.	.	.	.	.	.	.	.	11.89	1.773597	0.31411	.	.	ENSG00000155249	ENST00000285600	T	0.00231	8.49	4.82	4.82	0.62117	GPCR, rhodopsin-like superfamily (1);	0.105034	0.42294	D	0.000739	T	0.00271	0.0008	L	0.49256	1.55	0.25712	N	0.985476	B	0.29590	0.25	B	0.37346	0.247	T	0.50398	-0.8833	10	0.59425	D	0.04	.	15.418	0.74987	0.0:0.0:1.0:0.0	.	191	Q8NGD4	OR4K1_HUMAN	N	191	ENSP00000285600:D191N	ENSP00000285600:D191N	D	+	1	0	OR4K1	19474236	1.000000	0.71417	0.985000	0.45067	0.342000	0.28953	3.900000	0.56295	2.487000	0.83934	0.563000	0.77884	GAT		0.443	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409881.1				5	327	0	0	0	0.014758	0	5	327		
MIA2	117153	broad.mit.edu	37	14	39716635	39716635	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr14:39716635C>T	ENST00000280082.3	+	4	1056	c.857C>T	c.(856-858)tCa>tTa	p.S286L	MIA2_ENST00000556784.1_Missense_Mutation_p.S285L|RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.S286L	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	286					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)				NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		GAAATTGATTCAGTGCCAAAG	0.398																																						uc001wux.2		NaN																	0				ovary(1)|breast(1)	2						c.(856-858)TCA>TTA		melanoma inhibitory activity 2							107.0	106.0	106.0					14																	39716635		2203	4300	6503	SO:0001583	missense	117153					extracellular region		g.chr14:39716635C>T	BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.857C>T	14.37:g.39716635C>T	ENSP00000280082:p.Ser286Leu					MIA2_uc010amy.1_Missense_Mutation_p.S217L	p.S286L	NM_054024	NP_473365	Q96PC5	MIA2_HUMAN	LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)	4	1051	+	Hepatocellular(127;0.213)		286					A1L4H0|Q9H6C1	Missense_Mutation	SNP	ENST00000280082.3	37	c.857C>T	CCDS9672.1	.	.	.	.	.	.	.	.	.	.	C	11.04	1.522240	0.27211	.	.	ENSG00000150526;ENSG00000150526;ENSG00000258941	ENST00000280082;ENST00000556784;ENST00000553728	T;T;T	0.52983	0.64;0.67;2.97	5.47	4.58	0.56647	.	0.217463	0.23631	N	0.046122	T	0.43411	0.1246	M	0.66939	2.045	0.09310	N	1	B;B	0.28400	0.21;0.185	B;B	0.29716	0.088;0.106	T	0.37079	-0.9721	9	.	.	.	-18.7655	6.9824	0.24709	0.1722:0.7399:0.0:0.0879	.	286;286	Q96PC5;Q96PC5-2	MIA2_HUMAN;.	L	286;285;286	ENSP00000280082:S286L;ENSP00000451934:S285L;ENSP00000452252:S286L	.	S	+	2	0	MIA2;RP11-407N17.3	38786386	0.003000	0.15002	0.023000	0.16930	0.053000	0.15095	1.337000	0.33862	1.314000	0.45095	0.650000	0.86243	TCA		0.398	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276768.3		NM_054024		7	91	0	0	0	0.001984	0	7	91		
FANCM	57697	broad.mit.edu	37	14	45658433	45658433	+	Silent	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr14:45658433G>C	ENST00000267430.5	+	20	5293	c.5208G>C	c.(5206-5208)ctG>ctC	p.L1736L	FANCM_ENST00000542564.2_Silent_p.L1710L	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1736	Interaction with FAAP24 and EME1.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						AGACATCGCTGAATTTAAAGG	0.418								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													uc001wwd.3		NaN																	0				ovary(3)|lung(2)|breast(2)	7						c.(5206-5208)CTG>CTC	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group M							130.0	133.0	132.0					14																	45658433		2203	4300	6503	SO:0001819	synonymous_variant	57697	Fanconi_Anemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding	g.chr14:45658433G>C	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.5208G>C	14.37:g.45658433G>C						FANCM_uc010anf.2_Silent_p.L1710L|FANCM_uc001wwe.3_Silent_p.L1272L|FANCM_uc010ang.2_Silent_p.L950L	p.L1736L	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN			20	5307	+			1736			Interaction with FAAP24 and EME1.		B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	ENST00000267430.5	37	c.5208G>C	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	G	2.296	-0.361345	0.05103	.	.	ENSG00000187790	ENST00000554809	.	.	.	5.28	-1.47	0.08772	.	.	.	.	.	T	0.20414	0.0491	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26087	-1.0113	4	.	.	.	.	2.1951	0.03909	0.1317:0.1584:0.4134:0.2964	.	.	.	.	Q	669	.	.	E	+	1	0	FANCM	44728183	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.947000	0.03901	-0.168000	0.10853	-0.265000	0.10407	GAA		0.418	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1		XM_048128		19	237	0	0	0	0.010504	0	19	237		
POLE2	5427	broad.mit.edu	37	14	50118050	50118050	+	Silent	SNP	T	T	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr14:50118050T>C	ENST00000216367.5	-	16	1356	c.1257A>G	c.(1255-1257)ttA>ttG	p.L419L	POLE2_ENST00000539565.2_Silent_p.L393L|POLE2_ENST00000554396.1_Silent_p.L419L|POLE2_ENST00000556584.1_5'UTR	NM_002692.3	NP_002683.2	P56282	DPOE2_HUMAN	polymerase (DNA directed), epsilon 2, accessory subunit	419					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	epsilon DNA polymerase complex (GO:0008622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	10	all_epithelial(31;0.0021)|Breast(41;0.0124)				Cladribine(DB00242)	TTTTATTTACTAAGTCTTCAC	0.323																																						uc001wwu.2		NaN																	0				ovary(1)|skin(1)	2						c.(1255-1257)TTA>TTG		DNA-directed DNA polymerase epsilon 2							73.0	73.0	73.0					14																	50118050		2203	4300	6503	SO:0001819	synonymous_variant	5427				DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	DNA binding|DNA-directed DNA polymerase activity	g.chr14:50118050T>C	AF025840	CCDS32073.1, CCDS55914.1, CCDS55915.1	14q21-q22	2012-05-18	2012-05-18		ENSG00000100479	ENSG00000100479		"""DNA polymerases"""	9178	protein-coding gene	gene with protein product	"""DNA polymerase epsilon subunit B"""	602670	"""polymerase (DNA directed), epsilon 2 (p59 subunit)"""			9405441, 9443964	Standard	NM_002692		Approved	DPE2	uc001wwu.3	P56282	OTTHUMG00000170813	ENST00000216367.5:c.1257A>G	14.37:g.50118050T>C						SDCCAG1_uc010anj.1_Intron|POLE2_uc010ann.2_Silent_p.L133L|POLE2_uc001wwv.2_RNA|POLE2_uc010ano.2_Silent_p.L134L	p.L419L	NM_002692	NP_002683	P56282	DPOE2_HUMAN			16	1271	-	all_epithelial(31;0.0021)|Breast(41;0.0124)		419					A0AV55|A4FU92|A4LBB7|A6NH58|B4DDE6|O43560	Silent	SNP	ENST00000216367.5	37	c.1257A>G	CCDS32073.1																																																																																				0.323	POLE2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410512.1		NM_002692		5	66	0	0	0	0.021553	0	5	66		
PLEKHG3	26030	broad.mit.edu	37	14	65198166	65198166	+	Missense_Mutation	SNP	C	C	T	rs145887123	byFrequency	TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr14:65198166C>T	ENST00000394691.1	+	8	1084	c.937C>T	c.(937-939)Cgc>Tgc	p.R313C	PLEKHG3_ENST00000247226.7_Missense_Mutation_p.R257C			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	313	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		CCGCGTGCATCGCGTGCGCAA	0.552																																						uc001xho.1		NaN																	0				skin(1)	1						c.(937-939)CGC>TGC		pleckstrin homology domain containing, family G,			CYS/ARG	0,4406		0,0,2203	86.0	77.0	80.0		769	4.6	1.0	14	dbSNP_134	80	3,8597	3.0+/-9.4	0,3,4297	no	missense	PLEKHG3	NM_015549.1	180	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	257/1164	65198166	3,13003	2203	4300	6503	SO:0001583	missense	26030				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr14:65198166C>T	AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.937C>T	14.37:g.65198166C>T	ENSP00000378183:p.Arg313Cys					PLEKHG3_uc001xhn.1_Missense_Mutation_p.R257C|PLEKHG3_uc001xhp.2_Missense_Mutation_p.R313C|PLEKHG3_uc010aqh.1_5'UTR	p.R313C	NM_015549	NP_056364	A1L390	PKHG3_HUMAN		all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)	8	1206	+			313			PH.		A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Missense_Mutation	SNP	ENST00000394691.1	37	c.937C>T		.	.	.	.	.	.	.	.	.	.	c	28.6	4.936281	0.92458	0.0	3.49E-4	ENSG00000126822	ENST00000247226;ENST00000394691	D;D	0.87887	-2.31;-2.31	4.61	4.61	0.57282	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.078666	0.53938	D	0.000059	D	0.93854	0.8034	M	0.88241	2.94	0.80722	D	1	D;D	0.76494	0.999;0.997	D;P	0.65140	0.932;0.765	D	0.95106	0.8234	10	0.72032	D	0.01	.	16.2907	0.82750	0.0:1.0:0.0:0.0	.	313;257	A1L390;A1L390-3	PKHG3_HUMAN;.	C	257;313	ENSP00000247226:R257C;ENSP00000378183:R313C	ENSP00000247226:R257C	R	+	1	0	PLEKHG3	64267919	1.000000	0.71417	0.994000	0.49952	0.985000	0.73830	6.066000	0.71185	2.113000	0.64589	0.550000	0.68814	CGC		0.552	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000412028.1		NM_015549		5	67	0	0	0	0.014758	0	5	67		
NUDT14	256281	broad.mit.edu	37	14	105639498	105639498	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr14:105639498C>T	ENST00000392568.2	-	5	622	c.529G>A	c.(529-531)Gag>Aag	p.E177K	RP11-44N21.4_ENST00000548203.1_RNA|NUDT14_ENST00000550912.1_5'UTR	NM_177533.4	NP_803877.2	O95848	NUD14_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 14	177	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ADP-ribose diphosphatase activity (GO:0047631)|metal ion binding (GO:0046872)|UDP-sugar diphosphatase activity (GO:0008768)	p.E177K(1)		cervix(2)|endometrium(1)|lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	14		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		TCAATGAGCTCACCCTCCTCC	0.622										HNSCC(42;0.11)																												uc010tyn.1		NaN																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(529-531)GAG>AAG		nudix-type motif 14							83.0	72.0	75.0					14																	105639498		2201	4296	6497	SO:0001583	missense	256281					cytoplasm	metal ion binding|protein binding|UDP-sugar diphosphatase activity	g.chr14:105639498C>T	AB087802	CCDS10000.1	14q32.33	2013-02-15			ENSG00000183828	ENSG00000183828		"""Nudix motif containing"""	20141	protein-coding gene	gene with protein product		609219				12429023	Standard	NM_177533		Approved	UGPP	uc010tyn.3	O95848	OTTHUMG00000170372	ENST00000392568.2:c.529G>A	14.37:g.105639498C>T	ENSP00000376349:p.Glu177Lys	HNSCC(42;0.11)				NUDT14_uc001yqi.2_RNA	p.E177K	NM_177533	NP_803877	O95848	NUD14_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)	5	643	-		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	177			Nudix hydrolase.		Q86SJ8	Missense_Mutation	SNP	ENST00000392568.2	37	c.529G>A	CCDS10000.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.947161	0.53186	.	.	ENSG00000183828	ENST00000392568	T	0.72282	-0.64	4.27	2.37	0.29283	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.000000	0.85682	D	0.000000	D	0.83737	0.5319	H	0.96518	3.835	0.80722	D	1	P	0.51449	0.945	P	0.55055	0.767	D	0.83842	0.0258	10	0.87932	D	0	-27.7993	7.6667	0.28434	0.1872:0.6318:0.1809:0.0	.	177	O95848	NUD14_HUMAN	K	177	ENSP00000376349:E177K	ENSP00000376349:E177K	E	-	1	0	NUDT14	104710543	0.985000	0.35326	0.849000	0.33467	0.019000	0.09904	2.921000	0.48852	0.484000	0.27630	-0.521000	0.04368	GAG		0.622	NUDT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074544.4		NM_177533		4	34	0	0	0	0.009096	0	4	34		
CEP152	22995	broad.mit.edu	37	15	49076285	49076285	+	Silent	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr15:49076285C>T	ENST00000380950.2	-	10	1393	c.1206G>A	c.(1204-1206)gtG>gtA	p.V402V	CEP152_ENST00000399334.3_Silent_p.V402V|CEP152_ENST00000325747.5_Silent_p.V309V|RP11-485O10.2_ENST00000558304.1_RNA	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	402					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		CCAGTTGTTTCACGTGATCTT	0.333																																						uc001zwy.2		NaN																	0				lung(2)	2						c.(1204-1206)GTG>GTA		centrosomal protein 152kDa							100.0	91.0	94.0					15																	49076285		1853	4084	5937	SO:0001819	synonymous_variant	22995				centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding	g.chr15:49076285C>T	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.1206G>A	15.37:g.49076285C>T						CEP152_uc001zwz.2_Silent_p.V402V|CEP152_uc001zxa.1_Silent_p.V309V	p.V402V	NM_014985	NP_055800	O94986	CE152_HUMAN		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)	10	1240	-		all_lung(180;0.0428)	402			Potential.		E7ER66|Q17RV1|Q6NTA0	Silent	SNP	ENST00000380950.2	37	c.1206G>A	CCDS58361.1																																																																																				0.333	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1		NM_014985		5	66	0	0	0	0.021553	0	5	66		
ZNF609	23060	broad.mit.edu	37	15	64968069	64968069	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr15:64968069G>A	ENST00000326648.3	+	4	3144	c.3016G>A	c.(3016-3018)Gaa>Aaa	p.E1006K		NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	1006						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GCAGCAGTACGAAGAACAGCA	0.562																																						uc002ann.2		NaN																	0				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(3016-3018)GAA>AAA		zinc finger protein 609							164.0	148.0	154.0					15																	64968069		2203	4299	6502	SO:0001583	missense	23060					nucleus	zinc ion binding	g.chr15:64968069G>A	BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.3016G>A	15.37:g.64968069G>A	ENSP00000316527:p.Glu1006Lys						p.E1006K	NM_015042	NP_055857	O15014	ZN609_HUMAN			4	3016	+			1006					Q0D2I2	Missense_Mutation	SNP	ENST00000326648.3	37	c.3016G>A	CCDS32270.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.223266	0.79464	.	.	ENSG00000180357	ENST00000326648	T	0.60171	0.21	5.82	5.82	0.92795	.	0.045197	0.85682	D	0.000000	T	0.74374	0.3708	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.67103	0.949	T	0.73135	-0.4078	10	0.51188	T	0.08	-15.7953	20.1008	0.97874	0.0:0.0:1.0:0.0	.	1006	O15014	ZN609_HUMAN	K	1006	ENSP00000316527:E1006K	ENSP00000316527:E1006K	E	+	1	0	ZNF609	62755122	1.000000	0.71417	0.137000	0.22149	0.856000	0.48823	9.847000	0.99503	2.756000	0.94617	0.563000	0.77884	GAA		0.562	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1		XM_042833		4	115	0	0	0	0.014758	0	4	115		
CORO2B	10391	broad.mit.edu	37	15	69018260	69018260	+	Missense_Mutation	SNP	C	C	T	rs146678597		TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr15:69018260C>T	ENST00000566799.1	+	12	1419	c.1390C>T	c.(1390-1392)Cgg>Tgg	p.R464W	CORO2B_ENST00000540068.1_Missense_Mutation_p.R459W|CORO2B_ENST00000261861.5_Missense_Mutation_p.R459W|CORO2B_ENST00000543950.1_Missense_Mutation_p.R459W			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	464					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						CATCCGCATTCGGCAGCTCCA	0.557																																						uc002arj.3		NaN																	0				ovary(3)|skin(2)|large_intestine(1)	6						c.(1390-1392)CGG>TGG		coronin, actin binding protein, 2B							64.0	64.0	64.0					15																	69018260		2200	4298	6498	SO:0001583	missense	10391				actin cytoskeleton organization	actin cytoskeleton|cytoplasm|membrane	actin filament binding	g.chr15:69018260C>T	AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.1390C>T	15.37:g.69018260C>T	ENSP00000454783:p.Arg464Trp					CORO2B_uc010bic.2_Missense_Mutation_p.R459W|CORO2B_uc002ark.2_Missense_Mutation_p.R231W	p.R464W	NM_006091	NP_006082	Q9UQ03	COR2B_HUMAN			12	1419	+			464			Potential.		A8K0W3|O94767|Q8TAN1	Missense_Mutation	SNP	ENST00000566799.1	37	c.1390C>T	CCDS10229.2	.	.	.	.	.	.	.	.	.	.	C	22.0	4.234070	0.79688	.	.	ENSG00000103647	ENST00000261861;ENST00000540068;ENST00000543950	T;T	0.60299	0.2;0.2	3.62	3.62	0.41486	.	0.129722	0.52532	D	0.000061	T	0.66694	0.2815	L	0.50333	1.59	0.80722	D	1	D	0.69078	0.997	P	0.60949	0.881	T	0.71487	-0.4578	10	0.72032	D	0.01	-15.0799	14.1987	0.65688	0.0:1.0:0.0:0.0	.	464	Q9UQ03	COR2B_HUMAN	W	464;459;459	ENSP00000446250:R459W;ENSP00000443819:R459W	ENSP00000261861:R464W	R	+	1	2	CORO2B	66805314	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.381000	0.59587	1.732000	0.51606	0.442000	0.29010	CGG		0.557	CORO2B-203	KNOWN	basic|CCDS	protein_coding	protein_coding			NM_006091		4	52	0	0	0	0.009096	0	4	52		
RLBP1	6017	broad.mit.edu	37	15	89758326	89758326	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr15:89758326C>G	ENST00000268125.5	-	6	929	c.490G>C	c.(490-492)Gag>Cag	p.E164Q		NM_000326.4	NP_000317.1	P12271	RLBP1_HUMAN	retinaldehyde binding protein 1	164	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	cell body (GO:0044297)|cytosol (GO:0005829)	11-cis retinal binding (GO:0005502)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(1)|prostate(1)|skin(1)	18	Lung NSC(78;0.0472)|all_lung(78;0.089)				Vitamin A(DB00162)	TGCCAGTTCTCAATGTTGAAG	0.577																																						uc002bnl.2		NaN																	0				central_nervous_system(1)	1						c.(490-492)GAG>CAG		retinaldehyde binding protein 1	Vitamin A(DB00162)						127.0	118.0	121.0					15																	89758326		2200	4299	6499	SO:0001583	missense	6017				response to stimulus|visual perception|vitamin A metabolic process	cytoplasm|soluble fraction	retinol binding|transporter activity	g.chr15:89758326C>G	BC004199	CCDS32324.1	15q26.1	2007-07-16	2001-11-28			ENSG00000140522			10024	protein-coding gene	gene with protein product		180090	"""retinaldehyde-binding protein 1"""			1733864, 9326942	Standard	NM_000326		Approved	CRALBP	uc002bnl.3	P12271		ENST00000268125.5:c.490G>C	15.37:g.89758326C>G	ENSP00000268125:p.Glu164Gln						p.E164Q	NM_000326	NP_000317	P12271	RLBP1_HUMAN			6	870	-	Lung NSC(78;0.0472)|all_lung(78;0.089)		164			CRAL-TRIO.		B2R667	Missense_Mutation	SNP	ENST00000268125.5	37	c.490G>C	CCDS32324.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280292	0.80692	.	.	ENSG00000140522	ENST00000268125	D	0.84298	-1.83	4.8	4.8	0.61643	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.000000	0.85682	D	0.000000	D	0.88016	0.6324	L	0.46157	1.445	0.80722	D	1	D	0.58620	0.983	P	0.55824	0.785	D	0.89281	0.3612	10	0.62326	D	0.03	-14.6379	17.8642	0.88791	0.0:1.0:0.0:0.0	.	164	P12271	RLBP1_HUMAN	Q	164	ENSP00000268125:E164Q	ENSP00000268125:E164Q	E	-	1	0	RLBP1	87559330	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.273000	0.78527	2.229000	0.72834	0.561000	0.74099	GAG		0.577	RLBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421135.1		NM_000326		7	121	0	0	0	0.00308	0	7	121		
GLYR1	84656	broad.mit.edu	37	16	4882060	4882060	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr16:4882060C>T	ENST00000321919.9	-	5	533	c.457G>A	c.(457-459)Gag>Aag	p.E153K	GLYR1_ENST00000436648.5_Intron|GLYR1_ENST00000381983.3_Missense_Mutation_p.E153K|GLYR1_ENST00000586901.1_5'UTR|GLYR1_ENST00000591451.1_Missense_Mutation_p.E153K	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	153					pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						GAGCCTCTCTCTGAAGAGCCT	0.527																																						uc002cxx.3		NaN																	0					0						c.(457-459)GAG>AAG		cytokine-like nuclear factor n-pac							123.0	120.0	121.0					16																	4882060		2197	4300	6497	SO:0001583	missense	84656				pentose-phosphate shunt	nucleus	coenzyme binding|DNA binding|methylated histone residue binding|phosphogluconate dehydrogenase (decarboxylating) activity	g.chr16:4882060C>T	AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.457G>A	16.37:g.4882060C>T	ENSP00000322716:p.Glu153Lys					GLYR1_uc002cxy.2_RNA|GLYR1_uc002cxz.1_Missense_Mutation_p.E84K|GLYR1_uc002cya.2_Missense_Mutation_p.E153K|GLYR1_uc010uxv.1_Intron	p.E153K	NM_032569	NP_115958	Q49A26	GLYR1_HUMAN			5	494	-			153					B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Missense_Mutation	SNP	ENST00000321919.9	37	c.457G>A	CCDS10524.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.592957	0.46214	.	.	ENSG00000140632	ENST00000321919;ENST00000381983	T;T	0.63255	-0.03;-0.03	5.29	5.29	0.74685	.	0.102964	0.64402	D	0.000003	T	0.61540	0.2355	N	0.14661	0.345	0.38083	D	0.93673	P;P;P	0.37398	0.593;0.593;0.458	P;P;P	0.57846	0.828;0.828;0.678	T	0.55321	-0.8159	10	0.08381	T	0.77	-19.5841	16.2144	0.82195	0.0:1.0:0.0:0.0	.	153;153;153	Q49A26-3;Q49A26-2;Q49A26	.;.;GLYR1_HUMAN	K	153	ENSP00000322716:E153K;ENSP00000371413:E153K	ENSP00000322716:E153K	E	-	1	0	GLYR1	4822061	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.032000	0.64140	2.634000	0.89283	0.650000	0.86243	GAG		0.527	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251717.2		NM_032569		11	191	0	0	0	0.010729	0	11	191		
ADAT1	23536	broad.mit.edu	37	16	75654613	75654613	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr16:75654613G>A	ENST00000307921.3	-	3	230	c.85C>T	c.(85-87)Cat>Tat	p.H29Y		NM_012091.3	NP_036223.2	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	29					tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|RNA binding (GO:0003723)|tRNA-specific adenosine deaminase activity (GO:0008251)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)	19						GTCCACTCATGGTTTGGCTCA	0.522																																						uc002feo.1		NaN																	0				ovary(1)|skin(1)	2						c.(85-87)CAT>TAT		adenosine deaminase, tRNA-specific 1							104.0	99.0	100.0					16																	75654613		2198	4300	6498	SO:0001583	missense	23536				tRNA processing		metal ion binding|RNA binding|tRNA-specific adenosine deaminase activity	g.chr16:75654613G>A	AF125188	CCDS10922.1	16q23	2008-02-05			ENSG00000065457	ENSG00000065457			228	protein-coding gene	gene with protein product		604230				10430867	Standard	NM_012091		Approved		uc002feo.2	Q9BUB4	OTTHUMG00000137611	ENST00000307921.3:c.85C>T	16.37:g.75654613G>A	ENSP00000310015:p.His29Tyr					ADAT1_uc002fep.1_5'UTR	p.H29Y	NM_012091	NP_036223	Q9BUB4	ADAT1_HUMAN			3	187	-			29					Q9NVB7|Q9UNG3	Missense_Mutation	SNP	ENST00000307921.3	37	c.85C>T	CCDS10922.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.694974	0.30052	.	.	ENSG00000065457	ENST00000307921	T	0.14266	2.52	5.5	4.54	0.55810	Adenosine deaminase/editase (1);	0.095571	0.64402	D	0.000001	T	0.08626	0.0214	N	0.14661	0.345	0.20074	N	0.999933	B	0.31519	0.327	B	0.31101	0.124	T	0.27331	-1.0077	10	0.32370	T	0.25	.	12.1564	0.54079	0.0:0.0:0.5805:0.4195	.	29	Q9BUB4	ADAT1_HUMAN	Y	29	ENSP00000310015:H29Y	ENSP00000310015:H29Y	H	-	1	0	ADAT1	74212114	1.000000	0.71417	0.861000	0.33841	0.178000	0.23041	3.748000	0.55142	1.352000	0.45808	-0.325000	0.08501	CAT		0.522	ADAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269027.1		NM_012091		6	67	0	0	0	0.021553	0	6	67		
KARS	3735	broad.mit.edu	37	16	75669620	75669620	+	Silent	SNP	G	G	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr16:75669620G>T	ENST00000302445.3	-	6	792	c.753C>A	c.(751-753)atC>atA	p.I251I	KARS_ENST00000319410.5_Silent_p.I279I|KARS_ENST00000568378.1_Intron	NM_005548.2	NP_005539.1	Q15046	SYK_HUMAN	lysyl-tRNA synthetase	251					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|lysyl-tRNA aminoacylation (GO:0006430)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)|viral process (GO:0016032)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|microtubule cytoskeleton (GO:0015630)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid binding (GO:0016597)|ATP binding (GO:0005524)|lysine-tRNA ligase activity (GO:0004824)|metal ion binding (GO:0046872)|tRNA binding (GO:0000049)			kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	18					L-Lysine(DB00123)	TTATATATGTGATGATCTTAG	0.443																																						uc002feq.2		NaN																	0				ovary(2)	2						c.(751-753)ATC>ATA		lysyl-tRNA synthetase isoform 2	L-Lysine(DB00123)						80.0	76.0	77.0					16																	75669620		2198	4300	6498	SO:0001819	synonymous_variant	3735				interspecies interaction between organisms|lysyl-tRNA aminoacylation|tRNA processing	cytosol|extracellular region|mitochondrial matrix|nucleus|plasma membrane|soluble fraction	ATP binding|lysine-tRNA ligase activity|metal ion binding|tRNA binding	g.chr16:75669620G>T	AF285758	CCDS10923.1, CCDS45532.1	16q23.1	2014-09-17			ENSG00000065427	ENSG00000065427	6.1.1.6	"""Aminoacyl tRNA synthetases / Class II"""	6215	protein-coding gene	gene with protein product	"""lysine tRNA ligase"""	601421	"""deafness, autosomal recessive 89"""	DFNB89		8812440, 9278442, 23768514	Standard	NM_005548		Approved	KARS2, KARS1	uc002fer.3	Q15046	OTTHUMG00000137609	ENST00000302445.3:c.753C>A	16.37:g.75669620G>T						KARS_uc002fer.2_Silent_p.I279I|KARS_uc002fes.2_Silent_p.I95I|KARS_uc010cgz.2_Silent_p.I95I	p.I251I	NM_005548	NP_005539	Q15046	SYK_HUMAN			6	801	-			251					A8MSK1|D3DUK4|O14946|Q96J25|Q9HB23	Silent	SNP	ENST00000302445.3	37	c.753C>A	CCDS10923.1																																																																																				0.443	KARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269023.1		NM_005548		9	81	1	0	7.48243e-07	0.006214	8.30922e-07	9	81		
KARS	3735	broad.mit.edu	37	16	75669626	75669626	+	Missense_Mutation	SNP	C	C	G	rs199605493		TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr16:75669626C>G	ENST00000302445.3	-	6	786	c.747G>C	c.(745-747)aaG>aaC	p.K249N	KARS_ENST00000319410.5_Missense_Mutation_p.K277N|KARS_ENST00000568378.1_Intron	NM_005548.2	NP_005539.1	Q15046	SYK_HUMAN	lysyl-tRNA synthetase	249					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|lysyl-tRNA aminoacylation (GO:0006430)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)|viral process (GO:0016032)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|microtubule cytoskeleton (GO:0015630)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid binding (GO:0016597)|ATP binding (GO:0005524)|lysine-tRNA ligase activity (GO:0004824)|metal ion binding (GO:0046872)|tRNA binding (GO:0000049)			kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	18					L-Lysine(DB00123)	ATGTGATGATCTTAGAGCGGA	0.433																																						uc002feq.2		NaN																	0				ovary(2)	2						c.(745-747)AAG>AAC		lysyl-tRNA synthetase isoform 2	L-Lysine(DB00123)						85.0	80.0	82.0					16																	75669626		2198	4300	6498	SO:0001583	missense	3735				interspecies interaction between organisms|lysyl-tRNA aminoacylation|tRNA processing	cytosol|extracellular region|mitochondrial matrix|nucleus|plasma membrane|soluble fraction	ATP binding|lysine-tRNA ligase activity|metal ion binding|tRNA binding	g.chr16:75669626C>G	AF285758	CCDS10923.1, CCDS45532.1	16q23.1	2014-09-17			ENSG00000065427	ENSG00000065427	6.1.1.6	"""Aminoacyl tRNA synthetases / Class II"""	6215	protein-coding gene	gene with protein product	"""lysine tRNA ligase"""	601421	"""deafness, autosomal recessive 89"""	DFNB89		8812440, 9278442, 23768514	Standard	NM_005548		Approved	KARS2, KARS1	uc002fer.3	Q15046	OTTHUMG00000137609	ENST00000302445.3:c.747G>C	16.37:g.75669626C>G	ENSP00000303043:p.Lys249Asn					KARS_uc002fer.2_Missense_Mutation_p.K277N|KARS_uc002fes.2_Missense_Mutation_p.K93N|KARS_uc010cgz.2_Missense_Mutation_p.K93N	p.K249N	NM_005548	NP_005539	Q15046	SYK_HUMAN			6	795	-			249					A8MSK1|D3DUK4|O14946|Q96J25|Q9HB23	Missense_Mutation	SNP	ENST00000302445.3	37	c.747G>C	CCDS10923.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.827130	0.50739	.	.	ENSG00000065427	ENST00000319410;ENST00000302445	T;T	0.80824	-1.42;-1.42	6.17	3.18	0.36537	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.000000	0.85682	D	0.000000	D	0.83266	0.5217	M	0.86805	2.84	0.80722	D	1	B;P;P	0.49447	0.195;0.487;0.924	B;B;P	0.45538	0.135;0.136;0.484	D	0.85891	0.1428	10	0.59425	D	0.04	-12.1954	11.2972	0.49284	0.0:0.8069:0.0:0.1931	.	119;277;249	E9PDU1;Q15046-2;Q15046	.;.;SYK_HUMAN	N	277;249	ENSP00000325448:K277N;ENSP00000303043:K249N	ENSP00000303043:K249N	K	-	3	2	KARS	74227127	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	1.883000	0.39658	1.630000	0.50440	0.655000	0.94253	AAG		0.433	KARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269023.1		NM_005548		9	88	0	0	0	0.006214	0	9	88		
TAF1C	9013	broad.mit.edu	37	16	84214979	84214979	+	Silent	SNP	C	C	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr16:84214979C>A	ENST00000567759.1	-	10	1379	c.1197G>T	c.(1195-1197)gtG>gtT	p.V399V	TAF1C_ENST00000541676.1_Silent_p.V306V|TAF1C_ENST00000341690.6_Silent_p.V306V|TAF1C_ENST00000378541.4_Silent_p.V399V|TAF1C_ENST00000570117.1_Silent_p.V67V|TAF1C_ENST00000566732.1_Silent_p.V373V	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	399					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						CCACGGTCAGCACCCGAGGGT	0.667																																						uc002fhn.2		NaN																	0				ovary(1)	1						c.(1195-1197)GTG>GTT		TBP-associated factor 1C isoform 1							45.0	44.0	44.0					16																	84214979		2200	4299	6499	SO:0001819	synonymous_variant	9013				regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding	g.chr16:84214979C>A	L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.1197G>T	16.37:g.84214979C>A						TAF1C_uc002fhm.2_Silent_p.V306V|TAF1C_uc010vnx.1_Silent_p.V373V|TAF1C_uc010vny.1_5'UTR|TAF1C_uc010vnz.1_Silent_p.V67V|TAF1C_uc002fho.2_5'UTR|TAF1C_uc010voa.1_Silent_p.V67V|TAF1C_uc002fhp.1_Intron|TAF1C_uc010vob.1_3'UTR	p.V399V	NM_005679	NP_005670	Q15572	TAF1C_HUMAN			10	1425	-			399					B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Silent	SNP	ENST00000567759.1	37	c.1197G>T	CCDS32496.1																																																																																				0.667	TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433045.2		NM_139353		6	12	1	0	0.00116845	0.021553	0.00126267	6	12		
KCTD11	147040	broad.mit.edu	37	17	7256592	7256592	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr17:7256592C>G	ENST00000333751.3	+	1	1385	c.331C>G	c.(331-333)Cac>Gac	p.H111D	TMEM95_ENST00000330767.4_5'Flank|TMEM95_ENST00000576060.1_5'Flank|RP11-542C16.1_ENST00000572417.1_RNA|TMEM95_ENST00000389982.4_5'Flank	NM_001002914.2	NP_001002914.1	Q693B1	KCD11_HUMAN	potassium channel tetramerization domain containing 11	111					cell cycle (GO:0007049)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)				kidney(1)|large_intestine(2)|lung(1)	4		Prostate(122;0.157)				GGGACCCCATCACTATGAGCT	0.632																																						uc002gge.3		NaN																	0					0						c.(331-333)CAC>GAC		potassium channel tetramerisation domain							66.0	57.0	60.0					17																	7256592		2202	4300	6502	SO:0001583	missense	147040				cell cycle|regulation of growth	voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr17:7256592C>G	AK056227	CCDS32545.1	17p13.2	2013-06-20	2013-06-20	2003-11-26	ENSG00000213859	ENSG00000213859			21302	protein-coding gene	gene with protein product		609848	"""chromosome 17 open reading frame 36"", ""potassium channel tetramerisation domain containing 11"""	C17orf36		12186855, 21472142	Standard	NM_001002914		Approved	REN, KCASH1	uc002gge.4	Q693B1	OTTHUMG00000132061	ENST00000333751.3:c.331C>G	17.37:g.7256592C>G	ENSP00000328352:p.His111Asp					TMEM95_uc002ggf.1_5'Flank|TMEM95_uc002ggg.1_5'Flank|TMEM95_uc002ggh.1_5'Flank	p.H111D	NM_001002914	NP_001002914	Q693B1	KCD11_HUMAN			1	1385	+		Prostate(122;0.157)	111					B3KPE0	Missense_Mutation	SNP	ENST00000333751.3	37	c.331C>G	CCDS32545.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.964835	0.53507	.	.	ENSG00000213859	ENST00000333751	T	0.69685	-0.42	5.38	5.38	0.77491	.	0.120446	0.31963	U	0.006795	T	0.48750	0.1517	N	0.19112	0.55	0.33514	D	0.591559	P	0.43477	0.808	B	0.36335	0.222	T	0.60880	-0.7175	10	0.25751	T	0.34	.	14.6191	0.68572	0.0:1.0:0.0:0.0	.	111	Q693B1	KCD11_HUMAN	D	111	ENSP00000328352:H111D	ENSP00000328352:H111D	H	+	1	0	KCTD11	7197316	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	1.644000	0.37228	2.517000	0.84864	0.462000	0.41574	CAC		0.632	KCTD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255084.2		NM_001002914		6	59	0	0	0	0.001984	0	6	59		
PFAS	5198	broad.mit.edu	37	17	8168266	8168266	+	Silent	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr17:8168266G>A	ENST00000314666.6	+	18	2236	c.2103G>A	c.(2101-2103)ctG>ctA	p.L701L	PFAS_ENST00000545834.1_Silent_p.L277L	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	701					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	TGGGGCCCCTGCAAACTCCTC	0.632																																						uc002gkr.2		NaN																	0				ovary(2)|central_nervous_system(2)|pancreas(1)	5						c.(2101-2103)CTG>CTA		phosphoribosylformylglycinamidine synthase	L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)						14.0	16.0	15.0					17																	8168266		2196	4297	6493	SO:0001819	synonymous_variant	5198				'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding	g.chr17:8168266G>A	AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.2103G>A	17.37:g.8168266G>A						PFAS_uc010vuv.1_Silent_p.L277L|PFAS_uc002gks.2_5'Flank	p.L701L	NM_012393	NP_036525	O15067	PUR4_HUMAN			18	2244	+			701					A6H8V8	Silent	SNP	ENST00000314666.6	37	c.2103G>A	CCDS11136.1																																																																																				0.632	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226994.2				3	8	0	0	0	0.004672	0	3	8		
CCL23	6368	broad.mit.edu	37	17	34344932	34344932	+	Start_Codon_SNP	SNP	C	C	T	rs201639291		TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr17:34344932C>T	ENST00000591423.1	-	1	67	c.3G>A	c.(1-3)atG>atA	p.M1I	CCL23_ENST00000293280.2_Start_Codon_SNP_p.M1I	NM_145898.1	NP_665905.1	P55773	CCL23_HUMAN	chemokine (C-C motif) ligand 23	1					cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|monocyte chemotaxis (GO:0002548)|negative regulation of C-C chemokine binding (GO:2001264)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR1 chemokine receptor binding (GO:0031726)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)			large_intestine(2)|liver(1)|lung(2)|prostate(1)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CGGAGACCTTCATCCTCCTGG	0.577																																						uc002hkt.1		NaN																	0					0						c.(1-3)ATG>ATA		small inducible cytokine A23 isoform CKbeta8	Treprostinil(DB00374)						57.0	48.0	51.0					17																	34344932		2203	4299	6502	SO:0001582	initiator_codon_variant	6368				cell-cell signaling|cellular calcium ion homeostasis|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response|negative regulation of cell proliferation	extracellular space	chemokine activity|heparin binding	g.chr17:34344932C>T	U58913	CCDS11305.1, CCDS59282.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000167236	ENSG00000274736		"""Chemokine ligands"", ""Endogenous ligands"""	10622	protein-coding gene	gene with protein product		602494	"""small inducible cytokine subfamily A (Cys-Cys), member 23"""	SCYA23		9104803, 10409433	Standard	XR_429910		Approved	Ckb-8, MPIF-1, MIP-3, CKb8	uc002hks.1	P55773	OTTHUMG00000188409	ENST00000591423.1:c.3G>A	17.37:g.34344932C>T	ENSP00000465954:p.Met1Ile					CCL23_uc002hks.1_Missense_Mutation_p.M1I	p.M1I	NM_145898	NP_665905	P55773	CCL23_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	1	74	-		Ovarian(249;0.17)	1					B7ZKQ3|O00174|O75950|Q52LD4	Missense_Mutation	SNP	ENST00000591423.1	37	c.3G>A	CCDS59282.1	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515885	0.64634	.	.	ENSG00000167236	ENST00000293280	T	0.05717	3.4	4.43	3.46	0.39613	.	0.062799	0.64402	D	0.000011	T	0.18341	0.0440	.	.	.	0.28394	N	0.918944	D;D	0.89917	1.0;0.986	D;P	0.69307	0.963;0.791	T	0.01323	-1.1385	9	0.87932	D	0	.	8.2474	0.31698	0.0:0.8917:0.0:0.1083	.	1;1	P55773;P55773-2	CCL23_HUMAN;.	I	1	ENSP00000293280:M1I	ENSP00000293280:M1I	M	-	3	0	CCL23	31369045	1.000000	0.71417	0.477000	0.27303	0.181000	0.23173	1.126000	0.31344	1.223000	0.43536	0.655000	0.94253	ATG		0.577	CCL23-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450228.1		NM_005064, NM_145898	Missense_Mutation	4	28	0	0	0	0.014758	0	4	28		
LRRC46	90506	broad.mit.edu	37	17	45912735	45912735	+	Missense_Mutation	SNP	T	T	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr17:45912735T>C	ENST00000269025.4	+	4	605	c.242T>C	c.(241-243)aTt>aCt	p.I81T		NM_033413.3	NP_219481.1	Q96FV0	LRC46_HUMAN	leucine rich repeat containing 46	81										endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	9						ATCCAGCAAATTGAGAACCTG	0.547																																						uc002ima.2		NaN																	0				ovary(1)	1						c.(241-243)ATT>ACT		leucine rich repeat containing 46							152.0	143.0	146.0					17																	45912735		2203	4300	6503	SO:0001583	missense	90506							g.chr17:45912735T>C		CCDS11518.1	17q21.32	2005-08-09				ENSG00000141294			25047	protein-coding gene	gene with protein product						12477932	Standard	NM_033413		Approved	MGC16309	uc002ima.3	Q96FV0		ENST00000269025.4:c.242T>C	17.37:g.45912735T>C	ENSP00000269025:p.Ile81Thr					LRRC46_uc002imb.2_Missense_Mutation_p.I34T	p.I81T	NM_033413	NP_219481	Q96FV0	LRC46_HUMAN			4	498	+			81			LRR 2.		A8K9Q0	Missense_Mutation	SNP	ENST00000269025.4	37	c.242T>C	CCDS11518.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.307601	0.81247	.	.	ENSG00000141294	ENST00000269025	T	0.66099	-0.19	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000005	T	0.81336	0.4801	M	0.88640	2.97	0.39350	D	0.965743	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.99	D	0.85795	0.1370	10	0.87932	D	0	-12.3907	12.9784	0.58549	0.0:0.0:0.0:1.0	.	81;81	A8K9Q0;Q96FV0	.;LRC46_HUMAN	T	81	ENSP00000269025:I81T	ENSP00000269025:I81T	I	+	2	0	LRRC46	43267734	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.520000	0.60524	2.061000	0.61500	0.524000	0.50904	ATT		0.547	LRRC46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441377.1		NM_033413		21	195	0	0	0	0.016522	0	21	195		
LRRC46	90506	broad.mit.edu	37	17	45913412	45913412	+	Silent	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr17:45913412G>A	ENST00000269025.4	+	6	759	c.396G>A	c.(394-396)caG>caA	p.Q132Q		NM_033413.3	NP_219481.1	Q96FV0	LRC46_HUMAN	leucine rich repeat containing 46	132										endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	9						AGTTCCCCCAGAGCCTTCTCA	0.522																																						uc002ima.2		NaN																	0				ovary(1)	1						c.(394-396)CAG>CAA		leucine rich repeat containing 46							104.0	92.0	96.0					17																	45913412		2203	4300	6503	SO:0001819	synonymous_variant	90506							g.chr17:45913412G>A		CCDS11518.1	17q21.32	2005-08-09				ENSG00000141294			25047	protein-coding gene	gene with protein product						12477932	Standard	NM_033413		Approved	MGC16309	uc002ima.3	Q96FV0		ENST00000269025.4:c.396G>A	17.37:g.45913412G>A						LRRC46_uc002imb.2_Silent_p.Q85Q	p.Q132Q	NM_033413	NP_219481	Q96FV0	LRC46_HUMAN			6	652	+			132			LRR 4.		A8K9Q0	Silent	SNP	ENST00000269025.4	37	c.396G>A	CCDS11518.1																																																																																				0.522	LRRC46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441377.1		NM_033413		7	58	0	0	0	0.001984	0	7	58		
MSI2	124540	broad.mit.edu	37	17	55674294	55674294	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr17:55674294G>A	ENST00000284073.2	+	8	729	c.520G>A	c.(520-522)Gaa>Aaa	p.E174K	MSI2_ENST00000579505.1_3'UTR|MSI2_ENST00000579180.1_Missense_Mutation_p.E70K|MSI2_ENST00000322684.3_Missense_Mutation_p.E170K|MSI2_ENST00000416426.2_Missense_Mutation_p.E152K|MSI2_ENST00000442934.2_Missense_Mutation_p.E113K	NM_138962.2	NP_620412.1	Q96DH6	MSI2H_HUMAN	musashi RNA-binding protein 2	174	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	7	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		TCATTTCCATGAAATCAATAA	0.418			T	HOXA9	CML																																	uc002iuz.1		NaN		Dom	yes		17	17q23.2	124540	T	musashi homolog 2 (Drosophila)			L	HOXA9		CML		0				central_nervous_system(1)|pancreas(1)	2						c.(520-522)GAA>AAA		musashi 2 isoform a							104.0	102.0	103.0					17																	55674294		2203	4300	6503	SO:0001583	missense	124540					cytoplasm	nucleotide binding|RNA binding	g.chr17:55674294G>A	BC001526	CCDS11596.1, CCDS11597.1	17q23.2	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	18585	protein-coding gene	gene with protein product		607897	"""musashi homolog 2 (Drosophila)"""			11588182	Standard	NM_138962		Approved		uc002iuz.1	Q96DH6		ENST00000284073.2:c.520G>A	17.37:g.55674294G>A	ENSP00000284073:p.Glu174Lys					MSI2_uc010wnm.1_Missense_Mutation_p.E152K|MSI2_uc002iva.2_Missense_Mutation_p.E170K	p.E174K	NM_138962	NP_620412	Q96DH6	MSI2H_HUMAN		GBM - Glioblastoma multiforme(1;0.0025)	8	693	+	Breast(9;1.78e-08)		174			RRM 2.		Q7Z6M7|Q8N9T4	Missense_Mutation	SNP	ENST00000284073.2	37	c.520G>A	CCDS11596.1	.	.	.	.	.	.	.	.	.	.	G	35	5.446304	0.96187	.	.	ENSG00000153944	ENST00000416426;ENST00000284073;ENST00000322684;ENST00000442934	D;D;D;D	0.85556	-2.0;-2.0;-2.0;-2.0	5.83	4.86	0.63082	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.89294	0.6674	L	0.45470	1.425	0.80722	D	1	D;P;D	0.64830	0.987;0.934;0.994	P;P;D	0.68765	0.869;0.66;0.96	D	0.90248	0.4291	10	0.72032	D	0.01	.	14.8811	0.70534	0.0687:0.0:0.9313:0.0	.	152;170;174	B4DHE8;Q96DH6-2;Q96DH6	.;.;MSI2H_HUMAN	K	152;174;170;113	ENSP00000414671:E152K;ENSP00000284073:E174K;ENSP00000313616:E170K;ENSP00000392607:E113K	ENSP00000284073:E174K	E	+	1	0	MSI2	53029293	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.441000	0.97557	1.462000	0.47948	0.655000	0.94253	GAA		0.418	MSI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441813.1				5	113	0	0	0	0.014758	0	5	113		
TRIM37	4591	broad.mit.edu	37	17	57058003	57058003	+	IGR	SNP	C	C	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr17:57058003C>A	ENST00000393066.3	-	0	3622				PPM1E_ENST00000308249.2_Missense_Mutation_p.P627T	NM_001005207.2	NP_001005207.1	O94972	TRI37_HUMAN	tripartite motif containing 37						aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TGGAGAGTTTCCCACTGCTTT	0.428									Mulibrey Nanism																													uc002iwx.2		NaN																	0				breast(3)|lung(1)|skin(1)	5						c.(1879-1881)CCC>ACC		protein phosphatase 1E							137.0	139.0	138.0					17																	57058003		2203	4300	6503	SO:0001628	intergenic_variant	22843		Familial Cancer Database	Perheentupa syndrome	protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity	g.chr17:57058003C>A	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972			17.37:g.57058003C>A						PPM1E_uc010ddd.2_Missense_Mutation_p.P390T	p.P627T	NM_014906	NP_055721	Q8WY54	PPM1E_HUMAN	BRCA - Breast invasive adenocarcinoma(1;5.76e-11)		7	2006	+	Medulloblastoma(34;0.127)|all_neural(34;0.237)		636					Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000393066.3	37	c.1879C>A	CCDS45746.1	.	.	.	.	.	.	.	.	.	.	C	7.625	0.677596	0.14841	.	.	ENSG00000175175	ENST00000308249;ENST00000443121	T	0.17054	2.3	5.58	4.61	0.57282	.	0.870831	0.10460	N	0.672071	T	0.12178	0.0296	N	0.19112	0.55	0.09310	N	1	B;B	0.24426	0.103;0.069	B;B	0.28011	0.085;0.055	T	0.25710	-1.0124	10	0.56958	D	0.05	-23.0947	5.4581	0.16602	0.1722:0.6631:0.0:0.1647	.	636;627	Q8WY54-3;Q8WY54-2	.;.	T	627;478	ENSP00000312411:P627T	ENSP00000312411:P627T	P	+	1	0	PPM1E	54412785	0.000000	0.05858	0.970000	0.41538	0.964000	0.63967	0.198000	0.17217	1.372000	0.46190	0.491000	0.48974	CCC		0.428	TRIM37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445928.1		NM_015294		9	260	1	0	0.000274275	0.004482	0.000301253	9	260		
MED13	9969	broad.mit.edu	37	17	60028354	60028354	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr17:60028354C>G	ENST00000397786.2	-	28	6199	c.6123G>C	c.(6121-6123)caG>caC	p.Q2041H		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	2041					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GATCAGTACTCTGACCCTTAA	0.373																																						uc002izo.2		NaN																	0				large_intestine(1)|ovary(1)	2						c.(6121-6123)CAG>CAC		mediator complex subunit 13							91.0	82.0	85.0					17																	60028354		1875	4121	5996	SO:0001583	missense	9969				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:60028354C>G	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.6123G>C	17.37:g.60028354C>G	ENSP00000380888:p.Gln2041His						p.Q2041H	NM_005121	NP_005112	Q9UHV7	MED13_HUMAN			28	6200	-			2041					B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	37	c.6123G>C	CCDS42366.1	.	.	.	.	.	.	.	.	.	.	C	13.39	2.222451	0.39300	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	D	0.83335	-1.71	6.04	-0.102	0.13613	.	0.050607	0.85682	D	0.000000	D	0.85146	0.5630	M	0.65975	2.015	0.53688	D	0.999974	D	0.61080	0.989	P	0.58077	0.832	T	0.82643	-0.0356	10	0.48119	T	0.1	-1.8949	9.6691	0.40002	0.0:0.3732:0.0:0.6268	.	2041	Q9UHV7	MED13_HUMAN	H	2041;2040	ENSP00000380888:Q2041H	ENSP00000262436:Q2040H	Q	-	3	2	MED13	57383136	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	0.853000	0.27777	0.113000	0.18004	0.561000	0.74099	CAG		0.373	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1		NM_005121		7	98	0	0	0	0.004482	0	7	98		
HELZ	9931	broad.mit.edu	37	17	65162678	65162678	+	Missense_Mutation	SNP	T	T	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr17:65162678T>A	ENST00000358691.5	-	15	1977	c.1811A>T	c.(1810-1812)cAc>cTc	p.H604L	HELZ_ENST00000580168.1_Missense_Mutation_p.H604L	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	604						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TAGTGCATAGTGCATTTCACA	0.393																																						uc010wqk.1		NaN																	0				ovary(1)|pancreas(1)	2						c.(1810-1812)CAC>CTC		helicase with zinc finger domain							133.0	123.0	127.0					17																	65162678		1883	4121	6004	SO:0001583	missense	9931							g.chr17:65162678T>A	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.1811A>T	17.37:g.65162678T>A	ENSP00000351524:p.His604Leu					HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.H604L	p.H604L	NM_014877	NP_055692					15	1998	-	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)							I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	c.1811A>T	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	T	16.47	3.131223	0.56828	.	.	ENSG00000198265	ENST00000358691	D	0.87571	-2.27	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.93413	0.7899	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.94111	0.7371	10	0.87932	D	0	-21.8901	16.1923	0.82000	0.0:0.0:0.0:1.0	.	604;604	B7ZLW2;P42694	.;HELZ_HUMAN	L	604	ENSP00000351524:H604L	ENSP00000351524:H604L	H	-	2	0	HELZ	62593140	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.565000	0.82337	2.232000	0.73038	0.402000	0.26972	CAC		0.393	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1		NM_014877		7	154	0	0	0	0.00308	0	7	154		
BPTF	2186	broad.mit.edu	37	17	65889808	65889808	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr17:65889808C>T	ENST00000321892.4	+	8	2817	c.2756C>T	c.(2755-2757)tCa>tTa	p.S919L	BPTF_ENST00000424123.3_Missense_Mutation_p.S780L|BPTF_ENST00000335221.5_Missense_Mutation_p.S919L|BPTF_ENST00000306378.6_Missense_Mutation_p.S793L			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	919	Interaction with MAZ.				anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			AACATCCCTTCATCCTTTCTT	0.368																																						uc002jgf.2		NaN																	0				ovary(2)|skin(2)	4						c.(2377-2379)TCA>TTA		bromodomain PHD finger transcription factor							67.0	68.0	67.0					17																	65889808		2201	4297	6498	SO:0001583	missense	2186				brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding	g.chr17:65889808C>T	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.2756C>T	17.37:g.65889808C>T	ENSP00000315454:p.Ser919Leu					BPTF_uc002jge.2_Missense_Mutation_p.S919L|BPTF_uc010wqm.1_Missense_Mutation_p.S856L	p.S793L	NM_182641	NP_872579	Q12830	BPTF_HUMAN	BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)		6	2439	+	all_cancers(12;6e-11)		919			Interaction with MAZ.		Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	37	c.2378C>T		.	.	.	.	.	.	.	.	.	.	C	14.66	2.601369	0.46423	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892;ENST00000544778	T;T;T	0.62105	0.05;0.06;0.06	5.61	5.61	0.85477	.	.	.	.	.	T	0.48409	0.1498	N	0.20986	0.625	0.40625	D	0.981803	B;P;P	0.41848	0.278;0.481;0.763	B;B;B	0.33960	0.039;0.164;0.173	T	0.50110	-0.8866	9	0.33141	T	0.24	-10.3001	20.0016	0.97412	0.0:1.0:0.0:0.0	.	919;793;919	Q12830;Q12830-2;Q12830-4	BPTF_HUMAN;.;.	L	793;919;919;717	ENSP00000307208:S793L;ENSP00000334351:S919L;ENSP00000315454:S919L	ENSP00000307208:S793L	S	+	2	0	BPTF	63320270	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	4.863000	0.62983	2.802000	0.96397	0.655000	0.94253	TCA		0.368	BPTF-201	KNOWN	basic	protein_coding	protein_coding			NM_182641, NM_004459		4	93	0	0	0	0.021553	0	4	93		
HGS	9146	broad.mit.edu	37	17	79660899	79660899	+	Splice_Site	SNP	G	G	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr17:79660899G>T	ENST00000329138.4	+	11	975		c.e11-1			NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate						endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			TTCTGCCTCAGAGACAGAAGT	0.677																																						uc002kbg.2		NaN																	0				ovary(1)	1						c.e11-1		hepatocyte growth factor-regulated tyrosine							31.0	35.0	34.0					17																	79660899		2203	4300	6503	SO:0001630	splice_region_variant	9146				cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of JAK-STAT cascade|regulation of protein catabolic process	cytosol|early endosome membrane|multivesicular body membrane	metal ion binding|protein domain specific binding	g.chr17:79660899G>T	D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		ENST00000329138.4:c.841-1G>T	17.37:g.79660899G>T							p.R281_splice	NM_004712	NP_004703	O14964	HGS_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)		11	918	+	all_neural(118;0.0878)|all_lung(278;0.23)							Q9NR36	Splice_Site	SNP	ENST00000329138.4	37	c.841_splice	CCDS11784.1	.	.	.	.	.	.	.	.	.	.	G	14.06	2.422906	0.43020	.	.	ENSG00000185359	ENST00000329138;ENST00000442335	.	.	.	4.09	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8315	0.63384	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HGS	77271304	1.000000	0.71417	0.989000	0.46669	0.529000	0.34654	7.310000	0.78947	1.984000	0.57885	0.655000	0.94253	.		0.677	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440541.1		NM_004712	Intron	4	38	1	0	0.00909568	0.009096	0.00972464	4	38		
RNF125	54941	broad.mit.edu	37	18	29617078	29617078	+	Splice_Site	SNP	G	G	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr18:29617078G>T	ENST00000217740.3	+	2	656		c.e2-1		RP11-53I6.2_ENST00000583184.1_RNA	NM_017831.3	NP_060301.2	Q96EQ8	RN125_HUMAN	ring finger protein 125, E3 ubiquitin protein ligase						innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|lung(4)|upper_aerodigestive_tract(1)	6						GTTTGGGGTAGATTCTGCCGT	0.418																																						uc002kxf.1		NaN																	0					0						c.e2-1		ring finger protein 125							307.0	281.0	290.0					18																	29617078		2203	4300	6503	SO:0001630	splice_region_variant	54941				negative regulation of type I interferon production	intracellular	ligase activity|zinc ion binding	g.chr18:29617078G>T	AK000463	CCDS11902.1	18q12.1	2013-01-09	2012-02-23		ENSG00000101695	ENSG00000101695		"""RING-type (C3HC4) zinc fingers"""	21150	protein-coding gene	gene with protein product		610432	"""ring finger protein 125"""				Standard	NM_017831		Approved	FLJ20456	uc002kxf.1	Q96EQ8	OTTHUMG00000132266	ENST00000217740.3:c.165-1G>T	18.37:g.29617078G>T							p.V55_splice	NM_017831	NP_060301	Q96EQ8	RN125_HUMAN			2	547	+								Q9NX39	Splice_Site	SNP	ENST00000217740.3	37	c.165_splice	CCDS11902.1	.	.	.	.	.	.	.	.	.	.	G	16.22	3.060833	0.55432	.	.	ENSG00000101695	ENST00000217740	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4797	0.84155	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RNF125	27871076	1.000000	0.71417	0.976000	0.42696	0.805000	0.45488	5.440000	0.66563	2.619000	0.88677	0.650000	0.86243	.		0.418	RNF125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255354.1		NM_017831	Intron	23	371	1	0	1.55469e-16	0.01892	1.7655e-16	23	371		
ZFR2	23217	broad.mit.edu	37	19	3819052	3819052	+	Missense_Mutation	SNP	T	T	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr19:3819052T>C	ENST00000262961.4	-	12	1932	c.1922A>G	c.(1921-1923)gAc>gGc	p.D641G		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	641	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		CCTGCGCTTGTCACCCTCTTC	0.682																																						uc002lyw.2		NaN																	0				central_nervous_system(1)|pancreas(1)	2						c.(1921-1923)GAC>GGC		zinc finger RNA binding protein 2 isoform 1							31.0	36.0	35.0					19																	3819052		1969	4137	6106	SO:0001583	missense	23217					intracellular	nucleic acid binding|zinc ion binding	g.chr19:3819052T>C	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.1922A>G	19.37:g.3819052T>C	ENSP00000262961:p.Asp641Gly						p.D641G	NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)	12	1934	-			641						Missense_Mutation	SNP	ENST00000262961.4	37	c.1922A>G	CCDS45921.1	.	.	.	.	.	.	.	.	.	.	T	6.705	0.498721	0.12762	.	.	ENSG00000105278	ENST00000262961	T	0.07567	3.18	3.05	-2.84	0.05751	.	0.851159	0.10184	N	0.705518	T	0.01940	0.0061	N	0.01091	-1.02	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.46205	-0.9208	10	0.11182	T	0.66	-0.864	4.639	0.12540	0.0:0.2679:0.1802:0.5519	.	641	Q9UPR6	ZFR2_HUMAN	G	641	ENSP00000262961:D641G	ENSP00000262961:D641G	D	-	2	0	ZFR2	3770052	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.756000	0.26419	-0.656000	0.05380	-0.232000	0.12228	GAC		0.682	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453648.2		NM_015174		2	6	0	0	0	0.004672	0	2	6		
ZNF358	140467	broad.mit.edu	37	19	7584139	7584139	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr19:7584139C>T	ENST00000597229.1	+	2	181	c.11C>T	c.(10-12)tCa>tTa	p.S4L	CTD-2207O23.11_ENST00000602083.1_RNA|CTD-2207O23.12_ENST00000599312.1_Nonsense_Mutation_p.Q37*|ZNF358_ENST00000394341.2_Missense_Mutation_p.S4L	NM_018083.4	NP_060553.4	Q9NW07	ZN358_HUMAN	zinc finger protein 358	4					embryonic forelimb morphogenesis (GO:0035115)|neural tube development (GO:0021915)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|lung(1)|skin(2)	8						ATGCGGCGCTCAGTCCTGGTC	0.597																																						uc002mgn.2		NaN																	0				central_nervous_system(1)	1						c.(10-12)TCA>TTA		zinc finger protein 358							61.0	69.0	66.0					19																	7584139		2137	4261	6398	SO:0001583	missense	140467				embryonic forelimb morphogenesis|neural tube development|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:7584139C>T	AK001252	CCDS32890.2	19p13.2	2013-01-08			ENSG00000198816	ENSG00000198816		"""Zinc fingers, C2H2-type"""	16838	protein-coding gene	gene with protein product							Standard	NM_018083		Approved	FLJ10390, ZFEND	uc002mgn.2	Q9NW07		ENST00000597229.1:c.11C>T	19.37:g.7584139C>T	ENSP00000472305:p.Ser4Leu						p.S4L	NM_018083	NP_060553	Q9NW07	ZN358_HUMAN			2	181	+			4					Q9BTM7	Missense_Mutation	SNP	ENST00000597229.1	37	c.11C>T	CCDS32890.2	.	.	.	.	.	.	.	.	.	.	C	24.0	4.480012	0.84747	.	.	ENSG00000198816	ENST00000361576;ENST00000394341	T	0.09073	3.02	3.81	3.81	0.43845	.	.	.	.	.	T	0.05960	0.0155	N	0.08118	0	0.35840	D	0.825954	D	0.53885	0.963	B	0.43990	0.438	T	0.47018	-0.9149	9	0.46703	T	0.11	-5.8995	14.0534	0.64751	0.0:1.0:0.0:0.0	.	4	Q9NW07	ZN358_HUMAN	L	4	ENSP00000377873:S4L	ENSP00000354703:S4L	S	+	2	0	ZNF358	7490139	0.000000	0.05858	0.945000	0.38365	0.778000	0.44026	0.258000	0.18387	2.428000	0.82296	0.558000	0.71614	TCA		0.597	ZNF358-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316747.1				6	81	0	0	0	0.021553	0	6	81		
ZNF491	126069	broad.mit.edu	37	19	11916920	11916920	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr19:11916920C>T	ENST00000323169.5	+	3	483	c.152C>T	c.(151-153)tCc>tTc	p.S51F	ZNF491_ENST00000492230.1_Intron	NM_152356.3	NP_689569.2	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	51					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(14)|lung(6)|ovary(2)|skin(1)	26						GGATATTCATCCTTTAATAGG	0.393																																						uc002mso.1		NaN																	0				ovary(2)	2						c.(151-153)TCC>TTC		zinc finger protein 491							70.0	75.0	73.0					19																	11916920		2203	4300	6503	SO:0001583	missense	126069				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:11916920C>T	AK092110	CCDS12267.1	19p13.2	2013-01-08			ENSG00000177599	ENSG00000177599		"""Zinc fingers, C2H2-type"""	23706	protein-coding gene	gene with protein product							Standard	XM_005259730		Approved	FLJ34791	uc002mso.1	Q8N8L2	OTTHUMG00000156529	ENST00000323169.5:c.152C>T	19.37:g.11916920C>T	ENSP00000313443:p.Ser51Phe						p.S51F	NM_152356	NP_689569	Q8N8L2	ZN491_HUMAN			3	437	+			51			C2H2-type 1; degenerate.		Q3MJ35|Q8NAT8	Missense_Mutation	SNP	ENST00000323169.5	37	c.152C>T	CCDS12267.1	.	.	.	.	.	.	.	.	.	.	c	8.695	0.908257	0.17833	.	.	ENSG00000177599	ENST00000323169;ENST00000455048;ENST00000450087	T;T	0.16457	2.34;2.34	1.01	-1.93	0.07594	Zinc finger, C2H2 (1);	.	.	.	.	T	0.14917	0.0360	M	0.65975	2.015	0.09310	N	1	B	0.17268	0.021	B	0.04013	0.001	T	0.36529	-0.9744	9	0.62326	D	0.03	.	1.9065	0.03278	0.2674:0.3328:0.0:0.3998	.	51	Q8N8L2	ZN491_HUMAN	F	51	ENSP00000313443:S51F;ENSP00000392176:S51F	ENSP00000313443:S51F	S	+	2	0	ZNF491	11777920	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.692000	0.05127	-0.503000	0.06586	-0.467000	0.05162	TCC		0.393	ZNF491-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344518.1		NM_152356		6	111	0	0	0	0.00308	0	6	111		
COPE	11316	broad.mit.edu	37	19	19021838	19021838	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr19:19021838C>T	ENST00000262812.4	-	3	280	c.232G>A	c.(232-234)Gcc>Acc	p.A78T	COPE_ENST00000598969.1_5'UTR|COPE_ENST00000351079.4_Missense_Mutation_p.A78T|AC002985.3_ENST00000596918.1_3'UTR|COPE_ENST00000600932.1_Missense_Mutation_p.A78T|COPE_ENST00000349893.4_Missense_Mutation_p.A78T	NM_007263.3	NP_009194.2	O14579	COPE_HUMAN	coatomer protein complex, subunit epsilon	78					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|membrane organization (GO:0061024)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	11						AGCTCAGGGGCCGAGGAGGGC	0.632																																						uc002nkk.2		NaN																	0					0						c.(232-234)GCC>ACC		epsilon subunit of coatomer protein complex							157.0	129.0	138.0					19																	19021838		2203	4300	6503	SO:0001583	missense	11316				COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	binding|structural molecule activity	g.chr19:19021838C>T	AJ131182	CCDS12387.1, CCDS12388.1, CCDS12389.1	19p13.11	2008-02-05				ENSG00000105669			2234	protein-coding gene	gene with protein product		606942				10469566	Standard	NM_007263		Approved	epsilon-COP	uc002nkk.3	O14579		ENST00000262812.4:c.232G>A	19.37:g.19021838C>T	ENSP00000262812:p.Ala78Thr					COPE_uc002nkl.2_Missense_Mutation_p.A78T|COPE_uc002nkm.2_Missense_Mutation_p.A78T|COPE_uc002nkn.2_Missense_Mutation_p.A78T|HOMER3_uc002nko.1_RNA|HOMER3_uc002nkp.1_Intron	p.A78T	NM_007263	NP_009194	O14579	COPE_HUMAN			3	274	-			78					A6NE29|A6NKA3|O76097|Q6IBB8|Q9UGP6	Missense_Mutation	SNP	ENST00000262812.4	37	c.232G>A	CCDS12387.1	.	.	.	.	.	.	.	.	.	.	C	9.430	1.085356	0.20390	.	.	ENSG00000105669	ENST00000262812;ENST00000351079;ENST00000349893;ENST00000538245	T;T;T	0.46451	0.87;0.87;0.87	4.8	3.73	0.42828	.	0.560590	0.16895	N	0.195177	T	0.23289	0.0563	L	0.28274	0.84	0.09310	N	1	B;B;B;B	0.18166	0.003;0.026;0.007;0.005	B;B;B;B	0.19148	0.006;0.024;0.024;0.006	T	0.11324	-1.0592	10	0.15066	T	0.55	-16.1405	3.4886	0.07629	0.2726:0.5228:0.0:0.2047	.	78;78;78;78	Q53HJ6;A6NE29;A6NKA3;O14579	.;.;.;COPE_HUMAN	T	78;78;78;77	ENSP00000262812:A78T;ENSP00000345674:A78T;ENSP00000343134:A78T	ENSP00000262812:A78T	A	-	1	0	COPE	18882838	0.047000	0.20315	0.680000	0.29994	0.770000	0.43624	0.465000	0.22004	2.215000	0.71742	0.514000	0.50259	GCC		0.632	COPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464801.1		NM_007263		9	156	0	0	0	0.004482	0	9	156		
ZNF429	353088	broad.mit.edu	37	19	21720336	21720336	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr19:21720336C>G	ENST00000358491.4	+	4	1689	c.1481C>G	c.(1480-1482)tCa>tGa	p.S494*	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	494					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						AAGCAGTCCTCAAACCTTAAC	0.398																																						uc002nqd.1		NaN																	0				ovary(2)	2						c.(1480-1482)TCA>TGA		zinc finger protein 429							42.0	46.0	45.0					19																	21720336		2134	4275	6409	SO:0001587	stop_gained	353088				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:21720336C>G	AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.1481C>G	19.37:g.21720336C>G	ENSP00000351280:p.Ser494*					ZNF429_uc010ecu.1_Intron	p.S494*	NM_001001415	NP_001001415	Q86V71	ZN429_HUMAN			4	1618	+			494			C2H2-type 13.		A6NLV7|Q9BZE6	Nonsense_Mutation	SNP	ENST00000358491.4	37	c.1481C>G	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	.	18.91	3.723704	0.68959	.	.	ENSG00000197013	ENST00000358491	.	.	.	0.81	0.81	0.18732	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	8.393	0.32540	0.0:1.0:0.0:0.0	.	.	.	.	X	494	.	ENSP00000351280:S494X	S	+	2	0	ZNF429	21512176	0.000000	0.05858	0.795000	0.32087	0.796000	0.44982	-0.878000	0.04192	0.181000	0.19994	0.184000	0.17185	TCA		0.398	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463981.1		NM_001001415		9	59	0	0	0	0.004482	0	9	59		
ZNF429	353088	broad.mit.edu	37	19	21720683	21720683	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr19:21720683C>G	ENST00000358491.4	+	4	2036	c.1828C>G	c.(1828-1830)Caa>Gaa	p.Q610E	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	610					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						AAGACTTACTCAACATAAGAA	0.358																																						uc002nqd.1		NaN																	0				ovary(2)	2						c.(1828-1830)CAA>GAA		zinc finger protein 429							59.0	64.0	62.0					19																	21720683		2070	4245	6315	SO:0001583	missense	353088				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:21720683C>G	AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.1828C>G	19.37:g.21720683C>G	ENSP00000351280:p.Gln610Glu					ZNF429_uc010ecu.1_Intron	p.Q610E	NM_001001415	NP_001001415	Q86V71	ZN429_HUMAN			4	1965	+			610			C2H2-type 17.		A6NLV7|Q9BZE6	Missense_Mutation	SNP	ENST00000358491.4	37	c.1828C>G	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	.	0.310	-0.968315	0.02232	.	.	ENSG00000197013	ENST00000358491	T	0.06608	3.28	1.09	-2.18	0.07037	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01835	0.0058	N	0.03253	-0.375	0.09310	N	1	B	0.24963	0.115	B	0.21708	0.036	T	0.44667	-0.9313	9	0.06757	T	0.87	.	1.9764	0.03417	0.4302:0.3048:0.0:0.2649	.	610	Q86V71	ZN429_HUMAN	E	610	ENSP00000351280:Q610E	ENSP00000351280:Q610E	Q	+	1	0	ZNF429	21512523	0.000000	0.05858	0.001000	0.08648	0.409000	0.31022	-2.343000	0.01099	-0.272000	0.09259	0.298000	0.19748	CAA		0.358	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463981.1		NM_001001415		7	99	0	0	0	0.001984	0	7	99		
ERF	2077	broad.mit.edu	37	19	42754675	42754675	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr19:42754675G>C	ENST00000222329.4	-	2	222	c.65C>G	c.(64-66)cCt>cGt	p.P22R	ERF_ENST00000440177.2_5'UTR|AC006486.9_ENST00000594664.1_Intron|ERF_ENST00000595941.1_5'UTR	NM_006494.2	NP_006485.2	P50548	ERF_HUMAN	Ets2 repressor factor	22					cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chorio-allantoic fusion (GO:0060710)|ectodermal cell differentiation (GO:0010668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	17		Prostate(69;0.00682)				CCTTGAGCCAGGGGACGACTC	0.642																																						uc002ote.3		NaN																	0				lung(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(64-66)CCT>CGT		Ets2 repressor factor							50.0	43.0	45.0					19																	42754675		2203	4300	6503	SO:0001583	missense	2077				cell proliferation|regulation of transcription from RNA polymerase II promoter	nucleus	ligand-regulated transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr19:42754675G>C	U58535	CCDS12600.1	19q13	2008-07-16				ENSG00000105722			3444	protein-coding gene	gene with protein product	"""Ets2 repressor factor"""	611888				7588608, 9192842	Standard	XM_005258644		Approved	PE-2, PE2	uc002ote.4	P50548		ENST00000222329.4:c.65C>G	19.37:g.42754675G>C	ENSP00000222329:p.Pro22Arg					ERF_uc002otd.3_5'UTR	p.P22R	NM_006494	NP_006485	P50548	ERF_HUMAN			2	223	-		Prostate(69;0.00682)	22					B2RAP1|B7Z4R0|Q59G38|Q9UPI7	Missense_Mutation	SNP	ENST00000222329.4	37	c.65C>G	CCDS12600.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.198025	0.79015	.	.	ENSG00000105722	ENST00000222329	T	0.08896	3.04	5.37	4.34	0.51931	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.25680	0.0625	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00950	-1.1503	10	0.72032	D	0.01	.	12.2537	0.54611	0.0831:0.0:0.9169:0.0	.	22	P50548	ERF_HUMAN	R	22	ENSP00000222329:P22R	ENSP00000222329:P22R	P	-	2	0	ERF	47446515	1.000000	0.71417	0.982000	0.44146	0.989000	0.77384	9.806000	0.99153	1.418000	0.47098	0.655000	0.94253	CCT		0.642	ERF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463684.1		NM_006494		4	37	0	0	0	0.009096	0	4	37		
ZNF615	284370	broad.mit.edu	37	19	52496411	52496411	+	Missense_Mutation	SNP	T	T	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr19:52496411T>C	ENST00000602063.1	-	6	2267	c.1918A>G	c.(1918-1920)Ata>Gta	p.I640V	ZNF615_ENST00000391795.3_Missense_Mutation_p.I645V|ZNF615_ENST00000594083.1_Missense_Mutation_p.I651V|ZNF615_ENST00000376716.5_Missense_Mutation_p.I640V|ZNF615_ENST00000598071.1_Missense_Mutation_p.I651V			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	640					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TGATGTTGTATGAGGCATGTC	0.378																																						uc002pye.1		NaN																	0				ovary(4)|skin(1)	5						c.(1918-1920)ATA>GTA		zinc finger protein 615							162.0	160.0	161.0					19																	52496411		2203	4300	6503	SO:0001583	missense	284370				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52496411T>C	AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.1918A>G	19.37:g.52496411T>C	ENSP00000473089:p.Ile640Val					ZNF615_uc002pyf.1_Missense_Mutation_p.I651V|ZNF615_uc002pyg.1_Missense_Mutation_p.I532V|ZNF615_uc002pyh.1_Missense_Mutation_p.I651V|ZNF615_uc010epi.1_Missense_Mutation_p.I647V|ZNF615_uc010ydg.1_Missense_Mutation_p.I645V	p.I640V	NM_198480	NP_940882	Q8N8J6	ZN615_HUMAN		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)	6	2210	-		all_neural(266;0.117)	640			C2H2-type 16.		B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Missense_Mutation	SNP	ENST00000602063.1	37	c.1918A>G	CCDS12846.1	.	.	.	.	.	.	.	.	.	.	T	12.80	2.046593	0.36085	.	.	ENSG00000197619	ENST00000376716;ENST00000354939;ENST00000391795;ENST00000391793	T;T	0.15017	2.46;2.46	3.32	1.04	0.20106	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11495	0.0280	L	0.37466	1.105	0.09310	N	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.06405	0.002;0.002;0.002;0.002	T	0.31833	-0.9929	9	0.36615	T	0.2	.	3.6876	0.08334	0.0:0.2171:0.1934:0.5895	.	645;647;651;640	B4DH87;Q8N8J6-3;Q8N8J6-2;Q8N8J6	.;.;.;ZN615_HUMAN	V	640;650;645;594	ENSP00000365906:I640V;ENSP00000375672:I645V	ENSP00000347019:I650V	I	-	1	0	ZNF615	57188223	0.000000	0.05858	0.001000	0.08648	0.952000	0.60782	-2.223000	0.01214	0.027000	0.15297	0.533000	0.62120	ATA		0.378	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462391.1		NM_198480		16	308	0	0	0	0.024245	0	16	308		
NCR1	9437	broad.mit.edu	37	19	55420628	55420628	+	Missense_Mutation	SNP	C	C	T	rs142626797		TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr19:55420628C>T	ENST00000291890.4	+	4	418	c.380C>T	c.(379-381)tCg>tTg	p.S127L	NCR1_ENST00000594765.1_Missense_Mutation_p.S127L|NCR1_ENST00000338835.5_Missense_Mutation_p.S127L|NCR1_ENST00000350790.5_Missense_Mutation_p.S32L|NCR1_ENST00000598576.1_Missense_Mutation_p.S115L|NCR1_ENST00000447255.1_Missense_Mutation_p.S127L|NCR1_ENST00000357397.5_Missense_Mutation_p.S20L	NM_004829.5	NP_004820.2	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	127					cellular defense response (GO:0006968)|intracellular signal transduction (GO:0035556)|natural killer cell activation (GO:0030101)|regulation of natural killer cell mediated cytotoxicity (GO:0042269)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|SWI/SNF complex (GO:0016514)	receptor signaling protein activity (GO:0005057)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(193;0.0449)		CCCACCCTCTCGGTTCATCCT	0.483													.|||	1	0.000199681	0.0	0.0	5008	,	,		17541	0.0		0.001	False		,,,				2504	0.0					uc002qib.2		NaN																	0				large_intestine(1)|ovary(1)	2						c.(379-381)TCG>TTG		natural cytotoxicity triggering receptor 1		C	LEU/SER,LEU/SER,LEU/SER,LEU/SER,LEU/SER	0,4406		0,0,2203	83.0	71.0	75.0		380,380,95,95,380	1.2	0.4	19	dbSNP_134	75	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	NCR1	NM_001145457.1,NM_001145458.1,NM_001242356.1,NM_001242357.1,NM_004829.5	145,145,145,145,145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	127/304,127/288,32/210,32/193,127/305	55420628	1,13005	2203	4300	6503	SO:0001583	missense	9437				cellular defense response|natural killer cell activation|regulation of natural killer cell mediated cytotoxicity	integral to plasma membrane|SWI/SNF complex	receptor activity|receptor signaling protein activity	g.chr19:55420628C>T	AJ001383	CCDS12911.1, CCDS46181.1, CCDS46182.1, CCDS56103.1	19q13.42	2013-09-20	2002-11-13	2002-11-15	ENSG00000189430	ENSG00000189430		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6731	protein-coding gene	gene with protein product		604530	"""lymphocyte antigen 94 (mouse) homolog (activating NK-receptor; NK-p46)"""	LY94		9730896	Standard	NM_001145457		Approved	NK-p46, NKP46, CD335	uc002qib.2	O76036	OTTHUMG00000183212	ENST00000291890.4:c.380C>T	19.37:g.55420628C>T	ENSP00000291890:p.Ser127Leu					NCR1_uc002qic.2_Missense_Mutation_p.S127L|NCR1_uc002qie.2_Missense_Mutation_p.S127L|NCR1_uc002qid.2_Missense_Mutation_p.S32L|NCR1_uc002qif.2_Missense_Mutation_p.S32L|NCR1_uc010esj.2_Missense_Mutation_p.S20L	p.S127L	NM_004829	NP_004820	O76036	NCTR1_HUMAN		GBM - Glioblastoma multiforme(193;0.0449)	4	418	+			127			Extracellular (Potential).		B0V3L2|B0V3L3|B0V3L4|B0V3L5|B8JL03|O76016|O76017|O76018	Missense_Mutation	SNP	ENST00000291890.4	37	c.380C>T	CCDS12911.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	9.388	1.074674	0.20227	0.0	1.16E-4	ENSG00000189430	ENST00000291890;ENST00000447255;ENST00000338835;ENST00000350790;ENST00000357397	T;T;T;T;T	0.00776	5.71;5.71;5.71;5.71;5.71	3.53	1.23	0.21249	Immunoglobulin-like fold (1);	1.084070	0.07158	N	0.850155	T	0.00784	0.0026	L	0.45228	1.405	0.19575	N	0.999962	P;B;P;B;B;B	0.44429	0.835;0.077;0.614;0.077;0.24;0.086	B;B;B;B;B;B	0.25614	0.062;0.036;0.053;0.036;0.041;0.028	T	0.54098	-0.8344	10	0.56958	D	0.05	.	9.5244	0.39156	0.0:0.6059:0.3941:0.0	.	20;32;127;32;127;127	O76036-5;B0V3L4;B0V3L5;B0V3L2;O76036-6;O76036	.;.;.;.;.;NCTR1_HUMAN	L	127;127;127;32;20	ENSP00000291890:S127L;ENSP00000404434:S127L;ENSP00000339515:S127L;ENSP00000344358:S32L;ENSP00000349972:S20L	ENSP00000291890:S127L	S	+	2	0	NCR1	60112440	0.215000	0.23574	0.430000	0.26722	0.453000	0.32348	0.606000	0.24194	0.433000	0.26313	0.591000	0.81541	TCG		0.483	NCR1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465680.1				5	88	0	0	0	0.021553	0	5	88		
UGP2	7360	broad.mit.edu	37	2	64114722	64114722	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr2:64114722G>A	ENST00000337130.5	+	8	1734	c.1258G>A	c.(1258-1260)Gaa>Aaa	p.E420K	UGP2_ENST00000445915.2_Missense_Mutation_p.E429K|UGP2_ENST00000467648.2_Missense_Mutation_p.E409K|UGP2_ENST00000394417.2_Missense_Mutation_p.E409K	NM_006759.3	NP_006750.3	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2	420					carbohydrate metabolic process (GO:0005975)|cellular glucuronidation (GO:0052695)|glucose 1-phosphate metabolic process (GO:0019255)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	glucose binding (GO:0005536)|metal ion binding (GO:0046872)|pyrimidine ribonucleotide binding (GO:0032557)|UTP:glucose-1-phosphate uridylyltransferase activity (GO:0003983)			endometrium(2)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)	18						GACAATGAGTGAAAAGCGGGA	0.403																																						uc002scm.2		NaN																	0					0						c.(1258-1260)GAA>AAA		UDP-glucose pyrophosphorylase 2 isoform a							150.0	153.0	152.0					2																	64114722		2203	4300	6503	SO:0001583	missense	7360				glycogen biosynthetic process|phosphorylation|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	metal ion binding|protein binding|UTP:glucose-1-phosphate uridylyltransferase activity	g.chr2:64114722G>A		CCDS1875.1, CCDS42690.1	2p14-p13	2012-10-02			ENSG00000169764	ENSG00000169764	2.7.7.9		12527	protein-coding gene	gene with protein product		191760	"""UDP-glucose pyrophosphorylase 1"""	UGP1			Standard	NM_006759		Approved	UGPP1	uc002scm.3	Q16851	OTTHUMG00000129513	ENST00000337130.5:c.1258G>A	2.37:g.64114722G>A	ENSP00000338703:p.Glu420Lys					UGP2_uc002scl.2_Missense_Mutation_p.E409K|UGP2_uc010ypx.1_Missense_Mutation_p.E429K	p.E420K	NM_006759	NP_006750	Q16851	UGPA_HUMAN			8	1564	+			420					Q07131|Q0P6K2|Q86Y81|Q9BU15	Missense_Mutation	SNP	ENST00000337130.5	37	c.1258G>A	CCDS1875.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.243226	0.58995	.	.	ENSG00000169764	ENST00000394417;ENST00000467648;ENST00000337130;ENST00000445915	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	5.81	5.81	0.92471	.	0.144296	0.64402	D	0.000007	T	0.11793	0.0287	N	0.08118	0	0.53688	D	0.999977	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.18461	-1.0336	10	0.33141	T	0.24	-23.7017	20.066	0.97704	0.0:0.0:1.0:0.0	.	429;420	E7EUC7;Q16851	.;UGPA_HUMAN	K	409;409;420;429	ENSP00000377939:E409K;ENSP00000420793:E409K;ENSP00000338703:E420K;ENSP00000411803:E429K	ENSP00000338703:E420K	E	+	1	0	UGP2	63968226	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.392000	0.73213	2.730000	0.93505	0.650000	0.86243	GAA		0.403	UGP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251688.1		NM_006759		12	195	0	0	0	0.010729	0	12	195		
VPS54	51542	broad.mit.edu	37	2	64208891	64208891	+	Silent	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr2:64208891G>A	ENST00000272322.4	-	3	421	c.267C>T	c.(265-267)ttC>ttT	p.F89F	VPS54_ENST00000409558.4_Silent_p.F77F			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	89					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)				endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						TTTTTGTGAAGAAGTCAGATT	0.388																																						uc002scq.2		NaN																	0					0						c.(265-267)TTC>TTT		vacuolar protein sorting 54 isoform 1							245.0	224.0	231.0					2																	64208891		2203	4300	6503	SO:0001819	synonymous_variant	51542				protein transport|retrograde transport, endosome to Golgi			g.chr2:64208891G>A	AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.267C>T	2.37:g.64208891G>A						VPS54_uc002scp.2_Silent_p.F77F	p.F89F	NM_016516	NP_057600	Q9P1Q0	VPS54_HUMAN			3	430	-			89					Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Silent	SNP	ENST00000272322.4	37	c.267C>T	CCDS33208.1																																																																																				0.388	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327062.2		NM_016516		22	269	0	0	0	0.012319	0	22	269		
CCDC142	84865	broad.mit.edu	37	2	74709847	74709847	+	Missense_Mutation	SNP	G	G	A	rs143866681	byFrequency	TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr2:74709847G>A	ENST00000393965.3	-	1	514	c.118C>T	c.(118-120)Cgc>Tgc	p.R40C	TTC31_ENST00000233623.5_5'Flank|TTC31_ENST00000410003.1_5'Flank|CCDC142_ENST00000290418.4_Missense_Mutation_p.R40C|CCDC142_ENST00000471713.1_Intron|TTC31_ENST00000442235.2_5'Flank	NM_032779.3	NP_116168.3	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	40										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	16						ACCTCCCAGCGAAGACCGCCC	0.682													G|||	2	0.000399361	0.0015	0.0	5008	,	,		14683	0.0		0.0	False		,,,				2504	0.0					uc002slr.2		NaN																	0				central_nervous_system(1)	1						c.(118-120)CGC>TGC		coiled-coil domain containing 142		G	CYS/ARG	15,4371		0,15,2178	47.0	49.0	48.0		118	-0.9	0.0	2	dbSNP_134	48	0,8564		0,0,4282	yes	missense	CCDC142	NM_032779.3	180	0,15,6460	AA,AG,GG		0.0,0.342,0.1158	probably-damaging	40/744	74709847	15,12935	2193	4282	6475	SO:0001583	missense	84865							g.chr2:74709847G>A	AK075543	CCDS1945.1	2p13.1	2008-02-05			ENSG00000135637	ENSG00000135637			25889	protein-coding gene	gene with protein product							Standard	NM_032779		Approved	FLJ14397	uc002slq.3	Q17RM4	OTTHUMG00000129962	ENST00000393965.3:c.118C>T	2.37:g.74709847G>A	ENSP00000377537:p.Arg40Cys					TTC31_uc002sls.2_5'Flank|TTC31_uc010yrv.1_5'Flank|TTC31_uc002slt.2_5'Flank|TTC31_uc002slu.2_5'Flank|CCDC142_uc002slo.2_RNA|CCDC142_uc002slq.2_Missense_Mutation_p.R40C|CCDC142_uc002slp.2_Missense_Mutation_p.R40C	p.R40C	NM_032779	NP_116168	Q17RM4	CC142_HUMAN			1	511	-			40					B7ZKV5|Q8NBJ3|Q8NBV2|Q96KA7	Missense_Mutation	SNP	ENST00000393965.3	37	c.118C>T		1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	15.57	2.872367	0.51695	0.00342	0.0	ENSG00000135637	ENST00000393965;ENST00000290418	T;T	0.10477	2.87;2.87	3.38	-0.95	0.10372	.	0.806755	0.10453	N	0.672875	T	0.04137	0.0115	N	0.08118	0	0.09310	N	1	B;B;B	0.24675	0.067;0.067;0.109	B;B;B	0.15052	0.004;0.004;0.012	T	0.45352	-0.9267	9	.	.	.	0.1699	5.1311	0.14911	0.2468:0.2165:0.5366:0.0	.	40;40;40	Q17RM4;Q17RM4-2;Q17RM4-3	CC142_HUMAN;.;.	C	40	ENSP00000377537:R40C;ENSP00000290418:R40C	.	R	-	1	0	CCDC142	74563355	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	-0.399000	0.07250	-0.099000	0.12263	0.511000	0.50034	CGC		0.682	CCDC142-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000328391.1		NM_032779		8	62	0	0	0	0.004482	0	8	62		
TEX37	200523	broad.mit.edu	37	2	88828645	88828645	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr2:88828645G>C	ENST00000303254.3	+	4	338	c.196G>C	c.(196-198)Gat>Cat	p.D66H		NM_152670.2	NP_689883.1	Q96LM6	TEX37_HUMAN	testis expressed 37	66						nucleus (GO:0005634)											CAAGCTAACAGATGGGTACCC	0.532																																						uc002stb.1		NaN																	0				skin(1)	1						c.(196-198)GAT>CAT		chromosome 2 open reading frame 51							100.0	95.0	97.0					2																	88828645		2203	4300	6503	SO:0001583	missense	200523					nucleus		g.chr2:88828645G>C	AK058098	CCDS2003.1	2p11.2	2014-01-28	2012-09-14	2012-09-14	ENSG00000172073	ENSG00000172073			26341	protein-coding gene	gene with protein product	"""Testis-Specific Conserved gene 21kDa"""		"""chromosome 2 open reading frame 51"""	C2orf51		17091336	Standard	NM_152670		Approved	FLJ25369, TSC21	uc002stb.2	Q96LM6	OTTHUMG00000130332	ENST00000303254.3:c.196G>C	2.37:g.88828645G>C	ENSP00000307142:p.Asp66His						p.D66H	NM_152670	NP_689883	Q96LM6	TSC21_HUMAN			4	338	+			66						Missense_Mutation	SNP	ENST00000303254.3	37	c.196G>C	CCDS2003.1	.	.	.	.	.	.	.	.	.	.	G	13.51	2.257449	0.39896	.	.	ENSG00000172073	ENST00000303254	T	0.53857	0.6	4.61	3.72	0.42706	.	0.272209	0.26377	N	0.024730	T	0.54886	0.1886	L	0.34521	1.04	0.19775	N	0.999951	D	0.69078	0.997	D	0.63877	0.919	T	0.42292	-0.9460	10	0.72032	D	0.01	-5.4653	7.9692	0.30117	0.1085:0.0:0.8915:0.0	.	66	Q96LM6	TSC21_HUMAN	H	66	ENSP00000307142:D66H	ENSP00000307142:D66H	D	+	1	0	C2orf51	88609760	0.667000	0.27484	0.501000	0.27601	0.409000	0.31022	1.704000	0.37857	2.561000	0.86390	0.462000	0.41574	GAT		0.532	TEX37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252682.1		NM_152670		8	84	0	0	0	0.004482	0	8	84		
BUB1	699	broad.mit.edu	37	2	111427076	111427076	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr2:111427076G>C	ENST00000302759.6	-	6	639	c.521C>G	c.(520-522)tCa>tGa	p.S174*	BUB1_ENST00000409311.1_Nonsense_Mutation_p.S174*|BUB1_ENST00000535254.1_Nonsense_Mutation_p.S154*	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	174	BUB1 N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00822}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		ATTTGATTTTGATGTTATCAT	0.358																																						uc002tgc.2		NaN																	0				lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7						c.(520-522)TCA>TGA		budding uninhibited by benzimidazoles 1							171.0	162.0	165.0					2																	111427076		2203	4300	6503	SO:0001587	stop_gained	699				apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr2:111427076G>C	AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.521C>G	2.37:g.111427076G>C	ENSP00000302530:p.Ser174*					BUB1_uc010yxh.1_Nonsense_Mutation_p.S154*|BUB1_uc010fkb.2_Nonsense_Mutation_p.S174*|BUB1_uc002tgd.2_Nonsense_Mutation_p.S174*	p.S174*	NM_004336	NP_004327	O43683	BUB1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0556)	6	633	-		Ovarian(717;0.0822)	174			BUB1 N-terminal.		E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Nonsense_Mutation	SNP	ENST00000302759.6	37	c.521C>G	CCDS33273.1	.	.	.	.	.	.	.	.	.	.	G	34	5.351862	0.95830	.	.	ENSG00000169679	ENST00000535254;ENST00000409311;ENST00000302759;ENST00000541432	.	.	.	4.51	2.68	0.31781	.	0.877448	0.10066	N	0.720326	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-3.8774	6.6459	0.22934	0.2142:0.0:0.7858:0.0	.	.	.	.	X	154;174;174;174	.	ENSP00000302530:S174X	S	-	2	0	BUB1	111143547	0.838000	0.29461	0.141000	0.22245	0.973000	0.67179	2.281000	0.43452	1.221000	0.43506	0.467000	0.42956	TCA		0.358	BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331925.1		NM_004336		4	116	0	0	0	0.009096	0	4	116		
SCTR	6344	broad.mit.edu	37	2	120197742	120197742	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr2:120197742G>A	ENST00000019103.5	-	13	1541	c.1274C>T	c.(1273-1275)gCc>gTc	p.A425V		NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor	425					digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	CAAGTGGCTGGCCTTGGTGCT	0.627																																						uc002tma.2		NaN																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1273-1275)GCC>GTC		secretin receptor precursor	Secretin(DB00021)						67.0	55.0	59.0					2																	120197742		2203	4300	6503	SO:0001583	missense	6344				digestion|excretion	integral to plasma membrane	secretin receptor activity	g.chr2:120197742G>A		CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407	ENST00000019103.5:c.1274C>T	2.37:g.120197742G>A	ENSP00000019103:p.Ala425Val					SCTR_uc002tlz.2_Missense_Mutation_p.A247V	p.A425V	NM_002980	NP_002971	P47872	SCTR_HUMAN			13	1500	-			425			Cytoplasmic (Potential).		Q12961|Q13213|Q53T00	Missense_Mutation	SNP	ENST00000019103.5	37	c.1274C>T	CCDS2127.1	.	.	.	.	.	.	.	.	.	.	G	10.99	1.506855	0.26949	.	.	ENSG00000080293	ENST00000019103	T	0.45276	0.9	4.99	4.11	0.48088	.	0.257196	0.27181	N	0.020550	T	0.31575	0.0801	L	0.43701	1.375	0.31349	N	0.682795	P	0.44690	0.841	B	0.38842	0.283	T	0.27297	-1.0078	10	0.11485	T	0.65	.	13.1999	0.59761	0.0:0.4515:0.5484:0.0	.	425	P47872	SCTR_HUMAN	V	425	ENSP00000019103:A425V	ENSP00000019103:A425V	A	-	2	0	SCTR	119914212	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	1.930000	0.40124	1.314000	0.45095	0.650000	0.86243	GCC		0.627	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254198.2				5	24	0	0	0	0.014758	0	5	24		
ARHGEF4	50649	broad.mit.edu	37	2	131799455	131799455	+	Missense_Mutation	SNP	A	A	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr2:131799455A>C	ENST00000326016.5	+	10	1924	c.1405A>C	c.(1405-1407)Aag>Cag	p.K469Q	ARHGEF4_ENST00000409303.1_Missense_Mutation_p.K409Q|ARHGEF4_ENST00000525839.1_Missense_Mutation_p.K469Q|ARHGEF4_ENST00000355771.3_Missense_Mutation_p.K398Q|ARHGEF4_ENST00000392953.3_Missense_Mutation_p.K469Q|ARHGEF4_ENST00000428230.2_Intron	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	469					apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		CAACGAGCGGAAGCGGAGACT	0.562																																						uc002tsa.1		NaN																	0				breast(3)|ovary(2)|skin(1)	6						c.(1405-1407)AAG>CAG		Rho guanine nucleotide exchange factor 4 isoform							63.0	60.0	61.0					2																	131799455		2203	4300	6503	SO:0001583	missense	50649				apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|lamellipodium assembly|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|ruffle membrane	protein domain specific binding|Rac guanyl-nucleotide exchange factor activity	g.chr2:131799455A>C	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.1405A>C	2.37:g.131799455A>C	ENSP00000316845:p.Lys469Gln					ARHGEF4_uc010fmw.1_Intron|ARHGEF4_uc002tsb.1_Missense_Mutation_p.K469Q|ARHGEF4_uc010fmx.1_Missense_Mutation_p.K409Q|ARHGEF4_uc002tsc.1_Missense_Mutation_p.K12Q	p.K469Q	NM_015320	NP_056135	Q9NR80	ARHG4_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.097)	10	1925	+		Prostate(154;0.055)	469					Q9HDC6|Q9UPP0	Missense_Mutation	SNP	ENST00000326016.5	37	c.1405A>C	CCDS2165.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	32|32	5.149501|5.149501	0.94645|0.94645	.|.	.|.	ENSG00000136002|ENSG00000136002	ENST00000532720|ENST00000326016;ENST00000392953;ENST00000525839;ENST00000409303;ENST00000355771	.|T;T;T;T;T	.|0.70164	.|-0.46;-0.46;-0.46;1.4;-0.46	5.47|5.47	5.47|5.47	0.80525|0.80525	.|Dbl homology (DH) domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.81380|0.81380	0.4810|0.4810	M|M	0.78801|0.78801	2.425|2.425	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.87578	.|0.995;0.998;0.995	D|D	0.83753|0.83753	0.0210|0.0210	5|10	.|0.72032	.|D	.|0.01	.|.	13.4948|13.4948	0.61419|0.61419	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|409;469;469	.|E9PEM0;Q9NR80-4;Q9NR80	.|.;.;ARHG4_HUMAN	A|Q	85|469;469;469;409;398	.|ENSP00000316845:K469Q;ENSP00000376680:K469Q;ENSP00000432267:K469Q;ENSP00000387285:K409Q;ENSP00000348017:K398Q	.|ENSP00000316845:K469Q	E|K	+|+	2|1	0|0	ARHGEF4|ARHGEF4	131515925|131515925	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.961000|0.961000	0.63080|0.63080	8.695000|8.695000	0.91298|0.91298	2.089000|2.089000	0.63090|0.63090	0.379000|0.379000	0.24179|0.24179	GAA|AAG		0.562	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4				3	58	0	0	0	0.004672	0	3	58		
MAP3K19	80122	broad.mit.edu	37	2	135739074	135739074	+	Silent	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr2:135739074G>A	ENST00000375845.3	-	9	3267	c.3237C>T	c.(3235-3237)ctC>ctT	p.L1079L	MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000392917.3_Silent_p.L211L|MAP3K19_ENST00000375844.3_Silent_p.L261L|MAP3K19_ENST00000358371.4_Silent_p.L966L|MAP3K19_ENST00000392915.1_Missense_Mutation_p.S1147L	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	1079	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										CTTGACTAGTGAGACCACAGT	0.368																																						uc002tue.1		NaN																	0				stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5						c.(3235-3237)CTC>CTT		Yeast Sps1/Ste20-related kinase 4 isoform 1							68.0	65.0	66.0					2																	135739074		2203	4300	6503	SO:0001819	synonymous_variant	80122						ATP binding|protein serine/threonine kinase activity	g.chr2:135739074G>A	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.3237C>T	2.37:g.135739074G>A						YSK4_uc002tuf.1_Silent_p.L261L|YSK4_uc010fnc.1_Intron|YSK4_uc010fnd.1_Silent_p.L966L|YSK4_uc010zbg.1_Silent_p.L211L|YSK4_uc002tuh.3_Silent_p.L807L|YSK4_uc002tui.3_Missense_Mutation_p.S1147L	p.L1079L	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.112)	9	3268	-			1079			Protein kinase.		B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Silent	SNP	ENST00000375845.3	37	c.3237C>T	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	G	5.589	0.293373	0.10567	.	.	ENSG00000176601	ENST00000392915	T	0.25250	1.81	5.88	-3.43	0.04810	.	.	.	.	.	T	0.11452	0.0279	.	.	.	0.80722	D	1	B	0.12630	0.006	B	0.16722	0.016	T	0.26916	-1.0089	7	.	.	.	.	2.8127	0.05446	0.1306:0.1493:0.4156:0.3045	.	1147	A8MWG7	.	L	1147	ENSP00000376647:S1147L	.	S	-	2	0	YSK4	135455544	0.893000	0.30496	0.993000	0.49108	0.081000	0.17604	0.055000	0.14229	-0.234000	0.09782	0.655000	0.94253	TCA		0.368	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1		NM_025052		7	199	0	0	0	0.001984	0	7	199		
LRP1B	53353	broad.mit.edu	37	2	141641540	141641540	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr2:141641540C>T	ENST00000389484.3	-	25	4986	c.4015G>A	c.(4015-4017)Ggc>Agc	p.G1339S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1339					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACTGTCAGGCCTTCTGGAGTA	0.468										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	uc002tvj.1		NaN																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(4015-4017)GGC>AGC		low density lipoprotein-related protein 1B							137.0	131.0	133.0					2																	141641540		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141641540C>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4015G>A	2.37:g.141641540C>T	ENSP00000374135:p.Gly1339Ser	TSP Lung(27;0.18)				LRP1B_uc010fnl.1_Missense_Mutation_p.G521S	p.G1339S	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	25	4987	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	1339			Extracellular (Potential).|LDL-receptor class B 9.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.4015G>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	34	5.362863	0.95877	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.96619	-4.07;-4.07	5.63	5.63	0.86233	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.98330	0.9446	M	0.85630	2.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.98294	1.0515	10	0.52906	T	0.07	.	20.0499	0.97621	0.0:1.0:0.0:0.0	.	522;1339	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	S	1339;1277;484	ENSP00000374135:G1339S;ENSP00000413239:G484S	ENSP00000374135:G1339S	G	-	1	0	LRP1B	141358010	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	7.707000	0.84623	2.798000	0.96311	0.655000	0.94253	GGC		0.468	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2		NM_018557		16	131	0	0	0	0.024245	0	16	131		
SLC4A10	57282	broad.mit.edu	37	2	162751249	162751249	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr2:162751249G>C	ENST00000446997.1	+	11	1348	c.1255G>C	c.(1255-1257)Gag>Cag	p.E419Q	SLC4A10_ENST00000415876.2_Missense_Mutation_p.E389Q|SLC4A10_ENST00000272716.5_Missense_Mutation_p.E389Q|SLC4A10_ENST00000535165.1_Missense_Mutation_p.M389I|SLC4A10_ENST00000375514.5_Missense_Mutation_p.E400Q|SLC4A10_ENST00000421911.1_Missense_Mutation_p.E419Q|SLC4A10_ENST00000493021.1_3'UTR	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	419					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	AGGAATTGATGAGTTTCTGGA	0.353																																						uc002ubx.3		NaN																	0				ovary(2)|lung(2)|pancreas(1)	5						c.(1255-1257)GAG>CAG		solute carrier family 4, sodium bicarbonate							109.0	105.0	107.0					2																	162751249		1831	4085	5916	SO:0001583	missense	57282				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity	g.chr2:162751249G>C		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.1255G>C	2.37:g.162751249G>C	ENSP00000393066:p.Glu419Gln					SLC4A10_uc010fpa.1_Missense_Mutation_p.E431Q|SLC4A10_uc010zcr.1_RNA|SLC4A10_uc002uby.3_Missense_Mutation_p.E389Q|SLC4A10_uc010zcs.1_Missense_Mutation_p.E400Q	p.E419Q	NM_022058	NP_071341	Q6U841	S4A10_HUMAN			11	1439	+			419			Cytoplasmic (Potential).		B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	ENST00000446997.1	37	c.1255G>C	CCDS54411.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.175523|5.175523	0.94807|0.94807	.|.	.|.	ENSG00000144290|ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711|ENST00000535165	T;T;T;T;T|T	0.71698|0.51325	-0.59;-0.59;-0.59;-0.59;-0.59|0.71	5.43|5.43	5.43|5.43	0.79202|0.79202	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);|.	0.045148|.	0.85682|.	D|.	0.000000|.	T|T	0.77624|0.77624	0.4158|0.4158	M|M	0.92459|0.92459	3.31|3.31	0.80722|0.80722	D|D	1|1	D;P;D;D|.	0.89917|.	1.0;0.933;1.0;1.0|.	D;D;D;D|.	0.91635|.	0.999;0.928;0.999;0.999|.	T|T	0.82864|0.82864	-0.0246|-0.0246	10|7	0.87932|0.87932	D|D	0|0	.|.	19.6166|19.6166	0.95636|0.95636	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	400;419;389;419|.	F8W675;E7EW28;Q6U841-2;Q6U841|.	.;.;.;S4A10_HUMAN|.	Q|I	400;389;389;388;419;419;418|389	ENSP00000364664:E400Q;ENSP00000395797:E389Q;ENSP00000272716:E389Q;ENSP00000393066:E419Q;ENSP00000404486:E419Q|ENSP00000437527:M389I	ENSP00000272716:E389Q|ENSP00000437527:M389I	E|M	+|+	1|3	0|0	SLC4A10|SLC4A10	162459495|162459495	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.813000|9.813000	0.99286|0.99286	2.721000|2.721000	0.93114|0.93114	0.655000|0.655000	0.94253|0.94253	GAG|ATG		0.353	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1		NM_022058		8	94	0	0	0	0.006214	0	8	94		
FASTKD1	79675	broad.mit.edu	37	2	170416964	170416964	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr2:170416964G>A	ENST00000453153.2	-	5	1250	c.904C>T	c.(904-906)Cat>Tat	p.H302Y	FASTKD1_ENST00000453929.2_Missense_Mutation_p.H302Y	NM_024622.3	NP_078898.3	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	302					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(5)|large_intestine(10)|lung(9)|ovary(4)|prostate(3)	37						CTAGCAGGATGATTACACAGA	0.299																																						uc002uev.3		NaN																	0				ovary(4)	4						c.(904-906)CAT>TAT		FAST kinase domains 1							99.0	111.0	107.0					2																	170416964		2194	4298	6492	SO:0001583	missense	79675				apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity	g.chr2:170416964G>A	AL832058	CCDS33318.1, CCDS63051.1	2q31.1	2008-02-05			ENSG00000138399	ENSG00000138399			26150	protein-coding gene	gene with protein product						11347906	Standard	NM_024622		Approved	FLJ21901	uc002uev.4	Q53R41	OTTHUMG00000154953	ENST00000453153.2:c.904C>T	2.37:g.170416964G>A	ENSP00000400513:p.His302Tyr					FASTKD1_uc002uew.3_RNA|FASTKD1_uc002uex.3_Missense_Mutation_p.H288Y|FASTKD1_uc002uey.2_Missense_Mutation_p.H265Y	p.H302Y	NM_024622	NP_078898	Q53R41	FAKD1_HUMAN			5	1292	-			302					Q8N583|Q8TEA9|Q96JM5|Q96N71|Q9H6T4	Missense_Mutation	SNP	ENST00000453153.2	37	c.904C>T	CCDS33318.1	.	.	.	.	.	.	.	.	.	.	G	13.32	2.202124	0.38905	.	.	ENSG00000138399	ENST00000453153;ENST00000453929	T;T	0.19394	2.15;2.15	5.61	0.308	0.15815	.	1.222880	0.05710	N	0.595858	T	0.23886	0.0578	M	0.62723	1.935	0.25951	N	0.982752	B;B;B	0.13145	0.004;0.007;0.004	B;B;B	0.10450	0.002;0.005;0.002	T	0.37430	-0.9706	10	0.56958	D	0.05	-16.7143	7.9943	0.30258	0.0:0.4488:0.2468:0.3044	.	279;302;302	D3DPC4;Q53R41-2;Q53R41	.;.;FAKD1_HUMAN	Y	302	ENSP00000400513:H302Y;ENSP00000403229:H302Y	ENSP00000400513:H302Y	H	-	1	0	FASTKD1	170125210	0.106000	0.21978	0.361000	0.25849	0.905000	0.53344	0.416000	0.21198	0.263000	0.21812	0.650000	0.86243	CAT		0.299	FASTKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337788.2		NM_024622		18	239	0	0	0	0.008871	0	18	239		
FASTKD1	79675	broad.mit.edu	37	2	170417266	170417266	+	Missense_Mutation	SNP	G	G	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr2:170417266G>T	ENST00000453153.2	-	5	948	c.602C>A	c.(601-603)tCt>tAt	p.S201Y	FASTKD1_ENST00000453929.2_Missense_Mutation_p.S201Y	NM_024622.3	NP_078898.3	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	201					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(5)|large_intestine(10)|lung(9)|ovary(4)|prostate(3)	37						TATTAAAGAAGATATGTTGAC	0.294																																						uc002uev.3		NaN																	0				ovary(4)	4						c.(601-603)TCT>TAT		FAST kinase domains 1							29.0	30.0	30.0					2																	170417266		2202	4298	6500	SO:0001583	missense	79675				apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity	g.chr2:170417266G>T	AL832058	CCDS33318.1, CCDS63051.1	2q31.1	2008-02-05			ENSG00000138399	ENSG00000138399			26150	protein-coding gene	gene with protein product						11347906	Standard	NM_024622		Approved	FLJ21901	uc002uev.4	Q53R41	OTTHUMG00000154953	ENST00000453153.2:c.602C>A	2.37:g.170417266G>T	ENSP00000400513:p.Ser201Tyr					FASTKD1_uc002uew.3_RNA|FASTKD1_uc002uex.3_Missense_Mutation_p.S187Y|FASTKD1_uc002uey.2_Missense_Mutation_p.S164Y	p.S201Y	NM_024622	NP_078898	Q53R41	FAKD1_HUMAN			5	990	-			201					Q8N583|Q8TEA9|Q96JM5|Q96N71|Q9H6T4	Missense_Mutation	SNP	ENST00000453153.2	37	c.602C>A	CCDS33318.1	.	.	.	.	.	.	.	.	.	.	G	12.51	1.958227	0.34565	.	.	ENSG00000138399	ENST00000453153;ENST00000453929;ENST00000417376;ENST00000438035;ENST00000445210	T;T	0.20200	2.09;2.09	5.45	5.45	0.79879	.	0.110156	0.64402	D	0.000004	T	0.24851	0.0603	L	0.59436	1.845	0.47183	D	0.999341	P;P;P	0.39071	0.528;0.658;0.528	B;P;B	0.45428	0.287;0.48;0.287	T	0.02868	-1.1100	10	0.02654	T	1	-3.6732	13.2612	0.60106	0.0:0.0:0.8414:0.1585	.	178;201;201	D3DPC4;Q53R41-2;Q53R41	.;.;FAKD1_HUMAN	Y	201;201;29;178;201	ENSP00000400513:S201Y;ENSP00000403229:S201Y	ENSP00000408667:S29Y	S	-	2	0	FASTKD1	170125512	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.646000	0.61411	2.552000	0.86080	0.655000	0.94253	TCT		0.294	FASTKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337788.2		NM_024622		4	48	1	0	0.000602214	0.014758	0.000654298	4	48		
METTL8	79828	broad.mit.edu	37	2	172195788	172195788	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr2:172195788G>A	ENST00000375258.4	-	4	727	c.512C>T	c.(511-513)tCt>tTt	p.S171F		NM_024770.3	NP_079046.2	Q9H825	METL8_HUMAN	methyltransferase like 8	171						cytoplasm (GO:0005737)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	11						GGAAAAATCAGATTCTGTTTT	0.383																																						uc010zdo.1		NaN																	0				ovary(1)	1						c.(511-513)TCT>TTT		methyltransferase like 8							169.0	163.0	165.0					2																	172195788		2203	4300	6503	SO:0001583	missense	79828						methyltransferase activity	g.chr2:172195788G>A	AK024046	CCDS2242.1, CCDS2242.2	2q31.1	2012-06-12			ENSG00000123600	ENSG00000123600			25856	protein-coding gene	gene with protein product	"""tension-induced/inhibited protein"""	609525				15992539	Standard	NM_024770		Approved	FLJ13984, TIP	uc010zdo.2	Q9H825	OTTHUMG00000132261	ENST00000375258.4:c.512C>T	2.37:g.172195788G>A	ENSP00000364407:p.Ser171Phe					METTL8_uc002ugu.3_Missense_Mutation_p.S171F|METTL8_uc002ugv.3_Missense_Mutation_p.S171F|METTL8_uc002ugt.3_Missense_Mutation_p.S171F|METTL8_uc002ugs.3_Missense_Mutation_p.S121F|METTL8_uc010zdp.1_Missense_Mutation_p.S126F	p.S171F	NM_024770	NP_079046	B3KW44	B3KW44_HUMAN			4	653	-			171					Q53TM9|Q53TQ0	Missense_Mutation	SNP	ENST00000375258.4	37	c.512C>T		.	.	.	.	.	.	.	.	.	.	G	20.5	3.994221	0.74703	.	.	ENSG00000123600	ENST00000375258;ENST00000392599	T;T	0.19105	2.46;2.17	5.89	5.01	0.66863	.	1.464460	0.04117	N	0.315657	T	0.22244	0.0536	L	0.27053	0.805	0.09310	N	1	P;B;P	0.45283	0.734;0.306;0.855	B;B;P	0.45829	0.316;0.124;0.494	T	0.15065	-1.0450	10	0.12430	T	0.62	-2.3352	11.8847	0.52596	0.1436:0.0:0.8564:0.0	.	126;171;171	B4DLT0;B3KW44;Q9H825	.;.;METL8_HUMAN	F	171	ENSP00000364407:S171F;ENSP00000376377:S171F	ENSP00000364407:S171F	S	-	2	0	METTL8	171904034	0.006000	0.16342	0.008000	0.14137	0.870000	0.49936	0.862000	0.27899	1.499000	0.48617	0.557000	0.71058	TCT		0.383	METTL8-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255345.3		NM_024770		14	269	0	0	0	0.020292	0	14	269		
MAP2	4133	broad.mit.edu	37	2	210560016	210560016	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr2:210560016C>T	ENST00000360351.4	+	7	3628	c.3122C>T	c.(3121-3123)gCt>gTt	p.A1041V	MAP2_ENST00000199940.6_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.A1037V|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1041					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	CTGGATTTTGCTGTCCAGGGT	0.443																																					Pancreas(27;423 979 28787 29963)	uc002vde.1		NaN																	0				ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17						c.(3121-3123)GCT>GTT		microtubule-associated protein 2 isoform 1	Estramustine(DB01196)						107.0	107.0	107.0					2																	210560016		2203	4300	6503	SO:0001583	missense	4133				central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity	g.chr2:210560016C>T		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.3122C>T	2.37:g.210560016C>T	ENSP00000353508:p.Ala1041Val					MAP2_uc002vdc.1_Missense_Mutation_p.A1041V|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Missense_Mutation_p.A1037V	p.A1041V	NM_002374	NP_002365	P11137	MAP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	7	3370	+		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)	1041					Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	c.3122C>T	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050212	0.36181	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.25579	1.79;1.79	6.07	-2.22	0.06952	MAP2/Tau projection (1);	0.811929	0.11052	N	0.604938	T	0.12860	0.0312	N	0.21448	0.665	0.19300	N	0.999976	B;B	0.06786	0.001;0.001	B;B	0.12156	0.004;0.007	T	0.28713	-1.0035	10	0.72032	D	0.01	-0.3012	1.1227	0.01728	0.1899:0.351:0.1876:0.2716	.	1037;1041	P11137-3;P11137	.;MAP2_HUMAN	V	1041;1037	ENSP00000353508:A1041V;ENSP00000392164:A1037V	ENSP00000353508:A1041V	A	+	2	0	MAP2	210268261	0.997000	0.39634	0.047000	0.18901	0.655000	0.38815	0.559000	0.23485	-0.305000	0.08831	-0.142000	0.14014	GCT		0.443	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2		NM_001039538		5	101	0	0	0	0.014758	0	5	101		
SPHKAP	80309	broad.mit.edu	37	2	228883236	228883236	+	Missense_Mutation	SNP	G	G	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr2:228883236G>T	ENST00000392056.3	-	7	2380	c.2334C>A	c.(2332-2334)caC>caA	p.H778Q	SPHKAP_ENST00000344657.5_Missense_Mutation_p.H778Q	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	778						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GACTCGTGTTGTGTGAATTGC	0.512																																						uc002vpq.2		NaN																	0				skin(5)|ovary(4)|lung(1)	10						c.(2332-2334)CAC>CAA		sphingosine kinase type 1-interacting protein							237.0	233.0	235.0					2																	228883236		2203	4300	6503	SO:0001583	missense	80309					cytoplasm	protein binding	g.chr2:228883236G>T		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2334C>A	2.37:g.228883236G>T	ENSP00000375909:p.His778Gln					SPHKAP_uc002vpp.2_Missense_Mutation_p.H778Q|SPHKAP_uc010zlx.1_Missense_Mutation_p.H778Q	p.H778Q	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)	7	2381	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	778					Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	c.2334C>A	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	G	2.539	-0.306712	0.05458	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.11495	2.77;2.77	5.67	-3.46	0.04767	.	1.390520	0.03802	N	0.264682	T	0.08582	0.0213	L	0.40543	1.245	0.09310	N	1	B;P	0.37276	0.011;0.589	B;B	0.33454	0.003;0.164	T	0.26780	-1.0093	10	0.66056	D	0.02	.	4.5879	0.12291	0.0702:0.3554:0.3782:0.1962	.	778;778	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	Q	778	ENSP00000375909:H778Q;ENSP00000339886:H778Q	ENSP00000339886:H778Q	H	-	3	2	SPHKAP	228591480	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.108000	0.10857	-0.944000	0.03686	0.655000	0.94253	CAC		0.512	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1		NM_030623		30	451	1	0	1.80694e-10	0.009535	2.04043e-10	30	451		
NTSR1	4923	broad.mit.edu	37	20	61391508	61391508	+	Silent	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr20:61391508C>G	ENST00000370501.3	+	4	1517	c.1146C>G	c.(1144-1146)ctC>ctG	p.L382L	NTSR1_ENST00000482259.1_3'UTR	NM_002531.2	NP_002522.2	P30989	NTR1_HUMAN	neurotensin receptor 1 (high affinity)	382					adult locomotory behavior (GO:0008344)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(16)|prostate(1)|skin(3)	27	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			TGGCCTGCCTCTGCCCGGTGT	0.627																																					GBM(37;400 780 6403 19663 35669)	uc002ydf.2		NaN																	0				skin(2)|lung(1)|central_nervous_system(1)	4						c.(1144-1146)CTC>CTG		neurotensin receptor 1							138.0	116.0	123.0					20																	61391508		2203	4300	6503	SO:0001819	synonymous_variant	4923					endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	neurotensin receptor activity, G-protein coupled	g.chr20:61391508C>G		CCDS13502.1	20q13	2012-08-08			ENSG00000101188	ENSG00000101188		"""GPCR / Class A : Neurotensin receptors"""	8039	protein-coding gene	gene with protein product		162651				8075503	Standard	NM_002531		Approved	NTR	uc002ydf.3	P30989	OTTHUMG00000032932	ENST00000370501.3:c.1146C>G	20.37:g.61391508C>G							p.L382L	NM_002531	NP_002522	P30989	NTR1_HUMAN	BRCA - Breast invasive adenocarcinoma(19;3.63e-06)		4	1517	+	Breast(26;3.65e-08)		382			Cytoplasmic (Potential).		Q9H4H1|Q9H4T5	Silent	SNP	ENST00000370501.3	37	c.1146C>G	CCDS13502.1																																																																																				0.627	NTSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080061.1				3	57	0	0	0	0.00308	0	3	57		
SUN2	25777	broad.mit.edu	37	22	39141785	39141785	+	Silent	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr22:39141785C>T	ENST00000405510.1	-	9	1075	c.717G>A	c.(715-717)caG>caA	p.Q239Q	RP3-508I15.21_ENST00000609212.1_RNA|RP3-508I15.14_ENST00000416406.1_RNA|SUN2_ENST00000405018.1_Silent_p.Q260Q|SUN2_ENST00000411587.2_Silent_p.Q228Q|SUN2_ENST00000216064.4_Silent_p.Q239Q|SUN2_ENST00000406622.1_Silent_p.Q239Q|RP3-508I15.22_ENST00000607991.1_RNA	NM_001199580.1	NP_001186509.1	Q9UH99	SUN2_HUMAN	Sad1 and UNC84 domain containing 2	239					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|mitotic spindle organization (GO:0007052)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)	condensed nuclear chromosome (GO:0000794)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|SUN-KASH complex (GO:0034993)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|microtubule binding (GO:0008017)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)|stomach(1)	15						GGTGGAATGTCTGCAGCCCAT	0.617																																						uc003awh.1		NaN																	0				large_intestine(1)|skin(1)	2						c.(715-717)CAG>CAA		unc-84 homolog B							61.0	57.0	59.0					22																	39141785		2203	4300	6503	SO:0001819	synonymous_variant	25777				centrosome localization|cytoskeletal anchoring at nuclear membrane|mitotic spindle organization|nuclear envelope organization|nuclear matrix anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	endosome membrane|integral to membrane|nuclear inner membrane|SUN-KASH complex	lamin binding|microtubule binding	g.chr22:39141785C>T	AF202723	CCDS13978.1, CCDS56231.1	22q12-q13	2010-05-18	2010-05-18	2010-01-27	ENSG00000100242	ENSG00000100242			14210	protein-coding gene	gene with protein product		613569	"""unc-84 homolog B (C. elegans)"""	UNC84B		10508607, 10375507	Standard	NM_015374		Approved		uc010gxq.2	Q9UH99	OTTHUMG00000151031	ENST00000405510.1:c.717G>A	22.37:g.39141785C>T						SUN2_uc011anz.1_Silent_p.Q274Q|SUN2_uc011aoa.1_Silent_p.Q228Q|SUN2_uc003awi.1_Silent_p.Q239Q|SUN2_uc010gxq.1_Silent_p.Q260Q|SUN2_uc010gxr.1_Silent_p.Q239Q|SUN2_uc010gxs.1_Silent_p.Q239Q	p.Q239Q	NM_015374	NP_056189	Q9UH99	SUN2_HUMAN			9	1001	-			239			Perinuclear space.		B0QY62|O75156|Q2NKN8|Q2T9F7|Q504T5|Q6B4H1|Q7Z3E3	Silent	SNP	ENST00000405510.1	37	c.717G>A	CCDS13978.1	.	.	.	.	.	.	.	.	.	.	C	9.613	1.131816	0.21041	.	.	ENSG00000100242	ENST00000430185	.	.	.	5.35	4.32	0.51571	.	.	.	.	.	T	0.68860	0.3047	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67711	-0.5600	4	.	.	.	-23.7611	13.1227	0.59336	0.0:0.8392:0.1608:0.0	.	.	.	.	K	96	.	.	R	-	2	0	SUN2	37471731	0.934000	0.31675	0.991000	0.47740	0.983000	0.72400	1.006000	0.29847	1.226000	0.43582	0.655000	0.94253	AGA		0.617	SUN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321057.1		XM_039332		4	38	0	0	0	0.009096	0	4	38		
CCDC134	79879	broad.mit.edu	37	22	42209814	42209814	+	Silent	SNP	C	C	T	rs371808841		TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr22:42209814C>T	ENST00000255784.5	+	6	656	c.552C>T	c.(550-552)atC>atT	p.I184I	CCDC134_ENST00000402061.3_Intron	NM_024821.2	NP_079097.1	Q9H6E4	CC134_HUMAN	coiled-coil domain containing 134	184						extracellular region (GO:0005576)|membrane (GO:0016020)				large_intestine(1)|lung(2)|ovary(2)|skin(1)	6						CATTTAAAATCGACCGCACAG	0.567																																						uc003bbh.1		NaN																	0				ovary(2)	2						c.(550-552)ATC>ATT		coiled-coil domain containing 134 precursor		C		1,4405	2.1+/-5.4	0,1,2202	89.0	84.0	85.0		552	-1.3	0.6	22		85	0,8600		0,0,4300	no	coding-synonymous	CCDC134	NM_024821.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		184/230	42209814	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	79879					extracellular region		g.chr22:42209814C>T	AL021453	CCDS33654.1	22q13.2	2010-12-24			ENSG00000100147	ENSG00000100147			26185	protein-coding gene	gene with protein product						18087676	Standard	NM_024821		Approved	FLJ22349	uc003bbh.1	Q9H6E4	OTTHUMG00000151262	ENST00000255784.5:c.552C>T	22.37:g.42209814C>T						WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|CCDC134_uc011apg.1_Intron	p.I184I	NM_024821	NP_079097	Q9H6E4	CC134_HUMAN			6	661	+			184						Silent	SNP	ENST00000255784.5	37	c.552C>T	CCDS33654.1																																																																																				0.567	CCDC134-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000321964.1		NM_024821		4	86	0	0	0	0.014758	0	4	86		
XYLB	9942	broad.mit.edu	37	3	38404477	38404477	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr3:38404477C>T	ENST00000207870.3	+	4	350	c.260C>T	c.(259-261)tCt>tTt	p.S87F	XYLB_ENST00000542835.1_Intron	NM_005108.3	NP_005099.2	O75191	XYLB_HUMAN	xylulokinase homolog (H. influenzae)	87					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|D-xylose metabolic process (GO:0042732)|generation of precursor metabolites and energy (GO:0006091)|xylulose catabolic process (GO:0005998)|xylulose metabolic process (GO:0005997)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|xylulokinase activity (GO:0004856)			endometrium(3)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|prostate(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		TTCGACTTCTCTCAAGTCCTA	0.522																																						uc003cic.2		NaN																	0				ovary(1)	1						c.(259-261)TCT>TTT		xylulokinase							115.0	115.0	115.0					3																	38404477		2203	4300	6503	SO:0001583	missense	9942				D-xylose metabolic process|generation of precursor metabolites and energy|xylulose catabolic process		ATP binding|xylulokinase activity	g.chr3:38404477C>T	AB015046	CCDS2678.1	3p22-p21.3	2006-12-18	2001-12-04		ENSG00000093217	ENSG00000093217			12839	protein-coding gene	gene with protein product		604049	"""xylulokinase (H. influenzae) homolog"""			9763671	Standard	NM_005108		Approved	FLJ10343, FLJ12539	uc003cic.2	O75191	OTTHUMG00000131294	ENST00000207870.3:c.260C>T	3.37:g.38404477C>T	ENSP00000207870:p.Ser87Phe					XYLB_uc011ayp.1_Intron|XYLB_uc003cid.1_Missense_Mutation_p.S9F	p.S87F	NM_005108	NP_005099	O75191	XYLB_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)	4	369	+			87					B2RAW4|B4DDT2|B9EH64	Missense_Mutation	SNP	ENST00000207870.3	37	c.260C>T	CCDS2678.1	.	.	.	.	.	.	.	.	.	.	C	19.82	3.898217	0.72639	.	.	ENSG00000093217	ENST00000207870	T	0.50277	0.75	5.14	5.14	0.70334	Carbohydrate kinase, FGGY, N-terminal (1);	0.159728	0.64402	D	0.000019	T	0.69504	0.3118	M	0.87038	2.855	0.80722	D	1	P	0.46142	0.873	P	0.61800	0.894	T	0.73754	-0.3883	10	0.66056	D	0.02	.	12.2378	0.54526	0.0:0.8283:0.1717:0.0	.	87	O75191	XYLB_HUMAN	F	87	ENSP00000207870:S87F	ENSP00000207870:S87F	S	+	2	0	XYLB	38379481	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.563000	0.60823	2.554000	0.86153	0.455000	0.32223	TCT		0.522	XYLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254062.2		NM_005108		4	119	0	0	0	0.014758	0	4	119		
ZNF502	91392	broad.mit.edu	37	3	44763393	44763393	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr3:44763393C>G	ENST00000296091.4	+	4	1340	c.1084C>G	c.(1084-1086)Cag>Gag	p.Q362E	ZNF502_ENST00000449836.1_Missense_Mutation_p.Q362E|ZNF502_ENST00000436624.2_Missense_Mutation_p.Q362E	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	362					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		AGCCTTTTGTCAGAGCCCATC	0.408																																						uc011baa.1		NaN																	0					0						c.(1084-1086)CAG>GAG		zinc finger protein 502							56.0	60.0	59.0					3																	44763393		2203	4300	6503	SO:0001583	missense	91392				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr3:44763393C>G	AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.1084C>G	3.37:g.44763393C>G	ENSP00000296091:p.Gln362Glu					ZNF502_uc003cns.2_Missense_Mutation_p.Q362E|ZNF502_uc011bab.1_Missense_Mutation_p.Q362E|ZNF502_uc003cnt.2_Missense_Mutation_p.Q362E	p.Q362E	NM_001134440	NP_001127912	Q8TBZ5	ZN502_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)	4	1339	+			362			C2H2-type 8.			Missense_Mutation	SNP	ENST00000296091.4	37	c.1084C>G	CCDS2719.1	.	.	.	.	.	.	.	.	.	.	C	9.552	1.116217	0.20795	.	.	ENSG00000196653	ENST00000449836;ENST00000296091;ENST00000436624	T;T;T	0.35421	1.31;1.31;1.31	4.27	2.31	0.28768	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.27169	0.0666	L	0.45581	1.43	0.09310	N	1	P	0.52577	0.954	B	0.37650	0.255	T	0.12293	-1.0553	9	0.48119	T	0.1	-1.7372	8.3056	0.32041	0.155:0.7545:0.0:0.0905	.	362	Q8TBZ5	ZN502_HUMAN	E	362	ENSP00000397390:Q362E;ENSP00000296091:Q362E;ENSP00000406469:Q362E	ENSP00000296091:Q362E	Q	+	1	0	ZNF502	44738397	0.000000	0.05858	0.981000	0.43875	0.996000	0.88848	-1.229000	0.02945	1.160000	0.42584	0.655000	0.94253	CAG		0.408	ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256744.4		NM_033210		7	72	0	0	0	0.001984	0	7	72		
PRSS50	29122	broad.mit.edu	37	3	46783844	46783844	+	Intron	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr3:46783844G>A	ENST00000460241.1	-	4	1129				PRSS45_ENST00000442359.2_Missense_Mutation_p.S228F			Q9UI38	TSP50_HUMAN	protease, serine, 50						proteolysis (GO:0006508)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	serine-type endopeptidase activity (GO:0004252)|threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11						GGGAGGTCAGGAGCCCATCTG	0.552																																					Pancreas(41;915 1239 11561 17469)	uc010hjl.2		NaN																	0					0						c.(682-684)TCC>TTC		testis serine protease 5							150.0	193.0	179.0					3																	46783844		2102	4223	6325	SO:0001627	intron_variant	377047				proteolysis		serine-type endopeptidase activity	g.chr3:46783844G>A	AF100707	CCDS2745.1	3p21.31	2011-05-24			ENSG00000206549	ENSG00000206549		"""Serine peptidases / Serine peptidases"""	17910	protein-coding gene	gene with protein product	"""cancer/testis antigen 20"", ""testes specific protease 50"""	607950				10397268	Standard	NM_013270		Approved	TSP50, CT20	uc003cqe.1	Q9UI38	OTTHUMG00000164067	ENST00000460241.1:c.541+6270C>T	3.37:g.46783844G>A						PRSS45_uc011bam.1_RNA	p.S228F	NM_199183	NP_954652	Q7RTY3	PRS45_HUMAN			4	683	-			260						Missense_Mutation	SNP	ENST00000460241.1	37	c.683C>T	CCDS2745.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.974506	0.53720	.	.	ENSG00000188086	ENST00000331814;ENST00000442359	D	0.89552	-2.53	4.91	-0.272	0.12919	.	1.329980	0.04966	N	0.462896	T	0.80385	0.4613	.	.	.	0.09310	N	0.999997	B	0.31174	0.311	B	0.26969	0.075	T	0.68135	-0.5489	9	0.87932	D	0	.	1.2697	0.02019	0.3342:0.139:0.3841:0.1427	.	228	Q7RTY3-2	.	F	260;228	ENSP00000401932:S228F	ENSP00000330940:S260F	S	-	2	0	PRSS45	46758848	0.000000	0.05858	0.115000	0.21578	0.067000	0.16453	0.165000	0.16564	0.040000	0.15660	0.655000	0.94253	TCC		0.552	PRSS50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354544.1				7	168	0	0	0	0.00308	0	7	168		
PVRL3	25945	broad.mit.edu	37	3	110845149	110845149	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr3:110845149C>T	ENST00000485303.1	+	5	1311	c.1036C>T	c.(1036-1038)Caa>Taa	p.Q346*	PVRL3_ENST00000319792.3_Nonsense_Mutation_p.Q346*|PVRL3_ENST00000493615.1_Nonsense_Mutation_p.Q323*	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	346	Ig-like C2-type 2.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						TTCCCTTGGTCAAAGAAGTGA	0.313																																						uc003dxt.1		NaN																	0				upper_aerodigestive_tract(2)	2						c.(1036-1038)CAA>TAA		poliovirus receptor-related 3 precursor							84.0	82.0	83.0					3																	110845149		2202	4300	6502	SO:0001587	stop_gained	25945				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane	cell adhesion molecule binding|protein homodimerization activity	g.chr3:110845149C>T	AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.1036C>T	3.37:g.110845149C>T	ENSP00000418070:p.Gln346*					PVRL3_uc003dxu.1_Nonsense_Mutation_p.Q323*	p.Q346*	NM_015480	NP_056295	Q9NQS3	PVRL3_HUMAN			5	1036	+			346			Extracellular (Potential).|Ig-like C2-type 2.		E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Nonsense_Mutation	SNP	ENST00000485303.1	37	c.1036C>T	CCDS2957.1	.	.	.	.	.	.	.	.	.	.	C	35	5.575147	0.96553	.	.	ENSG00000177707	ENST00000485303;ENST00000319792;ENST00000493615	.	.	.	5.5	5.5	0.81552	.	0.053762	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	17.2428	0.87019	0.0:1.0:0.0:0.0	.	.	.	.	X	346;346;323	.	ENSP00000321514:Q346X	Q	+	1	0	PVRL3	112327839	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.427000	0.52785	2.736000	0.93811	0.591000	0.81541	CAA		0.313	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354045.1		NM_015480		5	62	0	0	0	0.021553	0	5	62		
MUC13	56667	broad.mit.edu	37	3	124646827	124646827	+	Silent	SNP	T	T	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr3:124646827T>C	ENST00000311075.3	-	2	101	c.63A>G	c.(61-63)caA>caG	p.Q21Q	MUC13_ENST00000497378.1_5'UTR	NM_033049.3	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, cell surface associated	21					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)|stomach(1)	18						CTGAGTTGCCTTGGTTGGTGG	0.418																																						uc003ehq.1		NaN																	0					0						c.(61-63)CAA>CAG		mucin 13, epithelial transmembrane							109.0	94.0	99.0					3																	124646827		2203	4300	6503	SO:0001819	synonymous_variant	56667					extracellular region|integral to membrane|plasma membrane		g.chr3:124646827T>C	AF286113		3q21.2	2007-01-17	2006-03-14		ENSG00000173702	ENSG00000173702		"""Mucins"""	7511	protein-coding gene	gene with protein product		612181	"""down-regulated in colon cancer 1"", ""mucin 13, epithelial transmembrane"""	DRCC1		11278439	Standard	NM_033049		Approved		uc003ehq.2	Q9H3R2	OTTHUMG00000159484	ENST00000311075.3:c.63A>G	3.37:g.124646827T>C							p.Q21Q	NM_033049	NP_149038	Q9H3R2	MUC13_HUMAN			2	87	-			21			Extracellular (Potential).		Q6UWD9|Q9NXT5	Silent	SNP	ENST00000311075.3	37	c.63A>G																																																																																					0.418	MUC13-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000355714.1		NM_033049		3	140	0	0	0	0.004672	0	3	140		
SLC41A3	54946	broad.mit.edu	37	3	125726027	125726027	+	Silent	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr3:125726027C>T	ENST00000315891.6	-	11	1534	c.1296G>A	c.(1294-1296)ctG>ctA	p.L432L	SLC41A3_ENST00000346785.5_Silent_p.L396L|SLC41A3_ENST00000360370.4_Silent_p.L432L|SLC41A3_ENST00000383598.2_Silent_p.L406L|SLC41A3_ENST00000508835.1_Silent_p.L315L	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3	432						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		GGTGCCAAGTCAGCCGAACCA	0.547																																						uc003eij.2		NaN																	0					0						c.(1294-1296)CTG>CTA		solute carrier family 41, member 3 isoform 1							79.0	72.0	74.0					3																	125726027		2203	4300	6503	SO:0001819	synonymous_variant	54946					integral to membrane|plasma membrane	cation transmembrane transporter activity	g.chr3:125726027C>T		CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.1296G>A	3.37:g.125726027C>T						SLC41A3_uc003eii.2_Silent_p.L406L|SLC41A3_uc003eil.2_Silent_p.L432L|SLC41A3_uc003eik.2_Silent_p.L396L|SLC41A3_uc011bkh.1_Silent_p.L315L	p.L432L	NM_001008485	NP_001008485	Q96GZ6	S41A3_HUMAN		GBM - Glioblastoma multiforme(114;0.167)	11	1522	-			432					A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Silent	SNP	ENST00000315891.6	37	c.1296G>A	CCDS33843.1																																																																																				0.547	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370886.1		NM_017836		4	46	0	0	0	0.014758	0	4	46		
DNAJC13	23317	broad.mit.edu	37	3	132166277	132166277	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr3:132166277C>T	ENST00000260818.6	+	4	505	c.257C>T	c.(256-258)tCt>tTt	p.S86F	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	86					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						TTAAAATTTTCTACAGAGCAC	0.353																																						uc003eor.2		NaN																	0				ovary(1)|breast(1)	2						c.(256-258)TCT>TTT		DnaJ (Hsp40) homolog, subfamily C, member 13							42.0	47.0	45.0					3																	132166277		2203	4300	6503	SO:0001583	missense	23317						heat shock protein binding	g.chr3:132166277C>T	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.257C>T	3.37:g.132166277C>T	ENSP00000260818:p.Ser86Phe					DNAJC13_uc010htq.1_Missense_Mutation_p.S86F	p.S86F	NM_015268	NP_056083	O75165	DJC13_HUMAN			4	322	+			86					Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	ENST00000260818.6	37	c.257C>T	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.938417	0.92526	.	.	ENSG00000138246	ENST00000260818	T	0.23552	1.9	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.58680	0.2139	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	1.0;0.99	D;D	0.76071	0.987;0.974	T	0.63319	-0.6664	10	0.87932	D	0	.	20.0018	0.97417	0.0:1.0:0.0:0.0	.	86;86	A7E2Y5;O75165	.;DJC13_HUMAN	F	86	ENSP00000260818:S86F	ENSP00000260818:S86F	S	+	2	0	DNAJC13	133648967	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.783000	0.68982	2.793000	0.96121	0.655000	0.94253	TCT		0.353	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2		NM_015268		5	83	0	0	0	0.021553	0	5	83		
CHST2	9435	broad.mit.edu	37	3	142840871	142840871	+	Missense_Mutation	SNP	A	A	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr3:142840871A>G	ENST00000309575.3	+	2	2597	c.1213A>G	c.(1213-1215)Acg>Gcg	p.T405A		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	405					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						TATGGCTAAGACGCTGCAGAC	0.652																																						uc003evm.2		NaN																	0				ovary(3)	3						c.(1213-1215)ACG>GCG		carbohydrate (N-acetylglucosamine-6-O)							43.0	52.0	49.0					3																	142840871		2202	4299	6501	SO:0001583	missense	9435				inflammatory response|multicellular organismal development|N-acetylglucosamine metabolic process|sulfur compound metabolic process	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity	g.chr3:142840871A>G	BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.1213A>G	3.37:g.142840871A>G	ENSP00000307911:p.Thr405Ala						p.T405A	NM_004267	NP_004258	Q9Y4C5	CHST2_HUMAN			2	2102	+			405			Lumenal (Potential).		D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Missense_Mutation	SNP	ENST00000309575.3	37	c.1213A>G	CCDS3129.1	.	.	.	.	.	.	.	.	.	.	A	15.36	2.811634	0.50527	.	.	ENSG00000175040	ENST00000309575	D	0.82167	-1.58	4.33	4.33	0.51752	Sulfotransferase domain (1);	0.063063	0.64402	D	0.000007	D	0.82641	0.5081	L	0.61218	1.895	0.51482	D	0.999922	P	0.43169	0.8	P	0.46718	0.525	T	0.79546	-0.1759	10	0.15952	T	0.53	-15.434	13.6608	0.62366	1.0:0.0:0.0:0.0	.	405	Q9Y4C5	CHST2_HUMAN	A	405	ENSP00000307911:T405A	ENSP00000307911:T405A	T	+	1	0	CHST2	144323561	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	6.950000	0.75977	1.812000	0.52913	0.334000	0.21626	ACG		0.652	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1		NM_004267		4	63	0	0	0	0.009096	0	4	63		
LAMP3	27074	broad.mit.edu	37	3	182853541	182853541	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr3:182853541G>C	ENST00000265598.3	-	5	1336	c.1081C>G	c.(1081-1083)Caa>Gaa	p.Q361E	LAMP3_ENST00000466939.1_Missense_Mutation_p.Q337E	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	361					cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			TCAAAGGCTTGAAGTTGGACA	0.478																																						uc003flh.3		NaN																	0				ovary(2)|central_nervous_system(1)	3						c.(1081-1083)CAA>GAA		lysosomal-associated membrane protein 3							200.0	192.0	194.0					3																	182853541		2203	4300	6503	SO:0001583	missense	27074				cell proliferation	integral to membrane|lysosomal membrane		g.chr3:182853541G>C	AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.1081C>G	3.37:g.182853541G>C	ENSP00000265598:p.Gln361Glu						p.Q361E	NM_014398	NP_055213	Q9UQV4	LAMP3_HUMAN	all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)		5	1305	-	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		361			Lumenal (Potential).		D3DNS4|O94781|Q8NEC8	Missense_Mutation	SNP	ENST00000265598.3	37	c.1081C>G	CCDS3242.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083475	0.76642	.	.	ENSG00000078081	ENST00000265598;ENST00000466939	T;T	0.41065	1.01;1.01	5.47	5.47	0.80525	.	0.000000	0.53938	D	0.000052	T	0.59142	0.2172	M	0.80183	2.485	0.37257	D	0.906811	D	0.54964	0.969	P	0.53266	0.722	T	0.69610	-0.5099	10	0.87932	D	0	-10.6702	15.1852	0.72996	0.0:0.0:1.0:0.0	.	361	Q9UQV4	LAMP3_HUMAN	E	361;337	ENSP00000265598:Q361E;ENSP00000418912:Q337E	ENSP00000265598:Q361E	Q	-	1	0	LAMP3	184336235	1.000000	0.71417	0.996000	0.52242	0.873000	0.50193	5.513000	0.67037	2.723000	0.93209	0.655000	0.94253	CAA		0.478	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350863.1				26	297	0	0	0	0.021523	0	26	297		
HRG	3273	broad.mit.edu	37	3	186383944	186383944	+	Nonsense_Mutation	SNP	C	C	T	rs146244921		TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr3:186383944C>T	ENST00000232003.4	+	1	204	c.124C>T	c.(124-126)Cga>Tga	p.R42*	RP11-134F2.2_ENST00000428501.1_RNA|HRG_ENST00000468154.1_3'UTR|RP11-134F2.2_ENST00000455926.1_RNA	NM_000412.2	NP_000403.1	P04196	HRG_HUMAN	histidine-rich glycoprotein	42	Cystatin 1.|Interaction with ATP5A1.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|defense response to fungus (GO:0050832)|fibrinolysis (GO:0042730)|heme export (GO:0097037)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel remodeling (GO:2000504)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of immune response to tumor cell (GO:0002839)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet activation (GO:0010543)|regulation of protein complex assembly (GO:0043254)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|response to organic cyclic compound (GO:0014070)	blood microparticle (GO:0072562)|endolysosome (GO:0036019)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|phagolysosome membrane (GO:0061474)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heme binding (GO:0020037)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|immunoglobulin binding (GO:0019865)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(12)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0683)		CAATAAAAGGCGACGGGATGG	0.512													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18807	0.0		0.0	False		,,,				2504	0.0					uc003fqq.2		NaN																	0				ovary(1)|central_nervous_system(1)	2						c.(124-126)CGA>TGA		histidine-rich glycoprotein precursor							138.0	132.0	134.0					3																	186383944		2203	4300	6503	SO:0001587	stop_gained	3273				fibrinolysis|platelet activation|platelet degranulation	extracellular region|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding	g.chr3:186383944C>T		CCDS3280.1	3q27	2008-07-18			ENSG00000113905	ENSG00000113905			5181	protein-coding gene	gene with protein product	"""histidine-proline rich glycoprotein"", ""thrombophilia due to elevated HRG"""	142640				1678514	Standard	NM_000412		Approved	HRGP, HPRG	uc003fqq.3	P04196	OTTHUMG00000156578	ENST00000232003.4:c.124C>T	3.37:g.186383944C>T	ENSP00000232003:p.Arg42*						p.R42*	NM_000412	NP_000403	P04196	HRG_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0683)	1	147	+	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		42			Cystatin 1.|Interaction with ATP5A1.		B9EK35|D3DNU7	Nonsense_Mutation	SNP	ENST00000232003.4	37	c.124C>T	CCDS3280.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	33	5.258004	0.95368	.	.	ENSG00000113905	ENST00000232003	.	.	.	5.5	5.5	0.81552	.	0.000000	0.43747	D	0.000534	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.5063	15.2638	0.73646	0.0:1.0:0.0:0.0	.	.	.	.	X	42	.	ENSP00000232003:R42X	R	+	1	2	HRG	187866638	0.474000	0.25886	0.716000	0.30569	0.860000	0.49131	1.147000	0.31602	2.757000	0.94681	0.655000	0.94253	CGA		0.512	HRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344655.1		NM_000412		9	82	0	0	0	0.004482	0	9	82		
TNK2	10188	broad.mit.edu	37	3	195593873	195593873	+	Silent	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr3:195593873G>A	ENST00000333602.6	-	14	3614	c.2997C>T	c.(2995-2997)ttC>ttT	p.F999F	TNK2_ENST00000381916.2_Silent_p.F1047F|TNK2_ENST00000428187.1_Silent_p.F1001F|TNK2_ENST00000392400.1_Silent_p.F999F	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	999				Missing (in Ref. 4; AAH08884). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	GACCCAGCCCGAAGAGCTGCT	0.697																																						uc003fvu.1		NaN																	0				ovary(3)|central_nervous_system(3)|lung(2)|stomach(1)|skin(1)	10						c.(2995-2997)TTC>TTT		tyrosine kinase, non-receptor, 2 isoform 1	Adenosine triphosphate(DB00171)						27.0	31.0	30.0					3																	195593873		2201	4300	6501	SO:0001819	synonymous_variant	10188				positive regulation of peptidyl-tyrosine phosphorylation|protein ubiquitination|small GTPase mediated signal transduction	adherens junction|cytoplasmic vesicle membrane|endosome|nucleus	ATP binding|GTPase inhibitor activity|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr3:195593873G>A	L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.2997C>T	3.37:g.195593873G>A						TNK2_uc003fvq.1_Silent_p.F408F|TNK2_uc003fvr.1_Silent_p.F526F|TNK2_uc003fvs.1_Silent_p.F1001F|TNK2_uc003fvt.1_Silent_p.F1047F	p.F999F	NM_005781	NP_005772	Q07912	ACK1_HUMAN	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	14	3540	-	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	999	Missing (in Ref. 4; AAH08884).				Q6ZMQ0|Q8N6U7|Q96H59	Silent	SNP	ENST00000333602.6	37	c.2997C>T	CCDS33928.1																																																																																				0.697	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341437.3		NM_005781		3	21	0	0	0	0.009096	0	3	21		
IQCG	84223	broad.mit.edu	37	3	197665561	197665561	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr3:197665561C>T	ENST00000265239.6	-	5	797	c.373G>A	c.(373-375)Gag>Aag	p.E125K	IQCG_ENST00000455191.1_Missense_Mutation_p.E125K|IQCG_ENST00000480302.1_5'UTR|IQCG_ENST00000453254.1_Missense_Mutation_p.E125K	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G	125						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		GGTCCTTCCTCAGTTATTAAC	0.413																																						uc003fyo.2		NaN																	0					0						c.(373-375)GAG>AAG		IQ motif containing G							254.0	265.0	262.0					3																	197665561		2203	4300	6503	SO:0001583	missense	84223							g.chr3:197665561C>T	AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.373G>A	3.37:g.197665561C>T	ENSP00000265239:p.Glu125Lys					IQCG_uc003fyn.2_Missense_Mutation_p.E27K|IQCG_uc003fyp.2_Missense_Mutation_p.E125K|IQCG_uc003fyq.3_Missense_Mutation_p.E125K	p.E125K	NM_001134435	NP_001127907	Q9H095	IQCG_HUMAN	Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)	4	519	-	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		125					Q9BST2|Q9HAG8	Missense_Mutation	SNP	ENST00000265239.6	37	c.373G>A	CCDS3331.1	.	.	.	.	.	.	.	.	.	.	C	1.253	-0.618031	0.03663	.	.	ENSG00000114473	ENST00000265239;ENST00000455191;ENST00000453254;ENST00000416896	T;T;T;T	0.48201	1.03;1.03;0.82;1.04	5.36	-1.46	0.08800	.	1.932190	0.03214	N	0.176544	T	0.11196	0.0273	N	0.00188	-1.89	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43798	-0.9369	10	0.02654	T	1	-0.7117	4.378	0.11279	0.0:0.2736:0.3319:0.3945	.	125;125	C9JKX8;Q9H095	.;IQCG_HUMAN	K	125;125;125;106	ENSP00000265239:E125K;ENSP00000407736:E125K;ENSP00000389897:E125K;ENSP00000406411:E106K	ENSP00000265239:E125K	E	-	1	0	IQCG	199149958	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.017000	0.12590	0.102000	0.17638	-1.454000	0.01032	GAG		0.413	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339730.1		NM_032263		33	497	0	0	0	0.019004	0	33	497		
DGKQ	1609	broad.mit.edu	37	4	954890	954890	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr4:954890C>T	ENST00000273814.3	-	22	2747	c.2674G>A	c.(2674-2676)Gag>Aag	p.E892K	DGKQ_ENST00000502309.1_5'Flank	NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa	892					blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to ATP (GO:0033198)|thrombin receptor signaling pathway (GO:0070493)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|phospholipase binding (GO:0043274)			breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			ACCCAGGGCTCCCCGTCCACC	0.692																																					Esophageal Squamous(17;537 645 4447 26373)	uc003gbw.2		NaN																	0				kidney(1)	1						c.(2674-2676)GAG>AAG		diacylglycerol kinase, theta							33.0	40.0	37.0					4																	954890		2203	4298	6501	SO:0001583	missense	1609				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|platelet activation|protein kinase C signaling cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to ATP|thrombin receptor signaling pathway	cytoskeleton|cytosol|nuclear speck|plasma membrane	activating transcription factor binding|ATP binding|diacylglycerol kinase activity|kinase binding|metal ion binding|phospholipase binding	g.chr4:954890C>T	L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214			2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4		8617502, 9099683	Standard	NM_001347		Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.2674G>A	4.37:g.954890C>T	ENSP00000273814:p.Glu892Lys					DGKQ_uc010ibn.2_Missense_Mutation_p.E879K	p.E892K	NM_001347	NP_001338	P52824	DGKQ_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0158)		22	2748	-			892					Q6P3W4	Missense_Mutation	SNP	ENST00000273814.3	37	c.2674G>A	CCDS3342.1	.	.	.	.	.	.	.	.	.	.	C	36	5.815785	0.96982	.	.	ENSG00000145214	ENST00000273814;ENST00000515182	T;T	0.63255	-0.03;-0.03	5.45	5.45	0.79879	Diacylglycerol kinase, accessory domain (2);	0.046622	0.85682	D	0.000000	D	0.86297	0.5899	H	0.96691	3.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.90736	0.4646	10	0.87932	D	0	.	16.7531	0.85492	0.0:1.0:0.0:0.0	.	892;892	E9KL49;P52824	.;DGKQ_HUMAN	K	892;107	ENSP00000273814:E892K;ENSP00000421756:E107K	ENSP00000273814:E892K	E	-	1	0	DGKQ	944890	1.000000	0.71417	0.971000	0.41717	0.988000	0.76386	5.722000	0.68485	2.561000	0.86390	0.556000	0.70494	GAG		0.692	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000200888.1				4	28	0	0	0	0.009096	0	4	28		
TBC1D1	23216	broad.mit.edu	37	4	37903928	37903928	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr4:37903928C>T	ENST00000261439.4	+	2	567	c.212C>T	c.(211-213)tCt>tTt	p.S71F	TBC1D1_ENST00000508802.1_Missense_Mutation_p.S71F|TBC1D1_ENST00000402522.1_Missense_Mutation_p.S71F	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	71					membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						GTTTCACCCTCTGGACTGAGA	0.547																																						uc003gtb.2		NaN																	0				ovary(1)	1						c.(211-213)TCT>TTT		TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							165.0	138.0	147.0					4																	37903928		2203	4300	6503	SO:0001583	missense	23216					nucleus	Rab GTPase activator activity	g.chr4:37903928C>T	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.212C>T	4.37:g.37903928C>T	ENSP00000261439:p.Ser71Phe					TBC1D1_uc011byd.1_Missense_Mutation_p.S71F|TBC1D1_uc010ifd.2_Missense_Mutation_p.S71F	p.S71F	NM_015173	NP_055988	Q86TI0	TBCD1_HUMAN			2	555	+			71					B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Missense_Mutation	SNP	ENST00000261439.4	37	c.212C>T	CCDS33972.1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.781530	0.70222	.	.	ENSG00000065882	ENST00000508802;ENST00000261439;ENST00000402522	T;T;T	0.15603	2.41;2.41;2.41	6.07	5.23	0.72850	Phosphotyrosine interaction domain (1);Pleckstrin homology-type (1);	0.143965	0.32624	N	0.005854	T	0.22399	0.0540	L	0.34521	1.04	0.42587	D	0.993235	D;P	0.54397	0.966;0.774	P;P	0.50440	0.641;0.62	T	0.01512	-1.1336	10	0.87932	D	0	-21.3083	15.1714	0.72875	0.0:0.9319:0.0:0.0681	.	71;71	E9PGH8;Q86TI0	.;TBCD1_HUMAN	F	71	ENSP00000423651:S71F;ENSP00000261439:S71F;ENSP00000383994:S71F	ENSP00000261439:S71F	S	+	2	0	TBC1D1	37580323	0.901000	0.30685	0.919000	0.36401	0.580000	0.36256	2.941000	0.49011	1.585000	0.49928	0.585000	0.79938	TCT		0.547	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2		NM_015173		6	168	0	0	0	0.001984	0	6	168		
LRRC66	339977	broad.mit.edu	37	4	52860928	52860928	+	Missense_Mutation	SNP	C	C	T	rs76998469		TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr4:52860928C>T	ENST00000343457.3	-	4	2266	c.2260G>A	c.(2260-2262)Gag>Aag	p.E754K		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	754						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						ACATTTTCCTCAAGACTGTCT	0.483																																						uc003gzi.2		NaN																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2260-2262)GAG>AAG		leucine rich repeat containing 66							122.0	119.0	120.0					4																	52860928		1950	4166	6116	SO:0001583	missense	339977					integral to membrane		g.chr4:52860928C>T	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.2260G>A	4.37:g.52860928C>T	ENSP00000341944:p.Glu754Lys						p.E754K	NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN			4	2273	-			754						Missense_Mutation	SNP	ENST00000343457.3	37	c.2260G>A	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	C	10.53	1.376334	0.24857	.	.	ENSG00000188993	ENST00000343457	T	0.55413	0.52	4.27	0.525	0.17072	.	0.704826	0.12888	N	0.430878	T	0.29256	0.0728	N	0.17082	0.46	0.09310	N	1	B	0.25235	0.121	B	0.19148	0.024	T	0.12708	-1.0537	10	0.33940	T	0.23	-2.8514	4.0712	0.09882	0.0:0.5268:0.174:0.2993	.	754	Q68CR7	LRC66_HUMAN	K	754	ENSP00000341944:E754K	ENSP00000341944:E754K	E	-	1	0	LRRC66	52555685	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.004000	0.13106	-0.043000	0.13513	-0.768000	0.03414	GAG		0.483	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1		NM_001024611		7	120	0	0	0	0.00308	0	7	120		
KDR	3791	broad.mit.edu	37	4	55961744	55961744	+	Splice_Site	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr4:55961744C>T	ENST00000263923.4	-	20	3112	c.2817G>A	c.(2815-2817)aaG>aaA	p.K939K		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	939	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GATGACATACCTTGTAGGGGA	0.413			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																												uc003has.2		NaN		Dom	yes		4	4q11-q12	3791	Mis	vascular endothelial growth factor receptor 2			E			NSCLC|angiosarcoma		0				lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33						c.(2815-2817)AAG>AAA		kinase insert domain receptor precursor	Sorafenib(DB00398)|Sunitinib(DB01268)						118.0	117.0	117.0					4																	55961744		2203	4300	6503	SO:0001630	splice_region_variant	3791	Familial_Infantile_Hemangioma			angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity	g.chr4:55961744C>T	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.2817+1G>A	4.37:g.55961744C>T		TSP Lung(20;0.16)				KDR_uc003hat.1_Silent_p.K939K	p.K939K	NM_002253	NP_002244	P35968	VGFR2_HUMAN	Epithelial(7;0.189)		20	3119	-	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		939			Protein kinase.|Cytoplasmic (Potential).		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Silent	SNP	ENST00000263923.4	37	c.2817G>A	CCDS3497.1																																																																																				0.413	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1			Silent	8	99	0	0	0	0.004482	0	8	99		
FRAS1	80144	broad.mit.edu	37	4	79294005	79294005	+	Silent	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr4:79294005C>G	ENST00000325942.6	+	24	3443	c.3003C>G	c.(3001-3003)ctC>ctG	p.L1001L	FRAS1_ENST00000264895.6_Silent_p.L1001L	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1001					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						ACTCGGGCCTCTGCAAGAGTA	0.537																																						uc003hlb.2		NaN																	0				large_intestine(5)	5						c.(3001-3003)CTC>CTG		Fraser syndrome 1							104.0	104.0	104.0					4																	79294005		1966	4160	6126	SO:0001819	synonymous_variant	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79294005C>G	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.3003C>G	4.37:g.79294005C>G						FRAS1_uc003hkw.2_Silent_p.L1001L	p.L1001L	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN			24	3443	+			1001			FU 13.|Extracellular (Potential).		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000325942.6	37	c.3003C>G	CCDS54772.1																																																																																				0.537	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2				8	86	0	0	0	0.006214	0	8	86		
SMARCAD1	56916	broad.mit.edu	37	4	95129666	95129666	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr4:95129666G>A	ENST00000354268.4	+	2	194	c.121G>A	c.(121-123)Gaa>Aaa	p.E41K	SMARCAD1_ENST00000457823.2_Missense_Mutation_p.E41K|RP11-363G15.2_ENST00000501965.2_lincRNA			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	41					ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		TCTTAGTGCTGAAGAGGAGAA	0.438																																						uc003htc.3		NaN																	0				skin(2)|ovary(1)|breast(1)	4						c.(121-123)GAA>AAA		SWI/SNF-related, matrix-associated							85.0	88.0	87.0					4																	95129666		2203	4300	6503	SO:0001583	missense	56916				chromatin modification|nucleotide metabolic process|positive regulation of transcription, DNA-dependent|protein homooligomerization|regulation of DNA recombination	nuclear matrix	ATP binding|DNA binding|helicase activity	g.chr4:95129666G>A	AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.121G>A	4.37:g.95129666G>A	ENSP00000346217:p.Glu41Lys					SMARCAD1_uc003htb.3_Missense_Mutation_p.E41K|SMARCAD1_uc003htd.3_Missense_Mutation_p.E41K|SMARCAD1_uc010ila.2_5'UTR	p.E41K	NM_020159	NP_064544	Q9H4L7	SMRCD_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)	2	376	+			41					B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Missense_Mutation	SNP	ENST00000354268.4	37	c.121G>A	CCDS3639.1	.	.	.	.	.	.	.	.	.	.	G	17.20	3.329949	0.60743	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000536267;ENST00000354268	T;T;T	0.05649	3.41;3.41;3.41	5.58	5.58	0.84498	.	0.000000	0.34088	N	0.004273	T	0.12135	0.0295	N	0.19112	0.55	0.80722	D	1	P;D	0.56035	0.956;0.974	P;D	0.67725	0.899;0.953	T	0.36648	-0.9739	10	0.23302	T	0.38	-22.4835	15.0826	0.72127	0.0:0.0:1.0:0.0	.	41;41	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	K	41	ENSP00000351947:E41K;ENSP00000415576:E41K;ENSP00000346217:E41K	ENSP00000346217:E41K	E	+	1	0	SMARCAD1	95348689	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.930000	0.63462	2.624000	0.88883	0.655000	0.94253	GAA		0.438	SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253583.1		NM_020159		7	127	0	0	0	0.006214	0	7	127		
KIAA1109	84162	broad.mit.edu	37	4	123166210	123166210	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr4:123166210G>A	ENST00000264501.4	+	32	5325	c.4952G>A	c.(4951-4953)cGa>cAa	p.R1651Q	KIAA1109_ENST00000388738.3_Missense_Mutation_p.R1651Q|KIAA1109_ENST00000455637.1_Missense_Mutation_p.R1651Q			Q2LD37	K1109_HUMAN	KIAA1109	1651					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						GCTAGTACCCGACATCCAGCT	0.343																																						uc003ieh.2		NaN																	0				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(4951-4953)CGA>CAA		fragile site-associated protein							145.0	136.0	139.0					4																	123166210		1864	4105	5969	SO:0001583	missense	84162				regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus		g.chr4:123166210G>A	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.4952G>A	4.37:g.123166210G>A	ENSP00000264501:p.Arg1651Gln					KIAA1109_uc003iek.2_Missense_Mutation_p.R270Q	p.R1651Q	NM_015312	NP_056127	Q2LD37	K1109_HUMAN			30	4997	+			1651					Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	c.4952G>A	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.6|20.6	4.024639|4.024639	0.75390|0.75390	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000446180|ENST00000264501;ENST00000388738;ENST00000455637	.|T;T;T	.|0.22945	.|2.52;2.52;1.93	5.75|5.75	4.03|4.03	0.46877|0.46877	.|.	.|0.175671	.|0.23928	.|N	.|0.043166	T|T	0.18299|0.18299	0.0439|0.0439	N|N	0.24115|0.24115	0.695|0.695	0.39508|0.39508	D|D	0.968315|0.968315	.|B;B	.|0.18461	.|0.028;0.016	.|B;B	.|0.10450	.|0.005;0.003	T|T	0.03503|0.03503	-1.1030|-1.1030	5|10	.|0.48119	.|T	.|0.1	.|.	12.3131|12.3131	0.54940|0.54940	0.1366:0.0:0.8634:0.0|0.1366:0.0:0.8634:0.0	.|.	.|1650;1651	.|Q2LD37-2;Q2LD37	.|.;K1109_HUMAN	N|Q	224|1651	.|ENSP00000264501:R1651Q;ENSP00000373390:R1651Q;ENSP00000389925:R1651Q	.|ENSP00000264501:R1651Q	D|R	+|+	1|2	0|0	KIAA1109|KIAA1109	123385660|123385660	0.989000|0.989000	0.36119|0.36119	0.993000|0.993000	0.49108|0.49108	0.999000|0.999000	0.98932|0.98932	3.602000|3.602000	0.54066|0.54066	0.769000|0.769000	0.33313|0.33313	0.655000|0.655000	0.94253|0.94253	GAC|CGA		0.343	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1		NM_020797		8	192	0	0	0	0.00308	0	8	192		
ARHGAP10	79658	broad.mit.edu	37	4	148743974	148743974	+	Splice_Site	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr4:148743974G>A	ENST00000336498.3	+	2	489		c.e2+1			NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10						establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		CGATGCATAGGTAATTAAACA	0.393																																						uc003ilf.2		NaN																	0				skin(2)|pancreas(1)|lung(1)	4						c.e2+1		Rho GTPase activating protein 10							175.0	163.0	167.0					4																	148743974		2203	4300	6503	SO:0001630	splice_region_variant	79658				apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding	g.chr4:148743974G>A	BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.250+1G>A	4.37:g.148743974G>A						ARHGAP10_uc003ile.1_Splice_Site_p.D84_splice	p.D84_splice	NM_024605	NP_078881	A1A4S6	RHG10_HUMAN		GBM - Glioblastoma multiforme(119;0.0423)	2	250	+	all_hematologic(180;0.151)	Renal(17;0.0166)						Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Splice_Site	SNP	ENST00000336498.3	37	c.250_splice	CCDS34075.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.636422	0.47049	.	.	ENSG00000071205	ENST00000336498	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3732	0.98896	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGAP10	148963424	1.000000	0.71417	0.998000	0.56505	0.129000	0.20672	8.421000	0.90259	2.809000	0.96659	0.650000	0.86243	.		0.393	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365005.1		NM_024605	Intron	4	152	0	0	0	0.009096	0	4	152		
DCLK2	166614	broad.mit.edu	37	4	151023764	151023764	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr4:151023764G>A	ENST00000296550.7	+	2	1310	c.556G>A	c.(556-558)Gaa>Aaa	p.E186K	DCLK2_ENST00000302176.8_Missense_Mutation_p.E186K|DCLK2_ENST00000506325.1_Missense_Mutation_p.E186K	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	186					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					TGTGAAAAGTGAAGTAAAAGA	0.428																																					GBM(195;186 2215 13375 16801 37459)	uc003ilm.3		NaN																	0				ovary(3)	3						c.(556-558)GAA>AAA		doublecortin-like kinase 2 isoform a							58.0	60.0	60.0					4																	151023764		2203	4300	6503	SO:0001583	missense	166614				intracellular signal transduction	cytoplasm|cytoskeleton	ATP binding|protein serine/threonine kinase activity	g.chr4:151023764G>A	BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.556G>A	4.37:g.151023764G>A	ENSP00000296550:p.Glu186Lys					DCLK2_uc003iln.3_Missense_Mutation_p.E186K|DCLK2_uc003ilo.3_Missense_Mutation_p.E186K|DCLK2_uc003ilp.3_RNA	p.E186K	NM_001040260	NP_001035350	Q8N568	DCLK2_HUMAN			2	656	+	all_hematologic(180;0.151)		186					C9J5Q9|Q59GC8|Q8N399	Missense_Mutation	SNP	ENST00000296550.7	37	c.556G>A	CCDS34076.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.039157	0.75617	.	.	ENSG00000170390	ENST00000296550;ENST00000506325;ENST00000302176	D;D;D	0.93247	-3.19;-3.19;-3.19	5.16	3.4	0.38934	.	0.000000	0.85682	D	0.000000	D	0.93177	0.7827	M	0.85710	2.77	0.54753	D	0.99998	B;P;B	0.35139	0.312;0.486;0.128	B;B;B	0.38225	0.185;0.268;0.101	D	0.91438	0.5171	10	0.28530	T	0.3	.	12.5337	0.56131	0.1443:0.0:0.8557:0.0	.	186;186;186	Q8N568-3;Q8N568-2;Q8N568	.;.;DCLK2_HUMAN	K	186	ENSP00000296550:E186K;ENSP00000427235:E186K;ENSP00000303887:E186K	ENSP00000296550:E186K	E	+	1	0	DCLK2	151243214	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.858000	0.86971	1.325000	0.45301	0.557000	0.71058	GAA		0.428	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364952.1		NM_001040260		10	53	0	0	0	0.008291	0	10	53		
F2R	2149	broad.mit.edu	37	5	76028929	76028929	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr5:76028929C>G	ENST00000319211.4	+	2	1144	c.879C>G	c.(877-879)atC>atG	p.I293M		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	293					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)	p.I293I(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	ATGTGTCTATCATTCGATGTC	0.483																																						uc003ken.3		NaN																	1	Substitution - coding silent(1)	p.I293I(1)	ovary(1)	ovary(3)	3						c.(877-879)ATC>ATG		coagulation factor II receptor precursor	Streptokinase(DB00086)						153.0	153.0	153.0					5																	76028929		2203	4300	6503	SO:0001583	missense	2149				activation of caspase activity|anatomical structure morphogenesis|connective tissue replacement involved in inflammatory response wound healing|negative regulation of cell proliferation|platelet activation|positive regulation of blood coagulation|positive regulation of cell migration|positive regulation of collagen biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of JAK-STAT cascade|positive regulation of MAPKKK cascade|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of transcription, DNA-dependent|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	caveola|extracellular region|Golgi apparatus|integral to plasma membrane|platelet dense tubular network	receptor binding|thrombin receptor activity	g.chr5:76028929C>G	M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.879C>G	5.37:g.76028929C>G	ENSP00000321326:p.Ile293Met						p.I293M	NM_001992	NP_001983	P25116	PAR1_HUMAN		all cancers(79;4.43e-43)	2	1144	+		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)	293			Cytoplasmic (Potential).		Q53XV0|Q96RF7|Q9BUN4	Missense_Mutation	SNP	ENST00000319211.4	37	c.879C>G	CCDS4032.1	.	.	.	.	.	.	.	.	.	.	C	13.70	2.315709	0.40996	.	.	ENSG00000181104	ENST00000319211	T	0.55930	0.49	4.71	3.84	0.44239	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.62612	0.2442	L	0.54863	1.705	0.80722	D	1	D	0.69078	0.997	D	0.72075	0.976	T	0.58668	-0.7596	10	0.11794	T	0.64	-43.4117	13.1064	0.59249	0.0:0.9224:0.0:0.0776	.	293	P25116	PAR1_HUMAN	M	293	ENSP00000321326:I293M	ENSP00000321326:I293M	I	+	3	3	F2R	76064685	1.000000	0.71417	0.991000	0.47740	0.974000	0.67602	1.165000	0.31822	1.341000	0.45600	0.561000	0.74099	ATC		0.483	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254068.2				8	137	0	0	0	0.00308	0	8	137		
FAT2	2196	broad.mit.edu	37	5	150920280	150920280	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr5:150920280C>G	ENST00000261800.5	-	10	8899	c.8887G>C	c.(8887-8889)Gag>Cag	p.E2963Q		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2963	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATCCTCCACTCATCTCCAACT	0.527																																						uc003lue.3		NaN																	0				ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6						c.(8887-8889)GAG>CAG		FAT tumor suppressor 2 precursor							89.0	77.0	81.0					5																	150920280		2203	4300	6503	SO:0001583	missense	2196				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding	g.chr5:150920280C>G	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.8887G>C	5.37:g.150920280C>G	ENSP00000261800:p.Glu2963Gln					GM2A_uc011dcs.1_Intron	p.E2963Q	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		10	8900	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	2963			Extracellular (Potential).|Cadherin 26.		O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	c.8887G>C	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239748	0.58995	.	.	ENSG00000086570	ENST00000261800	T	0.53423	0.62	5.26	4.38	0.52667	Cadherin (4);Cadherin-like (1);	0.204143	0.33732	N	0.004606	T	0.45935	0.1367	L	0.60012	1.86	0.42711	D	0.993647	P	0.41232	0.743	B	0.41510	0.359	T	0.42344	-0.9457	10	0.31617	T	0.26	.	13.2537	0.60066	0.0:0.9237:0.0:0.0763	.	2963	Q9NYQ8	FAT2_HUMAN	Q	2963	ENSP00000261800:E2963Q	ENSP00000261800:E2963Q	E	-	1	0	FAT2	150900473	0.943000	0.32029	0.997000	0.53966	0.984000	0.73092	1.926000	0.40084	2.471000	0.83476	0.563000	0.77884	GAG		0.527	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1		NM_001447		4	69	0	0	0	0.009096	0	4	69		
BNIP1	662	broad.mit.edu	37	5	172571562	172571562	+	Missense_Mutation	SNP	A	A	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr5:172571562A>C	ENST00000351486.5	+	1	45	c.14A>C	c.(13-15)cAa>cCa	p.Q5P	BNIP1_ENST00000393770.4_Missense_Mutation_p.Q5P|BNIP1_ENST00000352523.6_Missense_Mutation_p.Q5P|BNIP1_ENST00000231668.9_Missense_Mutation_p.Q5P|CTC-209H22.3_ENST00000521251.1_RNA	NM_001205.2	NP_001196.2	Q12981	SEC20_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 1	5					apoptotic process (GO:0006915)|autophagy (GO:0006914)|endoplasmic reticulum membrane fusion (GO:0016320)|endoplasmic reticulum organization (GO:0007029)|execution phase of apoptosis (GO:0097194)|negative regulation of apoptotic process (GO:0043066)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|skin(1)	11	Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GCGGCTCCCCAAGACGTCCAC	0.607											OREG0017054	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc003mcj.3		NaN																	0				ovary(1)	1						c.(13-15)CAA>CCA		BCL2/adenovirus E1B 19kD interacting protein 1							39.0	40.0	40.0					5																	172571562		2203	4300	6503	SO:0001583	missense	662				anti-apoptosis|apoptosis|endoplasmic reticulum membrane fusion|endoplasmic reticulum organization|induction of apoptosis|vesicle-mediated transport	integral to endoplasmic reticulum membrane|nuclear envelope|SNARE complex	protein binding	g.chr5:172571562A>C	AF083957	CCDS4384.1, CCDS4385.1, CCDS4386.1, CCDS43400.1	5q33-q34	2008-02-05	2002-08-29		ENSG00000113734	ENSG00000113734			1082	protein-coding gene	gene with protein product		603291	"""BCL2/adenovirus E1B 19kD-interacting protein 1"""			7954800, 15272311	Standard	NM_013979		Approved	Nip1, SEC20	uc003mcj.4	Q12981	OTTHUMG00000130521	ENST00000351486.5:c.14A>C	5.37:g.172571562A>C	ENSP00000239215:p.Gln5Pro		OREG0017054	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1901	BNIP1_uc003mci.3_Missense_Mutation_p.Q5P|BNIP1_uc003mck.3_Missense_Mutation_p.Q5P|BNIP1_uc003mcl.3_Missense_Mutation_p.Q5P	p.Q5P	NM_001205	NP_001196	Q12981	SEC20_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		1	118	+	Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	5			Cytoplasmic (Potential).		D3DQM3|D3DQM4|D3DQM5|D3DQM6|O75622|O75623|O75624|Q6K044|Q96FG4	Missense_Mutation	SNP	ENST00000351486.5	37	c.14A>C	CCDS4384.1	.	.	.	.	.	.	.	.	.	.	A	17.09	3.300850	0.60195	.	.	ENSG00000113734	ENST00000231668;ENST00000351486;ENST00000352523;ENST00000393770	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.07	2.45	0.29901	.	0.765361	0.12328	N	0.478656	T	0.22936	0.0554	N	0.16478	0.41	0.09310	N	1	B;B;B;B	0.26975	0.0;0.007;0.165;0.003	B;B;B;B	0.17979	0.001;0.005;0.02;0.005	T	0.12604	-1.0541	10	0.37606	T	0.19	.	5.8199	0.18522	0.5708:0.1729:0.0:0.2563	.	5;5;5;5	Q12981-2;Q12981-3;Q12981;Q12981-1	.;.;SEC20_HUMAN;.	P	5	ENSP00000231668:Q5P;ENSP00000239215:Q5P;ENSP00000239214:Q5P;ENSP00000377365:Q5P	ENSP00000231668:Q5P	Q	+	2	0	BNIP1	172504168	0.003000	0.15002	0.966000	0.40874	0.991000	0.79684	0.537000	0.23144	0.920000	0.36970	0.533000	0.62120	CAA		0.607	BNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252939.1		NM_013979		4	12	0	0	0	0.010729	0	4	12		
ZKSCAN3	80317	broad.mit.edu	37	6	28333833	28333833	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr6:28333833G>A	ENST00000377255.3	+	7	1685	c.1388G>A	c.(1387-1389)tGg>tAg	p.W463*	ZKSCAN3_ENST00000341464.5_Nonsense_Mutation_p.W315*|ZKSCAN3_ENST00000252211.2_Nonsense_Mutation_p.W463*	NM_001242894.1	NP_001229823.1	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	463				QGEAWKSRMESQLENVETPMS -> TGRGWKVGWKASWKML KLPCP (in Ref. 6; AAB16813). {ECO:0000305}.	autophagy (GO:0006914)|lysosome organization (GO:0007040)|negative regulation of autophagy (GO:0010507)|negative regulation of cellular senescence (GO:2000773)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(4)|large_intestine(3)|lung(8)|pancreas(1)|skin(2)|stomach(2)|urinary_tract(1)	21						GGAGAGGCCTGGAAAAGTAGG	0.433																																						uc003nle.3		NaN																	0				skin(2)	2						c.(1387-1389)TGG>TAG		zinc finger with KRAB and SCAN domains 3							82.0	85.0	84.0					6																	28333833		2203	4300	6503	SO:0001587	stop_gained	80317				positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	chromatin binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr6:28333833G>A	U71601	CCDS4650.1, CCDS56408.1	6p22.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000189298		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13853	protein-coding gene	gene with protein product		612791	"""zinc finger protein 306"", ""zinc finger protein 309"""	ZNF306, ZNF309		10520746, 22531714	Standard	NM_024493		Approved	Zfp47, ZF47, ZSCAN35	uc003nle.4	Q9BRR0	OTTHUMG00000014521	ENST00000377255.3:c.1388G>A	6.37:g.28333833G>A	ENSP00000366465:p.Trp463*					ZKSCAN3_uc010jrc.2_Nonsense_Mutation_p.W463*|ZKSCAN3_uc003nlf.3_Nonsense_Mutation_p.W315*|uc010jrd.2_5'Flank	p.W463*	NM_024493	NP_077819	Q9BRR0	ZKSC3_HUMAN			6	1604	+			463	QGEAWKSRMESQLENVETPMS -> TGRGWKVGWKASWKML KLPCP (in Ref. 5; AAB16813).				B2R8W2|B3KVC0|H7BXX1|Q5VXH3|Q92972|Q9H4T3	Nonsense_Mutation	SNP	ENST00000377255.3	37	c.1388G>A	CCDS4650.1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.827170	0.32329	.	.	ENSG00000189298	ENST00000252211;ENST00000341464;ENST00000377255	.	.	.	3.97	1.0	0.19881	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	5.4952	0.16799	0.1829:0.0:0.6591:0.158	.	.	.	.	X	463;315;463	.	ENSP00000252211:W463X	W	+	2	0	ZKSCAN3	28441812	0.058000	0.20735	0.251000	0.24312	0.123000	0.20343	2.707000	0.47143	0.353000	0.24079	0.655000	0.94253	TGG		0.433	ZKSCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040189.3		NM_024493		5	60	0	0	0	0.021553	0	5	60		
MDC1	9656	broad.mit.edu	37	6	30670531	30670531	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr6:30670531C>T	ENST00000376406.3	-	13	6636	c.5989G>A	c.(5989-5991)Gag>Aag	p.E1997K	MDC1_ENST00000376405.2_Missense_Mutation_p.E1733K|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1997	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Required for nuclear localization (NLS2).				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						CCTCTCACCTCTAGCAGCCTT	0.512								Other conserved DNA damage response genes																														uc003nrg.3		NaN																	0				breast(2)|ovary(1)|kidney(1)	4						c.(5989-5991)GAG>AAG	Other_conserved_DNA_damage_response_genes	mediator of DNA-damage checkpoint 1							176.0	185.0	182.0					6																	30670531		1511	2709	4220	SO:0001583	missense	9656				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding	g.chr6:30670531C>T	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.5989G>A	6.37:g.30670531C>T	ENSP00000365588:p.Glu1997Lys					MDC1_uc003nrf.3_Missense_Mutation_p.E628K	p.E1997K	NM_014641	NP_055456	Q14676	MDC1_HUMAN			13	6429	-			1997			Required for nuclear localization (NLS2).|BRCT 2.		A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	37	c.5989G>A	CCDS34384.1	.	.	.	.	.	.	.	.	.	.	C	17.53	3.413620	0.62511	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	D;D	0.88664	-2.41;-2.41	5.36	5.36	0.76844	BRCT (2);	0.000000	0.36409	N	0.002614	T	0.82047	0.4952	N	0.13299	0.325	0.42313	D	0.992223	B;P	0.49185	0.439;0.92	B;P	0.52386	0.319;0.697	T	0.82010	-0.0669	10	0.30078	T	0.28	-19.8656	16.6849	0.85302	0.0:1.0:0.0:0.0	.	1997;974	Q14676;Q14676-4	MDC1_HUMAN;.	K	1997;1733;1710;1563	ENSP00000365588:E1997K;ENSP00000365587:E1733K	ENSP00000365587:E1733K	E	-	1	0	MDC1	30778510	0.967000	0.33354	1.000000	0.80357	0.871000	0.50021	1.370000	0.34238	2.800000	0.96347	0.650000	0.86243	GAG		0.512	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1		NM_014641		13	196	0	0	0	0.020292	0	13	196		
VWA7	80737	broad.mit.edu	37	6	31734536	31734536	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr6:31734536G>C	ENST00000375688.4	-	14	2088	c.1888C>G	c.(1888-1890)Cag>Gag	p.Q630E	VWA7_ENST00000375686.3_Missense_Mutation_p.Q630E|VWA7_ENST00000467576.1_5'UTR|VWA7_ENST00000447450.1_Missense_Mutation_p.Q630E|SAPCD1-AS1_ENST00000419679.1_RNA			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	630						extracellular region (GO:0005576)											AGCTGGGTCTGAAGACCTGGG	0.557																																						uc011dog.1		NaN																	0				ovary(3)	3						c.(1888-1890)CAG>GAG		G7c protein precursor							43.0	52.0	49.0					6																	31734536		1476	2689	4165	SO:0001583	missense	80737					extracellular region		g.chr6:31734536G>C		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.1888C>G	6.37:g.31734536G>C	ENSP00000364840:p.Gln630Glu					C6orf27_uc003nxd.2_Missense_Mutation_p.Q305E	p.Q630E	NM_025258	NP_079534	Q9Y334	G7C_HUMAN			14	2126	-			630					A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	ENST00000375688.4	37	c.1888C>G	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	G	0.079	-1.187963	0.01607	.	.	ENSG00000204396	ENST00000375688;ENST00000375686;ENST00000447450	T;T;T	0.27890	2.84;2.62;1.64	5.68	4.81	0.61882	.	0.540002	0.17907	N	0.157978	T	0.07007	0.0178	L	0.32530	0.975	0.24876	N	0.992259	B	0.24721	0.11	B	0.22601	0.04	T	0.30238	-0.9985	10	0.06099	T	0.92	-1.2818	10.4686	0.44622	0.0894:0.0:0.9106:0.0	.	630	Q9Y334	G7C_HUMAN	E	630	ENSP00000364840:Q630E;ENSP00000364838:Q630E;ENSP00000390554:Q630E	ENSP00000364838:Q630E	Q	-	1	0	C6orf27	31842515	0.999000	0.42202	0.907000	0.35723	0.257000	0.26127	5.271000	0.65553	1.401000	0.46761	0.563000	0.77884	CAG		0.557	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2		NM_025258		4	52	0	0	0	0.009096	0	4	52		
VWA7	80737	broad.mit.edu	37	6	31735227	31735227	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr6:31735227G>C	ENST00000375688.4	-	12	1901	c.1701C>G	c.(1699-1701)ttC>ttG	p.F567L	VWA7_ENST00000375686.3_Missense_Mutation_p.F567L|VWA7_ENST00000467576.1_5'UTR|VWA7_ENST00000447450.1_Missense_Mutation_p.F567L|SAPCD1-AS1_ENST00000419679.1_RNA			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	567						extracellular region (GO:0005576)											TCACCATCCAGAACTGCCCAA	0.602																																						uc011dog.1		NaN																	0				ovary(3)	3						c.(1699-1701)TTC>TTG		G7c protein precursor							80.0	84.0	83.0					6																	31735227		1511	2709	4220	SO:0001583	missense	80737					extracellular region		g.chr6:31735227G>C		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.1701C>G	6.37:g.31735227G>C	ENSP00000364840:p.Phe567Leu					C6orf27_uc003nxd.2_Missense_Mutation_p.F242L	p.F567L	NM_025258	NP_079534	Q9Y334	G7C_HUMAN			12	1939	-			567					A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	ENST00000375688.4	37	c.1701C>G	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	G	2.820	-0.245101	0.05906	.	.	ENSG00000204396	ENST00000375688;ENST00000375686;ENST00000447450	T;T;T	0.27104	2.89;2.68;1.69	5.04	2.15	0.27550	.	0.219586	0.40222	N	0.001154	T	0.03564	0.0102	L	0.35288	1.05	0.27240	N	0.959172	B	0.21381	0.055	B	0.15484	0.013	T	0.42275	-0.9461	10	0.02654	T	1	-21.7577	4.4031	0.11397	0.19:0.0:0.632:0.178	.	567	Q9Y334	G7C_HUMAN	L	567	ENSP00000364840:F567L;ENSP00000364838:F567L;ENSP00000390554:F567L	ENSP00000364838:F567L	F	-	3	2	C6orf27	31843206	1.000000	0.71417	1.000000	0.80357	0.757000	0.42996	0.981000	0.29526	0.705000	0.31890	0.561000	0.74099	TTC		0.602	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2		NM_025258		6	108	0	0	0	0.004482	0	6	108		
TCP11	6954	broad.mit.edu	37	6	35088708	35088708	+	Silent	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr6:35088708C>T	ENST00000512012.1	-	5	849	c.693G>A	c.(691-693)caG>caA	p.Q231Q	TCP11_ENST00000373979.2_Silent_p.Q169Q|TCP11_ENST00000418521.2_Silent_p.Q168Q|TCP11_ENST00000444780.2_Silent_p.Q239Q|TCP11_ENST00000311875.5_Silent_p.Q244Q|TCP11_ENST00000244645.3_Silent_p.Q169Q|TCP11_ENST00000412155.2_Silent_p.Q193Q|TCP11_ENST00000373974.4_Silent_p.Q198Q			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific	231					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						TGAGGAGTTCCTGGAATTTAG	0.443																																						uc003okd.2		NaN																	0				ovary(3)|skin(2)	5						c.(730-732)CAG>CAA		t-complex 11 isoform 1							301.0	312.0	308.0					6																	35088708		2203	4300	6503	SO:0001819	synonymous_variant	6954				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane		g.chr6:35088708C>T		CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560	ENST00000512012.1:c.693G>A	6.37:g.35088708C>T						TCP11_uc003ojz.1_Silent_p.Q169Q|TCP11_uc003oka.2_Silent_p.Q169Q|TCP11_uc003okb.2_Silent_p.Q168Q|TCP11_uc003okc.2_Silent_p.Q168Q|TCP11_uc011dsu.1_Silent_p.Q226Q|TCP11_uc011dsv.1_Silent_p.Q193Q|TCP11_uc011dsw.1_Silent_p.Q198Q	p.Q244Q	NM_001093728	NP_001087197	Q8WWU5	TCP11_HUMAN			6	913	-			231					B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	Silent	SNP	ENST00000512012.1	37	c.732G>A		.	.	.	.	.	.	.	.	.	.	C	5.635	0.301830	0.10678	.	.	ENSG00000124678	ENST00000502480	.	.	.	4.32	3.45	0.39498	.	.	.	.	.	T	0.49795	0.1578	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46952	-0.9154	4	.	.	.	-23.1138	10.272	0.43489	0.0:0.8435:0.0:0.1565	.	.	.	.	R	39	.	.	G	-	1	0	TCP11	35196686	1.000000	0.71417	1.000000	0.80357	0.654000	0.38779	3.527000	0.53517	2.401000	0.81631	0.563000	0.77884	GGA		0.443	TCP11-014	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000370354.1		NM_001093728		45	534	0	0	0	0.01441	0	45	534		
ABCC10	89845	broad.mit.edu	37	6	43400436	43400436	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr6:43400436G>A	ENST00000372530.4	+	3	933	c.718G>A	c.(718-720)Gag>Aag	p.E240K	ABCC10_ENST00000244533.3_Missense_Mutation_p.E197K|ABCC10_ENST00000443426.2_Intron	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	240					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	GGCCTGTGGAGAGCTCCGGCA	0.637																																						uc003ouy.1		NaN																	0				ovary(6)|central_nervous_system(1)	7						c.(718-720)GAG>AAG		ATP-binding cassette, sub-family C, member 10							40.0	41.0	41.0					6																	43400436		2203	4299	6502	SO:0001583	missense	89845					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr6:43400436G>A	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.718G>A	6.37:g.43400436G>A	ENSP00000361608:p.Glu240Lys					ABCC10_uc003ouz.1_Missense_Mutation_p.E197K	p.E240K	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		3	933	+	all_lung(25;0.00536)		240					Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	37	c.718G>A	CCDS56430.1	.	.	.	.	.	.	.	.	.	.	G	5.676	0.309329	0.10733	.	.	ENSG00000124574	ENST00000372530;ENST00000244533	D;D	0.90504	-2.65;-2.68	5.54	2.6	0.31112	.	0.457958	0.24856	N	0.035059	T	0.59878	0.2226	N	0.17082	0.46	0.34592	D	0.715654	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.45571	-0.9252	10	0.06099	T	0.92	-49.8722	5.5005	0.16827	0.3425:0.1898:0.4677:0.0	.	197;240	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	K	240;197	ENSP00000361608:E240K;ENSP00000244533:E197K	ENSP00000244533:E197K	E	+	1	0	ABCC10	43508414	1.000000	0.71417	0.999000	0.59377	0.916000	0.54674	2.317000	0.43770	0.643000	0.30638	0.561000	0.74099	GAG		0.637	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2		NM_033450		5	56	0	0	0	0.021553	0	5	56		
SLC17A5	26503	broad.mit.edu	37	6	74345112	74345112	+	Missense_Mutation	SNP	C	C	G	rs386833994		TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr6:74345112C>G	ENST00000355773.5	-	6	1080	c.812G>C	c.(811-813)aGa>aCa	p.R271T	SLC17A5_ENST00000481996.1_5'UTR|SLC17A5_ENST00000393019.3_3'UTR	NM_012434.4	NP_036566.1	Q9NRA2	S17A5_HUMAN	solute carrier family 17 (acidic sugar transporter), member 5	271			Missing (in ISSD). {ECO:0000269|PubMed:10581036, ECO:0000269|PubMed:10947946}.		amino acid transport (GO:0006865)|anion transport (GO:0006820)|ion transport (GO:0006811)|proton transport (GO:0015992)|sialic acid transport (GO:0015739)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	sialic acid transmembrane transporter activity (GO:0015136)|sugar:proton symporter activity (GO:0005351)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TACCTGATTTCTTAATGATGA	0.274																																						uc003phn.3		NaN																	0				skin(5)|central_nervous_system(1)	6						c.(811-813)AGA>ACA		sialin							86.0	80.0	82.0					6																	74345112		2199	4291	6490	SO:0001583	missense	26503				anion transport	integral to plasma membrane|lysosomal membrane|membrane fraction	sialic acid:hydrogen symporter activity	g.chr6:74345112C>G	AJ387747	CCDS4981.1	6q13	2013-07-18	2013-07-18		ENSG00000119899	ENSG00000119899		"""Solute carriers"""	10933	protein-coding gene	gene with protein product		604322	"""sialic acid storage disease"", ""solute carrier family 17 (anion/sugar transporter), member 5"""	SIASD		10581036, 8198127	Standard	NM_012434		Approved	AST, SD, ISSD, NSD, SIALIN, SLD	uc003phn.4	Q9NRA2	OTTHUMG00000015039	ENST00000355773.5:c.812G>C	6.37:g.74345112C>G	ENSP00000348019:p.Arg271Thr					SLC17A5_uc010kax.2_5'UTR|SLC17A5_uc010kay.2_RNA|SLC17A5_uc011dyo.1_Missense_Mutation_p.R140T	p.R271T	NM_012434	NP_036566	Q9NRA2	S17A5_HUMAN			6	940	-			271		Missing (in ISSD).			Q5SZ76|Q8NBR5|Q9UGH0	Missense_Mutation	SNP	ENST00000355773.5	37	c.812G>C	CCDS4981.1	.	.	.	.	.	.	.	.	.	.	C	9.166	1.019951	0.19355	.	.	ENSG00000119899	ENST00000355773	T	0.59224	0.28	5.56	-6.43	0.01926	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	2.110200	0.01642	N	0.024127	T	0.23054	0.0557	N	0.17764	0.52	0.52501	D	0.999952	B;B	0.13145	0.007;0.003	B;B	0.15052	0.012;0.005	T	0.21245	-1.0251	10	0.33141	T	0.24	.	13.6569	0.62344	0.0:0.1088:0.0909:0.8002	.	333;271	E1P537;Q9NRA2	.;S17A5_HUMAN	T	271	ENSP00000348019:R271T	ENSP00000348019:R271T	R	-	2	0	SLC17A5	74401833	0.716000	0.27956	0.906000	0.35671	0.736000	0.42039	-0.411000	0.07142	-1.183000	0.02723	-0.145000	0.13849	AGA		0.274	SLC17A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041228.1				12	94	0	0	0	0.013537	0	12	94		
DOPEY1	23033	broad.mit.edu	37	6	83845382	83845382	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr6:83845382C>T	ENST00000349129.2	+	20	3175	c.2915C>T	c.(2914-2916)tCt>tTt	p.S972F	DOPEY1_ENST00000237163.5_Missense_Mutation_p.S953F|DOPEY1_ENST00000369739.3_Missense_Mutation_p.S963F	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	972					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		CTCGATGGTTCTACTAGCTCT	0.393																																						uc003pjs.1		NaN																	0				ovary(2)|breast(1)|central_nervous_system(1)	4						c.(2914-2916)TCT>TTT		dopey family member 1							162.0	148.0	153.0					6																	83845382		2203	4300	6503	SO:0001583	missense	23033				protein transport			g.chr6:83845382C>T	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.2915C>T	6.37:g.83845382C>T	ENSP00000195654:p.Ser972Phe					DOPEY1_uc011dyy.1_Missense_Mutation_p.S963F|DOPEY1_uc010kbl.1_Missense_Mutation_p.S963F|DOPEY1_uc003pjt.2_5'Flank	p.S972F	NM_015018	NP_055833	Q5JWR5	DOP1_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.053)	20	3175	+		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)	972					Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	37	c.2915C>T	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	C	19.74	3.882994	0.72410	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.25912	1.77;1.77	5.56	5.56	0.83823	.	0.049604	0.85682	D	0.000000	T	0.34716	0.0907	L	0.58101	1.795	0.80722	D	1	D;D;D	0.69078	0.997;0.989;0.989	P;P;P	0.59948	0.866;0.726;0.726	T	0.06588	-1.0818	10	0.66056	D	0.02	.	15.0694	0.72024	0.0:0.8587:0.1413:0.0	.	863;963;972	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	F	972;953;953	ENSP00000195654:S972F;ENSP00000237163:S953F	ENSP00000237163:S953F	S	+	2	0	DOPEY1	83902101	1.000000	0.71417	0.998000	0.56505	0.816000	0.46133	3.830000	0.55768	2.614000	0.88457	0.561000	0.74099	TCT		0.393	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2		NM_015018		14	182	0	0	0	0.020292	0	14	182		
EZR	7430	broad.mit.edu	37	6	159191809	159191809	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr6:159191809C>G	ENST00000367075.3	-	10	1245	c.1077G>C	c.(1075-1077)aaG>aaC	p.K359N	EZR_ENST00000337147.7_Missense_Mutation_p.K359N|EZR_ENST00000392177.4_Missense_Mutation_p.K327N	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	359	Interaction with SCYL3.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		TCTCTGCCTTCTTTGTCTTCT	0.567			T	ROS1	NSCLC																																	uc003qrt.3		NaN		Dom	yes		6	6q25.3	7430		ezrin			E					0				ovary(1)	1						c.(1075-1077)AAG>AAC		ezrin							182.0	171.0	175.0					6																	159191809		2203	4300	6503	SO:0001583	missense	7430				actin filament bundle assembly|axon guidance|cytoskeletal anchoring at plasma membrane|leukocyte cell-cell adhesion|membrane to membrane docking|regulation of cell shape	actin filament|apical plasma membrane|basolateral plasma membrane|cortical cytoskeleton|cytosol|extrinsic to membrane|filopodium|microvillus membrane|nucleolus|ruffle membrane	actin filament binding|cell adhesion molecule binding	g.chr6:159191809C>G	AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.1077G>C	6.37:g.159191809C>G	ENSP00000356042:p.Lys359Asn					EZR_uc011efr.1_5'Flank|EZR_uc011efs.1_Missense_Mutation_p.K327N|EZR_uc003qru.3_Missense_Mutation_p.K359N	p.K359N	NM_003379	NP_003370	P15311	EZRI_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)	9	1292	-		Breast(66;0.000776)|Ovarian(120;0.0303)	359			Interaction with SCYL3.		E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Missense_Mutation	SNP	ENST00000367075.3	37	c.1077G>C	CCDS5258.1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.132058	0.37630	.	.	ENSG00000092820	ENST00000337147;ENST00000367075;ENST00000392177	D;D;D	0.82984	-1.67;-1.67;-1.67	5.43	3.65	0.41850	Ezrin/radixin/moesin, C-terminal (1);	0.135580	0.64402	D	0.000003	T	0.77532	0.4144	M	0.80183	2.485	0.58432	D	0.999996	B;B	0.26041	0.07;0.14	B;B	0.35073	0.09;0.195	T	0.76586	-0.2905	10	0.59425	D	0.04	.	10.0533	0.42230	0.0:0.7838:0.0:0.2162	.	327;359	E7EQR4;P15311	.;EZRI_HUMAN	N	359;359;327	ENSP00000338934:K359N;ENSP00000356042:K359N;ENSP00000376016:K327N	ENSP00000338934:K359N	K	-	3	2	EZR	159111797	0.983000	0.35010	0.995000	0.50966	0.361000	0.29550	0.506000	0.22658	0.669000	0.31146	-0.140000	0.14226	AAG		0.567	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042878.1		NM_003379		10	149	0	0	0	0.008291	0	10	149		
FOXK1	221937	broad.mit.edu	37	7	4794948	4794948	+	Silent	SNP	G	G	C			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr7:4794948G>C	ENST00000328914.4	+	4	984	c.984G>C	c.(982-984)ctG>ctC	p.L328L	FOXK1_ENST00000446823.1_Silent_p.L165L	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		AGCTGACCCTGAGCGGGATCT	0.642																																						uc003snc.1		NaN																	0				upper_aerodigestive_tract(1)|skin(1)	2						c.(982-984)CTG>CTC		forkhead box K1							67.0	60.0	62.0					7																	4794948		2203	4300	6503	SO:0001819	synonymous_variant	221937				cell differentiation|embryo development|muscle organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr7:4794948G>C	BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.984G>C	7.37:g.4794948G>C						FOXK1_uc003sna.1_Silent_p.L165L|FOXK1_uc003snb.1_3'UTR	p.L328L	NM_001037165	NP_001032242	P85037	FOXK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)	4	994	+		Ovarian(82;0.0175)	328			Fork-head.			Silent	SNP	ENST00000328914.4	37	c.984G>C	CCDS34591.1																																																																																				0.642	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2				6	54	0	0	0	0.001984	0	6	54		
MLXIPL	51085	broad.mit.edu	37	7	73010266	73010266	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr7:73010266C>G	ENST00000313375.3	-	14	2139	c.2092G>C	c.(2092-2094)Gag>Cag	p.E698Q	MLXIPL_ENST00000434326.1_Missense_Mutation_p.E604Q|MLXIPL_ENST00000354613.1_Intron|MLXIPL_ENST00000429400.2_Intron|MLXIPL_ENST00000414749.2_Missense_Mutation_p.E696Q|MLXIPL_ENST00000395189.1_Missense_Mutation_p.E605Q	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	698	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				AGGATGTACTCAGCTGTCTTC	0.607																																						uc003tyn.1		NaN																	0				pancreas(1)	1						c.(2092-2094)GAG>CAG		Williams Beuren syndrome chromosome region 14							36.0	34.0	35.0					7																	73010266		2203	4299	6502	SO:0001583	missense	51085				anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of glycolysis|positive regulation of transcription from RNA polymerase II promoter|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr7:73010266C>G	AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.2092G>C	7.37:g.73010266C>G	ENSP00000320886:p.Glu698Gln					MLXIPL_uc003tyj.1_Missense_Mutation_p.E77Q|MLXIPL_uc003tyk.1_Intron|MLXIPL_uc003tyl.1_Missense_Mutation_p.E696Q|MLXIPL_uc003tym.1_Intron|MLXIPL_uc003tyo.1_RNA|MLXIPL_uc003typ.1_Missense_Mutation_p.E604Q	p.E698Q	NM_032951	NP_116569	Q9NP71	WBS14_HUMAN			14	2140	-		Lung NSC(55;0.0659)|all_lung(88;0.152)	698			Helix-loop-helix motif.		C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Missense_Mutation	SNP	ENST00000313375.3	37	c.2092G>C	CCDS5553.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095671	0.76870	.	.	ENSG00000009950	ENST00000414749;ENST00000313375;ENST00000395189;ENST00000434326	D;D;D;D	0.98474	-4.95;-4.95;-4.95;-4.95	4.64	4.64	0.57946	.	0.000000	0.85682	D	0.000000	D	0.98635	0.9543	M	0.72894	2.215	0.42783	D	0.993873	D;D;D	0.89917	0.997;1.0;0.995	D;D;D	0.77557	0.96;0.99;0.961	D	0.99799	1.1035	10	0.87932	D	0	-25.1177	15.0817	0.72119	0.0:1.0:0.0:0.0	.	605;698;696	Q9NP71-6;Q9NP71;Q9NP71-3	.;MLXPL_HUMAN;.	Q	696;698;605;604	ENSP00000412330:E696Q;ENSP00000320886:E698Q;ENSP00000378616:E605Q;ENSP00000392636:E604Q	ENSP00000320886:E698Q	E	-	1	0	MLXIPL	72648202	0.998000	0.40836	0.995000	0.50966	0.388000	0.30384	3.939000	0.56591	2.412000	0.81896	0.558000	0.71614	GAG		0.607	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252262.1		NM_032951		4	26	0	0	0	0.014758	0	4	26		
KIAA1324L	222223	broad.mit.edu	37	7	86556202	86556202	+	Missense_Mutation	SNP	T	T	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr7:86556202T>G	ENST00000450689.2	-	9	1305	c.1120A>C	c.(1120-1122)Aaa>Caa	p.K374Q	KIAA1324L_ENST00000444627.1_Missense_Mutation_p.K374Q|KIAA1324L_ENST00000416314.1_Missense_Mutation_p.K207Q|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.K134Q	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	374						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					CGGCAGATTTTGGGCTCTATC	0.378																																						uc011kha.1		NaN																	0				ovary(6)|skin(1)	7						c.(1120-1122)AAA>CAA		hypothetical protein LOC222223 isoform 1							96.0	96.0	96.0					7																	86556202		2203	4300	6503	SO:0001583	missense	222223					integral to membrane		g.chr7:86556202T>G	AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.1120A>C	7.37:g.86556202T>G	ENSP00000413445:p.Lys374Gln					KIAA1324L_uc003uif.1_Missense_Mutation_p.K134Q|KIAA1324L_uc011kgz.1_Missense_Mutation_p.K260Q|KIAA1324L_uc003uie.2_Missense_Mutation_p.K207Q	p.K374Q	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN			9	1305	-	Esophageal squamous(14;0.0058)		374			Extracellular (Potential).		A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	ENST00000450689.2	37	c.1120A>C	CCDS47632.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.05|14.05	2.419379|2.419379	0.42918|0.42918	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314|ENST00000423294	T;T;T;T|.	0.49720|.	0.77;0.77;0.77;0.77|.	5.05|5.05	3.87|3.87	0.44632|0.44632	Growth factor, receptor (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.52322|0.52322	0.1727|0.1727	L|L	0.35414|0.35414	1.06|1.06	0.54753|0.54753	D|D	0.99998|0.99998	D;B;B|.	0.58268|.	0.982;0.141;0.141|.	P;B;B|.	0.59487|.	0.858;0.073;0.073|.	T|T	0.43097|0.43097	-0.9412|-0.9412	10|5	0.23302|.	T|.	0.38|.	.|.	11.4662|11.4662	0.50241|0.50241	0.0:0.0:0.1511:0.8489|0.0:0.0:0.1511:0.8489	.|.	374;134;207|.	A8MWY0;A8MWY0-2;B4DJV3|.	K132L_HUMAN;.;.|.	Q|P	374;134;374;207|334	ENSP00000413445:K374Q;ENSP00000297222:K134Q;ENSP00000397377:K374Q;ENSP00000402390:K207Q|.	ENSP00000297222:K134Q|.	K|Q	-|-	1|2	0|0	KIAA1324L|KIAA1324L	86394138|86394138	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	6.154000|6.154000	0.71826|0.71826	0.844000|0.844000	0.35094|0.35094	-0.460000|-0.460000	0.05396|0.05396	AAA|CAA		0.378	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3		NM_152748		5	190	0	0	0	0.014758	0	5	190		
DBF4	10926	broad.mit.edu	37	7	87516657	87516657	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr7:87516657C>T	ENST00000265728.1	+	5	968	c.464C>T	c.(463-465)tCa>tTa	p.S155L		NM_006716.3	NP_006707.1	Q9UBU7	DBF4A_HUMAN	DBF4 zinc finger	155	BRCT 2.				DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)	nucleoplasm (GO:0005654)	enzyme activator activity (GO:0008047)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|skin(3)	28	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				TTTATTCCTTCAAATAGTATA	0.229																																						uc003ujf.1		NaN																	0				lung(2)	2						c.(463-465)TCA>TTA		activator of S phase kinase							37.0	38.0	38.0					7																	87516657		2197	4284	6481	SO:0001583	missense	10926				cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	enzyme activator activity|nucleic acid binding|protein binding|zinc ion binding	g.chr7:87516657C>T	AF160876	CCDS5611.1	7q21.3	2014-02-17	2014-02-17		ENSG00000006634	ENSG00000006634		"""Zinc fingers, DBF-type"""	17364	protein-coding gene	gene with protein product	"""activator of S phase kinase"", ""chiffon homolog (Drosophila)"", ""zinc finger, DBF-type containing 1"", ""DBF4 zinc finger A"""	604281	"""DBF4 homolog (S. cerevisiae)"""			10373557, 10517317	Standard	NM_006716		Approved	ASK, chif, ZDBF1, DBF4A	uc003ujf.1	Q9UBU7	OTTHUMG00000131034	ENST00000265728.1:c.464C>T	7.37:g.87516657C>T	ENSP00000265728:p.Ser155Leu					DBF4_uc003ujh.1_5'UTR|DBF4_uc003ujg.1_5'UTR|DBF4_uc011khf.1_5'UTR	p.S155L	NM_006716	NP_006707	Q9UBU7	DBF4A_HUMAN			5	968	+	Esophageal squamous(14;0.00202)	Breast(660;0.0334)	155			BRCT 2.		A4D1D8|A8K954|O75226|Q75MS6|Q75N01|Q9Y2M6	Missense_Mutation	SNP	ENST00000265728.1	37	c.464C>T	CCDS5611.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.053756	0.55218	.	.	ENSG00000006634	ENST00000265728	T	0.11930	2.73	5.76	5.76	0.90799	BRCT (1);	0.481200	0.22287	N	0.062043	T	0.20618	0.0496	L	0.43152	1.355	0.31306	N	0.687662	D	0.59767	0.986	P	0.50490	0.642	T	0.02464	-1.1155	10	0.54805	T	0.06	-8.0597	14.7836	0.69784	0.1442:0.8558:0.0:0.0	.	155	Q9UBU7	DBF4A_HUMAN	L	155	ENSP00000265728:S155L	ENSP00000265728:S155L	S	+	2	0	DBF4	87354593	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.250000	0.58772	2.706000	0.92434	0.655000	0.94253	TCA		0.229	DBF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253678.1		NM_006716		4	36	0	0	0	0.009096	0	4	36		
SAMD9	54809	broad.mit.edu	37	7	92734318	92734318	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr7:92734318C>G	ENST00000379958.2	-	3	1362	c.1093G>C	c.(1093-1095)Gat>Cat	p.D365H		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	365						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			GTTTTAAAATCTGCTTTAAAT	0.333																																						uc003umf.2		NaN																	0				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(1093-1095)GAT>CAT		sterile alpha motif domain containing 9							77.0	80.0	79.0					7																	92734318		2202	4298	6500	SO:0001583	missense	54809					cytoplasm		g.chr7:92734318C>G	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.1093G>C	7.37:g.92734318C>G	ENSP00000369292:p.Asp365His					SAMD9_uc003umg.2_Missense_Mutation_p.D365H	p.D365H	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		3	1349	-	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		365					A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	37	c.1093G>C	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	C	7.981	0.751175	0.15778	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.18810	2.19;2.19	4.24	1.33	0.21861	.	0.551302	0.16507	U	0.211383	T	0.17109	0.0411	L	0.47716	1.5	0.09310	N	1	P	0.35982	0.531	B	0.39185	0.293	T	0.14896	-1.0456	10	0.48119	T	0.1	-2.8369	3.254	0.06824	0.1803:0.4474:0.0:0.3723	.	365	Q5K651	SAMD9_HUMAN	H	365	ENSP00000369292:D365H;ENSP00000414529:D365H	ENSP00000369292:D365H	D	-	1	0	SAMD9	92572254	0.000000	0.05858	0.035000	0.18076	0.089000	0.18198	-0.760000	0.04756	0.167000	0.19631	0.603000	0.83216	GAT		0.333	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1		NM_017654		9	188	0	0	0	0.008291	0	9	188		
EPHB4	2050	broad.mit.edu	37	7	100410820	100410820	+	Silent	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr7:100410820G>A	ENST00000358173.3	-	11	2235	c.1767C>T	c.(1765-1767)gtC>gtT	p.V589V	EPHB4_ENST00000477446.1_5'Flank|EPHB4_ENST00000360620.3_Silent_p.V589V	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	589					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					GGTCGATGTAGACCTTAGTAC	0.507																																					GBM(200;2113 3072 25865 52728)	uc003uwn.1		NaN																	0				lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15						c.(1765-1767)GTC>GTT		EPH receptor B4 precursor							94.0	83.0	87.0					7																	100410820		2203	4300	6503	SO:0001819	synonymous_variant	2050				cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:100410820G>A	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.1767C>T	7.37:g.100410820G>A						EPHB4_uc003uwm.1_Silent_p.V496V|EPHB4_uc010lhj.1_Silent_p.V589V	p.V589V	NM_004444	NP_004435	P54760	EPHB4_HUMAN			11	2258	-	Lung NSC(181;0.041)|all_lung(186;0.0581)		589			Cytoplasmic (Potential).		B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Silent	SNP	ENST00000358173.3	37	c.1767C>T	CCDS5706.1																																																																																				0.507	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1		NM_004444		4	88	0	0	0	0.009096	0	4	88		
C7orf60	154743	broad.mit.edu	37	7	112472660	112472660	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr7:112472660C>G	ENST00000297145.4	-	4	709	c.544G>C	c.(544-546)Gaa>Caa	p.E182Q	C7orf60_ENST00000485446.1_5'UTR	NM_152556.2	NP_689769.2	Q1RMZ1	BMT2_HUMAN	chromosome 7 open reading frame 60	182							rRNA (adenine) methyltransferase activity (GO:0016433)			breast(1)|endometrium(2)|lung(7)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	17						AGAAATTCTTCAAACTTCAGA	0.308																																						uc003vgo.1		NaN																	0				ovary(2)|skin(1)	3						c.(544-546)GAA>CAA		hypothetical protein LOC154743							105.0	97.0	100.0					7																	112472660		1819	4086	5905	SO:0001583	missense	154743							g.chr7:112472660C>G		CCDS43634.1	7q31.1	2011-01-11	2008-06-19		ENSG00000164603	ENSG00000164603			26475	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31818"""						Standard	NM_152556		Approved	DKFZp762M126, FLJ31818	uc003vgo.1	Q1RMZ1	OTTHUMG00000155233	ENST00000297145.4:c.544G>C	7.37:g.112472660C>G	ENSP00000297145:p.Glu182Gln					C7orf60_uc011kms.1_Missense_Mutation_p.E208Q	p.E182Q	NM_152556	NP_689769	Q1RMZ1	CG060_HUMAN			4	671	-			182					Q8N3D0|Q96MV7	Missense_Mutation	SNP	ENST00000297145.4	37	c.544G>C	CCDS43634.1	.	.	.	.	.	.	.	.	.	.	C	18.27	3.587273	0.66105	.	.	ENSG00000164603	ENST00000297145;ENST00000432572;ENST00000358032	.	.	.	5.49	5.49	0.81192	.	0.045746	0.85682	D	0.000000	T	0.65647	0.2711	L	0.40543	1.245	0.58432	D	0.999999	D;B	0.60575	0.988;0.087	P;B	0.57204	0.815;0.033	T	0.63734	-0.6570	9	0.44086	T	0.13	-12.056	19.7245	0.96157	0.0:1.0:0.0:0.0	.	129;182	B4DST1;Q1RMZ1	.;CG060_HUMAN	Q	182;164;129	.	ENSP00000297145:E182Q	E	-	1	0	C7orf60	112259896	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.159000	0.77483	2.735000	0.93741	0.561000	0.74099	GAA		0.308	C7orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338923.1		NM_152556		6	133	0	0	0	0.001984	0	6	133		
NOS3	4846	broad.mit.edu	37	7	150698385	150698385	+	Missense_Mutation	SNP	G	G	C	rs563793183		TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr7:150698385G>C	ENST00000484524.1	+	10	1300	c.1300G>C	c.(1300-1302)Gag>Cag	p.E434Q	NOS3_ENST00000297494.3_Missense_Mutation_p.E434Q|NOS3_ENST00000467517.1_Missense_Mutation_p.E434Q|NOS3_ENST00000461406.1_Missense_Mutation_p.E228Q	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCTGGAGAATGAGCAGAAGGC	0.612																																						uc003wif.2		NaN																	0				central_nervous_system(5)|large_intestine(2)|skin(1)	8						c.(1300-1302)GAG>CAG		nitric oxide synthase 3 isoform 1	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)						65.0	68.0	67.0					7																	150698385		2203	4300	6503	SO:0001583	missense	4846				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding	g.chr7:150698385G>C		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.1300G>C	7.37:g.150698385G>C	ENSP00000420215:p.Glu434Gln					NOS3_uc011kuy.1_Missense_Mutation_p.E228Q|NOS3_uc011kuz.1_Missense_Mutation_p.E434Q|NOS3_uc011kva.1_Missense_Mutation_p.E434Q|NOS3_uc011kvb.1_Missense_Mutation_p.E434Q	p.E434Q	NM_000603	NP_000594	P29474	NOS3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	11	1596	+	all_neural(206;0.219)		434			Interaction with NOSIP.		Q495E5	Missense_Mutation	SNP	ENST00000484524.1	37	c.1300G>C	CCDS55182.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.961996	0.92791	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.36878	1.23;1.4;1.23;1.23	5.13	5.13	0.70059	Nitric oxide synthase, oxygenase domain (2);	0.000000	0.64402	D	0.000013	T	0.72285	0.3441	H	0.95917	3.74	0.58432	D	0.999992	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.82301	-0.0525	10	0.87932	D	0	-2.7966	16.0746	0.80960	0.0:0.0:1.0:0.0	.	434;434;434;228;434	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	Q	434;228;434;434	ENSP00000297494:E434Q;ENSP00000417143:E228Q;ENSP00000420215:E434Q;ENSP00000420551:E434Q	ENSP00000297494:E434Q	E	+	1	0	NOS3	150329318	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.863000	0.99569	2.373000	0.80994	0.561000	0.74099	GAG		0.612	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1		NM_000603		5	83	0	0	0	0.00308	0	5	83		
INSIG1	3638	broad.mit.edu	37	7	155094081	155094081	+	Silent	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr7:155094081C>T	ENST00000340368.4	+	4	869	c.658C>T	c.(658-660)Cta>Tta	p.L220L	INSIG1_ENST00000342407.5_Intron|INSIG1_ENST00000344756.4_Silent_p.L68L	NM_005542.4	NP_005533.2	O15503	INSI1_HUMAN	insulin induced gene 1	220					cell proliferation (GO:0008283)|cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|metabolic process (GO:0008152)|middle ear morphogenesis (GO:0042474)|negative regulation of cargo loading into COPII-coated vesicle (GO:1901303)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)		p.L220V(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	19	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CATAGCTTTTCTAGCTACGCT	0.438																																						uc003wly.2		NaN																	1	Substitution - Missense(1)		lung(1)		0						c.(658-660)CTA>TTA		insulin induced gene 1 isoform 1							124.0	113.0	117.0					7																	155094081		2203	4300	6503	SO:0001819	synonymous_variant	3638				cell proliferation|ER-nuclear sterol response pathway	endoplasmic reticulum membrane|integral to membrane	protein binding	g.chr7:155094081C>T		CCDS5938.1, CCDS5939.1	7q36	2008-07-18			ENSG00000186480	ENSG00000186480			6083	protein-coding gene	gene with protein product	"""INSIG-1 membrane protein"""	602055				9268630	Standard	NM_005542		Approved	CL-6, MGC1405	uc003wly.3	O15503	OTTHUMG00000151330	ENST00000340368.4:c.658C>T	7.37:g.155094081C>T						INSIG1_uc011kvu.1_Silent_p.L68L|INSIG1_uc003wlz.2_Intron	p.L220L	NM_005542	NP_005533	O15503	INSI1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	4	869	+	all_neural(206;0.119)	all_hematologic(28;0.0592)	220			Helical; (Potential).		A4D2N1|A8K6L0|Q53XW8|Q9BUV5	Silent	SNP	ENST00000340368.4	37	c.658C>T	CCDS5938.1	.	.	.	.	.	.	.	.	.	.	C	9.970	1.225111	0.22457	.	.	ENSG00000186480	ENST00000476756	.	.	.	5.73	4.85	0.62838	.	.	.	.	.	T	0.62295	0.2416	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60707	-0.7210	4	.	.	.	.	10.6978	0.45909	0.0:0.7566:0.1682:0.0752	.	.	.	.	F	128	.	.	S	+	2	0	INSIG1	154725016	1.000000	0.71417	0.827000	0.32855	0.839000	0.47603	1.415000	0.34748	1.424000	0.47217	0.650000	0.86243	TCT		0.438	INSIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322244.3		NM_198336		9	107	0	0	0	0.006214	0	9	107		
EXTL3	2137	broad.mit.edu	37	8	28575593	28575593	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr8:28575593G>A	ENST00000220562.4	+	3	2919	c.2017G>A	c.(2017-2019)Gag>Aag	p.E673K	EXTL3_ENST00000519886.1_Intron|EXTL3_ENST00000523149.1_Missense_Mutation_p.E289K	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	673					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		TTATGAGCGGGAGGAAGTGCT	0.542																																						uc003xgz.1		NaN																	0				skin(2)	2						c.(2017-2019)GAG>AAG		exostoses-like 3							143.0	136.0	139.0					8																	28575593		2203	4300	6503	SO:0001583	missense	2137					integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|metal ion binding|protein binding	g.chr8:28575593G>A	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.2017G>A	8.37:g.28575593G>A	ENSP00000220562:p.Glu673Lys						p.E673K	NM_001440	NP_001431	O43909	EXTL3_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)	3	2610	+		Ovarian(32;0.069)	673			Lumenal (Potential).		D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	ENST00000220562.4	37	c.2017G>A	CCDS6070.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.5|22.5	4.296017|4.296017	0.81025|0.81025	.|.	.|.	ENSG00000012232|ENSG00000012232	ENST00000523149;ENST00000220562|ENST00000521473	T;T|.	0.79033|.	-1.23;-1.23|.	6.04|6.04	6.04|6.04	0.98038|0.98038	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77336|0.77336	0.4115|0.4115	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.77557|.	0.99|.	T|T	0.73886|0.73886	-0.3841|-0.3841	10|5	0.14252|.	T|.	0.57|.	-35.0957|-35.0957	20.5948|20.5948	0.99439|0.99439	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	673|.	O43909|.	EXTL3_HUMAN|.	K|E	289;673|6	ENSP00000428691:E289K;ENSP00000220562:E673K|.	ENSP00000220562:E673K|.	E|G	+|+	1|2	0|0	EXTL3|EXTL3	28631512|28631512	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.869000|9.869000	0.99810|0.99810	2.873000|2.873000	0.98535|0.98535	0.563000|0.563000	0.77884|0.77884	GAG|GGA		0.542	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3		NM_001440		7	97	0	0	0	0.001984	0	7	97		
TEX15	56154	broad.mit.edu	37	8	30702398	30702398	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr8:30702398C>G	ENST00000256246.2	-	1	4210	c.4136G>C	c.(4135-4137)aGa>aCa	p.R1379T		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1379					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		CTCTTTTTCTCTACAGCTCTG	0.398																																						uc003xil.2		NaN																	0				ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7						c.(4135-4137)AGA>ACA		testis expressed 15							84.0	85.0	85.0					8																	30702398		2203	4300	6503	SO:0001583	missense	56154							g.chr8:30702398C>G	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.4136G>C	8.37:g.30702398C>G	ENSP00000256246:p.Arg1379Thr						p.R1379T	NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)	1	4136	-			1379						Missense_Mutation	SNP	ENST00000256246.2	37	c.4136G>C	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	C	9.500	1.102986	0.20632	.	.	ENSG00000133863	ENST00000256246	T	0.20069	2.1	5.7	0.00698	0.14069	.	1.308470	0.05026	N	0.473752	T	0.12518	0.0304	N	0.14661	0.345	0.09310	N	1	B	0.22480	0.07	B	0.21151	0.033	T	0.34650	-0.9820	10	0.87932	D	0	.	4.1646	0.10300	0.0:0.3941:0.1731:0.4328	.	1379	Q9BXT5	TEX15_HUMAN	T	1379	ENSP00000256246:R1379T	ENSP00000256246:R1379T	R	-	2	0	TEX15	30821940	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.307000	0.19296	0.062000	0.16340	0.655000	0.94253	AGA		0.398	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1				6	174	0	0	0	0.001984	0	6	174		
WHSC1L1	54904	broad.mit.edu	37	8	38173473	38173473	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr8:38173473C>G	ENST00000317025.8	-	10	2460	c.1943G>C	c.(1942-1944)aGa>aCa	p.R648T	WHSC1L1_ENST00000433384.2_Missense_Mutation_p.R648T|WHSC1L1_ENST00000525081.1_5'Flank|WHSC1L1_ENST00000527502.1_Missense_Mutation_p.R648T	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	648					histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			AGATGTGTCTCTGTATGCTGA	0.433			T	NUP98	AML																																	uc003xli.2		NaN		Dom	yes		8	8p12	54904	T	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)			L	NUP98		AML		0				breast(1)	1						c.(1942-1944)AGA>ACA		WHSC1L1 protein isoform long							161.0	153.0	156.0					8																	38173473		2100	4227	6327	SO:0001583	missense	54904				cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding	g.chr8:38173473C>G	AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.1943G>C	8.37:g.38173473C>G	ENSP00000313983:p.Arg648Thr					WHSC1L1_uc011lbm.1_Missense_Mutation_p.R648T|WHSC1L1_uc010lwe.2_Missense_Mutation_p.R648T	p.R648T	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)		10	2461	-	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	648					B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Missense_Mutation	SNP	ENST00000317025.8	37	c.1943G>C	CCDS43729.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.660159	0.88154	.	.	ENSG00000147548	ENST00000433384;ENST00000317025;ENST00000446459;ENST00000527502	D;D;D	0.95307	-3.67;-3.63;-3.63	5.85	5.85	0.93711	.	0.000000	0.52532	U	0.000062	D	0.96321	0.8800	L	0.50333	1.59	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.83275	0.991;0.996;0.991	D	0.94630	0.7821	10	0.29301	T	0.29	.	20.1632	0.98142	0.0:1.0:0.0:0.0	.	648;648;648	B7ZL11;Q9BZ95-2;Q9BZ95	.;.;NSD3_HUMAN	T	648;648;585;648	ENSP00000393284:R648T;ENSP00000313983:R648T;ENSP00000434730:R648T	ENSP00000313983:R648T	R	-	2	0	WHSC1L1	38292630	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.456000	0.80751	2.772000	0.95346	0.650000	0.86243	AGA		0.433	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381924.3		NM_023034		6	166	0	0	0	0.021553	0	6	166		
RIMS2	9699	broad.mit.edu	37	8	104898276	104898276	+	Silent	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr8:104898276C>G	ENST00000436393.2	+	2	1024	c.783C>G	c.(781-783)ctC>ctG	p.L261L	RIMS2_ENST00000406091.3_Silent_p.L483L|RIMS2_ENST00000507740.1_Silent_p.L291L|RIMS2_ENST00000262231.10_Silent_p.L291L			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	514					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ATGATTCTCTCAGTTCAGACC	0.438										HNSCC(12;0.0054)																												uc003yls.2		NaN																	0				ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(781-783)CTC>CTG		regulating synaptic membrane exocytosis 2							65.0	61.0	62.0					8																	104898276		2011	4175	6186	SO:0001819	synonymous_variant	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:104898276C>G	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.783C>G	8.37:g.104898276C>G		HNSCC(12;0.0054)				RIMS2_uc003ylp.2_Silent_p.L483L|RIMS2_uc003ylw.2_Silent_p.L291L|RIMS2_uc003ylq.2_Silent_p.L291L|RIMS2_uc003ylr.2_Silent_p.L291L	p.L261L	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		2	1024	+			514					B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	ENST00000436393.2	37	c.783C>G																																																																																					0.438	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1		NM_001100117		8	67	0	0	0	0.00308	0	8	67		
CDC14B	8555	broad.mit.edu	37	9	99301371	99301371	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr9:99301371C>T	ENST00000375241.1	-	7	1067	c.616G>A	c.(616-618)Gaa>Aaa	p.E206K	CDC14B_ENST00000265659.2_Missense_Mutation_p.E206K|CDC14B_ENST00000375240.3_Missense_Mutation_p.E206K|CDC14B_ENST00000375236.1_Missense_Mutation_p.E206K|CDC14B_ENST00000375242.3_Missense_Mutation_p.E169K|CDC14B_ENST00000463569.1_Missense_Mutation_p.E206K	NM_003671.3|NM_033331.2	NP_003662.1|NP_201588.1	O60729	CC14B_HUMAN	cell division cycle 14B	206	Linker.				activation of anaphase-promoting complex activity (GO:0051488)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	15		Acute lymphoblastic leukemia(62;0.0559)				TCATAGTGTTCATATTCATCA	0.343																																						uc004awj.2		NaN																	0				ovary(1)	1						c.(616-618)GAA>AAA		CDC14 homolog B isoform 2							80.0	81.0	81.0					9																	99301371		2203	4300	6503	SO:0001583	missense	8555				activation of anaphase-promoting complex activity|DNA repair|G2/M transition DNA damage checkpoint	nucleolus|nucleoplasm	protein binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr9:99301371C>T	AF023158	CCDS6721.1, CCDS6722.1, CCDS43853.1	9q22.3	2013-01-17	2013-01-17		ENSG00000081377	ENSG00000081377		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1719	protein-coding gene	gene with protein product		603505	"""CDC14 (cell division cycle 14, S. cerevisiae) homolog B"", ""CDC14 cell division cycle 14 homolog B (S. cerevisiae)"""			9367992	Standard	NM_003671		Approved	Cdc14B1, Cdc14B2, CDC14B3, hCDC14B	uc004awj.3	O60729	OTTHUMG00000020300	ENST00000375241.1:c.616G>A	9.37:g.99301371C>T	ENSP00000364389:p.Glu206Lys					CDC14B_uc004awk.2_Missense_Mutation_p.E206K|CDC14B_uc004awl.2_RNA|CDC14B_uc004awi.2_Missense_Mutation_p.E169K	p.E206K	NM_033331	NP_201588	O60729	CC14B_HUMAN			7	1068	-		Acute lymphoblastic leukemia(62;0.0559)	206			Linker.		A6N5X8|A8MQ20|B1AL31|B1AL32|O43183|O60730|Q5JU08	Missense_Mutation	SNP	ENST00000375241.1	37	c.616G>A	CCDS6722.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.757546	0.89843	.	.	ENSG00000081377	ENST00000265659;ENST00000375241;ENST00000375240;ENST00000375242;ENST00000463569;ENST00000375236;ENST00000415608	T;T;T;T;T;T;T	0.36520	2.0;2.0;2.0;2.0;2.0;2.0;1.25	5.02	5.02	0.67125	.	0.048068	0.85682	D	0.000000	T	0.59348	0.2187	M	0.83603	2.65	0.80722	D	1	P;P;P	0.51449	0.936;0.945;0.754	P;P;P	0.59761	0.863;0.837;0.555	T	0.65005	-0.6273	10	0.87932	D	0	-1.0157	14.173	0.65522	0.0:0.8504:0.1496:0.0	.	206;206;169	O60729-2;O60729;A8MQ20	.;CC14B_HUMAN;.	K	206;206;206;169;206;206;190	ENSP00000265659:E206K;ENSP00000364389:E206K;ENSP00000364388:E206K;ENSP00000364390:E169K;ENSP00000420572:E206K;ENSP00000364384:E206K;ENSP00000400480:E190K	ENSP00000265659:E206K	E	-	1	0	CDC14B	98341192	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.513000	0.67037	2.595000	0.87683	0.650000	0.86243	GAA		0.343	CDC14B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053278.2		NM_033331		7	91	0	0	0	0.001984	0	7	91		
RXRA	6256	broad.mit.edu	37	9	137328351	137328351	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	Fluidigm;RNASeq			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr9:137328351C>T	ENST00000481739.1	+	10	1332	c.1280C>T	c.(1279-1281)tCc>tTc	p.S427F	RXRA_ENST00000540193.1_Missense_Mutation_p.S330F|RXRA_ENST00000356384.4_3'UTR	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha	427	Ligand-binding.				camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	GCTCTGCGCTCCATCGGGCTC	0.607																																						uc004cfb.2		NaN																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1279-1281)TCC>TTC		retinoid X receptor, alpha	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)						132.0	117.0	122.0					9																	137328351		2203	4300	6503	SO:0001583	missense	6256				cellular lipid metabolic process|cholesterol metabolic process|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid|vitamin metabolic process	nuclear chromatin|nucleoplasm	enzyme binding|ligand-regulated transcription factor activity|protein heterodimerization activity|retinoic acid-responsive element binding|retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|transcription coactivator activity|vitamin D receptor binding|zinc ion binding	g.chr9:137328351C>T	X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000481739.1:c.1280C>T	9.37:g.137328351C>T	ENSP00000419692:p.Ser427Phe					RXRA_uc004cfc.1_Missense_Mutation_p.S330F	p.S427F	NM_002957	NP_002948	P19793	RXRA_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	10	1442	+			427			Ligand-binding.		B3KY83|Q2NL52|Q2V504	Missense_Mutation	SNP	ENST00000481739.1	37	c.1280C>T	CCDS35172.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.825420	0.90955	.	.	ENSG00000186350	ENST00000481739;ENST00000540193	D;D	0.96940	-4.18;-4.18	4.76	4.76	0.60689	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98369	0.9458	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99744	1.1016	10	0.87932	D	0	.	17.7817	0.88526	0.0:1.0:0.0:0.0	.	427	P19793	RXRA_HUMAN	F	427;330	ENSP00000419692:S427F;ENSP00000442123:S330F	ENSP00000419692:S427F	S	+	2	0	RXRA	136468172	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.532000	0.81985	2.193000	0.70182	0.591000	0.81541	TCC		0.607	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054949.1		NM_002957		5	86	0	0	0	0.021553	0	5	86		
TPRN	286262	broad.mit.edu	37	9	140086816	140086816	+	Splice_Site	SNP	G	G	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chr9:140086816G>T	ENST00000409012.4	-	3	2054	c.1968C>A	c.(1966-1968)ggC>ggA	p.G656G	TPRN_ENST00000321773.2_Splice_Site_p.G595G|TPRN_ENST00000541945.1_5'Flank	NM_001128228.2	NP_001121700.2	Q4KMQ1	TPRN_HUMAN	taperin	656					sensory perception of sound (GO:0007605)	stereocilium (GO:0032420)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	8						AGCTGGACAGGCCTGTGAATG	0.672																																						uc004clt.2		NaN																	0					0						c.(1783-1785)GGC>GGA		hypothetical protein LOC286262 isoform 2							28.0	25.0	26.0					9																	140086816		2202	4299	6501	SO:0001630	splice_region_variant	286262				sensory perception of sound	stereocilium		g.chr9:140086816G>T	AK074735	CCDS56594.1	9q34.3	2011-01-06	2010-03-24	2010-03-24	ENSG00000176058	ENSG00000176058			26894	protein-coding gene	gene with protein product		613354	"""chromosome 9 open reading frame 75"", ""deafness, autosomal recessive 79"""	C9orf75, DFNB79		20170898, 20170899	Standard	NM_001128228		Approved	FLJ90254	uc004clu.3	Q4KMQ1	OTTHUMG00000020984	ENST00000409012.4:c.1967-1C>A	9.37:g.140086816G>T						TPRN_uc004clu.2_Silent_p.G595G	p.G595G	NM_173691	NP_775962	Q4KMQ1	TPRN_HUMAN			3	1785	-			656					B7ZKU5|Q5VSG5|Q5VSG6|Q6IPP2|Q8NCH2	Silent	SNP	ENST00000409012.4	37	c.1785C>A	CCDS56594.1																																																																																				0.672	TPRN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055323.3		NM_173691	Silent	5	23	1	0	1.23904e-05	0.014758	1.36839e-05	5	23		
SLC25A6	293	broad.mit.edu	37	X	1508489	1508489	+	Silent	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chrX:1508489G>A	ENST00000381401.5	-	2	957	c.243C>T	c.(241-243)taC>taT	p.Y81Y	SLC25A6_ENST00000475167.1_5'UTR	NM_001636.3	NP_001627.2	P12236	ADT3_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6	81					active induction of host immune response by virus (GO:0046732)|ADP transport (GO:0015866)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|cellular protein metabolic process (GO:0044267)|energy reserve metabolic process (GO:0006112)|modulation by virus of host morphology or physiology (GO:0019048)|protein targeting to mitochondrion (GO:0006626)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP:ADP antiporter activity (GO:0005471)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|upper_aerodigestive_tract(1)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Clodronate(DB00720)	GAGTGGGGAAGTAGCGAATGA	0.567																																						uc004cpt.2		NaN																	0					0						c.(241-243)TAC>TAT		adenine nucleotide translocator 3	Clodronate(DB00720)						276.0	255.0	262.0					X																	1508489		2203	4296	6499	SO:0001819	synonymous_variant	293				active induction of host immune response by virus|apoptosis|energy reserve metabolic process|regulation of insulin secretion|viral infectious cycle	integral to membrane|mitochondrial inner membrane presequence translocase complex	ATP:ADP antiporter activity|protein binding	g.chrX:1508489G>A	AY007135	CCDS14114.1	Xp22.32 and Yp11.3	2013-05-22			ENSG00000169100	ENSG00000169100		"""Pseudoautosomal regions / PAR1"", ""Solute carriers"""	10992	protein-coding gene	gene with protein product		300151, 403000		ANT3			Standard	NM_001636		Approved	ANT3Y, MGC17525	uc004cpt.3	P12236	OTTHUMG00000021058	ENST00000381401.5:c.243C>T	X.37:g.1508489G>A						SLC25A6_uc004cpu.2_RNA	p.Y81Y	NM_001636	NP_001627	P12236	ADT3_HUMAN			2	339	-		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	81			Solcar 1.|Helical; Name=2; (By similarity).		Q96C49	Silent	SNP	ENST00000381401.5	37	c.243C>T	CCDS14114.1																																																																																				0.567	SLC25A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055596.1		NM_001636		11	189	0	0	0	0.010729	0	11	189		
DDX53	168400	broad.mit.edu	37	X	23019978	23019978	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chrX:23019978G>A	ENST00000327968.5	+	1	1892	c.1804G>A	c.(1804-1806)Gag>Aag	p.E602K	RP11-40F8.2_ENST00000455399.1_lincRNA	NM_182699.3	NP_874358.2	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	602						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|RNA binding (GO:0003723)			breast(2)|endometrium(5)|kidney(4)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	35						AGTAATGGCTGAGCAATACAA	0.383																																						uc004daj.2		NaN																	0				large_intestine(1)|ovary(1)|kidney(1)	3						c.(1804-1806)GAG>AAG		DEAD (Asp-Glu-Ala-Asp) box polypeptide 53							62.0	60.0	61.0					X																	23019978		2203	4300	6503	SO:0001583	missense	168400					nucleus	ATP binding|ATP-dependent helicase activity|RNA binding	g.chrX:23019978G>A	AY039237	CCDS35214.1	Xp22.13	2009-03-25			ENSG00000184735	ENSG00000184735		"""DEAD-boxes"""	20083	protein-coding gene	gene with protein product	"""cancer associated gene"", ""cancer/testis antigen 26"""						Standard	NM_182699		Approved	CAGE, CT26	uc004daj.3	Q86TM3	OTTHUMG00000021248	ENST00000327968.5:c.1804G>A	X.37:g.23019978G>A	ENSP00000368667:p.Glu602Lys						p.E602K	NM_182699	NP_874358	Q86TM3	DDX53_HUMAN			1	1892	+			602					Q0D2N2|Q6NVV4	Missense_Mutation	SNP	ENST00000327968.5	37	c.1804G>A	CCDS35214.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.712052	0.30322	.	.	ENSG00000184735	ENST00000327968	T	0.21734	1.99	4.99	2.25	0.28309	.	0.287717	0.36200	N	0.002736	T	0.09905	0.0243	N	0.17901	0.54	0.09310	N	1	P	0.35348	0.496	B	0.29663	0.105	T	0.20273	-1.0280	10	0.56958	D	0.05	-0.1437	3.7893	0.08713	0.2894:0.0:0.5408:0.1698	.	602	Q86TM3	DDX53_HUMAN	K	602	ENSP00000368667:E602K	ENSP00000368667:E602K	E	+	1	0	DDX53	22929899	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.057000	0.14279	0.121000	0.18284	0.600000	0.82982	GAG		0.383	DDX53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056043.1		NM_182699		4	120	0	0	0	0.009096	0	4	120		
FAM47A	158724	broad.mit.edu	37	X	34149795	34149795	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chrX:34149795G>A	ENST00000346193.3	-	1	652	c.601C>T	c.(601-603)Cca>Tca	p.P201S		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	201	Pro-rich.									NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GGAGGCTCTGGGAGGAGATGG	0.617																																						uc004ddg.2		NaN																	0				ovary(4)|central_nervous_system(1)	5						c.(601-603)CCA>TCA		hypothetical protein LOC158724							49.0	52.0	51.0					X																	34149795		2201	4296	6497	SO:0001583	missense	158724							g.chrX:34149795G>A	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.601C>T	X.37:g.34149795G>A	ENSP00000345029:p.Pro201Ser						p.P201S	NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN			1	634	-			201			Pro-rich.		A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	c.601C>T	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	G	9.335	1.061595	0.19987	.	.	ENSG00000185448	ENST00000346193	T	0.22134	1.97	0.235	0.235	0.15431	.	.	.	.	.	T	0.16385	0.0394	L	0.59436	1.845	0.09310	N	1	P	0.41345	0.746	B	0.34093	0.175	T	0.13683	-1.0500	8	0.44086	T	0.13	.	.	.	.	.	201	Q5JRC9	FA47A_HUMAN	S	201	ENSP00000345029:P201S	ENSP00000345029:P201S	P	-	1	0	FAM47A	34059716	0.020000	0.18652	0.003000	0.11579	0.003000	0.03518	0.205000	0.17356	0.288000	0.22398	0.292000	0.19580	CCA		0.617	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1		NM_203408		3	64	0	0	0	0.004672	0	3	64		
ZNF630	57232	broad.mit.edu	37	X	47918817	47918817	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chrX:47918817C>G	ENST00000409324.3	-	5	1240	c.1014G>C	c.(1012-1014)caG>caC	p.Q338H	ZNF630_ENST00000276054.4_Missense_Mutation_p.Q214H|ZNF630-AS1_ENST00000436124.1_RNA|ZNF630_ENST00000442455.3_Missense_Mutation_p.Q324H	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	338					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						TATGGACTCTCTGATGAACAG	0.428																																						uc004div.3		NaN																	0				ovary(1)|lung(1)	2						c.(1012-1014)CAG>CAC		zinc finger protein 630							61.0	56.0	58.0					X																	47918817		2193	4288	6481	SO:0001583	missense	57232				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chrX:47918817C>G	AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.1014G>C	X.37:g.47918817C>G	ENSP00000386393:p.Gln338His					ZNF630_uc010nhz.1_Intron|ZNF630_uc004diw.2_Missense_Mutation_p.Q214H	p.Q338H	NM_001037735	NP_001032824	Q2M218	ZN630_HUMAN			5	1266	-			338			C2H2-type 3; degenerate.		F8WAG4|Q5H8Z5	Missense_Mutation	SNP	ENST00000409324.3	37	c.1014G>C	CCDS35237.2	.	.	.	.	.	.	.	.	.	.	.	14.05	2.420460	0.42918	.	.	ENSG00000221994	ENST00000442455;ENST00000276054;ENST00000409324	T;T;T	0.18502	2.21;2.21;2.21	2.31	1.41	0.22369	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25457	0.0619	L	0.39898	1.24	0.24851	N	0.992407	D	0.71674	0.998	D	0.63597	0.916	T	0.08659	-1.0711	9	0.56958	D	0.05	.	6.1807	0.20470	0.0:0.8246:0.0:0.1754	.	338	Q2M218	ZN630_HUMAN	H	324;214;338	ENSP00000393163:Q324H;ENSP00000354683:Q214H;ENSP00000386393:Q338H	ENSP00000354683:Q214H	Q	-	3	2	ZNF630	47803761	0.002000	0.14202	0.901000	0.35422	0.946000	0.59487	-0.073000	0.11468	0.221000	0.20879	0.544000	0.68410	CAG		0.428	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327254.1		NM_001037735		8	123	0	0	0	0.00308	0	8	123		
WDR13	64743	broad.mit.edu	37	X	48460204	48460204	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chrX:48460204G>A	ENST00000218056.5	+	6	1369	c.864G>A	c.(862-864)atG>atA	p.M288I	WDR13_ENST00000376729.5_Missense_Mutation_p.M288I	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	288						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						TGCATGTCATGAACATCTCCA	0.602																																						uc004dkh.1		NaN																	0				ovary(2)	2						c.(862-864)ATG>ATA		WD repeat domain 13 protein							69.0	51.0	57.0					X																	48460204		2203	4300	6503	SO:0001583	missense	64743					cytoplasm|nucleus		g.chrX:48460204G>A	AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.864G>A	X.37:g.48460204G>A	ENSP00000218056:p.Met288Ile					WDR13_uc010nif.1_Missense_Mutation_p.M166I|WDR13_uc004dki.1_Missense_Mutation_p.M196I|WDR13_uc004dkj.1_Missense_Mutation_p.M288I|WDR13_uc004dkk.1_Missense_Mutation_p.M196I|WDR13_uc004dkl.3_Missense_Mutation_p.M196I	p.M288I	NM_017883	NP_060353	Q9H1Z4	WDR13_HUMAN			7	1011	+			288					Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	ENST00000218056.5	37	c.864G>A	CCDS14302.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.050468	0.36181	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.64085	-0.08;-0.08	5.4	4.53	0.55603	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.431887	0.28841	N	0.013961	T	0.41719	0.1171	N	0.05078	-0.115	0.35932	D	0.832607	B	0.02656	0.0	B	0.06405	0.002	T	0.44982	-0.9292	10	0.56958	D	0.05	-2.9095	12.9272	0.58266	0.0:0.16:0.84:0.0	.	288	Q9H1Z4	WDR13_HUMAN	I	288	ENSP00000365919:M288I;ENSP00000218056:M288I	ENSP00000218056:M288I	M	+	3	0	WDR13	48345148	1.000000	0.71417	0.999000	0.59377	0.905000	0.53344	3.716000	0.54904	1.049000	0.40321	0.431000	0.28591	ATG		0.602	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060743.2				3	32	0	0	0	0.009096	0	3	32		
USP51	158880	broad.mit.edu	37	X	55514287	55514287	+	Silent	SNP	C	C	G			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chrX:55514287C>G	ENST00000500968.3	-	2	1168	c.1086G>C	c.(1084-1086)ctG>ctC	p.L362L	USP51_ENST00000586165.1_5'UTR	NM_201286.3	NP_958443.1	Q70EK9	UBP51_HUMAN	ubiquitin specific peptidase 51	362					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30						TTAGCCCTCTCAGGCCTACAG	0.403																																						uc004dun.1		NaN																	0				ovary(1)|lung(1)|breast(1)	3						c.(1084-1086)CTG>CTC		ubiquitin specific protease 51							112.0	108.0	109.0					X																	55514287		2203	4300	6503	SO:0001819	synonymous_variant	158880				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding	g.chrX:55514287C>G	BF741256	CCDS14370.1	Xp11	2009-03-19	2005-08-08		ENSG00000247746	ENSG00000247746		"""Ubiquitin-specific peptidases"""	23086	protein-coding gene	gene with protein product			"""ubiquitin specific protease 51"""			12838346	Standard	NM_201286		Approved		uc004dun.2	Q70EK9	OTTHUMG00000021656	ENST00000500968.3:c.1086G>C	X.37:g.55514287C>G						USP51_uc011moo.1_Silent_p.L66L	p.L362L	NM_201286	NP_958443	Q70EK9	UBP51_HUMAN			2	1165	-			362					Q8IWJ8	Silent	SNP	ENST00000500968.3	37	c.1086G>C	CCDS14370.1																																																																																				0.403	USP51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056871.2		NM_201286		15	223	0	0	0	0.020292	0	15	223		
ATRX	546	broad.mit.edu	37	X	76939952	76939952	+	Missense_Mutation	SNP	A	A	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chrX:76939952A>T	ENST00000373344.5	-	9	1010	c.796T>A	c.(796-798)Tac>Aac	p.Y266N	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.Y228N	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	266	ADD. {ECO:0000255|PROSITE- ProRule:PRU00865}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TGACAAATGTAGCAATACCAT	0.388			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																															uc004ecp.3		NaN		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		1	Unknown(1)		bone(1)	haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(796-798)TAC>AAC		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						162.0	149.0	154.0					X																	76939952		2203	4296	6499	SO:0001583	missense	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76939952A>T	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.796T>A	X.37:g.76939952A>T	ENSP00000362441:p.Tyr266Asn					ATRX_uc004ecq.3_Missense_Mutation_p.Y228N|ATRX_uc004eco.3_Missense_Mutation_p.Y51N|ATRX_uc004ecr.2_Missense_Mutation_p.Y227N|ATRX_uc010nlx.1_Missense_Mutation_p.Y266N|ATRX_uc010nly.1_Missense_Mutation_p.Y211N	p.Y266N	NM_000489	NP_000480	P46100	ATRX_HUMAN			9	1028	-			266			ADD.|PHD-type; atypical.		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	c.796T>A	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	A	13.37	2.216144	0.39201	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	D;D	0.99042	-5.36;-5.36	5.52	5.52	0.82312	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000001	D	0.99149	0.9706	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.99647	1.0990	10	0.87932	D	0	-5.3373	14.6389	0.68708	1.0:0.0:0.0:0.0	.	266;227;228;266	A4LAA3;P46100-6;P46100-4;P46100	.;.;.;ATRX_HUMAN	N	266;228;222	ENSP00000362441:Y266N;ENSP00000378967:Y228N	ENSP00000362441:Y266N	Y	-	1	0	ATRX	76826608	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	1.838000	0.53458	0.417000	0.27973	TAC		0.388	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2		NM_000489		7	448	0	0	0	0.001984	0	7	448		
STAG2	10735	broad.mit.edu	37	X	123179197	123179197	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	Fluidigm;RNASeq			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chrX:123179197C>T	ENST00000371160.1	+	8	936	c.646C>T	c.(646-648)Cga>Tga	p.R216*	STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Nonsense_Mutation_p.R216*|STAG2_ENST00000371157.3_Nonsense_Mutation_p.R216*|STAG2_ENST00000371144.3_Nonsense_Mutation_p.R216*|STAG2_ENST00000371145.3_Nonsense_Mutation_p.R216*|STAG2_ENST00000354548.5_Nonsense_Mutation_p.R147*	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	216					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						CAGAGCATTTCGACATACAAG	0.343																																						uc004etz.3		NaN																	0				ovary(4)|skin(1)	5						c.(646-648)CGA>TGA		stromal antigen 2 isoform b							133.0	126.0	129.0					X																	123179197		2203	4300	6503	SO:0001587	stop_gained	10735				cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding	g.chrX:123179197C>T	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.646C>T	X.37:g.123179197C>T	ENSP00000360202:p.Arg216*					STAG2_uc004eua.2_Nonsense_Mutation_p.R216*|STAG2_uc004eub.2_Nonsense_Mutation_p.R216*|STAG2_uc004euc.2_Nonsense_Mutation_p.R216*|STAG2_uc004eud.2_Nonsense_Mutation_p.R216*|STAG2_uc004eue.2_Nonsense_Mutation_p.R216*	p.R216*	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN			7	985	+			216					B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Nonsense_Mutation	SNP	ENST00000371160.1	37	c.646C>T	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	C	37	6.052955	0.97241	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	.	.	.	4.95	4.03	0.46877	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.371	14.3204	0.66482	0.1482:0.8518:0.0:0.0	.	.	.	.	X	216;216;147;216;216;216;216	.	ENSP00000218089:R216X	R	+	1	2	STAG2	123006878	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.163000	0.50763	2.167000	0.68274	0.422000	0.28245	CGA		0.343	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2		NM_006603		20	335	0	0	0	0.010504	0	20	335		
KDM6A	7403	broad.mit.edu	37	X	44938507	44938507	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08			A	-	A	A		Valid	Somatic	Phase_I	WXS	Fluidigm			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chrX:44938507delA	ENST00000377967.4	+	20	3096	c.3055delA	c.(3055-3057)aaafs	p.K1019fs	KDM6A_ENST00000536777.1_Frame_Shift_Del_p.K974fs|KDM6A_ENST00000382899.4_Frame_Shift_Del_p.K1026fs|KDM6A_ENST00000543216.1_Frame_Shift_Del_p.K940fs	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	1019	Interaction with SUPT6H. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						TGGAACAAAGAAAATCTGGCA	0.398			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																Colon(129;1273 1667 15230 27352 52914)	uc004dge.3		NaN		Rec	yes		X	Xp11.2	7403	D|N|F|S	"""lysine (K)-specific demethylase 6A, UTX"""			"""E, L"""			renal|oesophageal SCC|MM		6	Whole gene deletion(6)		oesophagus(2)|breast(2)|pancreas(2)	kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						c.(3055-3057)AAAfs		ubiquitously transcribed tetratricopeptide							135.0	110.0	119.0					X																	44938507		2203	4300	6503	SO:0001589	frameshift_variant	7403				histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chrX:44938507delA	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.3055delA	X.37:g.44938507delA	ENSP00000367203:p.Lys1019fs					KDM6A_uc010nhk.2_Frame_Shift_Del_p.K985fs|KDM6A_uc011mkz.1_Frame_Shift_Del_p.K1071fs|KDM6A_uc011mla.1_Frame_Shift_Del_p.K974fs|KDM6A_uc011mlb.1_Frame_Shift_Del_p.K1026fs|KDM6A_uc011mlc.1_Frame_Shift_Del_p.K723fs|KDM6A_uc011mld.1_Frame_Shift_Del_p.K658fs	p.K1019fs	NM_021140	NP_066963	O15550	KDM6A_HUMAN			20	3430	+			1019					Q52LL9|Q5JVQ7	Frame_Shift_Del	DEL	ENST00000377967.4	37	c.3055delA	CCDS14265.1																																																																																				0.398	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1		NM_021140		7	106	NaN	NaN	NaN	NaN	NaN	7	106	---	---
F8	2157	broad.mit.edu	37	X	154197729	154197729	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A1AF-01A-11D-A13W-08	TCGA-DK-A1AF-10A-01D-A13W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbdcd7f9-1901-4e90-8e3c-71b05dc96da1	303b1fd2-d7a6-4166-a8a9-6f4677850cdd	g.chrX:154197729G>A	ENST00000360256.4	-	7	1086	c.886C>T	c.(886-888)Ctt>Ttt	p.L296F	F8_ENST00000483822.1_5'Flank	NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	296	F5/8 type A 1.|Plastocyanin-like 2.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TTCCTCACAAGAAATGTGTGA	0.463																																						uc004fmt.2		NaN																	0				ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	GRCh37	CM073053	F8	M		c.(886-888)CTT>TTT		coagulation factor VIII isoform a precursor	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)						160.0	139.0	146.0					X																	154197729		2203	4300	6503	SO:0001583	missense	2157				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding	g.chrX:154197729G>A	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.886C>T	X.37:g.154197729G>A	ENSP00000353393:p.Leu296Phe						p.L296F	NM_000132	NP_000123	P00451	FA8_HUMAN			7	1057	-	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		296			Plastocyanin-like 2.|F5/8 type A 1.		Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	c.886C>T	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	G	12.94	2.087985	0.36855	.	.	ENSG00000185010	ENST00000360256	D	0.99784	-6.74	5.51	4.65	0.58169	Cupredoxin (2);Multicopper oxidase, type 1 (1);	0.477632	0.22551	N	0.058592	D	0.99354	0.9773	M	0.85373	2.75	0.28863	N	0.895412	P	0.34864	0.473	B	0.39419	0.299	D	0.99956	1.1637	10	0.27082	T	0.32	-5.2721	10.2927	0.43605	0.0945:0.0:0.9055:0.0	.	296	P00451	FA8_HUMAN	F	296	ENSP00000353393:L296F	ENSP00000353393:L296F	L	-	1	0	F8	153850923	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.223000	0.42936	1.090000	0.41315	0.544000	0.68410	CTT		0.463	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4				12	195	0	0	0	0.028581	0	12	195		
