#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AGPAT9	84803	genome.wustl.edu	37	4	84516078	84516078	+	Silent	SNP	C	C	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr4:84516078C>T	ENST00000395226.2	+	8	1037	c.819C>T	c.(817-819)cgC>cgT	p.R273R	AGPAT9_ENST00000264409.4_Silent_p.R273R	NM_001256421.1	NP_001243350.1	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9	273					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|regulation of TOR signaling (GO:0032006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(3)	13		Hepatocellular(203;0.114)				GGTTTGAACGCTCAGAAATGA	0.448																																						dbGAP											0													149.0	144.0	145.0					4																	84516078		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055749	CCDS3606.1	4q21.23	2014-02-13	2008-01-29		ENSG00000138678	ENSG00000138678	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	28157	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, theta"""	610958	"""1-acylglycerol-3-phosphate O-acyltransferase 9 (lysophosphatidic acid acyltransferase, theta)"""			12975309	Standard	NM_001256421		Approved	MGC11324, LPAAT-theta, MAG1, HMFN0839	uc003how.4	Q53EU6	OTTHUMG00000130431	ENST00000395226.2:c.819C>T	4.37:g.84516078C>T			Q68CJ4|Q6GPI6|Q96NA3	Silent	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.R273	ENST00000395226.2	37	c.819	CCDS3606.1	4																																																																																			AGPAT9	-	pfam_Acyltransferase,smart_Acyltransferase	ENSG00000138678		0.448	AGPAT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPAT9	HGNC	protein_coding	OTTHUMT00000252821.3	125	0.00	0	C	NM_032717		84516078	84516078	+1	no_errors	ENST00000264409	ensembl	human	known	69_37n	silent	70	12.50	10	SNP	0.670	T
AKAP13	11214	genome.wustl.edu	37	15	86286780	86286780	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr15:86286780G>C	ENST00000394518.2	+	36	8211	c.8116G>C	c.(8116-8118)Gag>Cag	p.E2706Q	AKAP13_ENST00000394510.2_Missense_Mutation_p.E951Q|AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000361243.2_Missense_Mutation_p.E2710Q|RP11-158M2.3_ENST00000558375.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2706	Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CAGTCCTGAGGAGCCCCCCTC	0.507																																					Melanoma(94;603 1453 3280 32295 32951)	dbGAP											0													110.0	119.0	116.0					15																	86286780		2202	4299	6501	-	-	-	SO:0001583	missense	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.8116G>C	15.37:g.86286780G>C	ENSP00000378026:p.Glu2706Gln		Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.E2710Q	ENST00000394518.2	37	c.8128	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	G	16.78	3.217844	0.58560	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	T;T;T	0.47528	0.84;0.84;0.84	5.73	5.73	0.89815	.	.	.	.	.	T	0.63438	0.2511	L	0.59436	1.845	0.33306	D	0.565459	D;D	0.67145	0.993;0.996	P;P	0.61658	0.782;0.892	T	0.71290	-0.4637	9	0.54805	T	0.06	.	17.0692	0.86568	0.0:0.0:1.0:0.0	.	2706;2710	Q12802;Q12802-2	AKP13_HUMAN;.	Q	2710;2706;2709;2685;951	ENSP00000354718:E2710Q;ENSP00000378026:E2706Q;ENSP00000378018:E951Q	ENSP00000354718:E2710Q	E	+	1	0	AKAP13	84087784	1.000000	0.71417	0.987000	0.45799	0.056000	0.15407	6.760000	0.74939	2.721000	0.93114	0.655000	0.94253	GAG	AKAP13	-	NULL	ENSG00000170776		0.507	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	67	0.00	0	G	NM_007200		86286780	86286780	+1	no_errors	ENST00000361243	ensembl	human	known	69_37n	missense	57	18.57	13	SNP	0.999	C
C11orf30	56946	genome.wustl.edu	37	11	76239376	76239376	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr11:76239376T>C	ENST00000529032.1	+	13	2060	c.2060T>C	c.(2059-2061)cTa>cCa	p.L687P	C11orf30_ENST00000343878.3_Missense_Mutation_p.L687P|C11orf30_ENST00000334736.3_Missense_Mutation_p.L687P|C11orf30_ENST00000525919.1_Missense_Mutation_p.L688P|C11orf30_ENST00000524490.1_Missense_Mutation_p.L603P|C11orf30_ENST00000533248.1_Missense_Mutation_p.L701P|C11orf30_ENST00000525038.1_Missense_Mutation_p.L702P|C11orf30_ENST00000524767.1_Missense_Mutation_p.L702P			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	687					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						ACAAGACAGCTAGTAACAGAA	0.368																																						dbGAP											0													113.0	108.0	109.0					11																	76239376		2200	4292	6492	-	-	-	SO:0001583	missense	0			AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.2060T>C	11.37:g.76239376T>C	ENSP00000432327:p.Leu687Pro		B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	pfam_ENT_N,pfscan_ENT_N	p.L687P	ENST00000529032.1	37	c.2060	CCDS8244.1	11	.	.	.	.	.	.	.	.	.	.	T	17.25	3.341134	0.60963	.	.	ENSG00000158636	ENST00000524490;ENST00000334736;ENST00000343878;ENST00000393457;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032;ENST00000524451	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.66147	0.2760	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.998;0.998;0.998;0.999;0.999;0.998;0.999	D;D;D;D;D;D;D	0.85130	0.995;0.995;0.995;0.997;0.997;0.995;0.997	T	0.65713	-0.6101	9	0.39692	T	0.17	-5.4788	16.1141	0.81289	0.0:0.0:0.0:1.0	.	701;702;702;55;688;603;687	B7ZKT8;B7ZKU2;B7ZKU0;B3KWW8;Q17RM7;E9PMC9;Q7Z589	.;.;.;.;.;.;EMSY_HUMAN	P	603;687;687;490;702;701;688;702;687;80	.	ENSP00000334130:L687P	L	+	2	0	C11orf30	75917024	1.000000	0.71417	0.999000	0.59377	0.892000	0.51952	7.107000	0.77047	2.214000	0.71695	0.528000	0.53228	CTA	C11orf30	-	NULL	ENSG00000158636		0.368	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf30	HGNC	protein_coding	OTTHUMT00000383288.2	29	0.00	0	T	NM_020193		76239376	76239376	+1	no_errors	ENST00000334736	ensembl	human	known	69_37n	missense	41	14.58	7	SNP	1.000	C
C15orf39	56905	genome.wustl.edu	37	15	75498684	75498684	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr15:75498684G>T	ENST00000360639.2	+	2	615	c.295G>T	c.(295-297)Gaa>Taa	p.E99*	C15orf39_ENST00000394987.4_Nonsense_Mutation_p.E99*|C15orf39_ENST00000567617.1_Nonsense_Mutation_p.E99*			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	99						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						CTCGCCAGCAGAAGGCCCTGA	0.617																																						dbGAP											0													60.0	50.0	53.0					15																	75498684		2197	4295	6492	-	-	-	SO:0001587	stop_gained	0			AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.295G>T	15.37:g.75498684G>T	ENSP00000353854:p.Glu99*		B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Nonsense_Mutation	SNP	NULL	p.E99*	ENST00000360639.2	37	c.295	CCDS10276.1	15	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765226	0.90020	.	.	ENSG00000167173	ENST00000360639;ENST00000394987	.	.	.	5.13	5.13	0.70059	.	0.779717	0.11922	N	0.516548	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-3.1829	15.3115	0.74035	0.0:0.0:1.0:0.0	.	.	.	.	X	99	.	ENSP00000353854:E99X	E	+	1	0	C15orf39	73285737	1.000000	0.71417	0.164000	0.22755	0.203000	0.24098	5.508000	0.67006	2.393000	0.81446	0.561000	0.74099	GAA	C15orf39	-	NULL	ENSG00000167173		0.617	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf39	HGNC	protein_coding	OTTHUMT00000286410.1	54	0.00	0	G	NM_015492		75498684	75498684	+1	no_errors	ENST00000360639	ensembl	human	known	69_37n	nonsense	47	14.55	8	SNP	0.401	T
MTHFR	4524	genome.wustl.edu	37	1	11844330	11844330	+	IGR	SNP	C	C	T	rs10864543	byFrequency	TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr1:11844330C>T	ENST00000376592.1	-	0	7057				C1orf167_ENST00000433342.1_Silent_p.A1059A			P42898	MTHR_HUMAN	methylenetetrahydrofolate reductase (NAD(P)H)						blood circulation (GO:0008015)|cellular amino acid metabolic process (GO:0006520)|folic acid metabolic process (GO:0046655)|homocysteine metabolic process (GO:0050667)|methionine biosynthetic process (GO:0009086)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to vitamin B2 (GO:0033274)|S-adenosylmethionine metabolic process (GO:0046500)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|neuron projection (GO:0043005)	flavin adenine dinucleotide binding (GO:0050660)|methylenetetrahydrofolate reductase (NAD(P)H) activity (GO:0004489)|modified amino acid binding (GO:0072341)|NADP binding (GO:0050661)			NS(4)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Fluorouracil(DB00544)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Riboflavin(DB00140)|Tetrahydrofolic acid(DB00116)	CACTGGGGGCCGTGTTTGCCA	0.662													C|||	2494	0.498003	0.1415	0.7334	5008	,	,		18045	0.7649		0.6173	False		,,,				2504	0.4151					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			BC053509	CCDS137.1	1p36.3	2014-09-17	2010-05-04		ENSG00000177000	ENSG00000177000	1.5.1.20		7436	protein-coding gene	gene with protein product		607093	"""5,10-methylenetetrahydrofolate reductase (NADPH)"""			7920641	Standard	NM_005957		Approved		uc001atc.2	P42898	OTTHUMG00000002277		1.37:g.11844330C>T			B2R7A6|Q5SNW6|Q5SNW9|Q7Z6M6|Q8IU73|Q9UQR2	Missense_Mutation	SNP	NULL	p.R419C	ENST00000376592.1	37	c.1255	CCDS137.1	1	1284|1284	0.5879120879120879|0.5879120879120879	101|101	0.20528455284552846|0.20528455284552846	257|257	0.7099447513812155|0.7099447513812155	459|459	0.8024475524475524|0.8024475524475524	467|467	0.6160949868073878|0.6160949868073878	C|C	6.425|6.425	0.446510|0.446510	0.12223|0.12223	.|.	.|.	ENSG00000215910|ENSG00000215910	ENST00000449278|ENST00000312793;ENST00000444493	.|.	.|.	.|.	3.65|3.65	-4.88|-4.88	0.03113|0.03113	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	.|.	.|.	.|.	0.80722|0.80722	P|P	0.0|0.0	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.29366|0.29366	-1.0014|-1.0014	3|3	.|.	.|.	.|.	-0.4508|-0.4508	4.8004|4.8004	0.13294|0.13294	0.0:0.2498:0.3001:0.4501|0.0:0.2498:0.3001:0.4501	rs10864543|rs10864543	.|.	.|.	.|.	L|C	145|419;202	.|.	.|.	P|R	+|+	2|1	0|0	C1orf167|C1orf167	11766917|11766917	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-1.022000|-1.022000	0.03611|0.03611	-0.732000|-0.732000	0.04856|0.04856	-0.254000|-0.254000	0.11334|0.11334	CCG|CGT	C1orf167	-	NULL	ENSG00000215910		0.662	MTHFR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C1orf167	HGNC	protein_coding	OTTHUMT00000006538.1	35	0.00	0	C	NM_005957		11844330	11844330	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000312793	ensembl	human	putative	69_37n	missense	30	14.29	5	SNP	0.000	T
C6orf183	389422	genome.wustl.edu	37	6	109591433	109591433	+	RNA	SNP	T	T	C	rs9400262	byFrequency	TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr6:109591433T>C	ENST00000453496.2	+	0	1685							Q5T699	CF183_HUMAN	chromosome 6 open reading frame 183																		CACCAGCTAATGTCAGGCTGC	0.498													T|||	2005	0.400359	0.528	0.3242	5008	,	,		16859	0.4643		0.3648	False		,,,				2504	0.2526					dbGAP											0																																										-	-	-			0					6q21	2013-11-06	2012-02-07	2012-02-07	ENSG00000243587	ENSG00000243587			21562	other	unknown							Standard			Approved	bA487F23.3		Q5T699	OTTHUMG00000015337		6.37:g.109591433T>C				Silent	SNP	NULL	p.N546	ENST00000453496.2	37	c.1638		6																																																																																			C6orf183	-	NULL	ENSG00000243587		0.498	C6orf183-002	KNOWN	basic	processed_transcript	C6orf183	HGNC	polymorphic_pseudogene	OTTHUMT00000257660.2	25	0.00	0	T			109591433	109591433	+1	no_errors	ENST00000534901	ensembl	human	known	69_37n	silent	24	14.29	4	SNP	0.000	C
CASZ1	54897	genome.wustl.edu	37	1	10713493	10713493	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr1:10713493G>A	ENST00000377022.3	-	11	2938	c.2621C>T	c.(2620-2622)tCg>tTg	p.S874L	RP4-734G22.3_ENST00000606802.1_RNA|CASZ1_ENST00000344008.5_Missense_Mutation_p.S874L	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	874					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CATCATGGGCGAGATGAGGCC	0.662																																						dbGAP											0													35.0	41.0	39.0					1																	10713493		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.2621C>T	1.37:g.10713493G>A	ENSP00000366221:p.Ser874Leu		Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S874L	ENST00000377022.3	37	c.2621	CCDS41246.1	1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.641992	0.67244	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	3.9	3.9	0.45041	.	0.140685	0.49305	D	0.000142	T	0.66752	0.2821	L	0.34521	1.04	0.44417	D	0.99733	D;D;D	0.76494	0.999;0.999;0.996	P;D;P	0.77557	0.892;0.99;0.68	T	0.72404	-0.4304	9	0.87932	D	0	-6.2417	16.7942	0.85597	0.0:0.0:1.0:0.0	.	898;874;874	B7Z1S3;Q86V15-2;Q86V15	.;.;CASZ1_HUMAN	L	874	.	ENSP00000339445:S874L	S	-	2	0	CASZ1	10636080	1.000000	0.71417	0.984000	0.44739	0.974000	0.67602	7.356000	0.79445	2.117000	0.64856	0.563000	0.77884	TCG	CASZ1	-	NULL	ENSG00000130940		0.662	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	198	0.00	0	G	NM_017766		10713493	10713493	-1	no_errors	ENST00000377022	ensembl	human	known	69_37n	missense	138	13.75	22	SNP	0.998	A
CHM	1121	genome.wustl.edu	37	X	85302527	85302527	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chrX:85302527T>C	ENST00000357749.2	-	1	39	c.10A>G	c.(10-12)Act>Gct	p.T4A	CHM_ENST00000537751.1_De_novo_Start_OutOfFrame|CHM_ENST00000467744.2_5'Flank|CHM_ENST00000358786.4_Missense_Mutation_p.T4A	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)	4					blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				GAAGGGAGAGTATCCGCCATC	0.458																																						dbGAP											0													123.0	72.0	89.0					X																	85302527		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.10A>G	X.37:g.85302527T>C	ENSP00000350386:p.Thr4Ala		A1L4D2|O43732	Missense_Mutation	SNP	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.T4A	ENST00000357749.2	37	c.10	CCDS14454.1	X	.	.	.	.	.	.	.	.	.	.	T	9.924	1.213015	0.22289	.	.	ENSG00000188419	ENST00000357749;ENST00000358786	T;T	0.59772	0.24;0.24	5.06	3.87	0.44632	.	0.310402	0.35555	N	0.003134	T	0.36193	0.0958	N	0.14661	0.345	0.80722	D	1	B;B	0.11235	0.004;0.0	B;B	0.10450	0.005;0.002	T	0.16689	-1.0394	10	0.66056	D	0.02	-3.3731	5.0873	0.14689	0.1635:0.0861:0.0:0.7504	.	4;4	A1L4D2;P24386	.;RAE1_HUMAN	A	4	ENSP00000350386:T4A;ENSP00000362228:T4A	ENSP00000350386:T4A	T	-	1	0	CHM	85189183	1.000000	0.71417	0.970000	0.41538	0.843000	0.47879	1.783000	0.38664	0.717000	0.32145	0.486000	0.48141	ACT	CHM	-	pirsf_Rab_geranylTrfase_A_euk	ENSG00000188419		0.458	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHM	HGNC	protein_coding	OTTHUMT00000057396.3	64	0.00	0	T	NM_000390		85302527	85302527	-1	no_errors	ENST00000357749	ensembl	human	known	69_37n	missense	38	13.04	6	SNP	0.982	C
CHST1	8534	genome.wustl.edu	37	11	45671968	45671968	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr11:45671968G>A	ENST00000308064.2	-	4	1176	c.506C>T	c.(505-507)cCg>cTg	p.P169L	CHST1_ENST00000533673.1_5'Flank|RP11-495O11.1_ENST00000525563.1_RNA	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	169					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		GGCTGGCCCCGGAGGGTCGCA	0.711																																						dbGAP											0													22.0	26.0	25.0					11																	45671968		2201	4292	6493	-	-	-	SO:0001583	missense	0			U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.506C>T	11.37:g.45671968G>A	ENSP00000309270:p.Pro169Leu		D3DQP2	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	p.P169L	ENST00000308064.2	37	c.506	CCDS7913.1	11	.	.	.	.	.	.	.	.	.	.	G	1.495	-0.553692	0.03996	.	.	ENSG00000175264	ENST00000308064	D	0.95788	-3.81	4.98	3.97	0.46021	Sulfotransferase domain (1);	0.682764	0.13983	N	0.349335	T	0.80059	0.4554	N	0.00707	-1.245	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.71481	-0.4580	10	0.11182	T	0.66	-5.8417	4.2828	0.10841	0.2053:0.0:0.5753:0.2194	.	169	O43916	CHST1_HUMAN	L	169	ENSP00000309270:P169L	ENSP00000309270:P169L	P	-	2	0	CHST1	45628544	1.000000	0.71417	0.072000	0.20136	0.921000	0.55340	5.239000	0.65371	2.310000	0.77875	0.462000	0.41574	CCG	CHST1	-	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	ENSG00000175264		0.711	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST1	HGNC	protein_coding	OTTHUMT00000390127.1	58	0.00	0	G	NM_003654		45671968	45671968	-1	no_errors	ENST00000308064	ensembl	human	known	69_37n	missense	35	12.50	5	SNP	0.002	A
CIZ1	25792	genome.wustl.edu	37	9	130940822	130940822	+	Intron	SNP	C	C	T	rs3892074	byFrequency	TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr9:130940822C>T	ENST00000393608.1	-	9	1701				CIZ1_ENST00000476727.2_Intron|CIZ1_ENST00000538431.1_Intron|CIZ1_ENST00000372938.5_Intron|CIZ1_ENST00000357558.5_Intron|CIZ1_ENST00000277465.4_Intron|CIZ1_ENST00000325721.8_Intron|CIZ1_ENST00000372948.3_Intron|CIZ1_ENST00000372954.1_Intron|CIZ1_ENST00000541172.1_Intron	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1						maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						CAAGAGCTGCCTTCTCCGTCC	0.617													C|||	3442	0.6873	0.4228	0.7579	5008	,	,		21525	0.9435		0.6481	False		,,,				2504	0.771					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.1499-53G>A	9.37:g.130940822C>T			A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	RNA	SNP	-	NULL	ENST00000393608.1	37	NULL	CCDS6894.1	9																																																																																			CIZ1	-	-	ENSG00000148337		0.617	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIZ1	HGNC	protein_coding	OTTHUMT00000054399.1	28	0.00	0	C	NM_012127		130940822	130940822	-1	no_errors	ENST00000475471	ensembl	human	known	69_37n	rna	20	16.67	4	SNP	0.021	T
CNDP1	84735	genome.wustl.edu	37	18	72223592	72223594	+	In_Frame_Del	DEL	TGC	TGC	-	rs67791561		TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr18:72223592_72223594delTGC	ENST00000358821.3	+	2	272_274	c.44_46delTGC	c.(43-48)gtgctg>gtg	p.L20del	CNDP1_ENST00000585136.1_3'UTR|CNDP1_ENST00000582365.1_Intron	NM_032649.5	NP_116038	Q96KN2	CNDP1_HUMAN	carnosine dipeptidase 1 (metallopeptidase M20 family)	20			L -> LL. {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16046297}.			extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)	p.L20_E21insL(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		CTGCTGGCTGTGCTGCTGCTGCT	0.552																																					Melanoma(32;1029 1042 25286 38395 44237)	dbGAP											1	Insertion - In frame(1)	kidney(1)																																								-	-	-	SO:0001651	inframe_deletion	0				CCDS12007.1	18q22.3	2014-07-14			ENSG00000150656	ENSG00000150656	3.4.13.20		20675	protein-coding gene	gene with protein product	"""carnosinase 1"", ""glutamate carboxypeptidase-like protein 2"""	609064				12473676	Standard	NM_032649		Approved	MGC10825, CN1, CPGL2, HsT2308	uc002llq.3	Q96KN2	OTTHUMG00000132852	ENST00000358821.3:c.44_46delTGC	18.37:g.72223601_72223603delTGC	ENSP00000351682:p.Leu20del		Q14D40|Q17S05|Q2TBG0|Q6UWK2|Q9BT98	In_Frame_Del	DEL	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,pirsf_GSH_degradosome_DUG1	p.L19in_frame_del	ENST00000358821.3	37	c.44_46	CCDS12007.1	18																																																																																			CNDP1	-	NULL	ENSG00000150656		0.552	CNDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNDP1	HGNC	protein_coding	OTTHUMT00000256326.1	72	0.00	0	TGC	NM_032649		72223592	72223594	+1	no_errors	ENST00000358821	ensembl	human	known	69_37n	in_frame_del	36	10.00	4	DEL	0.574:0.612:0.628	-
COL6A5	256076	genome.wustl.edu	37	3	130190630	130190630	+	Missense_Mutation	SNP	G	G	A	rs322117	byFrequency	TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr3:130190630G>A	ENST00000265379.6	+	40	8173	c.7679G>A	c.(7678-7680)aGt>aAt	p.S2560N	COL6A5_ENST00000432398.2_Intron			A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2560	Nonhelical region.			S -> N (in Ref. 2; CAP20002/CAP20003 and 4; BAC04092). {ECO:0000305}.	cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						AATCATAGTAGTGGTTCTGAG	0.368													A|||	3834	0.765575	0.5711	0.7968	5008	,	,		19961	0.8482		0.8479	False		,,,				2504	0.8364					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000265379.6:c.7679G>A	3.37:g.130190630G>A	ENSP00000265379:p.Ser2560Asn		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.S2560N	ENST00000265379.6	37	c.7679		3	1690	0.7738095238095238	268	0.5447154471544715	285	0.787292817679558	484	0.8461538461538461	653	0.8614775725593667	A	0.171	-1.071378	0.01918	.	.	ENSG00000172752	ENST00000265379;ENST00000373157;ENST00000512482	D;T;T	0.88354	-2.37;-0.74;-0.55	5.54	1.6	0.23607	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41360	-0.9513	7	0.08599	T	0.76	.	1.3592	0.02188	0.5465:0.1484:0.1624:0.1427	rs322117;rs52795590;rs60996991;rs322117	2560	A8TX70	CO6A5_HUMAN	N	2560;503;395	ENSP00000265379:S2560N;ENSP00000362250:S503N;ENSP00000424968:S395N	ENSP00000265379:S2560N	S	+	2	0	COL6A5	131673320	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.738000	0.26158	0.071000	0.16664	-0.332000	0.08345	AGT	COL6A5	-	NULL	ENSG00000172752		0.368	COL6A5-201	KNOWN	basic	protein_coding	COL6A5	HGNC	protein_coding		57	0.00	0	G	NM_153264		130190630	130190630	+1	no_errors	ENST00000265379	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	0.000	A
CPT1B	1375	genome.wustl.edu	37	22	51015382	51015382	+	Silent	SNP	G	G	A			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr22:51015382G>A	ENST00000360719.2	-	4	500	c.363C>T	c.(361-363)atC>atT	p.I121I	CPT1B_ENST00000405237.3_Silent_p.I121I|CHKB-CPT1B_ENST00000452668.1_5'Flank|CPT1B_ENST00000440709.1_Silent_p.I121I|CPT1B_ENST00000395650.2_Silent_p.I121I|CPT1B_ENST00000312108.7_Silent_p.I121I|CPT1B_ENST00000434492.2_5'UTR|CHKB-CPT1B_ENST00000453634.1_3'UTR|CPT1B_ENST00000457250.1_Silent_p.I121I	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	121					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		GGAAGAAGAAGATGCCCGTCA	0.587											OREG0026685	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(170;988 1933 25577 30295 48163)	dbGAP											0													125.0	129.0	128.0					22																	51015382		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.363C>T	22.37:g.51015382G>A		974	B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Silent	SNP	pfam_Carn_acyl_trans	p.I121	ENST00000360719.2	37	c.363	CCDS14098.1	22																																																																																			CPT1B	-	NULL	ENSG00000205560		0.587	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT1B	HGNC	protein_coding	OTTHUMT00000317264.5	62	0.00	0	G	NM_152246		51015382	51015382	-1	no_errors	ENST00000312108	ensembl	human	known	69_37n	silent	31	16.22	6	SNP	1.000	A
CRIP1	1396	genome.wustl.edu	37	14	105953599	105953599	+	Start_Codon_SNP	SNP	G	G	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr14:105953599G>T	ENST00000330233.7	+	1	946	c.3G>T	c.(1-3)atG>atT	p.M1I	C14orf80_ENST00000329886.7_5'Flank|C14orf80_ENST00000392527.1_5'Flank|CRIP1_ENST00000392531.3_Start_Codon_SNP_p.M1I|CRIP1_ENST00000551180.1_5'Flank|CRIP1_ENST00000409393.2_Start_Codon_SNP_p.M1I			P50238	CRIP1_HUMAN	cysteine-rich protein 1 (intestinal)	1					cell proliferation (GO:0008283)|cellular response to antibiotic (GO:0071236)|cellular response to UV-B (GO:0071493)|heart development (GO:0007507)|immune response (GO:0006955)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|prostate gland stromal morphogenesis (GO:0060741)|regulation of gene expression (GO:0010468)|response to organic substance (GO:0010033)|response to zinc ion (GO:0010043)	cytoplasm (GO:0005737)	AT DNA binding (GO:0003680)|DNA binding, bending (GO:0008301)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)						Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.235)		GAGCCGTCATGCCCAAGTGTC	0.736																																						dbGAP											0													11.0	6.0	8.0					14																	105953599		1792	3323	5115	-	-	-	SO:0001582	initiator_codon_variant	0				CCDS10004.1	14q32.33	2004-06-18			ENSG00000213145	ENSG00000213145			2360	protein-coding gene	gene with protein product		123875				9480758	Standard	NM_001311		Approved	CRIP	uc001yri.4	P50238	OTTHUMG00000029908	ENST00000330233.7:c.3G>T	14.37:g.105953599G>T	ENSP00000332449:p.Met1Ile		H3BPI2|Q13628|Q53XY7|Q96J34	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.M1I	ENST00000330233.7	37	c.3	CCDS10004.1	14	.	.	.	.	.	.	.	.	.	.	g	18.11	3.551865	0.65311	.	.	ENSG00000213145	ENST00000330233;ENST00000409393;ENST00000392531	T;T;T	0.70516	-0.49;-0.49;-0.49	4.05	4.05	0.47172	.	0.000000	0.56097	U	0.000021	T	0.80984	0.4729	.	.	.	0.80722	D	1	D	0.69078	0.997	D	0.65323	0.934	T	0.83314	-0.0021	9	0.87932	D	0	-0.902	11.8949	0.52652	0.0:0.0:1.0:0.0	.	1	P50238	CRIP1_HUMAN	I	1	ENSP00000332449:M1I;ENSP00000386340:M1I;ENSP00000376315:M1I	ENSP00000447493:M1I	M	+	3	0	CRIP1	105024644	1.000000	0.71417	1.000000	0.80357	0.072000	0.16883	6.479000	0.73600	2.259000	0.74868	0.574000	0.79327	ATG	CRIP1	-	NULL	ENSG00000213145		0.736	CRIP1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CRIP1	HGNC	protein_coding	OTTHUMT00000335466.2	25	0.00	0	G	NM_001311	Missense_Mutation	105953599	105953599	+1	no_errors	ENST00000330233	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	1.000	T
CUL7	9820	genome.wustl.edu	37	6	43010839	43010839	+	Silent	SNP	G	G	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr6:43010839G>T	ENST00000265348.3	-	18	3520	c.3435C>A	c.(3433-3435)cgC>cgA	p.R1145R	CUL7_ENST00000478630.1_5'Flank|CUL7_ENST00000535468.1_Silent_p.R1229R			Q14999	CUL7_HUMAN	cullin 7	1145					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CCCGCCAACAGCGCGTCAGGT	0.592																																						dbGAP											0													55.0	56.0	55.0					6																	43010839		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.3435C>A	6.37:g.43010839G>T			B4DYZ0|F5H0L1|Q5T654	Silent	SNP	pfam_Cullin_N,pfam_CPH_domain,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.R1229	ENST00000265348.3	37	c.3687	CCDS4881.1	6																																																																																			CUL7	-	NULL	ENSG00000044090		0.592	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL7	HGNC	protein_coding	OTTHUMT00000040575.1	38	0.00	0	G	NM_014780		43010839	43010839	-1	no_errors	ENST00000535468	ensembl	human	known	69_37n	silent	36	10.00	4	SNP	1.000	T
DALRD3	55152	genome.wustl.edu	37	3	49055154	49055154	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr3:49055154C>A	ENST00000341949.4	-	3	616	c.610G>T	c.(610-612)Gac>Tac	p.D204Y	DALRD3_ENST00000313778.5_Missense_Mutation_p.D37Y|DALRD3_ENST00000441576.2_Missense_Mutation_p.D204Y|MIR425_ENST00000362162.1_RNA|DALRD3_ENST00000440857.1_Missense_Mutation_p.D37Y|DALRD3_ENST00000395462.4_Missense_Mutation_p.D37Y|NDUFAF3_ENST00000326912.4_5'Flank|DALRD3_ENST00000496568.1_5'UTR|MIR191_ENST00000384873.1_RNA	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	204					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)			breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GTCCTCCCGTCATTAGCAGAG	0.607																																						dbGAP											0													79.0	63.0	68.0					3																	49055154		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.610G>T	3.37:g.49055154C>A	ENSP00000344989:p.Asp204Tyr		Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Missense_Mutation	SNP	pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,smart_DALR_anticod-bd	p.D204Y	ENST00000341949.4	37	c.610	CCDS33754.1	3	.	.	.	.	.	.	.	.	.	.	c	11.83	1.756108	0.31137	.	.	ENSG00000178149	ENST00000441576;ENST00000341949;ENST00000395462;ENST00000440857;ENST00000313778;ENST00000420952	T;T;T;T;T;T	0.48836	0.84;0.87;0.85;0.8;0.85;0.88	5.06	-1.82	0.07857	.	0.573889	0.17623	N	0.167676	T	0.28532	0.0706	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.15473	0.004;0.013;0.004;0.006	B;B;B;B	0.12837	0.003;0.008;0.003;0.002	T	0.24083	-1.0170	10	0.13108	T	0.6	-4.5733	6.8591	0.24058	0.1156:0.3996:0.0:0.4849	.	204;37;204;204	B7Z727;C9JJG6;Q5D0E6-2;Q5D0E6	.;.;.;DALD3_HUMAN	Y	204;204;37;37;37;169	ENSP00000410623:D204Y;ENSP00000344989:D204Y;ENSP00000378846:D37Y;ENSP00000403770:D37Y;ENSP00000323265:D37Y;ENSP00000397385:D169Y	ENSP00000323265:D37Y	D	-	1	0	DALRD3	49030158	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.276000	0.08514	-0.293000	0.08986	-0.141000	0.14075	GAC	DALRD3	-	NULL	ENSG00000178149		0.607	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DALRD3	HGNC	protein_coding	OTTHUMT00000345581.1	114	0.00	0	C	NM_018114		49055154	49055154	-1	no_errors	ENST00000341949	ensembl	human	known	69_37n	missense	108	13.60	17	SNP	0.000	A
DCAF4L2	138009	genome.wustl.edu	37	8	88885923	88885923	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr8:88885923C>A	ENST00000319675.3	-	1	373	c.277G>T	c.(277-279)Gaa>Taa	p.E93*		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	93										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						CCTCCAGCTTCGACTTGGTTC	0.547																																						dbGAP											0													154.0	143.0	146.0					8																	88885923		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.277G>T	8.37:g.88885923C>A	ENSP00000316496:p.Glu93*			Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E93*	ENST00000319675.3	37	c.277	CCDS6245.1	8	.	.	.	.	.	.	.	.	.	.	C	14.67	2.605055	0.46423	.	.	ENSG00000176566	ENST00000319675	.	.	.	1.73	-3.45	0.04781	.	0.569183	0.21082	N	0.080475	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.8246	0.05481	0.207:0.3735:0.0:0.4195	.	.	.	.	X	93	.	ENSP00000316496:E93X	E	-	1	0	DCAF4L2	88955039	1.000000	0.71417	0.005000	0.12908	0.012000	0.07955	1.718000	0.38001	-0.461000	0.06993	-0.384000	0.06662	GAA	DCAF4L2	-	superfamily_WD40_repeat_dom	ENSG00000176566		0.547	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L2	HGNC	protein_coding	OTTHUMT00000375302.1	131	0.00	0	C	NM_152418		88885923	88885923	-1	no_errors	ENST00000319675	ensembl	human	known	69_37n	nonsense	160	17.35	34	SNP	0.055	A
DPP7	29952	genome.wustl.edu	37	9	140006171	140006171	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr9:140006171C>T	ENST00000371579.2	-	11	1247	c.1243G>A	c.(1243-1245)Ggg>Agg	p.G415R		NM_013379.2	NP_037511.2	Q9UHL4	DPP2_HUMAN	dipeptidyl-peptidase 7	415						cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;4.25e-05)|Epithelial(140;0.000633)		TCCAGGTTCCCGTTGGAGAAG	0.592																																						dbGAP											0													53.0	60.0	57.0					9																	140006171		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154502	CCDS7030.1	9q34.3	2008-02-05	2006-01-12		ENSG00000176978	ENSG00000176978			14892	protein-coding gene	gene with protein product		610537	"""dipeptidylpeptidase 7"""			10477574, 11139392	Standard	XM_005266075		Approved	DPPII	uc004clh.3	Q9UHL4	OTTHUMG00000020977	ENST00000371579.2:c.1243G>A	9.37:g.140006171C>T	ENSP00000360635:p.Gly415Arg		A8K7U7|Q5VSF1|Q969X4	Missense_Mutation	SNP	pfam_Peptidase_S28,pfam_AB_hydrolase_1	p.G415R	ENST00000371579.2	37	c.1243	CCDS7030.1	9	.	.	.	.	.	.	.	.	.	.	C	20.9	4.065931	0.76187	.	.	ENSG00000176978	ENST00000371579	T	0.60920	0.15	4.32	4.32	0.51571	.	0.000000	0.85682	D	0.000000	D	0.82651	0.5083	H	0.96365	3.81	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	D	0.88208	0.2888	10	0.87932	D	0	-11.1993	14.1605	0.65443	0.0:1.0:0.0:0.0	.	415	Q9UHL4	DPP2_HUMAN	R	415	ENSP00000360635:G415R	ENSP00000360635:G415R	G	-	1	0	DPP7	139125992	1.000000	0.71417	0.587000	0.28692	0.481000	0.33189	6.959000	0.76031	2.249000	0.74217	0.555000	0.69702	GGG	DPP7	-	pfam_Peptidase_S28	ENSG00000176978		0.592	DPP7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DPP7	HGNC	protein_coding	OTTHUMT00000055279.1	103	0.00	0	C	NM_013379		140006171	140006171	-1	no_errors	ENST00000371579	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	0.978	T
TMED11P	100379220	genome.wustl.edu	37	4	1147333	1147333	+	RNA	SNP	C	C	A	rs963598	byFrequency	TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr4:1147333C>A	ENST00000417557.1	+	0	2009																											TAGAGGATGGCAGAATTCTGT	0.383													C|||	2798	0.558706	0.2277	0.7104	5008	,	,		20692	0.6746		0.6998	False		,,,				2504	0.6339					dbGAP											0																																										-	-	-			0																															4.37:g.1147333C>A				RNA	SNP	-	NULL	ENST00000417557.1	37	NULL		4																																																																																			AC092535.3	-	-	ENSG00000227189		0.383	AC092535.3-001	KNOWN	basic	antisense	FLJ35816	Clone_based_vega_gene	antisense	OTTHUMT00000239196.1	110	0.90	1	C			1147333	1147333	+1	no_errors	ENST00000417557	ensembl	human	known	69_37n	rna	77	11.49	10	SNP	0.001	A
FOLH1	2346	genome.wustl.edu	37	11	49204779	49204779	+	Missense_Mutation	SNP	C	C	T	rs116795343	byFrequency	TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr11:49204779C>T	ENST00000256999.2	-	7	1102	c.842G>A	c.(841-843)cGt>cAt	p.R281H	FOLH1_ENST00000340334.7_Missense_Mutation_p.R266H|FOLH1_ENST00000533034.1_Missense_Mutation_p.R266H|FOLH1_ENST00000343844.4_De_novo_Start_OutOfFrame|FOLH1_ENST00000356696.3_Missense_Mutation_p.R281H	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	281	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.R281L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TGCAATTCCACGCCTATAAGC	0.348																																						dbGAP											1	Substitution - Missense(1)	lung(1)											72.0	73.0	73.0					11																	49204779		2201	4298	6499	-	-	-	SO:0001583	missense	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.842G>A	11.37:g.49204779C>T	ENSP00000256999:p.Arg281His		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.R281H	ENST00000256999.2	37	c.842	CCDS7946.1	11	.	.	.	.	.	.	.	.	.	.	C	2.929	-0.221410	0.06061	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	2.76	-1.12	0.09808	.	0.978445	0.08346	N	0.960084	T	0.21427	0.0516	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.06786	0.001;0.001;0.0;0.0	B;B;B;B	0.06405	0.001;0.0;0.002;0.0	T	0.23655	-1.0182	10	0.14656	T	0.56	.	6.6038	0.22714	0.0:0.3193:0.0:0.6807	.	266;266;281;281	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	H	281;281;266;266;281	ENSP00000256999:R281H;ENSP00000349129:R281H;ENSP00000344131:R266H;ENSP00000431463:R266H	ENSP00000256999:R281H	R	-	2	0	FOLH1	49161355	0.002000	0.14202	0.792000	0.32020	0.272000	0.26649	-0.922000	0.04004	-0.085000	0.12573	0.194000	0.17425	CGT	FOLH1	-	NULL	ENSG00000086205		0.348	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	48	0.00	0	C	NM_004476		49204779	49204779	-1	no_errors	ENST00000256999	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	0.843	T
FOLH1	2346	genome.wustl.edu	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000340334.7_Silent_p.Y262Y|FOLH1_ENST00000533034.1_Silent_p.Y262Y|FOLH1_ENST00000343844.4_5'UTR|FOLH1_ENST00000356696.3_Silent_p.Y277Y	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																						dbGAP											0													61.0	61.0	61.0					11																	49204790		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.Y277	ENST00000256999.2	37	c.831	CCDS7946.1	11																																																																																			FOLH1	-	NULL	ENSG00000086205		0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	44	0.00	0	A	NM_004476		49204790	49204790	-1	no_errors	ENST00000256999	ensembl	human	known	69_37n	silent	30	23.08	9	SNP	1.000	G
GNAT1	2779	genome.wustl.edu	37	3	50231619	50231619	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr3:50231619G>A	ENST00000433068.1	+	6	729	c.673G>A	c.(673-675)Gcc>Acc	p.A225T	GNAT1_ENST00000232461.3_Missense_Mutation_p.A225T	NM_000172.3	NP_000163.2	P11488	GNAT1_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1	225					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular response to electrical stimulus (GO:0071257)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|phototransduction, visible light (GO:0007603)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to light intensity (GO:0009642)|response to light stimulus (GO:0009416)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	acyl binding (GO:0000035)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GGCGCTGAGCGCCTACGACAT	0.657																																						dbGAP											0													56.0	51.0	52.0					3																	50231619		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS2812.1	3p21	2014-01-28			ENSG00000114349	ENSG00000114349			4393	protein-coding gene	gene with protein product		139330					Standard	NM_000172		Approved	CSNBAD3	uc003cyl.2	P11488	OTTHUMG00000156808	ENST00000433068.1:c.673G>A	3.37:g.50231619G>A	ENSP00000387555:p.Ala225Thr		Q4VBN2	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I	p.A225T	ENST00000433068.1	37	c.673	CCDS2812.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.687284	0.96784	.	.	ENSG00000114349	ENST00000232461;ENST00000433068	T;T	0.70045	-0.45;-0.45	4.7	4.7	0.59300	.	0.050680	0.85682	D	0.000000	D	0.84543	0.5495	M	0.89968	3.075	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.87126	0.2194	10	0.52906	T	0.07	.	16.5836	0.84722	0.0:0.0:1.0:0.0	.	225	P11488	GNAT1_HUMAN	T	225	ENSP00000232461:A225T;ENSP00000387555:A225T	ENSP00000232461:A225T	A	+	1	0	GNAT1	50206623	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.395000	0.97266	2.465000	0.83290	0.561000	0.74099	GCC	GNAT1	-	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su	ENSG00000114349		0.657	GNAT1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	GNAT1	HGNC	protein_coding	OTTHUMT00000345957.1	90	0.00	0	G	NM_000172		50231619	50231619	+1	no_errors	ENST00000232461	ensembl	human	known	69_37n	missense	58	18.31	13	SNP	1.000	A
HAUS3	79441	genome.wustl.edu	37	4	2240617	2240617	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr4:2240617C>G	ENST00000243706.4	-	3	1292	c.1063G>C	c.(1063-1065)Gat>Cat	p.D355H	POLN_ENST00000511885.2_Intron|HAUS3_ENST00000443786.2_Missense_Mutation_p.D355H|POLN_ENST00000515357.1_Intron|HAUS3_ENST00000506763.1_Missense_Mutation_p.D355H	NM_024511.5	NP_078787.2	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	355					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				breast(3)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						AGATCAAAATCTCCCTTTACC	0.328																																						dbGAP											0													143.0	150.0	147.0					4																	2240617		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF040964	CCDS33941.1	4p16.3	2013-10-11	2009-04-20	2009-04-20	ENSG00000214367	ENSG00000214367		"""HAUS augmin-like complex subunits"""	28719	protein-coding gene	gene with protein product		613430	"""chromosome 4 open reading frame 15"""	C4orf15		19427217, 19812674	Standard	NM_024511		Approved	MGC4701, IT1, dgt3	uc003ges.1	Q68CZ6		ENST00000243706.4:c.1063G>C	4.37:g.2240617C>G	ENSP00000243706:p.Asp355His		B4DF64|O43606|Q8TAZ5|Q9BTJ9	Missense_Mutation	SNP	NULL	p.D355H	ENST00000243706.4	37	c.1063	CCDS33941.1	4	.	.	.	.	.	.	.	.	.	.	C	17.76	3.468934	0.63625	.	.	ENSG00000214367	ENST00000506763;ENST00000243706;ENST00000443786	T;T	0.60672	0.17;0.17	5.87	5.03	0.67393	.	0.000000	0.85682	U	0.000000	T	0.72078	0.3416	M	0.74258	2.255	0.58432	D	0.999994	D;D	0.71674	0.998;0.998	D;D	0.65443	0.935;0.912	T	0.75124	-0.3428	10	0.72032	D	0.01	-14.9683	10.4453	0.44490	0.1337:0.7957:0.0:0.0706	.	355;355	B4DF64;Q68CZ6	.;HAUS3_HUMAN	H	355	ENSP00000243706:D355H;ENSP00000392903:D355H	ENSP00000243706:D355H	D	-	1	0	HAUS3	2210415	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.256000	0.65468	1.495000	0.48549	0.591000	0.81541	GAT	HAUS3	-	NULL	ENSG00000214367		0.328	HAUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS3	HGNC	protein_coding	OTTHUMT00000357446.1	52	0.00	0	C	NM_024511		2240617	2240617	-1	no_errors	ENST00000243706	ensembl	human	known	69_37n	missense	39	17.02	8	SNP	1.000	G
HEATR5A	25938	genome.wustl.edu	37	14	31858209	31858209	+	Missense_Mutation	SNP	C	C	T	rs7157977	byFrequency	TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr14:31858209C>T	ENST00000389961.3	-	6	756	c.757G>A	c.(757-759)Gcc>Acc	p.A253T	HEATR5A_ENST00000439348.1_Missense_Mutation_p.A253T|HEATR5A_ENST00000404677.3_Missense_Mutation_p.A259T|HEATR5A_ENST00000543095.2_Missense_Mutation_p.A259T|HEATR5A_ENST00000439727.1_5'Flank			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	253										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		TGACGTGAGGCTGCTATGACA	0.368													C|||	1557	0.310903	0.1195	0.3429	5008	,	,		20952	0.3353		0.4205	False		,,,				2504	0.409					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.757G>A	14.37:g.31858209C>T	ENSP00000374611:p.Ala253Thr		Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A253T	ENST00000389961.3	37	c.757		14	734	0.3360805860805861	57	0.11585365853658537	138	0.3812154696132597	214	0.3741258741258741	325	0.4287598944591029	C	14.32	2.501006	0.44455	.	.	ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000543095;ENST00000404677	T;T;T;T	0.08102	3.13;3.13;3.13;3.13	5.6	5.6	0.85130	.	.	.	.	.	T	0.00012	0.0000	N	0.10972	0.075	0.38151	P	0.06126900000000002	B	0.06786	0.001	B	0.06405	0.002	T	0.46843	-0.9162	8	0.13853	T	0.58	.	11.0175	0.47698	0.1998:0.6792:0.121:0.0	rs7157977;rs56643289;rs58492332;rs7157977	259	B5MC49	.	T	253;253;259;259	ENSP00000374611:A253T;ENSP00000405407:A253T;ENSP00000437968:A259T;ENSP00000384646:A259T	ENSP00000374611:A253T	A	-	1	0	HEATR5A	30927960	0.997000	0.39634	1.000000	0.80357	0.987000	0.75469	2.388000	0.44398	2.629000	0.89072	0.491000	0.48974	GCC	HEATR5A	-	superfamily_ARM-type_fold	ENSG00000129493		0.368	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	HEATR5A	HGNC	protein_coding		68	0.00	0	C	NM_015473		31858209	31858209	-1	no_errors	ENST00000389961	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	1.000	T
HUWE1	10075	genome.wustl.edu	37	X	53561637	53561637	+	Missense_Mutation	SNP	G	G	A	rs398124423		TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chrX:53561637G>A	ENST00000342160.3	-	81	13128	c.12671C>T	c.(12670-12672)gCg>gTg	p.A4224V	HUWE1_ENST00000262854.6_Missense_Mutation_p.A4224V			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	4224	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TAAGAAAGCCGCCAACTGCTT	0.488																																						dbGAP											0													64.0	59.0	61.0					X																	53561637		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.12671C>T	X.37:g.53561637G>A	ENSP00000340648:p.Ala4224Val		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.A4224V	ENST00000342160.3	37	c.12671	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	G	14.90	2.672297	0.47781	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.44482	0.92;0.92	5.36	5.36	0.76844	HECT (4);	0.000000	0.85682	D	0.000000	T	0.54983	0.1892	M	0.62723	1.935	0.80722	D	1	D;D	0.71674	0.998;0.998	P;P	0.54100	0.742;0.624	T	0.56318	-0.7999	10	0.48119	T	0.1	.	17.0821	0.86601	0.0:0.0:1.0:0.0	.	4224;4208	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	V	4224	ENSP00000340648:A4224V;ENSP00000262854:A4224V	ENSP00000262854:A4224V	A	-	2	0	HUWE1	53578362	1.000000	0.71417	0.980000	0.43619	0.974000	0.67602	9.224000	0.95209	2.385000	0.81259	0.600000	0.82982	GCG	HUWE1	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000086758		0.488	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	43	0.00	0	G	XM_497119		53561637	53561637	-1	no_errors	ENST00000262854	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	A
IMMP2L	83943	genome.wustl.edu	37	7	110303527	110303527	+	3'UTR	SNP	T	T	C	rs1044729	byFrequency	TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr7:110303527T>C	ENST00000405709.2	-	0	1101				IMMP2L_ENST00000452895.1_3'UTR|IMMP2L_ENST00000450877.1_3'UTR|IMMP2L_ENST00000489381.1_5'UTR|IMMP2L_ENST00000331762.3_3'UTR	NM_032549.3	NP_115938.1	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)						ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|protein processing involved in protein targeting to mitochondrion (GO:0006627)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial inner membrane peptidase complex (GO:0042720)	peptidase activity (GO:0008233)|serine-type peptidase activity (GO:0008236)			endometrium(3)|large_intestine(6)|lung(5)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		taCAGATCGTTTTAATGTGCT	0.338													C|||	1728	0.345048	0.6452	0.2608	5008	,	,		16242	0.1429		0.3519	False		,,,				2504	0.2004					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF359563	CCDS5753.1	7q31	2014-01-06	2005-08-17		ENSG00000184903	ENSG00000184903			14598	protein-coding gene	gene with protein product		605977	"""IMP2 inner mitochondrial membrane protease-like (S. cerevisiae)"", ""IMMP2L intronic transcript 1 (non-protein coding)"""	IMMP2L-IT1		11254443	Standard	NM_032549		Approved	IMP2	uc010ljr.2	Q96T52	OTTHUMG00000155023	ENST00000405709.2:c.*131A>G	7.37:g.110303527T>C			Q75MF1|Q75MN9|Q75MP0|Q75MS5|Q75MS8|Q96HJ2	RNA	SNP	-	NULL	ENST00000405709.2	37	NULL	CCDS5753.1	7																																																																																			IMMP2L	-	-	ENSG00000184903		0.338	IMMP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMMP2L	HGNC	protein_coding	OTTHUMT00000338109.4	23	0.00	0	T	NM_032549		110303527	110303527	-1	no_errors	ENST00000489381	ensembl	human	known	69_37n	rna	7	30.00	3	SNP	0.000	C
ITGB4	3691	genome.wustl.edu	37	17	73753041	73753041	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr17:73753041C>T	ENST00000200181.3	+	38	5258	c.5071C>T	c.(5071-5073)Cgg>Tgg	p.R1691W	ITGB4_ENST00000339591.3_Missense_Mutation_p.R1674W|ITGB4_ENST00000579662.1_Missense_Mutation_p.R1621W|ITGB4_ENST00000450894.3_Missense_Mutation_p.R1621W|GALK1_ENST00000225614.2_Intron|ITGB4_ENST00000449880.2_Missense_Mutation_p.R1674W	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	1691	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CACCGCATTCCGGGTGGATGG	0.682																																						dbGAP											0													29.0	37.0	34.0					17																	73753041		2202	4298	6500	-	-	-	SO:0001583	missense	0				CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.5071C>T	17.37:g.73753041C>T	ENSP00000200181:p.Arg1691Trp		A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	pirsf_Integrin_bsu-4,pfam_Integrin_bsu_N,pfam_Fibronectin_type3,pfam_Calx_beta,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Fibronectin_type3,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,smart_Calx_beta,smart_Fibronectin_type3,pfscan_Fibronectin_type3,prints_Integrin_bsu	p.R1691W	ENST00000200181.3	37	c.5071	CCDS11727.1	17	.	.	.	.	.	.	.	.	.	.	C	10.03	1.238884	0.22711	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.58358	0.34;0.34;0.34	4.93	3.93	0.45458	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.648921	0.15276	N	0.270963	T	0.57066	0.2028	L	0.56769	1.78	0.80722	D	1	P;P;P	0.52463	0.853;0.93;0.953	P;P;P	0.52386	0.502;0.636;0.697	T	0.57906	-0.7730	10	0.72032	D	0.01	.	7.0761	0.25205	0.0:0.7293:0.1765:0.0942	.	1674;1621;1691	P16144-3;A0AVL6;P16144	.;.;ITB4_HUMAN	W	1691;1674;1674	ENSP00000200181:R1691W;ENSP00000344079:R1674W;ENSP00000400217:R1674W	ENSP00000200181:R1691W	R	+	1	2	ITGB4	71264636	0.968000	0.33430	0.992000	0.48379	0.419000	0.31324	0.421000	0.21280	1.168000	0.42723	0.462000	0.41574	CGG	ITGB4	-	pirsf_Integrin_bsu-4,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000132470		0.682	ITGB4-001	KNOWN	basic|CCDS	protein_coding	ITGB4	HGNC	protein_coding	OTTHUMT00000448334.1	47	0.00	0	C			73753041	73753041	+1	no_errors	ENST00000200181	ensembl	human	known	69_37n	missense	48	14.29	8	SNP	1.000	T
ITIH1	3697	genome.wustl.edu	37	3	52814347	52814347	+	Silent	SNP	G	G	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr3:52814347G>T	ENST00000273283.2	+	6	660	c.636G>T	c.(634-636)ctG>ctT	p.L212L	ITIH1_ENST00000537050.1_5'UTR|ITIH1_ENST00000540715.1_Silent_p.L70L|ITIH1_ENST00000487686.1_3'UTR|ITIH1_ENST00000542827.1_Silent_p.L212L	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	212					hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		CCTCTTTCCTGCCGAAGGAAC	0.478																																						dbGAP											0													40.0	41.0	41.0					3																	52814347		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.636G>T	3.37:g.52814347G>T			A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Silent	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,superfamily_PsdUridine_synth_cat_dom,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.L212	ENST00000273283.2	37	c.636	CCDS2864.1	3																																																																																			ITIH1	-	NULL	ENSG00000055957		0.478	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH1	HGNC	protein_coding	OTTHUMT00000317522.1	47	0.00	0	G	NM_002215		52814347	52814347	+1	no_errors	ENST00000273283	ensembl	human	known	69_37n	silent	36	10.00	4	SNP	0.678	T
L3MBTL1	26013	genome.wustl.edu	37	20	42143191	42143191	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr20:42143191C>T	ENST00000373135.3	+	1	139	c.7C>T	c.(7-9)Cga>Tga	p.R3*	L3MBTL1_ENST00000373134.1_Nonsense_Mutation_p.R3*|L3MBTL1_ENST00000427442.2_Intron|L3MBTL1_ENST00000444063.1_Nonsense_Mutation_p.R3*|L3MBTL1_ENST00000457824.1_3'UTR|L3MBTL1_ENST00000418998.1_Intron	NM_015478.6	NP_056293.4	Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	3					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						TGGCATGAGGCGAAGAGAGGG	0.642																																						dbGAP											0													26.0	25.0	25.0					20																	42143191		2188	4279	6467	-	-	-	SO:0001587	stop_gained	0			U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000373135.3:c.7C>T	20.37:g.42143191C>T	ENSP00000362227:p.Arg3*		B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Nonsense_Mutation	SNP	pfam_Mbt,pfam_Znf_C2HC,superfamily_SAM/pointed,smart_Mbt,pfscan_Mbt	p.R3*	ENST00000373135.3	37	c.7	CCDS13319.1	20	.	.	.	.	.	.	.	.	.	.	C	25.4	4.630641	0.87660	.	.	ENSG00000185513	ENST00000373135;ENST00000444063;ENST00000373134	.	.	.	3.24	1.23	0.21249	.	0.465966	0.17216	N	0.182510	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.8464	0.18669	0.0:0.7449:0.0:0.2551	.	.	.	.	X	3	.	ENSP00000362226:R3X	R	+	1	2	L3MBTL1	41576605	0.045000	0.20229	0.003000	0.11579	0.066000	0.16364	1.800000	0.38833	0.387000	0.25024	0.561000	0.74099	CGA	L3MBTL1	-	NULL	ENSG00000185513		0.642	L3MBTL1-005	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	L3MBTL1	HGNC	protein_coding	OTTHUMT00000079298.2	122	0.00	0	C	NM_032107		42143191	42143191	+1	no_errors	ENST00000373135	ensembl	human	known	69_37n	nonsense	97	14.04	16	SNP	0.001	T
CTD-2532D12.4	0	genome.wustl.edu	37	17	71746427	71746427	+	lincRNA	SNP	G	G	A	rs35481671	byFrequency	TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr17:71746427G>A	ENST00000583854.1	+	0	166				LINC00469_ENST00000321800.7_lincRNA																							GGCCTCATCCGACCACGGCGC	0.607													G|||	2380	0.47524	0.6051	0.5115	5008	,	,		17293	0.2877		0.4483	False		,,,				2504	0.4949					dbGAP											0																																										-	-	-			0																															17.37:g.71746427G>A				RNA	SNP	-	NULL	ENST00000583854.1	37	NULL		17																																																																																			LINC00469	-	-	ENSG00000177338		0.607	CTD-2532D12.4-001	KNOWN	basic	lincRNA	LINC00469	HGNC	lincRNA	OTTHUMT00000442072.1	26	0.00	0	G			71746427	71746427	-1	no_errors	ENST00000444747	ensembl	human	known	69_37n	rna	23	17.86	5	SNP	0.029	A
LRFN2	57497	genome.wustl.edu	37	6	40399625	40399625	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr6:40399625C>T	ENST00000338305.6	-	2	1770	c.1228G>A	c.(1228-1230)Gga>Aga	p.G410R		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	410						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					CCACTGCCTCCACCTCCCCGG	0.657																																						dbGAP											0													42.0	45.0	44.0					6																	40399625		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1228G>A	6.37:g.40399625C>T	ENSP00000345985:p.Gly410Arg		A5PKU3|Q5SYP9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G410R	ENST00000338305.6	37	c.1228	CCDS34443.1	6	.	.	.	.	.	.	.	.	.	.	C	9.233	1.036386	0.19669	.	.	ENSG00000156564	ENST00000338305	T	0.56444	0.46	4.65	4.65	0.58169	.	0.117523	0.37809	N	0.001932	T	0.38878	0.1057	L	0.43152	1.355	0.29005	N	0.887215	P	0.51933	0.949	P	0.50314	0.637	T	0.16689	-1.0394	10	0.32370	T	0.25	.	12.8958	0.58098	0.0:1.0:0.0:0.0	.	410	Q9ULH4	LRFN2_HUMAN	R	410	ENSP00000345985:G410R	ENSP00000345985:G410R	G	-	1	0	LRFN2	40507603	0.012000	0.17670	0.840000	0.33206	0.841000	0.47740	0.349000	0.20055	2.419000	0.82065	0.561000	0.74099	GGA	LRFN2	-	NULL	ENSG00000156564		0.657	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN2	HGNC	protein_coding	OTTHUMT00000040488.1	51	0.00	0	C	XM_166372		40399625	40399625	-1	no_errors	ENST00000338305	ensembl	human	known	69_37n	missense	70	10.26	8	SNP	0.916	T
LRFN2	57497	genome.wustl.edu	37	6	40400198	40400198	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr6:40400198C>A	ENST00000338305.6	-	2	1197	c.655G>T	c.(655-657)Gcc>Tcc	p.A219S		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	219						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					TGGGAGCGGGCAAAGATGGGA	0.582																																						dbGAP											0													45.0	52.0	49.0					6																	40400198		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.655G>T	6.37:g.40400198C>A	ENSP00000345985:p.Ala219Ser		A5PKU3|Q5SYP9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A219S	ENST00000338305.6	37	c.655	CCDS34443.1	6	.	.	.	.	.	.	.	.	.	.	C	11.29	1.594626	0.28445	.	.	ENSG00000156564	ENST00000338305	T	0.02258	4.37	5.42	5.42	0.78866	.	0.047201	0.85682	D	0.000000	T	0.01254	0.0041	L	0.40543	1.245	0.80722	D	1	B	0.29378	0.243	B	0.33846	0.171	T	0.50268	-0.8848	10	0.08179	T	0.78	.	17.7794	0.88519	0.0:1.0:0.0:0.0	.	219	Q9ULH4	LRFN2_HUMAN	S	219	ENSP00000345985:A219S	ENSP00000345985:A219S	A	-	1	0	LRFN2	40508176	0.995000	0.38212	0.998000	0.56505	0.988000	0.76386	2.717000	0.47227	2.558000	0.86282	0.563000	0.77884	GCC	LRFN2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000156564		0.582	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN2	HGNC	protein_coding	OTTHUMT00000040488.1	84	0.00	0	C	XM_166372		40400198	40400198	-1	no_errors	ENST00000338305	ensembl	human	known	69_37n	missense	74	21.28	20	SNP	1.000	A
LRRC72	100506049	genome.wustl.edu	37	7	16606022	16606022	+	Missense_Mutation	SNP	G	G	A	rs535134984		TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr7:16606022G>A	ENST00000401542.2	+	6	569	c.512G>A	c.(511-513)cGa>cAa	p.R171Q		NM_001195280.1	NP_001182209.1	A6NJI9	LRC72_HUMAN	leucine rich repeat containing 72	171	LRRCT.																CTGCTTGACCGAAATCGTAAG	0.383													G|||	1	0.000199681	0.0	0.0	5008	,	,		15702	0.0		0.001	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS56464.1	7p21.1	2011-10-07			ENSG00000205858	ENSG00000205858			42972	protein-coding gene	gene with protein product							Standard	NM_001195280		Approved		uc022aaf.1	A6NJI9	OTTHUMG00000152446	ENST00000401542.2:c.512G>A	7.37:g.16606022G>A	ENSP00000384971:p.Arg171Gln			Missense_Mutation	SNP	NULL	p.R171Q	ENST00000401542.2	37	c.512	CCDS56464.1	7	.	.	.	.	.	.	.	.	.	.	G	13.82	2.351844	0.41700	.	.	ENSG00000205858	ENST00000401542	T	0.54279	0.58	5.41	3.59	0.41128	.	.	.	.	.	T	0.54581	0.1867	M	0.66939	2.045	0.21445	N	0.999685	.	.	.	.	.	.	T	0.44421	-0.9329	7	0.29301	T	0.29	.	7.6125	0.28139	0.1889:0.0:0.8111:0.0	.	.	.	.	Q	171	ENSP00000384971:R171Q	ENSP00000384971:R171Q	R	+	2	0	AC005014.4	16572547	0.998000	0.40836	0.937000	0.37676	0.668000	0.39293	2.178000	0.42519	1.427000	0.47276	0.655000	0.94253	CGA	LRRC72	-	NULL	ENSG00000205858		0.383	LRRC72-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRC72	HGNC	protein_coding	OTTHUMT00000326249.2	60	0.00	0	G			16606022	16606022	+1	no_errors	ENST00000401542	ensembl	human	novel	69_37n	missense	35	12.50	5	SNP	0.675	A
MAST4	375449	genome.wustl.edu	37	5	66088133	66088133	+	Intron	SNP	C	C	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr5:66088133C>T	ENST00000403625.2	+	3	937				MAST4_ENST00000404260.3_Intron|MAST4_ENST00000406039.1_Intron|MAST4_ENST00000406374.1_Intron	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4							cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		ttgcccctgtcgtagagctgt	0.502																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.642+3511C>T	5.37:g.66088133C>T			A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	RNA	SNP	-	NULL	ENST00000403625.2	37	NULL	CCDS54861.1	5																																																																																			MAST4	-	-	ENSG00000069020		0.502	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	MAST4	HGNC	protein_coding	OTTHUMT00000326324.2	155	0.00	0	C			66088133	66088133	+1	no_errors	ENST00000451144	ensembl	human	putative	69_37n	rna	107	13.60	17	SNP	0.000	T
MYBL2	4605	genome.wustl.edu	37	20	42340188	42340188	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr20:42340188G>A	ENST00000217026.4	+	11	1793	c.1666G>A	c.(1666-1668)Gaa>Aaa	p.E556K	MYBL2_ENST00000396863.4_Missense_Mutation_p.E532K	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	556					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GGCTGGCATCGAACTCATCAT	0.637																																						dbGAP											0													77.0	63.0	68.0					20																	42340188		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.1666G>A	20.37:g.42340188G>A	ENSP00000217026:p.Glu556Lys		B2RBS5|B7Z8D9|F8W6N6|Q53F07	Missense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.E556K	ENST00000217026.4	37	c.1666	CCDS13322.1	20	.	.	.	.	.	.	.	.	.	.	G	16.25	3.070654	0.55539	.	.	ENSG00000101057	ENST00000396863;ENST00000217026	T;T	0.31247	1.5;1.5	3.63	3.63	0.41609	C-myb, C-terminal (1);	0.160175	0.53938	D	0.000042	T	0.33177	0.0854	L	0.55990	1.75	0.80722	D	1	B;P	0.44521	0.429;0.837	B;B	0.42361	0.115;0.385	T	0.36504	-0.9745	10	0.62326	D	0.03	-34.9784	15.2657	0.73660	0.0:0.0:1.0:0.0	.	532;556	F8W6N6;P10244	.;MYBB_HUMAN	K	532;556	ENSP00000380072:E532K;ENSP00000217026:E556K	ENSP00000217026:E556K	E	+	1	0	MYBL2	41773602	1.000000	0.71417	0.935000	0.37517	0.177000	0.22998	8.635000	0.91006	2.323000	0.78572	0.655000	0.94253	GAA	MYBL2	-	pfam_C-myb_C	ENSG00000101057		0.637	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBL2	HGNC	protein_coding	OTTHUMT00000080408.1	45	0.00	0	G	NM_002466		42340188	42340188	+1	no_errors	ENST00000217026	ensembl	human	known	69_37n	missense	49	12.50	7	SNP	1.000	A
MYO7A	4647	genome.wustl.edu	37	11	76872063	76872063	+	Silent	SNP	C	C	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr11:76872063C>T	ENST00000409709.3	+	12	1517	c.1245C>T	c.(1243-1245)aaC>aaT	p.N415N	MYO7A_ENST00000409893.1_Silent_p.N415N|MYO7A_ENST00000409619.2_Silent_p.N404N|MYO7A_ENST00000458637.2_Silent_p.N415N	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	415	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						ACAAGATCAACGCAGCAATTT	0.572																																						dbGAP											0													99.0	107.0	105.0					11																	76872063		2046	4184	6230	-	-	-	SO:0001819	synonymous_variant	0			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.1245C>T	11.37:g.76872063C>T			B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_FERM_N,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.N415	ENST00000409709.3	37	c.1245	CCDS53683.1	11																																																																																			MYO7A	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000137474		0.572	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	128	0.00	0	C	NM_000260		76872063	76872063	+1	no_errors	ENST00000409709	ensembl	human	known	69_37n	silent	101	11.40	13	SNP	0.042	T
NAMPT	10135	genome.wustl.edu	37	7	105913026	105913026	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr7:105913026T>G	ENST00000222553.3	-	4	704	c.397A>C	c.(397-399)Acg>Ccg	p.T133P	NAMPT_ENST00000354289.4_Missense_Mutation_p.T133P|NAMPT_ENST00000484527.1_5'UTR	NM_005746.2	NP_005737.1	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	133					cell-cell signaling (GO:0007267)|circadian regulation of gene expression (GO:0032922)|NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|nicotinamide metabolic process (GO:0006769)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|nicotinamide phosphoribosyltransferase activity (GO:0047280)|nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						TTTTCCACCGTGAAGAGAACA	0.343																																						dbGAP											0													69.0	70.0	69.0					7																	105913026		2203	4300	6503	-	-	-	SO:0001583	missense	0			U02020	CCDS5737.1	7q22.3	2012-10-02	2008-03-27	2008-03-27	ENSG00000105835	ENSG00000105835			30092	protein-coding gene	gene with protein product	"""visfatin"""	608764	"""pre-B-cell colony enhancing factor 1"""	PBEF1		8289818	Standard	NM_005746		Approved	PBEF	uc003vdq.3	P43490	OTTHUMG00000140388	ENST00000222553.3:c.397A>C	7.37:g.105913026T>G	ENSP00000222553:p.Thr133Pro		A4D0Q9|A4D0R0|Q3KQV0|Q8WW95	Missense_Mutation	SNP	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nicotinamide_PRibTrfase	p.T133P	ENST00000222553.3	37	c.397	CCDS5737.1	7	.	.	.	.	.	.	.	.	.	.	T	25.5	4.647898	0.87958	.	.	ENSG00000105835	ENST00000222553;ENST00000354289	T;T	0.27402	1.67;1.67	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.64193	0.2576	H	0.94925	3.6	0.58432	D	0.999997	D;P;P	0.67145	0.996;0.871;0.826	P;P;P	0.62014	0.897;0.876;0.563	T	0.76162	-0.3060	10	0.72032	D	0.01	-34.4448	15.4097	0.74908	0.0:0.0:0.0:1.0	.	46;114;133	B7Z8W6;Q5SYT8;P43490	.;.;NAMPT_HUMAN	P	133	ENSP00000222553:T133P;ENSP00000346242:T133P	ENSP00000222553:T133P	T	-	1	0	NAMPT	105700262	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.972000	0.88022	2.105000	0.64084	0.529000	0.55759	ACG	NAMPT	-	pirsf_Nicotinamide_PRibTrfase	ENSG00000105835		0.343	NAMPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAMPT	HGNC	protein_coding	OTTHUMT00000277146.1	87	0.00	0	T	NM_182790		105913026	105913026	-1	no_errors	ENST00000222553	ensembl	human	known	69_37n	missense	49	12.50	7	SNP	1.000	G
NBPF1	55672	genome.wustl.edu	37	1	16889890	16889891	+	3'UTR	DEL	TG	TG	-	rs58780635|rs545158456	byFrequency	TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr1:16889890_16889891delTG	ENST00000430580.2	-	0	4854_4855					NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1							cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GCTGAAGGACTGTGGCTTCTCT	0.49														1471	0.29373	0.4054	0.2752	5008	,	,		55089	0.3006		0.1958	False		,,,				2504	0.2495					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.*548CA>-	1.37:g.16889892_16889893delTG			Q8N4E8|Q9C0H0	RNA	DEL	-	NULL	ENST00000430580.2	37	NULL		1																																																																																			NBPF1	-	-	ENSG00000219481		0.490	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	HGNC	protein_coding	OTTHUMT00000106436.3	11	0.00	0	TG	NM_017940		16889890	16889891	-1	no_errors	ENST00000392963	ensembl	human	known	69_37n	rna	4	33.33	2	DEL	0.001:0.000	-
NIPSNAP1	8508	genome.wustl.edu	37	22	29951936	29951936	+	Silent	SNP	C	C	T	rs564769856		TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr22:29951936C>T	ENST00000216121.7	-	10	1097	c.843G>A	c.(841-843)tcG>tcA	p.S281S	THOC5_ENST00000397871.1_5'Flank|THOC5_ENST00000397872.1_5'Flank|THOC5_ENST00000397873.2_5'Flank|THOC5_ENST00000490103.1_5'Flank	NM_001202502.1|NM_003634.3	NP_001189431.1|NP_003625.2	Q9BPW8	NIPS1_HUMAN	nipsnap homolog 1 (C. elegans)	281					sensory perception of pain (GO:0019233)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|synaptic membrane (GO:0097060)	neurotransmitter binding (GO:0042165)			large_intestine(2)|lung(2)|skin(1)	5						ACTGCAGAGGCGAGATCTTCA	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18894	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													146.0	111.0	123.0					22																	29951936		1973	3786	5759	-	-	-	SO:0001819	synonymous_variant	0			AJ001258	CCDS13860.1	22q12	2013-09-12	2001-11-28		ENSG00000184117	ENSG00000184117			7827	protein-coding gene	gene with protein product	"""4-nitrophenylphosphatase domain and non-neuronal SNAP25-like 1"""	603249	"""NIPSNAP, C. elegans, homolog 1"""			9661659	Standard	NM_003634		Approved		uc003afx.4	Q9BPW8	OTTHUMG00000151294	ENST00000216121.7:c.843G>A	22.37:g.29951936C>T			B2RAY3|O43800	Silent	SNP	pfam_NIPSNAP,superfamily_Dimeric_a/b-barrel	p.S281	ENST00000216121.7	37	c.843	CCDS13860.1	22																																																																																			NIPSNAP1	-	pfam_NIPSNAP,superfamily_Dimeric_a/b-barrel	ENSG00000184117		0.582	NIPSNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPSNAP1	HGNC	protein_coding	OTTHUMT00000322117.1	38	0.00	0	C			29951936	29951936	-1	no_errors	ENST00000216121	ensembl	human	known	69_37n	silent	22	21.43	6	SNP	0.068	T
NLRP13	126204	genome.wustl.edu	37	19	56424072	56424072	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr19:56424072G>T	ENST00000342929.3	-	5	1110	c.1111C>A	c.(1111-1113)Ctt>Att	p.L371I	NLRP13_ENST00000588751.1_Missense_Mutation_p.L371I	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	371	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		GAGGCCTTAAGATCTCTCACA	0.448																																						dbGAP											0													120.0	114.0	116.0					19																	56424072		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.1111C>A	19.37:g.56424072G>T	ENSP00000343891:p.Leu371Ile		Q7RTR5	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L371I	ENST00000342929.3	37	c.1111	CCDS33119.1	19	.	.	.	.	.	.	.	.	.	.	G	12.45	1.940565	0.34283	.	.	ENSG00000173572	ENST00000342929	T	0.79940	-1.32	2.81	0.181	0.15073	.	.	.	.	.	T	0.81522	0.4840	L	0.46157	1.445	0.09310	N	1	D	0.69078	0.997	D	0.68765	0.96	T	0.67409	-0.5678	9	0.56958	D	0.05	.	2.8295	0.05495	0.1636:0.0:0.5641:0.2724	.	371	Q86W25	NAL13_HUMAN	I	371	ENSP00000343891:L371I	ENSP00000343891:L371I	L	-	1	0	NLRP13	61115884	0.003000	0.15002	0.001000	0.08648	0.008000	0.06430	0.633000	0.24598	0.491000	0.27793	0.591000	0.81541	CTT	NLRP13	-	NULL	ENSG00000173572		0.448	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP13	HGNC	protein_coding	OTTHUMT00000396560.1	47	0.00	0	G	NM_176810		56424072	56424072	-1	no_errors	ENST00000342929	ensembl	human	known	69_37n	missense	35	20.45	9	SNP	0.000	T
NOP56	10528	genome.wustl.edu	37	20	2633420	2633421	+	Intron	INS	-	-	G	rs369912936		TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr20:2633420_2633421insG	ENST00000329276.5	+	2	519				SNORD110_ENST00000408189.1_RNA|MIR1292_ENST00000408135.1_RNA|SNORA51_ENST00000606420.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein						cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						cgcctgcgcctgccctgGGAAC	0.738																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.4-67->G	20.37:g.2633421_2633421dupG			Q2M3T6|Q9NQ05	RNA	INS	-	NULL	ENST00000329276.5	37	NULL	CCDS13030.1	20																																																																																			NOP56	-	-	ENSG00000101361		0.738	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP56	HGNC	protein_coding	OTTHUMT00000077631.2	11	0.00	0	-	NM_006392		2633420	2633421	+1	no_errors	ENST00000469588	ensembl	human	known	69_37n	rna	2	71.43	5	INS	0.003:0.000	G
OR5T2	219464	genome.wustl.edu	37	11	56000263	56000263	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr11:56000263G>T	ENST00000313264.4	-	1	474	c.399C>A	c.(397-399)ttC>ttA	p.F133L		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					CACATCCAAGGAATGAAATGA	0.388																																						dbGAP											0													133.0	120.0	125.0					11																	56000263		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.399C>A	11.37:g.56000263G>T	ENSP00000323688:p.Phe133Leu		B9EGX5|Q6IFC8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.F133L	ENST00000313264.4	37	c.399	CCDS31523.1	11	.	.	.	.	.	.	.	.	.	.	G	12.12	1.843587	0.32606	.	.	ENSG00000181718	ENST00000313264	T	0.00327	8.09	5.07	-7.47	0.01365	GPCR, rhodopsin-like superfamily (1);	0.159834	0.29133	N	0.013054	T	0.00178	0.0005	L	0.28740	0.885	0.09310	N	1	B	0.14012	0.009	B	0.17979	0.02	T	0.49735	-0.8908	10	0.54805	T	0.06	.	15.7665	0.78131	0.5096:0.0:0.4904:0.0	.	133	Q8NGG2	OR5T2_HUMAN	L	133	ENSP00000323688:F133L	ENSP00000323688:F133L	F	-	3	2	OR5T2	55756839	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.038000	0.01419	-1.416000	0.02019	-1.338000	0.01255	TTC	OR5T2	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181718		0.388	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T2	HGNC	protein_coding	OTTHUMT00000391598.1	65	0.00	0	G	NM_001004746		56000263	56000263	-1	no_errors	ENST00000313264	ensembl	human	known	69_37n	missense	58	29.27	24	SNP	0.000	T
OR5M11	219487	genome.wustl.edu	37	11	56310545	56310545	+	Silent	SNP	G	G	A			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr11:56310545G>A	ENST00000528616.2	-	1	212	c.189C>T	c.(187-189)ctC>ctT	p.L63L		NM_001005245.1	NP_001005245.1	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M, member 11	63						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)	18						CTAAGTTAGTGAGGAAGAAGT	0.458																																						dbGAP											0													150.0	150.0	150.0					11																	56310545		2168	4281	6449	-	-	-	SO:0001819	synonymous_variant	0			AP002517	CCDS53629.1	11q11	2012-08-09				ENSG00000255223		"""GPCR / Class A : Olfactory receptors"""	15291	protein-coding gene	gene with protein product							Standard	NM_001005245		Approved	OR11-199	uc010rjl.2	Q96RB7		ENST00000528616.2:c.189C>T	11.37:g.56310545G>A			B2RNL5|B2RNL7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L63	ENST00000528616.2	37	c.189	CCDS53629.1	11																																																																																			OR5M11	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000255223		0.458	OR5M11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M11	HGNC	protein_coding	OTTHUMT00000391608.1	58	0.00	0	G	NM_001005245		56310545	56310545	-1	no_errors	ENST00000528616	ensembl	human	known	69_37n	silent	85	13.27	13	SNP	0.998	A
PAQR8	85315	genome.wustl.edu	37	6	52268978	52268978	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr6:52268978G>T	ENST00000442253.2	+	2	1141	c.967G>T	c.(967-969)Gcc>Tcc	p.A323S	PAQR8_ENST00000360726.3_Missense_Mutation_p.A323S	NM_133367.4	NP_588608.1	Q8TEZ7	MPRB_HUMAN	progestin and adipoQ receptor family member VIII	323					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|response to steroid hormone (GO:0048545)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)			endometrium(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(2)	17	Lung NSC(77;0.0875)					TGTCCACATGGCCTGCCTCTC	0.602																																						dbGAP											0													34.0	33.0	33.0					6																	52268978		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF347029	CCDS4941.1	6p12	2012-08-10	2005-05-20	2005-05-20	ENSG00000170915	ENSG00000170915			15708	protein-coding gene	gene with protein product		607780	"""chromosome 6 open reading frame 33"""	C6orf33		11676489, 12574519	Standard	NM_133367		Approved	LMPB1, MPRB	uc003pao.4	Q8TEZ7	OTTHUMG00000014846	ENST00000442253.2:c.967G>T	6.37:g.52268978G>T	ENSP00000406197:p.Ala323Ser		B2RCF6|Q86WL0|Q8N6D3|Q9HD02	Missense_Mutation	SNP	pfam_HlyIII-related,superfamily_C-type_lectin_fold	p.A323S	ENST00000442253.2	37	c.967	CCDS4941.1	6	.	.	.	.	.	.	.	.	.	.	G	11.34	1.608793	0.28623	.	.	ENSG00000170915	ENST00000442253;ENST00000360726	T;T	0.23754	1.89;1.89	5.49	5.49	0.81192	.	0.338824	0.30126	N	0.010343	T	0.05593	0.0147	N	0.15975	0.35	0.42239	D	0.991928	B	0.12630	0.006	B	0.10450	0.005	T	0.29912	-0.9996	9	.	.	.	-0.9663	7.4507	0.27237	0.0837:0.0:0.738:0.1783	.	323	Q8TEZ7	MPRB_HUMAN	S	323	ENSP00000406197:A323S;ENSP00000353953:A323S	.	A	+	1	0	PAQR8	52376937	0.970000	0.33590	0.965000	0.40720	0.956000	0.61745	2.908000	0.48750	2.577000	0.86979	0.655000	0.94253	GCC	PAQR8	-	NULL	ENSG00000170915		0.602	PAQR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR8	HGNC	protein_coding	OTTHUMT00000040903.2	33	0.00	0	G	NM_133367		52268978	52268978	+1	no_errors	ENST00000360726	ensembl	human	known	69_37n	missense	47	12.96	7	SNP	0.998	T
PDE1B	5153	genome.wustl.edu	37	12	54969998	54969998	+	Intron	SNP	A	A	G	rs1249949	byFrequency	TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr12:54969998A>G	ENST00000243052.3	+	13	1812				PPP1R1A_ENST00000547431.1_3'UTR|PDE1B_ENST00000394277.3_Intron|PDE1B_ENST00000550620.1_Intron|PDE1B_ENST00000538346.1_Intron	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent						activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	GGGGAGGCAGACTGCTTCAAG	0.552													G|||	2528	0.504792	0.4902	0.5706	5008	,	,		18800	0.4712		0.4732	False		,,,				2504	0.545					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.1376+114A>G	12.37:g.54969998A>G			Q92825|Q96KP3	RNA	SNP	-	NULL	ENST00000243052.3	37	NULL	CCDS8882.1	12																																																																																			PPP1R1A	-	-	ENSG00000135447		0.552	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R1A	HGNC	protein_coding	OTTHUMT00000406203.1	9	0.00	0	A			54969998	54969998	-1	no_errors	ENST00000547431	ensembl	human	known	69_37n	rna	5	66.67	10	SNP	0.000	G
HELZ2	85441	genome.wustl.edu	37	20	62191954	62191954	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr20:62191954C>T	ENST00000467148.1	-	16	7447	c.7378G>A	c.(7378-7380)Gct>Act	p.A2460T	HELZ2_ENST00000427522.2_Missense_Mutation_p.A1891T	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2460	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TCCTTGCCAGCGTGGCCCAGG	0.632																																						dbGAP											0													89.0	88.0	88.0					20																	62191954		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.7378G>A	20.37:g.62191954C>T	ENSP00000417401:p.Ala2460Thr		Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	pfam_RNase_II/R,smart_RNase_II/R	p.A2460T	ENST00000467148.1	37	c.7378	CCDS33508.1	20	.	.	.	.	.	.	.	.	.	.	C	3.377	-0.127121	0.06795	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	D;D	0.92249	-3.0;-3.0	4.12	-5.93	0.02254	ATPase, AAA+ type, core (1);	1.116280	0.06769	N	0.783121	T	0.73156	0.3551	N	0.02379	-0.575	0.09310	N	1	B;B	0.23854	0.063;0.092	B;B	0.18561	0.022;0.013	T	0.66866	-0.5815	10	0.10377	T	0.69	0.1341	6.2973	0.21093	0.0:0.2575:0.3757:0.3669	.	2460;1891	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	T	1891;2460	ENSP00000393257:A1891T;ENSP00000417401:A2460T	ENSP00000393257:A1891T	A	-	1	0	RP4-697K14.7	61662398	0.000000	0.05858	0.000000	0.03702	0.462000	0.32619	-0.330000	0.07925	-0.526000	0.06383	0.491000	0.48974	GCT	RP4-697K14.7	-	NULL	ENSG00000130589		0.632	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIC285	Clone_based_vega_gene	protein_coding	OTTHUMT00000354127.1	56	0.00	0	C	NM_001037335		62191954	62191954	-1	no_errors	ENST00000467148	ensembl	human	known	69_37n	missense	45	15.09	8	SNP	0.000	T
RASA3	22821	genome.wustl.edu	37	13	114786882	114786882	+	Silent	SNP	C	C	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr13:114786882C>T	ENST00000334062.7	-	9	904	c.783G>A	c.(781-783)gcG>gcA	p.A261A	RASA3_ENST00000389544.4_Silent_p.A229A|RASA3_ENST00000542651.1_3'UTR	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	261					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			CATCTTACCACGCCTCGTAGG	0.527																																						dbGAP											0													129.0	104.0	112.0					13																	114786882		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.783G>A	13.37:g.114786882C>T			A6NL15|F8W6X8|Q8IUY2	Silent	SNP	pfam_RasGAP,pfam_C2_Ca-dep,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,prints_Znf_Btk_motif,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP	p.A261	ENST00000334062.7	37	c.783	CCDS32016.1	13																																																																																			RASA3	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	ENSG00000185989		0.527	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASA3	HGNC	protein_coding	OTTHUMT00000045957.2	54	0.00	0	C	NM_007368		114786882	114786882	-1	no_errors	ENST00000334062	ensembl	human	known	69_37n	silent	42	19.23	10	SNP	0.960	T
SLC28A2	9153	genome.wustl.edu	37	15	45557310	45557310	+	Silent	SNP	C	C	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr15:45557310C>T	ENST00000347644.3	+	8	791	c.726C>T	c.(724-726)gcC>gcT	p.A242A	CTD-2651B20.3_ENST00000561404.1_RNA|CTD-2651B20.3_ENST00000560344.1_RNA	NM_004212.3	NP_004203.2	O43868	S28A2_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 2	242					nucleobase-containing compound metabolic process (GO:0006139)|purine nucleoside transmembrane transport (GO:0015860)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside:sodium symporter activity (GO:0005415)|purine nucleoside transmembrane transporter activity (GO:0015211)			NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(4)|skin(1)	26		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)	Mercaptopurine(DB01033)	ACACTGTGGCCGGCTCCAGTT	0.448																																					NSCLC(92;493 1501 26361 28917 47116)	dbGAP											0													138.0	133.0	135.0					15																	45557310		2198	4298	6496	-	-	-	SO:0001819	synonymous_variant	0			U84392	CCDS10121.1	15q15	2013-07-17	2013-07-17		ENSG00000137860	ENSG00000137860		"""Solute carriers"""	11002	protein-coding gene	gene with protein product		606208	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 2"""			9435697	Standard	NM_004212		Approved	CNT2, SPNT1, HCNT2, HsT17153	uc001zva.2	O43868	OTTHUMG00000131426	ENST00000347644.3:c.726C>T	15.37:g.45557310C>T			A8K7F9|O43239|Q52LZ0	Silent	SNP	pfam_Nucleos_tra2_C,pfam_Nuclsd_transpt2,pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac	p.A242	ENST00000347644.3	37	c.726	CCDS10121.1	15																																																																																			SLC28A2	-	pfam_Nuclsd_transpt2,tigrfam_C_nuclsd_transpt_met_bac	ENSG00000137860		0.448	SLC28A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC28A2	HGNC	protein_coding	OTTHUMT00000254219.2	64	0.00	0	C	NM_004212		45557310	45557310	+1	no_errors	ENST00000347644	ensembl	human	known	69_37n	silent	45	30.77	20	SNP	0.802	T
SPRED2	200734	genome.wustl.edu	37	2	65561392	65561392	+	Intron	SNP	C	C	T	rs4671658	byFrequency	TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr2:65561392C>T	ENST00000356388.4	-	3	563				SPRED2_ENST00000474228.1_5'UTR|SPRED2_ENST00000443619.2_Intron	NM_181784.2	NP_861449.2	Q7Z698	SPRE2_HUMAN	sprouty-related, EVH1 domain containing 2						inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(7)|ovary(2)|upper_aerodigestive_tract(3)	34						AGAATCCATTCTCTACTTCTG	0.507													C|||	1798	0.359026	0.0598	0.3919	5008	,	,		18575	0.6796		0.2982	False		,,,				2504	0.4724					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF052178	CCDS33211.1, CCDS46308.1	2p14	2003-06-02			ENSG00000198369	ENSG00000198369			17722	protein-coding gene	gene with protein product		609292					Standard	NM_181784		Approved	Spred-2, FLJ21897, FLJ31917	uc002sdr.4	Q7Z698	OTTHUMG00000152737	ENST00000356388.4:c.373+346G>A	2.37:g.65561392C>T			A1L3V4|B7Z5K7|D6W5F7|E9PEP0|Q2NKX6	Silent	SNP	pfam_EVH1,pfscan_EVH1	p.E86	ENST00000356388.4	37	c.258	CCDS33211.1	2																																																																																			SPRED2	-	NULL	ENSG00000198369		0.507	SPRED2-001	KNOWN	basic|CCDS	protein_coding	SPRED2	HGNC	protein_coding	OTTHUMT00000327632.1	38	0.00	0	C			65561392	65561392	-1	no_start_codon	ENST00000426832	ensembl	human	known	69_37n	silent	25	13.79	4	SNP	0.254	T
SPTAN1	6709	genome.wustl.edu	37	9	131394575	131394575	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr9:131394575A>G	ENST00000372731.4	+	52	7027	c.6917A>G	c.(6916-6918)cAc>cGc	p.H2306R	SPTAN1_ENST00000372739.3_Missense_Mutation_p.H2311R|WDR34_ENST00000483181.1_5'Flank|SPTAN1_ENST00000358161.5_Missense_Mutation_p.H2311R	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	2306					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						CGCATGCAGCACAACCTGGAG	0.652																																					NSCLC(120;833 1744 2558 35612 37579)	dbGAP											0													30.0	31.0	31.0					9																	131394575		2203	4300	6503	-	-	-	SO:0001583	missense	0			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.6917A>G	9.37:g.131394575A>G	ENSP00000361816:p.His2306Arg		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_EF-hand,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,smart_EF_hand_Ca-bd,prints_Spectrin_alpha_SH3,prints_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain	p.H2311R	ENST00000372731.4	37	c.6932	CCDS6905.1	9	.	.	.	.	.	.	.	.	.	.	A	24.0	4.482880	0.84747	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.49432	0.78;0.78;0.78	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.73466	0.3590	M	0.88775	2.98	0.80722	D	1	D;D;D	0.89917	1.0;0.96;0.996	D;D;D	0.87578	0.998;0.923;0.938	T	0.79610	-0.1732	10	0.72032	D	0.01	.	15.1535	0.72720	1.0:0.0:0.0:0.0	.	2286;2311;2306	Q13813-3;Q13813-2;Q13813	.;.;SPTA2_HUMAN	R	2311;2306;2311;2286	ENSP00000350882:H2311R;ENSP00000361816:H2306R;ENSP00000361824:H2311R	ENSP00000350882:H2311R	H	+	2	0	SPTAN1	130434396	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.951000	0.93025	1.976000	0.57569	0.459000	0.35465	CAC	SPTAN1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000197694		0.652	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	HGNC	protein_coding	OTTHUMT00000054472.1	43	0.00	0	A	NM_003127		131394575	131394575	+1	no_errors	ENST00000358161	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	1.000	G
SUDS3	64426	genome.wustl.edu	37	12	118828801	118828801	+	Intron	SNP	A	A	G	rs61943397	byFrequency	TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr12:118828801A>G	ENST00000543473.1	+	6	672				SUDS3_ENST00000397564.2_Silent_p.T115T	NM_022491.2	NP_071936.2	Q9H7L9	SDS3_HUMAN	suppressor of defective silencing 3 homolog (S. cerevisiae)						apoptotic process (GO:0006915)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)			breast(1)|lung(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCTCAGACACACTGTTACTGC	0.478													G|||	507	0.101238	0.149	0.0908	5008	,	,		17019	0.006		0.1829	False		,,,				2504	0.0583					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK023801	CCDS44993.1	12q24.23	2006-02-13	2006-02-13		ENSG00000111707	ENSG00000111707			29545	protein-coding gene	gene with protein product	"""sin3A-associated protein, 45kDa"""	608250	"""suppressor of defective silencing 3 homolog (SDS3, S. cerevisiae)"""			11909966	Standard	NM_022491		Approved	SDS3, FLJ00052, SAP45	uc001twz.3	Q9H7L9	OTTHUMG00000168884	ENST00000543473.1:c.361-130A>G	12.37:g.118828801A>G			Q4KMQ5|Q8N6H0|Q9H8D2	Silent	SNP	pfam_Sds3	p.T115	ENST00000543473.1	37	c.345	CCDS44993.1	12																																																																																			SUDS3	-	pfam_Sds3	ENSG00000111707		0.478	SUDS3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SUDS3	HGNC	protein_coding	OTTHUMT00000401504.1	50	0.00	0	A	NM_022491		118828801	118828801	+1	no_errors	ENST00000397564	ensembl	human	known	69_37n	silent	27	15.62	5	SNP	0.000	G
TIMP3	7078	genome.wustl.edu	37	22	33253339	33253339	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr22:33253339T>C	ENST00000266085.6	+	3	609	c.308T>C	c.(307-309)cTg>cCg	p.L103P	SYN3_ENST00000358763.2_Intron|SYN3_ENST00000332840.5_Intron	NM_000362.4	NP_000353.1	P35625	TIMP3_HUMAN	TIMP metallopeptidase inhibitor 3	103	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				cellular response to organic substance (GO:0071310)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(2)|large_intestine(3)|lung(1)|urinary_tract(1)	7						TACCAGTACCTGCTGACAGGT	0.512																																						dbGAP											0													123.0	98.0	107.0					22																	33253339		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13911.1	22q12.3	2013-01-08	2008-07-31		ENSG00000100234	ENSG00000100234			11822	protein-coding gene	gene with protein product		188826	"""tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory)"""	SFD		8188246, 12652295	Standard	NM_000362		Approved		uc003anb.3	P35625	OTTHUMG00000030784	ENST00000266085.6:c.308T>C	22.37:g.33253339T>C	ENSP00000266085:p.Leu103Pro		B2RBY9|Q5THV4|Q9UC74|Q9UGS2	Missense_Mutation	SNP	pfam_Prot_inh_TIMP,superfamily_TIMP-like_OB-fold,smart_Prot_inh_TIMP,pfscan_Netrin_domain	p.L103P	ENST00000266085.6	37	c.308	CCDS13911.1	22	.	.	.	.	.	.	.	.	.	.	T	23.4	4.410433	0.83340	.	.	ENSG00000100234	ENST00000266085;ENST00000538671;ENST00000382049	D	0.97811	-4.55	5.62	5.62	0.85841	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);	0.000000	0.64402	D	0.000001	D	0.98905	0.9629	M	0.89968	3.075	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99768	1.1023	10	0.87932	D	0	.	15.8132	0.78581	0.0:0.0:0.0:1.0	.	103	P35625	TIMP3_HUMAN	P	103;37;103	ENSP00000266085:L103P	ENSP00000266085:L103P	L	+	2	0	TIMP3	31583339	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.474000	0.81024	2.131000	0.65755	0.459000	0.35465	CTG	TIMP3	-	pfam_Prot_inh_TIMP,superfamily_TIMP-like_OB-fold,smart_Prot_inh_TIMP,pfscan_Netrin_domain	ENSG00000100234		0.512	TIMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMP3	HGNC	protein_coding	OTTHUMT00000075672.2	78	0.00	0	T	NM_000362		33253339	33253339	+1	no_errors	ENST00000266085	ensembl	human	known	69_37n	missense	47	22.95	14	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7578370	7578370	+	Splice_Site	SNP	C	C	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr17:7578370C>T	ENST00000269305.4	-	5	749		c.e5+1		TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000574684.1_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(54)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCTGCTCACCATCGCTATC	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	68	Unknown(54)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	lung(12)|breast(9)|oesophagus(7)|ovary(7)|liver(7)|urinary_tract(5)|NS(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(2)|stomach(1)|soft_tissue(1)											48.0	46.0	47.0					17																	7578370		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.559+1G>A	17.37:g.7578370C>T			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e4+1	ENST00000269305.4	37	c.559+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	11.89	1.774230	0.31411	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.7	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0738	0.59075	0.0:0.8363:0.1637:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519095	1.000000	0.71417	0.967000	0.41034	0.201000	0.24016	3.085000	0.50151	1.248000	0.43934	0.655000	0.94253	.	TP53	-	-	ENSG00000141510		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	43	0.00	0	C	NM_000546	Intron	7578370	7578370	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	splice_site	24	27.27	9	SNP	1.000	T
TTC17	55761	genome.wustl.edu	37	11	43511840	43511840	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr11:43511840A>G	ENST00000039989.4	+	22	3096	c.3082A>G	c.(3082-3084)Aaa>Gaa	p.K1028E		NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	1028					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						CTGGAGGGTGAAAGGCCAAGG	0.552																																						dbGAP											0													102.0	87.0	92.0					11																	43511840		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.3082A>G	11.37:g.43511840A>G	ENSP00000039989:p.Lys1028Glu		G3XAB3|Q8NEC0	Missense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.K1028E	ENST00000039989.4	37	c.3082	CCDS31466.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.58|15.58	2.876269|2.876269	0.51801|0.51801	.|.	.|.	ENSG00000052841|ENSG00000052841	ENST00000039989|ENST00000418561	T|.	0.54675|.	0.56|.	5.66|5.66	5.66|5.66	0.87406|0.87406	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.60830|.	0.2299|.	L|L	0.45285|0.45285	1.41|1.41	0.50039|0.50039	D|D	0.999849|0.999849	D|.	0.69078|.	0.997|.	D|.	0.73380|.	0.98|.	T|.	0.58154|.	-0.7686|.	10|.	0.42905|.	T|.	0.14|.	-19.6628|-19.6628	14.4769|14.4769	0.67551|0.67551	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1028|.	Q96AE7|.	TTC17_HUMAN|.	E|W	1028|58	ENSP00000039989:K1028E|.	ENSP00000039989:K1028E|.	K|X	+|+	1|3	0|0	TTC17|TTC17	43468416|43468416	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	6.045000|6.045000	0.71020|0.71020	2.154000|2.154000	0.67381|0.67381	0.533000|0.533000	0.62120|0.62120	AAA|TGA	TTC17	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000052841		0.552	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC17	HGNC	protein_coding	OTTHUMT00000389577.2	55	0.00	0	A	NM_018259		43511840	43511840	+1	no_errors	ENST00000039989	ensembl	human	known	69_37n	missense	26	25.71	9	SNP	1.000	G
CFAP46	54777	genome.wustl.edu	37	10	134699401	134699401	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr10:134699401C>T	ENST00000368586.5	-	26	3467	c.3367G>A	c.(3367-3369)Gac>Aac	p.D1123N	TTC40_ENST00000368582.2_Missense_Mutation_p.D1123N	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						TCGTCCTGGTCGGCATGGCTG	0.697																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0																														ENST00000368586.5:c.3367G>A	10.37:g.134699401C>T	ENSP00000357575:p.Asp1123Asn			Missense_Mutation	SNP	NULL	p.D1123N	ENST00000368586.5	37	c.3367	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	C	16.40	3.112030	0.56398	.	.	ENSG00000171811	ENST00000368586;ENST00000368582	T;T	0.60424	2.15;0.19	3.52	3.52	0.40303	.	.	.	.	.	T	0.63593	0.2524	.	.	.	0.24333	N	0.994996	.	.	.	.	.	.	T	0.58940	-0.7547	6	0.72032	D	0.01	.	13.8994	0.63794	0.0:1.0:0.0:0.0	.	.	.	.	N	1123	ENSP00000357575:D1123N;ENSP00000357571:D1123N	ENSP00000357571:D1123N	D	-	1	0	C10orf93	134549391	0.987000	0.35691	0.044000	0.18714	0.273000	0.26683	3.136000	0.50554	1.529000	0.49120	0.306000	0.20318	GAC	TTC40	-	NULL	ENSG00000171811		0.697	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	29	0.00	0	C			134699401	134699401	-1	no_errors	ENST00000368582	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	0.769	T
TTLL4	9654	genome.wustl.edu	37	2	219602492	219602492	+	Frame_Shift_Del	DEL	G	G	-	rs568149810	byFrequency	TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr2:219602492delG	ENST00000392102.1	+	3	433	c.93delG	c.(91-93)acgfs	p.T31fs	TTLL4_ENST00000258398.4_Frame_Shift_Del_p.T31fs|TTLL4_ENST00000442769.1_Frame_Shift_Del_p.T31fs|TTLL4_ENST00000457313.1_Intron	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	31					protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		TACCTGCCACGCCACCTGAGA	0.567																																					GBM(172;1818 2053 15407 20943 49753)	dbGAP											0													64.0	66.0	65.0					2																	219602492		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.93delG	2.37:g.219602492delG	ENSP00000375951:p.Thr31fs		A8K6V5|Q8WW29	Frame_Shift_Del	DEL	pfam_Tub_tyr_ligase	p.P32fs	ENST00000392102.1	37	c.93	CCDS2422.1	2																																																																																			TTLL4	-	NULL	ENSG00000135912		0.567	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL4	HGNC	protein_coding	OTTHUMT00000256726.1	52	0.00	0	G	NM_014640		219602492	219602492	+1	no_errors	ENST00000258398	ensembl	human	known	69_37n	frame_shift_del	52	11.86	7	DEL	0.000	-
TUT1	64852	genome.wustl.edu	37	11	62344705	62344705	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr11:62344705G>A	ENST00000476907.1	-	6	1910	c.1219C>T	c.(1219-1221)Cgg>Tgg	p.R407W	EEF1G_ENST00000378019.3_5'Flank|TUT1_ENST00000308436.7_Missense_Mutation_p.R445W|MIR3654_ENST00000496634.2_Missense_Mutation_p.R407W			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	407					mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						ACGAGGGGCCGGACTCGACCA	0.602																																						dbGAP											0													63.0	63.0	63.0					11																	62344705		2202	4299	6501	-	-	-	SO:0001583	missense	0			BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.1219C>T	11.37:g.62344705G>A	ENSP00000419607:p.Arg407Trp		A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R445W	ENST00000476907.1	37	c.1333		11	.	.	.	.	.	.	.	.	.	.	G	25.0	4.595059	0.86953	.	.	ENSG00000149016	ENST00000308436;ENST00000476907	T;T	0.61040	0.14;0.14	5.84	5.84	0.93424	.	0.055265	0.64402	D	0.000001	D	0.82563	0.5064	M	0.93978	3.48	0.37768	D	0.926577	D	0.89917	1.0	D	0.79108	0.992	D	0.87926	0.2707	10	0.87932	D	0	-20.9906	17.6318	0.88111	0.0:0.0:1.0:0.0	.	445	F5H0R1	.	W	445;407	ENSP00000308000:R445W;ENSP00000419607:R407W	ENSP00000441670:R407W	R	-	1	2	TUT1	62101281	1.000000	0.71417	0.993000	0.49108	0.966000	0.64601	3.556000	0.53734	2.779000	0.95612	0.655000	0.94253	CGG	TUT1	-	NULL	ENSG00000149016		0.602	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	TUT1	HGNC	protein_coding	OTTHUMT00000351319.2	35	0.00	0	G	NM_022830		62344705	62344705	-1	no_errors	ENST00000308436	ensembl	human	known	69_37n	missense	34	15.00	6	SNP	0.989	A
WHAMM	123720	genome.wustl.edu	37	15	83491923	83491923	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr15:83491923G>C	ENST00000286760.4	+	6	1441	c.1342G>C	c.(1342-1344)Gtg>Ctg	p.V448L		NM_001080435.1	NP_001073904.1	Q8TF30	WHAMM_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules	448	Mediates interaction with microtubules. {ECO:0000269|PubMed:23027905}.				actin filament organization (GO:0007015)|actin filament reorganization (GO:0090527)|ER to Golgi vesicle-mediated transport (GO:0006888)|focal adhesion assembly (GO:0048041)|lamellipodium assembly (GO:0030032)|membrane tubulation (GO:0097320)|positive regulation of actin nucleation (GO:0051127)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|Golgi membrane (GO:0000139)	Arp2/3 complex binding (GO:0071933)|GTP-Rho binding (GO:0017049)|microtubule binding (GO:0008017)			endometrium(6)|large_intestine(5)|lung(1)|prostate(1)	13						TGACTGTGTGGTGGGGCTGCA	0.413																																						dbGAP											0													37.0	36.0	36.0					15																	83491923		1898	4121	6019	-	-	-	SO:0001583	missense	0			AK126887	CCDS45333.1	15q25.2	2009-02-18	2009-02-18	2009-02-18	ENSG00000156232	ENSG00000156232			30493	protein-coding gene	gene with protein product		612393	"""WAS protein homology region 2 domain containing 1"""	WHDC1		11853319, 18226259, 18614018, 18812086	Standard	XM_005272422		Approved	KIAA1971	uc002bje.3	Q8TF30		ENST00000286760.4:c.1342G>C	15.37:g.83491923G>C	ENSP00000286760:p.Val448Leu		Q8N1J9	Missense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_WH2_dom	p.V448L	ENST00000286760.4	37	c.1342	CCDS45333.1	15	.	.	.	.	.	.	.	.	.	.	G	11.98	1.801520	0.31869	.	.	ENSG00000156232	ENST00000286760;ENST00000234505	T	0.37752	1.18	5.13	1.62	0.23740	.	1.249040	0.05348	N	0.531341	T	0.17195	0.0413	N	0.04043	-0.29	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.24693	-1.0153	10	0.10377	T	0.69	.	7.881	0.29623	0.1892:0.1751:0.6357:0.0	.	448	Q8TF30	WHAMM_HUMAN	L	448	ENSP00000286760:V448L	ENSP00000234505:V448L	V	+	1	0	WHAMM	81288977	0.000000	0.05858	0.001000	0.08648	0.777000	0.43975	0.089000	0.15002	-0.027000	0.13873	0.491000	0.48974	GTG	WHAMM	-	NULL	ENSG00000156232		0.413	WHAMM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WHAMM	HGNC	protein_coding	OTTHUMT00000418463.1	106	0.00	0	G			83491923	83491923	+1	no_errors	ENST00000286760	ensembl	human	known	69_37n	missense	75	12.79	11	SNP	0.005	C
ZFYVE20	64145	genome.wustl.edu	37	3	15126258	15126258	+	Silent	SNP	G	G	A			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr3:15126258G>A	ENST00000253699.3	-	8	1195	c.582C>T	c.(580-582)atC>atT	p.I194I	ZFYVE20_ENST00000449964.2_5'UTR|ZFYVE20_ENST00000435849.3_Silent_p.I194I|ZFYVE20_ENST00000476527.2_Silent_p.I194I	NM_022340.2	NP_071735.2	Q9H1K0	RBNS5_HUMAN	zinc finger, FYVE domain containing 20	194	Necessary for the correct targeting to endosomes.				blood coagulation (GO:0007596)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	endosome (GO:0005768)|endosome membrane (GO:0010008)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|skin(3)|stomach(1)|urinary_tract(2)	26						AGGGAAGGCTGATGAGCTCCA	0.537																																						dbGAP											0													81.0	87.0	85.0					3																	15126258		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY009133	CCDS2623.1	3p25.1	2014-01-15			ENSG00000131381	ENSG00000131381		"""Zinc fingers, FYVE domain containing"""	20759	protein-coding gene	gene with protein product		609511				11062261	Standard	XR_427283		Approved	Rabenosyn-5	uc003bzm.1	Q9H1K0	OTTHUMG00000129860	ENST00000253699.3:c.582C>T	3.37:g.15126258G>A			B4DWY8|C9J4P5|Q3KP30|Q59EY8|Q8NAQ1	Silent	SNP	pfam_Rbsn,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Znf_C2H2	p.I194	ENST00000253699.3	37	c.582	CCDS2623.1	3																																																																																			ZFYVE20	-	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	ENSG00000131381		0.537	ZFYVE20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE20	HGNC	protein_coding	OTTHUMT00000252102.2	35	0.00	0	G	NM_022340		15126258	15126258	-1	no_errors	ENST00000253699	ensembl	human	known	69_37n	silent	23	23.33	7	SNP	1.000	A
ZNF747	65988	genome.wustl.edu	37	16	30544048	30544048	+	3'UTR	SNP	G	G	A			TCGA-A2-A3XY-01A-11D-A23C-09	TCGA-A2-A3XY-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5978cf32-c471-4f15-879f-398acec6a866	7a45c59e-841d-4e59-8c8c-f071064f28fc	g.chr16:30544048G>A	ENST00000252799.3	-	0	1575				ZNF747_ENST00000569360.1_Silent_p.H255H|ZNF747_ENST00000535210.1_Silent_p.H255H|ZNF747_ENST00000568028.1_Silent_p.H255H|ZNF747_ENST00000395094.3_3'UTR|AC002310.12_ENST00000569752.1_RNA|AC002310.12_ENST00000457283.3_RNA	NM_023931.2	NP_076420.1	Q9BV97	ZN747_HUMAN	zinc finger protein 747						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			kidney(1)|lung(3)|prostate(1)	5						GAACGCGCAGGTGAGAAGTCA	0.682																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC001361	CCDS10682.1	16p11.2	2013-01-08			ENSG00000169955	ENSG00000169955		"""Zinc fingers, C2H2-type"", ""-"""	28350	protein-coding gene	gene with protein product						10493829	Standard	NM_023931		Approved	MGC2474	uc002dyn.3	Q9BV97	OTTHUMG00000132401	ENST00000252799.3:c.*332C>T	16.37:g.30544048G>A			A8K827|B7WNU3|Q59FB4|Q96NW0	Silent	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H255	ENST00000252799.3	37	c.765	CCDS10682.1	16																																																																																			ZNF747	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000169955		0.682	ZNF747-001	KNOWN	NAGNAG_splice_site|basic|CCDS	protein_coding	ZNF747	HGNC	protein_coding	OTTHUMT00000255532.2	152	0.00	0	G	NM_023931		30544048	30544048	-1	no_errors	ENST00000535210	ensembl	human	known	69_37n	silent	105	13.93	17	SNP	0.982	A
