#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABHD4	63874	genome.wustl.edu	37	14	23078768	23078768	+	Silent	SNP	G	G	A	rs185929512	byFrequency	TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr14:23078768G>A	ENST00000428304.2	+	6	961	c.891G>A	c.(889-891)acG>acA	p.T297T		NM_022060.2	NP_071343.2	Q8TB40	ABHD4_HUMAN	abhydrolase domain containing 4	297					lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(3)|lung(3)|prostate(1)	14	all_cancers(95;5.49e-05)			GBM - Glioblastoma multiforme(265;0.0153)		ATACCAGTACGGGAAAAAAGG	0.517													G|||	2	0.000399361	0.0	0.0	5008	,	,		19630	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													91.0	82.0	85.0					14																	23078768		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022878	CCDS9572.1	14q11.1	2006-10-06			ENSG00000100439	ENSG00000100439		"""Abhydrolase domain containing"""	20154	protein-coding gene	gene with protein product							Standard	NM_022060		Approved	FLJ12816	uc001wgm.3	Q8TB40	OTTHUMG00000028686	ENST00000428304.2:c.891G>A	14.37:g.23078768G>A			B4DDH7|Q9H9E0	Silent	SNP	pfam_AB_hydrolase_1,prints_AB_hydrolase_1	p.T297	ENST00000428304.2	37	c.891	CCDS9572.1	14																																																																																			ABHD4	-	pfam_AB_hydrolase_1	ENSG00000100439		0.517	ABHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD4	HGNC	protein_coding	OTTHUMT00000071623.3	132	0.00	0	G			23078768	23078768	+1	no_errors	ENST00000428304	ensembl	human	known	69_37n	silent	126	30.98	57	SNP	0.047	A
ACVR2A	92	genome.wustl.edu	37	2	148657066	148657066	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr2:148657066delT	ENST00000241416.7	+	3	939	c.303delT	c.(301-303)tatfs	p.Y101fs	AC009480.3_ENST00000402410.2_RNA|ACVR2A_ENST00000404590.1_Frame_Shift_Del_p.Y101fs|ACVR2A_ENST00000535787.1_5'UTR	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	101					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		CTGAAGTATATTTTTGTTGCT	0.333																																						dbGAP											0													121.0	128.0	125.0					2																	148657066		2200	4299	6499	-	-	-	SO:0001589	frameshift_variant	0				CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.303delT	2.37:g.148657066delT	ENSP00000241416:p.Tyr101fs		B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Activin_II/TGFBeta-II_recpt	p.C103fs	ENST00000241416.7	37	c.303	CCDS33301.1	2																																																																																			ACVR2A	-	pfam_Activin_rcpt,prints_Activin_II/TGFBeta-II_recpt	ENSG00000121989		0.333	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR2A	HGNC	protein_coding	OTTHUMT00000319051.1	136	0.00	0	T	NM_001616		148657066	148657066	+1	no_errors	ENST00000241416	ensembl	human	known	69_37n	frame_shift_del	182	39.47	120	DEL	1.000	-
ADAD1	132612	genome.wustl.edu	37	4	123304955	123304955	+	Splice_Site	SNP	T	T	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr4:123304955T>G	ENST00000296513.2	+	5	548	c.363T>G	c.(361-363)ggT>ggG	p.G121G	ADAD1_ENST00000492454.1_3'UTR|ADAD1_ENST00000388725.2_Splice_Site_p.G103G|ADAD1_ENST00000388724.2_Splice_Site_p.G121G	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	121	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						TTTTTCAAGGTAATGTTATGG	0.338																																						dbGAP											0													155.0	150.0	152.0					4																	123304955		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.362-1T>G	4.37:g.123304955T>G			A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Silent	SNP	pfam_A_deamin,pfam_Ds-RNA-bd,smart_Ds-RNA-bd,smart_A_deamin,pfscan_Ds-RNA-bd,pfscan_A_deamin	p.G121	ENST00000296513.2	37	c.363	CCDS34058.1	4																																																																																			ADAD1	-	pfam_Ds-RNA-bd,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd	ENSG00000164113		0.338	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAD1	HGNC	protein_coding	OTTHUMT00000316452.1	226	0.00	0	T	NM_139243	Silent	123304955	123304955	+1	no_errors	ENST00000296513	ensembl	human	known	69_37n	silent	258	37.68	156	SNP	0.989	G
AKAP4	8852	genome.wustl.edu	37	X	49957298	49957298	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chrX:49957298A>T	ENST00000376056.2	-	5	2189	c.2039T>A	c.(2038-2040)aTg>aAg	p.M680K	AKAP4_ENST00000376064.3_Missense_Mutation_p.M680K|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Missense_Mutation_p.M306K|AKAP4_ENST00000358526.2_Missense_Mutation_p.M689K					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					CGCTTGCTTCATCCCACTGGT	0.478																																						dbGAP											0													126.0	92.0	104.0					X																	49957298		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.2039T>A	X.37:g.49957298A>T	ENSP00000365224:p.Met680Lys			Missense_Mutation	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.M689K	ENST00000376056.2	37	c.2066	CCDS14330.1	X	.	.	.	.	.	.	.	.	.	.	A	6.948	0.544648	0.13312	.	.	ENSG00000147081	ENST00000376056;ENST00000376058;ENST00000358526;ENST00000376064	T;T;T;T	0.08102	3.13;3.13;3.13;3.13	5.14	5.14	0.70334	A-kinase anchor 110kDa, C-terminal (1);	0.174372	0.40818	N	0.001003	T	0.17959	0.0431	L	0.51422	1.61	0.31866	N	0.620382	P;D	0.63880	0.586;0.993	B;P	0.60012	0.227;0.867	T	0.06499	-1.0823	9	.	.	.	-6.0556	10.3763	0.44083	1.0:0.0:0.0:0.0	.	689;306	Q5JQC9;A6ND82	AKAP4_HUMAN;.	K	680;306;689;680	ENSP00000365224:M680K;ENSP00000365226:M306K;ENSP00000351327:M689K;ENSP00000365232:M680K	.	M	-	2	0	AKAP4	49844038	0.998000	0.40836	0.997000	0.53966	0.040000	0.13550	3.596000	0.54024	1.718000	0.51419	0.430000	0.28490	ATG	AKAP4	-	pfam_AKAP_110_C,smart_AKAP_110	ENSG00000147081		0.478	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP4	HGNC	protein_coding	OTTHUMT00000056552.1	164	0.00	0	A	NM_003886		49957298	49957298	-1	no_errors	ENST00000358526	ensembl	human	known	69_37n	missense	205	18.65	47	SNP	0.997	T
AKAP9	10142	genome.wustl.edu	37	7	91690649	91690649	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr7:91690649C>G	ENST00000359028.2	+	24	5938	c.5713C>G	c.(5713-5715)Ctt>Gtt	p.L1905V	AKAP9_ENST00000358100.2_Missense_Mutation_p.L1905V|AKAP9_ENST00000356239.3_Missense_Mutation_p.L1893V|AKAP9_ENST00000491695.1_3'UTR			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1905	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.L1905fs*3(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AACAGAGTCCCTTAAGTGCCA	0.478			T	BRAF	papillary thyroid																																	dbGAP		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	1	Insertion - Frameshift(1)	large_intestine(1)											93.0	88.0	90.0					7																	91690649		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.5713C>G	7.37:g.91690649C>G	ENSP00000351922:p.Leu1905Val		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB-like	p.L1905V	ENST00000359028.2	37	c.5713		7	.	.	.	.	.	.	.	.	.	.	C	12.67	2.006711	0.35415	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000265737	T;T;T	0.03982	3.75;3.74;3.74	5.69	4.81	0.61882	.	0.000000	0.35555	N	0.003135	T	0.04724	0.0128	L	0.35487	1.065	0.43868	D	0.996477	B;B;B	0.32128	0.244;0.357;0.357	B;B;B	0.33339	0.078;0.162;0.162	T	0.51818	-0.8657	10	0.23891	T	0.37	.	10.715	0.46006	0.1385:0.7914:0.0:0.0701	.	1905;1893;1893	Q99996;Q99996-2;Q99996-3	AKAP9_HUMAN;.;.	V	1893;1905;1905;1905;108	ENSP00000348573:L1893V;ENSP00000351922:L1905V;ENSP00000350813:L1905V	ENSP00000265737:L108V	L	+	1	0	AKAP9	91528585	0.998000	0.40836	1.000000	0.80357	0.835000	0.47333	2.799000	0.47892	1.545000	0.49373	0.655000	0.94253	CTT	AKAP9	-	NULL	ENSG00000127914		0.478	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		66	0.00	0	C	NM_005751		91690649	91690649	+1	no_errors	ENST00000359028	ensembl	human	known	69_37n	missense	120	16.55	24	SNP	1.000	G
ANKRD20A4	728747	genome.wustl.edu	37	9	69423558	69423558	+	Silent	SNP	C	C	T	rs199996482		TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr9:69423558C>T	ENST00000357336.3	+	15	2135	c.1854C>T	c.(1852-1854)agC>agT	p.S618S		NM_001098805.1	NP_001092275.1	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4	618										breast(1)|large_intestine(1)|liver(1)|lung(9)|pancreas(2)|skin(2)	16						CTGCTATAAGCAAACACAGTG	0.378																																						dbGAP											0													5.0	8.0	7.0					9																	69423558		1307	3030	4337	-	-	-	SO:0001819	synonymous_variant	0				CCDS43828.1	9q21.11	2013-01-10			ENSG00000172014	ENSG00000172014		"""Ankyrin repeat domain containing"""	31982	protein-coding gene	gene with protein product							Standard	NM_001098805		Approved	OTTHUMG00000066855	uc004afn.3	Q4UJ75	OTTHUMG00000066855	ENST00000357336.3:c.1854C>T	9.37:g.69423558C>T				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S618	ENST00000357336.3	37	c.1854	CCDS43828.1	9																																																																																			ANKRD20A4	-	NULL	ENSG00000172014		0.378	ANKRD20A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A4	HGNC	protein_coding	OTTHUMT00000143287.3	34	0.00	0	C	NM_001098805		69423558	69423558	+1	no_errors	ENST00000357336	ensembl	human	known	69_37n	silent	80	13.04	12	SNP	0.000	T
ASB9	140462	genome.wustl.edu	37	X	15267033	15267033	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chrX:15267033C>T	ENST00000380488.4	-	6	866	c.593G>A	c.(592-594)gGt>gAt	p.G198D	ASB9_ENST00000473862.1_5'UTR|ASB9_ENST00000380483.3_Missense_Mutation_p.G188D|ASB9_ENST00000380485.3_Missense_Mutation_p.G198D|ASB9_ENST00000546332.1_Missense_Mutation_p.G198D	NM_001031739.2	NP_001026909.1	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box containing 9	198					intracellular signal transduction (GO:0035556)|positive regulation of protein catabolic process (GO:0045732)|protein ubiquitination (GO:0016567)	mitochondrion (GO:0005739)				breast(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(10)	15	Hepatocellular(33;0.183)					GGAATCCTGACCTTTCCCTTG	0.547													C|||	5	0.0013245	0.0038	0.0	3775	,	,		13791	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													73.0	59.0	64.0					X																	15267033		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000643	CCDS14163.1, CCDS35208.1, CCDS55372.1	Xp22.2	2013-01-10	2011-01-25		ENSG00000102048	ENSG00000102048		"""Ankyrin repeat domain containing"""	17184	protein-coding gene	gene with protein product		300890	"""ankyrin repeat and SOCS box-containing 9"""			12076535	Standard	NM_001031739		Approved	DKFZP564L0862, MGC4954, FLJ20636	uc004cwl.3	Q96DX5	OTTHUMG00000021172	ENST00000380488.4:c.593G>A	X.37:g.15267033C>T	ENSP00000369855:p.Gly198Asp		A8K8A5|Q9BVF5|Q9NWS5|Q9Y4T3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.G198D	ENST00000380488.4	37	c.593	CCDS35208.1	X	.	.	.	.	.	.	.	.	.	.	C	11.14	1.549952	0.27652	.	.	ENSG00000102048	ENST00000380483;ENST00000380485;ENST00000380488;ENST00000546332	T;T;T;T	0.49432	0.78;0.78;0.78;0.78	5.83	2.7	0.31948	Ankyrin repeat-containing domain (3);	0.485871	0.24843	N	0.035150	T	0.18130	0.0435	N	0.02403	-0.565	0.18873	N	0.999984	B;B;B;B	0.20887	0.025;0.006;0.006;0.049	B;B;B;B	0.24701	0.055;0.016;0.012;0.052	T	0.32903	-0.9889	10	0.02654	T	1	-13.4312	9.2364	0.37468	0.0:0.6588:0.0:0.3412	.	169;188;198;198	Q7Z4A2;Q9BVF5;Q96DX5;Q96DX5-2	.;.;ASB9_HUMAN;.	D	188;198;198;198	ENSP00000369850:G188D;ENSP00000369852:G198D;ENSP00000369855:G198D;ENSP00000438943:G198D	ENSP00000369850:G188D	G	-	2	0	ASB9	15176954	0.186000	0.23225	0.012000	0.15200	0.179000	0.23085	0.473000	0.22132	0.606000	0.29965	0.600000	0.82982	GGT	ASB9	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000102048		0.547	ASB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB9	HGNC	protein_coding	OTTHUMT00000055844.1	68	0.00	0	C			15267033	15267033	-1	no_errors	ENST00000380488	ensembl	human	known	69_37n	missense	74	12.79	11	SNP	0.023	T
ATF4	468	genome.wustl.edu	37	22	39917510	39917510	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr22:39917510C>G	ENST00000337304.2	+	1	942	c.60C>G	c.(58-60)ttC>ttG	p.F20L	ATF4_ENST00000404241.2_Missense_Mutation_p.F20L|ATF4_ENST00000396680.1_Missense_Mutation_p.F20L	NM_001675.2	NP_001666.2	P18848	ATF4_HUMAN	activating transcription factor 4	20					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular amino acid metabolic process (GO:0006520)|cellular protein metabolic process (GO:0044267)|circadian regulation of gene expression (GO:0032922)|endoplasmic reticulum unfolded protein response (GO:0030968)|gamma-aminobutyric acid signaling pathway (GO:0007214)|gluconeogenesis (GO:0006094)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990440)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to endoplasmic reticulum stress (GO:0034976)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|Lewy body core (GO:1990037)|neuron projection (GO:0043005)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	Melanoma(58;0.04)				Pseudoephedrine(DB00852)	TGTCCCCCTTCGACCAGTCGG	0.537																																						dbGAP											0													64.0	64.0	64.0					22																	39917510		2203	4300	6503	-	-	-	SO:0001583	missense	0			D90209	CCDS13996.1	22q13.1	2013-05-23	2013-05-23		ENSG00000128272	ENSG00000128272		"""basic leucine zipper proteins"""	786	protein-coding gene	gene with protein product	"""tax-responsive enhancer element B67"""	604064	"""activating transcription factor 4 (tax-responsive enhancer element B67)"""	TXREB		1847461, 1534408	Standard	NM_182810		Approved	TAXREB67, CREB-2	uc003axz.3	P18848	OTTHUMG00000151099	ENST00000337304.2:c.60C>G	22.37:g.39917510C>G	ENSP00000336790:p.Phe20Leu		Q9UH31	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,smart_bZIP,pfscan_bZIP	p.F20L	ENST00000337304.2	37	c.60	CCDS13996.1	22	.	.	.	.	.	.	.	.	.	.	C	21.6	4.177293	0.78564	.	.	ENSG00000128272	ENST00000404241;ENST00000337304;ENST00000396680	T;T;T	0.52295	0.67;0.67;0.67	4.37	3.3	0.37823	.	0.062027	0.64402	D	0.000003	T	0.49966	0.1588	M	0.72894	2.215	0.47994	D	0.999566	D	0.57899	0.981	B	0.43916	0.436	T	0.63359	-0.6655	10	0.87932	D	0	-15.9318	14.198	0.65684	0.0:0.8499:0.15:0.0	.	20	P18848	ATF4_HUMAN	L	20	ENSP00000384587:F20L;ENSP00000336790:F20L;ENSP00000379912:F20L	ENSP00000336790:F20L	F	+	3	2	ATF4	38247456	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.716000	0.54904	1.983000	0.57843	0.561000	0.74099	TTC	ATF4	-	NULL	ENSG00000128272		0.537	ATF4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ATF4	HGNC	protein_coding	OTTHUMT00000321305.1	42	0.00	0	C	NM_001675		39917510	39917510	+1	no_errors	ENST00000337304	ensembl	human	known	69_37n	missense	71	12.35	10	SNP	1.000	G
BIN2	51411	genome.wustl.edu	37	12	51696916	51696916	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr12:51696916G>A	ENST00000267012.4	-	3	233	c.172C>T	c.(172-174)Cac>Tac	p.H58Y	BIN2_ENST00000604560.1_Missense_Mutation_p.H31Y|BIN2_ENST00000544402.1_Missense_Mutation_p.H32Y|BIN2_ENST00000452142.2_Missense_Mutation_p.H58Y	NM_016293.2	NP_057377.2	Q9UBW5	BIN2_HUMAN	bridging integrator 2	58	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				cell chemotaxis (GO:0060326)|membrane tubulation (GO:0097320)|phagocytosis, engulfment (GO:0006911)|podosome assembly (GO:0071800)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|podosome (GO:0002102)	phospholipid binding (GO:0005543)			NS(2)|breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(3)	31						TACAGCTTGTGGCCTTCTGCC	0.428																																						dbGAP											0													120.0	110.0	113.0					12																	51696916		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF146531	CCDS8811.1	12q13.13	2012-01-23			ENSG00000110934	ENSG00000110934			1053	protein-coding gene	gene with protein product		605936				10903846	Standard	XM_005268957		Approved	BRAP-1	uc001ryg.3	Q9UBW5		ENST00000267012.4:c.172C>T	12.37:g.51696916G>A	ENSP00000267012:p.His58Tyr		Q86VV0|Q9NWK4|Q9UKN4	Missense_Mutation	SNP	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom,prints_Amphiphysin	p.H58Y	ENST00000267012.4	37	c.172	CCDS8811.1	12	.	.	.	.	.	.	.	.	.	.	G	0.648	-0.810846	0.02798	.	.	ENSG00000110934	ENST00000452142;ENST00000267012;ENST00000544402	T;T;T	0.62941	-0.01;-0.01;-0.01	4.61	0.676	0.17958	BAR (3);	0.907796	0.09413	N	0.805521	T	0.37598	0.1009	N	0.03608	-0.345	0.23510	N	0.997524	B;B;B	0.10296	0.001;0.002;0.003	B;B;B	0.09377	0.002;0.002;0.004	T	0.21280	-1.0250	10	0.38643	T	0.18	-1.3147	10.3602	0.43989	0.3139:0.0:0.6861:0.0	.	32;58;58	F5H0W4;Q9UBW5-2;Q9UBW5	.;.;BIN2_HUMAN	Y	58;58;32	ENSP00000410217:H58Y;ENSP00000267012:H58Y;ENSP00000445874:H32Y	ENSP00000267012:H58Y	H	-	1	0	BIN2	49983183	0.998000	0.40836	0.933000	0.37362	0.925000	0.55904	0.363000	0.20301	-0.187000	0.10516	-2.049000	0.00408	CAC	BIN2	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom,prints_Amphiphysin	ENSG00000110934		0.428	BIN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BIN2	HGNC	protein_coding	OTTHUMT00000469800.1	117	0.00	0	G			51696916	51696916	-1	no_errors	ENST00000267012	ensembl	human	known	69_37n	missense	127	13.01	19	SNP	0.991	A
BVES	11149	genome.wustl.edu	37	6	105573408	105573408	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr6:105573408C>T	ENST00000314641.5	-	4	613	c.397G>A	c.(397-399)Gaa>Aaa	p.E133K	BVES_ENST00000336775.5_Missense_Mutation_p.E133K|BVES_ENST00000446408.2_Missense_Mutation_p.E133K	NM_001199563.1	NP_001186492.1	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance	133					epithelial cell-cell adhesion (GO:0090136)|hematopoietic progenitor cell differentiation (GO:0002244)|muscle organ development (GO:0007517)|positive regulation of locomotion (GO:0040017)|positive regulation of receptor recycling (GO:0001921)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|regulation of Rac GTPase activity (GO:0032314)|sinoatrial node cell development (GO:0060931)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cAMP binding (GO:0030552)|structural molecule activity (GO:0005198)			NS(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|urinary_tract(1)	21		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				CGGAGTGGTTCAAACAATCGC	0.443																																						dbGAP											0													148.0	142.0	144.0					6																	105573408		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF124512	CCDS5051.1	6q21	2008-11-25			ENSG00000112276	ENSG00000112276			1152	protein-coding gene	gene with protein product	"""popeye domain containing 1"""	604577				10441744, 10882522	Standard	NM_147147		Approved	HBVES, POP1, POPDC1	uc003pqx.3	Q8NE79	OTTHUMG00000015291	ENST00000314641.5:c.397G>A	6.37:g.105573408C>T	ENSP00000313172:p.Glu133Lys		A8K1R4|E1P5D8|Q5T550|Q5T551|Q8IWC6|Q9HBV0|Q9UNG6	Missense_Mutation	SNP	pfam_Popeye_prot,superfamily_cNMP-bd-like	p.E133K	ENST00000314641.5	37	c.397	CCDS5051.1	6	.	.	.	.	.	.	.	.	.	.	C	17.03	3.284337	0.59867	.	.	ENSG00000112276	ENST00000314641;ENST00000336775;ENST00000446408	T;T;T	0.28069	1.63;1.63;1.63	5.71	5.71	0.89125	.	0.043880	0.85682	D	0.000000	T	0.15219	0.0367	N	0.20986	0.625	0.58432	D	0.999999	P	0.35684	0.515	B	0.42112	0.376	T	0.04203	-1.0969	10	0.08837	T	0.75	-26.6629	19.8324	0.96640	0.0:1.0:0.0:0.0	.	133	Q8NE79	POPD1_HUMAN	K	133	ENSP00000313172:E133K;ENSP00000337259:E133K;ENSP00000397310:E133K	ENSP00000313172:E133K	E	-	1	0	BVES	105680101	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.567000	0.60850	2.680000	0.91292	0.655000	0.94253	GAA	BVES	-	pfam_Popeye_prot	ENSG00000112276		0.443	BVES-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BVES	HGNC	protein_coding	OTTHUMT00000406075.1	79	0.00	0	C	NM_147147		105573408	105573408	-1	no_errors	ENST00000314641	ensembl	human	known	69_37n	missense	164	17.59	35	SNP	1.000	T
C10orf71	118461	genome.wustl.edu	37	10	50532310	50532310	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr10:50532310A>G	ENST00000374144.3	+	3	2008	c.1720A>G	c.(1720-1722)Aag>Gag	p.K574E	C10orf71_ENST00000323868.4_Missense_Mutation_p.K574E			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	574										endometrium(1)	1						CAATCCCCAGAAGGACCCTAC	0.547																																						dbGAP											0													45.0	45.0	45.0					10																	50532310		1991	4170	6161	-	-	-	SO:0001583	missense	0			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.1720A>G	10.37:g.50532310A>G	ENSP00000363259:p.Lys574Glu		A0AVL8	Missense_Mutation	SNP	NULL	p.K574E	ENST00000374144.3	37	c.1720	CCDS44387.1	10	.	.	.	.	.	.	.	.	.	.	A	18.79	3.699074	0.68501	.	.	ENSG00000177354	ENST00000323868;ENST00000374144	T;T	0.15017	2.46;3.6	5.26	-1.35	0.09114	.	0.419365	0.17485	N	0.172578	T	0.11879	0.0289	L	0.51422	1.61	0.09310	N	0.999999	B	0.20052	0.041	B	0.17722	0.019	T	0.26224	-1.0109	10	0.24483	T	0.36	.	4.9888	0.14203	0.5046:0.2749:0.2205:0.0	.	574	Q711Q0-3	.	E	574	ENSP00000318713:K574E;ENSP00000363259:K574E	ENSP00000318713:K574E	K	+	1	0	C10orf71	50202316	0.750000	0.28316	0.247000	0.24249	0.284000	0.27059	0.689000	0.25437	-0.009000	0.14296	0.482000	0.46254	AAG	C10orf71	-	NULL	ENSG00000177354		0.547	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C10orf71	HGNC	protein_coding	OTTHUMT00000047984.2	129	0.00	0	A	NM_199459		50532310	50532310	+1	no_errors	ENST00000374144	ensembl	human	known	69_37n	missense	44	16.98	9	SNP	0.251	G
MROH8	140699	genome.wustl.edu	37	20	35737007	35737007	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr20:35737007T>C	ENST00000400441.3	-	23	2974	c.2975A>G	c.(2974-2976)gAg>gGg	p.E992G	MROH8_ENST00000441008.2_3'UTR|MROH8_ENST00000466091.1_5'UTR|MROH8_ENST00000217333.8_Missense_Mutation_p.E821G			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	0																	CTTACCGTCCTCTATCCAGTC	0.473																																						dbGAP											0													76.0	72.0	73.0					20																	35737007		1977	4175	6152	-	-	-	SO:0001583	missense	0			AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.2975A>G	20.37:g.35737007T>C	ENSP00000383291:p.Glu992Gly		Q5JYQ6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E992G	ENST00000400441.3	37	c.2975		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.39|16.39	3.109630|3.109630	0.56398|0.56398	.|.	.|.	ENSG00000101353|ENSG00000101353	ENST00000400441;ENST00000217333|ENST00000343811	T;T|.	0.64618|.	1.45;-0.11|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	0.454460|.	0.22522|.	N|.	0.058959|.	T|T	0.53818|0.53818	0.1820|0.1820	L|L	0.56769|0.56769	1.78|1.78	0.30890|0.30890	N|N	0.730475|0.730475	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.83275|.	0.994;0.996|.	T|T	0.59129|0.59129	-0.7512|-0.7512	10|5	0.22706|.	T|.	0.39|.	-8.3277|-8.3277	12.0942|12.0942	0.53744|0.53744	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	992;826|.	E7ETR9;Q9H579-2|.	.;.|.	G|G	992;821|1019	ENSP00000383291:E992G;ENSP00000217333:E821G|.	ENSP00000217333:E821G|.	E|R	-|-	2|1	0|2	C20orf132|C20orf132	35170421|35170421	0.992000|0.992000	0.36948|0.36948	0.953000|0.953000	0.39169|0.39169	0.392000|0.392000	0.30506|0.30506	3.542000|3.542000	0.53625|0.53625	2.121000|2.121000	0.65114|0.65114	0.496000|0.496000	0.49642|0.49642	GAG|AGG	C20orf132	-	superfamily_ARM-type_fold	ENSG00000101353		0.473	MROH8-202	KNOWN	basic|appris_principal	protein_coding	C20orf132	HGNC	protein_coding		75	0.00	0	T	NM_152503		35737007	35737007	-1	no_errors	ENST00000400441	ensembl	human	known	69_37n	missense	38	66.37	75	SNP	0.988	C
SLC35F6	54978	genome.wustl.edu	37	2	26998354	26998354	+	Silent	SNP	C	C	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr2:26998354C>T	ENST00000344420.5	+	4	407	c.345C>T	c.(343-345)tcC>tcT	p.S115S	SLC35F6_ENST00000416475.2_Silent_p.S32S|SLC35F6_ENST00000482746.1_3'UTR|CENPA_ENST00000475662.1_Intron	NM_017877.3	NP_060347.2	Q8N357	S35F6_HUMAN	solute carrier family 35, member F6	115	EamA.				negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)											CCAGTGCCTCCAGCTTCCAGA	0.557																																						dbGAP											0													100.0	96.0	97.0					2																	26998354		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK075164	CCDS1728.1	2p24.1	2012-12-13	2012-12-07	2012-12-07	ENSG00000213699	ENSG00000213699			26055	protein-coding gene	gene with protein product	"""ANT2-binding protein"", ""transport and golgi organization 9 homolog (Drosophila)"""		"""chromosome 2 open reading frame 18"""	C2orf18		15911612, 19154410	Standard	NM_017877		Approved	FLJ20555, ANT2BP, TANGO9	uc002rhp.1	Q8N357	OTTHUMG00000128407	ENST00000344420.5:c.345C>T	2.37:g.26998354C>T			D6W543|Q53GK2|Q8NBX6|Q9NWX0	Silent	SNP	pfam_DUF914_euk,pfam_Nuc_sug_transpt,pfam_DMT,pfam_DUF250,pfam_UAA,pirsf_UCP036436	p.S115	ENST00000344420.5	37	c.345	CCDS1728.1	2																																																																																			C2orf18	-	pfam_DUF914_euk,pfam_Nuc_sug_transpt,pfam_DMT,pfam_UAA,pirsf_UCP036436	ENSG00000213699		0.557	SLC35F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf18	HGNC	protein_coding	OTTHUMT00000250187.2	75	0.00	0	C	NM_017877		26998354	26998354	+1	no_errors	ENST00000344420	ensembl	human	known	69_37n	silent	166	38.06	102	SNP	1.000	T
ACKR4	51554	genome.wustl.edu	37	3	132320043	132320043	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr3:132320043A>G	ENST00000249887.2	+	2	898	c.802A>G	c.(802-804)Atc>Gtc	p.I268V	ACAD11_ENST00000355458.3_Intron|ACAD11_ENST00000264990.6_Intron|ACAD11_ENST00000545291.1_Intron	NM_016557.2|NM_178445.2	NP_057641.1|NP_848540.1	Q9NPB9	ACKR4_HUMAN	atypical chemokine receptor 4	268					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)										CATAGACATCATCTACTCCCT	0.458																																						dbGAP											0													53.0	52.0	52.0					3																	132320043		2200	4295	6495	-	-	-	SO:0001583	missense	0			AF110640	CCDS3075.1	3q22	2013-07-17	2013-07-16	2013-07-16	ENSG00000129048	ENSG00000129048		"""GPCR / Class A : Chemokine receptors : Atypical"""	1611	protein-coding gene	gene with protein product		606065	"""chemokine (C-C motif) receptor-like 1"""	CCRL1		10767544, 16148	Standard	NM_016557		Approved	CCR11, CCBP2, VSHK1, CCX-CKR, PPR1	uc003eow.3	Q9NPB9	OTTHUMG00000159768	ENST00000249887.2:c.802A>G	3.37:g.132320043A>G	ENSP00000249887:p.Ile268Val		B2R9U7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_CCR11,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CXCR4	p.I268V	ENST00000249887.2	37	c.802	CCDS3075.1	3	.	.	.	.	.	.	.	.	.	.	A	13.05	2.122080	0.37436	.	.	ENSG00000129048	ENST00000249887	T	0.71934	-0.61	5.42	5.42	0.78866	GPCR, rhodopsin-like superfamily (1);	0.105636	0.64402	D	0.000005	T	0.65069	0.2656	L	0.45422	1.42	0.58432	D	0.999999	B	0.30326	0.276	B	0.34873	0.191	T	0.60979	-0.7155	10	0.19147	T	0.46	.	15.458	0.75330	1.0:0.0:0.0:0.0	.	268	Q9NPB9	CCRL1_HUMAN	V	268	ENSP00000249887:I268V	ENSP00000249887:I268V	I	+	1	0	CCRL1	133802733	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.161000	0.77505	2.069000	0.61940	0.533000	0.62120	ATC	CCRL1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000129048		0.458	ACKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCRL1	HGNC	protein_coding	OTTHUMT00000357238.2	288	0.00	0	A	NM_016557		132320043	132320043	+1	no_errors	ENST00000249887	ensembl	human	known	69_37n	missense	156	27.78	60	SNP	1.000	G
CEP95	90799	genome.wustl.edu	37	17	62506293	62506293	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr17:62506293C>A	ENST00000556440.2	+	3	661	c.151C>A	c.(151-153)Ctc>Atc	p.L51I	CEP95_ENST00000581056.1_Missense_Mutation_p.L51I|CEP95_ENST00000553412.1_5'UTR	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	51						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						CCCCCCAGACCTCATAGTTAT	0.418																																						dbGAP											0													79.0	72.0	74.0					17																	62506293		1880	4132	6012	-	-	-	SO:0001583	missense	0			AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.151C>A	17.37:g.62506293C>A	ENSP00000450461:p.Leu51Ile		B4DMD2|Q96M81	Missense_Mutation	SNP	superfamily_CH-domain	p.L51I	ENST00000556440.2	37	c.151	CCDS45763.1	17	.	.	.	.	.	.	.	.	.	.	C	10.13	1.264957	0.23136	.	.	ENSG00000258890	ENST00000553956;ENST00000556440	T;T	0.31769	1.48;1.48	5.77	3.78	0.43462	.	0.178605	0.49916	D	0.000136	T	0.26340	0.0643	L	0.59436	1.845	0.80722	D	1	B	0.33694	0.421	B	0.33750	0.169	T	0.09357	-1.0678	10	0.56958	D	0.05	-3.8194	3.9978	0.09566	0.1694:0.5685:0.0:0.2622	.	51	Q96GE4	CEP95_HUMAN	I	51	ENSP00000452317:L51I;ENSP00000450461:L51I	ENSP00000438458:L51I	L	+	1	0	CEP95	59936755	1.000000	0.71417	0.998000	0.56505	0.000000	0.00434	1.875000	0.39578	0.790000	0.33803	-1.288000	0.01363	CTC	CEP95	-	superfamily_CH-domain	ENSG00000258890		0.418	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP95	HGNC	protein_coding	OTTHUMT00000445100.2	70	0.00	0	C	NM_138363		62506293	62506293	+1	no_errors	ENST00000556440	ensembl	human	known	69_37n	missense	342	33.33	171	SNP	1.000	A
CNGB3	54714	genome.wustl.edu	37	8	87751884	87751884	+	Splice_Site	SNP	T	T	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr8:87751884T>A	ENST00000320005.5	-	2	257	c.210A>T	c.(208-210)caA>caT	p.Q70H	CNGB3_ENST00000519777.1_5'UTR|RP11-386D6.1_ENST00000519041.1_RNA	NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	70					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						CATTCTGACCTTGTATGTTGG	0.348																																						dbGAP											0													157.0	132.0	141.0					8																	87751884		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.211+1A>T	8.37:g.87751884T>A			C9JA51|Q9NRE9	Missense_Mutation	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.Q70H	ENST00000320005.5	37	c.210	CCDS6244.1	8	.	.	.	.	.	.	.	.	.	.	T	13.45	2.242135	0.39598	.	.	ENSG00000170289	ENST00000320005	T	0.31510	1.49	4.21	4.21	0.49690	.	0.883806	0.09204	U	0.834316	T	0.38134	0.1029	L	0.36672	1.1	0.80722	D	1	D	0.56968	0.978	P	0.53912	0.737	T	0.10730	-1.0617	10	0.72032	D	0.01	.	10.2484	0.43354	0.0:0.0:0.0:1.0	.	70	Q9NQW8	CNGB3_HUMAN	H	70	ENSP00000316605:Q70H	ENSP00000316605:Q70H	Q	-	3	2	CNGB3	87821000	0.997000	0.39634	0.987000	0.45799	0.594000	0.36715	3.207000	0.51106	1.857000	0.53885	0.533000	0.62120	CAA	CNGB3	-	NULL	ENSG00000170289		0.348	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGB3	HGNC	protein_coding	OTTHUMT00000375107.1	262	0.00	0	T	NM_019098	Missense_Mutation	87751884	87751884	-1	no_errors	ENST00000320005	ensembl	human	known	69_37n	missense	205	46.79	182	SNP	0.997	A
CXADR	1525	genome.wustl.edu	37	21	18933138	18933138	+	Silent	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr21:18933138C>G	ENST00000284878.7	+	5	1438	c.690C>G	c.(688-690)gtC>gtG	p.V230V	CXADR_ENST00000356275.6_Intron|CXADR_ENST00000400165.1_Intron|CXADR_ENST00000400169.1_Silent_p.V230V|CXADR_ENST00000400166.1_Intron|CXADR_ENST00000306618.10_Intron	NM_001338.4	NP_001329.1	P78310	CXAR_HUMAN	coxsackie virus and adenovirus receptor	230					actin cytoskeleton reorganization (GO:0031532)|AV node cell to bundle of His cell communication (GO:0086067)|blood coagulation (GO:0007596)|cardiac muscle fiber development (GO:0048739)|cell-cell junction organization (GO:0045216)|defense response to virus (GO:0051607)|epithelial structure maintenance (GO:0010669)|gamma-delta T cell activation (GO:0046629)|germ cell migration (GO:0008354)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|homotypic cell-cell adhesion (GO:0034109)|leukocyte migration (GO:0050900)|mitochondrion organization (GO:0007005)|neutrophil chemotaxis (GO:0030593)|regulation of immune response (GO:0050776)|transepithelial transport (GO:0070633)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|adherens junction (GO:0005912)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|filopodium (GO:0030175)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|cell adhesion molecule binding (GO:0050839)|connexin binding (GO:0071253)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|virus receptor activity (GO:0001618)			endometrium(2)|large_intestine(5)|lung(1)|ovary(1)|prostate(2)	11				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)		TAAACGTTGTCCCTCGTAAGT	0.423																																						dbGAP											0													295.0	248.0	264.0					21																	18933138		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y07593	CCDS33519.1, CCDS56204.1, CCDS56205.1, CCDS56206.1, CCDS56207.1	21q21.1	2013-01-29			ENSG00000154639	ENSG00000154639		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2559	protein-coding gene	gene with protein product		602621				9036860, 9096397	Standard	NM_001338		Approved	CAR	uc002yki.3	P78310	OTTHUMG00000074508	ENST00000284878.7:c.690C>G	21.37:g.18933138C>G			B2R8V8|B7WPI3|D3YHP0|O00694|Q8WWT6|Q8WWT7|Q8WWT8|Q9UKV4	Silent	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.V230	ENST00000284878.7	37	c.690	CCDS33519.1	21																																																																																			CXADR	-	smart_Ig_sub	ENSG00000154639		0.423	CXADR-001	KNOWN	basic|CCDS	protein_coding	CXADR	HGNC	protein_coding	OTTHUMT00000158209.1	418	0.00	0	C			18933138	18933138	+1	no_errors	ENST00000284878	ensembl	human	known	69_37n	silent	776	37.03	457	SNP	0.989	G
CYB5R1	51706	genome.wustl.edu	37	1	202935062	202935062	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr1:202935062G>C	ENST00000367249.4	-	4	372	c.298C>G	c.(298-300)Cct>Gct	p.P100A	CYB5R1_ENST00000497655.1_5'Flank	NM_016243.2	NP_057327.2	Q9UHQ9	NB5R1_HUMAN	cytochrome b5 reductase 1	100	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				sterol biosynthetic process (GO:0016126)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			breast(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(75;0.141)		Flavin adenine dinucleotide(DB03147)	CTGGTGACAGGAGTGTATGGC	0.517																																						dbGAP											0													153.0	129.0	137.0					1																	202935062		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169481	CCDS1431.1	1q32.1	2011-04-08		2005-07-13	ENSG00000159348	ENSG00000159348	1.6.2.2		13397	protein-coding gene	gene with protein product		608341	"""NAD(P)H:quinone oxidoreductase type 3, polypeptide A2"""	NQO3A2		12975309, 10611283	Standard	NM_016243		Approved	humb5R2	uc001gyt.2	Q9UHQ9	OTTHUMG00000041387	ENST00000367249.4:c.298C>G	1.37:g.202935062G>C	ENSP00000356218:p.Pro100Ala		A0PK21|B2R8E0|O95329|Q53F73|Q8NCL5|Q9UHJ1	Missense_Mutation	SNP	pfam_OxRdtase_FAD/NAD-bd,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_NADH-Cyt_B5_reductase,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Phe_hydroxylase	p.P100A	ENST00000367249.4	37	c.298	CCDS1431.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.322963	0.95708	.	.	ENSG00000159348	ENST00000367249	D	0.87256	-2.23	5.93	5.93	0.95920	Riboflavin synthase-like beta-barrel (1);Ferredoxin reductase-type FAD-binding domain (1);Oxidoreductase, FAD-binding domain (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.000000	0.85682	D	0.000000	D	0.96589	0.8887	H	0.98849	4.35	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97849	1.0273	10	0.87932	D	0	-2.3926	17.8272	0.88669	0.0:0.0:1.0:0.0	.	100	Q9UHQ9	NB5R1_HUMAN	A	100	ENSP00000356218:P100A	ENSP00000356218:P100A	P	-	1	0	CYB5R1	201201685	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.319000	0.96338	2.818000	0.97014	0.591000	0.81541	CCT	CYB5R1	-	pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_NADH-Cyt_B5_reductase,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase	ENSG00000159348		0.517	CYB5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R1	HGNC	protein_coding	OTTHUMT00000099155.1	185	0.00	0	G	NM_016243		202935062	202935062	-1	no_errors	ENST00000367249	ensembl	human	known	69_37n	missense	199	35.06	108	SNP	1.000	C
DHX58	79132	genome.wustl.edu	37	17	40259747	40259747	+	Missense_Mutation	SNP	A	A	T	rs568281152		TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr17:40259747A>T	ENST00000251642.3	-	8	1094	c.872T>A	c.(871-873)cTg>cAg	p.L291Q		NM_024119.2	NP_077024.2	Q96C10	DHX58_HUMAN	DEXH (Asp-Glu-X-His) box polypeptide 58	291					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of innate immune response (GO:0045824)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of type I interferon production (GO:0032481)|regulation of innate immune response (GO:0045088)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		ATGGATGAGCAGCGCGTCATT	0.617																																						dbGAP											0													44.0	40.0	41.0					17																	40259747		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC014949	CCDS11416.1	17q21.2	2008-02-05			ENSG00000108771	ENSG00000108771			29517	protein-coding gene	gene with protein product	"""RNA helicase LGP2"""	608588				11735219	Standard	NM_024119		Approved	LGP2, D11LGP2	uc002hyw.3	Q96C10	OTTHUMG00000133493	ENST00000251642.3:c.872T>A	17.37:g.40259747A>T	ENSP00000251642:p.Leu291Gln		Q9HAM6	Missense_Mutation	SNP	pfam_RIG-I_C-RD,pfam_Helicase/UvrB_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L291Q	ENST00000251642.3	37	c.872	CCDS11416.1	17	.	.	.	.	.	.	.	.	.	.	A	34	5.315885	0.95655	.	.	ENSG00000108771	ENST00000251642;ENST00000423748;ENST00000413196	T;T	0.44881	1.76;0.91	5.52	5.52	0.82312	.	0.076758	0.52532	D	0.000064	T	0.70482	0.3229	M	0.89601	3.045	0.40994	D	0.98487	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77357	-0.2618	10	0.54805	T	0.06	.	14.8245	0.70101	1.0:0.0:0.0:0.0	.	284;291	B7Z455;Q96C10	.;DHX58_HUMAN	Q	291;254;291	ENSP00000251642:L291Q;ENSP00000416389:L291Q	ENSP00000251642:L291Q	L	-	2	0	DHX58	37513273	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	8.628000	0.90979	2.104000	0.64026	0.379000	0.24179	CTG	DHX58	-	NULL	ENSG00000108771		0.617	DHX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX58	HGNC	protein_coding	OTTHUMT00000257396.1	19	0.00	0	A	NM_024119		40259747	40259747	-1	no_errors	ENST00000251642	ensembl	human	known	69_37n	missense	22	42.50	17	SNP	1.000	T
DNAH6	1768	genome.wustl.edu	37	2	84881840	84881840	+	Silent	SNP	T	T	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr2:84881840T>C	ENST00000237449.6	+	34	5699	c.5691T>C	c.(5689-5691)ttT>ttC	p.F1897F	DNAH6_ENST00000389394.3_Silent_p.F1897F|DNAH6_ENST00000398278.2_Silent_p.F1897F			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1897	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GAATGGTGTTTGTGGATCCTG	0.403																																						dbGAP											0													283.0	236.0	250.0					2																	84881840		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.5691T>C	2.37:g.84881840T>C			A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.F1897	ENST00000237449.6	37	c.5691	CCDS46348.1	2																																																																																			DNAH6	-	NULL	ENSG00000115423		0.403	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	472	0.00	0	T	NM_001370		84881840	84881840	+1	no_errors	ENST00000237449	ensembl	human	known	69_37n	silent	437	18.28	98	SNP	1.000	C
DPP8	54878	genome.wustl.edu	37	15	65799695	65799695	+	Splice_Site	SNP	T	T	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr15:65799695T>A	ENST00000341861.5	-	3	1888		c.e3-2		DPP8_ENST00000559233.1_Splice_Site|DPP8_ENST00000321147.6_Splice_Site|DPP8_ENST00000358939.4_Splice_Site|DPP8_ENST00000300141.6_Splice_Site|DPP8_ENST00000321118.7_Splice_Site|DPP8_ENST00000339244.5_Splice_Site	NM_197960.2	NP_932064.1	Q6V1X1	DPP8_HUMAN	dipeptidyl-peptidase 8						immune response (GO:0006955)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(2)|endometrium(3)|large_intestine(11)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CAGACATGGCTATAGGAGAAA	0.343																																						dbGAP											0													69.0	69.0	69.0					15																	65799695		2201	4298	6499	-	-	-	SO:0001630	splice_region_variant	0			AF221634	CCDS10207.1, CCDS10208.1, CCDS10209.1, CCDS10210.1	15q22	2008-07-18	2006-01-12		ENSG00000074603	ENSG00000074603			16490	protein-coding gene	gene with protein product	"""dipeptidyl peptidase VIII"", ""dipeptidyl peptidase IV-related protein-1"", ""prolyl dipeptidase DPP8"""	606819	"""dipeptidylpeptidase 8"""			11012666	Standard	XM_005254500		Approved	DP8, DPRP1, MSTP141, FLJ14920, FLJ20283, MGC26191	uc002aox.3	Q6V1X1	OTTHUMG00000133150	ENST00000341861.5:c.308-2A>T	15.37:g.65799695T>A			Q7Z4C8|Q7Z4D3|Q7Z4E1|Q8IWG7|Q8NEM5|Q96JX1|Q9HBM2|Q9HBM3|Q9HBM4|Q9HBM5|Q9NXF4	Splice_Site	SNP	-	e3-2	ENST00000341861.5	37	c.308-2	CCDS10207.1	15	.	.	.	.	.	.	.	.	.	.	T	16.67	3.186638	0.57909	.	.	ENSG00000074603	ENST00000341861;ENST00000358939;ENST00000300141;ENST00000321147;ENST00000321118;ENST00000339244;ENST00000395652	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4734	0.67531	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	DPP8	63586748	0.995000	0.38212	0.973000	0.42090	0.740000	0.42216	3.229000	0.51278	2.072000	0.62099	0.459000	0.35465	.	DPP8	-	-	ENSG00000074603		0.343	DPP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DPP8	HGNC	protein_coding	OTTHUMT00000256847.1	117	0.00	0	T	NM_017743	Intron	65799695	65799695	-1	no_errors	ENST00000341861	ensembl	human	known	69_37n	splice_site	61	58.22	85	SNP	0.996	A
DYNC2H1	79659	genome.wustl.edu	37	11	103059309	103059310	+	Missense_Mutation	DNP	TG	TG	CC			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T|G	T|G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr11:103059309_103059310TG>CC	ENST00000375735.2	+	44	7368_7369	c.7224_7225TG>CC	c.(7222-7227)gcTGga>gcCCga	p.G2409R	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.G2409R	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	2409	AAA 3. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CTATGTCAGCTGGAGGAAGACT	0.317																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	Exception_encountered	11.37:g.103059309_103059310delinsCC	ENSP00000364887:p.Gly2409Arg		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent|Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.A2408|p.G2409R	ENST00000375735.2	37	c.7224|c.7225	CCDS53701.1	11																																																																																			DYNC2H1	-	smart_AAA+_ATPase	ENSG00000187240		0.317	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	123|127	0.00	0	T|G	XM_370652		103059309|103059310	103059309|103059310	+1	no_errors	ENST00000398093	ensembl	human	known	69_37n	silent|missense	87	54.69|55.61	105|109	SNP	1.000	C
AGO4	192670	genome.wustl.edu	37	1	36298080	36298080	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr1:36298080C>G	ENST00000373210.3	+	11	1533	c.1288C>G	c.(1288-1290)Cga>Gga	p.R430G		NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	430					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)										CTGGGACATGCGAGGAAAGCA	0.368																																						dbGAP											0													112.0	113.0	113.0					1																	36298080		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.1288C>G	1.37:g.36298080C>G	ENSP00000362306:p.Arg430Gly		A7MD27	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.R430G	ENST00000373210.3	37	c.1288	CCDS397.1	1	.	.	.	.	.	.	.	.	.	.	C	15.51	2.855236	0.51376	.	.	ENSG00000134698	ENST00000373210	T	0.05996	3.36	5.27	4.34	0.51931	.	0.163299	0.53938	D	0.000056	T	0.25827	0.0629	M	0.93898	3.47	0.52099	D	0.999942	D	0.57571	0.98	P	0.54346	0.749	T	0.33445	-0.9868	10	0.33940	T	0.23	-2.4459	14.1718	0.65514	0.3704:0.6296:0.0:0.0	.	430	Q9HCK5	AGO4_HUMAN	G	430	ENSP00000362306:R430G	ENSP00000362306:R430G	R	+	1	2	EIF2C4	36070667	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.187000	0.42602	1.197000	0.43143	0.650000	0.86243	CGA	EIF2C4	-	NULL	ENSG00000134698		0.368	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C4	HGNC	protein_coding	OTTHUMT00000012213.3	249	0.00	0	C	NM_017629		36298080	36298080	+1	no_errors	ENST00000373210	ensembl	human	known	69_37n	missense	244	27.81	94	SNP	1.000	G
EMILIN2	84034	genome.wustl.edu	37	18	2890828	2890828	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr18:2890828C>A	ENST00000254528.3	+	4	862	c.703C>A	c.(703-705)Cct>Act	p.P235T		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	235					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		GCACCCCAAGCCTGACACCAC	0.527																																						dbGAP											0													67.0	73.0	71.0					18																	2890828		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.703C>A	18.37:g.2890828C>A	ENSP00000254528:p.Pro235Thr		B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	pfam_EMI_domain,pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,pfscan_EMI_domain	p.P235T	ENST00000254528.3	37	c.703	CCDS11828.1	18	.	.	.	.	.	.	.	.	.	.	C	15.12	2.739465	0.49045	.	.	ENSG00000132205	ENST00000254528	T	0.40225	1.04	5.41	5.41	0.78517	.	0.292228	0.28853	N	0.013932	T	0.67496	0.2899	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68269	-0.5453	10	0.48119	T	0.1	-15.3612	19.2047	0.93724	0.0:1.0:0.0:0.0	.	235	Q9BXX0	EMIL2_HUMAN	T	235	ENSP00000254528:P235T	ENSP00000254528:P235T	P	+	1	0	EMILIN2	2880828	1.000000	0.71417	0.093000	0.20910	0.054000	0.15201	7.284000	0.78650	2.521000	0.84997	0.557000	0.71058	CCT	EMILIN2	-	NULL	ENSG00000132205		0.527	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN2	HGNC	protein_coding	OTTHUMT00000250337.2	40	0.00	0	C	NM_032048		2890828	2890828	+1	no_errors	ENST00000254528	ensembl	human	known	69_37n	missense	16	75.38	49	SNP	0.999	A
ERCC6	2074	genome.wustl.edu	37	10	50690883	50690883	+	Silent	SNP	C	C	A	rs535929212		TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr10:50690883C>A	ENST00000355832.5	-	10	2097	c.2019G>T	c.(2017-2019)ctG>ctT	p.L673L	ERCC6_ENST00000542458.1_Silent_p.L43L	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	673	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						GTGAGCCAGACAGAATGATCC	0.463								Direct reversal of damage;Nucleotide excision repair (NER)																														dbGAP											0													97.0	93.0	94.0					10																	50690883		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.2019G>T	10.37:g.50690883C>A			D3DX94|Q5W0L9	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L673	ENST00000355832.5	37	c.2019	CCDS7229.1	10																																																																																			ERCC6	-	pfam_SNF2_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000225830		0.463	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6	HGNC	protein_coding	OTTHUMT00000047990.1	121	0.00	0	C	NM_000124		50690883	50690883	-1	no_errors	ENST00000355832	ensembl	human	known	69_37n	silent	63	30.77	28	SNP	1.000	A
ERVFRD-1	405754	genome.wustl.edu	37	6	11104836	11104836	+	Silent	SNP	A	A	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr6:11104836A>G	ENST00000472091.1	-	2	1083	c.708T>C	c.(706-708)tcT>tcC	p.S236S	ERVFRD-1_ENST00000542862.1_Silent_p.S236S|SMIM13_ENST00000416247.2_Intron	NM_207582.2	NP_997465.1	P60508	SYCY2_HUMAN	endogenous retrovirus group FRD, member 1	236					syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(4)|stomach(1)	15						cccaaaaaagagaatttcgag	0.463																																						dbGAP											0													29.0	31.0	30.0					6																	11104836		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK075092, AK123938, AY358244	CCDS4519.1	6p24.2	2014-05-02			ENSG00000244476	ENSG00000244476			33823	other	endogenous retrovirus		610524				12970426, 14557543, 15476554, 21542922	Standard	NM_207582		Approved	HERV-W/FRD, HERV-FRD, envFRD, ERVFRDE1, syncytin-2	uc003mzt.3	P60508	OTTHUMG00000159193	ENST00000472091.1:c.708T>C	6.37:g.11104836A>G				Silent	SNP	pfam_TLV/ENV_coat_polyprotein	p.S236	ENST00000472091.1	37	c.708	CCDS4519.1	6																																																																																			ERVFRD-1	-	NULL	ENSG00000244476		0.463	ERVFRD-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERVFRD-1	HGNC	protein_coding	OTTHUMT00000353776.1	58	0.00	0	A	NM_207582		11104836	11104836	-1	no_errors	ENST00000472091	ensembl	human	known	69_37n	silent	63	19.23	15	SNP	0.935	G
FAM135B	51059	genome.wustl.edu	37	8	139263115	139263115	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr8:139263115C>A	ENST00000395297.1	-	6	681	c.511G>T	c.(511-513)Gcc>Tcc	p.A171S		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	171										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GCCACCAGGGCAGCATGGACG	0.587										HNSCC(54;0.14)																												dbGAP											0													76.0	84.0	81.0					8																	139263115		2049	4192	6241	-	-	-	SO:0001583	missense	0			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.511G>T	8.37:g.139263115C>A	ENSP00000378710:p.Ala171Ser		B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.A171S	ENST00000395297.1	37	c.511	CCDS6375.2	8	.	.	.	.	.	.	.	.	.	.	C	3.702	-0.061278	0.07317	.	.	ENSG00000147724	ENST00000395297	T	0.10763	2.84	5.47	3.5	0.40072	.	0.075678	0.56097	D	0.000039	T	0.02267	0.0070	N	0.00358	-1.6	0.40437	D	0.980007	B	0.06786	0.001	B	0.06405	0.002	T	0.39800	-0.9596	10	0.02654	T	1	-21.8869	11.5065	0.50471	0.5568:0.4432:0.0:0.0	.	171	Q49AJ0	F135B_HUMAN	S	171	ENSP00000378710:A171S	ENSP00000276737:A171S	A	-	1	0	FAM135B	139332297	1.000000	0.71417	0.966000	0.40874	0.537000	0.34900	4.775000	0.62346	1.321000	0.45227	-0.268000	0.10319	GCC	FAM135B	-	pfam_DUF3657	ENSG00000147724		0.587	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3	106	0.00	0	C	NM_015912		139263115	139263115	-1	no_errors	ENST00000395297	ensembl	human	known	69_37n	missense	104	12.61	15	SNP	0.993	A
BRINP3	339479	genome.wustl.edu	37	1	190250700	190250700	+	Silent	SNP	A	A	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr1:190250700A>G	ENST00000367462.3	-	3	648	c.417T>C	c.(415-417)gcT>gcC	p.A139A	RP11-547I7.1_ENST00000452178.1_RNA|BRINP3_ENST00000534846.1_Intron	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	139	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											CTCCCAGAGTAGCAGATAGCA	0.408																																						dbGAP											0													86.0	86.0	86.0					1																	190250700		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.417T>C	1.37:g.190250700A>G			B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	NULL	p.L89P	ENST00000367462.3	37	c.266	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	A	10.30	1.311205	0.23821	.	.	ENSG00000162670	ENST00000445957	T	0.50277	0.75	5.67	0.487	0.16842	.	.	.	.	.	T	0.47581	0.1453	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46105	-0.9215	6	0.87932	D	0	.	3.4284	0.07420	0.5094:0.0:0.2297:0.2609	.	.	.	.	P	89	ENSP00000393441:L89P	ENSP00000393441:L89P	L	-	2	0	FAM5C	188517323	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.010000	0.29898	0.071000	0.16664	0.477000	0.44152	CTA	FAM5C	-	NULL	ENSG00000162670		0.408	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5C	HGNC	protein_coding	OTTHUMT00000086278.1	51	0.00	0	A	NM_199051		190250700	190250700	-1	no_stop_codon	ENST00000445957	ensembl	human	known	69_37n	missense	117	12.03	16	SNP	0.965	G
FARS2	10667	genome.wustl.edu	37	6	5431360	5431360	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr6:5431360G>C	ENST00000324331.6	+	4	1195	c.859G>C	c.(859-861)Gaa>Caa	p.E287Q	FARS2_ENST00000274680.4_Missense_Mutation_p.E287Q			O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2, mitochondrial	287					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)|stomach(2)	15	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	AGAATGGCTGGAAGTTCTTGG	0.443																																						dbGAP											0													185.0	171.0	176.0					6																	5431360		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF097441	CCDS4494.1	6p25.1	2011-07-01	2007-02-23	2004-12-03	ENSG00000145982	ENSG00000145982	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	21062	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 2, mitochondrial"""	611592	"""phenylalanine-tRNA synthetase 1 (mitochondrial)"""	FARS1		10329163	Standard	NM_006567		Approved	dJ236A3.1	uc003mwr.2	O95363	OTTHUMG00000014178	ENST00000324331.6:c.859G>C	6.37:g.5431360G>C	ENSP00000316335:p.Glu287Gln		B2R664|Q53F66|Q5TCS3|Q6FG29|Q9NPY7|Q9P062	Missense_Mutation	SNP	pfam_Phenylalanyl-tRNA_Synthase,pfam_PheS_beta_Fdx_antiC-bd,superfamily_PheS_beta_Fdx_antiC-bd,smart_PheS_beta_Fdx_antiC-bd,pfscan_aa-tRNA-synth_II,tigrfam_Phe-tRNA-synth_IIc_mito	p.E287Q	ENST00000324331.6	37	c.859	CCDS4494.1	6	.	.	.	.	.	.	.	.	.	.	G	28.9	4.958927	0.92726	.	.	ENSG00000145982	ENST00000274680;ENST00000397563;ENST00000324331;ENST00000445533	D;D;D	0.83755	-1.76;-1.76;-1.76	5.5	5.5	0.81552	Aminoacyl-tRNA synthetase, class II (1);Phenylalanyl-tRNA synthetase (1);	0.119404	0.56097	D	0.000039	D	0.90376	0.6988	H	0.98818	4.34	0.80722	D	1	P	0.48640	0.913	B	0.44133	0.442	D	0.93931	0.7214	10	0.87932	D	0	-12.0806	18.4297	0.90620	0.0:0.0:1.0:0.0	.	287	O95363	SYFM_HUMAN	Q	287;137;287;83	ENSP00000274680:E287Q;ENSP00000316335:E287Q;ENSP00000392525:E83Q	ENSP00000274680:E287Q	E	+	1	0	FARS2	5376359	1.000000	0.71417	0.889000	0.34880	0.990000	0.78478	9.535000	0.98064	2.587000	0.87381	0.585000	0.79938	GAA	FARS2	-	pfam_Phenylalanyl-tRNA_Synthase,pfscan_aa-tRNA-synth_II,tigrfam_Phe-tRNA-synth_IIc_mito	ENSG00000145982		0.443	FARS2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FARS2	HGNC	protein_coding	OTTHUMT00000467790.1	304	0.00	0	G	NM_006567		5431360	5431360	+1	no_errors	ENST00000274680	ensembl	human	known	69_37n	missense	496	12.68	72	SNP	1.000	C
GJA4	2701	genome.wustl.edu	37	1	35260061	35260061	+	Missense_Mutation	SNP	C	C	G	rs189666922		TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr1:35260061C>G	ENST00000342280.4	+	2	335	c.247C>G	c.(247-249)Ctc>Gtc	p.L83V		NM_002060.2	NP_002051.2	P35212	CXA4_HUMAN	gap junction protein, alpha 4, 37kDa	83					blood vessel development (GO:0001568)|calcium ion transport (GO:0006816)|cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|endothelium development (GO:0003158)|response to pain (GO:0048265)|transport (GO:0006810)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(4)|stomach(1)	14		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				GCTGCAGTTCCTCTTCGTCAG	0.607																																						dbGAP											0													109.0	96.0	100.0					1																	35260061		2203	4300	6503	-	-	-	SO:0001583	missense	0			M96789	CCDS30669.1	1p35.1	2008-02-05	2007-01-16		ENSG00000187513	ENSG00000187513		"""Ion channels / Gap junction proteins (connexins)"""	4278	protein-coding gene	gene with protein product	"""connexin 37"""	121012	"""gap junction protein, alpha 4, 37kD (connexin 37)"", ""gap junction protein, alpha 4, 37kDa (connexin 37)"""			9843209, 7680674	Standard	XM_005270750		Approved	CX37	uc001bya.3	P35212	OTTHUMG00000004050	ENST00000342280.4:c.247C>G	1.37:g.35260061C>G	ENSP00000343676:p.Leu83Val		A8K698|D3DPR4|Q9P106|Q9UBL1|Q9UNA9|Q9UNB0|Q9UNB1|Q9Y5N7	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin37	p.L83V	ENST00000342280.4	37	c.247	CCDS30669.1	1	.	.	.	.	.	.	.	.	.	.	C	16.99	3.274296	0.59649	.	.	ENSG00000187513	ENST00000342280;ENST00000450137;ENST00000543143	D;D	0.99042	-5.36;-5.36	5.48	4.55	0.56014	Connexin, N-terminal (1);	0.062472	0.64402	D	0.000005	D	0.98498	0.9499	N	0.26042	0.785	0.48975	D	0.999736	D;D	0.69078	0.967;0.997	P;D	0.85130	0.897;0.997	D	0.99900	1.1158	10	0.62326	D	0.03	.	15.5713	0.76341	0.139:0.861:0.0:0.0	.	83;83	Q5JW71;P35212	.;CXA4_HUMAN	V	83	ENSP00000343676:L83V;ENSP00000409186:L83V	ENSP00000343676:L83V	L	+	1	0	GJA4	35032648	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.218000	0.58554	1.266000	0.44231	0.655000	0.94253	CTC	GJA4	-	pfam_Connexin_N,prints_Connexin	ENSG00000187513		0.607	GJA4-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GJA4	HGNC	protein_coding	OTTHUMT00000011556.1	97	0.00	0	C	NM_002060		35260061	35260061	+1	no_errors	ENST00000342280	ensembl	human	known	69_37n	missense	92	24.59	30	SNP	1.000	G
FASLG	356	genome.wustl.edu	37	1	172628648	172628648	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr1:172628648C>A	ENST00000367721.2	+	1	491	c.307C>A	c.(307-309)Cag>Aag	p.Q103K	FASLG_ENST00000340030.3_Missense_Mutation_p.Q103K	NM_000639.1	NP_000630.1	P48023	TNFL6_HUMAN	Fas ligand (TNF superfamily, member 6)	103					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cellular chloride ion homeostasis (GO:0030644)|endosomal lumen acidification (GO:0048388)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|immune response (GO:0006955)|inflammatory cell apoptotic process (GO:0006925)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of angiogenesis (GO:0016525)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to growth factor (GO:0070848)|response to lipopolysaccharide (GO:0032496)|retinal cell programmed cell death (GO:0046666)|signal transduction (GO:0007165)|T cell apoptotic process (GO:0070231)|transcription, DNA-templated (GO:0006351)	caveola (GO:0005901)|cytoplasmic membrane-bounded vesicle (GO:0016023)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|skin(1)	19						GGGGATGTTTCAGCTCTTCCA	0.572																																					Ovarian(28;486 876 30334 44033)	dbGAP											0													121.0	110.0	114.0					1																	172628648		2203	4300	6503	-	-	-	SO:0001583	missense	0			U11821	CCDS1304.1	1q23	2014-09-17	2005-01-07	2005-01-07	ENSG00000117560	ENSG00000117560		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11936	protein-coding gene	gene with protein product		134638	"""tumor necrosis factor (ligand) superfamily, member 6"""	APT1LG1, TNFSF6		7826947, 9022072	Standard	NM_000639		Approved	FasL, CD178	uc001gis.3	P48023	OTTHUMG00000034841	ENST00000367721.2:c.307C>A	1.37:g.172628648C>A	ENSP00000356694:p.Gln103Lys		Q9BZP9	Missense_Mutation	SNP	pfam_TNF,superfamily_Tumour_necrosis_fac-like,smart_TNF,prints_Fas_ligand,prints_TNF_a/b/c,prints_TNF_C,pfscan_TNF	p.Q103K	ENST00000367721.2	37	c.307	CCDS1304.1	1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165837	0.78339	.	.	ENSG00000117560	ENST00000340030;ENST00000367721	T	0.29917	1.55	4.62	4.62	0.57501	.	0.152126	0.44285	D	0.000476	T	0.28134	0.0694	N	0.19112	0.55	0.41843	D	0.99013	D;B	0.67145	0.996;0.034	D;B	0.73708	0.981;0.012	T	0.06972	-1.0797	10	0.37606	T	0.19	-3.8118	14.5784	0.68268	0.0:1.0:0.0:0.0	.	103;103	P48023-2;P48023	.;TNFL6_HUMAN	K	103	ENSP00000356694:Q103K	ENSP00000344739:Q103K	Q	+	1	0	FASLG	170895271	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	1.702000	0.37836	2.291000	0.77112	0.563000	0.77884	CAG	FASLG	-	prints_Fas_ligand	ENSG00000117560		0.572	FASLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASLG	HGNC	protein_coding	OTTHUMT00000084276.1	288	0.00	0	C			172628648	172628648	+1	no_errors	ENST00000367721	ensembl	human	known	69_37n	missense	165	22.17	47	SNP	1.000	A
GOLGA6L2	283685	genome.wustl.edu	37	15	23685239	23685241	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr15:23685239_23685241delCTC	ENST00000567107.1	-	8	2433_2435	c.2381_2383delGAG	c.(2380-2385)ggagaa>gaa	p.G794del	GOLGA6L2_ENST00000312015.5_Intron|GOLGA6L2_ENST00000345070.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						cccacatcttctcctcctgctcc	0.581																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.2381_2383delGAG	15.37:g.23685242_23685244delCTC	ENSP00000454407:p.Gly794del		A1L301	In_Frame_Del	DEL	NULL	p.G794in_frame_del	ENST00000567107.1	37	c.2383_2381		15																																																																																			GOLGA6L2	-	NULL	ENSG00000174450		0.581	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	23	0.00	0	CTC	NM_182561		23685239	23685241	-1	no_errors	ENST00000567107	ensembl	human	putative	69_37n	in_frame_del	19	45.71	16	DEL	0.003:0.002:0.002	-
GRIN3B	116444	genome.wustl.edu	37	19	1005266	1005266	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr19:1005266C>T	ENST00000234389.3	+	3	1785	c.1766C>T	c.(1765-1767)gCg>gTg	p.A589V	GRIN3B_ENST00000588335.1_3'UTR|AC004528.4_ENST00000588380.1_RNA	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	589					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CACCTCACCGCGCTCTTCCTC	0.667																																						dbGAP											0													71.0	64.0	67.0					19																	1005266		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.1766C>T	19.37:g.1005266C>T	ENSP00000234389:p.Ala589Val		Q5EAK7|Q7RTW9	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A589V	ENST00000234389.3	37	c.1766	CCDS32861.1	19	.	.	.	.	.	.	.	.	.	.	C	18.58	3.654381	0.67472	.	.	ENSG00000116032	ENST00000234389	T	0.34472	1.36	4.53	4.53	0.55603	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.66228	0.2768	M	0.88906	2.99	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	T	0.75001	-0.3471	10	0.87932	D	0	.	15.8728	0.79136	0.0:1.0:0.0:0.0	.	589	O60391	NMD3B_HUMAN	V	589	ENSP00000234389:A589V	ENSP00000234389:A589V	A	+	2	0	GRIN3B	956266	1.000000	0.71417	0.998000	0.56505	0.128000	0.20619	7.671000	0.83941	2.100000	0.63781	0.485000	0.47835	GCG	GRIN3B	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	ENSG00000116032		0.667	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3B	HGNC	protein_coding	OTTHUMT00000103923.2	13	0.00	0	C			1005266	1005266	+1	no_errors	ENST00000234389	ensembl	human	known	69_37n	missense	7	63.16	12	SNP	1.000	T
GRM3	2913	genome.wustl.edu	37	7	86468742	86468742	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr7:86468742C>G	ENST00000361669.2	+	4	3011	c.1912C>G	c.(1912-1914)Cca>Gca	p.P638A	GRM3_ENST00000536043.1_Missense_Mutation_p.P510A|GRM3_ENST00000546348.1_Missense_Mutation_p.P230A|GRM3_ENST00000439827.1_Intron|GRM3_ENST00000394720.2_Intron	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	638					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					CAAGCCATCACCAGTCATCTG	0.522																																					GBM(52;969 1098 3139 52280)	dbGAP											0													241.0	194.0	210.0					7																	86468742		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1912C>G	7.37:g.86468742C>G	ENSP00000355316:p.Pro638Ala		Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B,pfscan_GPCR_3_C	p.P638A	ENST00000361669.2	37	c.1912	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	C	6.904	0.536299	0.13188	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043	D;D;D	0.87179	-2.22;-2.22;-2.22	5.95	5.07	0.68467	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.79958	0.4536	L	0.28054	0.825	0.80722	D	1	B;B;B	0.10296	0.003;0.002;0.002	B;B;B	0.14023	0.01;0.005;0.009	T	0.73726	-0.3892	10	0.26408	T	0.33	.	14.5359	0.67960	0.0:0.9298:0.0:0.0702	.	230;510;638	B7Z204;F5GYZ2;Q14832	.;.;GRM3_HUMAN	A	638;230;510	ENSP00000355316:P638A;ENSP00000444064:P230A;ENSP00000441407:P510A	ENSP00000355316:P638A	P	+	1	0	GRM3	86306678	0.993000	0.37304	0.665000	0.29768	0.987000	0.75469	3.247000	0.51422	1.519000	0.48950	0.563000	0.77884	CCA	GRM3	-	pfam_GPCR_3_C,pfscan_GPCR_3_C	ENSG00000198822		0.522	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2	147	0.00	0	C			86468742	86468742	+1	no_errors	ENST00000361669	ensembl	human	known	69_37n	missense	172	17.31	36	SNP	0.990	G
GSTP1	2950	genome.wustl.edu	37	11	67353658	67353658	+	Silent	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr11:67353658C>G	ENST00000398606.3	+	6	669	c.420C>G	c.(418-420)ggC>ggG	p.G140G	GSTP1_ENST00000498765.1_3'UTR|GSTP1_ENST00000398603.1_Intron	NM_000852.3	NP_000843.1	P09211	GSTP1_HUMAN	glutathione S-transferase pi 1	140	GST C-terminal.				cellular response to lipopolysaccharide (GO:0071222)|central nervous system development (GO:0007417)|common myeloid progenitor cell proliferation (GO:0035726)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biosynthetic process (GO:0009890)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of leukocyte proliferation (GO:0070664)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|nitric oxide storage (GO:0035732)|positive regulation of superoxide anion generation (GO:0032930)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of stress-activated MAPK cascade (GO:0032872)|response to reactive oxygen species (GO:0000302)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|TRAF2-GSTP1 complex (GO:0097057)|vesicle (GO:0031982)	dinitrosyl-iron complex binding (GO:0035731)|glutathione transferase activity (GO:0004364)|JUN kinase binding (GO:0008432)|kinase regulator activity (GO:0019207)|nitric oxide binding (GO:0070026)|S-nitrosoglutathione binding (GO:0035730)			central_nervous_system(1)|cervix(1)|endometrium(4)|lung(2)|ovary(1)	9					Busulfan(DB01008)|Carboplatin(DB00958)|Chlorambucil(DB00291)|Cisplatin(DB00515)|Clomipramine(DB01242)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	ACCAGGGAGGCAAGACCTTCA	0.577																																						dbGAP											0													46.0	50.0	48.0					11																	67353658		2095	4221	6316	-	-	-	SO:0001819	synonymous_variant	0			U12472	CCDS41679.1	11q13.2	2014-09-17	2008-07-18		ENSG00000084207	ENSG00000084207	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4638	protein-coding gene	gene with protein product		134660		FAEES3, GST3		1885604, 7587384, 19915149	Standard	NM_000852		Approved	GSTP	uc001omf.3	P09211	OTTHUMG00000137430	ENST00000398606.3:c.420C>G	11.37:g.67353658C>G			O00460|Q15690|Q5TZY3	Silent	SNP	pfam_GST_C,pfam_Glutathione_S-Trfase_N,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_pi	p.G140	ENST00000398606.3	37	c.420	CCDS41679.1	11																																																																																			GSTP1	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	ENSG00000084207		0.577	GSTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTP1	HGNC	protein_coding	OTTHUMT00000268504.1	60	0.00	0	C	NM_000852		67353658	67353658	+1	no_errors	ENST00000398606	ensembl	human	known	69_37n	silent	67	24.72	22	SNP	0.901	G
HEYL	26508	genome.wustl.edu	37	1	40092514	40092514	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr1:40092514G>A	ENST00000372852.3	-	5	971	c.652C>T	c.(652-654)Cga>Tga	p.R218*	HEYL_ENST00000535435.1_Nonsense_Mutation_p.R190*	NM_014571.3	NP_055386	Q9NQ87	HEYL_HUMAN	hes-related family bHLH transcription factor with YRPW motif-like	218	Pro-rich.				atrioventricular valve morphogenesis (GO:0003181)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to BMP stimulus (GO:0071773)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|glomerulus development (GO:0032835)|mesenchymal cell development (GO:0014031)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|pulmonary valve morphogenesis (GO:0003184)|skeletal muscle cell differentiation (GO:0035914)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-1 domain binding (GO:0050683)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.1e-18)|Epithelial(16;2.77e-17)|all cancers(16;5.64e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GGAGCGGTTCGGAGGGCTGGG	0.682																																						dbGAP											0													27.0	28.0	28.0					1																	40092514		2192	4290	6482	-	-	-	SO:0001587	stop_gained	0			BC006087	CCDS439.1	1p34.3	2013-10-17	2013-10-17		ENSG00000163909	ENSG00000163909		"""Basic helix-loop-helix proteins"""	4882	protein-coding gene	gene with protein product	"""hairy/enhancer-of-split related with YRPW motif 3"""	609034	"""hairy/enhancer-of-split related with YRPW motif-like"""			10415358, 10860664	Standard	NM_014571		Approved	bHLHb33, HEY3, HESR3	uc001cdp.3	Q9NQ87	OTTHUMG00000000458	ENST00000372852.3:c.652C>T	1.37:g.40092514G>A	ENSP00000361943:p.Arg218*		Q5TG99	Nonsense_Mutation	SNP	pfam_HLH_DNA-bd,pfam_Orange,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_Orange_subgr,pfscan_Orange,pfscan_HLH_DNA-bd	p.R218*	ENST00000372852.3	37	c.652	CCDS439.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.633248	0.96682	.	.	ENSG00000163909	ENST00000372852;ENST00000535435	.	.	.	5.02	0.538	0.17150	.	2.287770	0.02182	N	0.060571	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-25.6861	14.2411	0.65956	0.0:0.0:0.4046:0.5954	.	.	.	.	X	218;190	.	ENSP00000361943:R218X	R	-	1	2	HEYL	39865101	0.980000	0.34600	0.194000	0.23346	0.949000	0.60115	0.890000	0.28295	0.115000	0.18071	0.462000	0.41574	CGA	HEYL	-	NULL	ENSG00000163909		0.682	HEYL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEYL	HGNC	protein_coding	OTTHUMT00000001179.2	190	0.00	0	G	NM_014571		40092514	40092514	-1	no_errors	ENST00000372852	ensembl	human	known	69_37n	nonsense	106	10.17	12	SNP	0.066	A
HGSNAT	138050	genome.wustl.edu	37	8	43052147	43052147	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr8:43052147C>G	ENST00000458501.2	+	15	1605	c.1605C>G	c.(1603-1605)ttC>ttG	p.F535L	HGSNAT_ENST00000297798.7_Missense_Mutation_p.F239L|HGSNAT_ENST00000521576.1_Missense_Mutation_p.F224L|HGSNAT_ENST00000379644.4_Missense_Mutation_p.F507L			Q68CP4	HGNAT_HUMAN	heparan-alpha-glucosaminide N-acetyltransferase	535					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lysosomal transport (GO:0007041)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	heparan-alpha-glucosaminide N-acetyltransferase activity (GO:0015019)|transferase activity, transferring acyl groups (GO:0016746)			cervix(1)|endometrium(2)|large_intestine(4)|lung(6)	13	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			TGATTCGATTCACTGCTTGGT	0.383																																						dbGAP											0													108.0	109.0	108.0					8																	43052147		1888	4119	6007	-	-	-	SO:0001583	missense	0				CCDS47852.1	8p11.1	2011-11-16	2006-09-05	2006-08-16	ENSG00000165102	ENSG00000165102	2.3.1.78		26527	protein-coding gene	gene with protein product		610453	"""transmembrane protein 76"""	TMEM76		17033958, 16960811	Standard	NM_152419		Approved	FLJ32731, HGNAT	uc003xpx.4	Q68CP4	OTTHUMG00000164102	ENST00000458501.2:c.1605C>G	8.37:g.43052147C>G	ENSP00000389524:p.Phe535Leu		B4E2V0	Missense_Mutation	SNP	pfam_DUF1624	p.F535L	ENST00000458501.2	37	c.1605		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.666|7.666	0.685977|0.685977	0.14973|0.14973	.|.	.|.	ENSG00000165102|ENSG00000165102	ENST00000458501;ENST00000379644;ENST00000521576;ENST00000297798|ENST00000524016	D;D;D;D|.	0.86956|.	-2.19;-2.19;-2.19;-2.19|.	5.26|5.26	-1.06|-1.06	0.10002|0.10002	.|.	0.111354|.	0.64402|.	D|.	0.000011|.	T|T	0.35335|0.35335	0.0928|0.0928	L|L	0.41492|0.41492	1.28|1.28	0.26810|0.26810	N|N	0.969023|0.969023	B|.	0.24823|.	0.112|.	B|.	0.24006|.	0.05|.	T|T	0.34800|0.34800	-0.9814|-0.9814	10|5	0.02654|.	T|.	1|.	-24.1191|-24.1191	9.1356|9.1356	0.36872|0.36872	0.0:0.4882:0.0:0.5118|0.0:0.4882:0.0:0.5118	.|.	535|.	Q68CP4|.	HGNAT_HUMAN|.	L|D	535;507;224;239|246	ENSP00000389524:F535L;ENSP00000368965:F507L;ENSP00000429029:F224L;ENSP00000297798:F239L|.	ENSP00000297798:F239L|.	F|H	+|+	3|1	2|0	HGSNAT|HGSNAT	43171304|43171304	0.000000|0.000000	0.05858|0.05858	0.674000|0.674000	0.29902|0.29902	0.023000|0.023000	0.10783|0.10783	-1.344000|-1.344000	0.02639|0.02639	-0.453000|-0.453000	0.07076|0.07076	-0.140000|-0.140000	0.14226|0.14226	TTC|CAC	HGSNAT	-	NULL	ENSG00000165102		0.383	HGSNAT-202	KNOWN	basic	protein_coding	HGSNAT	HGNC	protein_coding		466	0.00	0	C	XM_372038		43052147	43052147	+1	no_errors	ENST00000458501	ensembl	human	known	69_37n	missense	225	11.76	30	SNP	0.030	G
HIPK1	204851	genome.wustl.edu	37	1	114510483	114510483	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr1:114510483A>G	ENST00000369558.1	+	12	2709	c.2477A>G	c.(2476-2478)aAt>aGt	p.N826S	HIPK1_ENST00000369553.1_Missense_Mutation_p.N432S|HIPK1_ENST00000369559.4_Missense_Mutation_p.N826S|HIPK1_ENST00000406344.1_Missense_Mutation_p.N432S|HIPK1_ENST00000369561.4_Missense_Mutation_p.N792S|HIPK1_ENST00000369555.2_Missense_Mutation_p.N781S|HIPK1_ENST00000369554.2_Missense_Mutation_p.N781S|HIPK1_ENST00000340480.4_Missense_Mutation_p.N452S|HIPK1_ENST00000426820.2_Missense_Mutation_p.N826S			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	826					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAGCCTCTGAATGTTGGTGTT	0.493																																						dbGAP											0													190.0	154.0	166.0					1																	114510483		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.2477A>G	1.37:g.114510483A>G	ENSP00000358571:p.Asn826Ser		A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.N826S	ENST00000369558.1	37	c.2477	CCDS867.1	1	.	.	.	.	.	.	.	.	.	.	A	15.74	2.921447	0.52653	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000340480;ENST00000369553;ENST00000406344	T;T;T;T;T;T;T;T;T;T	0.26810	1.71;1.71;1.71;1.71;1.71;1.71;1.71;1.71;1.71;1.71	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.22360	0.0539	N	0.21282	0.65	0.47905	D	0.999545	P;P;P;D	0.56035	0.712;0.712;0.956;0.974	B;B;D;D	0.70487	0.395;0.279;0.931;0.969	T	0.05937	-1.0855	10	0.13470	T	0.59	.	16.0347	0.80617	1.0:0.0:0.0:0.0	.	118;432;826;826	E9PCF6;Q86Z02-4;Q86Z02;Q86Z02-2	.;.;HIPK1_HUMAN;.	S	897;826;826;781;781;826;792;452;432;432	ENSP00000407442:N897S;ENSP00000358572:N826S;ENSP00000409673:N826S;ENSP00000358567:N781S;ENSP00000358568:N781S;ENSP00000358571:N826S;ENSP00000358574:N792S;ENSP00000340956:N452S;ENSP00000358566:N432S;ENSP00000384960:N432S	ENSP00000340956:N452S	N	+	2	0	HIPK1	114312006	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.101000	0.50283	2.248000	0.74166	0.533000	0.62120	AAT	HIPK1	-	NULL	ENSG00000163349		0.493	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HIPK1	HGNC	protein_coding	OTTHUMT00000033127.1	119	0.00	0	A	NM_198268		114510483	114510483	+1	no_errors	ENST00000369558	ensembl	human	known	69_37n	missense	130	40.64	89	SNP	1.000	G
HOOK3	84376	genome.wustl.edu	37	8	42819469	42819469	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr8:42819469G>C	ENST00000307602.4	+	9	831	c.631G>C	c.(631-633)Gaa>Caa	p.E211Q		NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	211					cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			AGCATTGCAGGAAGAGAAAAG	0.403			T	RET	papillary thyroid																																	dbGAP		Dom	yes		8	8p11.21	84376	hook homolog 3		E	0													117.0	114.0	115.0					8																	42819469		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.631G>C	8.37:g.42819469G>C	ENSP00000305699:p.Glu211Gln		D3DSY8|Q8NBH0|Q9BY13	Missense_Mutation	SNP	pfam_HOOK,superfamily_t-SNARE	p.E211Q	ENST00000307602.4	37	c.631	CCDS6139.1	8	.	.	.	.	.	.	.	.	.	.	G	25.3	4.623823	0.87460	.	.	ENSG00000168172	ENST00000307602	T	0.24350	1.86	5.93	5.93	0.95920	.	0.151725	0.56097	D	0.000032	T	0.55178	0.1904	M	0.82056	2.57	0.43750	D	0.996258	D;P	0.76494	0.999;0.879	D;P	0.77557	0.99;0.608	T	0.44967	-0.9293	10	0.27082	T	0.32	-5.7031	20.3887	0.98946	0.0:0.0:1.0:0.0	.	211;211	Q2VJ45;Q86VS8	.;HOOK3_HUMAN	Q	211	ENSP00000305699:E211Q	ENSP00000305699:E211Q	E	+	1	0	HOOK3	42938626	1.000000	0.71417	0.997000	0.53966	0.905000	0.53344	7.574000	0.82434	2.828000	0.97474	0.644000	0.83932	GAA	HOOK3	-	pfam_HOOK	ENSG00000168172		0.403	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK3	HGNC	protein_coding	OTTHUMT00000383172.2	271	0.37	1	G	NM_032410		42819469	42819469	+1	no_errors	ENST00000307602	ensembl	human	known	69_37n	missense	163	25.57	56	SNP	1.000	C
HS1BP3	64342	genome.wustl.edu	37	2	20823621	20823621	+	Intron	SNP	A	A	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr2:20823621A>C	ENST00000304031.3	-	6	946					NM_022460.3	NP_071905.3	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3								phosphatidylinositol binding (GO:0035091)			endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	15	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAACACTCTCAGAGCTGGCCA	0.642																																						dbGAP											0													17.0	18.0	18.0					2																	20823621		2196	4298	6494	-	-	-	SO:0001627	intron_variant	0				CCDS1700.1	2p24.1	2006-08-15			ENSG00000118960	ENSG00000118960			24979	protein-coding gene	gene with protein product		609359				10590261, 15699368	Standard	NM_022460		Approved	HS1-BP3,FLJ14249	uc002rdw.1	Q53T59	OTTHUMG00000122099	ENST00000304031.3:c.920+34T>G	2.37:g.20823621A>C			B2RAW2|D6W529|Q86VC2|Q8N367	Missense_Mutation	SNP	NULL	p.L111R	ENST00000304031.3	37	c.332	CCDS1700.1	2	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.910166	0.00508	.	.	ENSG00000118960	ENST00000445102	T	0.36157	1.27	2.38	-4.76	0.03229	.	.	.	.	.	T	0.26340	0.0643	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38023	-0.9680	6	0.87932	D	0	.	1.7799	0.03029	0.2436:0.4575:0.1353:0.1636	.	.	.	.	R	111	ENSP00000397546:L111R	ENSP00000397546:L111R	L	-	2	0	HS1BP3	20687102	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.284000	0.02793	-1.058000	0.03197	0.459000	0.35465	CTG	HS1BP3	-	NULL	ENSG00000118960		0.642	HS1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS1BP3	HGNC	protein_coding	OTTHUMT00000242863.1	31	0.00	0	A	NM_022460		20823621	20823621	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000445102	ensembl	human	putative	69_37n	missense	57	17.39	12	SNP	0.000	C
HTR1A	3350	genome.wustl.edu	37	5	63257274	63257274	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr5:63257274delG	ENST00000323865.3	-	1	506	c.273delC	c.(271-273)cccfs	p.P91fs	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	91					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GCGCGGCCATGGGCAGCACCA	0.592																																						dbGAP											0													51.0	53.0	52.0					5																	63257274		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.273delC	5.37:g.63257274delG	ENSP00000316244:p.Pro91fs		Q6LAE7	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_5HT1A_rcpt,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt,prints_NPY_rcpt	p.M92fs	ENST00000323865.3	37	c.273	CCDS34168.1	5																																																																																			HTR1A	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000178394		0.592	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1A	HGNC	protein_coding	OTTHUMT00000368397.1	100	0.00	0	G	NM_000524		63257274	63257274	-1	no_errors	ENST00000323865	ensembl	human	known	69_37n	frame_shift_del	9	65.62	21	DEL	1.000	-
IL10RB	3588	genome.wustl.edu	37	21	34652083	34652083	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr21:34652083G>A	ENST00000290200.2	+	4	466	c.358G>A	c.(358-360)Gta>Ata	p.V120I	AP000295.9_ENST00000433395.2_Silent_p.K247K	NM_000628.4	NP_000619.3	Q08334	I10R2_HUMAN	interleukin 10 receptor, beta	120	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	14						TGGAATGCAAGTAGAAGTACT	0.338																																					Melanoma(67;315 1275 21667 21943 44564)	dbGAP											0													152.0	145.0	148.0					21																	34652083		2203	4300	6503	-	-	-	SO:0001583	missense	0			U08988	CCDS13623.1	21q22.11	2014-09-17			ENSG00000243646	ENSG00000243646		"""Interleukins and interleukin receptors"", ""CD molecules"""	5965	protein-coding gene	gene with protein product		123889		CRFB4, D21S58, D21S66		8314576, 9312047	Standard	NM_000628		Approved	CRF2-4, CDW210B, IL-10R2		Q08334	OTTHUMG00000065128	ENST00000290200.2:c.358G>A	21.37:g.34652083G>A	ENSP00000290200:p.Val120Ile		Q9BUU4	Missense_Mutation	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3	p.V120I	ENST00000290200.2	37	c.358	CCDS13623.1	21	.	.	.	.	.	.	.	.	.	.	G	11.83	1.756165	0.31137	.	.	ENSG00000243646	ENST00000290200;ENST00000539894	T	0.73047	-0.71	5.86	0.994	0.19832	Fibronectin, type III (2);Interferon alpha/beta receptor, beta chain (1);Immunoglobulin-like fold (1);	0.307368	0.31392	N	0.007740	T	0.58864	0.2152	L	0.58428	1.81	0.09310	N	1	B;B;B;B	0.21071	0.051;0.051;0.051;0.013	B;B;B;B	0.25140	0.058;0.058;0.058;0.019	T	0.42085	-0.9472	10	0.22706	T	0.39	-5.0388	4.3338	0.11076	0.3211:0.0:0.5306:0.1483	.	122;120;120;120	Q6ZVU9;Q08334;B4DSX5;F5H766	.;I10R2_HUMAN;.;.	I	120	ENSP00000290200:V120I	ENSP00000290200:V120I	V	+	1	0	IL10RB	33573953	0.908000	0.30866	0.007000	0.13788	0.786000	0.44442	0.448000	0.21726	0.126000	0.18424	0.655000	0.94253	GTA	IL10RB	-	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3	ENSG00000243646		0.338	IL10RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL10RB	HGNC	protein_coding	OTTHUMT00000139831.3	181	0.00	0	G			34652083	34652083	+1	no_errors	ENST00000290200	ensembl	human	known	69_37n	missense	191	24.21	61	SNP	0.127	A
IL1RAPL1	11141	genome.wustl.edu	37	X	29973934	29973934	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chrX:29973934G>T	ENST00000378993.1	+	11	2761	c.2088G>T	c.(2086-2088)tgG>tgT	p.W696C	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.W696C	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	696					calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						GTGTGATATGGTGACAGAAAA	0.512																																						dbGAP											0													36.0	33.0	34.0					X																	29973934		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.2088G>T	X.37:g.29973934G>T	ENSP00000368278:p.Trp696Cys		A0AVG4|Q9UJ53	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_TIR_dom,smart_Ig_sub,smart_Ig_sub2,smart_TIR_dom,prints_IL1_rcpt_1,pfscan_TIR_dom,pfscan_Ig-like	p.W696C	ENST00000378993.1	37	c.2088	CCDS14218.1	X	.	.	.	.	.	.	.	.	.	.	G	15.44	2.835029	0.50951	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.10763	2.84;2.84	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.32346	0.0826	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.01413	-1.1361	9	.	.	.	.	17.759	0.88459	0.0:0.0:1.0:0.0	.	696	Q9NZN1	IRPL1_HUMAN	C	696	ENSP00000368278:W696C;ENSP00000305200:W696C	.	W	+	3	0	IL1RAPL1	29883855	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.263000	0.95617	2.382000	0.81193	0.600000	0.82982	TGG	IL1RAPL1	-	NULL	ENSG00000169306		0.512	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	HGNC	protein_coding	OTTHUMT00000056155.1	49	0.00	0	G	NM_014271		29973934	29973934	+1	no_errors	ENST00000302196	ensembl	human	known	69_37n	missense	26	48.00	24	SNP	1.000	T
ILKAP	80895	genome.wustl.edu	37	2	239079209	239079209	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr2:239079209delC	ENST00000254654.3	-	12	1322	c.1147delG	c.(1147-1149)gtcfs	p.V383fs		NM_030768.2	NP_110395.1	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated serine/threonine phosphatase	383	PP2C-like.				protein dephosphorylation (GO:0006470)|regulation of nuclear cell cycle DNA replication (GO:0033262)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		ATCACAGTGACGTTGTCGGCC	0.617																																						dbGAP											0													59.0	60.0	59.0					2																	239079209		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AY024365	CCDS2526.1	2q37.3	2012-04-17	2010-10-25		ENSG00000132323	ENSG00000132323	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	15566	protein-coding gene	gene with protein product			"""integrin-linked kinase-associated serine/threonine phosphatase 2C"""				Standard	NM_030768		Approved	DKFZP434J2031, FLJ10181	uc002vxv.3	Q9H0C8	OTTHUMG00000133334	ENST00000254654.3:c.1147delG	2.37:g.239079209delC	ENSP00000254654:p.Val383fs		B3KM39	Frame_Shift_Del	DEL	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.V383fs	ENST00000254654.3	37	c.1147	CCDS2526.1	2																																																																																			ILKAP	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000132323		0.617	ILKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILKAP	HGNC	protein_coding	OTTHUMT00000257163.2	23	0.00	0	C	NM_030768		239079209	239079209	-1	no_errors	ENST00000254654	ensembl	human	known	69_37n	frame_shift_del	8	65.38	17	DEL	1.000	-
INTS1	26173	genome.wustl.edu	37	7	1535175	1535175	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr7:1535175G>A	ENST00000404767.3	-	13	1811	c.1726C>T	c.(1726-1728)Cgc>Tgc	p.R576C	INTS1_ENST00000389470.4_Missense_Mutation_p.R704C	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	576					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		TGGAATGAGCGGAGCACTTCC	0.612																																						dbGAP											0													34.0	38.0	37.0					7																	1535175		2010	4154	6164	-	-	-	SO:0001583	missense	0			AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.1726C>T	7.37:g.1535175G>A	ENSP00000385722:p.Arg576Cys		A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	pfam_DUF3677,superfamily_ARM-type_fold	p.R704C	ENST00000404767.3	37	c.2110	CCDS47526.1	7	.	.	.	.	.	.	.	.	.	.	g	16.87	3.241981	0.58995	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.50548	0.74;0.75	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.58538	0.2129	L	0.47716	1.5	0.80722	D	1	D	0.76494	0.999	D	0.64410	0.925	T	0.57694	-0.7767	10	0.42905	T	0.14	.	13.6762	0.62456	0.0:0.0:0.8449:0.1551	.	576	Q8N201	INT1_HUMAN	C	576;704	ENSP00000385722:R576C;ENSP00000374121:R704C	ENSP00000374121:R704C	R	-	1	0	INTS1	1501701	1.000000	0.71417	0.477000	0.27303	0.561000	0.35649	3.361000	0.52306	2.194000	0.70268	0.651000	0.88453	CGC	INTS1	-	NULL	ENSG00000164880		0.612	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS1	HGNC	protein_coding	OTTHUMT00000323683.1	22	0.00	0	G			1535175	1535175	-1	no_errors	ENST00000389470	ensembl	human	known	69_37n	missense	19	51.28	20	SNP	1.000	A
IQCF1	132141	genome.wustl.edu	37	3	51928941	51928941	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr3:51928941C>A	ENST00000310914.5	-	4	645	c.583G>T	c.(583-585)Gtg>Ttg	p.V195L		NM_152397.2	NP_689610.2	Q8N6M8	IQCF1_HUMAN	IQ motif containing F1	195										central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CACTCTGTCACAATGCAAGGC	0.517																																						dbGAP											0													79.0	79.0	79.0					3																	51928941		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC029595	CCDS2836.1	3p21.31	2008-02-05			ENSG00000173389	ENSG00000173389			28607	protein-coding gene	gene with protein product						12477932	Standard	NM_152397		Approved	MGC39725	uc003dbv.3	Q8N6M8	OTTHUMG00000156908	ENST00000310914.5:c.583G>T	3.37:g.51928941C>A	ENSP00000307958:p.Val195Leu		Q8N711	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.V195L	ENST00000310914.5	37	c.583	CCDS2836.1	3	.	.	.	.	.	.	.	.	.	.	C	7.696	0.692085	0.15039	.	.	ENSG00000173389	ENST00000310914	T	0.38887	1.11	4.06	-1.38	0.09027	.	0.487640	0.17437	N	0.174267	T	0.31104	0.0786	M	0.63843	1.955	0.09310	N	1	B	0.17852	0.024	B	0.15052	0.012	T	0.28902	-1.0029	10	0.56958	D	0.05	-26.3484	1.4383	0.02349	0.1593:0.3356:0.3115:0.1935	.	195	Q8N6M8	IQCF1_HUMAN	L	195	ENSP00000307958:V195L	ENSP00000307958:V195L	V	-	1	0	IQCF1	51903981	0.193000	0.23313	0.053000	0.19242	0.231000	0.25187	0.549000	0.23329	-0.268000	0.09312	0.448000	0.29417	GTG	IQCF1	-	NULL	ENSG00000173389		0.517	IQCF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCF1	HGNC	protein_coding	OTTHUMT00000346568.1	107	0.00	0	C	NM_152397		51928941	51928941	-1	no_errors	ENST00000310914	ensembl	human	known	69_37n	missense	15	64.29	27	SNP	0.078	A
ITGA11	22801	genome.wustl.edu	37	15	68599782	68599782	+	Splice_Site	SNP	C	C	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr15:68599782C>A	ENST00000315757.7	-	28	3372		c.e28-1		ITGA11_ENST00000423218.2_Splice_Site	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11						cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						TGTACTTGAGCTGTGCAATCA	0.582											OREG0023219	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													31.0	39.0	37.0					15																	68599782		1985	4148	6133	-	-	-	SO:0001630	splice_region_variant	0			AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.3286-1G>T	15.37:g.68599782C>A		1108	J3KQM2|Q8WYI8|Q9UKQ1	Splice_Site	SNP	-	e28-1	ENST00000315757.7	37	c.3286-1	CCDS45291.1	15	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765271	0.69878	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000535491	.	.	.	4.82	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8497	0.85990	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ITGA11	66386836	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	5.731000	0.68554	2.386000	0.81285	0.555000	0.69702	.	ITGA11	-	-	ENSG00000137809		0.582	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA11	HGNC	protein_coding		88	0.00	0	C	NM_012211	Intron	68599782	68599782	-1	no_errors	ENST00000315757	ensembl	human	known	69_37n	splice_site	63	20.25	16	SNP	1.000	A
KCNAB1	7881	genome.wustl.edu	37	3	155838561	155838561	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr3:155838561A>T	ENST00000490337.1	+	1	225	c.161A>T	c.(160-162)cAg>cTg	p.Q54L	KCNAB1_ENST00000389636.5_Missense_Mutation_p.Q54L	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	54					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GGGGAAAGCCAGCTCAGGGCG	0.552																																						dbGAP											0													63.0	62.0	63.0					3																	155838561		2203	4300	6503	-	-	-	SO:0001583	missense	0			U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.161A>T	3.37:g.155838561A>T	ENSP00000419952:p.Gln54Leu		A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_K_chnl_volt-dep_bsu_KCNAB-rel,prints_K_chnl_volt-dep_bsu_KCNAB1,prints_K_chnl_volt-dep_bsu_KCNAB3,tigrfam_K_chnl_volt-dep_bsu_KCNAB	p.Q54L	ENST00000490337.1	37	c.161	CCDS3174.1	3	.	.	.	.	.	.	.	.	.	.	A	11.09	1.537888	0.27475	.	.	ENSG00000169282	ENST00000490337;ENST00000389636	T;T	0.11063	3.2;2.81	5.47	3.01	0.34805	.	.	.	.	.	T	0.05456	0.0144	N	0.08118	0	0.80722	D	1	B;B	0.19200	0.034;0.01	B;B	0.12156	0.007;0.007	T	0.34750	-0.9816	9	0.49607	T	0.09	-9.5899	7.4086	0.27006	0.8024:0.0:0.0697:0.1279	.	54;54	B7Z8E5;Q14722	.;KCAB1_HUMAN	L	54	ENSP00000419952:Q54L;ENSP00000374287:Q54L	ENSP00000374287:Q54L	Q	+	2	0	KCNAB1	157321255	1.000000	0.71417	0.649000	0.29536	0.597000	0.36814	3.448000	0.52943	0.341000	0.23771	0.455000	0.32223	CAG	KCNAB1	-	NULL	ENSG00000169282		0.552	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	KCNAB1	HGNC	protein_coding	OTTHUMT00000351411.1	93	0.00	0	A	NM_003471		155838561	155838561	+1	no_errors	ENST00000490337	ensembl	human	known	69_37n	missense	58	20.55	15	SNP	0.997	T
KCNJ4	3761	genome.wustl.edu	37	22	38823629	38823629	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr22:38823629G>T	ENST00000303592.3	-	2	767	c.509C>A	c.(508-510)aCc>aAc	p.T170N	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	170					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)			endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					GGCCATGATGGTGCCAATCAT	0.622																																						dbGAP											0													53.0	50.0	51.0					22																	38823629		2203	4300	6503	-	-	-	SO:0001583	missense	0			U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.509C>A	22.37:g.38823629G>T	ENSP00000306497:p.Thr170Asn		Q14D44	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir2.3	p.T170N	ENST00000303592.3	37	c.509	CCDS13971.1	22	.	.	.	.	.	.	.	.	.	.	G	23.8	4.456376	0.84317	.	.	ENSG00000168135	ENST00000303592	D	0.94280	-3.39	4.94	4.94	0.65067	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.96112	0.8733	M	0.69823	2.125	0.54753	D	0.999986	D	0.58620	0.983	D	0.63703	0.917	D	0.96590	0.9437	10	0.87932	D	0	.	18.5997	0.91244	0.0:0.0:1.0:0.0	.	170	P48050	IRK4_HUMAN	N	170	ENSP00000306497:T170N	ENSP00000306497:T170N	T	-	2	0	KCNJ4	37153575	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.832000	0.99423	2.472000	0.83506	0.555000	0.69702	ACC	KCNJ4	-	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.3	ENSG00000168135		0.622	KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ4	HGNC	protein_coding	OTTHUMT00000321447.1	20	0.00	0	G	NM_004981		38823629	38823629	-1	no_errors	ENST00000303592	ensembl	human	known	69_37n	missense	15	42.31	11	SNP	1.000	T
KLHL32	114792	genome.wustl.edu	37	6	97533213	97533213	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr6:97533213G>T	ENST00000369261.4	+	6	986	c.623G>T	c.(622-624)tGg>tTg	p.W208L	KLHL32_ENST00000544166.1_Intron|KLHL32_ENST00000536676.1_Missense_Mutation_p.W172L|KLHL32_ENST00000539200.1_Missense_Mutation_p.W139L	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	208										breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		GAGCAGATCTGGCAGGTAAGG	0.522																																						dbGAP											0													47.0	47.0	47.0					6																	97533213		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.623G>T	6.37:g.97533213G>T	ENSP00000358265:p.Trp208Leu		B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.W208L	ENST00000369261.4	37	c.623	CCDS5038.1	6	.	.	.	.	.	.	.	.	.	.	G	32	5.191428	0.94923	.	.	ENSG00000186231	ENST00000369255;ENST00000369261;ENST00000536676;ENST00000539200;ENST00000447886	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	6.06	6.06	0.98353	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	T	0.67832	0.2935	L	0.31371	0.925	0.80722	D	1	B;D;B;D	0.76494	0.067;0.999;0.024;0.98	B;D;B;P	0.83275	0.069;0.996;0.004;0.84	T	0.70226	-0.4930	10	0.87932	D	0	.	20.6282	0.99521	0.0:0.0:1.0:0.0	.	139;172;208;208	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	L	134;208;172;139;104	ENSP00000358265:W208L;ENSP00000440382:W172L;ENSP00000441527:W139L;ENSP00000389310:W104L	ENSP00000358259:W134L	W	+	2	0	KLHL32	97639934	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.224000	0.95209	2.871000	0.98454	0.655000	0.94253	TGG	KLHL32	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000186231		0.522	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL32	HGNC	protein_coding	OTTHUMT00000041570.1	170	0.00	0	G	NM_052904		97533213	97533213	+1	no_errors	ENST00000369261	ensembl	human	known	69_37n	missense	50	23.08	15	SNP	1.000	T
LIPE	3991	genome.wustl.edu	37	19	42911525	42911525	+	Silent	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr19:42911525C>G	ENST00000244289.4	-	6	2214	c.1938G>C	c.(1936-1938)ctG>ctC	p.L646L	LIPE_ENST00000602000.1_5'Flank|LIPE-AS1_ENST00000593491.2_RNA|LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000599276.1_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	646					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				AGTGCACTATCAGGGACCGCG	0.667																																						dbGAP											0													24.0	27.0	26.0					19																	42911525		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.1938G>C	19.37:g.42911525C>G			Q3LRT2|Q6NSL7	Silent	SNP	pfam_HSL_N,pfam_AB_hydrolase_3,pfam_Steryl_acetyl_hydrolase	p.L646	ENST00000244289.4	37	c.1938	CCDS12607.1	19																																																																																			LIPE	-	pfam_Steryl_acetyl_hydrolase	ENSG00000079435		0.667	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPE	HGNC	protein_coding	OTTHUMT00000463861.1	71	0.00	0	C	NM_005357		42911525	42911525	-1	no_errors	ENST00000244289	ensembl	human	known	69_37n	silent	23	56.60	30	SNP	0.574	G
LOXHD1	125336	genome.wustl.edu	37	18	44122705	44122705	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr18:44122705C>G	ENST00000398722.4	-	17	2898	c.2899G>C	c.(2899-2901)Ggc>Cgc	p.G967R	LOXHD1_ENST00000536736.1_Missense_Mutation_p.G1245R|LOXHD1_ENST00000441551.2_Missense_Mutation_p.G1039R|LOXHD1_ENST00000300591.6_Missense_Mutation_p.G134R|LOXHD1_ENST00000441893.2_Missense_Mutation_p.G178R|LOXHD1_ENST00000579038.1_Missense_Mutation_p.G38R|LOXHD1_ENST00000582408.1_Missense_Mutation_p.G134R			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	967	PLAT 7. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TTGTCATGGCCAAGCCGGACT	0.517																																						dbGAP											0													105.0	114.0	111.0					18																	44122705		692	1591	2283	-	-	-	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.2899G>C	18.37:g.44122705C>G	ENSP00000381707:p.Gly967Arg		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	p.G1245R	ENST00000398722.4	37	c.3733		18	.	.	.	.	.	.	.	.	.	.	C	10.35	1.327044	0.24080	.	.	ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730;ENST00000536111	T;T;T;T;T	0.61980	0.06;0.06;0.06;0.06;0.06	5.68	5.68	0.88126	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.099413	0.64402	D	0.000001	T	0.75213	0.3819	M	0.64676	1.99	0.58432	D	0.999999	D;D;D;D	0.89917	0.959;1.0;1.0;1.0	P;D;D;D	0.97110	0.897;1.0;1.0;1.0	T	0.67741	-0.5592	10	0.07813	T	0.8	.	19.3902	0.94578	0.0:1.0:0.0:0.0	.	1245;178;967;967	F5GZB4;F8WA52;Q8IVV2-2;Q8IVV2	.;.;.;LOXH1_HUMAN	R	134;967;1245;178;967;147	ENSP00000300591:G134R;ENSP00000381707:G967R;ENSP00000444586:G1245R;ENSP00000409062:G178R;ENSP00000440060:G147R	ENSP00000300591:G134R	G	-	1	0	LOXHD1	42376703	1.000000	0.71417	0.991000	0.47740	0.068000	0.16541	7.004000	0.76317	2.698000	0.92095	0.561000	0.74099	GGC	LOXHD1	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	ENSG00000167210		0.517	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		347	0.00	0	C	NM_144612		44122705	44122705	-1	no_errors	ENST00000536736	ensembl	human	known	69_37n	missense	35	64.29	63	SNP	1.000	G
LRRC37A4P	55073	genome.wustl.edu	37	17	43585719	43585719	+	RNA	SNP	A	A	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr17:43585719A>C	ENST00000579913.1	-	0	1630				RP11-798G7.5_ENST00000253803.2_RNA	NR_002940.2				leucine rich repeat containing 37, member A4, pseudogene																		TGGCACTGAGAGGTTTGTACA	0.448																																						dbGAP											0																																										-	-	-			0			AK000982		17q21.31	2014-04-01	2012-03-07	2012-03-07	ENSG00000214425	ENSG00000214425			25479	pseudogene	pseudogene			"""leucine rich repeat containing 37, member A4 (pseudogene)"""	LRRC37A4			Standard	NR_002940		Approved	FLJ10120	uc031rhd.1		OTTHUMG00000179212		17.37:g.43585719A>C				RNA	SNP	-	NULL	ENST00000579913.1	37	NULL		17																																																																																			LRRC37A4P	-	-	ENSG00000214425		0.448	LRRC37A4P-002	KNOWN	basic	processed_transcript	LRRC37A4P	HGNC	pseudogene	OTTHUMT00000445300.1	134	0.00	0	A	NR_002940		43585719	43585719	-1	no_errors	ENST00000579913	ensembl	human	known	69_37n	rna	228	12.64	33	SNP	0.485	C
MAB21L1	4081	genome.wustl.edu	37	13	36050009	36050009	+	Silent	SNP	C	C	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr13:36050009C>T	ENST00000379919.4	-	1	823	c.267G>A	c.(265-267)gtG>gtA	p.V89V	NBEA_ENST00000400445.3_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000540320.1_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	89					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		AGCCATCGTCCACGAAGTTGA	0.577																																						dbGAP											0													81.0	81.0	81.0					13																	36050009		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.267G>A	13.37:g.36050009C>T			Q6I9T5	Silent	SNP	pfam_Mab-21_dom	p.V89	ENST00000379919.4	37	c.267	CCDS9353.1	13																																																																																			MAB21L1	-	pfam_Mab-21_dom	ENSG00000180660		0.577	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L1	HGNC	protein_coding	OTTHUMT00000044459.3	72	0.00	0	C	NM_005584		36050009	36050009	-1	no_errors	ENST00000379919	ensembl	human	known	69_37n	silent	72	18.18	16	SNP	1.000	T
MAGEA1	4100	genome.wustl.edu	37	X	152482175	152482175	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chrX:152482175A>G	ENST00000356661.5	-	3	1054	c.836T>C	c.(835-837)gTc>gCc	p.V279A		NM_004988.4	NP_004979.3	P43355	MAGA1_HUMAN	melanoma antigen family A, 1 (directs expression of antigen MZ2-E)	279	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase binding (GO:0042826)			breast(1)|central_nervous_system(7)|kidney(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATACTCAAGGACTTTCACATA	0.537																																						dbGAP											0													137.0	131.0	133.0					X																	152482175		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS76051.1	Xq28	2010-05-26			ENSG00000198681	ENSG00000198681			6796	protein-coding gene	gene with protein product	"""melanoma-associated antigen 1"", ""melanoma-associated antigen MZ2-E"", ""melanoma antigen MAGE-1"", ""melanoma antigen family A 1"", ""cancer/testis antigen family 1, member 1"""	300016		MAGE1		1840703	Standard	NM_004988		Approved	MGC9326, CT1.1	uc004fhf.2	P43355	OTTHUMG00000024192	ENST00000356661.5:c.836T>C	X.37:g.152482175A>G	ENSP00000349085:p.Val279Ala		B2RC81|O00346	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.V279A	ENST00000356661.5	37	c.836	CCDS14720.1	X	.	.	.	.	.	.	.	.	.	.	A	12.08	1.831017	0.32329	.	.	ENSG00000198681	ENST00000356661	T	0.08008	3.14	1.28	1.28	0.21552	.	0.330205	0.32258	N	0.006356	T	0.24392	0.0591	M	0.85630	2.765	0.09310	N	1	D	0.71674	0.998	D	0.77004	0.989	T	0.02512	-1.1148	10	0.72032	D	0.01	.	4.336	0.11087	1.0:0.0:0.0:0.0	.	279	P43355	MAGA1_HUMAN	A	279	ENSP00000349085:V279A	ENSP00000349085:V279A	V	-	2	0	MAGEA1	152135369	0.149000	0.22717	0.003000	0.11579	0.033000	0.12548	1.439000	0.35013	0.758000	0.33059	0.158000	0.16466	GTC	MAGEA1	-	pfam_MAGE,pfscan_MAGE	ENSG00000198681		0.537	MAGEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA1	HGNC	protein_coding	OTTHUMT00000060940.1	91	0.00	0	A	NM_004988		152482175	152482175	-1	no_errors	ENST00000356661	ensembl	human	known	69_37n	missense	131	38.60	83	SNP	0.003	G
MTHFD1	4522	genome.wustl.edu	37	14	64906860	64906860	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr14:64906860C>G	ENST00000545908.1	+	18	2088	c.1859C>G	c.(1858-1860)tCt>tGt	p.S620C	CTD-2555O16.4_ENST00000609125.1_RNA|MTHFD1_ENST00000216605.8_Missense_Mutation_p.S564C|CTD-2555O16.2_ENST00000556640.1_RNA			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	564	Formyltetrahydrofolate synthetase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	TTTGATATCTCTGTGGCCAGT	0.448																																					Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	dbGAP											0													73.0	66.0	68.0					14																	64906860		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.1859C>G	14.37:g.64906860C>G	ENSP00000438588:p.Ser620Cys		B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	pfam_Formate_THF_ligase,pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.S620C	ENST00000545908.1	37	c.1859		14	.	.	.	.	.	.	.	.	.	.	C	25.1	4.598183	0.87055	.	.	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605;ENST00000555252	T;T;T;T	0.25250	1.81;1.81;1.81;1.81	5.54	5.54	0.83059	.	0.111393	0.64402	D	0.000007	T	0.56630	0.1998	M	0.83312	2.635	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.998;0.996	D;D;D	0.69479	0.959;0.964;0.919	T	0.60979	-0.7155	10	0.87932	D	0	-18.3566	19.8613	0.96786	0.0:1.0:0.0:0.0	.	620;564;564	F5H2F4;P11586;G3V2B8	.;C1TC_HUMAN;.	C	620;564;620;544	ENSP00000438588:S620C;ENSP00000450560:S564C;ENSP00000216605:S620C;ENSP00000451309:S544C	ENSP00000216605:S564C	S	+	2	0	MTHFD1	63976613	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	5.997000	0.70646	2.767000	0.95098	0.555000	0.69702	TCT	MTHFD1	-	pfam_Formate_THF_ligase	ENSG00000100714		0.448	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	MTHFD1	HGNC	protein_coding	OTTHUMT00000412167.1	104	0.00	0	C			64906860	64906860	+1	no_errors	ENST00000216605	ensembl	human	known	69_37n	missense	40	66.39	79	SNP	1.000	G
MUC12	10071	genome.wustl.edu	37	7	100635585	100635585	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr7:100635585C>T	ENST00000379442.3	+	5	2170	c.2170C>T	c.(2170-2172)Cac>Tac	p.H724Y	MUC12_ENST00000536621.1_Missense_Mutation_p.H581Y			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	724	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						TACTACCTTCCACAGCCGCCC	0.552																																						dbGAP											0													266.0	295.0	287.0					7																	100635585		692	1591	2283	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.2170C>T	7.37:g.100635585C>T	ENSP00000368755:p.His724Tyr		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.H724Y	ENST00000379442.3	37	c.2170		7	.	.	.	.	.	.	.	.	.	.	-	0.762	-0.768906	0.02974	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12039	2.72;2.72	0.695	-1.05	0.10036	.	.	.	.	.	T	0.06280	0.0162	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.36553	-0.9743	7	0.46703	T	0.11	.	4.3858	0.11316	0.0:0.5759:0.0:0.4241	.	.	.	.	Y	724;581	ENSP00000368755:H724Y;ENSP00000441929:H581Y	ENSP00000368755:H724Y	H	+	1	0	MUC12	100422305	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.032000	0.13732	-0.346000	0.08312	0.162000	0.16502	CAC	MUC12	-	NULL	ENSG00000205277		0.552	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	608	0.00	0	C	XM_379904		100635585	100635585	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	682	22.97	204	SNP	0.001	T
MYO18A	399687	genome.wustl.edu	37	17	27448654	27448654	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr17:27448654G>A	ENST00000527372.1	-	5	1462	c.1282C>T	c.(1282-1284)Cgc>Tgc	p.R428C	MYO18A_ENST00000533112.1_Missense_Mutation_p.R428C|MYO18A_ENST00000354329.4_Missense_Mutation_p.R428C|MYO18A_ENST00000531253.1_Missense_Mutation_p.R428C	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	428	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GCGCCATAGCGCTGGCGCAAG	0.637																																					Esophageal Squamous(182;472 2015 7001 15270 22562)	dbGAP											0													16.0	22.0	20.0					17																	27448654		2155	4240	6395	-	-	-	SO:0001583	missense	0			D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.1282C>T	17.37:g.27448654G>A	ENSP00000437073:p.Arg428Cys		Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_PDZ,superfamily_PDZ,superfamily_Regulat_G_prot_signal_superfam,smart_PDZ,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_PDZ,pfscan_RecA_monomer-monomer_interface,prints_Myosin_head_motor_dom	p.R428C	ENST00000527372.1	37	c.1282	CCDS45642.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.6|27.6	4.843031|4.843031	0.91197|0.91197	.|.	.|.	ENSG00000196535|ENSG00000196535	ENST00000528564|ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000531686	.|D;D;D;D	.|0.84944	.|-1.92;-1.92;-1.92;-1.92	5.51|5.51	5.51|5.51	0.81932|0.81932	.|Myosin head, motor domain (2);	.|0.101965	.|0.64402	.|D	.|0.000002	D|D	0.93986|0.93986	0.8074|0.8074	M|M	0.93939|0.93939	3.475|3.475	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D;D	.|0.89917	.|1.0;0.999;0.999;1.0	.|D;D;D;D	.|0.97110	.|1.0;0.917;0.917;0.967	D|D	0.95008|0.95008	0.8149|0.8149	5|10	.|0.87932	.|D	.|0	.|.	13.6788|13.6788	0.62472|0.62472	0.0762:0.0:0.9238:0.0|0.0762:0.0:0.9238:0.0	.|.	.|97;428;428;428	.|Q92614-2;Q92614-3;Q92614-4;Q92614	.|.;.;.;MY18A_HUMAN	V|C	133|428;428;428;428;428;108	.|ENSP00000346291:R428C;ENSP00000435932:R428C;ENSP00000434228:R428C;ENSP00000437073:R428C	.|ENSP00000346291:R428C	A|R	-|-	2|1	0|0	MYO18A|MYO18A	24472780|24472780	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.903000|0.903000	0.53119|0.53119	7.464000|7.464000	0.80887|0.80887	2.586000|2.586000	0.87340|0.87340	0.561000|0.561000	0.74099|0.74099	GCG|CGC	MYO18A	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000196535		0.637	MYO18A-001	KNOWN	basic|CCDS	protein_coding	MYO18A	HGNC	protein_coding	OTTHUMT00000389396.1	25	0.00	0	G	NM_078471		27448654	27448654	-1	no_errors	ENST00000354329	ensembl	human	known	69_37n	missense	9	55.00	11	SNP	1.000	A
N4BP2L2	10443	genome.wustl.edu	37	13	33018233	33018233	+	Silent	SNP	C	C	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr13:33018233C>T	ENST00000504114.1	-	6	487	c.396G>A	c.(394-396)agG>agA	p.R132R	N4BP2L2_ENST00000399396.3_Silent_p.R147R|N4BP2L2_ENST00000446957.2_Intron|N4BP2L2_ENST00000380121.3_5'UTR|N4BP2L2_ENST00000357505.6_Silent_p.R132R			Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	0					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)			kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		TTTTGCTGAGCCTATGCCCAG	0.308																																						dbGAP											0													33.0	32.0	32.0					13																	33018233		1822	4074	5896	-	-	-	SO:0001819	synonymous_variant	0			U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000504114.1:c.396G>A	13.37:g.33018233C>T			A3KME8	Silent	SNP	NULL	p.R147	ENST00000504114.1	37	c.441		13																																																																																			N4BP2L2	-	NULL	ENSG00000244754		0.308	N4BP2L2-004	PUTATIVE	basic	protein_coding	N4BP2L2	HGNC	protein_coding	OTTHUMT00000361380.1	40	0.00	0	C	NM_014887		33018233	33018233	-1	no_errors	ENST00000399396	ensembl	human	known	69_37n	silent	37	43.94	29	SNP	0.000	T
NPHP4	261734	genome.wustl.edu	37	1	5926438	5926438	+	Silent	SNP	A	A	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr1:5926438A>T	ENST00000378156.4	-	26	3904	c.3639T>A	c.(3637-3639)atT>atA	p.I1213I	NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	1213					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		CTTACGAGTAAATGATGACAA	0.602																																						dbGAP											0													40.0	43.0	42.0					1																	5926438		1943	4138	6081	-	-	-	SO:0001819	synonymous_variant	0			AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.3639T>A	1.37:g.5926438A>T			Q8IWC0	Silent	SNP	NULL	p.I1213	ENST00000378156.4	37	c.3639	CCDS44052.1	1																																																																																			NPHP4	-	NULL	ENSG00000131697		0.602	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	NPHP4	HGNC	protein_coding	OTTHUMT00000001715.2	71	0.00	0	A			5926438	5926438	-1	no_errors	ENST00000378156	ensembl	human	known	69_37n	silent	73	34.21	39	SNP	0.453	T
NOL9	79707	genome.wustl.edu	37	1	6593398	6593398	+	Silent	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr1:6593398C>G	ENST00000377705.5	-	7	1211	c.1179G>C	c.(1177-1179)gtG>gtC	p.V393V		NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	393					maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		AAGCGCTGAACACATATTTCA	0.438																																						dbGAP											0													126.0	118.0	120.0					1																	6593398		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.1179G>C	1.37:g.6593398C>G			Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Silent	SNP	pfam_Pre-mRNA_cleavage_cplxII_Clp1	p.V393	ENST00000377705.5	37	c.1179	CCDS80.1	1																																																																																			NOL9	-	NULL	ENSG00000162408		0.438	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL9	HGNC	protein_coding	OTTHUMT00000002625.1	99	0.00	0	C	NM_024654		6593398	6593398	-1	no_errors	ENST00000377705	ensembl	human	known	69_37n	silent	141	13.50	22	SNP	1.000	G
OGDH	4967	genome.wustl.edu	37	7	44734067	44734067	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr7:44734067G>A	ENST00000222673.5	+	12	1602	c.1560G>A	c.(1558-1560)atG>atA	p.M520I	OGDH_ENST00000439616.2_Missense_Mutation_p.M370I|OGDH_ENST00000543843.1_Missense_Mutation_p.M471I|OGDH_ENST00000447398.1_Missense_Mutation_p.M531I|OGDH_ENST00000449767.1_Missense_Mutation_p.M516I|OGDH_ENST00000444676.1_Missense_Mutation_p.M535I	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	520					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	ATGAGCCCATGTTCACGCAGC	0.577																																						dbGAP											0													127.0	102.0	111.0					7																	44734067		2203	4300	6503	-	-	-	SO:0001583	missense	0			D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.1560G>A	7.37:g.44734067G>A	ENSP00000222673:p.Met520Ile		B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.M520I	ENST00000222673.5	37	c.1560	CCDS34627.1	7	.	.	.	.	.	.	.	.	.	.	G	27.1	4.797881	0.90538	.	.	ENSG00000105953	ENST00000439616;ENST00000449767;ENST00000447398;ENST00000444676;ENST00000222673;ENST00000543843	D;D;D;D;D;D	0.95690	-3.78;-3.78;-3.78;-3.78;-3.78;-3.78	5.31	5.31	0.75309	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.97801	0.9278	M	0.85859	2.78	0.80722	D	1	P;P;D;D;D;D	0.59357	0.902;0.902;0.985;0.985;0.971;0.985	P;P;D;D;P;D	0.67725	0.842;0.842;0.953;0.953;0.898;0.953	D	0.97810	1.0250	10	0.51188	T	0.08	-52.5997	18.9458	0.92621	0.0:0.0:1.0:0.0	.	315;370;516;531;422;520	B4E3E9;E9PFG7;E9PBM1;E9PDF2;A2VCT2;Q02218	.;.;.;.;.;ODO1_HUMAN	I	370;516;531;535;520;471	ENSP00000398576:M370I;ENSP00000392878:M516I;ENSP00000388183:M531I;ENSP00000414662:M535I;ENSP00000222673:M520I;ENSP00000443821:M471I	ENSP00000222673:M520I	M	+	3	0	OGDH	44700592	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.813000	0.99286	2.652000	0.90054	0.655000	0.94253	ATG	OGDH	-	pfam_DH_E1,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000105953		0.577	OGDH-001	KNOWN	basic|CCDS	protein_coding	OGDH	HGNC	protein_coding	OTTHUMT00000339391.1	76	0.00	0	G			44734067	44734067	+1	no_errors	ENST00000222673	ensembl	human	known	69_37n	missense	95	30.15	41	SNP	1.000	A
OR4L1	122742	genome.wustl.edu	37	14	20529103	20529103	+	Silent	SNP	A	A	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr14:20529103A>G	ENST00000315683.1	+	1	900	c.900A>G	c.(898-900)aaA>aaG	p.K300K		NM_001004717.1	NP_001004717.1	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L, member 1	300						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(16)|ovary(2)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		CCATAAGAAAATTACGGTTCC	0.313																																						dbGAP											0													52.0	58.0	56.0					14																	20529103		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS32029.1	14q11.2	2013-09-23			ENSG00000176246	ENSG00000176246		"""GPCR / Class A : Olfactory receptors"""	15356	protein-coding gene	gene with protein product				OR4L2P			Standard	NM_001004717		Approved		uc001vwn.1	Q8NH43	OTTHUMG00000169492	ENST00000315683.1:c.900A>G	14.37:g.20529103A>G			Q6IEZ5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.K300	ENST00000315683.1	37	c.900	CCDS32029.1	14																																																																																			OR4L1	-	NULL	ENSG00000176246		0.313	OR4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4L1	HGNC	protein_coding	OTTHUMT00000404381.1	72	0.00	0	A			20529103	20529103	+1	no_errors	ENST00000315683	ensembl	human	known	69_37n	silent	45	43.04	34	SNP	0.991	G
OR9A2	135924	genome.wustl.edu	37	7	142723943	142723943	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr7:142723943G>C	ENST00000350513.2	-	1	339	c.277C>G	c.(277-279)Ctt>Gtt	p.L93V		NM_001001658.1	NP_001001658.1	Q8NGT5	OR9A2_HUMAN	olfactory receptor, family 9, subfamily A, member 2	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(3)|endometrium(4)|large_intestine(1)|lung(14)|skin(3)	25	Melanoma(164;0.059)					TGTAGAGAAAGATACTGTCTG	0.483																																						dbGAP											0													95.0	87.0	90.0					7																	142723943		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34767.1	7q34	2014-07-10			ENSG00000179468	ENSG00000179468		"""GPCR / Class A : Olfactory receptors"""	15093	protein-coding gene	gene with protein product							Standard	NM_001001658		Approved		uc003wcc.1	Q8NGT5	OTTHUMG00000158386	ENST00000350513.2:c.277C>G	7.37:g.142723943G>C	ENSP00000316518:p.Leu93Val		B9EH51|Q6IF71|Q8NGD9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L93V	ENST00000350513.2	37	c.277	CCDS34767.1	7	.	.	.	.	.	.	.	.	.	.	G	1.985	-0.433164	0.04669	.	.	ENSG00000179468	ENST00000350513	T	0.01092	5.35	4.62	3.74	0.42951	GPCR, rhodopsin-like superfamily (1);	0.556823	0.13404	U	0.390367	T	0.00936	0.0031	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49447	-0.8939	10	0.42905	T	0.14	-12.5949	10.9738	0.47454	0.0926:0.0:0.9074:0.0	.	93	Q8NGT5	OR9A2_HUMAN	V	93	ENSP00000316518:L93V	ENSP00000316518:L93V	L	-	1	0	OR9A2	142434065	0.993000	0.37304	0.003000	0.11579	0.123000	0.20343	6.118000	0.71583	1.287000	0.44583	0.561000	0.74099	CTT	OR9A2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000179468		0.483	OR9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9A2	HGNC	protein_coding	OTTHUMT00000350862.1	191	0.00	0	G			142723943	142723943	-1	no_errors	ENST00000350513	ensembl	human	known	69_37n	missense	121	42.99	92	SNP	0.018	C
OTOGL	283310	genome.wustl.edu	37	12	80712472	80712472	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr12:80712472C>G	ENST00000547103.1	+	32	3760	c.3754C>G	c.(3754-3756)Ctt>Gtt	p.L1252V	OTOGL_ENST00000458043.2_Missense_Mutation_p.L1252V			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1252					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						CACTCCAGGCCTTTTCAAAGA	0.338																																						dbGAP											0													21.0	19.0	20.0					12																	80712472		1771	4004	5775	-	-	-	SO:0001583	missense	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.3754C>G	12.37:g.80712472C>G	ENSP00000447211:p.Leu1252Val		F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.L1252V	ENST00000547103.1	37	c.3754		12	.	.	.	.	.	.	.	.	.	.	C	19.17	3.775733	0.70107	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.20598	2.06;2.07	5.91	5.91	0.95273	.	.	.	.	.	T	0.43389	0.1245	M	0.61703	1.905	0.51767	D	0.999933	.	.	.	.	.	.	T	0.05937	-1.0855	7	0.52906	T	0.07	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	.	.	.	V	1252	ENSP00000447211:L1252V;ENSP00000400895:L1252V	ENSP00000400895:L1252V	L	+	1	0	OTOGL	79236603	0.999000	0.42202	1.000000	0.80357	0.974000	0.67602	4.250000	0.58772	2.793000	0.96121	0.655000	0.94253	CTT	OTOGL	-	pfam_AbfB,superfamily_AbfB	ENSG00000165899		0.338	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	85	0.00	0	C	NM_173591		80712472	80712472	+1	no_errors	ENST00000458043	ensembl	human	known	69_37n	missense	61	37.11	36	SNP	1.000	G
PACSIN2	11252	genome.wustl.edu	37	22	43267475	43267475	+	Splice_Site	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr22:43267475C>G	ENST00000263246.3	-	11	1550	c.1349G>C	c.(1348-1350)gGg>gCg	p.G450A	PACSIN2_ENST00000402229.1_Splice_Site_p.G450A|PACSIN2_ENST00000403744.3_Splice_Site_p.G450A|PACSIN2_ENST00000337959.4_Splice_Site_p.G409A|PACSIN2_ENST00000407585.1_Splice_Site_p.G409A	NM_001184970.1	NP_001171899.1	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in neurons 2	450	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin cytoskeleton organization (GO:0030036)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cell projection morphogenesis (GO:0048858)|membrane tubulation (GO:0097320)|negative regulation of endocytosis (GO:0045806)|protein localization to endosome (GO:0036010)	caveola (GO:0005901)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	19		Glioma(61;0.222)				CAGCTCATCCCCTGCAAGACA	0.587																																						dbGAP											0													92.0	103.0	99.0					22																	43267475		2119	4258	6377	-	-	-	SO:0001630	splice_region_variant	0			AF128536	CCDS43023.1, CCDS54536.1	22q13.2-q13.33	2009-05-08			ENSG00000100266	ENSG00000100266			8571	protein-coding gene	gene with protein product	"""syndapin II"""	604960				10431838, 11082044	Standard	NM_007229		Approved	SDPII	uc003bdg.4	Q9UNF0	OTTHUMG00000150701	ENST00000263246.3:c.1349-1G>C	22.37:g.43267475C>G			O95921|Q96HV9|Q9H0D3|Q9NPN1|Q9Y4V2	Missense_Mutation	SNP	pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_FCH,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,prints_SH3_domain	p.G450A	ENST00000263246.3	37	c.1349	CCDS43023.1	22	.	.	.	.	.	.	.	.	.	.	C	21.0	4.085583	0.76642	.	.	ENSG00000100266	ENST00000263246;ENST00000337959;ENST00000407585;ENST00000403744;ENST00000402229	T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4	5.2	5.2	0.72013	Src homology-3 domain (5);	0.000000	0.85682	D	0.000000	D	0.87819	0.6273	H	0.95114	3.625	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.97110	0.983;1.0	D	0.91285	0.5054	10	0.87932	D	0	.	19.1217	0.93365	0.0:1.0:0.0:0.0	.	409;450	Q6FIA3;Q9UNF0	.;PACN2_HUMAN	A	450;409;409;450;450	ENSP00000263246:G450A;ENSP00000338379:G409A;ENSP00000385952:G409A;ENSP00000385372:G450A;ENSP00000385040:G450A	ENSP00000263246:G450A	G	-	2	0	PACSIN2	41597419	1.000000	0.71417	1.000000	0.80357	0.324000	0.28378	7.424000	0.80242	2.605000	0.88082	0.655000	0.94253	GGG	PACSIN2	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	ENSG00000100266		0.587	PACSIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PACSIN2	HGNC	protein_coding	OTTHUMT00000319665.1	64	0.00	0	C	NM_007229	Missense_Mutation	43267475	43267475	-1	no_errors	ENST00000263246	ensembl	human	known	69_37n	missense	135	44.67	109	SNP	1.000	G
PAK3	5063	genome.wustl.edu	37	X	110459702	110459702	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chrX:110459702A>C	ENST00000372010.1	+	18	1948	c.1506A>C	c.(1504-1506)agA>agC	p.R502S	PAK3_ENST00000519681.1_Missense_Mutation_p.R508S|PAK3_ENST00000372007.5_Missense_Mutation_p.R487S|PAK3_ENST00000262836.4_Missense_Mutation_p.R502S|PAK3_ENST00000518291.1_Missense_Mutation_p.R523S|PAK3_ENST00000360648.4_Missense_Mutation_p.R523S|PAK3_ENST00000417227.1_Missense_Mutation_p.R508S|PAK3_ENST00000425146.1_Missense_Mutation_p.R487S|PAK3_ENST00000446737.1_Missense_Mutation_p.R487S			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	502	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						ATCCTGAGAGACTGTCAGCTG	0.398										TSP Lung(19;0.15)																												dbGAP											0													132.0	128.0	129.0					X																	110459702		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.1506A>C	X.37:g.110459702A>C	ENSP00000361080:p.Arg502Ser		A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAK_box_Rho-bd,superfamily_Kinase-like_dom,smart_PAK_box_Rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAK_box_Rho-bd,pfscan_Prot_kinase_cat_dom	p.R523S	ENST00000372010.1	37	c.1569	CCDS48153.1	X	.	.	.	.	.	.	.	.	.	.	A	15.66	2.898659	0.52227	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000360648;ENST00000417227;ENST00000262836	T;T;T;T;T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11	5.54	5.54	0.83059	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.50650	0.1628	N	0.26042	0.785	0.58432	D	0.999996	B;B;B;B;B	0.11235	0.001;0.0;0.004;0.0;0.004	B;B;B;B;B	0.16722	0.006;0.006;0.016;0.006;0.016	T	0.43410	-0.9393	10	0.33940	T	0.23	.	14.8035	0.69935	1.0:0.0:0.0:0.0	.	508;523;502;487;502	O75914-4;O75914-3;O75914;O75914-2;B1GX77	.;.;PAK3_HUMAN;.;.	S	487;487;502;508;487;523;523;508;502	ENSP00000410853:R487S;ENSP00000401982:R487S;ENSP00000361080:R502S;ENSP00000429113:R508S;ENSP00000361077:R487S;ENSP00000428921:R523S;ENSP00000353864:R523S;ENSP00000389172:R508S;ENSP00000262836:R502S	ENSP00000262836:R502S	R	+	3	2	PAK3	110346358	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.770000	0.62309	1.877000	0.54381	0.427000	0.28365	AGA	PAK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000077264		0.398	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAK3	HGNC	protein_coding	OTTHUMT00000057918.1	304	0.00	0	A	NM_002578		110459702	110459702	+1	no_errors	ENST00000360648	ensembl	human	known	69_37n	missense	191	18.38	43	SNP	1.000	C
PCDHA13	56136	genome.wustl.edu	37	5	140263402	140263402	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr5:140263402G>A	ENST00000289272.2	+	1	1549	c.1549G>A	c.(1549-1551)Gtg>Atg	p.V517M	PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.V517M|PCDHA11_ENST00000398640.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	517	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCGGCAAGGTGTACGCGCT	0.687																																					Melanoma(147;1739 1852 5500 27947 37288)	dbGAP											0													77.0	81.0	80.0					5																	140263402		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1549G>A	5.37:g.140263402G>A	ENSP00000289272:p.Val517Met		O75277	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V517M	ENST00000289272.2	37	c.1549	CCDS4240.1	5	.	.	.	.	.	.	.	.	.	.	G	14.77	2.633671	0.47049	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.66460	-0.21;-0.21	4.77	3.9	0.45041	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.73385	0.3580	L	0.53729	1.69	0.23089	N	0.998317	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.992;0.98	T	0.60885	-0.7174	9	0.51188	T	0.08	.	3.9009	0.09161	0.0872:0.2676:0.4976:0.1475	.	517;517;517	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	M	517	ENSP00000386821:V517M;ENSP00000289272:V517M	ENSP00000289272:V517M	V	+	1	0	PCDHA13	140243586	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	-0.292000	0.08332	1.231000	0.43661	0.556000	0.70494	GTG	PCDHA13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000239389		0.687	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA13	HGNC	protein_coding	OTTHUMT00000335000.1	38	0.00	0	G	NM_018904		140263402	140263402	+1	no_errors	ENST00000289272	ensembl	human	known	69_37n	missense	12	60.00	18	SNP	0.783	A
PCDHGB4	8641	genome.wustl.edu	37	5	140769441	140769441	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr5:140769441G>A	ENST00000519479.1	+	1	1990	c.1990G>A	c.(1990-1992)Gac>Aac	p.D664N	PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA8_ENST00000398604.2_5'Flank|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	664	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTCTTCGCCGACAGCTTGCA	0.652																																						dbGAP											0													96.0	104.0	101.0					5																	140769441		2157	4259	6416	-	-	-	SO:0001583	missense	0			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.1990G>A	5.37:g.140769441G>A	ENSP00000428288:p.Asp664Asn		O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D664N	ENST00000519479.1	37	c.1990	CCDS54928.1	5	.	.	.	.	.	.	.	.	.	.	.	16.53	3.148886	0.57151	.	.	ENSG00000253953	ENST00000519479	T	0.53640	0.61	5.5	5.5	0.81552	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.71846	0.3388	M	0.86573	2.825	0.32174	N	0.581314	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.992	T	0.78588	-0.2146	9	0.52906	T	0.07	.	13.3619	0.60661	0.076:0.0:0.924:0.0	.	664;664	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	N	664	ENSP00000428288:D664N	ENSP00000428288:D664N	D	+	1	0	PCDHGB4	140749625	1.000000	0.71417	0.947000	0.38551	0.033000	0.12548	6.994000	0.76251	2.584000	0.87258	0.563000	0.77884	GAC	PCDHGB4	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253953		0.652	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB4	HGNC	protein_coding	OTTHUMT00000374745.1	54	0.00	0	G	NM_003736		140769441	140769441	+1	no_errors	ENST00000519479	ensembl	human	known	69_37n	missense	43	68.53	98	SNP	0.998	A
PDE1C	5137	genome.wustl.edu	37	7	31887635	31887635	+	Silent	SNP	C	C	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr7:31887635C>T	ENST00000396191.1	-	9	1382	c.927G>A	c.(925-927)ctG>ctA	p.L309L	PDE1C_ENST00000396182.2_Silent_p.L309L|PDE1C_ENST00000396193.1_Silent_p.L369L|PDE1C_ENST00000396184.3_Silent_p.L309L|PDE1C_ENST00000321453.7_Silent_p.L309L	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	309	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	CGTCATCTTGCAGAAGGCGAT	0.408																																						dbGAP											0													114.0	105.0	108.0					7																	31887635		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.927G>A	7.37:g.31887635C>T			B3KPC6|E9PE92|Q14124|Q8NB10	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.L309	ENST00000396191.1	37	c.927	CCDS55099.1	7																																																																																			PDE1C	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	ENSG00000154678		0.408	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	HGNC	protein_coding	OTTHUMT00000328458.1	110	0.00	0	C			31887635	31887635	-1	no_errors	ENST00000321453	ensembl	human	known	69_37n	silent	78	38.10	48	SNP	0.994	T
PDLIM4	8572	genome.wustl.edu	37	5	131607861	131607861	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr5:131607861A>T	ENST00000253754.3	+	7	996	c.932A>T	c.(931-933)aAg>aTg	p.K311M	P4HA2_ENST00000471826.1_Intron|PDLIM4_ENST00000379018.3_3'UTR	NM_001131027.1|NM_003687.3	NP_001124499.1|NP_003678.2	P50479	PDLI4_HUMAN	PDZ and LIM domain 4	311	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.						zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|urinary_tract(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCGCGCGTGAAGCCGCCCGAG	0.617																																						dbGAP											0													70.0	64.0	66.0					5																	131607861		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF153882	CCDS4152.1, CCDS47261.1	5q31.1	2008-02-05			ENSG00000131435	ENSG00000131435			16501	protein-coding gene	gene with protein product		603422				9573374	Standard	NM_001131027		Approved	RIL	uc003kwn.3	P50479	OTTHUMG00000059645	ENST00000253754.3:c.932A>T	5.37:g.131607861A>T	ENSP00000253754:p.Lys311Met		B2R8U1|Q53Y39|Q96AT8|Q9BTW8|Q9Y292	Missense_Mutation	SNP	pfam_PDZ,pfam_Znf_LIM,superfamily_PDZ,smart_PDZ,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.K311M	ENST00000253754.3	37	c.932	CCDS4152.1	5	.	.	.	.	.	.	.	.	.	.	A	17.37	3.372880	0.61624	.	.	ENSG00000131435	ENST00000253754	T	0.13538	2.58	5.05	3.87	0.44632	Zinc finger, LIM-type (2);	0.115341	0.64402	D	0.000015	T	0.33847	0.0877	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.66196	0.942	T	0.05084	-1.0907	10	0.59425	D	0.04	-19.5586	12.0267	0.53375	0.8553:0.1447:0.0:0.0	.	311	P50479	PDLI4_HUMAN	M	311	ENSP00000253754:K311M	ENSP00000253754:K311M	K	+	2	0	PDLIM4	131635760	1.000000	0.71417	1.000000	0.80357	0.613000	0.37349	5.210000	0.65214	0.743000	0.32719	-0.313000	0.08912	AAG	PDLIM4	-	pfscan_Znf_LIM	ENSG00000131435		0.617	PDLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDLIM4	HGNC	protein_coding	OTTHUMT00000132644.2	64	0.00	0	A	NM_003687		131607861	131607861	+1	no_errors	ENST00000253754	ensembl	human	known	69_37n	missense	9	68.97	20	SNP	1.000	T
PGLS	25796	genome.wustl.edu	37	19	17628661	17628661	+	Splice_Site	SNP	T	T	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr19:17628661T>A	ENST00000252603.2	+	4	683		c.e4+2		CTD-3131K8.3_ENST00000596192.1_RNA	NM_012088.2	NP_036220.1	O95336	6PGL_HUMAN	6-phosphogluconolactonase						carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	6-phosphogluconolactonase activity (GO:0017057)|monosaccharide binding (GO:0048029)			endometrium(1)|lung(1)	2						GTTCTGAAGGTAACAGCTGAG	0.537																																						dbGAP											0													86.0	71.0	76.0					19																	17628661		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ243972	CCDS12361.1	19p13.2	2008-02-05				ENSG00000130313	3.1.1.31		8903	protein-coding gene	gene with protein product		604951				10518023	Standard	NM_012088		Approved	6PGL	uc002ngw.3	O95336		ENST00000252603.2:c.639+2T>A	19.37:g.17628661T>A				Splice_Site	SNP	-	e4+2	ENST00000252603.2	37	c.639+2	CCDS12361.1	19	.	.	.	.	.	.	.	.	.	.	T	15.67	2.901435	0.52227	.	.	ENSG00000130313	ENST00000252603	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3589	0.66757	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	PGLS	17489661	1.000000	0.71417	0.998000	0.56505	0.347000	0.29111	7.618000	0.83043	2.274000	0.75844	0.533000	0.62120	.	PGLS	-	-	ENSG00000130313		0.537	PGLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLS	HGNC	protein_coding	OTTHUMT00000464154.1	23	0.00	0	T		Intron	17628661	17628661	+1	no_errors	ENST00000252603	ensembl	human	known	69_37n	splice_site	108	32.74	55	SNP	1.000	A
PHEX	5251	genome.wustl.edu	37	X	22237179	22237179	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chrX:22237179T>C	ENST00000379374.4	+	17	2292	c.1727T>C	c.(1726-1728)gTa>gCa	p.V576A	PHEX_ENST00000535894.1_Missense_Mutation_p.V479A|PHEX_ENST00000537599.1_Missense_Mutation_p.V576A|PHEX_ENST00000418858.3_Missense_Mutation_p.V279A	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	576					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						GCTATAGGAGTAATTGTCGGA	0.313																																						dbGAP											0													162.0	144.0	150.0					X																	22237179		2203	4299	6502	-	-	-	SO:0001583	missense	0			U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.1727T>C	X.37:g.22237179T>C	ENSP00000368682:p.Val576Ala		O00678|Q13646|Q2M325|Q93032|Q99827	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.V576A	ENST00000379374.4	37	c.1727	CCDS14204.1	X	.	.	.	.	.	.	.	.	.	.	T	18.41	3.618638	0.66787	.	.	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894;ENST00000418858	T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45	5.86	5.86	0.93980	Peptidase M13, neprilysin, C-terminal (2);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74794	0.3763	N	0.13098	0.295	0.80722	D	1	P;P	0.48162	0.885;0.906	P;P	0.49922	0.492;0.626	T	0.75861	-0.3168	10	0.34782	T	0.22	.	15.2047	0.73169	0.0:0.0:0.0:1.0	.	576;576	F5GXU4;P78562	.;PHEX_HUMAN	A	576;576;479;279	ENSP00000368682:V576A;ENSP00000440362:V576A;ENSP00000439418:V479A;ENSP00000443531:V279A	ENSP00000368682:V576A	V	+	2	0	PHEX	22147100	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.105000	0.77031	1.974000	0.57490	0.486000	0.48141	GTA	PHEX	-	pfam_Peptidase_M13_C,prints_Peptidase_M13_C	ENSG00000102174		0.313	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHEX	HGNC	protein_coding	OTTHUMT00000056035.1	292	0.00	0	T	NM_000444		22237179	22237179	+1	no_errors	ENST00000379374	ensembl	human	known	69_37n	missense	417	23.06	125	SNP	1.000	C
PIK3CA	5290	genome.wustl.edu	37	3	178916876	178916876	+	Missense_Mutation	SNP	G	G	A	rs121913287		TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr3:178916876G>A	ENST00000263967.3	+	2	420	c.263G>A	c.(262-264)cGa>cAa	p.R88Q		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	88	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.		R -> Q (in MCAP; also found in a glioblastoma multiforme sample; may disrupt the interaction between the PI3K- ABD domain and the N-terminal lobe of PI3K/PI4K kinase domain possibly affecting the conformation of the kinase domain). {ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.R88Q(53)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAAACAAGACGACTTTGTGAC	0.363	R88Q(JHUEM1_ENDOMETRIUM)|R88Q(SKUT1_SOFT_TISSUE)|R88Q(SNGM_ENDOMETRIUM)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	53	Substitution - Missense(53)	endometrium(27)|large_intestine(13)|central_nervous_system(8)|cervix(3)|soft_tissue(1)|breast(1)											107.0	102.0	104.0					3																	178916876		1821	4078	5899	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.263G>A	3.37:g.178916876G>A	ENSP00000263967:p.Arg88Gln		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.R88Q	ENST00000263967.3	37	c.263	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971870	0.92919	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	T;T	0.80033	-1.33;-1.33	5.44	5.44	0.79542	Phosphatidylinositol 3-kinase, p85-binding (2);	0.000000	0.85682	D	0.000000	D	0.89079	0.6613	M	0.72353	2.195	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	D	0.88404	0.3017	9	.	.	.	-14.8194	19.2635	0.93977	0.0:0.0:1.0:0.0	.	88	P42336	PK3CA_HUMAN	Q	88	ENSP00000263967:R88Q;ENSP00000417479:R88Q	.	R	+	2	0	PIK3CA	180399570	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.571000	0.82399	2.547000	0.85894	0.555000	0.69702	CGA	PIK3CA	-	pfam_PI3K_adapt-bd_dom,smart_PI3K_adapt-bd_dom	ENSG00000121879		0.363	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	89	0.00	0	G			178916876	178916876	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	60	98.15	3294	SNP	1.000	A
PLEKHA8P1	51054	genome.wustl.edu	37	12	45567946	45567946	+	RNA	SNP	T	T	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr12:45567946T>C	ENST00000256692.5	-	0	739					NR_037144.1		O95397	PKHA9_HUMAN	pleckstrin homology domain containing, family A member 8 pseudogene 1							cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TGGTGGAGTGTGGTAGAGCAG	0.448																																						dbGAP											0													198.0	185.0	189.0					12																	45567946		2203	4300	6503	-	-	-			0			AF103731		12q12	2010-11-24	2010-11-24	2010-11-24	ENSG00000134297	ENSG00000134297			30222	pseudogene	pseudogene	"""putative glycolipid transfer protein"""		"""pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9"""	PLEKHA9		12477932	Standard	NR_037144		Approved	FLJ14156	uc001rom.2	O95397			12.37:g.45567946T>C				RNA	SNP	-	NULL	ENST00000256692.5	37	NULL		12																																																																																			PLEKHA8P1	-	-	ENSG00000134297		0.448	PLEKHA8P1-002	KNOWN	basic	processed_transcript	PLEKHA8P1	HGNC	pseudogene	OTTHUMT00000404814.1	376	0.26	1	T	NR_037144		45567946	45567946	-1	no_errors	ENST00000256692	ensembl	human	known	69_37n	rna	313	27.48	119	SNP	0.001	C
PLEKHB2	55041	genome.wustl.edu	37	2	131904268	131904268	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr2:131904268C>G	ENST00000403716.1	+	8	1151	c.591C>G	c.(589-591)aaC>aaG	p.N197K	PLEKHB2_ENST00000409158.1_Missense_Mutation_p.N205K|PLEKHB2_ENST00000438882.2_Missense_Mutation_p.T161R|PLEKHB2_ENST00000234115.6_Missense_Mutation_p.N196K|PLEKHB2_ENST00000538982.1_Missense_Mutation_p.N149K|PLEKHB2_ENST00000409612.1_Missense_Mutation_p.N197K|PLEKHB2_ENST00000439822.2_Missense_Mutation_p.T153R|PLEKHB2_ENST00000409279.1_Missense_Mutation_p.N197K|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron	NM_001100623.1|NM_001267062.1|NM_001267063.1|NM_001267064.1|NM_001267065.1|NM_001267066.1|NM_017958.2	NP_001094093.1|NP_001253991.1|NP_001253992.1|NP_001253993.1|NP_001253994.1|NP_001253995.1|NP_060428.2	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2	197						endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		ATCGAGACAACGACAGCGACC	0.527																																						dbGAP											0													174.0	179.0	177.0					2																	131904268		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000403716.1:c.591C>G	2.37:g.131904268C>G	ENSP00000385892:p.Asn197Lys		B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.N197K	ENST00000403716.1	37	c.591	CCDS46413.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.58|13.58	2.279698|2.279698	0.40294|0.40294	.|.	.|.	ENSG00000115762|ENSG00000115762	ENST00000409158;ENST00000403716;ENST00000234115;ENST00000538982;ENST00000409612;ENST00000409279|ENST00000439822;ENST00000438882	.|.	.|.	.|.	5.59|5.59	-2.47|-2.47	0.06442|0.06442	.|.	.|.	.|.	.|.	.|.	T|T	0.52435|0.52435	0.1734|0.1734	L|L	0.60455|0.60455	1.87|1.87	0.37332|0.37332	D|D	0.910021|0.910021	B;B;B;B|P;P	0.33583|0.39847	0.22;0.327;0.22;0.418|0.691;0.662	B;B;B;B|B;B	0.35114|0.40741	0.096;0.196;0.096;0.096|0.339;0.174	T|T	0.55742|0.55742	-0.8093|-0.8093	8|8	0.59425|0.56958	D|D	0.04|0.05	.|.	11.99|11.99	0.53169|0.53169	0.0:0.3349:0.0:0.6651|0.0:0.3349:0.0:0.6651	.|.	196;196;197;205|153;161	Q53FF1;Q96CS7-3;Q96CS7;B8ZZN1|B4DZ66;B4DF08	.;.;PKHB2_HUMAN;.|.;.	K|R	205;197;196;149;197;197|153;161	.|.	ENSP00000234115:N196K|ENSP00000401193:T161R	N|T	+|+	3|2	2|0	PLEKHB2|PLEKHB2	131620738|131620738	0.045000|0.045000	0.20229|0.20229	0.037000|0.037000	0.18230|0.18230	0.900000|0.900000	0.52787|0.52787	-0.958000|-0.958000	0.03857|0.03857	-0.902000|-0.902000	0.03886|0.03886	-0.162000|-0.162000	0.13425|0.13425	AAC|ACG	PLEKHB2	-	NULL	ENSG00000115762		0.527	PLEKHB2-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLEKHB2	HGNC	protein_coding	OTTHUMT00000331304.2	121	0.00	0	C	NM_017958		131904268	131904268	+1	no_errors	ENST00000403716	ensembl	human	known	69_37n	missense	88	26.67	32	SNP	0.581	G
PPRC1	23082	genome.wustl.edu	37	10	103907133	103907133	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr10:103907133C>T	ENST00000278070.2	+	9	4423	c.4384C>T	c.(4384-4386)Cac>Tac	p.H1462Y	PPRC1_ENST00000489648.1_Intron|PPRC1_ENST00000413464.2_Intron|PPRC1_ENST00000370012.1_Missense_Mutation_p.H429Y	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1462	Arg-rich.|Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CTCCCCCCCACACAAGAGGTG	0.527																																						dbGAP											0													83.0	70.0	74.0					10																	103907133		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.4384C>T	10.37:g.103907133C>T	ENSP00000278070:p.His1462Tyr		Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.H1462Y	ENST00000278070.2	37	c.4384	CCDS7529.1	10	.	.	.	.	.	.	.	.	.	.	C	12.03	1.814368	0.32053	.	.	ENSG00000148840	ENST00000278070;ENST00000370012	T;T	0.47177	0.85;0.85	5.76	4.84	0.62591	.	0.437579	0.25391	N	0.031009	T	0.26666	0.0652	N	0.08118	0	0.80722	D	1	D;P	0.54964	0.969;0.947	B;B	0.43867	0.434;0.25	T	0.04400	-1.0954	10	0.35671	T	0.21	.	6.5626	0.22495	0.1544:0.702:0.0:0.1436	.	1342;1462	Q5VV67-2;Q5VV67	.;PPRC1_HUMAN	Y	1462;429	ENSP00000278070:H1462Y;ENSP00000359029:H429Y	ENSP00000278070:H1462Y	H	+	1	0	PPRC1	103897123	0.730000	0.28100	1.000000	0.80357	0.996000	0.88848	1.324000	0.33712	1.378000	0.46305	0.462000	0.41574	CAC	PPRC1	-	NULL	ENSG00000148840		0.527	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPRC1	HGNC	protein_coding	OTTHUMT00000050021.1	104	0.00	0	C	NM_015062		103907133	103907133	+1	no_errors	ENST00000278070	ensembl	human	known	69_37n	missense	60	11.76	8	SNP	0.974	T
PSMD1	5707	genome.wustl.edu	37	2	231927249	231927249	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr2:231927249G>A	ENST00000308696.6	+	4	326	c.164G>A	c.(163-165)cGg>cAg	p.R55Q	PSMD1_ENST00000409643.1_Missense_Mutation_p.R55Q|PSMD1_ENST00000373635.4_Missense_Mutation_p.R55Q	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	55					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	GAAGGTTTCCGGAGTCGGCAG	0.418																																						dbGAP											0													89.0	94.0	92.0					2																	231927249		2203	4300	6503	-	-	-	SO:0001583	missense	0			D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.164G>A	2.37:g.231927249G>A	ENSP00000309474:p.Arg55Gln		B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Missense_Mutation	SNP	pfam_APC_proteasome,superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn2	p.R55Q	ENST00000308696.6	37	c.164	CCDS2482.1	2	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628409	0.67015	.	.	ENSG00000173692	ENST00000308696;ENST00000373635;ENST00000440838;ENST00000409643	T;T;T	0.40756	1.02;1.02;1.02	6.08	6.08	0.98989	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.27205	0.0667	N	0.04090	-0.28	0.80722	D	1	B;B	0.23806	0.011;0.091	B;B	0.20577	0.001;0.03	T	0.08207	-1.0733	10	0.36615	T	0.2	-1.1949	20.6634	0.99662	0.0:0.0:1.0:0.0	.	55;55	Q99460;Q99460-2	PSMD1_HUMAN;.	Q	55	ENSP00000309474:R55Q;ENSP00000362738:R55Q;ENSP00000386932:R55Q	ENSP00000309474:R55Q	R	+	2	0	PSMD1	231635493	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.876000	0.87215	2.894000	0.99253	0.655000	0.94253	CGG	PSMD1	-	superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn2	ENSG00000173692		0.418	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD1	HGNC	protein_coding	OTTHUMT00000256958.2	115	0.00	0	G			231927249	231927249	+1	no_errors	ENST00000308696	ensembl	human	known	69_37n	missense	70	72.11	181	SNP	1.000	A
PTPRO	5800	genome.wustl.edu	37	12	15637127	15637127	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr12:15637127G>C	ENST00000281171.4	+	2	625	c.295G>C	c.(295-297)Gtg>Ctg	p.V99L	PTPRO_ENST00000348962.2_Missense_Mutation_p.V99L|PTPRO_ENST00000543886.1_Missense_Mutation_p.V99L	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	99	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				CACTCTGGTAGTGGTAAATGG	0.378																																						dbGAP											0													91.0	90.0	90.0					12																	15637127		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.295G>C	12.37:g.15637127G>C	ENSP00000281171:p.Val99Leu		A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.V99L	ENST00000281171.4	37	c.295	CCDS8675.1	12	.	.	.	.	.	.	.	.	.	.	G	16.07	3.018686	0.54576	.	.	ENSG00000151490	ENST00000281171;ENST00000543886;ENST00000348962	T;T	0.04454	3.63;3.62	5.48	5.48	0.80851	Fibronectin, type III (1);	0.000000	0.46442	D	0.000285	T	0.05777	0.0151	N	0.12182	0.205	0.80722	D	1	B;B;P	0.45902	0.012;0.007;0.868	B;B;P	0.46110	0.011;0.005;0.504	T	0.54377	-0.8303	10	0.36615	T	0.2	.	19.3636	0.94453	0.0:0.0:1.0:0.0	.	99;99;99	Q16827-2;Q16827;Q8IYG3	.;PTPRO_HUMAN;.	L	99	ENSP00000281171:V99L;ENSP00000343434:V99L	ENSP00000281171:V99L	V	+	1	0	PTPRO	15528394	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.473000	0.66774	2.573000	0.86826	0.655000	0.94253	GTG	PTPRO	-	superfamily_Fibronectin_type3	ENSG00000151490		0.378	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRO	HGNC	protein_coding	OTTHUMT00000401079.1	208	0.00	0	G			15637127	15637127	+1	no_errors	ENST00000281171	ensembl	human	known	69_37n	missense	211	16.86	43	SNP	1.000	C
PYROXD1	79912	genome.wustl.edu	37	12	21621644	21621644	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr12:21621644G>C	ENST00000240651.9	+	12	1513	c.1459G>C	c.(1459-1461)Gat>Cat	p.D487H	PYROXD1_ENST00000538582.1_Missense_Mutation_p.D416H	NM_024854.3	NP_079130.2	Q8WU10	PYRD1_HUMAN	pyridine nucleotide-disulphide oxidoreductase domain 1	487							oxidoreductase activity (GO:0016491)			endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|soft_tissue(1)	18						ATATGGAGAAGATCTGCTAGA	0.313																																						dbGAP											0													29.0	28.0	28.0					12																	21621644		2201	4294	6495	-	-	-	SO:0001583	missense	0			AL832441	CCDS31755.1	12p12.1	2014-02-12			ENSG00000121350	ENSG00000121350			26162	protein-coding gene	gene with protein product						12477932	Standard	NM_024854		Approved	DKFZp762G094, FLJ22028	uc001rew.3	Q8WU10	OTTHUMG00000169129	ENST00000240651.9:c.1459G>C	12.37:g.21621644G>C	ENSP00000240651:p.Asp487His		A6NKI6|B3KWN8|Q9H6P1	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_FAD_pyr_nucl-diS_OxRdtase	p.D487H	ENST00000240651.9	37	c.1459	CCDS31755.1	12	.	.	.	.	.	.	.	.	.	.	G	19.47	3.834209	0.71373	.	.	ENSG00000121350	ENST00000536935;ENST00000240651;ENST00000538582	.	.	.	5.02	5.02	0.67125	.	0.218813	0.47455	D	0.000233	T	0.63873	0.2548	M	0.75777	2.31	0.80722	D	1	P	0.49783	0.928	P	0.48270	0.572	T	0.65701	-0.6104	9	0.39692	T	0.17	.	13.4559	0.61199	0.0:0.157:0.8429:0.0	.	487	Q8WU10	PYRD1_HUMAN	H	193;487;416	.	ENSP00000240651:D487H	D	+	1	0	PYROXD1	21512911	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.379000	0.73154	2.477000	0.83638	0.563000	0.77884	GAT	PYROXD1	-	NULL	ENSG00000121350		0.313	PYROXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYROXD1	HGNC	protein_coding	OTTHUMT00000402363.1	107	0.00	0	G	NM_024854		21621644	21621644	+1	no_errors	ENST00000240651	ensembl	human	known	69_37n	missense	114	16.18	22	SNP	1.000	C
RBM19	9904	genome.wustl.edu	37	12	114296661	114296661	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr12:114296661T>C	ENST00000545145.2	-	22	2677	c.2599A>G	c.(2599-2601)Atg>Gtg	p.M867V	RBM19_ENST00000392561.3_Missense_Mutation_p.M867V|RBM19_ENST00000261741.5_Missense_Mutation_p.M867V	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	867	RRM 6. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					GTCCCAGTCATCTTCTTTGGC	0.557																																						dbGAP											0													129.0	121.0	124.0					12																	114296661		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.2599A>G	12.37:g.114296661T>C	ENSP00000442053:p.Met867Val		A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.M867V	ENST00000545145.2	37	c.2599	CCDS9172.1	12	.	.	.	.	.	.	.	.	.	.	T	12.08	1.829967	0.32329	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.05199	3.48;3.48;3.48	5.2	-2.04	0.07343	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.396839	0.29624	N	0.011637	T	0.02649	0.0080	N	0.13098	0.295	0.35835	D	0.825572	B	0.06786	0.001	B	0.17979	0.02	T	0.46317	-0.9200	10	0.23891	T	0.37	-28.1224	2.4046	0.04409	0.1127:0.1282:0.2346:0.5245	.	867	Q9Y4C8	RBM19_HUMAN	V	867	ENSP00000442053:M867V;ENSP00000376344:M867V;ENSP00000261741:M867V	ENSP00000261741:M867V	M	-	1	0	RBM19	112781044	1.000000	0.71417	0.870000	0.34147	0.985000	0.73830	0.763000	0.26517	-0.668000	0.05296	-0.264000	0.10439	ATG	RBM19	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000122965		0.557	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	RBM19	HGNC	protein_coding	OTTHUMT00000405251.1	104	0.00	0	T	NM_016196		114296661	114296661	-1	no_errors	ENST00000261741	ensembl	human	known	69_37n	missense	141	14.55	24	SNP	0.999	C
RBM27	54439	genome.wustl.edu	37	5	145610352	145610352	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr5:145610352C>A	ENST00000265271.5	+	6	888	c.722C>A	c.(721-723)aCt>aAt	p.T241N	RBM27_ENST00000506502.1_Missense_Mutation_p.T241N	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	241					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGCACTGTTACTGTGATCGCA	0.463																																						dbGAP											0													142.0	121.0	128.0					5																	145610352		1568	3582	5150	-	-	-	SO:0001583	missense	0			AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.722C>A	5.37:g.145610352C>A	ENSP00000265271:p.Thr241Asn		Q8IYW9	Missense_Mutation	SNP	pfam_PWI,pfam_Znf_CCCH,smart_RRM_dom,pfscan_RRM_dom	p.T241N	ENST00000265271.5	37	c.722	CCDS43378.1	5	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715970	0.89205	.	.	ENSG00000091009	ENST00000265271	T	0.50277	0.75	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.65165	0.2665	L	0.59436	1.845	0.58432	D	0.999998	D;D	0.76494	0.997;0.999	P;D	0.78314	0.829;0.991	T	0.57877	-0.7735	10	0.21014	T	0.42	-10.9461	19.2991	0.94136	0.0:1.0:0.0:0.0	.	241;241	Q9P2N5;B3KY61	RBM27_HUMAN;.	N	241	ENSP00000265271:T241N	ENSP00000265271:T241N	T	+	2	0	RBM27	145590545	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.717000	0.74707	2.561000	0.86390	0.563000	0.77884	ACT	RBM27	-	NULL	ENSG00000091009		0.463	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM27	HGNC	protein_coding	OTTHUMT00000373420.1	212	0.00	0	C	XM_291128		145610352	145610352	+1	no_errors	ENST00000265271	ensembl	human	known	69_37n	missense	45	75.81	141	SNP	1.000	A
RBM44	375316	genome.wustl.edu	37	2	238726909	238726909	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr2:238726909G>A	ENST00000409864.1	+	3	1604	c.1350G>A	c.(1348-1350)atG>atA	p.M450I	RBM44_ENST00000316997.4_Missense_Mutation_p.M450I|RBM44_ENST00000444524.2_Intron			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	449						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		TAGGAGAAATGTGTACTAAAT	0.398																																						dbGAP											0													80.0	75.0	77.0					2																	238726909		1934	4123	6057	-	-	-	SO:0001583	missense	0			AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.1350G>A	2.37:g.238726909G>A	ENSP00000386727:p.Met450Ile		A0AUW3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.M450I	ENST00000409864.1	37	c.1350	CCDS46554.1	2	.	.	.	.	.	.	.	.	.	.	G	1.241	-0.621304	0.03636	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.21932	1.98;1.98	5.86	-6.17	0.02091	.	0.981049	0.08357	N	0.958334	T	0.13415	0.0325	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32402	-0.9908	10	0.38643	T	0.18	0.0224	11.0612	0.47948	0.2101:0.0:0.6609:0.129	.	449	Q6ZP01	RBM44_HUMAN	I	450	ENSP00000321179:M450I;ENSP00000386727:M450I	ENSP00000321179:M450I	M	+	3	0	RBM44	238391648	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.333000	0.07894	-1.035000	0.03291	-1.239000	0.01543	ATG	RBM44	-	NULL	ENSG00000177483		0.398	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM44	HGNC	protein_coding	OTTHUMT00000328733.2	53	0.00	0	G	NM_001080504		238726909	238726909	+1	no_errors	ENST00000316997	ensembl	human	known	69_37n	missense	40	68.75	88	SNP	0.000	A
ROBO2	6092	genome.wustl.edu	37	3	77651571	77651571	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr3:77651571G>T	ENST00000461745.1	+	20	3965	c.3065G>T	c.(3064-3066)aGc>aTc	p.S1022I	ROBO2_ENST00000487694.3_Missense_Mutation_p.S1038I|ROBO2_ENST00000332191.8_Missense_Mutation_p.S1022I	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	1022					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CAATGGAAAAGCTCAATTCAG	0.443																																						dbGAP											0													117.0	109.0	112.0					3																	77651571		1928	4147	6075	-	-	-	SO:0001583	missense	0			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.3065G>T	3.37:g.77651571G>T	ENSP00000417164:p.Ser1022Ile		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S1022I	ENST00000461745.1	37	c.3065	CCDS43109.1	3	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	17.19|17.19|17.19	3.326167|3.326167|3.326167	0.60743|0.60743|0.60743	.|.|.	.|.|.	ENSG00000185008|ENSG00000185008|ENSG00000185008	ENST00000490991|ENST00000471893|ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191	.|T|T;T;T	.|0.73047|0.62498	.|-0.71|0.02;0.05;0.04	5.84|5.84|5.84	4.95|4.95|4.95	0.65309|0.65309|0.65309	.|.|.	.|.|0.000000	.|.|0.56097	.|.|D	.|.|0.000040	T|T|T	0.53367|0.53367|0.53367	0.1792|0.1792|0.1792	N|N|N	0.14661|0.14661|0.14661	0.345|0.345|0.345	.|.|.	.|.|.	.|.|.	.|.|P;P;P	.|.|0.47106	.|.|0.698;0.692;0.89	.|.|B;P;B	.|.|0.47528	.|.|0.205;0.549;0.391	T|T|T	0.66862|0.66862|0.66862	-0.5816|-0.5816|-0.5816	4|6|9	.|0.87932|0.52906	.|D|T	.|0|0.07	.|.|.	15.2336|15.2336|15.2336	0.73411|0.73411|0.73411	0.0:0.266:0.734:0.0|0.0:0.266:0.734:0.0|0.0:0.266:0.734:0.0	.|.|.	.|.|1038;1022;1022	.|.|Q19AB5;F8W703;Q9HCK4	.|.|.;.;ROBO2_HUMAN	S|N|I	179|96|1038;1038;1042;1022;1022	.|ENSP00000418190:K96N|ENSP00000417335:S1038I;ENSP00000417164:S1022I;ENSP00000327536:S1022I	.|ENSP00000418190:K96N|ENSP00000327536:S1022I	A|K|S	+|+|+	1|3|2	0|2|0	ROBO2|ROBO2|ROBO2	77734261|77734261|77734261	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.994000|0.994000|0.994000	0.84299|0.84299|0.84299	5.592000|5.592000|5.592000	0.67543|0.67543|0.67543	1.438000|1.438000|1.438000	0.47492|0.47492|0.47492	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GCT|AAG|AGC	ROBO2	-	NULL	ENSG00000185008		0.443	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	HGNC	protein_coding	OTTHUMT00000352600.2	77	0.00	0	G	XM_031246		77651571	77651571	+1	no_errors	ENST00000461745	ensembl	human	known	69_37n	missense	60	61.54	96	SNP	1.000	T
RPP38	10557	genome.wustl.edu	37	10	15145558	15145558	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr10:15145558T>C	ENST00000378197.4	+	3	759	c.245T>C	c.(244-246)aTt>aCt	p.I82T	NMT2_ENST00000466201.1_5'UTR|RPP38_ENST00000378202.5_Missense_Mutation_p.I82T|RPP38_ENST00000451677.1_Intron	NM_183005.4	NP_892117.1	P78345	RPP38_HUMAN	ribonuclease P/MRP 38kDa subunit	82					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)			breast(1)|endometrium(3)|large_intestine(1)|lung(2)|ovary(1)	8						AAATGCAGCATTGCTGTTGAT	0.418																																					GBM(118;1591 1611 9649 34378 50720)	dbGAP											0													51.0	53.0	52.0					10																	15145558		2203	4300	6503	-	-	-	SO:0001583	missense	0			U77664	CCDS7108.1	10p13	2012-05-21			ENSG00000152464	ENSG00000152464			30329	protein-coding gene	gene with protein product		606116				9037013, 9630247	Standard	NM_183005		Approved		uc001inx.5	P78345	OTTHUMG00000017728	ENST00000378197.4:c.245T>C	10.37:g.15145558T>C	ENSP00000367439:p.Ile82Thr		B3KPY0|D3DRT8|Q53F71|Q8NHS8	Missense_Mutation	SNP	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	p.I82T	ENST00000378197.4	37	c.245	CCDS7108.1	10	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.522753	0.00149	.	.	ENSG00000152464	ENST00000378203;ENST00000378201;ENST00000378202;ENST00000378197;ENST00000441850	T;T;T;T	0.22945	2.94;2.94;2.94;1.93	4.11	-8.22	0.01037	.	1.182100	0.06427	N	0.723434	T	0.11239	0.0274	N	0.10874	0.06	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34030	-0.9845	10	0.11794	T	0.64	4.3587	11.476	0.50297	0.1717:0.5681:0.0:0.2602	.	82	P78345	RPP38_HUMAN	T	82	ENSP00000367445:I82T;ENSP00000367444:I82T;ENSP00000367439:I82T;ENSP00000402635:I82T	ENSP00000367439:I82T	I	+	2	0	RPP38	15185564	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.012000	0.01451	-4.315000	0.00057	-3.306000	0.00045	ATT	RPP38	-	NULL	ENSG00000152464		0.418	RPP38-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPP38	HGNC	protein_coding	OTTHUMT00000046976.1	93	0.00	0	T	NM_006414		15145558	15145558	+1	no_errors	ENST00000378197	ensembl	human	known	69_37n	missense	82	37.59	50	SNP	0.000	C
RPTOR	57521	genome.wustl.edu	37	17	78867561	78867561	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr17:78867561G>C	ENST00000306801.3	+	20	2659	c.2297G>C	c.(2296-2298)aGc>aCc	p.S766T	RPTOR_ENST00000544334.2_Missense_Mutation_p.S608T|RPTOR_ENST00000575542.1_3'UTR	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	766					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						AGCAGCGCCAGCAGCACCCTG	0.672																																						dbGAP											0													70.0	62.0	64.0					17																	78867561		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.2297G>C	17.37:g.78867561G>C	ENSP00000307272:p.Ser766Thr		B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	pfam_HEAT,pfam_WD40_repeat,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Raptor	p.S766T	ENST00000306801.3	37	c.2297	CCDS11773.1	17	.	.	.	.	.	.	.	.	.	.	G	26.8	4.774657	0.90108	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.44881	0.95;0.91	4.89	4.89	0.63831	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.55561	0.1928	L	0.52011	1.625	0.80722	D	1	P;B	0.52577	0.954;0.158	D;B	0.66351	0.943;0.027	T	0.46938	-0.9155	10	0.11182	T	0.66	.	18.0465	0.89334	0.0:0.0:1.0:0.0	.	608;766	F5H7J5;Q8N122	.;RPTOR_HUMAN	T	766;608	ENSP00000307272:S766T;ENSP00000442479:S608T	ENSP00000307272:S766T	S	+	2	0	RPTOR	76482156	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	9.636000	0.98440	2.259000	0.74868	0.650000	0.86243	AGC	RPTOR	-	superfamily_ARM-type_fold	ENSG00000141564		0.672	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTOR	HGNC	protein_coding	OTTHUMT00000438125.1	134	0.00	0	G	NM_020761		78867561	78867561	+1	no_errors	ENST00000306801	ensembl	human	known	69_37n	missense	68	37.61	41	SNP	1.000	C
RYR2	6262	genome.wustl.edu	37	1	237586392	237586392	+	Splice_Site	SNP	G	G	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr1:237586392G>T	ENST00000366574.2	+	12	1166	c.849G>T	c.(847-849)gcG>gcT	p.A283A	RYR2_ENST00000360064.6_Splice_Site_p.A281A|RYR2_ENST00000542537.1_Splice_Site_p.A267A	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	283					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTTTCATTAGGTGGAGTGGAA	0.413																																						dbGAP											0													143.0	140.0	141.0					1																	237586392		1924	4129	6053	-	-	-	SO:0001630	splice_region_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.849-1G>T	1.37:g.237586392G>T			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.A281	ENST00000366574.2	37	c.843	CCDS55691.1	1																																																																																			RYR2	-	pfam_MIR,superfamily_MIR,prints_Ryan_recept	ENSG00000198626		0.413	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	73	0.00	0	G	NM_001035	Silent	237586392	237586392	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	silent	108	30.77	48	SNP	0.996	T
SAAL1	113174	genome.wustl.edu	37	11	18127464	18127464	+	Missense_Mutation	SNP	C	C	A	rs77233279	byFrequency	TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr11:18127464C>A	ENST00000524803.1	-	1	174	c.125G>T	c.(124-126)gGa>gTa	p.G42V	SAAL1_ENST00000529318.1_Missense_Mutation_p.G42V|SAAL1_ENST00000533851.1_5'UTR|SAAL1_ENST00000300013.4_Missense_Mutation_p.G42V			Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1	42										breast(2)|large_intestine(5)|lung(8)	15						CTGGATGAGTCCGCTGAGGAC	0.682											OREG0020819	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													61.0	43.0	49.0					11																	18127464		2199	4291	6490	-	-	-	SO:0001583	missense	0			AK123457	CCDS31439.1	11p15.1	2005-10-28			ENSG00000166788	ENSG00000166788			25158	protein-coding gene	gene with protein product							Standard	NM_138421		Approved	FLJ41463	uc001mnq.3	Q96ER3	OTTHUMG00000166428	ENST00000524803.1:c.125G>T	11.37:g.18127464C>A	ENSP00000432487:p.Gly42Val	723	A6NH05	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.G42V	ENST00000524803.1	37	c.125	CCDS31439.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.32|15.32	2.797257|2.797257	0.50208|0.50208	.|.	.|.	ENSG00000166788|ENSG00000166788	ENST00000532452|ENST00000524803;ENST00000300013;ENST00000529318;ENST00000530180	.|T;T;T;T	.|0.35048	.|1.33;1.33;1.33;1.33	5.46|5.46	4.48|4.48	0.54585|0.54585	.|.	.|0.168649	.|0.52532	.|D	.|0.000068	T|T	0.24699|0.24699	0.0599|0.0599	N|N	0.22421|0.22421	0.69|0.69	0.50313|0.50313	D|D	0.999864|0.999864	.|B;B;B	.|0.30361	.|0.277;0.277;0.277	.|B;B;B	.|0.34779	.|0.189;0.122;0.122	T|T	0.05162|0.05162	-1.0902|-1.0902	5|10	.|0.39692	.|T	.|0.17	-5.7028|-5.7028	7.9343|7.9343	0.29920|0.29920	0.1614:0.7563:0.0:0.0823|0.1614:0.7563:0.0:0.0823	.|.	.|42;42;42	.|E9PRZ1;G1UCX3;Q96ER3	.|.;.;SAAL1_HUMAN	Y|V	35|42	.|ENSP00000432487:G42V;ENSP00000300013:G42V;ENSP00000432216:G42V;ENSP00000431489:G42V	.|ENSP00000300013:G42V	D|G	-|-	1|2	0|0	SAAL1|SAAL1	18084040|18084040	0.556000|0.556000	0.26538|0.26538	1.000000|1.000000	0.80357|0.80357	0.909000|0.909000	0.53808|0.53808	0.892000|0.892000	0.28322|0.28322	2.720000|2.720000	0.93068|0.93068	0.655000|0.655000	0.94253|0.94253	GAC|GGA	SAAL1	-	NULL	ENSG00000166788		0.682	SAAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAAL1	HGNC	protein_coding	OTTHUMT00000389728.1	49	0.00	0	C	NM_138421		18127464	18127464	-1	no_errors	ENST00000524803	ensembl	human	known	69_37n	missense	18	30.77	8	SNP	0.997	A
SALL1	6299	genome.wustl.edu	37	16	51173426	51173426	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr16:51173426A>G	ENST00000251020.4	-	2	2740	c.2707T>C	c.(2707-2709)Tcc>Ccc	p.S903P	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.S806P	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	903					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			CCCACTGAGGATGAATCATTG	0.562																																					GBM(103;1352 1446 1855 4775 8890)	dbGAP											0													100.0	77.0	84.0					16																	51173426		2198	4300	6498	-	-	-	SO:0001583	missense	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2707T>C	16.37:g.51173426A>G	ENSP00000251020:p.Ser903Pro		Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S903P	ENST00000251020.4	37	c.2707	CCDS10747.1	16	.	.	.	.	.	.	.	.	.	.	A	11.18	1.562319	0.27915	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.80909	-1.43;-1.43	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.87489	0.6190	M	0.63169	1.94	0.58432	D	0.999997	D	0.76494	0.999	D	0.65874	0.939	D	0.88609	0.3155	10	0.66056	D	0.02	-22.3149	15.6025	0.76636	1.0:0.0:0.0:0.0	.	903	Q9NSC2	SALL1_HUMAN	P	903;806;867	ENSP00000251020:S903P;ENSP00000407914:S806P	ENSP00000251020:S903P	S	-	1	0	SALL1	49730927	1.000000	0.71417	0.997000	0.53966	0.012000	0.07955	7.327000	0.79147	2.085000	0.62840	0.455000	0.32223	TCC	SALL1	-	NULL	ENSG00000103449		0.562	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	130	0.00	0	A	NM_002968		51173426	51173426	-1	no_errors	ENST00000251020	ensembl	human	known	69_37n	missense	82	37.40	49	SNP	1.000	G
SEMA4D	10507	genome.wustl.edu	37	9	92017794	92017794	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr9:92017794G>A	ENST00000450295.1	-	4	1020	c.244C>T	c.(244-246)Cag>Tag	p.Q82*	SEMA4D_ENST00000356444.2_Nonsense_Mutation_p.Q82*|SEMA4D_ENST00000343780.4_Nonsense_Mutation_p.Q82*|SEMA4D_ENST00000455551.2_Nonsense_Mutation_p.Q82*|SEMA4D_ENST00000339861.4_Nonsense_Mutation_p.Q82*|SEMA4D_ENST00000420987.1_Nonsense_Mutation_p.Q82*|SEMA4D_ENST00000438547.2_Nonsense_Mutation_p.Q82*|SEMA4D_ENST00000422704.2_Nonsense_Mutation_p.Q82*			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	82	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						ACCTCATGCTGCTTCTCGGAG	0.607																																						dbGAP											0													123.0	89.0	101.0					9																	92017794		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.244C>T	9.37:g.92017794G>A	ENSP00000416523:p.Gln82*		B2RPM6|Q7Z5S4|Q8N8B0	Nonsense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,pfam_Immunoglobulin,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,smart_Ig_sub2,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.Q82*	ENST00000450295.1	37	c.244	CCDS6685.1	9	.	.	.	.	.	.	.	.	.	.	G	40	8.118479	0.98662	.	.	ENSG00000187764	ENST00000339861;ENST00000420987;ENST00000455551;ENST00000343780;ENST00000450295;ENST00000438547;ENST00000356444;ENST00000422704;ENST00000420681	.	.	.	4.78	4.78	0.61160	.	1.031490	0.07663	N	0.934035	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	15.3369	0.74263	0.0:0.0:1.0:0.0	.	.	.	.	X	82	.	ENSP00000344923:Q82X	Q	-	1	0	SEMA4D	91207614	0.999000	0.42202	0.988000	0.46212	0.491000	0.33493	3.278000	0.51662	2.470000	0.83445	0.609000	0.83330	CAG	SEMA4D	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000187764		0.607	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA4D	HGNC	protein_coding	OTTHUMT00000342411.1	114	0.00	0	G	NM_006378		92017794	92017794	-1	no_errors	ENST00000356444	ensembl	human	known	69_37n	nonsense	81	21.50	23	SNP	0.996	A
SERPINA7	6906	genome.wustl.edu	37	X	105278253	105278253	+	Silent	SNP	T	T	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chrX:105278253T>G	ENST00000327674.4	-	3	1352	c.1017A>C	c.(1015-1017)acA>acC	p.T339T	SERPINA7_ENST00000372563.1_Silent_p.T339T|SERPINA7_ENST00000487487.1_5'UTR			P05543	THBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7	339					aging (GO:0007568)|negative regulation of endopeptidase activity (GO:0010951)|post-embryonic development (GO:0009791)|regulation of proteolysis (GO:0030162)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to peptide hormone (GO:0043434)|response to prostaglandin E (GO:0034695)|response to vitamin A (GO:0033189)|thyroid hormone transport (GO:0070327)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone binding (GO:0042562)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|skin(3)	24					Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CATTGTCCTCTGTGAGTCCAG	0.378																																						dbGAP											0													96.0	83.0	87.0					X																	105278253		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M14091	CCDS14518.1	Xq21-q22	2014-02-18	2005-08-18		ENSG00000123561	ENSG00000123561		"""Serine (or cysteine) peptidase inhibitors"""	11583	protein-coding gene	gene with protein product	"""thyroxin-binding globulin"", ""thyroxine-binding globulin"", ""alpha-1 antiproteinase, antitrypsin"""	314200	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7"""	TBG		24172014	Standard	NM_000354		Approved		uc004eme.2	P05543	OTTHUMG00000022144	ENST00000327674.4:c.1017A>C	X.37:g.105278253T>G			D3DUX1	Silent	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom,prints_Prot_inh_Lserp2	p.T339	ENST00000327674.4	37	c.1017	CCDS14518.1	X																																																																																			SERPINA7	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000123561		0.378	SERPINA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA7	HGNC	protein_coding	OTTHUMT00000057790.1	146	0.00	0	T	NM_000354		105278253	105278253	-1	no_errors	ENST00000327674	ensembl	human	known	69_37n	silent	96	46.37	83	SNP	0.101	G
SETDB1	9869	genome.wustl.edu	37	1	150933074	150933074	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr1:150933074G>T	ENST00000271640.5	+	16	2726	c.2536G>T	c.(2536-2538)Ggt>Tgt	p.G846C	SETDB1_ENST00000368969.4_Missense_Mutation_p.G846C|SETDB1_ENST00000459773.1_3'UTR	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	846	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			AGACAAGGAGGGTCTGGAAAT	0.428																																						dbGAP											0													88.0	83.0	85.0					1																	150933074		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.2536G>T	1.37:g.150933074G>T	ENSP00000271640:p.Gly846Cys		A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	pfam_SET_dom,pfam_Pre-SET_dom,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Tudor,smart_Methyl_CpG_DNA-bd,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Methyl_CpG_DNA-bd,pfscan_SET_dom,pfscan_Pre-SET_dom,pfscan_Post-SET_dom	p.G846C	ENST00000271640.5	37	c.2536	CCDS44217.1	1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.457906	0.84317	.	.	ENSG00000143379	ENST00000271640;ENST00000368969;ENST00000498193	D;D;D	0.89939	-2.59;-2.59;-2.59	5.06	5.06	0.68205	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.91195	0.7226	L	0.39898	1.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92142	0.5721	10	0.87932	D	0	.	18.6077	0.91272	0.0:0.0:1.0:0.0	.	846;846;846	E9PRF4;Q15047-3;Q15047	.;.;SETB1_HUMAN	C	846	ENSP00000271640:G846C;ENSP00000357965:G846C;ENSP00000432348:G846C	ENSP00000271640:G846C	G	+	1	0	SETDB1	149199698	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.335000	0.96500	2.630000	0.89119	0.462000	0.41574	GGT	SETDB1	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000143379		0.428	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SETDB1	HGNC	protein_coding	OTTHUMT00000084717.2	184	0.54	1	G			150933074	150933074	+1	no_errors	ENST00000271640	ensembl	human	known	69_37n	missense	80	14.89	14	SNP	1.000	T
SHROOM4	57477	genome.wustl.edu	37	X	50381257	50381257	+	Silent	SNP	C	C	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chrX:50381257C>A	ENST00000289292.7	-	3	604	c.321G>T	c.(319-321)ctG>ctT	p.L107L	SHROOM4_ENST00000460112.3_5'UTR|SHROOM4_ENST00000376020.2_Silent_p.L107L			Q9ULL8	SHRM4_HUMAN	shroom family member 4	107					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					GGCATCCCTCCAGCAGCTTGG	0.567																																						dbGAP											0													94.0	60.0	72.0					X																	50381257		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.321G>T	X.37:g.50381257C>A			A7E2X9|D6RFW0|Q96LA0	Silent	SNP	pfam_ASD2,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L107	ENST00000289292.7	37	c.321	CCDS35277.1	X																																																																																			SHROOM4	-	NULL	ENSG00000158352		0.567	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	SHROOM4	HGNC	protein_coding	OTTHUMT00000056564.4	93	0.00	0	C	NM_020717		50381257	50381257	-1	no_errors	ENST00000289292	ensembl	human	known	69_37n	silent	85	14.14	14	SNP	1.000	A
SLCO1C1	53919	genome.wustl.edu	37	12	20890110	20890110	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr12:20890110G>C	ENST00000266509.2	+	11	1820	c.1452G>C	c.(1450-1452)gaG>gaC	p.E484D	SLCO1C1_ENST00000381552.1_Missense_Mutation_p.E484D|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.E435D|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.E366D|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.E484D	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	484	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	AATGTTCAGAGACAAAATGGG	0.358																																						dbGAP											0													102.0	94.0	97.0					12																	20890110		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1452G>C	12.37:g.20890110G>C	ENSP00000266509:p.Glu484Asp		B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.E484D	ENST00000266509.2	37	c.1452	CCDS8683.1	12	.	.	.	.	.	.	.	.	.	.	G	9.849	1.193097	0.21954	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.05447	3.44;3.44;3.44;3.44;3.44	5.02	2.04	0.26737	Proteinase inhibitor I1, Kazal (1);Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Protease inhibitor, Kazal-type (1);	0.515550	0.23874	N	0.043717	T	0.02848	0.0085	N	0.11651	0.15	0.25838	N	0.984097	B;B;B;B	0.09022	0.002;0.001;0.001;0.0	B;B;B;B	0.15484	0.003;0.013;0.012;0.004	T	0.47182	-0.9137	10	0.12430	T	0.62	.	6.3655	0.21453	0.1585:0.2983:0.5433:0.0	.	366;435;484;484	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	D	484;435;484;484;366	ENSP00000444149:E484D;ENSP00000438665:E435D;ENSP00000266509:E484D;ENSP00000370964:E484D;ENSP00000444527:E366D	ENSP00000266509:E484D	E	+	3	2	SLCO1C1	20781377	0.125000	0.22332	1.000000	0.80357	0.994000	0.84299	0.142000	0.16096	0.331000	0.23511	0.650000	0.86243	GAG	SLCO1C1	-	pfam_OA_transporter,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000139155		0.358	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1C1	HGNC	protein_coding	OTTHUMT00000401765.1	197	0.00	0	G	NM_017435		20890110	20890110	+1	no_errors	ENST00000381552	ensembl	human	known	69_37n	missense	291	29.54	122	SNP	0.972	C
SOS1	6654	genome.wustl.edu	37	2	39281774	39281774	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr2:39281774G>C	ENST00000426016.1	-	6	787	c.701C>G	c.(700-702)tCa>tGa	p.S234*	SOS1_ENST00000428721.2_Nonsense_Mutation_p.S177*|SOS1_ENST00000402219.2_Nonsense_Mutation_p.S234*|SOS1_ENST00000395038.2_Nonsense_Mutation_p.S234*			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	234	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				AAACAATTTTGAATTGGAGAC	0.299									Noonan syndrome																													dbGAP											0													41.0	44.0	43.0					2																	39281774		2202	4288	6490	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.701C>G	2.37:g.39281774G>C	ENSP00000387784:p.Ser234*		A8K2G3|B4DXG2	Nonsense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Histone_core_D,superfamily_Ras_GEF_dom,superfamily_Histone-fold,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S234*	ENST00000426016.1	37	c.701	CCDS1802.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.438221	0.96168	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000395038;ENST00000263879;ENST00000428721	.	.	.	5.88	4.99	0.66335	.	0.221076	0.40728	N	0.001038	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	15.297	0.73916	0.0679:0.0:0.9321:0.0	.	.	.	.	X	234;234;234;234;177	.	ENSP00000263879:S234X	S	-	2	0	SOS1	39135278	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.248000	0.58760	2.780000	0.95670	0.655000	0.94253	TCA	SOS1	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000115904		0.299	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SOS1	HGNC	protein_coding	OTTHUMT00000219948.3	70	0.00	0	G	NM_005633		39281774	39281774	-1	no_errors	ENST00000402219	ensembl	human	known	69_37n	nonsense	76	17.39	16	SNP	1.000	C
SPTBN5	51332	genome.wustl.edu	37	15	42185136	42185136	+	Missense_Mutation	SNP	A	A	C	rs373540677		TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr15:42185136A>C	ENST00000320955.6	-	3	567	c.340T>G	c.(340-342)Ttc>Gtc	p.F114V	RP11-23P13.6_ENST00000309874.2_RNA|RP11-23P13.6_ENST00000562920.1_RNA|RP11-23P13.6_ENST00000564432.2_RNA|RP11-23P13.6_ENST00000568861.1_RNA|RP11-23P13.7_ENST00000605942.1_lincRNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	114	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		TTCTCCAGGAAGTGCACACGC	0.692																																						dbGAP											0													29.0	35.0	33.0					15																	42185136		1934	4130	6064	-	-	-	SO:0001583	missense	0			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.340T>G	15.37:g.42185136A>C	ENSP00000317790:p.Phe114Val			Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.F114V	ENST00000320955.6	37	c.340		15	.	.	.	.	.	.	.	.	.	.	A	25.8	4.674004	0.88445	.	.	ENSG00000137877	ENST00000320955	D	0.94862	-3.54	5.15	5.15	0.70609	Calponin homology domain (5);	0.247438	0.33534	N	0.004802	D	0.95928	0.8674	L	0.55834	1.745	0.31038	N	0.716652	D	0.71674	0.998	D	0.71656	0.974	D	0.94571	0.7771	10	0.42905	T	0.14	.	14.673	0.68958	1.0:0.0:0.0:0.0	.	114	Q9NRC6	SPTN5_HUMAN	V	114	ENSP00000317790:F114V	ENSP00000317790:F114V	F	-	1	0	SPTBN5	39972428	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	8.102000	0.89548	1.952000	0.56665	0.533000	0.62120	TTC	SPTBN5	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000137877		0.692	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	SPTBN5	HGNC	protein_coding	OTTHUMT00000420237.1	12	0.00	0	A	NM_016642		42185136	42185136	-1	no_errors	ENST00000320955	ensembl	human	known	69_37n	missense	3	62.50	5	SNP	1.000	C
SRPK1	6732	genome.wustl.edu	37	6	35810362	35810362	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr6:35810362C>A	ENST00000373825.2	-	14	1925	c.1640G>T	c.(1639-1641)gGt>gTt	p.G547V	SRPK1_ENST00000423325.2_Missense_Mutation_p.G531V|SRPK1_ENST00000373822.1_Missense_Mutation_p.G439V					SRSF protein kinase 1											endometrium(2)|large_intestine(10)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21						CAAATAGTCACCTGTGGCCAG	0.418																																					NSCLC(31;67 978 16289 24856 26454)	dbGAP											0													73.0	67.0	69.0					6																	35810362		1889	4109	5998	-	-	-	SO:0001583	missense	0			U09564	CCDS47415.1	6p21.31	2010-06-23	2010-06-23		ENSG00000096063	ENSG00000096063			11305	protein-coding gene	gene with protein product	"""SR protein kinase 1"", ""serine/arginine-rich splicing factor kinase 1"""	601939	"""SFRS protein kinase 1"""			8208298, 10198174	Standard	NM_003137		Approved	SFRSK1	uc003olj.3	Q96SB4	OTTHUMG00000014583	ENST00000373825.2:c.1640G>T	6.37:g.35810362C>A	ENSP00000362931:p.Gly547Val			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.G547V	ENST00000373825.2	37	c.1640	CCDS47415.1	6	.	.	.	.	.	.	.	.	.	.	C	25.0	4.588292	0.86851	.	.	ENSG00000096063	ENST00000373825;ENST00000361690;ENST00000423325;ENST00000373822	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	5.18	5.18	0.71444	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.69922	0.3165	H	0.96175	3.78	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.87578	0.998;0.957	T	0.80763	-0.1237	9	0.87932	D	0	-5.0245	19.0463	0.93020	0.0:1.0:0.0:0.0	.	531;547	B4DS61;Q96SB4	.;SRPK1_HUMAN	V	547;563;531;439	ENSP00000362931:G547V;ENSP00000354674:G563V;ENSP00000391069:G531V;ENSP00000362928:G439V	ENSP00000354674:G563V	G	-	2	0	SRPK1	35918340	1.000000	0.71417	0.962000	0.40283	0.995000	0.86356	7.442000	0.80503	2.572000	0.86782	0.491000	0.48974	GGT	SRPK1	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000096063		0.418	SRPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPK1	HGNC	protein_coding	OTTHUMT00000040319.3	108	0.00	0	C	NM_003137		35810362	35810362	-1	no_errors	ENST00000373825	ensembl	human	known	69_37n	missense	75	41.41	53	SNP	1.000	A
TANC1	85461	genome.wustl.edu	37	2	160035597	160035597	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr2:160035597G>A	ENST00000263635.6	+	14	2670	c.2433G>A	c.(2431-2433)atG>atA	p.M811I	TANC1_ENST00000454300.1_Missense_Mutation_p.M705I	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	811					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						AAACCCGCATGTTCTGCCACC	0.582																																						dbGAP											0													79.0	83.0	82.0					2																	160035597		1973	4151	6124	-	-	-	SO:0001583	missense	0			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.2433G>A	2.37:g.160035597G>A	ENSP00000263635:p.Met811Ile		C9JD88|Q49AI8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.M811I	ENST00000263635.6	37	c.2433	CCDS42766.1	2	.	.	.	.	.	.	.	.	.	.	G	26.7	4.758745	0.89843	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	T;T	0.71698	-0.55;-0.59	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.83538	0.5276	M	0.72894	2.215	0.80722	D	1	D;D;P	0.58268	0.969;0.982;0.922	D;D;P	0.68943	0.914;0.961;0.739	T	0.81558	-0.0878	10	0.39692	T	0.17	.	19.8534	0.96748	0.0:0.0:1.0:0.0	.	803;705;811	B9EK39;Q9C0D5-2;Q9C0D5	.;.;TANC1_HUMAN	I	705;811	ENSP00000396339:M705I;ENSP00000263635:M811I	ENSP00000263635:M811I	M	+	3	0	TANC1	159743843	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.711000	0.92665	0.563000	0.77884	ATG	TANC1	-	NULL	ENSG00000115183		0.582	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANC1	HGNC	protein_coding	OTTHUMT00000333135.1	42	0.00	0	G			160035597	160035597	+1	no_errors	ENST00000263635	ensembl	human	known	69_37n	missense	42	19.23	10	SNP	1.000	A
TAS2R31	259290	genome.wustl.edu	37	12	11183563	11183563	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr12:11183563T>G	ENST00000390675.2	-	1	443	c.372A>C	c.(370-372)agA>agC	p.R124S	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	124					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						CACTCTTAACTCTCCTCTTTA	0.388																																						dbGAP											0													92.0	104.0	100.0					12																	11183563		2039	4254	6293	-	-	-	SO:0001583	missense	0			AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.372A>C	12.37:g.11183563T>G	ENSP00000375093:p.Arg124Ser		P59547|Q17R84|Q645X5	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.R124S	ENST00000390675.2	37	c.372	CCDS53747.1	12	.	.	.	.	.	.	.	.	.	.	.	15.24	2.775394	0.49786	.	.	ENSG00000256436	ENST00000390675	T	0.01203	5.18	2.45	-2.2	0.06994	.	.	.	.	.	T	0.06325	0.0163	H	0.96301	3.8	0.09310	N	1	D	0.60575	0.988	P	0.62560	0.904	T	0.20371	-1.0277	9	0.87932	D	0	.	0.2815	0.00245	0.2218:0.1551:0.2264:0.3967	.	124	P59538	T2R31_HUMAN	S	124	ENSP00000375093:R124S	ENSP00000375093:R124S	R	-	3	2	TAS2R31	11074830	0.000000	0.05858	0.001000	0.08648	0.319000	0.28217	-0.002000	0.12924	-0.637000	0.05516	0.163000	0.16589	AGA	TAS2R31	-	pfam_TAS2_rcpt	ENSG00000256436		0.388	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R31	HGNC	protein_coding	OTTHUMT00000400233.1	159	0.00	0	T	NM_176885		11183563	11183563	-1	no_errors	ENST00000390675	ensembl	human	known	69_37n	missense	85	61.78	139	SNP	0.008	G
TDRD1	56165	genome.wustl.edu	37	10	115964497	115964497	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr10:115964497T>C	ENST00000369280.1	+	10	1602	c.1142T>C	c.(1141-1143)gTa>gCa	p.V381A	TDRD1_ENST00000369281.2_Missense_Mutation_p.V381A|TDRD1_ENST00000251864.2_Missense_Mutation_p.V381A|TDRD1_ENST00000369282.1_Missense_Mutation_p.V381A|TDRD1_ENST00000422662.1_Missense_Mutation_p.V42A			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	381					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		AAGTGCTTTGTAGCCAATGTT	0.328																																						dbGAP											0													69.0	65.0	67.0					10																	115964497		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.1142T>C	10.37:g.115964497T>C	ENSP00000358286:p.Val381Ala		A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	pfam_Tudor,pfam_Znf_MYND,smart_Tudor,pfscan_Tudor,pfscan_Znf_MYND	p.V381A	ENST00000369280.1	37	c.1142		10	.	.	.	.	.	.	.	.	.	.	T	15.42	2.828301	0.50845	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000422662;ENST00000369280	T;T;T;T;T	0.16073	2.73;2.73;2.73;2.37;2.73	6.17	5.04	0.67666	Maternal tudor protein (1);	0.350628	0.30311	N	0.009903	T	0.22898	0.0553	M	0.76002	2.32	0.25759	N	0.984967	P;P;P;P;B	0.51147	0.566;0.698;0.942;0.649;0.305	B;B;B;B;B	0.42625	0.393;0.349;0.371;0.237;0.204	T	0.25779	-1.0122	10	0.72032	D	0.01	-7.559	10.2749	0.43504	0.0:0.0753:0.0:0.9247	.	42;381;381;381;381	Q9BXT4-4;Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	.;TDRD1_HUMAN;.;.;.	A	381;381;381;42;381	ENSP00000358288:V381A;ENSP00000251864:V381A;ENSP00000358287:V381A;ENSP00000402794:V42A;ENSP00000358286:V381A	ENSP00000251864:V381A	V	+	2	0	TDRD1	115954487	1.000000	0.71417	0.572000	0.28498	0.950000	0.60333	4.822000	0.62686	1.147000	0.42369	-0.290000	0.09829	GTA	TDRD1	-	pfam_Tudor	ENSG00000095627		0.328	TDRD1-001	KNOWN	basic	protein_coding	TDRD1	HGNC	protein_coding	OTTHUMT00000050457.2	123	0.00	0	T			115964497	115964497	+1	no_errors	ENST00000251864	ensembl	human	known	69_37n	missense	93	27.91	36	SNP	0.868	C
TEX10	54881	genome.wustl.edu	37	9	103065953	103065953	+	Silent	SNP	G	G	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr9:103065953G>A	ENST00000374902.4	-	14	2813	c.2637C>T	c.(2635-2637)acC>acT	p.T879T	TEX10_ENST00000535814.1_Silent_p.T863T|TEX10_ENST00000477648.1_5'UTR	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	879						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		AGATCGCATTGGTCAACATAT	0.522																																						dbGAP											0													198.0	191.0	193.0					9																	103065953		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.2637C>T	9.37:g.103065953G>A			B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Silent	SNP	pfam_IPI1-like_dom,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.T879	ENST00000374902.4	37	c.2637	CCDS6748.1	9																																																																																			TEX10	-	NULL	ENSG00000136891		0.522	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX10	HGNC	protein_coding	OTTHUMT00000053416.1	84	0.00	0	G	NM_017746		103065953	103065953	-1	no_errors	ENST00000374902	ensembl	human	known	69_37n	silent	20	55.56	25	SNP	0.999	A
TEX15	56154	genome.wustl.edu	37	8	30702239	30702239	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr8:30702239C>G	ENST00000256246.2	-	1	4369	c.4295G>C	c.(4294-4296)aGt>aCt	p.S1432T		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1432					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		AGAACTATCACTGGAAGATAA	0.348																																						dbGAP											0													80.0	77.0	78.0					8																	30702239		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.4295G>C	8.37:g.30702239C>G	ENSP00000256246:p.Ser1432Thr			Missense_Mutation	SNP	NULL	p.S1432T	ENST00000256246.2	37	c.4295	CCDS6080.1	8	.	.	.	.	.	.	.	.	.	.	C	10.73	1.432500	0.25813	.	.	ENSG00000133863	ENST00000256246	T	0.12361	2.69	5.8	-8.55	0.00908	.	1.126930	0.06488	N	0.734053	T	0.09905	0.0243	L	0.34521	1.04	0.09310	N	1	B	0.27732	0.187	B	0.27500	0.08	T	0.36065	-0.9763	10	0.87932	D	0	.	10.7622	0.46272	0.1115:0.5727:0.0:0.3158	.	1432	Q9BXT5	TEX15_HUMAN	T	1432	ENSP00000256246:S1432T	ENSP00000256246:S1432T	S	-	2	0	TEX15	30821781	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.907000	0.04067	-2.083000	0.00867	-1.284000	0.01376	AGT	TEX15	-	NULL	ENSG00000133863		0.348	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	HGNC	protein_coding	OTTHUMT00000376193.1	111	0.00	0	C			30702239	30702239	-1	no_errors	ENST00000256246	ensembl	human	known	69_37n	missense	75	35.90	42	SNP	0.000	G
TNRC6B	23112	genome.wustl.edu	37	22	40711386	40711386	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr22:40711386G>T	ENST00000454349.2	+	20	4989	c.4778G>T	c.(4777-4779)aGg>aTg	p.R1593M	TNRC6B_ENST00000301923.9_Missense_Mutation_p.R789M|TNRC6B_ENST00000335727.9_Missense_Mutation_p.R1483M|TNRC6B_ENST00000402203.1_Missense_Mutation_p.R789M	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	1593	Silencing domain; interaction with CNOT1 and PAN3.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						ATTTCCTCCAGGAACACTACA	0.552																																						dbGAP											0													85.0	86.0	86.0					22																	40711386		2001	4159	6160	-	-	-	SO:0001583	missense	0			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.4778G>T	22.37:g.40711386G>T	ENSP00000401946:p.Arg1593Met		B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Nonsense_Mutation	SNP	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.G1279*	ENST00000454349.2	37	c.3835	CCDS54533.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.1|28.1	4.890764|4.890764	0.91889|0.91889	.|.	.|.	ENSG00000100354|ENSG00000100354	ENST00000446273|ENST00000301923;ENST00000402203;ENST00000454349;ENST00000400140;ENST00000335727	.|T;T;T;T	.|0.48201	.|0.82;0.82;0.82;0.82	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	.|0.111100	.|0.85682	.|D	.|0.000000	.|T	.|0.70745	.|0.3259	M|M	0.71581|0.71581	2.175|2.175	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D;D;D	.|0.71674	.|0.997;0.989;0.994;0.998	.|D;P;D;D	.|0.79108	.|0.987;0.891;0.949;0.992	.|T	.|0.69680	.|-0.5080	.|10	.|0.66056	.|D	.|0.02	-14.3031|-14.3031	20.8598|20.8598	0.99761|0.99761	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1593;1483;1483;789	.|Q9UPQ9;A8MYY3;Q9UPQ9-1;Q9UPQ9-2	.|TNR6B_HUMAN;.;.;.	X|M	1279|789;789;1593;1483;1483	.|ENSP00000306759:R789M;ENSP00000384795:R789M;ENSP00000401946:R1593M;ENSP00000338371:R1483M	.|ENSP00000306759:R789M	G|R	+|+	1|2	0|0	TNRC6B|TNRC6B	39041332|39041332	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.671000|7.671000	0.83941|0.83941	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GGA|AGG	TNRC6B	-	NULL	ENSG00000100354		0.552	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	TNRC6B	HGNC	protein_coding		101	0.00	0	G			40711386	40711386	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000446273	ensembl	human	putative	69_37n	nonsense	152	40.16	102	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7579364	7579364	+	Frame_Shift_Del	DEL	C	C	-	rs587783063		TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr17:7579364delC	ENST00000269305.4	-	4	512	c.323delG	c.(322-324)ggtfs	p.G108fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.G108fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.G108fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.G108fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Del_p.G108fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.G108fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	108	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		G -> D (in a sporadic cancer; somatic mutation).|G -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.Q100fs*37(3)|p.G59fs*23(3)|p.G108_F109delGF(2)|p.G108del(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.?_?ins?(1)|p.Y107fs*44(1)|p.W91fs*13(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.G108D(1)|p.Y107fs*38(1)|p.Y103_L111>L(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGACGGAAACCGTAGCTGCC	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	29	Deletion - Frameshift(12)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(2)|Insertion - In frame(1)|Substitution - Missense(1)	upper_aerodigestive_tract(5)|breast(5)|bone(4)|large_intestine(3)|ovary(3)|central_nervous_system(2)|lung(2)|liver(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)											61.0	59.0	60.0					17																	7579364		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.323delG	17.37:g.7579364delC	ENSP00000269305:p.Gly108fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.G108fs	ENST00000269305.4	37	c.323	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	169	0.00	0	C	NM_000546		7579364	7579364	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	19	55.81	24	DEL	0.910	-
TTBK2	146057	genome.wustl.edu	37	15	43045173	43045173	+	Silent	SNP	T	T	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr15:43045173T>C	ENST00000267890.6	-	14	2379	c.2271A>G	c.(2269-2271)aaA>aaG	p.K757K		NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	757					cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		CAGGAAGTTCTTTTGGTCCCA	0.398																																						dbGAP											0													209.0	197.0	201.0					15																	43045173		1847	4089	5936	-	-	-	SO:0001819	synonymous_variant	0			AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.2271A>G	15.37:g.43045173T>C			O94932|Q6ZN52|Q8IVV1	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K757	ENST00000267890.6	37	c.2271	CCDS42029.1	15																																																																																			TTBK2	-	NULL	ENSG00000128881		0.398	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTBK2	HGNC	protein_coding	OTTHUMT00000431106.2	206	0.00	0	T	NM_173500		43045173	43045173	-1	no_errors	ENST00000267890	ensembl	human	known	69_37n	silent	203	29.02	83	SNP	1.000	C
UBE2J2	118424	genome.wustl.edu	37	1	1190626	1190626	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr1:1190626G>A	ENST00000349431.6	-	7	956	c.737C>T	c.(736-738)gCt>gTt	p.A246V	UBE2J2_ENST00000400930.4_Missense_Mutation_p.A262V|UBE2J2_ENST00000339385.6_Missense_Mutation_p.A211V|UBE2J2_ENST00000491779.1_5'Flank|UBE2J2_ENST00000400929.2_Missense_Mutation_p.A194V|UBE2J2_ENST00000360466.2_Missense_Mutation_p.A246V|UBE2J2_ENST00000348298.7_Missense_Mutation_p.A194V|UBE2J2_ENST00000347370.2_Missense_Mutation_p.A194V	NM_058167.2	NP_477515.2	Q8N2K1	UB2J2_HUMAN	ubiquitin-conjugating enzyme E2, J2	246					protein ubiquitination (GO:0016567)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			cervix(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)		GACCGTGTAAGCAAAGGCTGC	0.647																																						dbGAP											0													56.0	56.0	56.0					1																	1190626		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF296658	CCDS14.1, CCDS15.1, CCDS16.1	1p36.33	2011-05-19	2011-05-19		ENSG00000160087	ENSG00000160087		"""Ubiquitin-conjugating enzymes E2"""	19268	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast)"""			11278356	Standard	NM_058167		Approved	Ubc6p, NCUBE2	uc001ado.3	Q8N2K1	OTTHUMG00000001911	ENST00000349431.6:c.737C>T	1.37:g.1190626G>A	ENSP00000305826:p.Ala246Val		A8MYC7|Q504T9|Q96N26|Q96T84	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.A262V	ENST00000349431.6	37	c.785	CCDS14.1	1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.156561	0.78114	.	.	ENSG00000160087	ENST00000347370;ENST00000349431;ENST00000339385;ENST00000348298;ENST00000400929;ENST00000360466;ENST00000400930	T;T;T;T;T;T;D	0.82803	0.07;-0.98;0.06;0.07;0.07;-0.98;-1.65	5.85	4.95	0.65309	.	0.000000	0.85682	D	0.000000	D	0.88916	0.6567	L	0.58810	1.83	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.976;0.998;0.997;0.989	D	0.89235	0.3580	10	0.54805	T	0.06	-27.1479	14.0392	0.64665	0.0723:0.0:0.9277:0.0	.	194;262;246;279	A6NGS0;A8MYC7;Q8N2K1;B1AME9	.;.;UB2J2_HUMAN;.	V	194;246;211;194;194;246;262	ENSP00000344857:A194V;ENSP00000305826:A246V;ENSP00000340197:A211V;ENSP00000342541:A194V;ENSP00000383718:A194V;ENSP00000353653:A246V;ENSP00000383719:A262V	ENSP00000340197:A211V	A	-	2	0	UBE2J2	1180489	1.000000	0.71417	0.996000	0.52242	0.320000	0.28249	9.317000	0.96327	1.490000	0.48466	-0.136000	0.14681	GCT	UBE2J2	-	NULL	ENSG00000160087		0.647	UBE2J2-001	KNOWN	basic|CCDS	protein_coding	UBE2J2	HGNC	protein_coding	OTTHUMT00000005430.1	22	0.00	0	G	NM_058167		1190626	1190626	-1	no_errors	ENST00000400930	ensembl	human	known	69_37n	missense	35	36.36	20	SNP	1.000	A
UFL1	23376	genome.wustl.edu	37	6	96997376	96997376	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr6:96997376A>G	ENST00000369278.4	+	14	1675	c.1609A>G	c.(1609-1611)Atc>Gtc	p.I537V		NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1	537					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										AAAACGCACAATCAAGGACTT	0.368																																						dbGAP											0													71.0	68.0	69.0					6																	96997376		2203	4298	6501	-	-	-	SO:0001583	missense	0			BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238	ENST00000369278.4:c.1609A>G	6.37:g.96997376A>G	ENSP00000358283:p.Ile537Val		A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	Missense_Mutation	SNP	pfam_E3_UFM1_ligase_1	p.I537V	ENST00000369278.4	37	c.1609	CCDS5034.1	6	.	.	.	.	.	.	.	.	.	.	A	12.74	2.029642	0.35797	.	.	ENSG00000014123	ENST00000369278	T	0.42513	0.97	5.73	3.26	0.37387	.	0.127122	0.64402	D	0.000002	T	0.12008	0.0292	L	0.44542	1.39	0.29418	N	0.860723	B	0.22480	0.07	B	0.19148	0.024	T	0.28776	-1.0033	10	0.13108	T	0.6	-5.7564	7.9675	0.30109	0.7919:0.1369:0.0712:0.0	.	537	O94874	UFL1_HUMAN	V	537	ENSP00000358283:I537V	ENSP00000358283:I537V	I	+	1	0	KIAA0776	97104097	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	2.974000	0.49272	0.404000	0.25506	0.528000	0.53228	ATC	UFL1	-	NULL	ENSG00000014123		0.368	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFL1	HGNC	protein_coding	OTTHUMT00000041557.1	190	0.00	0	A	NM_015323		96997376	96997376	+1	no_errors	ENST00000369278	ensembl	human	known	69_37n	missense	77	49.67	76	SNP	1.000	G
UNC5C	8633	genome.wustl.edu	37	4	96166163	96166163	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr4:96166163C>G	ENST00000453304.1	-	6	1256	c.908G>C	c.(907-909)aGt>aCt	p.S303T	UNC5C_ENST00000506749.1_Missense_Mutation_p.S303T	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	303	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		TTTCTGCACACTCTGCCCTTC	0.463																																						dbGAP											0													179.0	177.0	178.0					4																	96166163		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.908G>C	4.37:g.96166163C>G	ENSP00000406022:p.Ser303Thr		Q8IUT0	Missense_Mutation	SNP	pfam_ZU5,pfam_Death,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like	p.S303T	ENST00000453304.1	37	c.908	CCDS3643.1	4	.	.	.	.	.	.	.	.	.	.	C	13.54	2.267453	0.40095	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749	T;T;T	0.52295	0.67;0.67;0.67	5.2	5.2	0.72013	.	0.163773	0.64402	D	0.000016	T	0.36826	0.0981	L	0.28344	0.845	0.80722	D	1	B;B;B	0.20164	0.004;0.042;0.005	B;B;B	0.25506	0.026;0.061;0.025	T	0.22836	-1.0205	10	0.66056	D	0.02	.	11.8708	0.52519	0.0:0.8771:0.0:0.1229	.	303;303;303	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	T	303;262;303;303	ENSP00000406022:S303T;ENSP00000426924:S303T;ENSP00000426153:S303T	ENSP00000328673:S262T	S	-	2	0	UNC5C	96385186	0.984000	0.35163	1.000000	0.80357	0.998000	0.95712	0.942000	0.29017	2.717000	0.92951	0.655000	0.94253	AGT	UNC5C	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000182168		0.463	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5C	HGNC	protein_coding	OTTHUMT00000253607.1	133	0.00	0	C	NM_003728		96166163	96166163	-1	no_errors	ENST00000453304	ensembl	human	known	69_37n	missense	66	60.24	100	SNP	0.998	G
USP37	57695	genome.wustl.edu	37	2	219411017	219411017	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr2:219411017C>G	ENST00000258399.3	-	8	1019	c.607G>C	c.(607-609)Gaa>Caa	p.E203Q	USP37_ENST00000415516.1_Missense_Mutation_p.E131Q|USP37_ENST00000454775.1_Missense_Mutation_p.E203Q|USP37_ENST00000418019.1_Missense_Mutation_p.E203Q|USP37_ENST00000338465.5_Missense_Mutation_p.E203Q	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	203					G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)			NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		TTCCTCTTTTCAGTACTACAG	0.328																																						dbGAP											0													102.0	97.0	99.0					2																	219411017		2200	4300	6500	-	-	-	SO:0001583	missense	0			AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.607G>C	2.37:g.219411017C>G	ENSP00000258399:p.Glu203Gln		A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Ubiquitin-int_motif,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_Peptidase_C19	p.E203Q	ENST00000258399.3	37	c.607	CCDS2418.1	2	.	.	.	.	.	.	.	.	.	.	C	12.32	1.901499	0.33535	.	.	ENSG00000135913	ENST00000258399;ENST00000454775;ENST00000415516;ENST00000418019;ENST00000338465	T;T;T;T;T	0.52295	0.79;0.79;0.8;0.79;0.67	4.56	3.65	0.41850	.	0.000000	0.85682	D	0.000000	T	0.56558	0.1993	L	0.54323	1.7	0.43756	D	0.996267	D;D;P	0.76494	0.999;0.996;0.935	D;P;P	0.65443	0.935;0.856;0.494	T	0.50127	-0.8864	10	0.25106	T	0.35	-18.4104	10.3475	0.43913	0.0:0.9023:0.0:0.0977	.	203;131;203	Q86W68;Q86T82-2;Q86T82	.;.;UBP37_HUMAN	Q	203;203;131;203;203	ENSP00000258399:E203Q;ENSP00000393662:E203Q;ENSP00000400902:E131Q;ENSP00000396585:E203Q;ENSP00000345043:E203Q	ENSP00000258399:E203Q	E	-	1	0	USP37	219119261	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	3.265000	0.51561	2.344000	0.79699	0.563000	0.77884	GAA	USP37	-	NULL	ENSG00000135913		0.328	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP37	HGNC	protein_coding	OTTHUMT00000256779.3	174	0.00	0	C	NM_020935		219411017	219411017	-1	no_errors	ENST00000258399	ensembl	human	known	69_37n	missense	221	11.24	28	SNP	1.000	G
VAC14	55697	genome.wustl.edu	37	16	70796918	70796918	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr16:70796918C>T	ENST00000261776.5	-	11	1431	c.1171G>A	c.(1171-1173)Gcc>Acc	p.A391T	VAC14-AS1_ENST00000398177.1_RNA|VAC14-AS1_ENST00000562507.1_RNA	NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	391					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				GTCACTGGGGCTCTTTCAGTG	0.587																																						dbGAP											0													97.0	77.0	84.0					16																	70796918		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.1171G>A	16.37:g.70796918C>T	ENSP00000261776:p.Ala391Thr		B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Missense_Mutation	SNP	pfam_DUF3434,pfam_HEAT,superfamily_ARM-type_fold	p.A391T	ENST00000261776.5	37	c.1171	CCDS10896.1	16	.	.	.	.	.	.	.	.	.	.	C	9.226	1.034623	0.19590	.	.	ENSG00000103043	ENST00000261776	.	.	.	5.68	1.37	0.22104	Armadillo-type fold (1);	0.602886	0.19627	N	0.109772	T	0.25531	0.0621	N	0.13098	0.295	0.54753	D	0.999987	B	0.14012	0.009	B	0.08055	0.003	T	0.04664	-1.0935	9	0.13108	T	0.6	-12.6575	3.1096	0.06353	0.109:0.4732:0.1991:0.2187	.	391	Q08AM6	VAC14_HUMAN	T	391	.	ENSP00000261776:A391T	A	-	1	0	VAC14	69354419	0.999000	0.42202	0.997000	0.53966	0.983000	0.72400	0.875000	0.28079	0.765000	0.33221	0.563000	0.77884	GCC	VAC14	-	superfamily_ARM-type_fold	ENSG00000103043		0.587	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAC14	HGNC	protein_coding	OTTHUMT00000268973.3	98	0.00	0	C	NM_018052		70796918	70796918	-1	no_errors	ENST00000261776	ensembl	human	known	69_37n	missense	79	36.00	45	SNP	0.853	T
WTAP	9589	genome.wustl.edu	37	6	160164703	160164703	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr6:160164703A>C	ENST00000358372.4	+	5	1909	c.152A>C	c.(151-153)gAt>gCt	p.D51A	SOD2_ENST00000546087.1_Intron|WTAP_ENST00000337387.4_Missense_Mutation_p.D51A	NM_001270531.1|NM_004906.4	NP_001257460.1|NP_004897.2	Q15007	FL2D_HUMAN	Wilms tumor 1 associated protein	51					cell cycle (GO:0007049)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	MIS complex (GO:0036396)|nuclear membrane (GO:0031965)|nuclear speck (GO:0016607)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	18		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		TCAGCTAATGATGTAACTGGC	0.343																																						dbGAP											0													48.0	49.0	49.0					6																	160164703		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ276706	CCDS5266.1, CCDS5267.1, CCDS75542.1	6q25-q27	2008-02-05			ENSG00000146457	ENSG00000146457			16846	protein-coding gene	gene with protein product		605442				7788527, 11001926	Standard	NM_004906		Approved	KIAA0105, MGC3925	uc003qsl.4	Q15007	OTTHUMG00000015933	ENST00000358372.4:c.152A>C	6.37:g.160164703A>C	ENSP00000351141:p.Asp51Ala		Q5TCL8|Q5TCL9|Q96T28|Q9BYJ7|Q9H4E2	Missense_Mutation	SNP	NULL	p.D51A	ENST00000358372.4	37	c.152	CCDS5266.1	6	.	.	.	.	.	.	.	.	.	.	A	28.5	4.923042	0.92319	.	.	ENSG00000146457	ENST00000358372;ENST00000337387	T;T	0.53857	0.6;0.6	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.50205	0.1602	L	0.45581	1.43	0.80722	D	1	D;P	0.58268	0.982;0.597	P;B	0.55615	0.78;0.199	T	0.44559	-0.9320	10	0.31617	T	0.26	0.2941	16.371	0.83361	1.0:0.0:0.0:0.0	.	51;51	Q15007;Q5TCL9	FL2D_HUMAN;.	A	51	ENSP00000351141:D51A;ENSP00000336911:D51A	ENSP00000336911:D51A	D	+	2	0	WTAP	160084693	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.324000	0.96373	2.267000	0.75376	0.477000	0.44152	GAT	WTAP	-	NULL	ENSG00000146457		0.343	WTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WTAP	HGNC	protein_coding	OTTHUMT00000042905.1	78	0.00	0	A	NM_152857		160164703	160164703	+1	no_errors	ENST00000358372	ensembl	human	known	69_37n	missense	135	19.16	32	SNP	1.000	C
ZNF595	152687	genome.wustl.edu	37	4	86522	86522	+	3'UTR	SNP	C	C	G			TCGA-A2-A04P-01A-31D-A128-09	TCGA-A2-A04P-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a85cf239-ff51-46e7-9b88-4c2cb49c66b9	aaef2ada-b81d-4e89-8add-a571603d67bb	g.chr4:86522C>G	ENST00000339368.6	+	0	1331							Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		GTGGCAAAGCCTTTACTTGGT	0.363																																						dbGAP											0													65.0	72.0	70.0					4																	86522		2112	4240	6352	-	-	-	SO:0001624	3_prime_UTR_variant	0			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000339368.6:c.*1328C>G	4.37:g.86522C>G				RNA	SNP	-	NULL	ENST00000339368.6	37	NULL		4																																																																																			ZNF595	-	-	ENSG00000197701		0.363	ZNF595-001	KNOWN	basic	processed_transcript	ZNF595	HGNC	protein_coding	OTTHUMT00000357814.2	102	0.00	0	C	NM_182524		86522	86522	+1	no_errors	ENST00000339368	ensembl	human	known	69_37n	rna	98	24.62	32	SNP	0.886	G
