#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AGAP7P	653268	genome.wustl.edu	37	10	51465579	51465579	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr10:51465579A>G	ENST00000374095.5	-	7	1002	c.877T>C	c.(877-879)Tat>Cat	p.Y293H		NM_001077685.1	NP_001071153.1	Q5VUJ5	AGAP7_HUMAN		293	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	11						AAGCTTGAATAATAGGTGAGC	0.423																																						dbGAP											0													40.0	42.0	42.0					10																	51465579		2175	4262	6437	-	-	-	SO:0001583	missense	0																														ENST00000374095.5:c.877T>C	10.37:g.51465579A>G	ENSP00000363208:p.Tyr293His		A6NGH4	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.Y293H	ENST00000374095.5	37	c.877	CCDS41524.1	10	.	.	.	.	.	.	.	.	.	.	.	0.015	-1.555540	0.00918	.	.	ENSG00000204169	ENST00000374095	T	0.79141	-1.24	.	.	.	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.168916	0.51477	N	0.000098	T	0.39253	0.1071	N	0.01417	-0.88	0.23016	N	0.998421	B	0.11235	0.004	B	0.18871	0.023	T	0.43877	-0.9364	9	0.02654	T	1	.	4.6093	0.12395	0.9995:0.0:5.0E-4:0.0	.	293	Q5VUJ5	AGAP7_HUMAN	H	293	ENSP00000363208:Y293H	ENSP00000363208:Y293H	Y	-	1	0	AGAP7	51135585	1.000000	0.71417	0.180000	0.23079	0.179000	0.23085	2.809000	0.47971	0.149000	0.19098	0.147000	0.16070	TAT	AGAP7	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000204169		0.423	AGAP7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	AGAP7	HGNC	protein_coding	OTTHUMT00000048033.1	84	0.00	0	A			51465579	51465579	-1	no_errors	ENST00000374095	ensembl	human	known	69_37n	missense	50	39.76	33	SNP	1.000	G
AKT3	10000	genome.wustl.edu	37	1	243727150	243727150	+	Splice_Site	SNP	A	A	G			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr1:243727150A>G	ENST00000366539.1	-	10	1020	c.820T>C	c.(820-822)Ttg>Ctg	p.L274L	AKT3_ENST00000366540.1_Splice_Site_p.L274L|AKT3_ENST00000336199.5_Splice_Site_p.L274L|AKT3_ENST00000263826.5_Splice_Site_p.L274L			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	274	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			AGATTCTCCAACTGTGTATTA	0.338																																						dbGAP											0													109.0	103.0	105.0					1																	243727150		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.820-1T>C	1.37:g.243727150A>G			Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom	p.L274	ENST00000366539.1	37	c.820	CCDS31077.1	1																																																																																			AKT3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000117020		0.338	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKT3	HGNC	protein_coding	OTTHUMT00000096479.1	252	0.00	0	A	NM_181690	Silent	243727150	243727150	-1	no_errors	ENST00000263826	ensembl	human	known	69_37n	silent	231	19.23	55	SNP	1.000	G
ARHGAP31	57514	genome.wustl.edu	37	3	119133553	119133553	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr3:119133553C>T	ENST00000264245.4	+	12	3309	c.2777C>T	c.(2776-2778)gCg>gTg	p.A926V		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	926					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						CTGAAAGACGCGCACAAGGCC	0.602																																					Pancreas(7;176 297 5394 51128 51241)	dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2777C>T	3.37:g.119133553C>T	ENSP00000264245:p.Ala926Val		Q9ULL6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.A926V	ENST00000264245.4	37	c.2777	CCDS43135.1	3	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.100054	0.00360	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.04654	3.58	4.87	0.668	0.17912	.	0.935480	0.08872	N	0.881446	T	0.01592	0.0051	N	0.01576	-0.805	0.20926	N	0.999825	B	0.02656	0.0	B	0.01281	0.0	T	0.45338	-0.9268	10	0.02654	T	1	.	7.028	0.24950	0.0:0.0774:0.3035:0.6191	.	926	Q2M1Z3	RHG31_HUMAN	V	926	ENSP00000264245:A926V	ENSP00000264245:A926V	A	+	2	0	ARHGAP31	120616243	0.002000	0.14202	0.051000	0.19133	0.112000	0.19704	0.404000	0.20999	0.010000	0.14839	-1.157000	0.01802	GCG	ARHGAP31	-	NULL	ENSG00000031081		0.602	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	HGNC	protein_coding	OTTHUMT00000354942.2	58	0.00	0	C			119133553	119133553	+1	no_errors	ENST00000264245	ensembl	human	known	69_37n	missense	57	27.85	22	SNP	0.890	T
ATHL1	80162	genome.wustl.edu	37	11	289917	289917	+	Missense_Mutation	SNP	G	G	A	rs556436029	byFrequency	TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr11:289917G>A	ENST00000409548.2	+	2	216	c.101G>A	c.(100-102)cGa>cAa	p.R34Q	ATHL1_ENST00000409655.1_5'UTR|RP11-326C3.2_ENST00000533924.1_RNA|ATHL1_ENST00000409479.1_Missense_Mutation_p.R34Q|RP11-326C3.2_ENST00000525217.1_RNA|RP11-326C3.2_ENST00000534742.1_RNA	NM_025092.4	NP_079368.3	Q32M88	ATHL1_HUMAN	ATH1, acid trehalase-like 1 (yeast)	34					carbohydrate metabolic process (GO:0005975)		hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|skin(3)	17		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.38e-28)|Epithelial(43;3.25e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		CTGGGCACACGAGTGTTTCAC	0.667																																						dbGAP											0													69.0	72.0	71.0					11																	289917		692	1591	2283	-	-	-	SO:0001583	missense	0			AK090428	CCDS31322.2	11p15.5	2005-10-27			ENSG00000142102	ENSG00000142102			26210	protein-coding gene	gene with protein product							Standard	NM_025092		Approved	FLJ22635	uc010qvu.2	Q32M88	OTTHUMG00000153218	ENST00000409548.2:c.101G>A	11.37:g.289917G>A	ENSP00000387185:p.Arg34Gln		Q658X8|Q8TEG9|Q9H635	Missense_Mutation	SNP	pfam_Glyco_hydro_65_M,superfamily_6-hairpin_glycosidase-like	p.R34Q	ENST00000409548.2	37	c.101	CCDS31322.2	11	.	.	.	.	.	.	.	.	.	.	G	18.96	3.733877	0.69189	.	.	ENSG00000142102	ENST00000409548;ENST00000409479	.	.	.	4.66	3.51	0.40186	.	.	.	.	.	T	0.58424	0.2121	L	0.56769	1.78	0.27887	N	0.939462	D;D	0.76494	0.999;0.998	P;P	0.56751	0.805;0.771	T	0.53041	-0.8494	8	0.72032	D	0.01	.	12.7401	0.57246	0.097:0.0:0.903:0.0	.	34;34	Q32M88;E7EMA9	ATHL1_HUMAN;.	Q	34	.	ENSP00000387099:R34Q	R	+	2	0	ATHL1	279917	0.983000	0.35010	0.824000	0.32777	0.550000	0.35303	3.618000	0.54188	2.145000	0.66743	0.491000	0.48974	CGA	ATHL1	-	NULL	ENSG00000142102		0.667	ATHL1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATHL1	HGNC	protein_coding	OTTHUMT00000330164.3	158	0.00	0	G	NM_025092		289917	289917	+1	no_errors	ENST00000409548	ensembl	human	known	69_37n	missense	36	30.77	16	SNP	0.926	A
BCAT2	587	genome.wustl.edu	37	19	49303011	49303011	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr19:49303011C>T	ENST00000316273.6	-	6	628	c.616G>A	c.(616-618)Gtg>Atg	p.V206M	BCAT2_ENST00000598162.1_Missense_Mutation_p.V206M|BCAT2_ENST00000402551.1_Missense_Mutation_p.V166M|BCAT2_ENST00000545387.2_Missense_Mutation_p.V114M|BCAT2_ENST00000597011.1_Missense_Mutation_p.V166M|BCAT2_ENST00000599246.1_Missense_Mutation_p.V114M	NM_001190.3	NP_001181.2	O15382	BCAT2_HUMAN	branched chain amino-acid transaminase 2, mitochondrial	206					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|isoleucine catabolic process (GO:0006550)|leucine metabolic process (GO:0006551)|regulation of hormone levels (GO:0010817)|small molecule metabolic process (GO:0044281)|valine metabolic process (GO:0006573)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	12		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.000366)|Epithelial(262;0.0195)|GBM - Glioblastoma multiforme(486;0.0224)	L-Isoleucine(DB00167)|L-Leucine(DB00149)	ACCGGGGTCACGGAGCCTCCA	0.677																																						dbGAP											0													26.0	25.0	25.0					19																	49303011		2194	4278	6472	-	-	-	SO:0001583	missense	0			U68418	CCDS12735.1, CCDS54290.1, CCDS74416.1	19q13.33	2013-09-20	2010-05-07		ENSG00000105552	ENSG00000105552	2.6.1.42		977	protein-coding gene	gene with protein product		113530	"""branched chain aminotransferase 2, mitochondrial"""	BCT2		9165094	Standard	NM_001190		Approved	BCAM	uc002pkr.3	O15382	OTTHUMG00000183327	ENST00000316273.6:c.616G>A	19.37:g.49303011C>T	ENSP00000322991:p.Val206Met		B2RB87|O00269|Q96KG1|Q9BTB6|Q9BUU6	Missense_Mutation	SNP	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	p.V206M	ENST00000316273.6	37	c.616	CCDS12735.1	19	.	.	.	.	.	.	.	.	.	.	C	8.330	0.826301	0.16749	.	.	ENSG00000105552	ENST00000316273;ENST00000545387;ENST00000402551	T;T;T	0.22336	1.96;1.96;1.96	4.24	-8.47	0.00939	.	0.556527	0.18313	N	0.145046	T	0.06325	0.0163	N	0.04669	-0.19	0.09310	N	0.999997	B;B;B;B	0.09022	0.001;0.001;0.002;0.001	B;B;B;B	0.06405	0.001;0.002;0.002;0.002	T	0.11916	-1.0568	10	0.51188	T	0.08	-10.1807	6.4969	0.22148	0.5338:0.1302:0.0:0.336	.	166;206;114;206	B3KSI3;Q53EW7;O15382-2;O15382	.;.;.;BCAT2_HUMAN	M	206;114;166	ENSP00000322991:V206M;ENSP00000440973:V114M;ENSP00000385161:V166M	ENSP00000322991:V206M	V	-	1	0	BCAT2	53994823	0.792000	0.28813	0.000000	0.03702	0.261000	0.26267	0.060000	0.14342	-2.166000	0.00780	-0.254000	0.11334	GTG	BCAT2	-	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	ENSG00000105552		0.677	BCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAT2	HGNC	protein_coding	OTTHUMT00000466202.1	41	0.00	0	C			49303011	49303011	-1	no_errors	ENST00000316273	ensembl	human	known	69_37n	missense	13	51.85	14	SNP	0.016	T
RP11-464F9.1	0	genome.wustl.edu	37	10	75480346	75480346	+	RNA	SNP	C	C	A			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr10:75480346C>A	ENST00000399449.3	-	0	910				RP11-574K11.28_ENST00000580790.1_RNA|BMS1P4_ENST00000584747.1_RNA																							TCTTAAATAACCGTAAAGTAA	0.378																																						dbGAP											0																																										-	-	-			0																															10.37:g.75480346C>A				RNA	SNP	-	NULL	ENST00000399449.3	37	NULL		10																																																																																			RP11-464F9.1	-	-	ENSG00000242288		0.378	RP11-464F9.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	BMS1P4	Clone_based_vega_gene	processed_transcript	OTTHUMT00000048674.2	64	0.00	0	C			75480346	75480346	-1	no_errors	ENST00000399449	ensembl	human	known	69_37n	rna	43	35.82	24	SNP	1.000	A
BRWD1	54014	genome.wustl.edu	37	21	40570751	40570751	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr21:40570751C>T	ENST00000333229.2	-	40	5918	c.5591G>A	c.(5590-5592)gGa>gAa	p.G1864E	BRWD1_ENST00000342449.3_Missense_Mutation_p.G1864E|BRWD1_ENST00000380800.3_Missense_Mutation_p.G1864E	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1864					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				AGTTTCACATCCATGATCTGA	0.338																																					Melanoma(170;988 1986 4794 16843 39731)	dbGAP											0													107.0	100.0	103.0					21																	40570751		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.5591G>A	21.37:g.40570751C>T	ENSP00000330753:p.Gly1864Glu		C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G1864E	ENST00000333229.2	37	c.5591	CCDS13662.1	21	.	.	.	.	.	.	.	.	.	.	C	3.552	-0.091466	0.07053	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.39056	1.1;1.1;1.1	5.48	-0.668	0.11392	.	0.696627	0.13110	N	0.413025	T	0.16300	0.0392	N	0.12746	0.255	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21999	-1.0229	10	0.09590	T	0.72	-0.8888	1.9009	0.03267	0.511:0.2229:0.0875:0.1787	.	1864;1864	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	E	1864	ENSP00000330753:G1864E;ENSP00000344333:G1864E;ENSP00000370178:G1864E	ENSP00000330753:G1864E	G	-	2	0	BRWD1	39492621	0.001000	0.12720	0.058000	0.19502	0.033000	0.12548	-0.005000	0.12855	0.050000	0.15949	-0.266000	0.10368	GGA	BRWD1	-	NULL	ENSG00000185658		0.338	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3	151	0.00	0	C	NM_033656		40570751	40570751	-1	no_errors	ENST00000333229	ensembl	human	known	69_37n	missense	245	41.53	174	SNP	0.010	T
BRWD1	54014	genome.wustl.edu	37	21	40570851	40570851	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr21:40570851C>G	ENST00000333229.2	-	40	5818	c.5491G>C	c.(5491-5493)Gat>Cat	p.D1831H	BRWD1_ENST00000342449.3_Missense_Mutation_p.D1831H|BRWD1_ENST00000380800.3_Missense_Mutation_p.D1831H	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1831					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TCTTCTCTATCTTGCTCTTCA	0.383																																					Melanoma(170;988 1986 4794 16843 39731)	dbGAP											0													133.0	133.0	133.0					21																	40570851		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.5491G>C	21.37:g.40570851C>G	ENSP00000330753:p.Asp1831His		C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D1831H	ENST00000333229.2	37	c.5491	CCDS13662.1	21	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969433	0.74246	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.45668	0.89;0.89;0.89	5.48	2.57	0.30868	.	0.471728	0.21169	N	0.079014	T	0.38746	0.1052	L	0.54323	1.7	0.09310	N	1	P;B	0.41569	0.755;0.001	B;B	0.44224	0.444;0.001	T	0.25916	-1.0118	10	0.62326	D	0.03	-0.8253	5.7225	0.17995	0.1448:0.6491:0.1316:0.0745	.	1831;1831	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	H	1831	ENSP00000330753:D1831H;ENSP00000344333:D1831H;ENSP00000370178:D1831H	ENSP00000330753:D1831H	D	-	1	0	BRWD1	39492721	0.001000	0.12720	0.001000	0.08648	0.757000	0.42996	1.169000	0.31871	0.631000	0.30412	0.655000	0.94253	GAT	BRWD1	-	NULL	ENSG00000185658		0.383	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3	184	0.00	0	C	NM_033656		40570851	40570851	-1	no_errors	ENST00000333229	ensembl	human	known	69_37n	missense	330	36.90	193	SNP	0.001	G
BRWD1	54014	genome.wustl.edu	37	21	40571558	40571558	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr21:40571558C>G	ENST00000333229.2	-	40	5111	c.4784G>C	c.(4783-4785)aGa>aCa	p.R1595T	BRWD1_ENST00000342449.3_Missense_Mutation_p.R1595T|BRWD1_ENST00000380800.3_Missense_Mutation_p.R1595T	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1595					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				AGTGGCTTTTCTGCCACATCC	0.323											OREG0003861	type=REGULATORY REGION|Gene=BRWD1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									Melanoma(170;988 1986 4794 16843 39731)	dbGAP											0													42.0	47.0	46.0					21																	40571558		2203	4291	6494	-	-	-	SO:0001583	missense	0			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.4784G>C	21.37:g.40571558C>G	ENSP00000330753:p.Arg1595Thr	894	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1595T	ENST00000333229.2	37	c.4784	CCDS13662.1	21	.	.	.	.	.	.	.	.	.	.	C	14.85	2.659264	0.47467	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.59772	0.24;0.36;0.44	5.19	4.3	0.51218	.	0.088013	0.48767	D	0.000162	T	0.55386	0.1917	M	0.66939	2.045	0.80722	D	1	P;B	0.39480	0.675;0.319	B;B	0.41988	0.372;0.096	T	0.51020	-0.8758	10	0.17832	T	0.49	-12.8458	11.0242	0.47736	0.0:0.8499:0.0:0.1501	.	1595;1595	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	T	1595	ENSP00000330753:R1595T;ENSP00000344333:R1595T;ENSP00000370178:R1595T	ENSP00000330753:R1595T	R	-	2	0	BRWD1	39493428	0.990000	0.36364	0.989000	0.46669	0.990000	0.78478	2.033000	0.41136	1.183000	0.42943	0.563000	0.77884	AGA	BRWD1	-	NULL	ENSG00000185658		0.323	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3	41	0.00	0	C	NM_033656		40571558	40571558	-1	no_errors	ENST00000333229	ensembl	human	known	69_37n	missense	67	42.74	50	SNP	0.960	G
C12orf57	113246	genome.wustl.edu	37	12	7053746	7053746	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr12:7053746G>A	ENST00000229281.5	+	2	259	c.160G>A	c.(160-162)Gtg>Atg	p.V54M	RNU7-1_ENST00000458811.1_RNA|C12orf57_ENST00000537087.1_Intron|PTPN6_ENST00000447931.2_5'Flank|U47924.31_ENST00000607421.1_RNA|C12orf57_ENST00000542222.1_3'UTR|PTPN6_ENST00000399448.1_5'Flank|C12orf57_ENST00000540506.2_Missense_Mutation_p.V19M|C12orf57_ENST00000544681.1_Missense_Mutation_p.V54M	NM_138425.2	NP_612434.1	Q99622	C10_HUMAN	chromosome 12 open reading frame 57	54						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)	2						GCTGCAATTCGTGCTGCCCGT	0.627											OREG0021642	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													90.0	68.0	75.0					12																	7053746		2203	4300	6503	-	-	-	SO:0001583	missense	0			U47924	CCDS8571.1	12p13.31	2012-05-30			ENSG00000111678	ENSG00000111678			29521	protein-coding gene	gene with protein product		615140				9445485	Standard	NM_138425		Approved	GRCC10, C10	uc009zfj.2	Q99622	OTTHUMG00000169017	ENST00000229281.5:c.160G>A	12.37:g.7053746G>A	ENSP00000229281:p.Val54Met	638	B2R4Q6	Missense_Mutation	SNP	NULL	p.V54M	ENST00000229281.5	37	c.160	CCDS8571.1	12	.	.	.	.	.	.	.	.	.	.	G	18.01	3.528154	0.64860	.	.	ENSG00000111678	ENST00000545581;ENST00000229281	D;D	0.81739	-1.53;-1.53	3.74	3.74	0.42951	.	0.130598	0.51477	D	0.000086	T	0.72070	0.3415	L	0.52905	1.665	0.53005	D	0.999964	D	0.57899	0.981	B	0.40534	0.332	T	0.75213	-0.3397	10	0.72032	D	0.01	-27.8077	6.9254	0.24412	0.0:0.1895:0.6151:0.1954	.	54	Q99622	C10_HUMAN	M	54	ENSP00000440602:V54M;ENSP00000229281:V54M	ENSP00000229281:V54M	V	+	1	0	C12orf57	6924007	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	3.746000	0.55127	2.373000	0.80994	0.561000	0.74099	GTG	C12orf57	-	NULL	ENSG00000111678		0.627	C12orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf57	HGNC	protein_coding	OTTHUMT00000401959.1	165	0.00	0	G	NM_138425		7053746	7053746	+1	no_errors	ENST00000229281	ensembl	human	known	69_37n	missense	31	35.42	17	SNP	1.000	A
CCDC171	203238	genome.wustl.edu	37	9	15778997	15778998	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr9:15778997_15778998delTT	ENST00000380701.3	+	20	3258_3259	c.2930_2931delTT	c.(2929-2931)cttfs	p.L977fs	RNU6-14P_ENST00000384630.1_RNA|CCDC171_ENST00000297641.3_Frame_Shift_Del_p.L977fs	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	977																	AAGCAAATACTTGGATTTACAC	0.381																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.2930_2931delTT	9.37:g.15778997_15778998delTT	ENSP00000370077:p.Leu977fs		B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Frame_Shift_Del	DEL	superfamily_STAT_TF_coiled-coil	p.L977fs	ENST00000380701.3	37	c.2930_2931	CCDS6481.1	9																																																																																			CCDC171	-	NULL	ENSG00000164989		0.381	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC171	HGNC	protein_coding	OTTHUMT00000051768.4	80	0.00	0	TT	NM_173550		15778997	15778998	+1	no_errors	ENST00000380701	ensembl	human	known	69_37n	frame_shift_del	40	35.48	22	DEL	0.997:1.000	-
CCDC79	283847	genome.wustl.edu	37	16	66803899	66803899	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr16:66803899G>T	ENST00000558713.2	-	13	1658	c.1586C>A	c.(1585-1587)aCt>aAt	p.T529N	CCDC79_ENST00000415744.1_Missense_Mutation_p.T487N|CCDC79_ENST00000432602.1_Missense_Mutation_p.T529N|CCDC79_ENST00000433574.1_Missense_Mutation_p.T529N|CCDC79_ENST00000433154.1_Missense_Mutation_p.T529N|CCDC79_ENST00000561333.1_5'UTR			Q8NA31	TERB1_HUMAN	coiled-coil domain containing 79	529	Interaction with TERF1. {ECO:0000250}.				meiotic telomere clustering (GO:0045141)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|skin(2)	7						TTCAAAAGTAGTTTCTTCATG	0.323																																						dbGAP											0													136.0	100.0	111.0					16																	66803899		692	1591	2283	-	-	-	SO:0001583	missense	0			AK093213		16q22.1	2012-10-03			ENSG00000249961	ENSG00000249961			26675	protein-coding gene	gene with protein product							Standard	NM_001136505		Approved	FLJ35894	uc010viv.2	Q8NA31	OTTHUMG00000133562	ENST00000558713.2:c.1586C>A	16.37:g.66803899G>T	ENSP00000462883:p.Thr529Asn		A0AUW1	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_ARM-type_fold,superfamily_Homeodomain-like,superfamily_Cytokine_IL1-like,smart_SANT/Myb	p.T529N	ENST00000558713.2	37	c.1586		16	.	.	.	.	.	.	.	.	.	.	G	4.934	0.173623	0.09391	.	.	ENSG00000177461	ENST00000433154;ENST00000432602;ENST00000433574;ENST00000415744	T;T;T	0.19394	2.15;2.15;2.15	5.12	-0.337	0.12654	.	0.493168	0.18603	N	0.136392	T	0.16214	0.0390	L	0.44542	1.39	0.09310	N	1	B;P	0.36837	0.309;0.571	B;B	0.40228	0.073;0.323	T	0.11743	-1.0575	10	0.51188	T	0.08	0.7549	4.4121	0.11438	0.225:0.0:0.4903:0.2847	.	529;529	Q8NA31;Q8NA31-2	CCD79_HUMAN;.	N	529;529;529;487	ENSP00000463762:T529N;ENSP00000462977:T529N;ENSP00000462037:T529N	ENSP00000440822:T487N	T	-	2	0	CCDC79	65361400	0.000000	0.05858	0.121000	0.21740	0.626000	0.37791	0.025000	0.13577	0.095000	0.17434	-0.311000	0.09066	ACT	CCDC79	-	superfamily_Cytokine_IL1-like	ENSG00000249961		0.323	CCDC79-003	KNOWN	basic|appris_principal	protein_coding	CCDC79	HGNC	protein_coding	OTTHUMT00000418864.2	140	0.00	0	G			66803899	66803899	-1	no_errors	ENST00000433154	ensembl	human	known	69_37n	missense	147	15.03	26	SNP	0.016	T
CDK12	51755	genome.wustl.edu	37	17	37681111	37681111	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr17:37681111G>T	ENST00000447079.4	+	12	3313	c.3280G>T	c.(3280-3282)Gtg>Ttg	p.V1094L	CDK12_ENST00000430627.2_Missense_Mutation_p.V1094L	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	1094					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						TCCTGGCAAGGTGGAGTCTGG	0.522			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																												dbGAP		Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	0													64.0	66.0	65.0					17																	37681111		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.3280G>T	17.37:g.37681111G>T	ENSP00000398880:p.Val1094Leu		A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V1094L	ENST00000447079.4	37	c.3280	CCDS11337.1	17	.	.	.	.	.	.	.	.	.	.	G	11.77	1.737465	0.30774	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.67698	-0.28;-0.27	4.98	4.98	0.66077	.	0.386519	0.18765	N	0.131765	T	0.40743	0.1129	N	0.03608	-0.345	0.23089	N	0.998311	B;B;B	0.13594	0.005;0.005;0.008	B;B;B	0.18561	0.01;0.01;0.022	T	0.15867	-1.0422	10	0.17369	T	0.5	-0.6529	10.7359	0.46124	0.0884:0.0:0.9116:0.0	.	1093;1094;1094	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	L	1094	ENSP00000407720:V1094L;ENSP00000398880:V1094L	ENSP00000407720:V1094L	V	+	1	0	CDK12	34934637	1.000000	0.71417	0.999000	0.59377	0.800000	0.45204	2.238000	0.43070	2.591000	0.87537	0.563000	0.77884	GTG	CDK12	-	NULL	ENSG00000167258		0.522	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK12	HGNC	protein_coding	OTTHUMT00000256941.4	98	0.00	0	G	NM_016507		37681111	37681111	+1	no_errors	ENST00000447079	ensembl	human	known	69_37n	missense	31	49.18	30	SNP	1.000	T
CNOT1	23019	genome.wustl.edu	37	16	58589801	58589801	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr16:58589801G>A	ENST00000317147.5	-	20	2823	c.2491C>T	c.(2491-2493)Cag>Tag	p.Q831*	CNOT1_ENST00000441024.2_Nonsense_Mutation_p.Q831*|CNOT1_ENST00000569240.1_Nonsense_Mutation_p.Q826*|CNOT1_ENST00000569732.1_5'UTR	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	831	Interaction with ZFP36.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GGCCACACCTGAGACAAGTCC	0.443																																						dbGAP											0													134.0	114.0	121.0					16																	58589801		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.2491C>T	16.37:g.58589801G>A	ENSP00000320949:p.Gln831*		Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Nonsense_Mutation	SNP	pfam_CCR4-Not_Not1_C,superfamily_ARM-type_fold	p.Q831*	ENST00000317147.5	37	c.2491	CCDS10799.1	16	.	.	.	.	.	.	.	.	.	.	G	43	10.348085	0.99388	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000394200;ENST00000441024	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	.	20.6397	0.99537	0.0:0.0:1.0:0.0	.	.	.	.	X	831;260;826;831	.	ENSP00000320949:Q831X	Q	-	1	0	CNOT1	57147302	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.880000	0.98712	0.650000	0.86243	CAG	CNOT1	-	NULL	ENSG00000125107		0.443	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3	239	0.00	0	G	NM_016284		58589801	58589801	-1	no_errors	ENST00000317147	ensembl	human	known	69_37n	nonsense	99	35.71	55	SNP	1.000	A
CPSF4	10898	genome.wustl.edu	37	7	99054135	99054135	+	3'UTR	SNP	G	G	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr7:99054135G>T	ENST00000292476.5	+	0	832				PTCD1_ENST00000555673.1_Intron|CPSF4_ENST00000451876.1_3'UTR|CPSF4_ENST00000441580.1_3'UTR|ATP5J2-PTCD1_ENST00000413834.1_Intron|ATP5J2-PTCD1_ENST00000437572.1_Intron|CPSF4_ENST00000436336.2_3'UTR|ATP5J2_ENST00000466753.1_Intron			O95639	CPSF4_HUMAN	cleavage and polyadenylation specific factor 4, 30kDa						modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA processing (GO:0006397)|viral life cycle (GO:0019058)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(5)	14	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					AGCAGCTGGAGCCAGCTCCGA	0.607																																						dbGAP											0													52.0	47.0	49.0					7																	99054135		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS5664.1, CCDS47652.1	7q22	2007-10-18	2002-08-29		ENSG00000160917	ENSG00000160917			2327	protein-coding gene	gene with protein product		603052	"""cleavage and polyadenylation specific factor 4, 30kD subunit"""			9651582, 9224719	Standard	NM_006693		Approved	NAR, CPSF30	uc003uqj.3	O95639	OTTHUMG00000154599	ENST00000292476.5:c.*12G>T	7.37:g.99054135G>T			D6W5S8|Q6FGE6|Q86TF8|Q9BTW6	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.S185I	ENST00000292476.5	37	c.554	CCDS5664.1	7	.	.	.	.	.	.	.	.	.	.	G	13.36	2.213467	0.39102	.	.	ENSG00000160917	ENST00000452047;ENST00000440514	T	0.37235	1.21	6.01	2.07	0.26955	.	.	.	.	.	T	0.34135	0.0887	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.04930	-1.0917	5	.	.	.	.	5.6542	0.17633	0.1703:0.3088:0.5209:0.0	.	.	.	.	I	185;171	ENSP00000392584:S185I	.	S	+	2	0	CPSF4	98892071	1.000000	0.71417	0.957000	0.39632	0.983000	0.72400	1.252000	0.32874	0.100000	0.17581	0.609000	0.83330	AGC	CPSF4	-	NULL	ENSG00000160917		0.607	CPSF4-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CPSF4	HGNC	protein_coding	OTTHUMT00000336254.1	129	0.77	1	G			99054135	99054135	+1	no_start_codon:no_stop_codon	ENST00000452047	ensembl	human	putative	69_37n	missense	44	38.03	27	SNP	0.974	T
CSRNP2	81566	genome.wustl.edu	37	12	51457800	51457800	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr12:51457800A>G	ENST00000228515.1	-	5	1658	c.1361T>C	c.(1360-1362)cTc>cCc	p.L454P		NM_030809.2	NP_110436.1	Q9H175	CSRN2_HUMAN	cysteine-serine-rich nuclear protein 2	454					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	14						GGTAACAGGGAGAGAGAAGAC	0.537																																						dbGAP											0													73.0	81.0	79.0					12																	51457800		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ298133	CCDS8807.1	12q13.11-q13.12	2012-04-17	2009-01-07	2009-01-07				"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16006	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 72"""		"""chromosome 12 open reading frame 22"", ""family with sequence similarity 130, member A1"""	C12orf22, FAM130A1		17726538	Standard	NM_030809		Approved	C12ORF2, TAIP-12, PPP1R72	uc001rxu.2	Q9H175		ENST00000228515.1:c.1361T>C	12.37:g.51457800A>G	ENSP00000228515:p.Leu454Pro			Missense_Mutation	SNP	prints_Cys/Ser-rich_nuc_prot	p.L454P	ENST00000228515.1	37	c.1361	CCDS8807.1	12	.	.	.	.	.	.	.	.	.	.	A	13.20	2.166608	0.38217	.	.	ENSG00000110925	ENST00000228515	T	0.52754	0.65	4.38	4.38	0.52667	.	0.193072	0.31963	N	0.006791	T	0.30293	0.0760	N	0.14661	0.345	0.58432	D	0.999999	P	0.46142	0.873	B	0.39840	0.311	T	0.19063	-1.0317	10	0.54805	T	0.06	-11.5131	11.9225	0.52799	1.0:0.0:0.0:0.0	.	454	Q9H175	CSRN2_HUMAN	P	454	ENSP00000228515:L454P	ENSP00000228515:L454P	L	-	2	0	CSRNP2	49744067	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.649000	0.67936	2.202000	0.70862	0.454000	0.30748	CTC	CSRNP2	-	NULL	ENSG00000110925		0.537	CSRNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRNP2	HGNC	protein_coding	OTTHUMT00000404893.1	131	0.00	0	A			51457800	51457800	-1	no_errors	ENST00000228515	ensembl	human	known	69_37n	missense	71	33.64	36	SNP	1.000	G
DOPEY1	23033	genome.wustl.edu	37	6	83877655	83877655	+	Silent	SNP	C	C	G			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr6:83877655C>G	ENST00000349129.2	+	39	7427	c.7167C>G	c.(7165-7167)acC>acG	p.T2389T	DOPEY1_ENST00000484282.1_3'UTR|DOPEY1_ENST00000369739.3_Silent_p.T2400T|PGM3_ENST00000512866.1_Intron|DOPEY1_ENST00000237163.5_Silent_p.T2293T|PGM3_ENST00000513973.1_3'UTR	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	2389					protein transport (GO:0015031)			p.T2389T(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		CCATCTGCACCGTGCGCAGTA	0.512																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											60.0	54.0	56.0					6																	83877655		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.7167C>G	6.37:g.83877655C>G			Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Silent	SNP	pfam_Dopey_N,superfamily_ARM-type_fold	p.T2389	ENST00000349129.2	37	c.7167	CCDS4996.1	6																																																																																			DOPEY1	-	NULL	ENSG00000083097		0.512	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY1	HGNC	protein_coding	OTTHUMT00000043785.2	74	0.00	0	C	NM_015018		83877655	83877655	+1	no_errors	ENST00000349129	ensembl	human	known	69_37n	silent	26	40.91	18	SNP	0.987	G
DRD4	1815	genome.wustl.edu	37	11	640571	640571	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr11:640571G>A	ENST00000176183.5	+	4	1240	c.1228G>A	c.(1228-1230)Gtc>Atc	p.V410I		NM_000797.3	NP_000788.2	P21917	DRD4_HUMAN	dopamine receptor D4	458					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult locomotory behavior (GO:0008344)|arachidonic acid secretion (GO:0050482)|behavioral fear response (GO:0001662)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|cellular calcium ion homeostasis (GO:0006874)|circadian rhythm (GO:0007623)|dopamine metabolic process (GO:0042417)|dopamine receptor signaling pathway (GO:0007212)|fear response (GO:0042596)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein secretion (GO:0050709)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|olfactory learning (GO:0008355)|photoperiodism (GO:0009648)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of kinase activity (GO:0033674)|positive regulation of penile erection (GO:0060406)|positive regulation of sodium:proton antiporter activity (GO:0032417)|regulation of calcium-mediated signaling (GO:0050848)|regulation of circadian rhythm (GO:0042752)|regulation of dopamine metabolic process (GO:0042053)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of neurotransmitter secretion (GO:0046928)|response to amphetamine (GO:0001975)|response to histamine (GO:0034776)|response to steroid hormone (GO:0048545)|retina development in camera-type eye (GO:0060041)|short-term memory (GO:0007614)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)	cell cortex (GO:0005938)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|vesicle membrane (GO:0012506)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)|SH3 domain binding (GO:0017124)			NS(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.36e-28)|Epithelial(43;2.59e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Ziprasidone(DB00246)	GTTCCGCAACGTCTTCCGCAA	0.701																																						dbGAP											0													88.0	74.0	79.0					11																	640571		2201	4298	6499	-	-	-	SO:0001583	missense	0			L12398	CCDS7710.1	11p15.5	2012-08-08			ENSG00000069696	ENSG00000069696		"""GPCR / Class A : Dopamine receptors"""	3025	protein-coding gene	gene with protein product		126452					Standard	NM_000797		Approved		uc001lqp.2	P21917	OTTHUMG00000133312	ENST00000176183.5:c.1228G>A	11.37:g.640571G>A	ENSP00000176183:p.Val410Ile		B0M0J7|Q7Z7Q5|Q8NGM5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Dopa_D4_rcpt,prints_Dopamine_rcpt	p.V410I	ENST00000176183.5	37	c.1228	CCDS7710.1	11	.	.	.	.	.	.	.	.	.	.	g	17.95	3.514211	0.64522	.	.	ENSG00000069696	ENST00000176183	T	0.37411	1.2	3.02	1.98	0.26296	.	0.164522	0.39687	U	0.001298	T	0.36166	0.0957	.	.	.	0.23519	N	0.997508	D	0.59767	0.986	P	0.49665	0.618	T	0.15694	-1.0428	9	0.72032	D	0.01	.	7.67	0.28453	0.0:0.0:0.5351:0.4648	.	458	P21917	DRD4_HUMAN	I	410	ENSP00000176183:V410I	ENSP00000176183:V410I	V	+	1	0	DRD4	630571	0.940000	0.31905	0.830000	0.32933	0.930000	0.56654	1.693000	0.37742	1.709000	0.51313	0.457000	0.33378	GTC	DRD4	-	prints_Dopamine_rcpt	ENSG00000069696		0.701	DRD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRD4	HGNC	protein_coding	OTTHUMT00000257109.1	169	0.00	0	G	NM_000797		640571	640571	+1	no_errors	ENST00000176183	ensembl	human	known	69_37n	missense	24	46.67	21	SNP	0.792	A
AGO2	27161	genome.wustl.edu	37	8	141566309	141566309	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr8:141566309G>C	ENST00000220592.5	-	9	1215	c.1103C>G	c.(1102-1104)aCt>aGt	p.T368S	AGO2_ENST00000519980.1_Missense_Mutation_p.T368S	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	368					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										CGACCTAGCAGTCGCTCTGAT	0.522																																						dbGAP											0													102.0	95.0	97.0					8																	141566309		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.1103C>G	8.37:g.141566309G>C	ENSP00000220592:p.Thr368Ser		Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.T368S	ENST00000220592.5	37	c.1103	CCDS6380.1	8	.	.	.	.	.	.	.	.	.	.	G	29.2	4.983932	0.93044	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.09538	2.97;2.97	5.11	5.11	0.69529	Argonaute/Dicer protein, PAZ (3);	0.000000	0.85682	D	0.000000	T	0.33323	0.0859	M	0.71296	2.17	0.80722	D	1	B;B	0.31125	0.309;0.088	P;P	0.51945	0.683;0.685	T	0.07271	-1.0781	10	0.59425	D	0.04	-0.806	18.8995	0.92437	0.0:0.0:1.0:0.0	.	368;368	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	S	368	ENSP00000220592:T368S;ENSP00000430176:T368S	ENSP00000220592:T368S	T	-	2	0	EIF2C2	141635491	1.000000	0.71417	0.869000	0.34112	0.979000	0.70002	9.697000	0.98697	2.548000	0.85928	0.655000	0.94253	ACT	EIF2C2	-	pfam_PAZ,superfamily_PAZ,smart_PAZ	ENSG00000123908		0.522	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C2	HGNC	protein_coding	OTTHUMT00000377866.4	159	0.00	0	G			141566309	141566309	-1	no_errors	ENST00000220592	ensembl	human	known	69_37n	missense	129	22.75	38	SNP	1.000	C
EZH1	2145	genome.wustl.edu	37	17	40856673	40856673	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr17:40856673C>G	ENST00000428826.2	-	18	2085	c.1964G>C	c.(1963-1965)cGc>cCc	p.R655P	EZH1_ENST00000590078.1_Missense_Mutation_p.R585P|EZH1_ENST00000415827.2_Missense_Mutation_p.R646P|EZH1_ENST00000585893.1_Missense_Mutation_p.R615P|EZH1_ENST00000592743.1_Missense_Mutation_p.R655P|EZH1_ENST00000590783.1_5'UTR|EZH1_ENST00000435174.1_Missense_Mutation_p.R516P			Q92800	EZH1_HUMAN	enhancer of zeste 1 polycomb repressive complex 2 subunit	655	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				anatomical structure morphogenesis (GO:0009653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)			breast(1)|endometrium(4)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	27		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		GACCTTTCCGCGTCGATCAGC	0.453																																						dbGAP											0													79.0	70.0	73.0					17																	40856673		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32659.1	17q21.1-q21.3	2014-05-28	2014-05-28			ENSG00000108799		"""Chromatin-modifying enzymes / K-methyltransferases"""	3526	protein-coding gene	gene with protein product		601674	"""enhancer of zeste (Drosophila) homolog 1"", ""enhancer of zeste homolog 1 (Drosophila)"""			8921387	Standard	NM_001991		Approved	KIAA0388, KMT6B	uc002iaz.3	Q92800		ENST00000428826.2:c.1964G>C	17.37:g.40856673C>G	ENSP00000404658:p.Arg655Pro		A6NCH6|B4DIJ1|B4DIZ7|B4DSS2|B4E3R7|O43287|Q14459|Q53XP3	Missense_Mutation	SNP	pfam_SET_dom,pfam_EZH2_WD-Binding,superfamily_Homeodomain-like,smart_SANT/Myb,smart_SET_dom,pfscan_SET_dom	p.R655P	ENST00000428826.2	37	c.1964	CCDS32659.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.070601	0.93950	.	.	ENSG00000108799	ENST00000264646;ENST00000428826;ENST00000415827;ENST00000435174	D;D	0.84873	-1.91;-1.91	5.4	5.4	0.78164	SET domain (3);	0.055849	0.64402	D	0.000001	D	0.96470	0.8848	H	0.99732	4.735	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.98113	1.0421	10	0.87932	D	0	.	19.3628	0.94448	0.0:1.0:0.0:0.0	.	516;615;661;585;655	Q92800-5;Q92800-3;Q92800-2;Q92800-4;Q92800	.;.;.;.;EZH1_HUMAN	P	658;655;615;516	ENSP00000404658:R655P;ENSP00000404071:R516P	ENSP00000264646:R658P	R	-	2	0	EZH1	38110199	1.000000	0.71417	0.974000	0.42286	0.890000	0.51754	7.647000	0.83462	2.802000	0.96397	0.561000	0.74099	CGC	EZH1	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000108799		0.453	EZH1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EZH1	HGNC	protein_coding	OTTHUMT00000452347.1	189	0.00	0	C	NM_001991		40856673	40856673	-1	no_errors	ENST00000428826	ensembl	human	known	69_37n	missense	39	50.63	40	SNP	1.000	G
GNAT2	2780	genome.wustl.edu	37	1	110148929	110148929	+	Splice_Site	DEL	C	C	-			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr1:110148929delC	ENST00000351050.3	-	5	777		c.e5+1			NM_005272.3	NP_005263.1	P19087	GNAT2_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to light intensity (GO:0009642)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	heterotrimeric G-protein complex (GO:0005834)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	14		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0422)|Colorectal(144;0.108)|Epithelial(280;0.125)|all cancers(265;0.129)|LUSC - Lung squamous cell carcinoma(189;0.227)		CATGCACTTACCTGAAATTCA	0.483																																						dbGAP											0													138.0	125.0	129.0					1																	110148929		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC000233	CCDS803.1	1p13	2013-01-08			ENSG00000134183	ENSG00000134183			4394	protein-coding gene	gene with protein product		139340				8406495	Standard	NM_005272		Approved	ACHM4	uc001dya.3	P19087	OTTHUMG00000011639	ENST00000351050.3:c.590+1G>-	1.37:g.110148929delC				Splice_Site	DEL	-	e5+1	ENST00000351050.3	37	c.590+1	CCDS803.1	1																																																																																			GNAT2	-	-	ENSG00000134183		0.483	GNAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAT2	HGNC	protein_coding	OTTHUMT00000032181.1	209	0.00	0	C	NM_005272	Intron	110148929	110148929	-1	no_errors	ENST00000351050	ensembl	human	known	69_37n	splice_site_del	146	14.12	24	DEL	1.000	-
GRID2	2895	genome.wustl.edu	37	4	94377069	94377069	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr4:94377069C>T	ENST00000282020.4	+	11	2060	c.1802C>T	c.(1801-1803)aCg>aTg	p.T601M	GRID2_ENST00000510992.1_Missense_Mutation_p.T506M	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	601					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		GGATCAATGACGTCTACTACT	0.413																																						dbGAP											0													199.0	179.0	186.0					4																	94377069		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.1802C>T	4.37:g.94377069C>T	ENSP00000282020:p.Thr601Met		E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.T601M	ENST00000282020.4	37	c.1802	CCDS3637.1	4	.	.	.	.	.	.	.	.	.	.	C	16.52	3.147310	0.57151	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.53423	0.62;0.62	6.17	5.32	0.75619	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	.	.	.	.	T	0.58609	0.2134	L	0.52011	1.625	0.54753	D	0.999983	D;D	0.58620	0.983;0.983	P;P	0.54965	0.765;0.765	T	0.61686	-0.7012	9	0.59425	D	0.04	.	17.6278	0.88097	0.0:0.8768:0.1231:0.0	.	506;601	E9PH24;O43424	.;GRID2_HUMAN	M	601;506	ENSP00000282020:T601M;ENSP00000421257:T506M	ENSP00000282020:T601M	T	+	2	0	GRID2	94596092	1.000000	0.71417	0.975000	0.42487	0.982000	0.71751	4.921000	0.63397	1.597000	0.50072	0.655000	0.94253	ACG	GRID2	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000152208		0.413	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2	470	0.00	0	C			94377069	94377069	+1	no_errors	ENST00000282020	ensembl	human	known	69_37n	missense	134	41.74	96	SNP	1.000	T
HSPG2	3339	genome.wustl.edu	37	1	22211365	22211365	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr1:22211365C>T	ENST00000374695.3	-	12	1481	c.1402G>A	c.(1402-1404)Gat>Aat	p.D468N		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	468	Ig-like C2-type 1.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	TCCTTCACATCACGGATGATC	0.607																																						dbGAP											0													64.0	54.0	57.0					1																	22211365		2203	4300	6503	-	-	-	SO:0001583	missense	0			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.1402G>A	1.37:g.22211365C>T	ENSP00000363827:p.Asp468Asn		Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_SEA,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA,pfscan_Ig-like	p.D468N	ENST00000374695.3	37	c.1402	CCDS30625.1	1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.973064	0.53614	.	.	ENSG00000142798	ENST00000374695	T	0.36699	1.24	5.46	5.46	0.80206	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.39687	N	0.001300	T	0.34978	0.0916	N	0.02391	-0.57	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.51156	-0.8741	10	0.29301	T	0.29	.	16.8039	0.85621	0.0:1.0:0.0:0.0	.	468	P98160	PGBM_HUMAN	N	468	ENSP00000363827:D468N	ENSP00000363827:D468N	D	-	1	0	HSPG2	22083952	1.000000	0.71417	0.069000	0.20011	0.260000	0.26232	7.175000	0.77632	2.560000	0.86352	0.561000	0.74099	GAT	HSPG2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000142798		0.607	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1	71	0.00	0	C	NM_005529		22211365	22211365	-1	no_errors	ENST00000374695	ensembl	human	known	69_37n	missense	13	48.00	12	SNP	0.980	T
IGKV1-6	28943	genome.wustl.edu	37	2	89265934	89265934	+	RNA	SNP	A	A	C	rs544936178	byFrequency	TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr2:89265934A>C	ENST00000464162.1	-	0	226									immunoglobulin kappa variable 1-6																		TCAGGAGCTTAGGGGCTTTCC	0.512																																						dbGAP											0													150.0	141.0	144.0					2																	89265934		1871	4084	5955	-	-	-			0			M64858		2p11.2	2012-02-10			ENSG00000239855	ENSG00000239855		"""Immunoglobulins / IGK locus"""	5742	other	immunoglobulin gene							Standard	NG_000834		Approved				OTTHUMG00000151559		2.37:g.89265934A>C				Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.P66	ENST00000464162.1	37	c.198		2																																																																																			IGKV1-6	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000239855		0.512	IGKV1-6-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV1-6	HGNC	IG_V_gene	OTTHUMT00000323134.2	447	0.00	0	A	NG_000834		89265934	89265934	-1	no_stop_codon	ENST00000464162	ensembl	human	known	69_37n	silent	202	39.88	134	SNP	0.980	C
IRS4	8471	genome.wustl.edu	37	X	107979179	107979179	+	Silent	SNP	G	G	A			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chrX:107979179G>A	ENST00000372129.2	-	1	472	c.396C>T	c.(394-396)gcC>gcT	p.A132A	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	132	Ala-rich.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						CGCCAGAGGCGGCCGCCGCTG	0.657																																						dbGAP											0													14.0	16.0	15.0					X																	107979179		2150	4159	6309	-	-	-	SO:0001819	synonymous_variant	0			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.396C>T	X.37:g.107979179G>A				Silent	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1,prints_Insln_rcpt_S1	p.A132	ENST00000372129.2	37	c.396	CCDS14544.1	X																																																																																			IRS4	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000133124		0.657	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS4	HGNC	protein_coding	OTTHUMT00000057879.1	13	0.00	0	G	NM_003604		107979179	107979179	-1	no_errors	ENST00000372129	ensembl	human	known	69_37n	silent	10	44.44	8	SNP	0.980	A
JPH2	57158	genome.wustl.edu	37	20	42788508	42788508	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr20:42788508C>T	ENST00000372980.3	-	2	1791	c.919G>A	c.(919-921)Gaa>Aaa	p.E307K		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	307					calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CTGGAGCGTTCGCTCACGCCG	0.677																																						dbGAP											0													58.0	50.0	52.0					20																	42788508		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.919G>A	20.37:g.42788508C>T	ENSP00000362071:p.Glu307Lys		E1P5X1|O95913|Q5JY74|Q9UJN4	Missense_Mutation	SNP	pfam_MORN,smart_MORN,pirsf_Junctophilin	p.E307K	ENST00000372980.3	37	c.919	CCDS13325.1	20	.	.	.	.	.	.	.	.	.	.	c	19.14	3.769239	0.69992	.	.	ENSG00000149596	ENST00000372980	T	0.53857	0.6	3.1	3.1	0.35709	.	0.000000	0.85682	D	0.000000	T	0.53658	0.1810	L	0.27975	0.815	0.80722	D	1	D	0.64830	0.994	P	0.57960	0.83	T	0.58031	-0.7708	10	0.49607	T	0.09	.	14.3498	0.66694	0.0:1.0:0.0:0.0	.	307	Q9BR39	JPH2_HUMAN	K	307	ENSP00000362071:E307K	ENSP00000362071:E307K	E	-	1	0	JPH2	42221922	1.000000	0.71417	1.000000	0.80357	0.482000	0.33219	5.473000	0.66774	1.545000	0.49373	0.298000	0.19748	GAA	JPH2	-	pfam_MORN,smart_MORN,pirsf_Junctophilin	ENSG00000149596		0.677	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH2	HGNC	protein_coding	OTTHUMT00000080307.1	164	0.00	0	C			42788508	42788508	-1	no_errors	ENST00000372980	ensembl	human	known	69_37n	missense	107	10.08	12	SNP	1.000	T
CEMIP	57214	genome.wustl.edu	37	15	81229087	81229087	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr15:81229087C>G	ENST00000394685.3	+	24	3501	c.3082C>G	c.(3082-3084)Ctt>Gtt	p.L1028V	KIAA1199_ENST00000220244.3_Missense_Mutation_p.L1028V|KIAA1199_ENST00000356249.5_Missense_Mutation_p.L1028V|RP11-351M8.2_ENST00000560873.1_RNA			Q8WUJ3	CEMIP_HUMAN		1028					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CAGCCACCCTCTTTACCTGGA	0.512																																						dbGAP											0													108.0	115.0	112.0					15																	81229087		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000394685.3:c.3082C>G	15.37:g.81229087C>G	ENSP00000378177:p.Leu1028Val		Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.L1028V	ENST00000394685.3	37	c.3082	CCDS10315.1	15	.	.	.	.	.	.	.	.	.	.	C	12.16	1.854616	0.32791	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249	T;T;T	0.61392	0.11;0.11;0.11	5.4	5.4	0.78164	.	0.071618	0.56097	D	0.000030	T	0.44477	0.1295	L	0.37507	1.11	0.32786	N	0.501887	P	0.48294	0.908	B	0.41860	0.368	T	0.55068	-0.8198	10	0.25106	T	0.35	-38.0407	8.5408	0.33390	0.1532:0.7701:0.0:0.0768	.	1028	Q8WUJ3	K1199_HUMAN	V	1028	ENSP00000220244:L1028V;ENSP00000378177:L1028V;ENSP00000348583:L1028V	ENSP00000220244:L1028V	L	+	1	0	KIAA1199	79016142	0.985000	0.35326	0.276000	0.24689	0.824000	0.46624	2.658000	0.46733	2.528000	0.85240	0.467000	0.42956	CTT	KIAA1199	-	NULL	ENSG00000103888		0.512	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1199	HGNC	protein_coding	OTTHUMT00000291389.1	169	0.00	0	C			81229087	81229087	+1	no_errors	ENST00000220244	ensembl	human	known	69_37n	missense	81	37.69	49	SNP	0.757	G
LRP2	4036	genome.wustl.edu	37	2	170042184	170042184	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr2:170042184C>T	ENST00000263816.3	-	50	9959	c.9674G>A	c.(9673-9675)gGa>gAa	p.G3225E		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3225					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ATTGTCCAGTCCTTCCAAGAT	0.373																																						dbGAP											0													165.0	164.0	164.0					2																	170042184		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.9674G>A	2.37:g.170042184C>T	ENSP00000263816:p.Gly3225Glu		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.G3225E	ENST00000263816.3	37	c.9674	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	24.9	4.581016	0.86748	.	.	ENSG00000081479	ENST00000263816	D	0.91996	-2.95	5.97	5.97	0.96955	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.96479	0.8851	M	0.84219	2.685	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95228	0.8340	10	0.41790	T	0.15	.	20.4388	0.99107	0.0:1.0:0.0:0.0	.	3225	P98164	LRP2_HUMAN	E	3225	ENSP00000263816:G3225E	ENSP00000263816:G3225E	G	-	2	0	LRP2	169750430	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.974000	0.63771	2.836000	0.97738	0.655000	0.94253	GGA	LRP2	-	superfamily_Growth_fac_rcpt,smart_LDLR_classB_rpt	ENSG00000081479		0.373	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	345	0.00	0	C	NM_004525		170042184	170042184	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	missense	170	34.62	90	SNP	1.000	T
MFSD6L	162387	genome.wustl.edu	37	17	8702017	8702017	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr17:8702017G>C	ENST00000329805.4	-	1	650	c.422C>G	c.(421-423)cCa>cGa	p.P141R		NM_152599.3	NP_689812.3	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing 6-like	141						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|skin(4)	17						CCTCTTGGCTGGGTGGCTGGA	0.587																																						dbGAP											0													82.0	90.0	87.0					17																	8702017		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093092	CCDS11146.1	17p13.1	2014-05-30			ENSG00000185156	ENSG00000185156			26656	protein-coding gene	gene with protein product							Standard	NM_152599		Approved	FLJ35773	uc002glp.2	Q8IWD5	OTTHUMG00000178584	ENST00000329805.4:c.422C>G	17.37:g.8702017G>C	ENSP00000330051:p.Pro141Arg		Q6YL34|Q8NA76	Missense_Mutation	SNP	superfamily_MFS_dom_general_subst_transpt	p.P141R	ENST00000329805.4	37	c.422	CCDS11146.1	17	.	.	.	.	.	.	.	.	.	.	G	8.596	0.885772	0.17540	.	.	ENSG00000185156	ENST00000329805	T	0.54675	0.56	4.11	0.689	0.18033	.	2.598310	0.01924	N	0.040725	T	0.49150	0.1540	M	0.69823	2.125	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.04650	-1.0936	10	0.18710	T	0.47	-9.0694	3.0411	0.06139	0.2613:0.0:0.5337:0.205	.	141	Q8IWD5	MFS6L_HUMAN	R	141	ENSP00000330051:P141R	ENSP00000330051:P141R	P	-	2	0	MFSD6L	8642742	0.000000	0.05858	0.003000	0.11579	0.010000	0.07245	-0.127000	0.10547	0.066000	0.16515	-0.122000	0.15005	CCA	MFSD6L	-	NULL	ENSG00000185156		0.587	MFSD6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD6L	HGNC	protein_coding	OTTHUMT00000442554.1	151	0.00	0	G	NM_152599		8702017	8702017	-1	no_errors	ENST00000329805	ensembl	human	known	69_37n	missense	29	57.14	40	SNP	0.000	C
MAFG	4097	genome.wustl.edu	37	17	79880760	79880760	+	Silent	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr17:79880760C>T	ENST00000357736.4	-	3	425	c.210G>A	c.(208-210)gtG>gtA	p.V70V	MAFG_ENST00000392366.3_Silent_p.V70V|RP11-498C9.12_ENST00000580897.1_RNA	NM_002359.3|NM_032711.3	NP_002350.1|NP_116100.2	O15525	MAFG_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog G	70	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				adult behavior (GO:0030534)|blood coagulation (GO:0007596)|in utero embryonic development (GO:0001701)|regulation of cell proliferation (GO:0042127)|regulation of cellular pH (GO:0030641)|regulation of epidermal cell differentiation (GO:0045604)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|lung(1)	3	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			TCACCCGCTTCACGCGGCAGC	0.652																																						dbGAP											0													32.0	24.0	27.0					17																	79880760		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AF059195	CCDS11793.1	17q25.3	2013-07-09	2013-07-09		ENSG00000197063	ENSG00000197063			6781	protein-coding gene	gene with protein product	"""transcription factor MafG"", ""basic leucine zipper transcription factor MafG"""	602020				9763667	Standard	NM_002359		Approved	MGC13090, MGC20149	uc002kcm.3	O15525		ENST00000357736.4:c.210G>A	17.37:g.79880760C>T				Silent	SNP	pfam_bZIP_Maf,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.V70	ENST00000357736.4	37	c.210	CCDS11793.1	17																																																																																			MAFG	-	pfam_bZIP_Maf,smart_bZIP,pfscan_bZIP	ENSG00000197063		0.652	MAFG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAFG	HGNC	protein_coding	OTTHUMT00000439980.1	90	0.00	0	C	NM_002359		79880760	79880760	-1	no_errors	ENST00000357736	ensembl	human	known	69_37n	silent	33	26.67	12	SNP	0.998	T
MUC12	10071	genome.wustl.edu	37	7	100639291	100639291	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr7:100639291C>T	ENST00000379442.3	+	5	5876	c.5876C>T	c.(5875-5877)tCt>tTt	p.S1959F	MUC12_ENST00000536621.1_Missense_Mutation_p.S1816F			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1959	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AGCACCACATCTGCCCTTGTT	0.522																																						dbGAP											0													1.0	1.0	1.0					7																	100639291		121	363	484	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.5876C>T	7.37:g.100639291C>T	ENSP00000368755:p.Ser1959Phe		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.S1959F	ENST00000379442.3	37	c.5876		7	.	.	.	.	.	.	.	.	.	.	-	2.297	-0.361122	0.05103	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12879	2.64;2.64	0.77	0.77	0.18497	.	.	.	.	.	T	0.07007	0.0178	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.34800	-0.9814	7	0.56958	D	0.05	.	4.8691	0.13624	0.0:1.0:0.0:0.0	.	.	.	.	F	1959;1816	ENSP00000368755:S1959F;ENSP00000441929:S1816F	ENSP00000368755:S1959F	S	+	2	0	MUC12	100426011	0.000000	0.05858	0.364000	0.25888	0.082000	0.17680	0.549000	0.23329	0.704000	0.31869	0.173000	0.16961	TCT	MUC12	-	NULL	ENSG00000205277		0.522	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	10	0.00	0	C	XM_379904		100639291	100639291	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	7	42.86	6	SNP	0.414	T
MUC12	10071	genome.wustl.edu	37	7	100647790	100647790	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr7:100647790C>T	ENST00000379442.3	+	5	14375	c.14375C>T	c.(14374-14376)tCt>tTt	p.S4792F	MUC12_ENST00000536621.1_Missense_Mutation_p.S4649F			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4792	Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AGCACCACATCTGCCCTTGTT	0.517																																						dbGAP											0													111.0	114.0	113.0					7																	100647790		692	1590	2282	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.14375C>T	7.37:g.100647790C>T	ENSP00000368755:p.Ser4792Phe		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.S4792F	ENST00000379442.3	37	c.14375		7	.	.	.	.	.	.	.	.	.	.	c	0.752	-0.772440	0.02951	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12879	2.64;2.64	0.735	0.735	0.18300	.	.	.	.	.	T	0.06600	0.0169	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.33727	-0.9857	7	0.59425	D	0.04	.	3.0631	0.06206	0.0:0.6661:0.0:0.3339	.	.	.	.	F	4792;4649	ENSP00000368755:S4792F;ENSP00000441929:S4649F	ENSP00000368755:S4792F	S	+	2	0	MUC12	100434510	0.000000	0.05858	0.002000	0.10522	0.013000	0.08279	0.250000	0.18235	0.667000	0.31107	0.174000	0.16983	TCT	MUC12	-	NULL	ENSG00000205277		0.517	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	756	0.00	0	C	XM_379904		100647790	100647790	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	304	46.19	261	SNP	0.001	T
MYO1D	4642	genome.wustl.edu	37	17	31087405	31087405	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr17:31087405A>T	ENST00000318217.5	-	10	1503	c.1199T>A	c.(1198-1200)aTc>aAc	p.I400N	MYO1D_ENST00000583621.1_Missense_Mutation_p.I400N|MYO1D_ENST00000579584.1_Missense_Mutation_p.I400N|MYO1D_ENST00000394649.4_Missense_Mutation_p.I312N|MYO1D_ENST00000584232.1_5'UTR	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	400	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			GCAGTAATTGATACAGAATTG	0.373																																						dbGAP											0													131.0	129.0	130.0					17																	31087405		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.1199T>A	17.37:g.31087405A>T	ENSP00000324527:p.Ile400Asn		A6H8V3|Q8NHP9	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.I400N	ENST00000318217.5	37	c.1199	CCDS32615.1	17	.	.	.	.	.	.	.	.	.	.	A	22.1	4.249225	0.80024	.	.	ENSG00000176658	ENST00000318217	D	0.91740	-2.9	5.46	5.46	0.80206	Myosin head, motor domain (3);	0.000000	0.39909	U	0.001239	D	0.97324	0.9125	H	0.97611	4.04	0.80722	D	1	D;D	0.61080	0.989;0.989	D;D	0.67900	0.954;0.954	D	0.98448	1.0590	10	0.87932	D	0	.	13.7799	0.63077	1.0:0.0:0.0:0.0	.	311;400	Q7Z3N6;O94832	.;MYO1D_HUMAN	N	400	ENSP00000324527:I400N	ENSP00000324527:I400N	I	-	2	0	MYO1D	28111518	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	9.339000	0.96797	2.206000	0.71126	0.533000	0.62120	ATC	MYO1D	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000176658		0.373	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1D	HGNC	protein_coding	OTTHUMT00000447457.1	195	0.00	0	A			31087405	31087405	-1	no_errors	ENST00000318217	ensembl	human	known	69_37n	missense	97	42.94	73	SNP	1.000	T
OR2D2	120776	genome.wustl.edu	37	11	6913663	6913663	+	Silent	SNP	G	G	A	rs139169283		TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr11:6913663G>A	ENST00000299459.2	-	1	167	c.69C>T	c.(67-69)acC>acT	p.T23T		NM_003700.1	NP_003691.1	Q9H210	OR2D2_HUMAN	olfactory receptor, family 2, subfamily D, member 2	23					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	18		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GCAGCTGCTCGGTGTGTGGCC	0.438													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18538	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													120.0	101.0	108.0					11																	6913663		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065824	CCDS31416.1	11p15.4	2012-08-09			ENSG00000166368	ENSG00000166368		"""GPCR / Class A : Olfactory receptors"""	8244	protein-coding gene	gene with protein product		608494		OR2D1		9787077	Standard	NM_003700		Approved	OR11-610, hg27	uc010rau.2	Q9H210	OTTHUMG00000165741	ENST00000299459.2:c.69C>T	11.37:g.6913663G>A			B9EIL5|O95224|Q6IF28|Q8NGH4|Q96R52	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt	p.T23	ENST00000299459.2	37	c.69	CCDS31416.1	11																																																																																			OR2D2	-	NULL	ENSG00000166368		0.438	OR2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2D2	HGNC	protein_coding	OTTHUMT00000385986.1	161	0.00	0	G	NM_003700		6913663	6913663	-1	no_errors	ENST00000299459	ensembl	human	known	69_37n	silent	97	32.17	46	SNP	0.019	A
PIK3CA	5290	genome.wustl.edu	37	3	178952090	178952090	+	Missense_Mutation	SNP	G	G	C	rs121913277		TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr3:178952090G>C	ENST00000263967.3	+	21	3302	c.3145G>C	c.(3145-3147)Ggt>Cgt	p.G1049R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1049	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		G -> S (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.G1049R(27)|p.G1049S(13)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGCACATCATGGTGGCTGGAC	0.378		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	40	Substitution - Missense(40)	breast(12)|endometrium(7)|lung(4)|thyroid(3)|large_intestine(3)|central_nervous_system(3)|upper_aerodigestive_tract(2)|urinary_tract(2)|kidney(2)|ovary(1)|pancreas(1)											98.0	88.0	91.0					3																	178952090		1919	4132	6051	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3145G>C	3.37:g.178952090G>C	ENSP00000263967:p.Gly1049Arg		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.G1049R	ENST00000263967.3	37	c.3145	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	11.63	1.697316	0.30142	.	.	ENSG00000121879	ENST00000263967	T	0.80824	-1.42	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.78084	0.4228	L	0.48642	1.525	0.80722	D	1	B	0.30914	0.3	B	0.28916	0.096	T	0.73668	-0.3910	10	0.41790	T	0.15	-16.0151	20.6721	0.99693	0.0:0.0:1.0:0.0	.	1049	P42336	PK3CA_HUMAN	R	1049	ENSP00000263967:G1049R	ENSP00000263967:G1049R	G	+	1	0	PIK3CA	180434784	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.367000	0.97148	2.894000	0.99253	0.591000	0.81541	GGT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	152	0.00	0	G			178952090	178952090	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	88	20.72	23	SNP	1.000	C
PPP6R1	22870	genome.wustl.edu	37	19	55753591	55753591	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr19:55753591G>T	ENST00000412770.2	-	7	1354	c.788C>A	c.(787-789)tCt>tAt	p.S263Y	PPP6R1_ENST00000587283.1_Missense_Mutation_p.S263Y	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	263	Interaction with PPP6C.				regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						GACGATGACAGACTGGCTCTG	0.657																																						dbGAP											0													152.0	159.0	157.0					19																	55753591		2117	4238	6355	-	-	-	SO:0001583	missense	0			AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.788C>A	19.37:g.55753591G>T	ENSP00000414202:p.Ser263Tyr		Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Missense_Mutation	SNP	pfam_SAPS,superfamily_ARM-type_fold	p.S263Y	ENST00000412770.2	37	c.788	CCDS46186.1	19	.	.	.	.	.	.	.	.	.	.	G	19.46	3.832042	0.71258	.	.	ENSG00000105063	ENST00000412770	T	0.55930	0.49	5.17	5.17	0.71159	.	0.000000	0.48767	D	0.000176	T	0.76040	0.3932	M	0.84585	2.705	0.47778	D	0.999512	D	0.76494	0.999	D	0.79108	0.992	T	0.79862	-0.1624	10	0.66056	D	0.02	-14.5659	17.8221	0.88653	0.0:0.0:1.0:0.0	.	263	Q9UPN7	PP6R1_HUMAN	Y	263	ENSP00000414202:S263Y	ENSP00000414202:S263Y	S	-	2	0	PPP6R1	60445403	0.983000	0.35010	0.011000	0.14972	0.728000	0.41692	4.452000	0.60054	2.582000	0.87167	0.555000	0.69702	TCT	PPP6R1	-	pfam_SAPS,superfamily_ARM-type_fold	ENSG00000105063		0.657	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP6R1	HGNC	protein_coding	OTTHUMT00000452663.1	316	0.00	0	G	NM_014931		55753591	55753591	-1	no_errors	ENST00000412770	ensembl	human	known	69_37n	missense	182	14.15	30	SNP	0.979	T
PRRT3	285368	genome.wustl.edu	37	3	9990556	9990556	+	Missense_Mutation	SNP	G	G	A	rs569295912		TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr3:9990556G>A	ENST00000412055.1	-	3	1186	c.1057C>T	c.(1057-1059)Cgg>Tgg	p.R353W	PRRT3-AS1_ENST00000431558.1_RNA|PRRT3_ENST00000411976.2_Missense_Mutation_p.R353W	NM_207351.3	NP_997234.3	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3	353	Pro-rich.					integral component of membrane (GO:0016021)				NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)|stomach(2)	13						CCTCTCACCCGCTGGGGGGAG	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		16833	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													58.0	64.0	62.0					3																	9990556		1928	4136	6064	-	-	-	SO:0001583	missense	0			AK090993	CCDS43049.1	3p25.3	2011-10-10			ENSG00000163704	ENSG00000163704		"""Proline-rich transmembrane proteins"""	26591	protein-coding gene	gene with protein product							Standard	NM_207351		Approved	FLJ33674	uc003bul.2	Q5FWE3	OTTHUMG00000155285	ENST00000412055.1:c.1057C>T	3.37:g.9990556G>A	ENSP00000392511:p.Arg353Trp		Q49AD0|Q6UXY6|Q8NBC9	Missense_Mutation	SNP	NULL	p.R353W	ENST00000412055.1	37	c.1057	CCDS43049.1	3	.	.	.	.	.	.	.	.	.	.	G	19.80	3.895543	0.72639	.	.	ENSG00000163704	ENST00000412055;ENST00000411976	T;T	0.34472	1.62;1.36	5.17	4.28	0.50868	.	0.000000	0.50627	D	0.000103	T	0.46795	0.1411	L	0.36672	1.1	0.36155	D	0.847731	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.52616	-0.8552	9	.	.	.	-10.5905	11.0286	0.47759	0.0:0.0:0.8138:0.1862	.	353;353	Q5FWE3-3;Q5FWE3	.;PRRT3_HUMAN	W	353	ENSP00000392511:R353W;ENSP00000404512:R353W	.	R	-	1	2	PRRT3	9965556	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	1.681000	0.37618	1.139000	0.42245	0.655000	0.94253	CGG	PRRT3	-	NULL	ENSG00000163704		0.592	PRRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT3	HGNC	protein_coding	OTTHUMT00000339322.1	75	0.00	0	G	NM_207351		9990556	9990556	-1	no_errors	ENST00000295984	ensembl	human	known	69_37n	missense	44	63.41	78	SNP	1.000	A
RNF213	57674	genome.wustl.edu	37	17	78360175	78360175	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr17:78360175C>T	ENST00000582970.1	+	62	14808	c.14665C>T	c.(14665-14667)Cgc>Tgc	p.R4889C	RNF213_ENST00000427003.3_3'UTR|CTD-2047H16.4_ENST00000572151.1_RNA|CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.R2962C|RNF213_ENST00000508628.2_Missense_Mutation_p.R4938C|CTD-2047H16.4_ENST00000573394.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4889					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CTACTTGATTCGCCTACACAA	0.552																																						dbGAP											0													117.0	103.0	108.0					17																	78360175		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.14665C>T	17.37:g.78360175C>T	ENSP00000464087:p.Arg4889Cys		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.R4889C	ENST00000582970.1	37	c.14665	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	C	9.967	1.224489	0.22457	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301;ENST00000427003	T;T	0.29397	1.57;1.9	5.18	-1.82	0.07857	.	2.020920	0.01889	N	0.038400	T	0.15652	0.0377	N	0.14661	0.345	0.09310	N	1	P	0.47762	0.9	B	0.33799	0.17	T	0.29150	-1.0021	10	0.59425	D	0.04	.	6.5274	0.22309	0.1658:0.5222:0.312:0.0	.	2962	Q63HN8	RN213_HUMAN	C	4889;4938;2962;239	ENSP00000425956:R4889C;ENSP00000338218:R2962C	ENSP00000338218:R2962C	R	+	1	0	RNF213	75974770	0.000000	0.05858	0.001000	0.08648	0.249000	0.25844	-0.195000	0.09546	-0.265000	0.09352	-0.410000	0.06199	CGC	RNF213	-	NULL	ENSG00000173821		0.552	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	185	0.00	0	C	NM_020914		78360175	78360175	+1	no_errors	ENST00000582970	ensembl	human	known	69_37n	missense	62	40.95	43	SNP	0.001	T
RP1	6101	genome.wustl.edu	37	8	55540804	55540804	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr8:55540804C>A	ENST00000220676.1	+	4	4510	c.4362C>A	c.(4360-4362)agC>agA	p.S1454R		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1454					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TAACCAACAGCATGACATCAA	0.358																																					Colon(91;1014 1389 7634 14542 40420)	dbGAP											0													55.0	58.0	57.0					8																	55540804		2200	4300	6500	-	-	-	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.4362C>A	8.37:g.55540804C>A	ENSP00000220676:p.Ser1454Arg			Missense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.S1454R	ENST00000220676.1	37	c.4362	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	10.01	1.233665	0.22626	.	.	ENSG00000104237	ENST00000220676	T	0.71817	-0.6	5.48	1.66	0.24008	.	0.090774	0.48286	D	0.000192	T	0.78604	0.4309	M	0.68952	2.095	0.26370	N	0.976904	D	0.89917	1.0	D	0.70227	0.968	T	0.68922	-0.5281	10	0.87932	D	0	-3.6645	8.5559	0.33480	0.0:0.6018:0.0:0.3982	.	1454	P56715	RP1_HUMAN	R	1454	ENSP00000220676:S1454R	ENSP00000220676:S1454R	S	+	3	2	RP1	55703357	0.000000	0.05858	0.130000	0.21974	0.186000	0.23388	-0.930000	0.03972	0.269000	0.21961	-0.140000	0.14226	AGC	RP1	-	NULL	ENSG00000104237		0.358	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	54	0.00	0	C	NM_006269		55540804	55540804	+1	no_errors	ENST00000220676	ensembl	human	known	69_37n	missense	26	42.22	19	SNP	0.848	A
RPS6KA6	27330	genome.wustl.edu	37	X	83411145	83411145	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chrX:83411145C>T	ENST00000262752.2	-	3	203	c.196G>A	c.(196-198)Gag>Aag	p.E66K	RPS6KA6_ENST00000543399.1_Missense_Mutation_p.E66K	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	66					axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						TCTGCTTTCTCATAGCCTTCC	0.363																																						dbGAP											0													100.0	83.0	88.0					X																	83411145		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.196G>A	X.37:g.83411145C>T	ENSP00000262752:p.Glu66Lys		B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	p.E66K	ENST00000262752.2	37	c.196	CCDS14451.1	X	.	.	.	.	.	.	.	.	.	.	C	22.8	4.340237	0.81911	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.70164	-0.46;-0.45	5.42	5.42	0.78866	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.70202	0.3197	M	0.75085	2.285	0.80722	D	1	B;B	0.24823	0.112;0.112	B;B	0.27715	0.082;0.038	T	0.70517	-0.4850	10	0.66056	D	0.02	.	17.8151	0.88630	0.0:1.0:0.0:0.0	.	66;66	B7ZL90;Q9UK32	.;KS6A6_HUMAN	K	66	ENSP00000262752:E66K;ENSP00000440830:E66K	ENSP00000262752:E66K	E	-	1	0	RPS6KA6	83297801	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.263000	0.78421	2.239000	0.73571	0.513000	0.50165	GAG	RPS6KA6	-	superfamily_Kinase-like_dom,pirsf_Ribosomal_S6_kinase_II	ENSG00000072133		0.363	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA6	HGNC	protein_coding	OTTHUMT00000057372.1	216	0.00	0	C	NM_014496		83411145	83411145	-1	no_errors	ENST00000262752	ensembl	human	known	69_37n	missense	86	41.50	61	SNP	1.000	T
RTN4	57142	genome.wustl.edu	37	2	55214629	55214629	+	Silent	SNP	G	G	A			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr2:55214629G>A	ENST00000337526.6	-	4	3462	c.3219C>T	c.(3217-3219)ttC>ttT	p.F1073F	RTN4_ENST00000357732.4_Silent_p.F273F|RTN4_ENST00000404909.1_Silent_p.F867F|RTN4_ENST00000405240.1_Silent_p.F867F|RTN4_ENST00000354474.6_Silent_p.F841F|RTN4_ENST00000394611.2_Silent_p.F867F|RTN4_ENST00000357376.3_Silent_p.F867F|RTN4_ENST00000394609.2_Silent_p.F80F|RTN4_ENST00000402434.2_Silent_p.F226F|RTN4_ENST00000317610.7_Silent_p.F254F|RTN4_ENST00000486085.1_5'UTR	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	1073	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						CATCTCACCTGAATGGGTGGC	0.438																																						dbGAP											0													137.0	117.0	124.0					2																	55214629		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.3219C>T	2.37:g.55214629G>A			O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Nonsense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.Q97*	ENST00000337526.6	37	c.289	CCDS42684.1	2	.	.	.	.	.	.	.	.	.	.	G	15.27	2.783311	0.49891	.	.	ENSG00000115310	ENST00000438462	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.3845	14.8642	0.70401	0.0709:0.0:0.9291:0.0	.	.	.	.	X	97	.	.	Q	-	1	0	RTN4	55068133	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.816000	0.55658	2.637000	0.89404	0.650000	0.86243	CAG	RTN4	-	pfam_Reticulon,pfscan_Reticulon	ENSG00000115310		0.438	RTN4-001	KNOWN	basic|CCDS	protein_coding	RTN4	HGNC	protein_coding	OTTHUMT00000251484.1	304	0.00	0	G			55214629	55214629	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000438462	ensembl	human	putative	69_37n	nonsense	85	36.09	48	SNP	1.000	A
RUNX1	861	genome.wustl.edu	37	21	36252994	36252995	+	Frame_Shift_Ins	INS	-	-	C	rs373498347		TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr21:36252994_36252995insC	ENST00000344691.4	-	2	1863_1864	c.286_287insG	c.(286-288)gatfs	p.D96fs	RUNX1_ENST00000300305.3_Frame_Shift_Ins_p.D123fs|RUNX1_ENST00000325074.5_Frame_Shift_Ins_p.D111fs|RUNX1_ENST00000486278.2_Frame_Shift_Ins_p.D99fs|RUNX1_ENST00000399240.1_Frame_Shift_Ins_p.D96fs|RUNX1_ENST00000358356.5_Frame_Shift_Ins_p.D96fs|RUNX1_ENST00000437180.1_Frame_Shift_Ins_p.D123fs	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	96	Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						ATCTGGAACATCCCCTAGGGCC	0.46			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																	dbGAP		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	0			GRCh37	CM086911	RUNX1	M																																				-	-	-	SO:0001589	frameshift_variant	0			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.287dupG	21.37:g.36252998_36252998dupC	ENSP00000340690:p.Asp96fs		A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Frame_Shift_Ins	INS	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	p.D123fs	ENST00000344691.4	37	c.368_367	CCDS42922.1	21																																																																																			RUNX1	-	pfam_AML1/Runt_N,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	ENSG00000159216		0.460	RUNX1-001	KNOWN	basic|CCDS	protein_coding	RUNX1	HGNC	protein_coding	OTTHUMT00000194230.1	304	0.00	0	-			36252994	36252995	-1	no_errors	ENST00000300305	ensembl	human	known	69_37n	frame_shift_ins	286	29.38	119	INS	0.999:1.000	C
RYR2	6262	genome.wustl.edu	37	1	237711763	237711763	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr1:237711763C>A	ENST00000366574.2	+	26	3256	c.2939C>A	c.(2938-2940)cCt>cAt	p.P980H	RYR2_ENST00000542537.1_Missense_Mutation_p.P964H|RYR2_ENST00000360064.6_Missense_Mutation_p.P978H	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	980	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAGCCTGCCCCTATGGACCTG	0.423																																						dbGAP											0													56.0	53.0	54.0					1																	237711763		1900	4112	6012	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2939C>A	1.37:g.237711763C>A	ENSP00000355533:p.Pro980His		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.P978H	ENST00000366574.2	37	c.2933	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.929554	0.92389	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.95482	-3.72;-3.72;-3.72	5.81	5.81	0.92471	Ryanodine receptor Ryr (1);	0.000000	0.64402	D	0.000005	D	0.98359	0.9455	M	0.93550	3.43	0.80722	D	1	D	0.64830	0.994	D	0.65684	0.937	D	0.98894	1.0774	10	0.87932	D	0	.	20.0804	0.97772	0.0:1.0:0.0:0.0	.	980	Q92736	RYR2_HUMAN	H	980;978;964	ENSP00000355533:P980H;ENSP00000353174:P978H;ENSP00000443798:P964H	ENSP00000353174:P978H	P	+	2	0	RYR2	235778386	1.000000	0.71417	0.976000	0.42696	0.991000	0.79684	7.645000	0.83430	2.738000	0.93877	0.655000	0.94253	CCT	RYR2	-	pfam_Ryanodine_rcpt	ENSG00000198626		0.423	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	188	0.00	0	C	NM_001035		237711763	237711763	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	111	27.45	42	SNP	1.000	A
SCFD2	152579	genome.wustl.edu	37	4	54231342	54231342	+	Missense_Mutation	SNP	G	G	C	rs147960965		TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr4:54231342G>C	ENST00000401642.3	-	1	900	c.767C>G	c.(766-768)gCa>gGa	p.A256G	SCFD2_ENST00000388940.4_Missense_Mutation_p.A256G	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	256					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)					breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CCTGTTCTTTGCAGGGGCATA	0.493																																						dbGAP											0													131.0	125.0	127.0					4																	54231342		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.767C>G	4.37:g.54231342G>C	ENSP00000384182:p.Ala256Gly		Q8N5F3|Q8N8H0|Q96ED3	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.A256G	ENST00000401642.3	37	c.767	CCDS33984.1	4	.	.	.	.	.	.	.	.	.	.	G	14.85	2.659924	0.47572	.	.	ENSG00000184178	ENST00000401642;ENST00000388940	T;T	0.79940	-1.32;-1.32	5.03	4.19	0.49359	.	0.000000	0.85682	D	0.000000	D	0.85745	0.5768	M	0.77820	2.39	0.58432	D	0.99999	D;D	0.59767	0.986;0.976	P;P	0.55713	0.782;0.609	D	0.87043	0.2142	10	0.72032	D	0.01	.	11.1936	0.48700	0.0887:0.0:0.9113:0.0	.	256;256	Q8WU76-2;Q8WU76	.;SCFD2_HUMAN	G	256	ENSP00000384182:A256G;ENSP00000373592:A256G	ENSP00000373592:A256G	A	-	2	0	SCFD2	53926099	1.000000	0.71417	1.000000	0.80357	0.040000	0.13550	7.013000	0.76373	1.367000	0.46095	0.462000	0.41574	GCA	SCFD2	-	NULL	ENSG00000184178		0.493	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCFD2	HGNC	protein_coding	OTTHUMT00000361311.3	221	0.00	0	G	NM_152540		54231342	54231342	-1	no_errors	ENST00000401642	ensembl	human	known	69_37n	missense	66	42.74	50	SNP	1.000	C
SF3B4	10262	genome.wustl.edu	37	1	149895759	149895759	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr1:149895759C>A	ENST00000271628.8	-	5	1645	c.1061G>T	c.(1060-1062)cGa>cTa	p.R354L		NM_005850.4	NP_005841.1	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4, 49kDa	354					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R354fs*>72(1)		endometrium(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)	17	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			TGGAGGCCCTCGGGGGGGCAT	0.627																																						dbGAP											1	Insertion - Frameshift(1)	ovary(1)											16.0	17.0	16.0					1																	149895759		2202	4298	6500	-	-	-	SO:0001583	missense	0			L35013	CCDS72900.1	1q21.2	2013-02-12	2002-08-29		ENSG00000143368	ENSG00000143368		"""RNA binding motif (RRM) containing"""	10771	protein-coding gene	gene with protein product		605593	"""splicing factor 3b, subunit 4, 49kD"""			7958871	Standard	NM_005850		Approved	SAP49, SF3b49, Hsh49	uc001etk.2	Q15427	OTTHUMG00000012208	ENST00000271628.8:c.1061G>T	1.37:g.149895759C>A	ENSP00000271628:p.Arg354Leu		Q5SZ63	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R354L	ENST00000271628.8	37	c.1061	CCDS941.1	1	.	.	.	.	.	.	.	.	.	.	C	18.42	3.619074	0.66787	.	.	ENSG00000143368	ENST00000271628	T	0.23950	1.88	4.96	4.96	0.65561	.	0.101735	0.64402	D	0.000003	T	0.11707	0.0285	L	0.36672	1.1	0.58432	D	0.999999	B	0.33940	0.433	B	0.23716	0.048	T	0.04373	-1.0956	10	0.54805	T	0.06	.	16.9551	0.86257	0.0:1.0:0.0:0.0	.	354	Q15427	SF3B4_HUMAN	L	354	ENSP00000271628:R354L	ENSP00000271628:R354L	R	-	2	0	SF3B4	148162383	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.881000	0.63114	2.577000	0.86979	0.655000	0.94253	CGA	SF3B4	-	NULL	ENSG00000143368		0.627	SF3B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B4	HGNC	protein_coding	OTTHUMT00000033753.1	75	0.00	0	C	NM_005850		149895759	149895759	-1	no_errors	ENST00000271628	ensembl	human	known	69_37n	missense	33	32.00	16	SNP	1.000	A
SLC6A13	6540	genome.wustl.edu	37	12	352926	352926	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr12:352926A>T	ENST00000343164.4	-	3	308	c.256T>A	c.(256-258)Ttc>Atc	p.F86I	SLC6A13_ENST00000445055.2_Intron	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	86					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			TCCAGAAGGAAGACAGGAATG	0.527																																						dbGAP											0													107.0	94.0	98.0					12																	352926		2203	4300	6503	-	-	-	SO:0001583	missense	0			U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.256T>A	12.37:g.352926A>T	ENSP00000339260:p.Phe86Ile		B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_GABA_GAT2	p.F86I	ENST00000343164.4	37	c.256	CCDS8502.1	12	.	.	.	.	.	.	.	.	.	.	A	35	5.535433	0.96460	.	.	ENSG00000010379	ENST00000313154;ENST00000343164	T	0.79940	-1.32	6.17	6.17	0.99709	.	0.041576	0.85682	D	0.000000	D	0.91918	0.7441	M	0.91300	3.195	0.80722	D	1	D;D	0.71674	0.994;0.998	D;D	0.78314	0.991;0.991	D	0.93396	0.6756	10	0.87932	D	0	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	65;86	B4DJS3;Q9NSD5	.;S6A13_HUMAN	I	65;86	ENSP00000339260:F86I	ENSP00000318097:F65I	F	-	1	0	SLC6A13	223187	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.323000	0.96364	2.371000	0.80710	0.533000	0.62120	TTC	SLC6A13	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	ENSG00000010379		0.527	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A13	HGNC	protein_coding	OTTHUMT00000397801.1	242	0.00	0	A	NM_016615		352926	352926	-1	no_errors	ENST00000343164	ensembl	human	known	69_37n	missense	67	32.32	32	SNP	1.000	T
SVEP1	79987	genome.wustl.edu	37	9	113192280	113192280	+	Silent	SNP	A	A	C			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr9:113192280A>C	ENST00000401783.2	-	34	5871	c.5535T>G	c.(5533-5535)gtT>gtG	p.V1845V	SVEP1_ENST00000297826.5_5'Flank|SVEP1_ENST00000374469.1_Silent_p.V1822V	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	1845	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TACCACATGAAACAGCTTAAC	0.348																																						dbGAP											0													85.0	77.0	80.0					9																	113192280		1847	4097	5944	-	-	-	SO:0001819	synonymous_variant	0			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.5535T>G	9.37:g.113192280A>C			Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Growth_fac_rcpt,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.V1845	ENST00000401783.2	37	c.5535	CCDS48004.1	9																																																																																			SVEP1	-	superfamily_Complement_control_module,pfscan_Sushi_SCR_CCP	ENSG00000165124		0.348	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	HGNC	protein_coding		168	0.00	0	A			113192280	113192280	-1	no_errors	ENST00000401783	ensembl	human	known	69_37n	silent	101	32.67	49	SNP	0.994	C
TBP	6908	genome.wustl.edu	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000230354.6_Silent_p.Q76Q|TBP_ENST00000540980.1_Silent_p.Q56Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																						dbGAP											4	Substitution - coding silent(4)	lung(3)|prostate(1)											14.0	19.0	17.0					6																	170871052		1952	3842	5794	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A			B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q76	ENST00000392092.2	37	c.228	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	44	0.00	0	G	NM_003194		170871052	170871052	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	44	16.98	9	SNP	0.994	A
TCEAL2	140597	genome.wustl.edu	37	X	101382274	101382274	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chrX:101382274C>A	ENST00000372780.1	+	3	691	c.472C>A	c.(472-474)Cat>Aat	p.H158N	TCEAL2_ENST00000329035.2_Missense_Mutation_p.H158N	NM_080390.3	NP_525129.1	Q9H3H9	TCAL2_HUMAN	transcription elongation factor A (SII)-like 2	158					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11						GGAAGCCATACATGATATGAA	0.438																																						dbGAP											0													127.0	123.0	124.0					X																	101382274		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF325115	CCDS14496.1	Xq22.1-q22.3	2014-03-21			ENSG00000184905	ENSG00000184905			29818	protein-coding gene	gene with protein product						16221301	Standard	NM_080390		Approved	my048, MY0876G05, WEX1	uc004eip.3	Q9H3H9	OTTHUMG00000022048	ENST00000372780.1:c.472C>A	X.37:g.101382274C>A	ENSP00000361866:p.His158Asn		B2R5C7	Missense_Mutation	SNP	pfam_TF_A-like/BEX-like	p.H158N	ENST00000372780.1	37	c.472	CCDS14496.1	X	.	.	.	.	.	.	.	.	.	.	C	16.72	3.201492	0.58234	.	.	ENSG00000184905	ENST00000372780;ENST00000329035	T;T	0.10573	2.86;2.86	3.17	3.17	0.36434	.	0.000000	0.48767	D	0.000167	T	0.19886	0.0478	M	0.65975	2.015	0.09310	N	1	P	0.51791	0.948	P	0.54372	0.75	T	0.02345	-1.1173	10	0.39692	T	0.17	.	8.9691	0.35894	0.0:1.0:0.0:0.0	.	158	Q9H3H9	TCAL2_HUMAN	N	158	ENSP00000361866:H158N;ENSP00000332359:H158N	ENSP00000332359:H158N	H	+	1	0	TCEAL2	101268930	0.818000	0.29161	0.034000	0.17996	0.773000	0.43773	2.656000	0.46716	1.851000	0.53745	0.594000	0.82650	CAT	TCEAL2	-	pfam_TF_A-like/BEX-like	ENSG00000184905		0.438	TCEAL2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEAL2	HGNC	protein_coding	OTTHUMT00000057605.1	166	0.00	0	C	NM_080390		101382274	101382274	+1	no_errors	ENST00000329035	ensembl	human	known	69_37n	missense	99	25.56	34	SNP	0.034	A
TP53	7157	genome.wustl.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	GRCh37	CM941329	TP53	M							102.0	91.0	94.0					17																	7578263		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R196*	ENST00000269305.4	37	c.586	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	265	0.00	0	G	NM_000546		7578263	7578263	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	72	53.85	84	SNP	1.000	A
TSTD1	100131187	genome.wustl.edu	37	1	161008416	161008416	+	Silent	SNP	G	G	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr1:161008416G>T	ENST00000423014.2	-	2	158	c.58C>A	c.(58-60)Cgg>Agg	p.R20R	TSTD1_ENST00000368023.3_Silent_p.R27R|TSTD1_ENST00000368024.1_Intron|TSTD1_ENST00000466967.1_5'UTR|TSTD1_ENST00000318289.10_Silent_p.R20R|F11R_ENST00000289779.3_Intron	NM_001113205.1|NM_001113207.1	NP_001106676.1|NP_001106678.1	Q8NFU3	TSTD1_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 1	20	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.					cytoplasm (GO:0005737)											AGCCGGGCCCGTCCGGAGGCT	0.687																																						dbGAP											0													12.0	17.0	15.0					1																	161008416		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS44257.1, CCDS44258.1, CCDS53400.1	1q23.3	2009-09-02			ENSG00000215845	ENSG00000215845			35410	protein-coding gene	gene with protein product						12817473	Standard	NM_001113205		Approved	KAT		Q8NFU3	OTTHUMG00000031476	ENST00000423014.2:c.58C>A	1.37:g.161008416G>T			Q5SY48|Q5SY49|Q5SY50|Q5SY51|Q8NFU2|Q9BV22	Silent	SNP	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	p.R27	ENST00000423014.2	37	c.79	CCDS53400.1	1																																																																																			TSTD1	-	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	ENSG00000215845		0.687	TSTD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TSTD1	HGNC	protein_coding	OTTHUMT00000077078.2	37	0.00	0	G	NM_001113207		161008416	161008416	-1	no_errors	ENST00000368023	ensembl	human	known	69_37n	silent	51	23.53	16	SNP	0.929	T
USH2A	7399	genome.wustl.edu	37	1	216348792	216348792	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr1:216348792C>T	ENST00000307340.3	-	21	4815	c.4429G>A	c.(4429-4431)Gga>Aga	p.G1477R	USH2A_ENST00000366943.2_Missense_Mutation_p.G1477R|USH2A_ENST00000366942.3_Missense_Mutation_p.G1477R	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1477					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTGTTGATTCCTTTAACCAGA	0.413										HNSCC(13;0.011)																												dbGAP											0													128.0	117.0	121.0					1																	216348792		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.4429G>A	1.37:g.216348792C>T	ENSP00000305941:p.Gly1477Arg		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.G1477R	ENST00000307340.3	37	c.4429	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	11.35	1.612267	0.28712	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.53206	0.63;0.63;0.63	5.38	4.47	0.54385	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.349463	0.20377	N	0.093533	T	0.39572	0.1083	L	0.41236	1.265	0.09310	N	0.999999	B;B	0.31548	0.178;0.328	B;B	0.31547	0.132;0.101	T	0.18335	-1.0340	10	0.25751	T	0.34	.	14.2202	0.65820	0.0:0.9276:0.0:0.0724	.	1477;1477	O75445-2;O75445	.;USH2A_HUMAN	R	1477	ENSP00000305941:G1477R;ENSP00000355910:G1477R;ENSP00000355909:G1477R	ENSP00000305941:G1477R	G	-	1	0	USH2A	214415415	0.865000	0.29922	0.005000	0.12908	0.389000	0.30415	2.718000	0.47236	1.246000	0.43901	0.544000	0.68410	GGA	USH2A	-	superfamily_Fibronectin_type3	ENSG00000042781		0.413	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	335	0.00	0	C	NM_007123		216348792	216348792	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	191	30.55	84	SNP	0.120	T
VRK3	51231	genome.wustl.edu	37	19	50482398	50482398	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr19:50482398G>T	ENST00000599538.1	-	14	2042	c.1378C>A	c.(1378-1380)Ctg>Atg	p.L460M	VRK3_ENST00000316763.3_Missense_Mutation_p.L460M|VRK3_ENST00000601341.1_Missense_Mutation_p.L410M|VRK3_ENST00000377011.2_Missense_Mutation_p.L410M|VRK3_ENST00000443401.2_Missense_Mutation_p.L229M|VRK3_ENST00000594948.1_Missense_Mutation_p.L460M			Q8IV63	VRK3_HUMAN	vaccinia related kinase 3	460					negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)|stomach(2)|urinary_tract(1)	23		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		GACACACGCAGATCCTGCAGC	0.577																																					Pancreas(6;90 181 4352 12603 17050 34726 35237 44094)	dbGAP											0													171.0	136.0	148.0					19																	50482398		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB031052	CCDS12791.1, CCDS33076.1	19q13.33	2011-01-14			ENSG00000105053	ENSG00000105053			18996	protein-coding gene	gene with protein product							Standard	XM_005258971		Approved		uc002prh.1	Q8IV63		ENST00000599538.1:c.1378C>A	19.37:g.50482398G>T	ENSP00000469880:p.Leu460Met		A6NEG5|A8KA53|Q502Y2|Q9P2V8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.L460M	ENST00000599538.1	37	c.1378	CCDS12791.1	19	.	.	.	.	.	.	.	.	.	.	G	4.589	0.109382	0.08780	.	.	ENSG00000105053	ENST00000316763;ENST00000377011;ENST00000443401	T;T;T	0.21734	1.99;1.99;1.99	4.82	1.31	0.21738	Protein kinase-like domain (1);	0.513028	0.19446	N	0.114053	T	0.10895	0.0266	N	0.24115	0.695	0.09310	N	1	B;B;B	0.20368	0.027;0.044;0.044	B;B;B	0.19148	0.024;0.02;0.02	T	0.32508	-0.9904	10	0.19147	T	0.46	-2.1937	5.5039	0.16844	0.0975:0.0:0.5417:0.3608	.	229;410;460	B4DGW1;A6NEG5;Q8IV63	.;.;VRK3_HUMAN	M	460;410;229	ENSP00000324636:L460M;ENSP00000366210:L410M;ENSP00000414907:L229M	ENSP00000324636:L460M	L	-	1	2	VRK3	55174210	0.001000	0.12720	0.156000	0.22583	0.194000	0.23727	0.364000	0.20325	0.134000	0.18681	0.561000	0.74099	CTG	VRK3	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom	ENSG00000105053		0.577	VRK3-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	VRK3	HGNC	protein_coding	OTTHUMT00000464815.1	310	0.32	1	G	NM_016440		50482398	50482398	-1	no_errors	ENST00000316763	ensembl	human	known	69_37n	missense	113	38.59	71	SNP	0.003	T
WWP2	11060	genome.wustl.edu	37	16	69971470	69971470	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr16:69971470A>T	ENST00000359154.2	+	21	2359	c.2258A>T	c.(2257-2259)cAg>cTg	p.Q753L	WWP2_ENST00000568684.1_Missense_Mutation_p.Q314L|WWP2_ENST00000542271.1_Missense_Mutation_p.Q637L|WWP2_ENST00000544162.1_3'UTR|WWP2_ENST00000448661.1_Missense_Mutation_p.Q753L|WWP2_ENST00000356003.2_Missense_Mutation_p.Q753L	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	753	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TGCGGCATGCAGGAGATAGAC	0.617																																						dbGAP											0													92.0	77.0	82.0					16																	69971470		2198	4300	6498	-	-	-	SO:0001583	missense	0			BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.2258A>T	16.37:g.69971470A>T	ENSP00000352069:p.Gln753Leu		A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_WW_Rsp5_WWP	p.Q753L	ENST00000359154.2	37	c.2258	CCDS10885.1	16	.	.	.	.	.	.	.	.	.	.	A	29.2	4.984957	0.93044	.	.	ENSG00000198373	ENST00000359154;ENST00000545099;ENST00000448661;ENST00000356003;ENST00000544162;ENST00000542271	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.42	5.42	0.78866	HECT (4);	0.000000	0.85682	D	0.000000	T	0.63757	0.2538	M	0.70842	2.15	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.64786	-0.6325	9	.	.	.	.	15.4811	0.75528	1.0:0.0:0.0:0.0	.	753	O00308	WWP2_HUMAN	L	753;314;753;753;640;637	ENSP00000352069:Q753L;ENSP00000396871:Q753L;ENSP00000348283:Q753L;ENSP00000445616:Q637L	.	Q	+	2	0	WWP2	68528971	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.339000	0.96797	2.064000	0.61679	0.459000	0.35465	CAG	WWP2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000198373		0.617	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWP2	HGNC	protein_coding	OTTHUMT00000268954.1	140	0.00	0	A	NM_007014		69971470	69971470	+1	no_errors	ENST00000356003	ensembl	human	known	69_37n	missense	51	37.80	31	SNP	1.000	T
ZNF160	90338	genome.wustl.edu	37	19	53571578	53571578	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr19:53571578C>T	ENST00000429604.1	-	7	2624	c.2209G>A	c.(2209-2211)Gaa>Aaa	p.E737K	ZNF160_ENST00000599056.1_Missense_Mutation_p.E737K|ZNF160_ENST00000601421.1_Missense_Mutation_p.E701K|ZNF160_ENST00000418871.1_Missense_Mutation_p.E737K	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	737					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		TTGCCACATTCATTACATTTG	0.448																																						dbGAP											0													136.0	131.0	133.0					19																	53571578		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.2209G>A	19.37:g.53571578C>T	ENSP00000406201:p.Glu737Lys		Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E737K	ENST00000429604.1	37	c.2209	CCDS12859.1	19	.	.	.	.	.	.	.	.	.	.	C	10.93	1.488866	0.26686	.	.	ENSG00000170949	ENST00000429604;ENST00000418871	T;T	0.07327	3.2;3.2	2.47	-3.77	0.04346	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05181	0.0138	N	0.21545	0.675	0.09310	N	1	P	0.47106	0.89	B	0.44085	0.44	T	0.25363	-1.0134	9	0.52906	T	0.07	.	2.1309	0.03750	0.1502:0.4857:0.1482:0.2159	.	737	Q9HCG1	ZN160_HUMAN	K	737	ENSP00000406201:E737K;ENSP00000409597:E737K	ENSP00000409597:E737K	E	-	1	0	ZNF160	58263390	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	-1.466000	0.02355	-0.388000	0.07797	-0.258000	0.10820	GAA	ZNF160	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000170949		0.448	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF160	HGNC	protein_coding	OTTHUMT00000463994.2	266	0.00	0	C	NM_033288		53571578	53571578	-1	no_errors	ENST00000418871	ensembl	human	known	69_37n	missense	56	71.43	140	SNP	0.001	T
ZNF160	90338	genome.wustl.edu	37	19	53573463	53573463	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr19:53573463A>C	ENST00000429604.1	-	7	739	c.324T>G	c.(322-324)agT>agG	p.S108R	ZNF160_ENST00000599056.1_Missense_Mutation_p.S108R|ZNF160_ENST00000601421.1_Missense_Mutation_p.S72R|ZNF160_ENST00000418871.1_Missense_Mutation_p.S108R	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	108					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		CTGCTTCTGTACTGCTCTTCT	0.373																																						dbGAP											0													98.0	94.0	96.0					19																	53573463		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.324T>G	19.37:g.53573463A>C	ENSP00000406201:p.Ser108Arg		Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S108R	ENST00000429604.1	37	c.324	CCDS12859.1	19	.	.	.	.	.	.	.	.	.	.	A	11.37	1.618720	0.28801	.	.	ENSG00000170949	ENST00000429604;ENST00000418871	T;T	0.07021	3.23;3.23	2.39	2.39	0.29439	.	.	.	.	.	T	0.04318	0.0119	N	0.14661	0.345	0.09310	N	1	B	0.29432	0.244	B	0.19666	0.026	T	0.43015	-0.9417	9	0.19590	T	0.45	.	7.9177	0.29827	1.0:0.0:0.0:0.0	.	108	Q9HCG1	ZN160_HUMAN	R	108	ENSP00000406201:S108R;ENSP00000409597:S108R	ENSP00000409597:S108R	S	-	3	2	ZNF160	58265275	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	0.081000	0.14823	1.084000	0.41184	0.459000	0.35465	AGT	ZNF160	-	NULL	ENSG00000170949		0.373	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF160	HGNC	protein_coding	OTTHUMT00000463994.2	263	0.00	0	A	NM_033288		53573463	53573463	-1	no_errors	ENST00000418871	ensembl	human	known	69_37n	missense	63	73.86	178	SNP	0.001	C
ZNF335	63925	genome.wustl.edu	37	20	44596988	44596988	+	Silent	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr20:44596988C>T	ENST00000322927.2	-	4	556	c.456G>A	c.(454-456)gtG>gtA	p.V152V	ZNF335_ENST00000426788.1_Intron|ZNF335_ENST00000494955.1_5'UTR	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	152					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				CAGCACTGGTCACAGTGATGC	0.642																																						dbGAP											0													124.0	109.0	114.0					20																	44596988		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.456G>A	20.37:g.44596988C>T			B4DLG7|Q548D0|Q9H684	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V152	ENST00000322927.2	37	c.456	CCDS13389.1	20																																																																																			ZNF335	-	NULL	ENSG00000198026		0.642	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF335	HGNC	protein_coding	OTTHUMT00000079553.1	132	0.00	0	C	NM_022095		44596988	44596988	-1	no_errors	ENST00000322927	ensembl	human	known	69_37n	silent	133	18.40	30	SNP	1.000	T
ZNF480	147657	genome.wustl.edu	37	19	52824933	52824933	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr19:52824933G>C	ENST00000595962.1	+	5	496	c.430G>C	c.(430-432)Gat>Cat	p.D144H	ZNF480_ENST00000335090.6_Missense_Mutation_p.D67H|ZNF480_ENST00000490272.1_Missense_Mutation_p.Q58H|ZNF480_ENST00000334564.7_Missense_Mutation_p.D101H|CTD-2525I3.6_ENST00000594379.1_RNA	NM_144684.2	NP_653285.2	Q8WV37	ZN480_HUMAN	zinc finger protein 480	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)		GCTATTTCCAGATGAAAGGGT	0.388																																						dbGAP											0													82.0	74.0	77.0					19																	52824933		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY512662	CCDS12850.2, CCDS74437.1	19q13.41	2013-01-08			ENSG00000198464	ENSG00000198464		"""Zinc fingers, C2H2-type"", ""-"""	23305	protein-coding gene	gene with protein product		613910				15219843	Standard	XM_005258525		Approved	MGC32104	uc010ydl.2	Q8WV37	OTTHUMG00000157507	ENST00000595962.1:c.430G>C	19.37:g.52824933G>C	ENSP00000471754:p.Asp144His		Q5JPG9|Q6P0Q4|Q8N1M5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D144H	ENST00000595962.1	37	c.430	CCDS12850.2	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.08|14.08	2.428952|2.428952	0.43122|0.43122	.|.	.|.	ENSG00000198464|ENSG00000198464	ENST00000354515;ENST00000468240;ENST00000334564;ENST00000335090|ENST00000490272	T;T;T|.	0.07327|.	3.35;3.3;3.2|.	2.02|2.02	-0.8|-0.8	0.10897|0.10897	.|.	.|.	.|.	.|.	.|.	T|T	0.11024|0.11024	0.0269|0.0269	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	D;P|.	0.59767|.	0.986;0.947|.	P;P|.	0.56865|.	0.808;0.453|.	T|T	0.26985|0.26985	-1.0087|-1.0087	9|5	0.37606|.	T|.	0.19|.	.|.	1.4714|1.4714	0.02417|0.02417	0.4511:0.0:0.2353:0.3136|0.4511:0.0:0.2353:0.3136	.|.	101;144|.	F8WEZ9;Q8WV37|.	.;ZN480_HUMAN|.	H|H	166;144;101;67|58	ENSP00000417424:D144H;ENSP00000334164:D101H;ENSP00000335670:D67H|.	ENSP00000334164:D101H|.	D|Q	+|+	1|3	0|2	ZNF480|ZNF480	57516745|57516745	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.910000|0.910000	0.53928|0.53928	-0.945000|-0.945000	0.03909|0.03909	0.050000|0.050000	0.15949|0.15949	0.313000|0.313000	0.20887|0.20887	GAT|CAG	ZNF480	-	NULL	ENSG00000198464		0.388	ZNF480-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF480	HGNC	protein_coding	OTTHUMT00000349001.3	98	0.00	0	G	NM_144684		52824933	52824933	+1	no_errors	ENST00000468240	ensembl	human	known	69_37n	missense	71	36.61	41	SNP	0.000	C
ZFP69	339559	genome.wustl.edu	37	1	40961283	40961283	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr1:40961283C>T	ENST00000372706.1	+	6	2139	c.1133C>T	c.(1132-1134)tCt>tTt	p.S378F	RP11-656D10.3_ENST00000450713.1_RNA|ZFP69_ENST00000372705.3_Missense_Mutation_p.S378F			Q49AA0	ZFP69_HUMAN	ZFP69 zinc finger protein	378					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										AGGACTCATTCTGGAGAGAAA	0.398																																						dbGAP											0													74.0	77.0	76.0					1																	40961283		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK122618	CCDS30686.1	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187815	ENSG00000187815		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	24708	protein-coding gene	gene with protein product	"""ZFP69 zinc finger protein A"""		"""zinc finger protein 642"""	ZNF642			Standard	XM_005270808		Approved	ZKSCAN23A, FLJ16030, ZFP69A, ZSCAN54A	uc001cfo.3	Q49AA0	OTTHUMG00000007303	ENST00000372706.1:c.1133C>T	1.37:g.40961283C>T	ENSP00000361791:p.Ser378Phe		Q5SWM5|Q6ZWK8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,superfamily_Retrov_capsid_C,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S378F	ENST00000372706.1	37	c.1133	CCDS30686.1	1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.136887	0.77662	.	.	ENSG00000187815	ENST00000372706;ENST00000372705	T;T	0.19806	2.12;2.12	4.65	4.65	0.58169	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42964	D	0.000633	T	0.42653	0.1212	L	0.58925	1.835	0.45390	D	0.998371	D	0.76494	0.999	D	0.73708	0.981	T	0.23691	-1.0181	10	0.87932	D	0	-13.7281	15.8405	0.78842	0.0:1.0:0.0:0.0	.	378	Q49AA0	ZN642_HUMAN	F	378	ENSP00000361791:S378F;ENSP00000361790:S378F	ENSP00000361790:S378F	S	+	2	0	ZNF642	40733870	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	3.791000	0.55469	2.854000	0.98071	0.655000	0.94253	TCT	ZNF642	-	pfscan_Znf_C2H2	ENSG00000187815		0.398	ZFP69-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF642	HGNC	protein_coding	OTTHUMT00000019082.1	111	0.00	0	C	NM_198494		40961283	40961283	+1	no_errors	ENST00000372705	ensembl	human	known	69_37n	missense	42	25.00	14	SNP	1.000	T
ZNF705D	728957	genome.wustl.edu	37	8	11970495	11970495	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr8:11970495G>A	ENST00000400085.3	+	6	847	c.731G>A	c.(730-732)cGa>cAa	p.R244Q	FAM66D_ENST00000434078.2_RNA|FAM66D_ENST00000530099.2_RNA	NM_001039615.3	NP_001034704.2	P0CH99	Z705D_HUMAN	zinc finger protein 705D	244					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						TTTAACCTTCGAAGACATGAG	0.388																																						dbGAP											0													3.0	3.0	3.0					8																	11970495		573	1192	1765	-	-	-	SO:0001583	missense	0			BC110823	CCDS43712.1	8p23.1	2013-01-08			ENSG00000215343	ENSG00000215343		"""Zinc fingers, C2H2-type"", ""-"""	33202	protein-coding gene	gene with protein product							Standard	NM_001039615		Approved		uc003wva.3	P0CH99	OTTHUMG00000165474	ENST00000400085.3:c.731G>A	8.37:g.11970495G>A	ENSP00000382957:p.Arg244Gln		A8K971|A8MY01|Q2TAN0	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R244Q	ENST00000400085.3	37	c.731	CCDS43712.1	8	.	.	.	.	.	.	.	.	.	.	-	5.030	0.191299	0.09547	.	.	ENSG00000215343	ENST00000400085	T	0.07444	3.19	0.744	0.744	0.18353	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04724	0.0128	N	0.16368	0.405	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44390	-0.9331	9	0.20046	T	0.44	.	7.382	0.26862	0.0:0.0:1.0:0.0	.	244	P0CH99	Z705D_HUMAN	Q	244	ENSP00000382957:R244Q	ENSP00000382957:R244Q	R	+	2	0	ZNF705D	12007904	0.000000	0.05858	0.121000	0.21740	0.020000	0.10135	-0.823000	0.04443	0.715000	0.32103	0.384000	0.25694	CGA	ZNF705D	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000215343		0.388	ZNF705D-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF705D	HGNC	protein_coding	OTTHUMT00000383411.1	39	0.00	0	G	NM_001039615		11970495	11970495	+1	no_errors	ENST00000400085	ensembl	human	known	69_37n	missense	12	29.41	5	SNP	0.000	A
ZNF821	55565	genome.wustl.edu	37	16	71893986	71893986	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CW-01A-21D-A10Y-09	TCGA-A2-A0CW-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	da4f0f85-b16f-40fa-95c6-524d70d7ac4d	b6b51168-dc64-4bb1-aca5-346a1f1c8b67	g.chr16:71893986C>G	ENST00000565601.1	-	7	1581	c.1174G>C	c.(1174-1176)Gag>Cag	p.E392Q	ZNF821_ENST00000313565.6_Missense_Mutation_p.E350Q|ZNF821_ENST00000446827.2_Missense_Mutation_p.E350Q|ZNF821_ENST00000425432.1_Missense_Mutation_p.E392Q|ZNF821_ENST00000564134.1_3'UTR|ATXN1L_ENST00000569119.1_Intron	NM_001201553.1	NP_001188482.1	O75541	ZN821_HUMAN	zinc finger protein 821	392					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(2)	13						CTGTCCAACTCCACCCCACTT	0.557																																						dbGAP											0													70.0	57.0	61.0					16																	71893986		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF070588	CCDS32481.1, CCDS56006.1, CCDS73911.1	16q22.3	2008-05-02				ENSG00000102984		"""Zinc fingers, C2H2-type"""	28043	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_017530		Approved		uc021tlb.1	O75541		ENST00000565601.1:c.1174G>C	16.37:g.71893986C>G	ENSP00000455648:p.Glu392Gln		A6NK48|B4DKK4|D3DWS3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E392Q	ENST00000565601.1	37	c.1174	CCDS56006.1	16	.	.	.	.	.	.	.	.	.	.	C	14.11	2.439110	0.43326	.	.	ENSG00000102984	ENST00000425432;ENST00000313565;ENST00000446827	T;T;T	0.01613	6.32;4.73;4.73	6.16	5.21	0.72293	.	0.067812	0.64402	D	0.000010	T	0.01905	0.0060	N	0.14661	0.345	0.39250	D	0.964023	P;P;P	0.40476	0.596;0.718;0.596	B;B;B	0.38616	0.201;0.277;0.201	T	0.65319	-0.6197	10	0.72032	D	0.01	-16.7325	17.0157	0.86418	0.1285:0.8715:0.0:0.0	.	392;350;392	B4DKK4;O75541-2;O75541	.;.;ZN821_HUMAN	Q	392;350;350	ENSP00000398089:E392Q;ENSP00000313822:E350Q;ENSP00000405908:E350Q	ENSP00000313822:E350Q	E	-	1	0	ZNF821	70451487	.	.	0.791000	0.31998	0.987000	0.75469	.	.	1.609000	0.50190	0.650000	0.86243	GAG	ZNF821	-	NULL	ENSG00000102984		0.557	ZNF821-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF821	HGNC	protein_coding	OTTHUMT00000434180.1	119	0.00	0	C	NM_017530		71893986	71893986	-1	no_errors	ENST00000425432	ensembl	human	known	69_37n	missense	39	29.09	16	SNP	0.991	G
