#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ANKRD30B	374860	genome.wustl.edu	37	18	14852311	14852311	+	Silent	SNP	G	G	A	rs538202869		TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr18:14852311G>A	ENST00000358984.4	+	36	4191	c.4011G>A	c.(4009-4011)gaG>gaA	p.E1337E		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1337										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						AGTTTCCTGAGATGAAAATGC	0.318																																						dbGAP											0													17.0	12.0	14.0					18																	14852311		692	1586	2278	-	-	-	SO:0001819	synonymous_variant	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.4011G>A	18.37:g.14852311G>A			B4DGP1|F8WAG3|Q4G175	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E1337	ENST00000358984.4	37	c.4011	CCDS54182.1	18																																																																																			ANKRD30B	-	NULL	ENSG00000180777		0.318	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	50	0.00	0	G	NM_001145029		14852311	14852311	+1	no_errors	ENST00000358984	ensembl	human	known	69_37n	silent	31	13.89	5	SNP	0.010	A
ANKRD30BL	554226	genome.wustl.edu	37	2	133015374	133015374	+	5'UTR	SNP	G	G	C	rs112494139		TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr2:133015374G>C	ENST00000470729.1	-	0	168				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						TTGAGCCTTCGCGGTCTGGGC	0.692																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1257C>G	2.37:g.133015374G>C			B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-	ENSG00000163046		0.692	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1	41	0.00	0	G	NR_027019		133015374	133015374	-1	no_errors	ENST00000470729	ensembl	human	known	69_37n	rna	66	14.29	11	SNP	0.001	C
CXCR3	2833	genome.wustl.edu	37	X	70837002	70837002	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chrX:70837002G>A	ENST00000373693.3	-	2	387	c.320C>T	c.(319-321)cCg>cTg	p.P107L	CXCR3_ENST00000373691.4_Missense_Mutation_p.P154L	NM_001504.1	NP_001495.1	P49682	CXCR3_HUMAN	chemokine (C-X-C motif) receptor 3	107					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|calcium-mediated signaling (GO:0019722)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|chemokine (C-C motif) ligand 11 production (GO:0071954)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of execution phase of apoptosis (GO:1900118)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of leukocyte migration (GO:0002685)|T cell chemotaxis (GO:0010818)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|chemokine binding (GO:0019956)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(2)|lung(3)|ovary(2)	10	Renal(35;0.156)					TGCCCAGAGCGGCAGTGTCAG	0.637																																						dbGAP											0													21.0	16.0	18.0					X																	70837002		2190	4260	6450	-	-	-	SO:0001583	missense	0			U32674	CCDS14416.1, CCDS48135.1	Xq13	2012-08-08	2002-08-22	2002-08-23	ENSG00000186810	ENSG00000186810		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	4540	protein-coding gene	gene with protein product		300574	"""G protein-coupled receptor 9"""	GPR9		8666380, 9064356	Standard	NM_001142797		Approved	CKR-L2, CMKAR3, IP10-R, MigR, CD183	uc011mpx.2	P49682	OTTHUMG00000033326	ENST00000373693.3:c.320C>T	X.37:g.70837002G>A	ENSP00000362797:p.Pro107Leu		B2R982|O15185|Q7Z710|Q9P2T4|Q9P2T5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_CXCR3,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_CXCR4,prints_Chemokine_rcpt,prints_ATII_rcpt	p.P154L	ENST00000373693.3	37	c.461	CCDS14416.1	X	.	.	.	.	.	.	.	.	.	.	G	15.86	2.956563	0.53293	.	.	ENSG00000186810	ENST00000373691;ENST00000373693;ENST00000373687	T;T	0.72051	-0.62;-0.62	5.44	5.44	0.79542	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.86331	0.5907	M	0.88570	2.965	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88741	0.3243	10	0.87932	D	0	.	15.3791	0.74637	0.0:0.0:1.0:0.0	.	154;107	P49682-2;P49682	.;CXCR3_HUMAN	L	154;107;107	ENSP00000362795:P154L;ENSP00000362797:P107L	ENSP00000362791:P107L	P	-	2	0	CXCR3	70753727	1.000000	0.71417	0.095000	0.20976	0.001000	0.01503	9.430000	0.97488	2.517000	0.84864	0.600000	0.82982	CCG	CXCR3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_ATII_rcpt	ENSG00000186810		0.637	CXCR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR3	HGNC	protein_coding	OTTHUMT00000144141.1	56	0.00	0	G			70837002	70837002	-1	no_errors	ENST00000373691	ensembl	human	known	69_37n	missense	40	34.43	21	SNP	0.999	A
DGKG	1608	genome.wustl.edu	37	3	185879390	185879390	+	Splice_Site	SNP	A	A	G			TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr3:185879390A>G	ENST00000265022.3	-	24	2817		c.e24+1		DGKG_ENST00000382164.4_Splice_Site|DGKG_ENST00000544847.1_Splice_Site|DGKG_ENST00000447054.1_Splice_Site|DGKG_ENST00000344484.4_Splice_Site	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	GGCAAGACTCACCGTGCAACA	0.473																																						dbGAP											0													106.0	96.0	99.0					3																	185879390		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.2277+1T>C	3.37:g.185879390A>G			B2RAH4|Q2M1H4|Q5FWG1	Splice_Site	SNP	-	e23+2	ENST00000265022.3	37	c.2277+2	CCDS3274.1	3	.	.	.	.	.	.	.	.	.	.	A	18.24	3.580060	0.65992	.	.	ENSG00000058866	ENST00000265022;ENST00000344484;ENST00000382164;ENST00000544847	.	.	.	4.52	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9539	0.58416	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DGKG	187362084	1.000000	0.71417	0.998000	0.56505	0.808000	0.45660	8.983000	0.93477	1.912000	0.55364	0.383000	0.25322	.	DGKG	-	-	ENSG00000058866		0.473	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKG	HGNC	protein_coding	OTTHUMT00000344800.3	50	0	0	A		Intron	185879390	185879390	-1	no_errors	ENST00000265022	ensembl	human	known	69_37n	splice_site	34	25.53	12	SNP	1.000	G
FCRL3	115352	genome.wustl.edu	37	1	157666256	157666256	+	Intron	SNP	T	T	C	rs72708359	byFrequency	TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr1:157666256T>C	ENST00000368184.3	-	7	1136				FCRL3_ENST00000473231.1_5'UTR|FCRL3_ENST00000368186.5_Intron|RP11-367J7.3_ENST00000453692.1_RNA	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					AAGAAATTAATTGTGTATACG	0.453													T|||	812	0.162141	0.0847	0.1974	5008	,	,		20084	0.1865		0.2445	False		,,,				2504	0.1319					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.845-139A>G	1.37:g.157666256T>C			A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	RNA	SNP	-	NULL	ENST00000368184.3	37	NULL	CCDS1167.1	1																																																																																			FCRL3	-	-	ENSG00000160856		0.453	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	HGNC	protein_coding	OTTHUMT00000051419.2	8	0.00	0	T	NM_052939		157666256	157666256	-1	no_errors	ENST00000473231	ensembl	human	known	69_37n	rna	3	76.92	10	SNP	0.000	C
FER1L4	80307	genome.wustl.edu	37	20	34171140	34171140	+	RNA	SNP	T	T	C			TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr20:34171140T>C	ENST00000430275.2	-	0	2991							A9Z1Z3	FR1L4_HUMAN	fer-1-like family member 4, pseudogene (functional)							integral component of membrane (GO:0016021)											ACTGCTCAAATACCAGGAGTT	0.532																																						dbGAP											0																																										-	-	-			0			AL121586		20q11.23	2014-09-11	2014-06-27		ENSG00000088340	ENSG00000088340		"""-"""	15801	pseudogene	pseudogene			"""fer-1-like 4 (C. elegans)"", ""fer-1-like 4 (C. elegans), pseudogene (functional)"""	C20orf124		24063685, 24961353	Standard	XR_425236		Approved	bA563A22B.1, dJ309K20.1	uc002xcx.3	A9Z1Z3	OTTHUMG00000032354		20.37:g.34171140T>C			Q9GZQ9|Q9H646|Q9H8L7	RNA	SNP	-	NULL	ENST00000430275.2	37	NULL		20																																																																																			FER1L4	-	-	ENSG00000088340		0.532	FER1L4-016	KNOWN	basic	processed_transcript	FER1L4	HGNC	pseudogene	OTTHUMT00000443297.1	32	0.00	0	T	NR_024377		34171140	34171140	-1	no_errors	ENST00000430275	ensembl	human	known	69_37n	rna	29	12.12	4	SNP	0.969	C
FLJ37453	729614	genome.wustl.edu	37	1	16162471	16162471	+	RNA	SNP	C	C	A	rs4661666	byFrequency	TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr1:16162471C>A	ENST00000317122.1	-	0	970				RP11-169K16.9_ENST00000535249.1_RNA	NR_024279.1																						GAAAGAATTCCCCCTCCCCTC	0.657													C|||	1190	0.23762	0.0764	0.3256	5008	,	,		14503	0.0893		0.3529	False		,,,				2504	0.4274					dbGAP											0																																										-	-	-			0																															1.37:g.16162471C>A				RNA	SNP	-	NULL	ENST00000317122.1	37	NULL		1																																																																																			RP11-169K16.9	-	-	ENSG00000179743		0.657	RP11-169K16.9-001	KNOWN	basic	antisense	FLJ37453	Clone_based_vega_gene	antisense	OTTHUMT00000025992.1	10	0.00	0	C			16162471	16162471	-1	no_errors	ENST00000317122	ensembl	human	known	69_37n	rna	4	60.00	6	SNP	0.000	A
FOXI1	2299	genome.wustl.edu	37	5	169535084	169535084	+	Silent	SNP	C	C	T			TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr5:169535084C>T	ENST00000306268.6	+	2	667	c.606C>T	c.(604-606)aaC>aaT	p.N202N	FOXI1_ENST00000449804.2_Intron			Q12951	FOXI1_HUMAN	forkhead box I1	202					embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGGACCCCAACTGTGAGAAAA	0.443									Pendred syndrome																													dbGAP											0													70.0	68.0	68.0					5																	169535084		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Goiter-Deafness syndrome	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.606C>T	5.37:g.169535084C>T			Q14518|Q66SR7|Q8N6L8	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.N202	ENST00000306268.6	37	c.606	CCDS4372.1	5																																																																																			FOXI1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000168269		0.443	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXI1	HGNC	protein_coding	OTTHUMT00000252827.2	17	0.00	0	C	NM_144769, NM_012188		169535084	169535084	+1	no_errors	ENST00000306268	ensembl	human	known	69_37n	silent	6	40.00	4	SNP	1.000	T
HPS4	89781	genome.wustl.edu	37	22	26868810	26868810	+	Silent	SNP	G	G	A			TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr22:26868810G>A	ENST00000398145.2	-	5	988	c.372C>T	c.(370-372)tcC>tcT	p.S124S	HPS4_ENST00000402105.3_Silent_p.S119S|HPS4_ENST00000398141.1_Silent_p.S119S|HPS4_ENST00000336873.5_Silent_p.S124S	NM_022081.5	NP_071364.4	Q9NQG7	HPS4_HUMAN	Hermansky-Pudlak syndrome 4	124					blood coagulation (GO:0007596)|hemostasis (GO:0007599)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of eye pigmentation (GO:0048075)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|platelet dense granule (GO:0042827)	protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(3)|kidney(5)|large_intestine(4)|lung(12)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	32						CATAAGCTAGGGAAACAGGTC	0.468									Hermansky-Pudlak syndrome																													dbGAP											0													117.0	120.0	119.0					22																	26868810		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	HPS, HPS1-8		CCDS13835.1, CCDS46677.1	22q12.1	2014-09-17			ENSG00000100099	ENSG00000100099			15844	protein-coding gene	gene with protein product		606682				11836498, 12663659	Standard	NM_022081		Approved	KIAA1667, LE	uc003aci.4	Q9NQG7	OTTHUMG00000030459	ENST00000398145.2:c.372C>T	22.37:g.26868810G>A			B1AHQ4|Q5H8V6|Q96LX6|Q9BY93|Q9UH37|Q9UH38	Silent	SNP	NULL	p.S119	ENST00000398145.2	37	c.357	CCDS13835.1	22																																																																																			HPS4	-	NULL	ENSG00000100099		0.468	HPS4-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HPS4	HGNC	protein_coding	OTTHUMT00000320778.1	39	0.00	0	G	NM_022081		26868810	26868810	-1	no_errors	ENST00000398141	ensembl	human	known	69_37n	silent	26	21.21	7	SNP	0.088	A
IGHA2	3494	genome.wustl.edu	37	14	106053932	106053932	+	RNA	SNP	G	G	A			TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr14:106053932G>A	ENST00000390539.2	-	0	586				AL928742.1_ENST00000581377.1_RNA			P01877	IGHA2_HUMAN	immunoglobulin heavy constant alpha 2 (A2m marker)						antibacterial humoral response (GO:0019731)|glomerular filtration (GO:0003094)|immune response (GO:0006955)|positive regulation of respiratory burst (GO:0060267)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|monomeric IgA immunoglobulin complex (GO:0071748)|secretory dimeric IgA immunoglobulin complex (GO:0071752)|secretory IgA immunoglobulin complex (GO:0071751)	antigen binding (GO:0003823)										CTTCAACTCGGGGTGGGCAGC	0.607																																						dbGAP											0													53.0	64.0	60.0					14																	106053932		2086	4198	6284	-	-	-			0			J00221		14q32.33	2012-10-02			ENSG00000211890	ENSG00000211890		"""Immunoglobulins / IGH locus"""	5479	other	immunoglobulin gene		147000					Standard	NG_001019		Approved			P01877	OTTHUMG00000152472		14.37:g.106053932G>A				Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.P196L	ENST00000390539.2	37	c.587		14																																																																																			IGHA2	-	smart_Ig_C1-set,pfscan_Ig-like	ENSG00000211890		0.607	IGHA2-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHA2	HGNC	IG_C_gene	OTTHUMT00000326338.1	57	0.00	0	G	NG_001019		106053932	106053932	-1	no_start_codon	ENST00000390539	ensembl	human	known	69_37n	missense	109	14.84	19	SNP	0.543	A
KRT16P1	729252	genome.wustl.edu	37	17	18343286	18343286	+	RNA	SNP	C	C	T	rs200041528	byFrequency	TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr17:18343286C>T	ENST00000581027.1	+	0	252									keratin 16 pseudogene 1																		CGCTCACCTCCCTCCTTGGCA	0.607																																						dbGAP											0																																										-	-	-			0					17p11.2	2012-08-13	2010-02-25	2010-02-25	ENSG00000214856	ENSG00000214856			6420	pseudogene	pseudogene			"""keratin 14 pseudogene"""	KRT14P			Standard	NR_073414		Approved		uc010vya.2		OTTHUMG00000059249		17.37:g.18343286C>T				RNA	SNP	-	NULL	ENST00000581027.1	37	NULL		17																																																																																			KRT16P1	-	-	ENSG00000214856		0.607	KRT16P1-003	KNOWN	basic	processed_transcript	KRT16P1	HGNC	pseudogene	OTTHUMT00000446576.1	15	0.00	0	C	NG_007001		18343286	18343286	+1	no_errors	ENST00000584135	ensembl	human	known	69_37n	rna	16	23.81	5	SNP	0.002	T
KRT4	3851	genome.wustl.edu	37	12	53207582	53207582	+	Silent	SNP	A	A	G	rs74445207	byFrequency	TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr12:53207582A>G	ENST00000551956.1	-	1	753	c.261T>C	c.(259-261)ggT>ggC	p.G87G	KRT4_ENST00000293774.4_Silent_p.G161G|KRT4_ENST00000458244.2_Silent_p.G67G			P19013	K2C4_HUMAN	keratin 4	87	Gly-rich.|Head.		Missing (in allele K4B). {ECO:0000269|PubMed:16541075, ECO:0000269|PubMed:7684424}.		cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CCCCAAATCCACCACCAAAGC	0.607																																					Pancreas(190;284 2995 41444 45903)	dbGAP											0													43.0	58.0	53.0					12																	53207582		2119	4255	6374	-	-	-	SO:0001819	synonymous_variant	0				CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.261T>C	12.37:g.53207582A>G			F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.G161	ENST00000551956.1	37	c.483	CCDS41787.2	12																																																																																			KRT4	-	NULL	ENSG00000170477		0.607	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	KRT4	HGNC	protein_coding	OTTHUMT00000405931.1	33	0.00	0	A	NM_002272		53207582	53207582	-1	no_errors	ENST00000293774	ensembl	human	known	69_37n	silent	32	21.95	9	SNP	0.946	G
LMCD1	29995	genome.wustl.edu	37	3	8609232	8609232	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr3:8609232T>C	ENST00000157600.3	+	6	1278	c.1046T>C	c.(1045-1047)gTc>gCc	p.V349A	LMCD1_ENST00000397386.3_Missense_Mutation_p.V237A|LMCD1_ENST00000454244.1_Missense_Mutation_p.V276A|LMCD1-AS1_ENST00000439407.1_RNA	NM_014583.2	NP_055398.1	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1	349	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|regulation of cardiac muscle hypertrophy (GO:0010611)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)	16				OV - Ovarian serous cystadenocarcinoma(96;0.124)		GCGTACATCGTCACCAAGGGT	0.592																																						dbGAP											0													236.0	225.0	229.0					3																	8609232		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169284	CCDS33688.1, CCDS63533.1, CCDS63534.1	3p26-p24	2008-07-18			ENSG00000071282	ENSG00000071282			6633	protein-coding gene	gene with protein product	"""dyxin"""	604859				10662546	Standard	NM_001278233		Approved		uc003bqq.4	Q9NZU5	OTTHUMG00000154971	ENST00000157600.3:c.1046T>C	3.37:g.8609232T>C	ENSP00000157600:p.Val349Ala		B4DG80	Missense_Mutation	SNP	pfam_PET_domain,pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.V349A	ENST00000157600.3	37	c.1046	CCDS33688.1	3	.	.	.	.	.	.	.	.	.	.	T	13.66	2.304536	0.40795	.	.	ENSG00000071282	ENST00000157600;ENST00000454244;ENST00000397386	D;D;D	0.87412	-2.25;-2.25;-2.25	5.52	5.52	0.82312	Zinc finger, LIM-type (4);	0.835831	0.10354	N	0.684754	D	0.82481	0.5046	N	0.25426	0.745	0.37350	D	0.910748	B;B	0.21147	0.014;0.052	B;B	0.24701	0.043;0.055	T	0.76146	-0.3066	10	0.41790	T	0.15	-13.3054	14.7495	0.69513	0.0:0.0:0.0:1.0	.	237;349	B4DEY6;Q9NZU5	.;LMCD1_HUMAN	A	349;276;237	ENSP00000157600:V349A;ENSP00000396515:V276A;ENSP00000380542:V237A	ENSP00000157600:V349A	V	+	2	0	LMCD1	8584232	1.000000	0.71417	0.926000	0.36857	0.190000	0.23558	7.906000	0.87423	2.232000	0.73038	0.482000	0.46254	GTC	LMCD1	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000071282		0.592	LMCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMCD1	HGNC	protein_coding	OTTHUMT00000337854.1	47	0.00	0	T	NM_014583		8609232	8609232	+1	no_errors	ENST00000157600	ensembl	human	known	69_37n	missense	25	23.53	8	SNP	0.998	C
MED1	5469	genome.wustl.edu	37	17	37584005	37584005	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr17:37584005C>T	ENST00000394287.3	-	10	893	c.688G>A	c.(688-690)Gac>Aac	p.D230N	MED1_ENST00000300651.6_Missense_Mutation_p.D230N			O95243	MBD4_HUMAN	mediator complex subunit 1	115					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		TCCAGTAGGTCAGAAGGAGAG	0.338										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)	dbGAP											0													98.0	97.0	97.0					17																	37584005		2203	4300	6503	-	-	-	SO:0001583	missense	0			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000394287.3:c.688G>A	17.37:g.37584005C>T	ENSP00000377828:p.Asp230Asn		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	pfam_Mediator_Med1_met/fun	p.D230N	ENST00000394287.3	37	c.688		17	.	.	.	.	.	.	.	.	.	.	C	33	5.274579	0.95459	.	.	ENSG00000125686	ENST00000394287;ENST00000300651	T	0.40476	1.03	5.4	5.4	0.78164	Mediator complex, subunit Med1, metazoa/fungi (1);	.	.	.	.	T	0.66317	0.2777	M	0.74881	2.28	0.58432	D	0.999993	D;D	0.69078	0.997;0.988	D;P	0.72075	0.976;0.844	T	0.69551	-0.5115	9	0.72032	D	0.01	-8.7605	18.7672	0.91878	0.0:1.0:0.0:0.0	.	230;230	Q15648;Q15648-3	MED1_HUMAN;.	N	230	ENSP00000300651:D230N	ENSP00000300651:D230N	D	-	1	0	MED1	34837531	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.947000	0.70242	2.519000	0.84933	0.563000	0.77884	GAC	MED1	-	pfam_Mediator_Med1_met/fun	ENSG00000125686		0.338	MED1-002	PUTATIVE	basic|exp_conf	protein_coding	MED1	HGNC	protein_coding	OTTHUMT00000256944.1	38	0.00	0	C	NM_004774		37584005	37584005	-1	no_errors	ENST00000300651	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	1.000	T
OR6K6	128371	genome.wustl.edu	37	1	158724608	158724608	+	Start_Codon_SNP	SNP	G	G	A			TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr1:158724608G>A	ENST00000368144.2	+	1	99	c.3G>A	c.(1-3)atG>atA	p.M1I		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	1						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					AGAAAGGAATGAAGCAATATT	0.388																																						dbGAP											0													112.0	116.0	115.0					1																	158724608		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.3G>A	1.37:g.158724608G>A	ENSP00000357126:p.Met1Ile		B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M1I	ENST00000368144.2	37	c.3	CCDS30904.1	1	.	.	.	.	.	.	.	.	.	.	G	4.316	0.058050	0.08339	.	.	ENSG00000180433	ENST00000368144	T	0.00281	8.32	3.93	0.829	0.18847	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.27994	N	0.935533	B	0.02656	0.0	B	0.01281	0.0	T	0.19811	-1.0294	8	0.87932	D	0	.	6.4585	0.21944	0.4589:0.0:0.5411:0.0	.	1	Q8NGW6	OR6K6_HUMAN	I	1	ENSP00000357126:M1I	ENSP00000357126:M1I	M	+	3	0	OR6K6	156991232	0.000000	0.05858	0.002000	0.10522	0.092000	0.18411	0.025000	0.13577	0.313000	0.23062	-0.192000	0.12808	ATG	OR6K6	-	NULL	ENSG00000180433		0.388	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6K6	HGNC	protein_coding	OTTHUMT00000059065.2	32	0.00	0	G	NM_001005184	Missense_Mutation	158724608	158724608	+1	no_errors	ENST00000368144	ensembl	human	known	69_37n	missense	67	10.67	8	SNP	0.000	A
PBX2P1	5088	genome.wustl.edu	37	3	142897015	142897015	+	RNA	SNP	C	C	T			TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr3:142897015C>T	ENST00000560287.1	+	0	1889									pre-B-cell leukemia homeobox 2 pseudogene 1																		TTACCTCATACGCAGCTCATC	0.507																																						dbGAP											0																																										-	-	-			0					3q24	2014-03-25	2007-01-30	2007-01-30	ENSG00000244171	ENSG00000244171		"""Homeoboxes / TALE class"""	8635	pseudogene	pseudogene			"""pre-B-cell leukemia transcription factor pseudogene 1"""	PBX2, PBXP1		1682799	Standard	NG_002434		Approved				OTTHUMG00000159350		3.37:g.142897015C>T				RNA	SNP	-	NULL	ENST00000560287.1	37	NULL		3																																																																																			PBX2P1	-	-	ENSG00000244171		0.507	PBX2P1-002	KNOWN	basic	processed_transcript	PBX2P1	HGNC	pseudogene	OTTHUMT00000417717.1	50	0.00	0	C	NG_002434		142897015	142897015	+1	no_errors	ENST00000560287	ensembl	human	known	69_37n	rna	41	25.00	14	SNP	0.987	T
SLC39A9	55334	genome.wustl.edu	37	14	69920016	69920016	+	Silent	SNP	C	C	T			TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr14:69920016C>T	ENST00000336643.5	+	4	1140	c.462C>T	c.(460-462)gtC>gtT	p.V154V	SLC39A9_ENST00000031146.4_Silent_p.V88V|SLC39A9_ENST00000556605.1_Silent_p.V154V|SLC39A9_ENST00000557046.1_Intron|SLC39A9_ENST00000555245.1_3'UTR	NM_018375.4	NP_060845.2	Q9NUM3	S39A9_HUMAN	solute carrier family 39, member 9	154					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|skin(1)|stomach(1)	14				all cancers(60;0.00299)|BRCA - Breast invasive adenocarcinoma(234;0.0145)|OV - Ovarian serous cystadenocarcinoma(108;0.0373)		GTCTGGTTGTCCATGCTGCAG	0.458																																						dbGAP											0													132.0	121.0	125.0					14																	69920016		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9795.1, CCDS58327.1, CCDS58328.1	14q24.1	2013-07-17	2013-07-17			ENSG00000029364		"""Solute carriers"""	20182	protein-coding gene	gene with protein product							Standard	NM_018375		Approved	FLJ11274	uc001xle.3	Q9NUM3		ENST00000336643.5:c.462C>T	14.37:g.69920016C>T			G3V5J8|Q53HN3|Q5MJQ0|Q6P2Q1|Q86WY2	Silent	SNP	pfam_ZIP	p.V154	ENST00000336643.5	37	c.462	CCDS9795.1	14																																																																																			SLC39A9	-	pfam_ZIP	ENSG00000029364		0.458	SLC39A9-009	NOVEL	basic|appris_principal|CCDS	protein_coding	SLC39A9	HGNC	protein_coding	OTTHUMT00000412446.1	66	0.00	0	C	NM_018375		69920016	69920016	+1	no_errors	ENST00000555840	ensembl	human	known	69_37n	silent	47	42.17	35	SNP	1.000	T
TBC1D3P1-DHX40P1	653645	genome.wustl.edu	37	17	58085530	58085530	+	lincRNA	SNP	T	T	C			TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chr17:58085530T>C	ENST00000407042.3	-	0	1906									TBC1D3P1-DHX40P1 readthrough transcribed pseudogene																		GTGGTTATCCTTCCATGAGTT	0.453																																						dbGAP											0																																										-	-	-			0					17q23.1	2014-09-10	2012-12-07		ENSG00000267104	ENSG00000267104			42362	other	readthrough			"""TBC1D3P1-DHX40P1 readthrough (non-protein coding)"""				Standard	NR_002924		Approved		uc002iyf.2		OTTHUMG00000179977		17.37:g.58085530T>C				RNA	SNP	-	NULL	ENST00000407042.3	37	NULL		17																																																																																			TBC1D3P1-DHX40P1	-	-	ENSG00000267104		0.453	TBC1D3P1-DHX40P1-201	KNOWN	basic	lincRNA	TBC1D3P1-DHX40P1	HGNC	lincRNA		20	0.00	0	T	NR_002924		58085530	58085530	-1	no_errors	ENST00000407042	ensembl	human	known	69_37n	rna	26	16.13	5	SNP	0.068	C
ZNF275	10838	genome.wustl.edu	37	X	152613219	152613219	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3KD-01A-12D-A20S-09	TCGA-A2-A3KD-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	37ddccc5-9ff1-4733-a5a9-595bba074e54	4d1c9503-ba24-449f-8f5c-8eb3a54067a1	g.chrX:152613219G>A	ENST00000421401.3	+	4	1253	c.1076G>A	c.(1075-1077)cGt>cAt	p.R359H	ZNF275_ENST00000370249.2_Missense_Mutation_p.R306H|ZNF275_ENST00000440091.1_Missense_Mutation_p.R389H|ZNF275_ENST00000370251.3_Silent_p.P326P			Q9NSD4	ZN275_HUMAN	zinc finger protein 275	359					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AAGGCCTTCCGTGGGCCCTCT	0.667																																						dbGAP											0													19.0	19.0	19.0					X																	152613219		2198	4292	6490	-	-	-	SO:0001583	missense	0			BC041602		Xq28	2013-01-08			ENSG00000063587	ENSG00000063587		"""Zinc fingers, C2H2-type"", ""-"""	13069	protein-coding gene	gene with protein product							Standard	NM_001080485		Approved		uc004fhg.2	Q9NSD4	OTTHUMG00000067450	ENST00000421401.3:c.1076G>A	X.37:g.152613219G>A	ENSP00000398977:p.Arg359His		A6NE92	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R389H	ENST00000421401.3	37	c.1166		X	.	.	.	.	.	.	.	.	.	.	G	11.40	1.628086	0.28978	.	.	ENSG00000063587	ENST00000421401;ENST00000440091;ENST00000370249	T;T;T	0.15718	2.4;2.4;2.4	4.28	4.28	0.50868	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.39544	N	0.001334	T	0.36826	0.0981	.	.	.	0.29379	N	0.863424	D	0.89917	1.0	D	0.65987	0.94	T	0.18053	-1.0349	9	0.54805	T	0.06	-23.5825	13.4166	0.60972	0.0:0.0:1.0:0.0	.	359	Q9NSD4	ZN275_HUMAN	H	359;389;306	ENSP00000398977:R359H;ENSP00000411097:R389H;ENSP00000359269:R306H	ENSP00000359269:R306H	R	+	2	0	ZNF275	152266413	0.000000	0.05858	0.914000	0.36105	0.284000	0.27059	0.009000	0.13219	2.120000	0.65058	0.436000	0.28706	CGT	ZNF275	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000063587		0.667	ZNF275-201	KNOWN	basic	protein_coding	ZNF275	HGNC	protein_coding		67	0.00	0	G	NM_001080485		152613219	152613219	+1	no_errors	ENST00000440091	ensembl	human	known	69_37n	missense	59	23.38	18	SNP	0.797	A
