#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC8	6833	genome.wustl.edu	37	11	17424297	17424297	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr11:17424297G>T	ENST00000389817.3	-	29	3629	c.3561C>A	c.(3559-3561)gaC>gaA	p.D1187E	ABCC8_ENST00000302539.4_Missense_Mutation_p.D1188E			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1187	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	GCTGCTGCAGGTCCCTGTGGC	0.602																																						dbGAP											0													135.0	126.0	129.0					11																	17424297		2200	4293	6493	-	-	-	SO:0001583	missense	0			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.3561C>A	11.37:g.17424297G>T	ENSP00000374467:p.Asp1187Glu		A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.D1188E	ENST00000389817.3	37	c.3564	CCDS31437.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.04|10.04	1.242424|1.242424	0.22796|0.22796	.|.	.|.	ENSG00000006071|ENSG00000006071	ENST00000389817;ENST00000302539|ENST00000528374	D;D|.	0.88818|.	-2.43;-2.43|.	5.49|5.49	4.57|4.57	0.56435|0.56435	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.33411|0.33411	0.0862|0.0862	N|N	0.03154|0.03154	-0.405|-0.405	0.54753|0.54753	D|D	0.999981|0.999981	B|.	0.27140|.	0.169|.	B|.	0.41236|.	0.351|.	T|T	0.20009|0.20009	-1.0288|-1.0288	10|5	0.12430|.	T|.	0.62|.	.|.	14.7907|14.7907	0.69841|0.69841	0.07:0.0:0.93:0.0|0.07:0.0:0.93:0.0	.|.	1187|.	Q09428|.	ABCC8_HUMAN|.	E|T	1187;1188|11	ENSP00000374467:D1187E;ENSP00000303960:D1188E|.	ENSP00000303960:D1188E|.	D|P	-|-	3|1	2|0	ABCC8|ABCC8	17380873|17380873	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.970000|0.970000	0.65996|0.65996	2.605000|2.605000	0.46283|0.46283	1.435000|1.435000	0.47434|0.47434	0.655000|0.655000	0.94253|0.94253	GAC|CCT	ABCC8	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000006071		0.602	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	HGNC	protein_coding	OTTHUMT00000389093.1	72	0.00	0	G	NM_000352		17424297	17424297	-1	no_errors	ENST00000302539	ensembl	human	known	69_37n	missense	45	43.75	35	SNP	1.000	T
AGBL5	60509	genome.wustl.edu	37	2	27280266	27280266	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr2:27280266C>T	ENST00000360131.4	+	9	1790	c.1631C>T	c.(1630-1632)cCg>cTg	p.P544L	AGBL5_ENST00000323064.8_Missense_Mutation_p.P544L	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	544	Poly-Pro.				protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTCCCCCGCCGGCTTTCCCC	0.522																																						dbGAP											0													72.0	74.0	73.0					2																	27280266		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.1631C>T	2.37:g.27280266C>T	ENSP00000353249:p.Pro544Leu		A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	pfam_Peptidase_M14	p.P544L	ENST00000360131.4	37	c.1631	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	C	21.5	4.163517	0.78226	.	.	ENSG00000084693	ENST00000323064;ENST00000360131	T;T	0.32023	1.47;1.47	6.16	6.16	0.99307	.	0.093041	0.85682	D	0.000000	T	0.52933	0.1765	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.989	T	0.18116	-1.0347	10	0.19147	T	0.46	-20.399	20.4549	0.99139	0.0:1.0:0.0:0.0	.	544;544	Q8NDL9;Q8NDL9-3	CBPC5_HUMAN;.	L	544	ENSP00000323681:P544L;ENSP00000353249:P544L	ENSP00000323681:P544L	P	+	2	0	AGBL5	27133770	0.966000	0.33281	0.977000	0.42913	0.977000	0.68977	4.515000	0.60489	2.937000	0.99478	0.650000	0.86243	CCG	AGBL5	-	NULL	ENSG00000084693		0.522	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	59	0.00	0	C	NM_021831		27280266	27280266	+1	no_errors	ENST00000360131	ensembl	human	known	69_37n	missense	45	42.50	34	SNP	0.995	T
ARHGEF15	22899	genome.wustl.edu	37	17	8219172	8219172	+	Silent	SNP	T	T	C			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr17:8219172T>C	ENST00000361926.3	+	8	1631	c.1521T>C	c.(1519-1521)taT>taC	p.Y507Y	AC135178.7_ENST00000458568.1_RNA|ARHGEF15_ENST00000421050.1_Silent_p.Y507Y	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	507	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						TCTCGGTGTATGTGGATTATG	0.602																																						dbGAP											0													83.0	78.0	80.0					17																	8219172		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.1521T>C	17.37:g.8219172T>C			A8K6G1|Q8N449|Q9H8B4	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	p.Y507	ENST00000361926.3	37	c.1521	CCDS11139.1	17																																																																																			ARHGEF15	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000198844		0.602	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF15	HGNC	protein_coding	OTTHUMT00000226993.2	58	0.00	0	T	NM_173728		8219172	8219172	+1	no_errors	ENST00000361926	ensembl	human	known	69_37n	silent	27	46.00	23	SNP	0.972	C
ARID3B	10620	genome.wustl.edu	37	15	74889163	74889163	+	3'UTR	SNP	C	C	T	rs11072494	byFrequency	TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr15:74889163C>T	ENST00000563567.1	+	0	227				ARID3B_ENST00000346246.5_3'UTR			Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)							nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						aaatttttatCGTAGCACCAA	0.398													T|||	1817	0.362819	0.3533	0.4424	5008	,	,		14752	0.5724		0.1213	False		,,,				2504	0.3517					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000563567.1:c.*224C>T	15.37:g.74889163C>T			O95443|Q59HC9|Q6P9C9	RNA	SNP	-	NULL	ENST00000563567.1	37	NULL		15																																																																																			ARID3B	-	-	ENSG00000179361		0.398	ARID3B-006	PUTATIVE	basic|exp_conf	processed_transcript	ARID3B	HGNC	protein_coding	OTTHUMT00000420641.1	43	0.00	0	C	NM_006465		74889163	74889163	+1	no_errors	ENST00000563567	ensembl	human	putative	69_37n	rna	15	21.05	4	SNP	1.000	T
BAAT	570	genome.wustl.edu	37	9	104130496	104130496	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr9:104130496G>T	ENST00000395051.3	-	2	645	c.575C>A	c.(574-576)gCt>gAt	p.A192D	BAAT_ENST00000259407.2_Missense_Mutation_p.A192D			Q14032	BAAT_HUMAN	bile acid CoA:amino acid N-acyltransferase	192					acyl-CoA metabolic process (GO:0006637)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid conjugation (GO:0002152)|bile acid metabolic process (GO:0008206)|fatty acid metabolic process (GO:0006631)|glycine metabolic process (GO:0006544)|liver development (GO:0001889)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|taurine metabolic process (GO:0019530)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carboxylic ester hydrolase activity (GO:0052689)|glycine N-choloyltransferase activity (GO:0047963)|long-chain acyl-CoA hydrolase activity (GO:0052816)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|N-acyltransferase activity (GO:0016410)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|very long chain acyl-CoA hydrolase activity (GO:0052817)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		Acute lymphoblastic leukemia(62;0.0559)			Glycine(DB00145)	GTTATGGTAAGCCAAGGCCAA	0.498																																						dbGAP											0													67.0	70.0	69.0					9																	104130496		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34081	CCDS6752.1	9q22.3	2014-06-24	2014-06-24		ENSG00000136881	ENSG00000136881	2.3.1.65		932	protein-coding gene	gene with protein product	"""glycine N-choloyltransferase"""	602938	"""bile acid Coenzyme A:amino acid N-acyltransferase (glycine N-choloyltransferase)"", ""bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)"""				Standard	NM_001701		Approved	BAT	uc010mtd.3	Q14032	OTTHUMG00000020377	ENST00000395051.3:c.575C>A	9.37:g.104130496G>T	ENSP00000378491:p.Ala192Asp		Q3B7W9|Q96L31	Missense_Mutation	SNP	pfam_BAAT_C,pfam_Thio_Ohase/aa_AcTrfase,pirsf_Acyl-CoA_thioEstase_long-chain	p.A192D	ENST00000395051.3	37	c.575	CCDS6752.1	9	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257548	0.59321	.	.	ENSG00000136881	ENST00000259407;ENST00000395051	T;T	0.19250	2.16;2.16	4.47	3.58	0.41010	.	0.103749	0.41001	D	0.000973	T	0.53158	0.1779	M	0.93678	3.445	0.46823	D	0.999212	D	0.89917	1.0	D	0.79108	0.992	T	0.62609	-0.6818	10	0.87932	D	0	-23.2095	10.2811	0.43541	0.0964:0.0:0.9036:0.0	.	192	Q14032	BAAT_HUMAN	D	192	ENSP00000259407:A192D;ENSP00000378491:A192D	ENSP00000259407:A192D	A	-	2	0	BAAT	103170317	1.000000	0.71417	0.850000	0.33497	0.565000	0.35776	5.050000	0.64251	1.113000	0.41760	0.561000	0.74099	GCT	BAAT	-	pirsf_Acyl-CoA_thioEstase_long-chain	ENSG00000136881		0.498	BAAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAAT	HGNC	protein_coding	OTTHUMT00000053433.1	56	0.00	0	G			104130496	104130496	-1	no_errors	ENST00000259407	ensembl	human	known	69_37n	missense	38	11.63	5	SNP	0.959	T
CCDC185	164127	genome.wustl.edu	37	1	223568468	223568468	+	Nonsense_Mutation	SNP	G	G	T	rs370521807		TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr1:223568468G>T	ENST00000366875.3	+	1	1754	c.1651G>T	c.(1651-1653)Gag>Tag	p.E551*		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		551								p.E551K(1)		breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		ACTGAAAGCCGAGAAGGAGGA	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											100.0	105.0	103.0					1																	223568468		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0																														ENST00000366875.3:c.1651G>T	1.37:g.223568468G>T	ENSP00000355840:p.Glu551*		Q8N746|Q8NA93	Nonsense_Mutation	SNP	NULL	p.E551*	ENST00000366875.3	37	c.1651	CCDS1537.1	1	.	.	.	.	.	.	.	.	.	.	G	38	7.068027	0.98040	.	.	ENSG00000178395	ENST00000366875	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	17.4428	0.87569	0.0:0.0:1.0:0.0	.	.	.	.	X	551	.	ENSP00000355840:E551X	E	+	1	0	C1orf65	221635091	1.000000	0.71417	0.978000	0.43139	0.945000	0.59286	4.646000	0.61411	2.719000	0.93026	0.655000	0.94253	GAG	C1orf65	-	NULL	ENSG00000178395		0.522	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf65	HGNC	protein_coding	OTTHUMT00000092718.1	27	0.00	0	G			223568468	223568468	+1	no_errors	ENST00000366875	ensembl	human	known	69_37n	nonsense	56	17.65	12	SNP	0.996	T
CASK	8573	genome.wustl.edu	37	X	41416285	41416285	+	Splice_Site	SNP	C	C	T			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chrX:41416285C>T	ENST00000378163.1	-	19	2280	c.1806G>A	c.(1804-1806)tcG>tcA	p.S602S	CASK_ENST00000318588.9_Splice_Site_p.S602S|CASK_ENST00000378158.1_Splice_Site_p.S602S|CASK_ENST00000421587.2_Intron|CASK_ENST00000472704.1_Intron|CASK_ENST00000378166.4_Splice_Site_p.S602S|CASK_ENST00000361962.4_Splice_Site_p.S602S|CASK_ENST00000442742.2_Intron			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	602					calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						AAGTTCTTACCGAAACAGAAT	0.428																																					NSCLC(42;104 1086 3090 27189 35040)	dbGAP											0													154.0	110.0	125.0					X																	41416285		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.1806+1G>A	X.37:g.41416285C>T			A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Guanylate_kin,pfam_L27_C,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Guanylate_kin	p.S602	ENST00000378163.1	37	c.1806		X																																																																																			CASK	-	superfamily_SH3_domain	ENSG00000147044		0.428	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	CASK	HGNC	protein_coding	OTTHUMT00000056285.1	60	0.00	0	C	NM_003688	Silent	41416285	41416285	-1	no_errors	ENST00000378163	ensembl	human	known	69_37n	silent	37	46.38	32	SNP	1.000	T
CXCR6	10663	genome.wustl.edu	37	3	45988437	45988437	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr3:45988437T>C	ENST00000458629.1	+	1	1927	c.464T>C	c.(463-465)aTc>aCc	p.I155T	CXCR6_ENST00000438735.1_Missense_Mutation_p.I155T|CXCR6_ENST00000304552.4_Missense_Mutation_p.I155T|FYCO1_ENST00000535325.1_Intron|CXCR6_ENST00000457814.1_Missense_Mutation_p.I155T|FYCO1_ENST00000296137.2_Intron|FYCO1_ENST00000438446.1_Intron			O00574	CXCR6_HUMAN	chemokine (C-X-C motif) receptor 6	155					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|viral genome replication (GO:0019079)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(1)|kidney(3)|lung(1)|prostate(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		AGCTTGCTCATCTGGGTGATA	0.488																																					Esophageal Squamous(63;1005 1117 15521 45762 47089)	dbGAP											0													154.0	136.0	142.0					3																	45988437		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF007545	CCDS2735.1	3p21	2012-08-08			ENSG00000172215	ENSG00000172215		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	16647	protein-coding gene	gene with protein product		605163				9166430, 9230441	Standard	XM_005264809		Approved	TYMSTR, STRL33, BONZO, CD186	uc003cpc.1	O00574	OTTHUMG00000133448	ENST00000458629.1:c.464T>C	3.37:g.45988437T>C	ENSP00000395704:p.Ile155Thr		O00575|Q9HCA5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_CXCR6,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CXCR4	p.I155T	ENST00000458629.1	37	c.464	CCDS2735.1	3	.	.	.	.	.	.	.	.	.	.	T	13.80	2.346573	0.41599	.	.	ENSG00000172215	ENST00000438735;ENST00000304552;ENST00000458629;ENST00000457814	T;T;T;T	0.73152	-0.72;-0.72;-0.72;-0.72	5.57	1.91	0.25777	GPCR, rhodopsin-like superfamily (1);	0.356564	0.33092	N	0.005299	T	0.55800	0.1943	L	0.41710	1.295	0.26182	N	0.979711	B	0.06786	0.001	B	0.15052	0.012	T	0.37572	-0.9700	10	0.17832	T	0.49	.	8.8195	0.35016	0.0:0.2211:0.0:0.7789	.	155	O00574	CXCR6_HUMAN	T	155	ENSP00000396218:I155T;ENSP00000304414:I155T;ENSP00000395704:I155T;ENSP00000396886:I155T	ENSP00000304414:I155T	I	+	2	0	CXCR6	45963441	0.015000	0.18098	0.152000	0.22495	0.829000	0.46940	1.846000	0.39289	0.155000	0.19261	0.533000	0.62120	ATC	CXCR6	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000172215		0.488	CXCR6-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CXCR6	HGNC	protein_coding	OTTHUMT00000344395.1	51	0.00	0	T			45988437	45988437	+1	no_errors	ENST00000304552	ensembl	human	known	69_37n	missense	41	34.92	22	SNP	0.526	C
DMD	1756	genome.wustl.edu	37	X	31950256	31950256	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chrX:31950256T>A	ENST00000357033.4	-	46	6909	c.6703A>T	c.(6703-6705)Agt>Tgt	p.S2235C	DMD_ENST00000378707.3_5'UTR|DMD_ENST00000343523.2_5'UTR|DMD_ENST00000541735.1_5'UTR|DMD_ENST00000359836.1_5'UTR|DMD_ENST00000378677.2_Missense_Mutation_p.S2231C|DMD_ENST00000474231.1_5'UTR	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2235					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AGTGGGATACTAGCAATGTTA	0.368																																						dbGAP											0													111.0	103.0	106.0					X																	31950256		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.6703A>T	X.37:g.31950256T>A	ENSP00000354923:p.Ser2235Cys		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.S2235C	ENST00000357033.4	37	c.6703	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	t	10.52	1.374394	0.24857	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.55052	0.54;0.54	5.95	2.3	0.28687	.	1.589400	0.04359	U	0.357130	T	0.35828	0.0945	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001;0.0	T	0.27938	-1.0059	10	0.54805	T	0.06	.	4.5093	0.11903	0.2547:0.1563:0.0:0.589	.	894;2227;2235;2231;894;891	P11532-2;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;.;DMD_HUMAN;.;.;.	C	2227;894;891;2231;2235;2235;2112	ENSP00000367948:S2231C;ENSP00000354923:S2235C	ENSP00000354923:S2235C	S	-	1	0	DMD	31860177	0.000000	0.05858	0.001000	0.08648	0.616000	0.37450	0.555000	0.23422	0.818000	0.34468	0.478000	0.44815	AGT	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.368	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	82	0.00	0	T	NM_004006		31950256	31950256	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	missense	35	45.31	29	SNP	0.000	A
DNAAF2	55172	genome.wustl.edu	37	14	50101796	50101796	+	Silent	SNP	G	G	T			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr14:50101796G>T	ENST00000298292.8	-	1	152	c.72C>A	c.(70-72)acC>acA	p.T24T	DNAAF2_ENST00000406043.3_Silent_p.T24T	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	24					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						GGAAGGCGGAGGTGAGCCGCT	0.687																																						dbGAP											0													6.0	7.0	7.0					14																	50101796		1917	4061	5978	-	-	-	SO:0001819	synonymous_variant	0			AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.72C>A	14.37:g.50101796G>T			B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Silent	SNP	NULL	p.T24	ENST00000298292.8	37	c.72	CCDS9691.2	14																																																																																			DNAAF2	-	NULL	ENSG00000165506		0.687	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNAAF2	HGNC	protein_coding	OTTHUMT00000276813.1	94	0.00	0	G			50101796	50101796	-1	no_errors	ENST00000298292	ensembl	human	known	69_37n	silent	40	24.53	13	SNP	0.084	T
EI24	9538	genome.wustl.edu	37	11	125454349	125454349	+	3'UTR	SNP	C	C	G			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr11:125454349C>G	ENST00000530985.1	+	0	2221				EI24_ENST00000278903.6_3'UTR|EI24_ENST00000343678.4_3'UTR|STT3A-AS1_ENST00000530526.1_RNA|STT3A-AS1_ENST00000532714.1_RNA			O14681	EI24_HUMAN	etoposide induced 2.4						apoptotic process (GO:0006915)|autophagy (GO:0006914)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of cell growth (GO:0030308)|neuromuscular process controlling balance (GO:0050885)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|response to drug (GO:0042493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				large_intestine(1)|lung(9)|ovary(1)	11	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.64e-07)|OV - Ovarian serous cystadenocarcinoma(99;0.0975)		TTTTCAACTCCGTTGGTGGTG	0.443																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF010313	CCDS73410.1	11q24.2	2012-11-19	2012-11-16		ENSG00000149547	ENSG00000149547			13276	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 4 homolog (C. elegans)"""	605170	"""etoposide induced 2.4 mRNA"""			10594026, 9305847	Standard	NM_001290135		Approved	PIG8, TP53I8, EPG4	uc001qcb.3	O14681	OTTHUMG00000165851	ENST00000530985.1:c.*2218C>G	11.37:g.125454349C>G			A8K7D6|B4DKL6|Q9BUQ1	RNA	SNP	-	NULL	ENST00000530985.1	37	NULL		11																																																																																			EI24	-	-	ENSG00000149547		0.443	EI24-002	KNOWN	basic	processed_transcript	EI24	HGNC	protein_coding	OTTHUMT00000386671.1	42	0.00	0	C	NM_004879		125454349	125454349	+1	no_errors	ENST00000530985	ensembl	human	known	69_37n	rna	20	31.03	9	SNP	0.020	G
EIF2AK1	27102	genome.wustl.edu	37	7	6080848	6080848	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr7:6080848T>A	ENST00000199389.6	-	9	940	c.794A>T	c.(793-795)gAg>gTg	p.E265V	EIF2AK1_ENST00000536084.1_Missense_Mutation_p.E141V|EIF2AK1_ENST00000495565.1_5'UTR	NM_001134335.1|NM_014413.3	NP_001127807.1|NP_055228.2	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 1	265	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of hemoglobin biosynthetic process (GO:0046986)|negative regulation of translational initiation by iron (GO:0045993)|protein autophosphorylation (GO:0046777)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|response to external stimulus (GO:0009605)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	27		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		ACCACATTGCTCTCTGAAAAA	0.433																																						dbGAP											0													52.0	55.0	54.0					7																	6080848		2197	4299	6496	-	-	-	SO:0001583	missense	0			BC006524	CCDS5345.1	7p22	2005-01-20			ENSG00000086232	ENSG00000086232			24921	protein-coding gene	gene with protein product	"""heme regulated initiation factor 2 alpha kinase"""	613635				7709427, 10718198	Standard	NM_014413		Approved	HRI, KIAA1369	uc003spp.3	Q9BQI3	OTTHUMG00000090689	ENST00000199389.6:c.794A>T	7.37:g.6080848T>A	ENSP00000199389:p.Glu265Val		A8K2R2|Q549K6|Q8NBW3|Q9HC02|Q9NYE0|Q9P0V6|Q9P1J5|Q9P2H8|Q9UHG4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E265V	ENST00000199389.6	37	c.794	CCDS5345.1	7	.	.	.	.	.	.	.	.	.	.	.	12.33	1.905914	0.33628	.	.	ENSG00000086232	ENST00000199389;ENST00000536084	T;T	0.15256	2.44;2.44	5.15	2.66	0.31614	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.618971	0.17654	N	0.166580	T	0.13243	0.0321	L	0.37850	1.14	0.20489	N	0.999898	B;B;B	0.26002	0.032;0.139;0.037	B;B;B	0.24006	0.021;0.05;0.023	T	0.21965	-1.0230	10	0.28530	T	0.3	-4.6474	10.6134	0.45436	0.0:0.0:0.3093:0.6907	.	141;264;265	B4DIP4;Q9BQI3-2;Q9BQI3	.;.;E2AK1_HUMAN	V	265;141	ENSP00000199389:E265V;ENSP00000445784:E141V	ENSP00000199389:E265V	E	-	2	0	EIF2AK1	6047374	0.546000	0.26457	0.021000	0.16686	0.018000	0.09664	0.703000	0.25646	0.255000	0.21593	0.533000	0.62120	GAG	EIF2AK1	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000086232		0.433	EIF2AK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2AK1	HGNC	protein_coding	OTTHUMT00000207373.2	36	0.00	0	T	NM_014413		6080848	6080848	-1	no_errors	ENST00000199389	ensembl	human	known	69_37n	missense	21	34.29	12	SNP	0.468	A
FAM99B	100132464	genome.wustl.edu	37	11	1705462	1705462	+	RNA	SNP	G	G	A			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr11:1705462G>A	ENST00000382166.2	-	0	262					NR_026642.1				family with sequence similarity 99, member B (non-protein coding)																		AGGACAGGGAGCCTTCTCCAT	0.672																																						dbGAP											0																																										-	-	-			0			CR627417		11p15.5	2012-10-16	2011-08-31		ENSG00000205865	ENSG00000205865		"""Long non-coding RNAs"""	32369	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 99, member B"""				Standard	NR_026642		Approved	DKFZp781M09150	uc010qxa.1		OTTHUMG00000057552		11.37:g.1705462G>A				RNA	SNP	-	NULL	ENST00000382166.2	37	NULL		11																																																																																			FAM99B	-	-	ENSG00000205865		0.672	FAM99B-001	KNOWN	basic	antisense	FAM99B	HGNC	antisense	OTTHUMT00000127917.1	62	0.00	0	G			1705462	1705462	-1	no_errors	ENST00000382166	ensembl	human	known	69_37n	rna	51	33.77	26	SNP	0.001	A
FAM86B3P	286042	genome.wustl.edu	37	8	8098038	8098038	+	RNA	SNP	T	T	C	rs2945232	byFrequency	TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr8:8098038T>C	ENST00000310542.3	+	0	148				ALG1L13P_ENST00000523017.1_RNA					family with sequence similarity 86, member B3, pseudogene																		CCATGAAGGCTGACCGCTCCA	0.627													.|||	2738	0.546725	0.3351	0.6282	5008	,	,		17658	0.8383		0.4543	False		,,,				2504	0.5695					dbGAP											0																																										-	-	-			0					8p23.1	2013-06-10			ENSG00000173295	ENSG00000173295			44371	pseudogene	pseudogene							Standard	NR_024361		Approved		uc011kwt.2		OTTHUMG00000163669		8.37:g.8098038T>C				RNA	SNP	-	NULL	ENST00000310542.3	37	NULL		8																																																																																			RP11-556O5.3	-	-	ENSG00000173295		0.627	FAM86B3P-005	KNOWN	basic	processed_transcript	FLJ10661	Clone_based_vega_gene	pseudogene	OTTHUMT00000448496.1	93	0.00	0	T			8098038	8098038	+1	no_errors	ENST00000310542	ensembl	human	known	69_37n	rna	38	11.36	5	SNP	0.793	C
GLTP	51228	genome.wustl.edu	37	12	110290498	110290498	+	Silent	SNP	C	C	T			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr12:110290498C>T	ENST00000318348.4	-	5	605	c.492G>A	c.(490-492)gcG>gcA	p.A164A	GLTP_ENST00000544393.1_Silent_p.A145A	NM_016433.3	NP_057517.1	Q9NZD2	GLTP_HUMAN	glycolipid transfer protein	164					glycolipid transport (GO:0046836)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)|lipid binding (GO:0008289)			endometrium(1)|kidney(1)|lung(1)|upper_aerodigestive_tract(1)	4		Lung NSC(355;2.38e-06)|Breast(359;0.00354)|Myeloproliferative disorder(1001;0.0122)		BRCA - Breast invasive adenocarcinoma(302;0.0025)		CCTTGGAGAGCGCTTTCAGGA	0.562											OREG0022112	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													250.0	242.0	244.0					12																	110290498		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF209704, AY372530	CCDS9136.1	12q24.11	2008-08-08			ENSG00000139433	ENSG00000139433			24867	protein-coding gene	gene with protein product		608949				15287756, 15901739	Standard	NM_016433		Approved		uc001tpm.3	Q9NZD2	OTTHUMG00000169278	ENST00000318348.4:c.492G>A	12.37:g.110290498C>T		1426	Q53Z13|Q96J68	Missense_Mutation	SNP	pfam_Glycolipid_transfer_prot_dom,superfamily_Glycolipid_transfer_prot_dom	p.A138T	ENST00000318348.4	37	c.412	CCDS9136.1	12	.	.	.	.	.	.	.	.	.	.	C	4.571	0.106075	0.08780	.	.	ENSG00000139433	ENST00000540772	.	.	.	5.11	-10.2	0.00374	.	0.050288	0.85682	D	0.000000	T	0.32912	0.0845	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51442	-0.8705	6	0.24483	T	0.36	.	3.0133	0.06051	0.1352:0.1883:0.3679:0.3086	.	.	.	.	T	138	.	ENSP00000440136:A138T	A	-	1	0	GLTP	108774881	0.000000	0.05858	0.181000	0.23098	0.627000	0.37826	-5.104000	0.00151	-2.608000	0.00447	-3.232000	0.00051	GCT	GLTP	-	pfam_Glycolipid_transfer_prot_dom,superfamily_Glycolipid_transfer_prot_dom	ENSG00000139433		0.562	GLTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLTP	HGNC	protein_coding	OTTHUMT00000403278.2	52	0.00	0	C	NM_016433		110290498	110290498	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000540772	ensembl	human	putative	69_37n	missense	56	12.50	8	SNP	0.072	T
HECW1	23072	genome.wustl.edu	37	7	43484586	43484586	+	Silent	SNP	G	G	A			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr7:43484586G>A	ENST00000395891.2	+	11	2420	c.1815G>A	c.(1813-1815)acG>acA	p.T605T	HECW1_ENST00000453890.1_Silent_p.T605T	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	605					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						AGGTGGACACGGTGGCCGCTG	0.711																																						dbGAP											0													12.0	16.0	15.0					7																	43484586		2119	4228	6347	-	-	-	SO:0001819	synonymous_variant	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.1815G>A	7.37:g.43484586G>A			A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Silent	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.T605	ENST00000395891.2	37	c.1815	CCDS5469.2	7																																																																																			HECW1	-	NULL	ENSG00000002746		0.711	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	14	0.00	0	G	NM_015052		43484586	43484586	+1	no_errors	ENST00000395891	ensembl	human	known	69_37n	silent	2	71.43	5	SNP	0.042	A
HIC2	23119	genome.wustl.edu	37	22	21800989	21800989	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr22:21800989G>C	ENST00000443632.2	+	2	2177	c.1805G>C	c.(1804-1806)cGc>cCc	p.R602P	HIC2_ENST00000407464.2_Missense_Mutation_p.R602P|HIC2_ENST00000407598.2_Missense_Mutation_p.R602P			Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2	602					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				ACCCAGCAGCGCAACCTCATC	0.652																																					NSCLC(23;437 858 2282 27947 40366)	dbGAP											0													64.0	64.0	64.0					22																	21800989		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028943	CCDS13789.1	22q11.21	2013-01-09			ENSG00000169635	ENSG00000169635		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18595	protein-coding gene	gene with protein product		607712				11554746	Standard	NM_015094		Approved	KIAA1020, HRG22, ZBTB30, ZNF907	uc002zur.4	Q96JB3	OTTHUMG00000150781	ENST00000443632.2:c.1805G>C	22.37:g.21800989G>C	ENSP00000387757:p.Arg602Pro		Q504T6|Q96KR3|Q9NSM9|Q9UPX9	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R602P	ENST00000443632.2	37	c.1805	CCDS13789.1	22	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509084	0.64410	.	.	ENSG00000169635	ENST00000407464;ENST00000407598;ENST00000443632	T;T;T	0.11277	2.79;2.79;2.79	4.92	3.91	0.45181	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.19685	0.0473	L	0.48935	1.535	0.58432	D	0.999994	D	0.65815	0.995	P	0.58013	0.831	T	0.00634	-1.1634	10	0.54805	T	0.06	.	10.941	0.47273	0.0911:0.0:0.9089:0.0	.	602	Q96JB3	HIC2_HUMAN	P	602	ENSP00000385319:R602P;ENSP00000384889:R602P;ENSP00000387757:R602P	ENSP00000385319:R602P	R	+	2	0	HIC2	20130989	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.342000	0.72982	1.311000	0.45024	0.650000	0.86243	CGC	HIC2	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000169635		0.652	HIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIC2	HGNC	protein_coding	OTTHUMT00000320061.2	88	0.00	0	G			21800989	21800989	+1	no_errors	ENST00000407464	ensembl	human	known	69_37n	missense	61	12.86	9	SNP	1.000	C
IK	3550	genome.wustl.edu	37	5	140027592	140027593	+	Intron	INS	-	-	GT	rs70988770|rs377124947		TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr5:140027592_140027593insGT	ENST00000417647.2	+	1	155				IK_ENST00000523672.1_3'UTR|NDUFA2_ENST00000510680.1_5'Flank|NDUFA2_ENST00000512088.1_5'Flank|MIR3655_ENST00000581765.1_RNA|NDUFA2_ENST00000252102.4_5'Flank	NM_006083.3	NP_006074.2	Q13123	RED_HUMAN	IK cytokine, down-regulator of HLA II						cell-cell signaling (GO:0007267)|immune response (GO:0006955)	extracellular space (GO:0005615)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTTAAGCCGGgtgtgtgtgtg	0.53																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC051295	CCDS47280.1	5q31.3	2008-08-07			ENSG00000113141	ENSG00000113141			5958	protein-coding gene	gene with protein product		600549				7970704	Standard	NM_006083		Approved		uc003lgq.3	Q13123	OTTHUMG00000163374	ENST00000417647.2:c.16+83->GT	5.37:g.140027601_140027602dupGT			Q6IPD8	Splice_Site	INS	-	NULL	ENST00000417647.2	37	c.NULL	CCDS47280.1	5																																																																																			IK	-	-	ENSG00000113141		0.530	IK-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	IK	HGNC	protein_coding	OTTHUMT00000372897.1	11	0.00	0	-	NM_006083		140027592	140027593	+1	no_errors	ENST00000523672	ensembl	human	known	69_37n	splice_site_ins	22	26.67	8	INS	0.000:0.000	GT
KIAA0430	9665	genome.wustl.edu	37	16	15696479	15696480	+	Intron	DEL	GA	GA	-	rs373385405|rs373082870|rs79821793|rs76777980|rs71293163	byFrequency	TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	GA	GA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr16:15696479_15696480delGA	ENST00000396368.3	-	23	4620				KIAA0430_ENST00000547936.1_Intron|KIAA0430_ENST00000344181.3_Frame_Shift_Del_p.P1117fs|KIAA0430_ENST00000540441.2_Intron|KIAA0430_ENST00000602337.1_Intron|KIAA0430_ENST00000548025.1_Intron|KIAA0430_ENST00000551742.1_Intron	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430						double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						ggaggaggaggaaggaaagaag	0.406																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4414-419TC>-	16.37:g.15696479_15696480delGA			A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Frame_Shift_Del	DEL	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.P1114fs	ENST00000396368.3	37	c.3340_3339	CCDS10562.2	16																																																																																			KIAA0430	-	NULL	ENSG00000166783		0.406	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	HGNC	protein_coding	OTTHUMT00000252131.2	10	0.00	0	GA	NM_014647		15696479	15696480	-1	no_errors	ENST00000344181	ensembl	human	known	69_37n	frame_shift_del	9	31.25	5	DEL	0.000:0.000	-
LINGO2	158038	genome.wustl.edu	37	9	28295319	28295319	+	5'UTR	SNP	C	C	T			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr9:28295319C>T	ENST00000379992.2	-	0	250				LINGO2_ENST00000493941.1_5'UTR	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2							integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		ATGTCATGGGCAGCAGCATCT	0.453																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.-200G>A	9.37:g.28295319C>T			A8K4K7|B2RPM5|Q6ZMD0	RNA	SNP	-	NULL	ENST00000379992.2	37	NULL	CCDS6524.1	9																																																																																			LINGO2	-	-	ENSG00000174482		0.453	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO2	HGNC	protein_coding	OTTHUMT00000051978.2	62	0.00	0	C	NM_152570		28295319	28295319	-1	no_errors	ENST00000493941	ensembl	human	known	69_37n	rna	28	39.13	18	SNP	0.691	T
NPLOC4	55666	genome.wustl.edu	37	17	79534473	79534473	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr17:79534473G>T	ENST00000331134.6	-	15	1751	c.1536C>A	c.(1534-1536)ttC>ttA	p.F512L	NPLOC4_ENST00000572760.1_5'Flank|NPLOC4_ENST00000573876.1_5'Flank|NPLOC4_ENST00000374747.5_Missense_Mutation_p.F512L|NPLOC4_ENST00000539314.1_Missense_Mutation_p.F351L	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	512					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			TGGTGACCAGGAACAGCAAGA	0.498																																						dbGAP											0													107.0	102.0	103.0					17																	79534473		2009	4183	6192	-	-	-	SO:0001583	missense	0			AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.1536C>A	17.37:g.79534473G>T	ENSP00000331487:p.Phe512Leu		Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Missense_Mutation	SNP	pfam_NPL4,pfam_NPL4_Zn-bd_put,pfam_Npl4_Ub-like_dom,pirsf_PolyUb_recognition_cplx_Npl4	p.F512L	ENST00000331134.6	37	c.1536	CCDS45812.1	17	.	.	.	.	.	.	.	.	.	.	G	16.14	3.040168	0.55003	.	.	ENSG00000182446	ENST00000331134;ENST00000374747;ENST00000539314	.	.	.	5.83	-7.23	0.01480	Nuclear pore localisation protein NPL4 (1);	0.050519	0.85682	D	0.000000	T	0.61527	0.2354	M	0.67625	2.065	0.51012	D	0.999909	P;P;P	0.41008	0.633;0.51;0.735	B;B;B	0.42495	0.378;0.21;0.389	T	0.66760	-0.5842	9	0.59425	D	0.04	-23.2275	22.1812	0.99968	0.2107:0.0:0.7893:0.0	.	351;512;512	B4DG89;Q8TAT6-2;Q8TAT6	.;.;NPL4_HUMAN	L	512;511;351	.	ENSP00000331487:F512L	F	-	3	2	NPLOC4	77144911	1.000000	0.71417	0.706000	0.30403	0.992000	0.81027	0.625000	0.24477	-1.335000	0.02241	-0.302000	0.09304	TTC	NPLOC4	-	pfam_NPL4,pirsf_PolyUb_recognition_cplx_Npl4	ENSG00000182446		0.498	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPLOC4	HGNC	protein_coding	OTTHUMT00000440140.1	40	0.00	0	G			79534473	79534473	-1	no_errors	ENST00000374747	ensembl	human	known	69_37n	missense	26	36.59	15	SNP	0.764	T
PARP1	142	genome.wustl.edu	37	1	226549141	226549141	+	3'UTR	SNP	G	G	A			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr1:226549141G>A	ENST00000366794.5	-	0	3208				PARP1_ENST00000490921.1_5'UTR	NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1						base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		CACCGGGTGTGACTCGGCTAC	0.468								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																														dbGAP											0													42.0	38.0	40.0					1																	226549141		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.*20C>T	1.37:g.226549141G>A			B1ANJ4|Q8IUZ9	RNA	SNP	-	NULL	ENST00000366794.5	37	NULL	CCDS1554.1	1																																																																																			PARP1	-	-	ENSG00000143799		0.468	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP1	HGNC	protein_coding	OTTHUMT00000091519.1	37	0.00	0	G	NM_001618		226549141	226549141	-1	no_errors	ENST00000463968	ensembl	human	known	69_37n	rna	25	59.38	38	SNP	0.001	A
OR14I1	401994	genome.wustl.edu	37	1	248845530	248845530	+	Missense_Mutation	SNP	C	C	T	rs558079121		TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr1:248845530C>T	ENST00000342623.3	-	1	99	c.76G>A	c.(76-78)Gcc>Acc	p.A26T		NM_001004734.1	NP_001004734.1	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I, member 1	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(4)|large_intestine(2)|lung(24)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	35						AACAGCCCGGCGTGCAGCACC	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		18229	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													68.0	62.0	64.0					1																	248845530		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31125.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000189181	ENSG00000189181		"""GPCR / Class A : Olfactory receptors"""	19575	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BU, member 1"""	OR5BU1P, OR5BU1			Standard	NM_001004734		Approved		uc001ieu.1	A6ND48	OTTHUMG00000040378	ENST00000342623.3:c.76G>A	1.37:g.248845530C>T	ENSP00000339726:p.Ala26Thr			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt	p.A26T	ENST00000342623.3	37	c.76	CCDS31125.1	1	.	.	.	.	.	.	.	.	.	.	.	14.79	2.639760	0.47153	.	.	ENSG00000189181	ENST00000342623	T	0.00575	6.46	3.35	-2.93	0.05598	.	0.504333	0.16601	N	0.207332	T	0.01454	0.0047	M	0.74546	2.27	0.09310	N	1	D	0.89917	1.0	D	0.73708	0.981	T	0.42207	-0.9465	10	0.54805	T	0.06	.	2.8857	0.05660	0.3267:0.2788:0.0:0.3945	.	26	A6ND48	O14I1_HUMAN	T	26	ENSP00000339726:A26T	ENSP00000339726:A26T	A	-	1	0	OR14I1	246912153	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.897000	0.28390	-0.402000	0.07633	-0.268000	0.10319	GCC	OR14I1	-	prints_7TM_GPCR_Rhodpsn	ENSG00000189181		0.493	OR14I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR14I1	HGNC	protein_coding	OTTHUMT00000097128.1	31	0.00	0	C	NM_001004734		248845530	248845530	-1	no_errors	ENST00000342623	ensembl	human	known	69_37n	missense	64	23.81	20	SNP	0.000	T
RBMXL3	139804	genome.wustl.edu	37	X	114425058	114425058	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chrX:114425058G>A	ENST00000424776.3	+	1	1096	c.1054G>A	c.(1054-1056)Gtc>Atc	p.V352I	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	352							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CTTGCCAGTCGTCTTGCCAGA	0.627																																						dbGAP											0													24.0	25.0	25.0					X																	114425058		692	1591	2283	-	-	-	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.1054G>A	X.37:g.114425058G>A	ENSP00000417451:p.Val352Ile		B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.V352I	ENST00000424776.3	37	c.1054	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	G	5.783	0.328813	0.10956	.	.	ENSG00000175718	ENST00000424776	T	0.04862	3.54	0.0465	0.0465	0.14256	.	.	.	.	.	T	0.02083	0.0065	N	0.08118	0	0.09310	N	0.999999	P	0.47841	0.901	B	0.23419	0.046	T	0.46020	-0.9221	8	0.87932	D	0	.	.	.	.	.	352	Q8N7X1	RMXL3_HUMAN	I	352	ENSP00000417451:V352I	ENSP00000417451:V352I	V	+	1	0	RBMXL3	114331314	0.001000	0.12720	0.061000	0.19648	0.062000	0.15995	-1.771000	0.01789	0.122000	0.18314	0.124000	0.15798	GTC	RBMXL3	-	NULL	ENSG00000175718		0.627	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	91	0.00	0	G	NM_001145346		114425058	114425058	+1	no_errors	ENST00000424776	ensembl	human	known	69_37n	missense	58	36.26	33	SNP	0.840	A
SH2D3A	10045	genome.wustl.edu	37	19	6755277	6755277	+	Silent	SNP	C	C	T			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr19:6755277C>T	ENST00000245908.6	-	5	815	c.546G>A	c.(544-546)ccG>ccA	p.P182P	SH2D3A_ENST00000437152.3_Silent_p.P60P|SH2D3A_ENST00000599563.1_5'UTR	NM_005490.2	NP_005481.2	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	182					JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|urinary_tract(1)	24						TCAGCAACACCGGGTCACTGC	0.597																																						dbGAP											0													88.0	93.0	91.0					19																	6755277		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF124249	CCDS12173.1	19p13.3	2013-02-14	2002-01-14			ENSG00000125731		"""SH2 domain containing"""	16885	protein-coding gene	gene with protein product		604721	"""SH2 domain-containing 3A"""			10187783	Standard	NM_005490		Approved	NSP1	uc002mft.3	Q9BRG2		ENST00000245908.6:c.546G>A	19.37:g.6755277C>T			A8K9R6|B4DRS7|Q9Y2X4	Silent	SNP	pfam_SH2,pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_SH2,smart_RasGRF_CDC25,pfscan_SH2,prints_SH2	p.P182	ENST00000245908.6	37	c.546	CCDS12173.1	19																																																																																			SH2D3A	-	NULL	ENSG00000125731		0.597	SH2D3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH2D3A	HGNC	protein_coding	OTTHUMT00000458016.1	82	0.00	0	C	NM_005490		6755277	6755277	-1	no_errors	ENST00000245908	ensembl	human	known	69_37n	silent	39	45.07	32	SNP	0.020	T
SLC18B1	116843	genome.wustl.edu	37	6	133118190	133118191	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr6:133118190_133118191insA	ENST00000275227.4	-	2	209_210	c.113_114insT	c.(112-114)atafs	p.I38fs	SLC18B1_ENST00000367918.1_Frame_Shift_Ins_p.I38fs|SLC18B1_ENST00000538764.1_5'UTR|SLC18B1_ENST00000460518.1_5'UTR	NM_052831.2	NP_439896.1	Q6NT16	S18B1_HUMAN	solute carrier family 18, subfamily B, member 1	38					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)											AAGCTGCCGATATCAGTACAAA	0.455																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK124442	CCDS5163.1	6q22.3-q23.3	2013-05-22	2012-03-09	2012-03-09	ENSG00000146409	ENSG00000146409		"""Solute carriers"""	21573	protein-coding gene	gene with protein product		613361	"""chromosome 6 open reading frame 192"""	C6orf192		19697161	Standard	XM_006715328		Approved	dJ55C23.6	uc003qdw.1	Q6NT16	OTTHUMG00000015595	ENST00000275227.4:c.114dupT	6.37:g.133118191_133118191dupA	ENSP00000275227:p.Ile38fs		A8K1K3|B3KW77|Q6ISF2	Frame_Shift_Ins	INS	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S39fs	ENST00000275227.4	37	c.114_113	CCDS5163.1	6																																																																																			SLC18B1	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000146409		0.455	SLC18B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18B1	HGNC	protein_coding	OTTHUMT00000042273.1	38	0.00	0	-	NM_052831		133118190	133118191	-1	no_errors	ENST00000275227	ensembl	human	known	69_37n	frame_shift_ins	21	47.50	19	INS	0.995:0.997	A
SMCR8	140775	genome.wustl.edu	37	17	18220650	18220650	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr17:18220650G>C	ENST00000406438.3	+	1	2027	c.1547G>C	c.(1546-1548)aGt>aCt	p.S516T	TOP3A_ENST00000542570.1_5'Flank|TOP3A_ENST00000582230.1_5'Flank|TOP3A_ENST00000321105.5_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	516						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						AGCGAGGACAGTATTGAAGTC	0.522																																						dbGAP											0													83.0	81.0	81.0					17																	18220650		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.1547G>C	17.37:g.18220650G>C	ENSP00000385025:p.Ser516Thr		A5PKZ5|Q3ZCN0|Q6PJL3	Missense_Mutation	SNP	pfam_Folliculin	p.S516T	ENST00000406438.3	37	c.1547	CCDS11195.2	17	.	.	.	.	.	.	.	.	.	.	G	20.1	3.941014	0.73557	.	.	ENSG00000176994	ENST00000406438	T	0.35421	1.31	5.91	5.91	0.95273	.	0.192533	0.50627	D	0.000107	T	0.52533	0.1740	L	0.34521	1.04	0.50632	D	0.999883	D	0.76494	0.999	D	0.80764	0.994	T	0.47983	-0.9074	10	0.52906	T	0.07	-68.4326	20.2983	0.98569	0.0:0.0:1.0:0.0	.	516	Q8TEV9	SMCR8_HUMAN	T	516	ENSP00000385025:S516T	ENSP00000385025:S516T	S	+	2	0	SMCR8	18161375	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	9.167000	0.94773	2.802000	0.96397	0.655000	0.94253	AGT	SMCR8	-	NULL	ENSG00000176994		0.522	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR8	HGNC	protein_coding	OTTHUMT00000132065.2	38	0.00	0	G	NM_144775		18220650	18220650	+1	no_errors	ENST00000406438	ensembl	human	known	69_37n	missense	34	29.17	14	SNP	1.000	C
TMEM41B	440026	genome.wustl.edu	37	11	9310063	9310063	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr11:9310063G>T	ENST00000528080.1	-	4	726	c.388C>A	c.(388-390)Cca>Aca	p.P130T	TMEM41B_ENST00000527813.1_Missense_Mutation_p.P130T	NM_015012.3	NP_055827.1	Q5BJD5	TM41B_HUMAN	transmembrane protein 41B	130					nervous system development (GO:0007399)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(1)|prostate(1)|urinary_tract(2)	7				all cancers(16;9.96e-08)|Epithelial(150;4.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0972)		ATAGAGCCTGGAATAGCAAAT	0.294																																						dbGAP											0													53.0	57.0	56.0					11																	9310063		2200	4293	6493	-	-	-	SO:0001583	missense	0			D26067	CCDS31424.1, CCDS53600.1	11p15.3	2008-02-05			ENSG00000166471	ENSG00000166471			28948	protein-coding gene	gene with protein product						7584026, 7584028	Standard	NM_015012		Approved	KIAA0033	uc001mhn.2	Q5BJD5	OTTHUMG00000165719	ENST00000528080.1:c.388C>A	11.37:g.9310063G>T	ENSP00000433126:p.Pro130Thr		D3DQU9|E9PP29|Q15055|Q4G0P0	Missense_Mutation	SNP	pfam_SNARE_assoc	p.P130T	ENST00000528080.1	37	c.388	CCDS31424.1	11	.	.	.	.	.	.	.	.	.	.	G	23.9	4.471391	0.84533	.	.	ENSG00000166471	ENST00000299596;ENST00000528080;ENST00000527813	T;T;T	0.57752	0.38;0.38;0.38	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.82167	0.4978	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86946	0.2082	10	0.87932	D	0	-1.8351	19.88	0.96892	0.0:0.0:1.0:0.0	.	130	Q5BJD5	TM41B_HUMAN	T	130	ENSP00000299596:P130T;ENSP00000433126:P130T;ENSP00000435685:P130T	ENSP00000299596:P130T	P	-	1	0	TMEM41B	9266639	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.703000	0.92315	0.655000	0.94253	CCA	TMEM41B	-	pfam_SNARE_assoc	ENSG00000166471		0.294	TMEM41B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM41B	HGNC	protein_coding	OTTHUMT00000385940.2	25	0.00	0	G			9310063	9310063	-1	no_errors	ENST00000299596	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	T
TSPAN7	7102	genome.wustl.edu	37	X	38482195	38482195	+	Intron	SNP	C	C	T			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chrX:38482195C>T	ENST00000378482.2	+	2	258				TM4SF2_ENST00000465127.1_Intron|TSPAN7_ENST00000488893.1_Intron|TSPAN7_ENST00000422612.2_Intron|TSPAN7_ENST00000545599.1_5'UTR|TSPAN7_ENST00000286824.6_Intron	NM_004615.3	NP_004606.2	P41732	TSN7_HUMAN	tetraspanin 7						viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	11						GGTTTCTCCTCATTTACATAA	0.373																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D29808	CCDS14248.1	Xp11.4	2013-02-14	2005-03-21	2005-03-21	ENSG00000156298	ENSG00000156298		"""CD molecules"", ""Tetraspanins"""	11854	protein-coding gene	gene with protein product		300096	"""transmembrane 4 superfamily member 2"", ""mental retardation, X-linked 58"""	MXS1, TM4SF2, MRX58		12070254	Standard	NM_004615		Approved	DXS1692E, TALLA-1, A15, CD231	uc004deg.4	P41732	OTTHUMG00000024090	ENST00000378482.2:c.82-43180C>T	X.37:g.38482195C>T			B2R5W7|D3DWB1|Q8WVG5|Q9UEY9	Missense_Mutation	SNP	NULL	p.H41Y	ENST00000378482.2	37	c.121	CCDS14248.1	X																																																																																			TSPAN7	-	NULL	ENSG00000156298		0.373	TSPAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN7	HGNC	protein_coding	OTTHUMT00000356412.1	34	0.00	0	C			38482195	38482195	+1	no_errors	ENST00000475216	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.037	T
UBE2A	7319	genome.wustl.edu	37	X	118717178	118717178	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chrX:118717178G>T	ENST00000371558.2	+	6	593	c.419G>T	c.(418-420)cGt>cTt	p.R140L	UBE2A_ENST00000371569.5_Missense_Mutation_p.R65L|UBE2A_ENST00000346330.3_Missense_Mutation_p.R110L	NM_001282161.1|NM_003336.2|NM_181762.1	NP_001269090.1|NP_003327.2|NP_861427.1	P49459	UBE2A_HUMAN	ubiquitin-conjugating enzyme E2A	140					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|DNA repair (GO:0006281)|histone H2A ubiquitination (GO:0033522)|in utero embryonic development (GO:0001701)|maternal process involved in female pregnancy (GO:0060135)|positive regulation of cell proliferation (GO:0008284)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|response to UV (GO:0009411)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|cytosol (GO:0005829)|HULC complex (GO:0033503)|nuclear chromatin (GO:0000790)|XY body (GO:0001741)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)			haematopoietic_and_lymphoid_tissue(1)|lung(7)	8						TATGAAAAGCGTGTTTCTGCA	0.433								Rad6 pathway																														dbGAP											0													138.0	125.0	129.0					X																	118717178		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK223045	CCDS14580.1, CCDS14581.1	Xq24	2011-05-19	2011-05-19		ENSG00000077721	ENSG00000077721		"""Ubiquitin-conjugating enzymes E2"""	12472	protein-coding gene	gene with protein product		312180	"""ubiquitin-conjugating enzyme E2A (RAD6 homolog)"""			1559696	Standard	NM_003336		Approved	UBC2, HHR6A, RAD6A	uc004erl.3	P49459	OTTHUMG00000022275	ENST00000371558.2:c.419G>T	X.37:g.118717178G>T	ENSP00000360613:p.Arg140Leu		A6NFE9|A6NGR2|A6NMF5|B2R7R9|D3DWI1|Q4TTG1|Q96FX4	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.R140L	ENST00000371558.2	37	c.419	CCDS14580.1	X	.	.	.	.	.	.	.	.	.	.	G	23.9	4.467032	0.84533	.	.	ENSG00000077721	ENST00000371558;ENST00000346330;ENST00000371569	T;T;T	0.71222	-0.55;-0.55;-0.55	6.04	6.04	0.98038	Ubiquitin-conjugating enzyme, E2 (1);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.72534	0.3472	L	0.47016	1.485	0.80722	D	1	P;P	0.46457	0.878;0.523	P;P	0.47786	0.557;0.536	T	0.71220	-0.4657	10	0.39692	T	0.17	-21.3955	18.3451	0.90319	0.0:0.0:1.0:0.0	.	110;140	A6NGR2;P49459	.;UBE2A_HUMAN	L	140;110;65	ENSP00000360613:R140L;ENSP00000335027:R110L;ENSP00000360624:R65L	ENSP00000335027:R110L	R	+	2	0	UBE2A	118601206	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.052000	0.89448	2.558000	0.86282	0.594000	0.82650	CGT	UBE2A	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD	ENSG00000077721		0.433	UBE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2A	HGNC	protein_coding	OTTHUMT00000058036.1	67	0.00	0	G	NM_003336		118717178	118717178	+1	no_errors	ENST00000371558	ensembl	human	known	69_37n	missense	30	53.85	35	SNP	1.000	T
ZFP36L1	677	genome.wustl.edu	37	14	69256924	69256925	+	Frame_Shift_Ins	INS	-	-	GC			TCGA-A2-A3XU-01A-12D-A22X-09	TCGA-A2-A3XU-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	468cd8a6-60b1-465a-b44f-1e3515166a34	b9a3f99c-a15f-4552-aa83-d22cbbd3c921	g.chr14:69256924_69256925insGC	ENST00000439696.2	-	2	643_644	c.342_343insGC	c.(340-345)cgctacfs	p.Y115fs	ZFP36L1_ENST00000336440.3_Frame_Shift_Ins_p.Y115fs|ZFP36L1_ENST00000555997.1_3'UTR	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	115					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TCCGTCTTGTAGCGGCTGGAGT	0.668											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.341_342dupGC	14.37:g.69256925_69256926dupGC	ENSP00000388402:p.Tyr115fs	1113	Q13851	Frame_Shift_Ins	INS	pfam_Tis11B_N,pfam_Znf_CCCH,smart_Znf_CCCH	p.Y114fs	ENST00000439696.2	37	c.343_342	CCDS9791.1	14																																																																																			ZFP36L1	-	smart_Znf_CCCH	ENSG00000185650		0.668	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP36L1	HGNC	protein_coding	OTTHUMT00000413227.1	121	0.00	0	-			69256924	69256925	-1	no_errors	ENST00000336440	ensembl	human	known	69_37n	frame_shift_ins	21	68.18	45	INS	1.000:1.000	GC
