#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AGAP7P	653268	genome.wustl.edu	37	10	51465920	51465920	+	Missense_Mutation	SNP	G	G	A	rs4043622	byFrequency	TCGA-A2-A1G6-01A-11D-A13L-09	TCGA-A2-A1G6-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c012bce9-de13-4e32-a29e-8ab64e16ea96	af61b79f-695b-4de6-a0cc-ef58346f5170	g.chr10:51465920G>A	ENST00000374095.5	-	7	661	c.536C>T	c.(535-537)aCg>aTg	p.T179M		NM_001077685.1	NP_001071153.1	Q5VUJ5	AGAP7_HUMAN		179					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	11						TCTGTTCTTCGTAATGTGCAC	0.488													-|||	2022	0.403754	0.1089	0.5749	5008	,	,		17678	0.501		0.5865	False		,,,				2504	0.3926					dbGAP											0													1.0	1.0	1.0					10																	51465920		904	1860	2764	-	-	-	SO:0001583	missense	0																														ENST00000374095.5:c.536C>T	10.37:g.51465920G>A	ENSP00000363208:p.Thr179Met		A6NGH4	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.T179M	ENST00000374095.5	37	c.536	CCDS41524.1	10	901	0.4125457875457875	58	0.11788617886178862	182	0.5027624309392266	268	0.46853146853146854	393	0.5184696569920845	.	0.020	-1.436324	0.01108	.	.	ENSG00000204169	ENST00000374095	T	0.54479	0.57	.	.	.	.	0.168466	0.49916	D	0.000130	T	0.00012	0.0000	N	0.19112	0.55	0.46981	P	7.289999999999797E-4	B	0.25809	0.135	B	0.18561	0.022	T	0.48703	-0.9012	7	0.31617	T	0.26	.	.	.	.	rs4043622	179	Q5VUJ5	AGAP7_HUMAN	M	179	ENSP00000363208:T179M	ENSP00000363208:T179M	T	-	2	0	AGAP7	51135926	0.359000	0.24955	0.020000	0.16555	0.020000	0.10135	0.086000	0.14935	0.172000	0.19760	0.175000	0.17021	ACG	AGAP7	-	NULL	ENSG00000204169		0.488	AGAP7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	AGAP7	HGNC	protein_coding	OTTHUMT00000048033.1	10	0.00	0	G			51465920	51465920	-1	no_errors	ENST00000374095	ensembl	human	known	69_37n	missense	3	70.00	7	SNP	0.892	A
ESPNP	284729	genome.wustl.edu	37	1	17029274	17029274	+	RNA	SNP	C	C	T			TCGA-A2-A1G6-01A-11D-A13L-09	TCGA-A2-A1G6-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c012bce9-de13-4e32-a29e-8ab64e16ea96	af61b79f-695b-4de6-a0cc-ef58346f5170	g.chr1:17029274C>T	ENST00000492551.1	-	0	1091					NR_026567.1				espin pseudogene																		CCTGTGGTCCCACAGGAGGCT	0.652																																						dbGAP											0																																										-	-	-			0			AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17029274C>T				RNA	SNP	-	NULL	ENST00000492551.1	37	NULL		1																																																																																			ESPNP	-	-	ENSG00000116219		0.652	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	HGNC	pseudogene	OTTHUMT00000326311.1	11	0.00	0	C			17029274	17029274	-1	no_errors	ENST00000492551	ensembl	human	known	69_37n	rna	10	33.33	5	SNP	0.312	T
GOLGA8DP	100132979	genome.wustl.edu	37	15	22706758	22706758	+	RNA	SNP	T	T	A	rs368931923		TCGA-A2-A1G6-01A-11D-A13L-09	TCGA-A2-A1G6-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c012bce9-de13-4e32-a29e-8ab64e16ea96	af61b79f-695b-4de6-a0cc-ef58346f5170	g.chr15:22706758T>A	ENST00000314246.8	-	0	1572				AC116165.1_ENST00000408073.1_RNA|RN7SL545P_ENST00000495815.2_RNA			Q0D2H9	GOG8D_HUMAN	golgin A8 family, member D, pseudogene							Golgi apparatus (GO:0005794)											TGTCCAGATGTTCTCCTCCGT	0.622																																						dbGAP											0																																										-	-	-			0					15q11.2	2014-04-10	2011-04-15	2010-02-12	ENSG00000185182	ENSG00000185182			32376	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8D"""	GOLGA8D		12477932	Standard	NR_027407		Approved		uc010axw.2	Q0D2H9	OTTHUMG00000171882		15.37:g.22706758T>A				RNA	SNP	-	NULL	ENST00000314246.8	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	7.006	0.555915	0.13436	.	.	ENSG00000185182	ENST00000341390;ENST00000314246	.	.	.	0.128	0.128	0.14733	.	.	.	.	.	T	0.53029	0.1771	.	.	.	0.24195	N	0.995536	D	0.64830	0.994	P	0.60473	0.875	T	0.59526	-0.7438	5	0.22706	T	0.39	.	.	.	.	.	225	F8WBT8	.	D	225	.	ENSP00000327024:E225D	E	-	3	2	AC116165.1	20258122	0.000000	0.05858	0.016000	0.15963	0.158000	0.22134	-1.210000	0.02999	0.243000	0.21327	0.240000	0.17902	GAA	GOLGA8DP	-	-	ENSG00000185182		0.622	GOLGA8DP-002	KNOWN	basic	processed_transcript	GOLGA8DP	HGNC	pseudogene	OTTHUMT00000415613.1	10	0.00	0	T	NR_027407		22706758	22706758	-1	no_errors	ENST00000314246	ensembl	human	known	69_37n	rna	22	26.67	8	SNP	0.928	A
PM20D1	148811	genome.wustl.edu	37	1	205819079	205819079	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A1G6-01A-11D-A13L-09	TCGA-A2-A1G6-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c012bce9-de13-4e32-a29e-8ab64e16ea96	af61b79f-695b-4de6-a0cc-ef58346f5170	g.chr1:205819079G>C	ENST00000367136.4	-	1	166	c.122C>G	c.(121-123)tCt>tGt	p.S41C	PM20D1_ENST00000460624.1_5'UTR	NM_152491.4	NP_689704.4	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1	41					negative regulation of neuron death (GO:1901215)|regulation of defense response to virus by host (GO:0050691)|regulation of viral process (GO:0050792)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|peptidase activity (GO:0008233)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)	28	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			GCTGAACTGAGAAGGGATTCG	0.602																																						dbGAP											0													89.0	93.0	92.0					1																	205819079		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1460.1	1q32.1	2008-02-05			ENSG00000162877	ENSG00000162877			26518	protein-coding gene	gene with protein product							Standard	NM_152491		Approved	FLJ32569, Cps1	uc001hdj.3	Q6GTS8	OTTHUMG00000035999	ENST00000367136.4:c.122C>G	1.37:g.205819079G>C	ENSP00000356104:p.Ser41Cys		Q6P4E3|Q96DM4	Missense_Mutation	SNP	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,superfamily_Peptidase_M20_dimer	p.S41C	ENST00000367136.4	37	c.122	CCDS1460.1	1	.	.	.	.	.	.	.	.	.	.	G	13.94	2.386054	0.42308	.	.	ENSG00000162877	ENST00000367136	T	0.07567	3.18	5.27	5.27	0.74061	.	0.376195	0.31123	N	0.008220	T	0.13415	0.0325	L	0.54323	1.7	0.20926	N	0.999822	D	0.59357	0.985	P	0.46796	0.527	T	0.09314	-1.0680	10	0.46703	T	0.11	.	14.2463	0.65990	0.0:0.0:1.0:0.0	.	41	Q6GTS8	P20D1_HUMAN	C	41	ENSP00000356104:S41C	ENSP00000356104:S41C	S	-	2	0	PM20D1	204085702	0.980000	0.34600	0.525000	0.27900	0.443000	0.32047	2.686000	0.46968	2.712000	0.92718	0.655000	0.94253	TCT	PM20D1	-	NULL	ENSG00000162877		0.602	PM20D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PM20D1	HGNC	protein_coding	OTTHUMT00000087736.1	46	0.00	0	G	NM_152491		205819079	205819079	-1	no_errors	ENST00000367136	ensembl	human	known	69_37n	missense	65	12.16	9	SNP	0.373	C
R3HDML	140902	genome.wustl.edu	37	20	42965985	42965985	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A1G6-01A-11D-A13L-09	TCGA-A2-A1G6-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c012bce9-de13-4e32-a29e-8ab64e16ea96	af61b79f-695b-4de6-a0cc-ef58346f5170	g.chr20:42965985T>A	ENST00000217043.2	+	1	360	c.188T>A	c.(187-189)aTg>aAg	p.M63K		NM_178491.2	NP_848586.1	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like	63						extracellular region (GO:0005576)	peptidase inhibitor activity (GO:0030414)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)	21		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			GTGAGAGACATGAATGCCTTA	0.632																																						dbGAP											0													72.0	65.0	67.0					20																	42965985		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC107048	CCDS13329.1	20q13.12	2007-04-26	2005-09-02		ENSG00000101074	ENSG00000101074			16249	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing-like"""				Standard	NM_178491		Approved	dJ881L22.3	uc002xls.2	Q9H3Y0	OTTHUMG00000032524	ENST00000217043.2:c.188T>A	20.37:g.42965985T>A	ENSP00000217043:p.Met63Lys			Missense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.M63K	ENST00000217043.2	37	c.188	CCDS13329.1	20	.	.	.	.	.	.	.	.	.	.	T	15.18	2.757525	0.49468	.	.	ENSG00000101074	ENST00000217043	T	0.08282	3.11	5.18	5.18	0.71444	CAP domain (2);	0.088910	0.85682	D	0.000000	T	0.10723	0.0262	M	0.65498	2.005	0.80722	D	1	P	0.46395	0.877	B	0.41860	0.368	T	0.08534	-1.0717	10	0.02654	T	1	.	15.0238	0.71653	0.0:0.0:0.0:1.0	.	63	Q9H3Y0	CRSPL_HUMAN	K	63	ENSP00000217043:M63K	ENSP00000217043:M63K	M	+	2	0	R3HDML	42399399	1.000000	0.71417	0.984000	0.44739	0.042000	0.13812	7.110000	0.77069	1.958000	0.56883	0.317000	0.21355	ATG	R3HDML	-	superfamily_CAP_domain,smart_Allrgn_V5/Tpx1	ENSG00000101074		0.632	R3HDML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	R3HDML	HGNC	protein_coding	OTTHUMT00000079344.1	19	0.00	0	T	NM_178491		42965985	42965985	+1	no_errors	ENST00000217043	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	1.000	A
SLC38A10	124565	genome.wustl.edu	37	17	79220335	79220335	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A1G6-01A-11D-A13L-09	TCGA-A2-A1G6-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c012bce9-de13-4e32-a29e-8ab64e16ea96	af61b79f-695b-4de6-a0cc-ef58346f5170	g.chr17:79220335delG	ENST00000374759.3	-	16	2764	c.2381delC	c.(2380-2382)ccafs	p.P794fs		NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	794					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GTCCTGGGATGGAGCAGGGCG	0.687																																						dbGAP											0													21.0	24.0	23.0					17																	79220335		1879	4070	5949	-	-	-	SO:0001589	frameshift_variant	0			BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.2381delC	17.37:g.79220335delG	ENSP00000363891:p.Pro794fs		Q6ZRC5|Q8NA99|Q96C66	Frame_Shift_Del	DEL	pfam_AA_transpt_TM	p.P794fs	ENST00000374759.3	37	c.2381	CCDS42397.1	17																																																																																			SLC38A10	-	NULL	ENSG00000157637		0.687	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A10	HGNC	protein_coding	OTTHUMT00000397747.1	11	0.00	0	G	NM_138570		79220335	79220335	-1	no_errors	ENST00000374759	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	0.000	-
