#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM21P1	145241	genome.wustl.edu	37	14	70712917	70712917	+	RNA	SNP	A	A	G			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr14:70712917A>G	ENST00000530196.1	-	0	1601					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		GCACATATCTATCTTCTGGAC	0.453																																						dbGAP											0																																										-	-	-			0					14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70712917A>G				RNA	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			ADAM21P1	-	-	ENSG00000235812		0.453	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	HGNC	pseudogene	OTTHUMT00000390451.1	76	0.00	0	A	NG_002467		70712917	70712917	-1	no_errors	ENST00000530196	ensembl	human	known	69_37n	rna	51	13.56	8	SNP	0.990	G
ADAM21P1	145241	genome.wustl.edu	37	14	70712917	70712917	+	RNA	SNP	A	A	G			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr14:70712917A>G	ENST00000530196.1	-	0	1601					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		GCACATATCTATCTTCTGGAC	0.453																																						dbGAP											0																																										-	-	-			0					14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70712917A>G				RNA	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			ADAM21P1	-	-	ENSG00000235812		0.453	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	HGNC	pseudogene	OTTHUMT00000390451.1	57	0.00	0	A	NG_002467		70712917	70712917	-1	no_errors	ENST00000530196	ensembl	human	known	69_37n	rna	51	13.56	8	SNP	0.990	G
BOLA1	51027	genome.wustl.edu	37	1	149871946	149871946	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr1:149871946G>A	ENST00000369153.2	+	3	998	c.334G>A	c.(334-336)Gcc>Acc	p.A112T	BOLA1_ENST00000369150.1_Missense_Mutation_p.A112T|BOLA1_ENST00000476344.1_3'UTR|BOLA1_ENST00000369152.5_Missense_Mutation_p.A112T			Q9Y3E2	BOLA1_HUMAN	bolA family member 1	112						extracellular region (GO:0005576)|mitochondrion (GO:0005739)				endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	10	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			ACGGACCCCCGCCCAGTGGAG	0.657																																						dbGAP											0													26.0	30.0	29.0					1																	149871946		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF151901	CCDS939.1	1q21	2013-09-02	2013-09-02		ENSG00000178096	ENSG00000178096			24263	protein-coding gene	gene with protein product		613181	"""bolA-like 1 (E. coli)"", ""bolA homolog 1 (E. coli)"""			14718656	Standard	NM_016074		Approved	CGI-143	uc001etf.3	Q9Y3E2	OTTHUMG00000012087	ENST00000369153.2:c.334G>A	1.37:g.149871946G>A	ENSP00000358149:p.Ala112Thr		B2R7K2|D3DUZ4|Q5QNY0	Missense_Mutation	SNP	pfam_BolA,superfamily_BolA	p.A112T	ENST00000369153.2	37	c.334	CCDS939.1	1	.	.	.	.	.	.	.	.	.	.	G	8.242	0.807029	0.16467	.	.	ENSG00000178096	ENST00000369153;ENST00000369152;ENST00000369150	T;T;T	0.63913	-0.07;-0.07;-0.07	5.5	3.61	0.41365	.	0.231258	0.37095	N	0.002252	T	0.21387	0.0515	N	0.25890	0.77	0.29921	N	0.822779	B	0.10296	0.003	B	0.11329	0.006	T	0.08006	-1.0743	10	0.15952	T	0.53	-15.5448	5.329	0.15922	0.1768:0.1692:0.654:0.0	.	112	Q9Y3E2	BOLA1_HUMAN	T	112	ENSP00000358149:A112T;ENSP00000358148:A112T;ENSP00000358146:A112T	ENSP00000358146:A112T	A	+	1	0	BOLA1	148138570	0.828000	0.29307	0.720000	0.30636	0.033000	0.12548	1.421000	0.34815	1.466000	0.48025	0.462000	0.41574	GCC	BOLA1	-	pfam_BolA,superfamily_BolA	ENSG00000178096		0.657	BOLA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BOLA1	HGNC	protein_coding	OTTHUMT00000033443.2	64	0.00	0	G	NM_016074		149871946	149871946	+1	no_errors	ENST00000369150	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	0.522	A
BOLA1	51027	genome.wustl.edu	37	1	149871946	149871946	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr1:149871946G>A	ENST00000369153.2	+	3	998	c.334G>A	c.(334-336)Gcc>Acc	p.A112T	BOLA1_ENST00000369150.1_Missense_Mutation_p.A112T|BOLA1_ENST00000476344.1_3'UTR|BOLA1_ENST00000369152.5_Missense_Mutation_p.A112T			Q9Y3E2	BOLA1_HUMAN	bolA family member 1	112						extracellular region (GO:0005576)|mitochondrion (GO:0005739)				endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	10	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			ACGGACCCCCGCCCAGTGGAG	0.657																																						dbGAP											0													26.0	30.0	29.0					1																	149871946		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF151901	CCDS939.1	1q21	2013-09-02	2013-09-02		ENSG00000178096	ENSG00000178096			24263	protein-coding gene	gene with protein product		613181	"""bolA-like 1 (E. coli)"", ""bolA homolog 1 (E. coli)"""			14718656	Standard	NM_016074		Approved	CGI-143	uc001etf.3	Q9Y3E2	OTTHUMG00000012087	ENST00000369153.2:c.334G>A	1.37:g.149871946G>A	ENSP00000358149:p.Ala112Thr		B2R7K2|D3DUZ4|Q5QNY0	Missense_Mutation	SNP	pfam_BolA,superfamily_BolA	p.A112T	ENST00000369153.2	37	c.334	CCDS939.1	1	.	.	.	.	.	.	.	.	.	.	G	8.242	0.807029	0.16467	.	.	ENSG00000178096	ENST00000369153;ENST00000369152;ENST00000369150	T;T;T	0.63913	-0.07;-0.07;-0.07	5.5	3.61	0.41365	.	0.231258	0.37095	N	0.002252	T	0.21387	0.0515	N	0.25890	0.77	0.29921	N	0.822779	B	0.10296	0.003	B	0.11329	0.006	T	0.08006	-1.0743	10	0.15952	T	0.53	-15.5448	5.329	0.15922	0.1768:0.1692:0.654:0.0	.	112	Q9Y3E2	BOLA1_HUMAN	T	112	ENSP00000358149:A112T;ENSP00000358148:A112T;ENSP00000358146:A112T	ENSP00000358146:A112T	A	+	1	0	BOLA1	148138570	0.828000	0.29307	0.720000	0.30636	0.033000	0.12548	1.421000	0.34815	1.466000	0.48025	0.462000	0.41574	GCC	BOLA1	-	pfam_BolA,superfamily_BolA	ENSG00000178096		0.657	BOLA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BOLA1	HGNC	protein_coding	OTTHUMT00000033443.2	65	0.00	0	G	NM_016074		149871946	149871946	+1	no_errors	ENST00000369150	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	0.522	A
GPR124	25960	genome.wustl.edu	37	8	37702522	37702522	+	IGR	SNP	C	C	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr8:37702522C>T	ENST00000412232.2	+	0	5651				BRF2_ENST00000220659.6_Missense_Mutation_p.R249Q|BRF2_ENST00000520601.1_3'UTR	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124						central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TTTACAAAATCGGGCAAGGGA	0.622																																						dbGAP											0													33.0	34.0	34.0					8																	37702522		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182		8.37:g.37702522C>T			A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	pfam_Znf_TFIIB,superfamily_Cyclin-like,pfscan_Znf_TFIIB	p.R249Q	ENST00000412232.2	37	c.746	CCDS6097.2	8	.	.	.	.	.	.	.	.	.	.	C	6.436	0.448666	0.12223	.	.	ENSG00000104221	ENST00000220659;ENST00000545765	.	.	.	5.09	2.28	0.28536	.	0.330375	0.32068	N	0.006625	T	0.33089	0.0851	L	0.28192	0.835	0.33895	D	0.637787	B	0.15141	0.012	B	0.04013	0.001	T	0.32877	-0.9890	9	0.12766	T	0.61	.	8.9102	0.35548	0.0:0.6356:0.0:0.3644	.	249	Q9HAW0	BRF2_HUMAN	Q	249;226	.	ENSP00000220659:R249Q	R	-	2	0	BRF2	37821680	0.226000	0.23696	0.952000	0.39060	0.081000	0.17604	0.730000	0.26043	0.170000	0.19704	-0.768000	0.03414	CGA	BRF2	-	superfamily_Cyclin-like	ENSG00000104221		0.622	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRF2	HGNC	protein_coding	OTTHUMT00000343331.2	47	0.00	0	C			37702522	37702522	-1	no_errors	ENST00000220659	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	0.514	T
GPR124	25960	genome.wustl.edu	37	8	37702522	37702522	+	IGR	SNP	C	C	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr8:37702522C>T	ENST00000412232.2	+	0	5651				BRF2_ENST00000220659.6_Missense_Mutation_p.R249Q|BRF2_ENST00000520601.1_3'UTR	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124						central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TTTACAAAATCGGGCAAGGGA	0.622																																						dbGAP											0													33.0	34.0	34.0					8																	37702522		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182		8.37:g.37702522C>T			A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	pfam_Znf_TFIIB,superfamily_Cyclin-like,pfscan_Znf_TFIIB	p.R249Q	ENST00000412232.2	37	c.746	CCDS6097.2	8	.	.	.	.	.	.	.	.	.	.	C	6.436	0.448666	0.12223	.	.	ENSG00000104221	ENST00000220659;ENST00000545765	.	.	.	5.09	2.28	0.28536	.	0.330375	0.32068	N	0.006625	T	0.33089	0.0851	L	0.28192	0.835	0.33895	D	0.637787	B	0.15141	0.012	B	0.04013	0.001	T	0.32877	-0.9890	9	0.12766	T	0.61	.	8.9102	0.35548	0.0:0.6356:0.0:0.3644	.	249	Q9HAW0	BRF2_HUMAN	Q	249;226	.	ENSP00000220659:R249Q	R	-	2	0	BRF2	37821680	0.226000	0.23696	0.952000	0.39060	0.081000	0.17604	0.730000	0.26043	0.170000	0.19704	-0.768000	0.03414	CGA	BRF2	-	superfamily_Cyclin-like	ENSG00000104221		0.622	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRF2	HGNC	protein_coding	OTTHUMT00000343331.2	54	0.00	0	C			37702522	37702522	-1	no_errors	ENST00000220659	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	0.514	T
C2CD3	26005	genome.wustl.edu	37	11	73849826	73849826	+	Silent	SNP	C	C	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr11:73849826C>T	ENST00000334126.7	-	5	1120	c.894G>A	c.(892-894)aaG>aaA	p.K298K	C2CD3_ENST00000539061.1_Silent_p.K298K|C2CD3_ENST00000313663.7_Silent_p.K298K			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	298					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					CACTGTGACTCTTGGCAACTG	0.428																																						dbGAP											0													149.0	133.0	139.0					11																	73849826		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.894G>A	11.37:g.73849826C>T			C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	p.K298	ENST00000334126.7	37	c.894		11																																																																																			C2CD3	-	NULL	ENSG00000168014		0.428	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	HGNC	protein_coding		42	0.00	0	C	NM_015531		73849826	73849826	-1	no_errors	ENST00000334126	ensembl	human	known	69_37n	silent	27	22.86	8	SNP	1.000	T
C2CD3	26005	genome.wustl.edu	37	11	73849826	73849826	+	Silent	SNP	C	C	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr11:73849826C>T	ENST00000334126.7	-	5	1120	c.894G>A	c.(892-894)aaG>aaA	p.K298K	C2CD3_ENST00000539061.1_Silent_p.K298K|C2CD3_ENST00000313663.7_Silent_p.K298K			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	298					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					CACTGTGACTCTTGGCAACTG	0.428																																						dbGAP											0													149.0	133.0	139.0					11																	73849826		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.894G>A	11.37:g.73849826C>T			C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	p.K298	ENST00000334126.7	37	c.894		11																																																																																			C2CD3	-	NULL	ENSG00000168014		0.428	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	HGNC	protein_coding		31	0.00	0	C	NM_015531		73849826	73849826	-1	no_errors	ENST00000334126	ensembl	human	known	69_37n	silent	27	22.86	8	SNP	1.000	T
CDH1	999	genome.wustl.edu	37	16	68862103	68862103	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr16:68862103delC	ENST00000261769.5	+	14	2382	c.2191delC	c.(2191-2193)cttfs	p.L731fs	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Frame_Shift_Del_p.L670fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	731		Cleavage; by gamma-secretase/PS1.			adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CTTGCTGTTTCTTCGGAGGAG	0.522			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	0													116.0	107.0	111.0					16																	68862103		2198	4300	6498	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2191delC	16.37:g.68862103delC	ENSP00000261769:p.Leu731fs		A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L731fs	ENST00000261769.5	37	c.2191	CCDS10869.1	16																																																																																			CDH1	-	NULL	ENSG00000039068		0.522	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	186	0.00	0	C	NM_004360		68862103	68862103	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_del	82	24.11	27	DEL	0.037	-
CDH1	999	genome.wustl.edu	37	16	68862103	68862103	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr16:68862103delC	ENST00000261769.5	+	14	2382	c.2191delC	c.(2191-2193)cttfs	p.L731fs	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Frame_Shift_Del_p.L670fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	731		Cleavage; by gamma-secretase/PS1.			adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CTTGCTGTTTCTTCGGAGGAG	0.522			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	0													116.0	107.0	111.0					16																	68862103		2198	4300	6498	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2191delC	16.37:g.68862103delC	ENSP00000261769:p.Leu731fs		A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L731fs	ENST00000261769.5	37	c.2191	CCDS10869.1	16																																																																																			CDH1	-	NULL	ENSG00000039068		0.522	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	148	0.00	0	C	NM_004360		68862103	68862103	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_del	82	24.11	27	DEL	0.037	-
CHD4	1108	genome.wustl.edu	37	12	6702280	6702280	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr12:6702280G>A	ENST00000357008.2	-	17	2792	c.2629C>T	c.(2629-2631)Cgg>Tgg	p.R877W	CHD4_ENST00000309577.6_Missense_Mutation_p.R877W|CHD4_ENST00000544040.1_Missense_Mutation_p.R870W|CHD4_ENST00000544484.1_Missense_Mutation_p.R874W	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	877	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						TTCTTCAGCCGATGGGCTTCA	0.468																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													95.0	88.0	90.0					12																	6702280		2203	4300	6503	-	-	-	SO:0001583	missense	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2629C>T	12.37:g.6702280G>A	ENSP00000349508:p.Arg877Trp		Q8IXZ5	Missense_Mutation	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R877W	ENST00000357008.2	37	c.2629	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030807	0.54790	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.95035	-3.59;-3.59;-3.59;-3.59	5.3	3.27	0.37495	DEAD-like helicase (2);DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (1);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98391	0.9465	H	0.97732	4.065	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.996	D	0.99709	1.1006	10	0.87932	D	0	-4.9516	19.0658	0.93110	0.0:0.0:0.7401:0.2598	.	877;877;870	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	W	874;870;877;877;851	ENSP00000440392:R874W;ENSP00000440542:R870W;ENSP00000312419:R877W;ENSP00000349508:R877W	ENSP00000312419:R877W	R	-	1	2	CHD4	6572541	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.298000	0.43602	0.633000	0.30452	-2.051000	0.00406	CGG	CHD4	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000111642		0.468	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		37	0.00	0	G	NM_001273		6702280	6702280	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.999	A
CHD4	1108	genome.wustl.edu	37	12	6702280	6702280	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr12:6702280G>A	ENST00000357008.2	-	17	2792	c.2629C>T	c.(2629-2631)Cgg>Tgg	p.R877W	CHD4_ENST00000309577.6_Missense_Mutation_p.R877W|CHD4_ENST00000544040.1_Missense_Mutation_p.R870W|CHD4_ENST00000544484.1_Missense_Mutation_p.R874W	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	877	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						TTCTTCAGCCGATGGGCTTCA	0.468																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													95.0	88.0	90.0					12																	6702280		2203	4300	6503	-	-	-	SO:0001583	missense	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2629C>T	12.37:g.6702280G>A	ENSP00000349508:p.Arg877Trp		Q8IXZ5	Missense_Mutation	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R877W	ENST00000357008.2	37	c.2629	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030807	0.54790	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.95035	-3.59;-3.59;-3.59;-3.59	5.3	3.27	0.37495	DEAD-like helicase (2);DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (1);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98391	0.9465	H	0.97732	4.065	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.996	D	0.99709	1.1006	10	0.87932	D	0	-4.9516	19.0658	0.93110	0.0:0.0:0.7401:0.2598	.	877;877;870	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	W	874;870;877;877;851	ENSP00000440392:R874W;ENSP00000440542:R870W;ENSP00000312419:R877W;ENSP00000349508:R877W	ENSP00000312419:R877W	R	-	1	2	CHD4	6572541	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.298000	0.43602	0.633000	0.30452	-2.051000	0.00406	CGG	CHD4	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000111642		0.468	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		28	0.00	0	G	NM_001273		6702280	6702280	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.999	A
CYP4A22	284541	genome.wustl.edu	37	1	47611572	47611572	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr1:47611572C>A	ENST00000371891.3	+	10	1288	c.1257C>A	c.(1255-1257)caC>caA	p.H419Q	CYP4A22_ENST00000485117.1_3'UTR|CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000371890.3_Missense_Mutation_p.H321Q|CYP4A22_ENST00000294337.3_Missense_Mutation_p.H419Q	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	419						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ATGGCCTTCACCACAACCCAA	0.517																																					Pancreas(88;1240 1470 2099 14214 37557)	dbGAP											0													349.0	337.0	341.0					1																	47611572		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.1257C>A	1.37:g.47611572C>A	ENSP00000360958:p.His419Gln		Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV	p.H419Q	ENST00000371891.3	37	c.1257	CCDS30707.1	1	.	.	.	.	.	.	.	.	.	.	c	14.62	2.589089	0.46110	.	.	ENSG00000162365	ENST00000371890;ENST00000371891;ENST00000294337	T;T;T	0.72282	-0.63;-0.64;-0.64	1.44	0.485	0.16830	.	0.000000	0.85682	D	0.000000	T	0.77903	0.4200	M	0.76574	2.34	0.40540	D	0.981015	D;D	0.76494	0.999;0.992	D;D	0.79784	0.993;0.969	T	0.74671	-0.3587	10	0.87932	D	0	.	3.9407	0.09326	0.0:0.5754:0.0:0.4246	.	321;419	Q5TCH5;Q5TCH4	.;CP4AM_HUMAN	Q	321;419;419	ENSP00000360957:H321Q;ENSP00000360958:H419Q;ENSP00000294337:H419Q	ENSP00000294337:H419Q	H	+	3	2	CYP4A22	47384159	0.002000	0.14202	0.973000	0.42090	0.398000	0.30690	-0.204000	0.09425	0.169000	0.19679	0.194000	0.17425	CAC	CYP4A22	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-II	ENSG00000162365		0.517	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4A22	HGNC	protein_coding	OTTHUMT00000021635.1	128	0.00	0	C	XM_208213		47611572	47611572	+1	no_errors	ENST00000371891	ensembl	human	known	69_37n	missense	88	16.19	17	SNP	1.000	A
CYP4A22	284541	genome.wustl.edu	37	1	47611572	47611572	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr1:47611572C>A	ENST00000371891.3	+	10	1288	c.1257C>A	c.(1255-1257)caC>caA	p.H419Q	CYP4A22_ENST00000485117.1_3'UTR|CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000371890.3_Missense_Mutation_p.H321Q|CYP4A22_ENST00000294337.3_Missense_Mutation_p.H419Q	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	419						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ATGGCCTTCACCACAACCCAA	0.517																																					Pancreas(88;1240 1470 2099 14214 37557)	dbGAP											0													349.0	337.0	341.0					1																	47611572		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.1257C>A	1.37:g.47611572C>A	ENSP00000360958:p.His419Gln		Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV	p.H419Q	ENST00000371891.3	37	c.1257	CCDS30707.1	1	.	.	.	.	.	.	.	.	.	.	c	14.62	2.589089	0.46110	.	.	ENSG00000162365	ENST00000371890;ENST00000371891;ENST00000294337	T;T;T	0.72282	-0.63;-0.64;-0.64	1.44	0.485	0.16830	.	0.000000	0.85682	D	0.000000	T	0.77903	0.4200	M	0.76574	2.34	0.40540	D	0.981015	D;D	0.76494	0.999;0.992	D;D	0.79784	0.993;0.969	T	0.74671	-0.3587	10	0.87932	D	0	.	3.9407	0.09326	0.0:0.5754:0.0:0.4246	.	321;419	Q5TCH5;Q5TCH4	.;CP4AM_HUMAN	Q	321;419;419	ENSP00000360957:H321Q;ENSP00000360958:H419Q;ENSP00000294337:H419Q	ENSP00000294337:H419Q	H	+	3	2	CYP4A22	47384159	0.002000	0.14202	0.973000	0.42090	0.398000	0.30690	-0.204000	0.09425	0.169000	0.19679	0.194000	0.17425	CAC	CYP4A22	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-II	ENSG00000162365		0.517	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4A22	HGNC	protein_coding	OTTHUMT00000021635.1	143	0.00	0	C	XM_208213		47611572	47611572	+1	no_errors	ENST00000371891	ensembl	human	known	69_37n	missense	88	16.19	17	SNP	1.000	A
DMD	1756	genome.wustl.edu	37	X	32361404	32361404	+	Splice_Site	SNP	C	C	G			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chrX:32361404C>G	ENST00000357033.4	-	40	5793		c.e40-1		DMD_ENST00000378677.2_Splice_Site	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin						cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ACCTCAAATCCTGTTCATGGT	0.363																																						dbGAP											0													80.0	73.0	75.0					X																	32361404		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5587-1G>C	X.37:g.32361404C>G			E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Splice_Site	SNP	-	e40-1	ENST00000357033.4	37	c.5587-1	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	16.16	3.044852	0.55110	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000493412	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8812	0.92356	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DMD	32271325	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.680000	0.74518	2.493000	0.84123	0.594000	0.82650	.	DMD	-	-	ENSG00000198947		0.363	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	74	0.00	0	C	NM_004006	Intron	32361404	32361404	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	splice_site	40	27.27	15	SNP	1.000	G
DMD	1756	genome.wustl.edu	37	X	32361404	32361404	+	Splice_Site	SNP	C	C	G			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chrX:32361404C>G	ENST00000357033.4	-	40	5793		c.e40-1		DMD_ENST00000378677.2_Splice_Site	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin						cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ACCTCAAATCCTGTTCATGGT	0.363																																						dbGAP											0													80.0	73.0	75.0					X																	32361404		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5587-1G>C	X.37:g.32361404C>G			E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Splice_Site	SNP	-	e40-1	ENST00000357033.4	37	c.5587-1	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	16.16	3.044852	0.55110	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000493412	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8812	0.92356	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DMD	32271325	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.680000	0.74518	2.493000	0.84123	0.594000	0.82650	.	DMD	-	-	ENSG00000198947		0.363	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	51	0.00	0	C	NM_004006	Intron	32361404	32361404	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	splice_site	40	27.27	15	SNP	1.000	G
EYS	346007	genome.wustl.edu	37	6	65655792	65655792	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr6:65655792A>G	ENST00000370621.3	-	15	2801	c.2275T>C	c.(2275-2277)Tgc>Cgc	p.C759R	EYS_ENST00000370616.2_Missense_Mutation_p.C759R|EYS_ENST00000503581.1_Missense_Mutation_p.C759R			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	759	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TCAGATAGGCACACACACTGG	0.333																																						dbGAP											0													168.0	138.0	147.0					6																	65655792		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2275T>C	6.37:g.65655792A>G	ENSP00000359655:p.Cys759Arg		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.C759R	ENST00000370621.3	37	c.2275		6	.	.	.	.	.	.	.	.	.	.	A	9.105	1.005009	0.19199	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.96651	-3.97;-4.08;-4.08	4.61	2.23	0.28157	.	.	.	.	.	D	0.94278	0.8162	M	0.93150	3.385	0.58432	D	0.999999	B	0.20261	0.043	B	0.21546	0.035	D	0.90817	0.4706	9	0.87932	D	0	.	6.4107	0.21690	0.7901:0.0:0.2099:0.0	.	759	Q5T1H1-1	.	R	759	ENSP00000424243:C759R;ENSP00000359655:C759R;ENSP00000359650:C759R	ENSP00000359650:C759R	C	-	1	0	EYS	65712513	0.382000	0.25148	0.026000	0.17262	0.133000	0.20885	1.501000	0.35693	0.186000	0.20125	0.459000	0.35465	TGC	EYS	-	smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000188107		0.333	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	45	0.00	0	A	XM_294050		65655792	65655792	-1	no_errors	ENST00000370616	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	0.874	G
EYS	346007	genome.wustl.edu	37	6	65655792	65655792	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr6:65655792A>G	ENST00000370621.3	-	15	2801	c.2275T>C	c.(2275-2277)Tgc>Cgc	p.C759R	EYS_ENST00000370616.2_Missense_Mutation_p.C759R|EYS_ENST00000503581.1_Missense_Mutation_p.C759R			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	759	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TCAGATAGGCACACACACTGG	0.333																																						dbGAP											0													168.0	138.0	147.0					6																	65655792		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2275T>C	6.37:g.65655792A>G	ENSP00000359655:p.Cys759Arg		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.C759R	ENST00000370621.3	37	c.2275		6	.	.	.	.	.	.	.	.	.	.	A	9.105	1.005009	0.19199	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.96651	-3.97;-4.08;-4.08	4.61	2.23	0.28157	.	.	.	.	.	D	0.94278	0.8162	M	0.93150	3.385	0.58432	D	0.999999	B	0.20261	0.043	B	0.21546	0.035	D	0.90817	0.4706	9	0.87932	D	0	.	6.4107	0.21690	0.7901:0.0:0.2099:0.0	.	759	Q5T1H1-1	.	R	759	ENSP00000424243:C759R;ENSP00000359655:C759R;ENSP00000359650:C759R	ENSP00000359650:C759R	C	-	1	0	EYS	65712513	0.382000	0.25148	0.026000	0.17262	0.133000	0.20885	1.501000	0.35693	0.186000	0.20125	0.459000	0.35465	TGC	EYS	-	smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000188107		0.333	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	52	0.00	0	A	XM_294050		65655792	65655792	-1	no_errors	ENST00000370616	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	0.874	G
FIBIN	387758	genome.wustl.edu	37	11	27016341	27016341	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr11:27016341C>A	ENST00000318627.2	+	1	714	c.268C>A	c.(268-270)Cag>Aag	p.Q90K		NM_203371.1	NP_976249.1	Q8TAL6	FIBIN_HUMAN	fin bud initiation factor homolog (zebrafish)	90						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)				breast(1)|endometrium(2)|lung(7)|upper_aerodigestive_tract(1)	11						GCTGGGCCGCCAGGTGGAGGA	0.662																																						dbGAP											0													33.0	29.0	30.0					11																	27016341		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC026873	CCDS7861.1	11p14.2	2008-12-03				ENSG00000176971			33747	protein-coding gene	gene with protein product						17196583	Standard	NM_203371		Approved	MGC24932	uc001mrd.3	Q8TAL6		ENST00000318627.2:c.268C>A	11.37:g.27016341C>A	ENSP00000321962:p.Gln90Lys			Missense_Mutation	SNP	NULL	p.Q90K	ENST00000318627.2	37	c.268	CCDS7861.1	11	.	.	.	.	.	.	.	.	.	.	C	29.2	4.989482	0.93106	.	.	ENSG00000176971	ENST00000318627	.	.	.	5.7	5.7	0.88788	.	0.120261	0.64402	D	0.000018	T	0.54695	0.1874	L	0.32530	0.975	0.80722	D	1	P	0.46784	0.884	P	0.44673	0.457	T	0.58847	-0.7564	9	0.66056	D	0.02	-9.7409	18.3976	0.90504	0.0:1.0:0.0:0.0	.	90	Q8TAL6	FIBIN_HUMAN	K	90	.	ENSP00000321962:Q90K	Q	+	1	0	FIBIN	26972917	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.325000	0.79124	2.706000	0.92434	0.557000	0.71058	CAG	FIBIN	-	NULL	ENSG00000176971		0.662	FIBIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIBIN	HGNC	protein_coding	OTTHUMT00000387945.1	49	0.00	0	C	NM_203371		27016341	27016341	+1	no_errors	ENST00000318627	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	1.000	A
FIBIN	387758	genome.wustl.edu	37	11	27016341	27016341	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr11:27016341C>A	ENST00000318627.2	+	1	714	c.268C>A	c.(268-270)Cag>Aag	p.Q90K		NM_203371.1	NP_976249.1	Q8TAL6	FIBIN_HUMAN	fin bud initiation factor homolog (zebrafish)	90						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)				breast(1)|endometrium(2)|lung(7)|upper_aerodigestive_tract(1)	11						GCTGGGCCGCCAGGTGGAGGA	0.662																																						dbGAP											0													33.0	29.0	30.0					11																	27016341		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC026873	CCDS7861.1	11p14.2	2008-12-03				ENSG00000176971			33747	protein-coding gene	gene with protein product						17196583	Standard	NM_203371		Approved	MGC24932	uc001mrd.3	Q8TAL6		ENST00000318627.2:c.268C>A	11.37:g.27016341C>A	ENSP00000321962:p.Gln90Lys			Missense_Mutation	SNP	NULL	p.Q90K	ENST00000318627.2	37	c.268	CCDS7861.1	11	.	.	.	.	.	.	.	.	.	.	C	29.2	4.989482	0.93106	.	.	ENSG00000176971	ENST00000318627	.	.	.	5.7	5.7	0.88788	.	0.120261	0.64402	D	0.000018	T	0.54695	0.1874	L	0.32530	0.975	0.80722	D	1	P	0.46784	0.884	P	0.44673	0.457	T	0.58847	-0.7564	9	0.66056	D	0.02	-9.7409	18.3976	0.90504	0.0:1.0:0.0:0.0	.	90	Q8TAL6	FIBIN_HUMAN	K	90	.	ENSP00000321962:Q90K	Q	+	1	0	FIBIN	26972917	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.325000	0.79124	2.706000	0.92434	0.557000	0.71058	CAG	FIBIN	-	NULL	ENSG00000176971		0.662	FIBIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIBIN	HGNC	protein_coding	OTTHUMT00000387945.1	49	0.00	0	C	NM_203371		27016341	27016341	+1	no_errors	ENST00000318627	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	1.000	A
HOXA11	3207	genome.wustl.edu	37	7	27224434	27224434	+	Missense_Mutation	SNP	G	G	T	rs377286501		TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr7:27224434G>T	ENST00000006015.3	-	1	401	c.330C>A	c.(328-330)agC>agA	p.S110R	RP1-170O19.14_ENST00000523331.1_lincRNA|HOXA11-AS_ENST00000522863.1_RNA|HOXA11-AS_ENST00000522674.1_RNA|HOXA11-AS_ENST00000520395.1_RNA|HOXA11-AS_ENST00000520360.1_RNA	NM_005523.5	NP_005514.1	P31270	HXA11_HUMAN	homeobox A11	110					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal joint morphogenesis (GO:0060272)|male gonad development (GO:0008584)|mesodermal cell fate specification (GO:0007501)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)	nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	16						CGTTGGCCGAGCTCTTGGCCA	0.657			T	NUP98	CML																																	dbGAP		Dom	yes		7	7p15-p14.2	3207	homeo box A11		L	0													40.0	46.0	44.0					7																	27224434		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5411.1	7p15.2	2014-09-17	2005-12-22		ENSG00000005073	ENSG00000005073		"""Homeoboxes / ANTP class : HOXL subclass"""	5101	protein-coding gene	gene with protein product		142958	"""homeo box A11"""	HOX1I, HOX1		1973146, 1358459	Standard	NM_005523		Approved		uc003syx.3	P31270	OTTHUMG00000023437	ENST00000006015.3:c.330C>A	7.37:g.27224434G>T	ENSP00000006015:p.Ser110Arg		A4D190	Missense_Mutation	SNP	pfam_DUF3528,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_Homeobox_metazoa,pfscan_Homeodomain	p.S110R	ENST00000006015.3	37	c.330	CCDS5411.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.03|13.03	2.116486|2.116486	0.37339|0.37339	.|.	.|.	ENSG00000005073|ENSG00000005073	ENST00000517402|ENST00000006015	.|T	.|0.46063	.|0.88	5.35|5.35	4.48|4.48	0.54585|0.54585	.|Domain of unknown function DUF3528, homeobox protein, eukaryotic (1);	.|0.100713	.|0.64402	.|D	.|0.000001	T|T	0.41903|0.41903	0.1179|0.1179	L|L	0.61218|0.61218	1.895|1.895	0.46586|0.46586	D|D	0.999111|0.999111	.|B	.|0.31413	.|0.322	.|B	.|0.29176	.|0.099	T|T	0.40905|0.40905	-0.9538|-0.9538	5|10	.|0.59425	.|D	.|0.04	.|.	14.2274|14.2274	0.65868|0.65868	0.0721:0.0:0.9279:0.0|0.0721:0.0:0.9279:0.0	.|.	.|110	.|P31270	.|HXA11_HUMAN	D|R	80|110	.|ENSP00000006015:S110R	.|ENSP00000006015:S110R	A|S	-|-	2|3	0|2	HOXA11|HOXA11	27190959|27190959	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	6.303000|6.303000	0.72794|0.72794	1.242000|1.242000	0.43836|0.43836	-0.143000|-0.143000	0.13931|0.13931	GCT|AGC	HOXA11	-	pfam_DUF3528	ENSG00000005073		0.657	HOXA11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HOXA11	HGNC	protein_coding	OTTHUMT00000358754.1	63	0.00	0	G			27224434	27224434	-1	no_errors	ENST00000006015	ensembl	human	known	69_37n	missense	45	21.05	12	SNP	1.000	T
HOXA11	3207	genome.wustl.edu	37	7	27224434	27224434	+	Missense_Mutation	SNP	G	G	T	rs377286501		TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr7:27224434G>T	ENST00000006015.3	-	1	401	c.330C>A	c.(328-330)agC>agA	p.S110R	RP1-170O19.14_ENST00000523331.1_lincRNA|HOXA11-AS_ENST00000522863.1_RNA|HOXA11-AS_ENST00000522674.1_RNA|HOXA11-AS_ENST00000520395.1_RNA|HOXA11-AS_ENST00000520360.1_RNA	NM_005523.5	NP_005514.1	P31270	HXA11_HUMAN	homeobox A11	110					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal joint morphogenesis (GO:0060272)|male gonad development (GO:0008584)|mesodermal cell fate specification (GO:0007501)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)	nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	16						CGTTGGCCGAGCTCTTGGCCA	0.657			T	NUP98	CML																																	dbGAP		Dom	yes		7	7p15-p14.2	3207	homeo box A11		L	0													40.0	46.0	44.0					7																	27224434		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5411.1	7p15.2	2014-09-17	2005-12-22		ENSG00000005073	ENSG00000005073		"""Homeoboxes / ANTP class : HOXL subclass"""	5101	protein-coding gene	gene with protein product		142958	"""homeo box A11"""	HOX1I, HOX1		1973146, 1358459	Standard	NM_005523		Approved		uc003syx.3	P31270	OTTHUMG00000023437	ENST00000006015.3:c.330C>A	7.37:g.27224434G>T	ENSP00000006015:p.Ser110Arg		A4D190	Missense_Mutation	SNP	pfam_DUF3528,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_Homeobox_metazoa,pfscan_Homeodomain	p.S110R	ENST00000006015.3	37	c.330	CCDS5411.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.03|13.03	2.116486|2.116486	0.37339|0.37339	.|.	.|.	ENSG00000005073|ENSG00000005073	ENST00000517402|ENST00000006015	.|T	.|0.46063	.|0.88	5.35|5.35	4.48|4.48	0.54585|0.54585	.|Domain of unknown function DUF3528, homeobox protein, eukaryotic (1);	.|0.100713	.|0.64402	.|D	.|0.000001	T|T	0.41903|0.41903	0.1179|0.1179	L|L	0.61218|0.61218	1.895|1.895	0.46586|0.46586	D|D	0.999111|0.999111	.|B	.|0.31413	.|0.322	.|B	.|0.29176	.|0.099	T|T	0.40905|0.40905	-0.9538|-0.9538	5|10	.|0.59425	.|D	.|0.04	.|.	14.2274|14.2274	0.65868|0.65868	0.0721:0.0:0.9279:0.0|0.0721:0.0:0.9279:0.0	.|.	.|110	.|P31270	.|HXA11_HUMAN	D|R	80|110	.|ENSP00000006015:S110R	.|ENSP00000006015:S110R	A|S	-|-	2|3	0|2	HOXA11|HOXA11	27190959|27190959	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	6.303000|6.303000	0.72794|0.72794	1.242000|1.242000	0.43836|0.43836	-0.143000|-0.143000	0.13931|0.13931	GCT|AGC	HOXA11	-	pfam_DUF3528	ENSG00000005073		0.657	HOXA11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HOXA11	HGNC	protein_coding	OTTHUMT00000358754.1	74	0.00	0	G			27224434	27224434	-1	no_errors	ENST00000006015	ensembl	human	known	69_37n	missense	45	21.05	12	SNP	1.000	T
HYDIN	54768	genome.wustl.edu	37	16	70993639	70993639	+	Missense_Mutation	SNP	C	C	T	rs200979879	byFrequency	TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr16:70993639C>T	ENST00000393567.2	-	39	6203	c.6053G>A	c.(6052-6054)cGc>cAc	p.R2018H		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2018					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GCCCAGGTGGCGAGCGATTGC	0.507																																						dbGAP											0													10.0	20.0	17.0					16																	70993639		1769	4045	5814	-	-	-	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6053G>A	16.37:g.70993639C>T	ENSP00000377197:p.Arg2018His		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.R2017H	ENST00000393567.2	37	c.6050	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	27.6	4.842834	0.91197	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.45668	0.89	4.6	4.6	0.57074	.	0.000000	0.33834	U	0.004514	T	0.61400	0.2344	L	0.58810	1.83	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65948	-0.6044	10	0.87932	D	0	.	16.1826	0.81920	0.0:1.0:0.0:0.0	.	2017	F8WD23	.	H	2018;2017	ENSP00000377197:R2018H	ENSP00000310485:R309H	R	-	2	0	HYDIN	69551140	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	4.285000	0.58989	2.124000	0.65301	0.505000	0.49811	CGC	HYDIN	-	NULL	ENSG00000157423		0.507	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	18	0.00	0	C			70993639	70993639	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	1.000	T
IQCG	84223	genome.wustl.edu	37	3	197670789	197670789	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr3:197670789C>T	ENST00000265239.6	-	4	566	c.142G>A	c.(142-144)Gaa>Aaa	p.E48K	IQCG_ENST00000455191.1_Missense_Mutation_p.E48K|IQCG_ENST00000480302.1_5'UTR|IQCG_ENST00000453254.1_Missense_Mutation_p.E48K	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G	48						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		TCCGGGATTTCTGGGATGATT	0.478																																						dbGAP											0													152.0	144.0	146.0					3																	197670789		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.142G>A	3.37:g.197670789C>T	ENSP00000265239:p.Glu48Lys		Q9BST2|Q9HAG8	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.E48K	ENST00000265239.6	37	c.142	CCDS3331.1	3	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240025	0.79912	.	.	ENSG00000114473	ENST00000265239;ENST00000455191;ENST00000453254;ENST00000416896;ENST00000452735	T;T;T;T	0.48201	0.85;0.85;0.82;0.86	5.4	5.4	0.78164	.	0.000000	0.50627	D	0.000115	T	0.62950	0.2470	M	0.73598	2.24	0.18873	N	0.999985	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.994	T	0.56390	-0.7987	10	0.10377	T	0.69	-10.4491	11.3127	0.49372	0.0:0.9164:0.0:0.0836	.	48;48	C9JKX8;Q9H095	.;IQCG_HUMAN	K	48;48;48;29;48	ENSP00000265239:E48K;ENSP00000407736:E48K;ENSP00000389897:E48K;ENSP00000406411:E29K	ENSP00000265239:E48K	E	-	1	0	IQCG	199155186	0.465000	0.25815	0.040000	0.18447	0.484000	0.33280	2.005000	0.40864	2.559000	0.86315	0.551000	0.68910	GAA	IQCG	-	NULL	ENSG00000114473		0.478	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCG	HGNC	protein_coding	OTTHUMT00000339730.1	142	0.00	0	C	NM_032263		197670789	197670789	-1	no_errors	ENST00000265239	ensembl	human	known	69_37n	missense	85	10.53	10	SNP	0.171	T
IQCG	84223	genome.wustl.edu	37	3	197670789	197670789	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr3:197670789C>T	ENST00000265239.6	-	4	566	c.142G>A	c.(142-144)Gaa>Aaa	p.E48K	IQCG_ENST00000455191.1_Missense_Mutation_p.E48K|IQCG_ENST00000480302.1_5'UTR|IQCG_ENST00000453254.1_Missense_Mutation_p.E48K	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G	48						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		TCCGGGATTTCTGGGATGATT	0.478																																						dbGAP											0													152.0	144.0	146.0					3																	197670789		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.142G>A	3.37:g.197670789C>T	ENSP00000265239:p.Glu48Lys		Q9BST2|Q9HAG8	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.E48K	ENST00000265239.6	37	c.142	CCDS3331.1	3	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240025	0.79912	.	.	ENSG00000114473	ENST00000265239;ENST00000455191;ENST00000453254;ENST00000416896;ENST00000452735	T;T;T;T	0.48201	0.85;0.85;0.82;0.86	5.4	5.4	0.78164	.	0.000000	0.50627	D	0.000115	T	0.62950	0.2470	M	0.73598	2.24	0.18873	N	0.999985	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.994	T	0.56390	-0.7987	10	0.10377	T	0.69	-10.4491	11.3127	0.49372	0.0:0.9164:0.0:0.0836	.	48;48	C9JKX8;Q9H095	.;IQCG_HUMAN	K	48;48;48;29;48	ENSP00000265239:E48K;ENSP00000407736:E48K;ENSP00000389897:E48K;ENSP00000406411:E29K	ENSP00000265239:E48K	E	-	1	0	IQCG	199155186	0.465000	0.25815	0.040000	0.18447	0.484000	0.33280	2.005000	0.40864	2.559000	0.86315	0.551000	0.68910	GAA	IQCG	-	NULL	ENSG00000114473		0.478	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCG	HGNC	protein_coding	OTTHUMT00000339730.1	125	0.00	0	C	NM_032263		197670789	197670789	-1	no_errors	ENST00000265239	ensembl	human	known	69_37n	missense	85	10.53	10	SNP	0.171	T
MAP3K12	7786	genome.wustl.edu	37	12	53877488	53877488	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr12:53877488C>T	ENST00000267079.2	-	10	1504	c.1279G>A	c.(1279-1281)Gag>Aag	p.E427K	MAP3K12_ENST00000547035.1_Missense_Mutation_p.E460K|MAP3K12_ENST00000547488.1_Missense_Mutation_p.E460K|MAP3K12_ENST00000547151.1_5'Flank	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	427					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						TCATAGTGCTCCCTGATGTCC	0.522																																						dbGAP											0													131.0	112.0	118.0					12																	53877488		2203	4300	6503	-	-	-	SO:0001583	missense	0			U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.1279G>A	12.37:g.53877488C>T	ENSP00000267079:p.Glu427Lys		B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	pirsf_MAP3K12_MAP3K13,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E427K	ENST00000267079.2	37	c.1279	CCDS8860.1	12	.	.	.	.	.	.	.	.	.	.	C	22.4	4.286436	0.80803	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	T;T;T	0.77358	-1.07;-1.09;-1.09	5.12	5.12	0.69794	.	0.000000	0.46145	D	0.000317	T	0.78104	0.4231	L	0.59436	1.845	0.80722	D	1	B;B	0.28998	0.178;0.23	B;B	0.36845	0.234;0.118	T	0.73610	-0.3928	10	0.30078	T	0.28	.	17.8627	0.88786	0.0:1.0:0.0:0.0	.	460;427	G3V1Y2;Q12852	.;M3K12_HUMAN	K	427;460;460	ENSP00000267079:E427K;ENSP00000449038:E460K;ENSP00000448689:E460K	ENSP00000267079:E427K	E	-	1	0	MAP3K12	52163755	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.627000	0.83176	2.837000	0.97791	0.655000	0.94253	GAG	MAP3K12	-	pirsf_MAP3K12_MAP3K13	ENSG00000139625		0.522	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP3K12	HGNC	protein_coding	OTTHUMT00000406267.1	21	0.00	0	C	NM_006301		53877488	53877488	-1	no_errors	ENST00000267079	ensembl	human	known	69_37n	missense	12	20.00	3	SNP	1.000	T
MAP3K12	7786	genome.wustl.edu	37	12	53877488	53877488	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr12:53877488C>T	ENST00000267079.2	-	10	1504	c.1279G>A	c.(1279-1281)Gag>Aag	p.E427K	MAP3K12_ENST00000547035.1_Missense_Mutation_p.E460K|MAP3K12_ENST00000547488.1_Missense_Mutation_p.E460K|MAP3K12_ENST00000547151.1_5'Flank	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	427					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						TCATAGTGCTCCCTGATGTCC	0.522																																						dbGAP											0													131.0	112.0	118.0					12																	53877488		2203	4300	6503	-	-	-	SO:0001583	missense	0			U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.1279G>A	12.37:g.53877488C>T	ENSP00000267079:p.Glu427Lys		B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	pirsf_MAP3K12_MAP3K13,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E427K	ENST00000267079.2	37	c.1279	CCDS8860.1	12	.	.	.	.	.	.	.	.	.	.	C	22.4	4.286436	0.80803	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	T;T;T	0.77358	-1.07;-1.09;-1.09	5.12	5.12	0.69794	.	0.000000	0.46145	D	0.000317	T	0.78104	0.4231	L	0.59436	1.845	0.80722	D	1	B;B	0.28998	0.178;0.23	B;B	0.36845	0.234;0.118	T	0.73610	-0.3928	10	0.30078	T	0.28	.	17.8627	0.88786	0.0:1.0:0.0:0.0	.	460;427	G3V1Y2;Q12852	.;M3K12_HUMAN	K	427;460;460	ENSP00000267079:E427K;ENSP00000449038:E460K;ENSP00000448689:E460K	ENSP00000267079:E427K	E	-	1	0	MAP3K12	52163755	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.627000	0.83176	2.837000	0.97791	0.655000	0.94253	GAG	MAP3K12	-	pirsf_MAP3K12_MAP3K13	ENSG00000139625		0.522	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP3K12	HGNC	protein_coding	OTTHUMT00000406267.1	19	0.00	0	C	NM_006301		53877488	53877488	-1	no_errors	ENST00000267079	ensembl	human	known	69_37n	missense	12	20.00	3	SNP	1.000	T
MCAM	4162	genome.wustl.edu	37	11	119181178	119181178	+	Splice_Site	SNP	T	T	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr11:119181178T>A	ENST00000264036.4	-	15	1808		c.e15-2		MCAM_ENST00000392814.1_Splice_Site	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule						anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		GGTAGCGTGCTGGGAGGAGGG	0.577																																						dbGAP											0													94.0	99.0	97.0					11																	119181178		2199	4295	6494	-	-	-	SO:0001630	splice_region_variant	0			X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.1794-2A>T	11.37:g.119181178T>A			O95812|Q59E86|Q6PHR3|Q6ZTR2	Splice_Site	SNP	-	e15-2	ENST00000264036.4	37	c.1794-2	CCDS31690.1	11	.	.	.	.	.	.	.	.	.	.	T	18.99	3.740187	0.69304	.	.	ENSG00000076706	ENST00000264036	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2073	0.59805	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MCAM	118686388	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.931000	0.63469	1.937000	0.56155	0.379000	0.24179	.	MCAM	-	-	ENSG00000076706		0.577	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCAM	HGNC	protein_coding	OTTHUMT00000388332.2	40	0.00	0	T		Intron	119181178	119181178	-1	no_errors	ENST00000264036	ensembl	human	known	69_37n	splice_site	27	15.62	5	SNP	1.000	A
MCAM	4162	genome.wustl.edu	37	11	119181178	119181178	+	Splice_Site	SNP	T	T	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr11:119181178T>A	ENST00000264036.4	-	15	1808		c.e15-2		MCAM_ENST00000392814.1_Splice_Site	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule						anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		GGTAGCGTGCTGGGAGGAGGG	0.577																																						dbGAP											0													94.0	99.0	97.0					11																	119181178		2199	4295	6494	-	-	-	SO:0001630	splice_region_variant	0			X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.1794-2A>T	11.37:g.119181178T>A			O95812|Q59E86|Q6PHR3|Q6ZTR2	Splice_Site	SNP	-	e15-2	ENST00000264036.4	37	c.1794-2	CCDS31690.1	11	.	.	.	.	.	.	.	.	.	.	T	18.99	3.740187	0.69304	.	.	ENSG00000076706	ENST00000264036	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2073	0.59805	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MCAM	118686388	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.931000	0.63469	1.937000	0.56155	0.379000	0.24179	.	MCAM	-	-	ENSG00000076706		0.577	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCAM	HGNC	protein_coding	OTTHUMT00000388332.2	31	0.00	0	T		Intron	119181178	119181178	-1	no_errors	ENST00000264036	ensembl	human	known	69_37n	splice_site	27	15.62	5	SNP	1.000	A
MCM3AP	8888	genome.wustl.edu	37	21	47664837	47664837	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr21:47664837G>T	ENST00000397708.1	-	24	5176	c.4922C>A	c.(4921-4923)gCa>gAa	p.A1641E	MCM3AP-AS1_ENST00000455567.1_RNA|MCM3AP_ENST00000467026.1_5'UTR|MCM3AP-AS1_ENST00000421927.1_RNA|MCM3AP-AS1_ENST00000591223.1_RNA|AP001469.7_ENST00000444966.1_RNA|MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP_ENST00000291688.1_Missense_Mutation_p.A1641E|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP-AS1_ENST00000414659.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1641					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					GCTGCCCCCTGCCTCAGCAAA	0.592																																						dbGAP											0													74.0	64.0	67.0					21																	47664837		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.4922C>A	21.37:g.47664837G>T	ENSP00000380820:p.Ala1641Glu		C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.A1641E	ENST00000397708.1	37	c.4922	CCDS13734.1	21	.	.	.	.	.	.	.	.	.	.	G	13.25	2.181569	0.38511	.	.	ENSG00000160294	ENST00000397708;ENST00000291688;ENST00000539647	T;T	0.03717	3.83;3.83	5.55	1.58	0.23477	.	0.469026	0.26979	N	0.021530	T	0.03178	0.0093	N	0.22421	0.69	0.09310	N	1	B;B	0.30973	0.201;0.302	B;B	0.33620	0.081;0.167	T	0.40308	-0.9570	10	0.54805	T	0.06	-0.2241	8.9355	0.35697	0.3221:0.0:0.6779:0.0	.	1641;136	O60318;B3KT88	MCM3A_HUMAN;.	E	1641;1641;136	ENSP00000380820:A1641E;ENSP00000291688:A1641E	ENSP00000291688:A1641E	A	-	2	0	MCM3AP	46489265	0.584000	0.26766	0.001000	0.08648	0.989000	0.77384	1.932000	0.40143	-0.004000	0.14419	0.655000	0.94253	GCA	MCM3AP	-	NULL	ENSG00000160294		0.592	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM3AP	HGNC	protein_coding	OTTHUMT00000207254.1	47	0.00	0	G	NM_003906		47664837	47664837	-1	no_errors	ENST00000291688	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.001	T
MCM3AP	8888	genome.wustl.edu	37	21	47664837	47664837	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr21:47664837G>T	ENST00000397708.1	-	24	5176	c.4922C>A	c.(4921-4923)gCa>gAa	p.A1641E	MCM3AP-AS1_ENST00000455567.1_RNA|MCM3AP_ENST00000467026.1_5'UTR|MCM3AP-AS1_ENST00000421927.1_RNA|MCM3AP-AS1_ENST00000591223.1_RNA|AP001469.7_ENST00000444966.1_RNA|MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP_ENST00000291688.1_Missense_Mutation_p.A1641E|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP-AS1_ENST00000414659.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1641					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					GCTGCCCCCTGCCTCAGCAAA	0.592																																						dbGAP											0													74.0	64.0	67.0					21																	47664837		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.4922C>A	21.37:g.47664837G>T	ENSP00000380820:p.Ala1641Glu		C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.A1641E	ENST00000397708.1	37	c.4922	CCDS13734.1	21	.	.	.	.	.	.	.	.	.	.	G	13.25	2.181569	0.38511	.	.	ENSG00000160294	ENST00000397708;ENST00000291688;ENST00000539647	T;T	0.03717	3.83;3.83	5.55	1.58	0.23477	.	0.469026	0.26979	N	0.021530	T	0.03178	0.0093	N	0.22421	0.69	0.09310	N	1	B;B	0.30973	0.201;0.302	B;B	0.33620	0.081;0.167	T	0.40308	-0.9570	10	0.54805	T	0.06	-0.2241	8.9355	0.35697	0.3221:0.0:0.6779:0.0	.	1641;136	O60318;B3KT88	MCM3A_HUMAN;.	E	1641;1641;136	ENSP00000380820:A1641E;ENSP00000291688:A1641E	ENSP00000291688:A1641E	A	-	2	0	MCM3AP	46489265	0.584000	0.26766	0.001000	0.08648	0.989000	0.77384	1.932000	0.40143	-0.004000	0.14419	0.655000	0.94253	GCA	MCM3AP	-	NULL	ENSG00000160294		0.592	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM3AP	HGNC	protein_coding	OTTHUMT00000207254.1	40	0.00	0	G	NM_003906		47664837	47664837	-1	no_errors	ENST00000291688	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.001	T
MGA	23269	genome.wustl.edu	37	15	42058213	42058213	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr15:42058213T>G	ENST00000570161.1	+	23	7933	c.7933T>G	c.(7933-7935)Tta>Gta	p.L2645V	MGA_ENST00000566586.1_Missense_Mutation_p.L2436V|MGA_ENST00000219905.7_Missense_Mutation_p.L2645V|MGA_ENST00000545763.1_Missense_Mutation_p.L2436V|MGA_ENST00000389936.4_Missense_Mutation_p.L2606V			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AAATGACGACTTATTTATGAT	0.343																																						dbGAP											0													74.0	69.0	70.0					15																	42058213		1827	4085	5912	-	-	-	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.7933T>G	15.37:g.42058213T>G	ENSP00000457035:p.Leu2645Val		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_HLH_DNA-bd,superfamily_p53-like_TF_DNA-bd,superfamily_HLH_DNA-bd,smart_TF_T-box,smart_HLH_DNA-bd,prints_TF_T-box,pfscan_HLH_DNA-bd,pfscan_TF_T-box	p.L2645V	ENST00000570161.1	37	c.7933	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	T	19.10	3.762127	0.69763	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.85411	-1.95;-1.98;-1.98	5.08	5.08	0.68730	.	0.745223	0.11530	N	0.554826	D	0.86585	0.5968	N	0.24115	0.695	0.26090	N	0.980976	D;D	0.63880	0.993;0.988	P;P	0.60789	0.879;0.76	T	0.79981	-0.1574	10	0.72032	D	0.01	.	15.3161	0.74078	0.0:0.0:0.0:1.0	.	2436;2645	F5H7K2;E7ENI0	.;.	V	2645;2606;2436	ENSP00000219905:L2645V;ENSP00000374586:L2606V;ENSP00000442467:L2436V	ENSP00000219905:L2645V	L	+	1	2	MGA	39845505	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.712000	0.54875	2.254000	0.74563	0.533000	0.62120	TTA	MGA	-	NULL	ENSG00000174197		0.343	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	37	0.00	0	T	NM_001164273.1		42058213	42058213	+1	no_errors	ENST00000219905	ensembl	human	known	69_37n	missense	17	34.62	9	SNP	1.000	G
MGA	23269	genome.wustl.edu	37	15	42058213	42058213	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr15:42058213T>G	ENST00000570161.1	+	23	7933	c.7933T>G	c.(7933-7935)Tta>Gta	p.L2645V	MGA_ENST00000566586.1_Missense_Mutation_p.L2436V|MGA_ENST00000219905.7_Missense_Mutation_p.L2645V|MGA_ENST00000545763.1_Missense_Mutation_p.L2436V|MGA_ENST00000389936.4_Missense_Mutation_p.L2606V			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AAATGACGACTTATTTATGAT	0.343																																						dbGAP											0													74.0	69.0	70.0					15																	42058213		1827	4085	5912	-	-	-	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.7933T>G	15.37:g.42058213T>G	ENSP00000457035:p.Leu2645Val		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_HLH_DNA-bd,superfamily_p53-like_TF_DNA-bd,superfamily_HLH_DNA-bd,smart_TF_T-box,smart_HLH_DNA-bd,prints_TF_T-box,pfscan_HLH_DNA-bd,pfscan_TF_T-box	p.L2645V	ENST00000570161.1	37	c.7933	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	T	19.10	3.762127	0.69763	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.85411	-1.95;-1.98;-1.98	5.08	5.08	0.68730	.	0.745223	0.11530	N	0.554826	D	0.86585	0.5968	N	0.24115	0.695	0.26090	N	0.980976	D;D	0.63880	0.993;0.988	P;P	0.60789	0.879;0.76	T	0.79981	-0.1574	10	0.72032	D	0.01	.	15.3161	0.74078	0.0:0.0:0.0:1.0	.	2436;2645	F5H7K2;E7ENI0	.;.	V	2645;2606;2436	ENSP00000219905:L2645V;ENSP00000374586:L2606V;ENSP00000442467:L2436V	ENSP00000219905:L2645V	L	+	1	2	MGA	39845505	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.712000	0.54875	2.254000	0.74563	0.533000	0.62120	TTA	MGA	-	NULL	ENSG00000174197		0.343	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	35	0.00	0	T	NM_001164273.1		42058213	42058213	+1	no_errors	ENST00000219905	ensembl	human	known	69_37n	missense	17	34.62	9	SNP	1.000	G
MMP16	4325	genome.wustl.edu	37	8	89053874	89053874	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr8:89053874C>T	ENST00000286614.6	-	10	1920	c.1639G>A	c.(1639-1641)Gat>Aat	p.D547N		NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	547					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	TCTACATCATCTGGTGGGCTG	0.453																																						dbGAP											0													330.0	252.0	278.0					8																	89053874		2203	4300	6503	-	-	-	SO:0001583	missense	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1639G>A	8.37:g.89053874C>T	ENSP00000286614:p.Asp547Asn		B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,prints_Pept_M10A_matrixin	p.D547N	ENST00000286614.6	37	c.1639	CCDS6246.1	8	.	.	.	.	.	.	.	.	.	.	C	15.88	2.962947	0.53507	.	.	ENSG00000156103	ENST00000286614	T	0.42131	0.98	5.72	3.91	0.45181	Peptidase M10A, matrix metallopeptidase, C-terminal (1);	0.103806	0.64402	N	0.000004	T	0.34716	0.0907	L	0.40543	1.245	0.51233	D	0.999915	B	0.23540	0.087	B	0.27608	0.081	T	0.10268	-1.0637	10	0.44086	T	0.13	.	10.7012	0.45928	0.1329:0.7991:0.0:0.0681	.	547	P51512	MMP16_HUMAN	N	547	ENSP00000286614:D547N	ENSP00000286614:D547N	D	-	1	0	MMP16	89122990	1.000000	0.71417	0.992000	0.48379	0.985000	0.73830	4.830000	0.62745	0.746000	0.32786	0.655000	0.94253	GAT	MMP16	-	pfam_Pept_M10A_metallopeptidase_C	ENSG00000156103		0.453	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2	94	0.00	0	C	NM_005941		89053874	89053874	-1	no_errors	ENST00000286614	ensembl	human	known	69_37n	missense	58	10.77	7	SNP	1.000	T
MMP16	4325	genome.wustl.edu	37	8	89053874	89053874	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr8:89053874C>T	ENST00000286614.6	-	10	1920	c.1639G>A	c.(1639-1641)Gat>Aat	p.D547N		NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	547					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	TCTACATCATCTGGTGGGCTG	0.453																																						dbGAP											0													330.0	252.0	278.0					8																	89053874		2203	4300	6503	-	-	-	SO:0001583	missense	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1639G>A	8.37:g.89053874C>T	ENSP00000286614:p.Asp547Asn		B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,prints_Pept_M10A_matrixin	p.D547N	ENST00000286614.6	37	c.1639	CCDS6246.1	8	.	.	.	.	.	.	.	.	.	.	C	15.88	2.962947	0.53507	.	.	ENSG00000156103	ENST00000286614	T	0.42131	0.98	5.72	3.91	0.45181	Peptidase M10A, matrix metallopeptidase, C-terminal (1);	0.103806	0.64402	N	0.000004	T	0.34716	0.0907	L	0.40543	1.245	0.51233	D	0.999915	B	0.23540	0.087	B	0.27608	0.081	T	0.10268	-1.0637	10	0.44086	T	0.13	.	10.7012	0.45928	0.1329:0.7991:0.0:0.0681	.	547	P51512	MMP16_HUMAN	N	547	ENSP00000286614:D547N	ENSP00000286614:D547N	D	-	1	0	MMP16	89122990	1.000000	0.71417	0.992000	0.48379	0.985000	0.73830	4.830000	0.62745	0.746000	0.32786	0.655000	0.94253	GAT	MMP16	-	pfam_Pept_M10A_metallopeptidase_C	ENSG00000156103		0.453	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2	66	0.00	0	C	NM_005941		89053874	89053874	-1	no_errors	ENST00000286614	ensembl	human	known	69_37n	missense	58	10.77	7	SNP	1.000	T
OR11H12	440153	genome.wustl.edu	37	14	19377927	19377927	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr14:19377927T>C	ENST00000550708.1	+	1	406	c.334T>C	c.(334-336)Tgt>Cgt	p.C112R		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTTTGCTGGATGTTTTCTCCA	0.398																																						dbGAP											0													3.0	3.0	3.0					14																	19377927		942	2224	3166	-	-	-	SO:0001583	missense	0				CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.334T>C	14.37:g.19377927T>C	ENSP00000449002:p.Cys112Arg			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.C112R	ENST00000550708.1	37	c.334	CCDS32017.1	14	.	.	.	.	.	.	.	.	.	.	t	7.999	0.754940	0.15846	.	.	ENSG00000257115	ENST00000550708	T	0.00545	6.67	.	.	.	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45867	D	0.000330	T	0.03178	0.0093	H	0.98701	4.305	0.30395	N	0.780639	D	0.89917	1.0	D	0.97110	1.0	T	0.11591	-1.0581	8	0.87932	D	0	.	3.8131	0.08805	0.0:0.3321:0.0:0.6679	.	112	B2RN74	O11HC_HUMAN	R	112	ENSP00000449002:C112R	ENSP00000449002:C112R	C	+	1	0	CR383656.1	18447927	0.962000	0.33011	0.218000	0.23776	0.114000	0.19823	3.714000	0.54889	-0.542000	0.06249	0.055000	0.15244	TGT	OR11H12	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000257115		0.398	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H12	Clone_based_vega_gene	protein_coding	OTTHUMT00000408402.1	78	0.00	0	T	NM_001013354		19377927	19377927	+1	no_errors	ENST00000550708	ensembl	human	known	69_37n	missense	56	15.15	10	SNP	0.110	C
OR11H12	440153	genome.wustl.edu	37	14	19377927	19377927	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr14:19377927T>C	ENST00000550708.1	+	1	406	c.334T>C	c.(334-336)Tgt>Cgt	p.C112R		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTTTGCTGGATGTTTTCTCCA	0.398																																						dbGAP											0													3.0	3.0	3.0					14																	19377927		942	2224	3166	-	-	-	SO:0001583	missense	0				CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.334T>C	14.37:g.19377927T>C	ENSP00000449002:p.Cys112Arg			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.C112R	ENST00000550708.1	37	c.334	CCDS32017.1	14	.	.	.	.	.	.	.	.	.	.	t	7.999	0.754940	0.15846	.	.	ENSG00000257115	ENST00000550708	T	0.00545	6.67	.	.	.	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45867	D	0.000330	T	0.03178	0.0093	H	0.98701	4.305	0.30395	N	0.780639	D	0.89917	1.0	D	0.97110	1.0	T	0.11591	-1.0581	8	0.87932	D	0	.	3.8131	0.08805	0.0:0.3321:0.0:0.6679	.	112	B2RN74	O11HC_HUMAN	R	112	ENSP00000449002:C112R	ENSP00000449002:C112R	C	+	1	0	CR383656.1	18447927	0.962000	0.33011	0.218000	0.23776	0.114000	0.19823	3.714000	0.54889	-0.542000	0.06249	0.055000	0.15244	TGT	OR11H12	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000257115		0.398	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H12	Clone_based_vega_gene	protein_coding	OTTHUMT00000408402.1	70	0.00	0	T	NM_001013354		19377927	19377927	+1	no_errors	ENST00000550708	ensembl	human	known	69_37n	missense	56	15.15	10	SNP	0.110	C
PBX2P1	5088	genome.wustl.edu	37	3	142895516	142895516	+	RNA	SNP	G	G	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr3:142895516G>A	ENST00000560287.1	+	0	390									pre-B-cell leukemia homeobox 2 pseudogene 1																		CACAGCTGATGCGCTTGGACA	0.627																																						dbGAP											0																																										-	-	-			0					3q24	2014-03-25	2007-01-30	2007-01-30	ENSG00000244171	ENSG00000244171		"""Homeoboxes / TALE class"""	8635	pseudogene	pseudogene			"""pre-B-cell leukemia transcription factor pseudogene 1"""	PBX2, PBXP1		1682799	Standard	NG_002434		Approved				OTTHUMG00000159350		3.37:g.142895516G>A				RNA	SNP	-	NULL	ENST00000560287.1	37	NULL		3																																																																																			PBX2P1	-	-	ENSG00000244171		0.627	PBX2P1-002	KNOWN	basic	processed_transcript	PBX2P1	HGNC	pseudogene	OTTHUMT00000417717.1	108	0.00	0	G	NG_002434		142895516	142895516	+1	no_errors	ENST00000560287	ensembl	human	known	69_37n	rna	87	11.22	11	SNP	1.000	A
PBX2P1	5088	genome.wustl.edu	37	3	142895516	142895516	+	RNA	SNP	G	G	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr3:142895516G>A	ENST00000560287.1	+	0	390									pre-B-cell leukemia homeobox 2 pseudogene 1																		CACAGCTGATGCGCTTGGACA	0.627																																						dbGAP											0																																										-	-	-			0					3q24	2014-03-25	2007-01-30	2007-01-30	ENSG00000244171	ENSG00000244171		"""Homeoboxes / TALE class"""	8635	pseudogene	pseudogene			"""pre-B-cell leukemia transcription factor pseudogene 1"""	PBX2, PBXP1		1682799	Standard	NG_002434		Approved				OTTHUMG00000159350		3.37:g.142895516G>A				RNA	SNP	-	NULL	ENST00000560287.1	37	NULL		3																																																																																			PBX2P1	-	-	ENSG00000244171		0.627	PBX2P1-002	KNOWN	basic	processed_transcript	PBX2P1	HGNC	pseudogene	OTTHUMT00000417717.1	95	0.00	0	G	NG_002434		142895516	142895516	+1	no_errors	ENST00000560287	ensembl	human	known	69_37n	rna	87	11.22	11	SNP	1.000	A
PCCA	5095	genome.wustl.edu	37	13	100982917	100982917	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr13:100982917G>A	ENST00000376285.1	+	17	1570	c.1532G>A	c.(1531-1533)gGc>gAc	p.G511D	PCCA_ENST00000376286.4_Missense_Mutation_p.G485D|PCCA_ENST00000376279.3_Missense_Mutation_p.G511D	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	511					biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	TATCCTGATGGCTTCAAAGGT	0.299																																						dbGAP											0													99.0	92.0	95.0					13																	100982917		2203	4299	6502	-	-	-	SO:0001583	missense	0			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.1532G>A	13.37:g.100982917G>A	ENSP00000365462:p.Gly511Asp		B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_Biotin_lipoyl	p.G511D	ENST00000376285.1	37	c.1532	CCDS9496.2	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.44|19.44	3.827121|3.827121	0.71143|0.71143	.|.	.|.	ENSG00000175198|ENSG00000175198	ENST00000443601|ENST00000376286;ENST00000376279;ENST00000376285;ENST00000424527;ENST00000376254;ENST00000536640	.|D;D;D;D	.|0.98947	.|-4.25;-4.26;-4.27;-5.26	4.91|4.91	4.91|4.91	0.64330|0.64330	.|ATP-grasp fold, subdomain 2 (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.98836|0.98836	0.9607|0.9607	L|L	0.58101|0.58101	1.795|1.795	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.998;0.999;0.998	D|D	0.99905|0.99905	1.1177|1.1177	5|10	.|0.66056	.|D	.|0.02	.|.	18.1043|18.1043	0.89515|0.89515	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|511;485;511	.|C9JPQ8;P05165-2;P05165	.|.;.;PCCA_HUMAN	T|D	103|485;511;511;45;102;7	.|ENSP00000365463:G485D;ENSP00000365456:G511D;ENSP00000365462:G511D;ENSP00000396050:G45D	.|ENSP00000365430:G102D	A|G	+|+	1|2	0|0	PCCA|PCCA	99780918|99780918	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.826000|0.826000	0.46750|0.46750	7.158000|7.158000	0.77470|0.77470	2.285000|2.285000	0.76669|0.76669	0.557000|0.557000	0.71058|0.71058	GCT|GGC	PCCA	-	NULL	ENSG00000175198		0.299	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCCA	HGNC	protein_coding	OTTHUMT00000045627.2	41	0.00	0	G			100982917	100982917	+1	no_errors	ENST00000376285	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	1.000	A
PCCA	5095	genome.wustl.edu	37	13	100982917	100982917	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr13:100982917G>A	ENST00000376285.1	+	17	1570	c.1532G>A	c.(1531-1533)gGc>gAc	p.G511D	PCCA_ENST00000376286.4_Missense_Mutation_p.G485D|PCCA_ENST00000376279.3_Missense_Mutation_p.G511D	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	511					biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	TATCCTGATGGCTTCAAAGGT	0.299																																						dbGAP											0													99.0	92.0	95.0					13																	100982917		2203	4299	6502	-	-	-	SO:0001583	missense	0			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.1532G>A	13.37:g.100982917G>A	ENSP00000365462:p.Gly511Asp		B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_Biotin_lipoyl	p.G511D	ENST00000376285.1	37	c.1532	CCDS9496.2	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.44|19.44	3.827121|3.827121	0.71143|0.71143	.|.	.|.	ENSG00000175198|ENSG00000175198	ENST00000443601|ENST00000376286;ENST00000376279;ENST00000376285;ENST00000424527;ENST00000376254;ENST00000536640	.|D;D;D;D	.|0.98947	.|-4.25;-4.26;-4.27;-5.26	4.91|4.91	4.91|4.91	0.64330|0.64330	.|ATP-grasp fold, subdomain 2 (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.98836|0.98836	0.9607|0.9607	L|L	0.58101|0.58101	1.795|1.795	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.998;0.999;0.998	D|D	0.99905|0.99905	1.1177|1.1177	5|10	.|0.66056	.|D	.|0.02	.|.	18.1043|18.1043	0.89515|0.89515	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|511;485;511	.|C9JPQ8;P05165-2;P05165	.|.;.;PCCA_HUMAN	T|D	103|485;511;511;45;102;7	.|ENSP00000365463:G485D;ENSP00000365456:G511D;ENSP00000365462:G511D;ENSP00000396050:G45D	.|ENSP00000365430:G102D	A|G	+|+	1|2	0|0	PCCA|PCCA	99780918|99780918	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.826000|0.826000	0.46750|0.46750	7.158000|7.158000	0.77470|0.77470	2.285000|2.285000	0.76669|0.76669	0.557000|0.557000	0.71058|0.71058	GCT|GGC	PCCA	-	NULL	ENSG00000175198		0.299	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCCA	HGNC	protein_coding	OTTHUMT00000045627.2	36	0.00	0	G			100982917	100982917	+1	no_errors	ENST00000376285	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	1.000	A
PCCB	5096	genome.wustl.edu	37	3	136048838	136048838	+	Silent	SNP	T	T	G			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr3:136048838T>G	ENST00000251654.4	+	15	1660	c.1590T>G	c.(1588-1590)ccT>ccG	p.P530P	PCCB_ENST00000466072.1_Silent_p.P550P|PCCB_ENST00000483687.1_Silent_p.P511P|PCCB_ENST00000468777.1_Silent_p.P561P|PCCB_ENST00000462637.1_Silent_p.P507P|PCCB_ENST00000482086.1_Silent_p.P414P|PCCB_ENST00000478469.1_Intron|PCCB_ENST00000471595.1_Intron|PCCB_ENST00000490504.1_Silent_p.P473P|PCCB_ENST00000469217.1_Silent_p.P550P	NM_000532.4	NP_000523.2	P05166	PCCB_HUMAN	propionyl CoA carboxylase, beta polypeptide	530	Carboxyltransferase.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|propionyl-CoA carboxylase activity (GO:0004658)	p.R529_K533delRPWRK(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	25					Biotin(DB00121)|L-Valine(DB00161)	TACAACGTCCTTGGAGAAAAC	0.448																																						dbGAP											1	Deletion - In frame(1)	ovary(1)											136.0	111.0	120.0					3																	136048838		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3089.1, CCDS54643.1	3q21-q22	2010-07-01	2010-04-30		ENSG00000114054	ENSG00000114054	6.4.1.3		8654	protein-coding gene	gene with protein product		232050	"""propionyl Coenzyme A carboxylase, beta polypeptide"""			2895916	Standard	NM_000532		Approved		uc003eqy.2	P05166	OTTHUMG00000159792	ENST00000251654.4:c.1590T>G	3.37:g.136048838T>G			B7Z2Z4|Q16813|Q96CX0	Silent	SNP	pfam_Carboxyl_trans,pfscan_COA_CT_N,pfscan_COA_CT_C	p.P530	ENST00000251654.4	37	c.1590	CCDS3089.1	3																																																																																			PCCB	-	pfam_Carboxyl_trans,pfscan_COA_CT_C	ENSG00000114054		0.448	PCCB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCCB	HGNC	protein_coding	OTTHUMT00000357335.1	67	0.00	0	T			136048838	136048838	+1	no_errors	ENST00000251654	ensembl	human	known	69_37n	silent	39	18.75	9	SNP	1.000	G
PCCB	5096	genome.wustl.edu	37	3	136048838	136048838	+	Silent	SNP	T	T	G			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr3:136048838T>G	ENST00000251654.4	+	15	1660	c.1590T>G	c.(1588-1590)ccT>ccG	p.P530P	PCCB_ENST00000466072.1_Silent_p.P550P|PCCB_ENST00000483687.1_Silent_p.P511P|PCCB_ENST00000468777.1_Silent_p.P561P|PCCB_ENST00000462637.1_Silent_p.P507P|PCCB_ENST00000482086.1_Silent_p.P414P|PCCB_ENST00000478469.1_Intron|PCCB_ENST00000471595.1_Intron|PCCB_ENST00000490504.1_Silent_p.P473P|PCCB_ENST00000469217.1_Silent_p.P550P	NM_000532.4	NP_000523.2	P05166	PCCB_HUMAN	propionyl CoA carboxylase, beta polypeptide	530	Carboxyltransferase.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|propionyl-CoA carboxylase activity (GO:0004658)	p.R529_K533delRPWRK(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	25					Biotin(DB00121)|L-Valine(DB00161)	TACAACGTCCTTGGAGAAAAC	0.448																																						dbGAP											1	Deletion - In frame(1)	ovary(1)											136.0	111.0	120.0					3																	136048838		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3089.1, CCDS54643.1	3q21-q22	2010-07-01	2010-04-30		ENSG00000114054	ENSG00000114054	6.4.1.3		8654	protein-coding gene	gene with protein product		232050	"""propionyl Coenzyme A carboxylase, beta polypeptide"""			2895916	Standard	NM_000532		Approved		uc003eqy.2	P05166	OTTHUMG00000159792	ENST00000251654.4:c.1590T>G	3.37:g.136048838T>G			B7Z2Z4|Q16813|Q96CX0	Silent	SNP	pfam_Carboxyl_trans,pfscan_COA_CT_N,pfscan_COA_CT_C	p.P530	ENST00000251654.4	37	c.1590	CCDS3089.1	3																																																																																			PCCB	-	pfam_Carboxyl_trans,pfscan_COA_CT_C	ENSG00000114054		0.448	PCCB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCCB	HGNC	protein_coding	OTTHUMT00000357335.1	51	0.00	0	T			136048838	136048838	+1	no_errors	ENST00000251654	ensembl	human	known	69_37n	silent	39	18.75	9	SNP	1.000	G
TMEM199	147007	genome.wustl.edu	37	17	26684529	26684529	+	5'Flank	DEL	G	G	-	rs113967755		TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr17:26684529delG	ENST00000292114.3	+	0	0				TMEM199_ENST00000509083.1_5'Flank|POLDIP2_ENST00000540200.1_5'Flank|POLDIP2_ENST00000003607.4_5'UTR|TMEM199_ENST00000395404.3_5'Flank|CTB-96E2.3_ENST00000591482.1_RNA	NM_152464.1	NP_689677.1	Q8N511	TM199_HUMAN	transmembrane protein 199							integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		GCGGCCGGGCGGTTCCGCCCC	0.771																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AY074907	CCDS11228.1	17q11.2	2007-12-17	2007-12-17	2007-12-17	ENSG00000244045	ENSG00000244045			18085	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 32"""	C17orf32			Standard	NM_152464		Approved	MGC45714	uc002hba.3	Q8N511	OTTHUMG00000132498		17.37:g.26684529delG	Exception_encountered			RNA	DEL	-	NULL	ENST00000292114.3	37	NULL	CCDS11228.1	17																																																																																			POLDIP2	-	-	ENSG00000004142		0.771	TMEM199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLDIP2	HGNC	protein_coding	OTTHUMT00000255676.2	8	0.00	0	G	NM_152464		26684529	26684529	-1	no_errors	ENST00000003607	ensembl	human	known	69_37n	rna	3	50.00	3	DEL	0.993	-
PSMD13	5719	genome.wustl.edu	37	11	252640	252640	+	3'UTR	SNP	G	G	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr11:252640G>A	ENST00000532097.1	+	0	1675				PSMD13_ENST00000352303.5_3'UTR|PSMD13_ENST00000532025.1_3'UTR|PSMD13_ENST00000431206.2_3'UTR	NM_002817.3	NP_002808.3	Q9UNM6	PSD13_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 13						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|meiosis I (GO:0007127)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				NS(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	10		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)		TGACTCACCTGAGAGAGGCGT	0.567																																						dbGAP											0													42.0	36.0	38.0					11																	252640		2202	4300	6502	-	-	-	SO:0001624	3_prime_UTR_variant	0			AB009398	CCDS7692.1, CCDS44504.1	11p15.5	2008-05-22			ENSG00000185627	ENSG00000185627		"""Proteasome (prosome, macropain) subunits"""	9558	protein-coding gene	gene with protein product		603481				9714768, 8811196	Standard	NM_002817		Approved	p40.5, Rpn9	uc001loo.2	Q9UNM6	OTTHUMG00000119072	ENST00000532097.1:c.*40G>A	11.37:g.252640G>A			B3KT15|O75831|Q53XU2|Q9UNV3	RNA	SNP	-	NULL	ENST00000532097.1	37	NULL	CCDS7692.1	11																																																																																			PSMD13	-	-	ENSG00000185627		0.567	PSMD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD13	HGNC	protein_coding	OTTHUMT00000239286.2	60	0.00	0	G	NM_002817		252640	252640	+1	no_errors	ENST00000532025	ensembl	human	known	69_37n	rna	38	11.63	5	SNP	0.000	A
PSMD13	5719	genome.wustl.edu	37	11	252640	252640	+	3'UTR	SNP	G	G	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr11:252640G>A	ENST00000532097.1	+	0	1675				PSMD13_ENST00000352303.5_3'UTR|PSMD13_ENST00000532025.1_3'UTR|PSMD13_ENST00000431206.2_3'UTR	NM_002817.3	NP_002808.3	Q9UNM6	PSD13_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 13						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|meiosis I (GO:0007127)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				NS(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	10		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)		TGACTCACCTGAGAGAGGCGT	0.567																																						dbGAP											0													42.0	36.0	38.0					11																	252640		2202	4300	6502	-	-	-	SO:0001624	3_prime_UTR_variant	0			AB009398	CCDS7692.1, CCDS44504.1	11p15.5	2008-05-22			ENSG00000185627	ENSG00000185627		"""Proteasome (prosome, macropain) subunits"""	9558	protein-coding gene	gene with protein product		603481				9714768, 8811196	Standard	NM_002817		Approved	p40.5, Rpn9	uc001loo.2	Q9UNM6	OTTHUMG00000119072	ENST00000532097.1:c.*40G>A	11.37:g.252640G>A			B3KT15|O75831|Q53XU2|Q9UNV3	RNA	SNP	-	NULL	ENST00000532097.1	37	NULL	CCDS7692.1	11																																																																																			PSMD13	-	-	ENSG00000185627		0.567	PSMD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD13	HGNC	protein_coding	OTTHUMT00000239286.2	39	0.00	0	G	NM_002817		252640	252640	+1	no_errors	ENST00000532025	ensembl	human	known	69_37n	rna	38	11.63	5	SNP	0.000	A
PTPRQ	374462	genome.wustl.edu	37	12	81067076	81067076	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr12:81067076A>T	ENST00000266688.5	+	48	6719	c.6719A>T	c.(6718-6720)cAg>cTg	p.Q2240L				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	2277	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						TGCATGGTGCAGAATCTGGTA	0.393																																						dbGAP											0													206.0	175.0	184.0					12																	81067076		692	1591	2283	-	-	-	SO:0001583	missense	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.6719A>T	12.37:g.81067076A>T	ENSP00000266688:p.Gln2240Leu			Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.R1941*	ENST00000266688.5	37	c.5821		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.3|25.3	4.624785|4.624785	0.87560|0.87560	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000266688|ENST00000532722	D|.	0.86164|.	-2.08|.	5.48|5.48	5.48|5.48	0.80851|0.80851	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);|.	.|.	.|.	.|.	.|.	T|.	0.71962|.	0.3402|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|.	0.71248|.	-0.4649|.	8|.	0.87932|.	D|.	0|.	.|.	15.8673|15.8673	0.79074|0.79074	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	2277|.	Q9UMZ3|.	PTPRQ_HUMAN|.	L|X	2240|1941	ENSP00000266688:Q2240L|.	ENSP00000266688:Q2240L|.	Q|R	+|+	2|1	0|2	PTPRQ|PTPRQ	79591207|79591207	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	8.755000|8.755000	0.91646|0.91646	2.208000|2.208000	0.71279|0.71279	0.455000|0.455000	0.32223|0.32223	CAG|AGA	PTPRQ	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	ENSG00000139304		0.393	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding		65	0.00	0	A	NM_001145026		81067076	81067076	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000532722	ensembl	human	novel	69_37n	nonsense	25	19.35	6	SNP	1.000	T
PTPRQ	374462	genome.wustl.edu	37	12	81067076	81067076	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr12:81067076A>T	ENST00000266688.5	+	48	6719	c.6719A>T	c.(6718-6720)cAg>cTg	p.Q2240L				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	2277	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						TGCATGGTGCAGAATCTGGTA	0.393																																						dbGAP											0													206.0	175.0	184.0					12																	81067076		692	1591	2283	-	-	-	SO:0001583	missense	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.6719A>T	12.37:g.81067076A>T	ENSP00000266688:p.Gln2240Leu			Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.R1941*	ENST00000266688.5	37	c.5821		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.3|25.3	4.624785|4.624785	0.87560|0.87560	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000266688|ENST00000532722	D|.	0.86164|.	-2.08|.	5.48|5.48	5.48|5.48	0.80851|0.80851	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);|.	.|.	.|.	.|.	.|.	T|.	0.71962|.	0.3402|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|.	0.71248|.	-0.4649|.	8|.	0.87932|.	D|.	0|.	.|.	15.8673|15.8673	0.79074|0.79074	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	2277|.	Q9UMZ3|.	PTPRQ_HUMAN|.	L|X	2240|1941	ENSP00000266688:Q2240L|.	ENSP00000266688:Q2240L|.	Q|R	+|+	2|1	0|2	PTPRQ|PTPRQ	79591207|79591207	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	8.755000|8.755000	0.91646|0.91646	2.208000|2.208000	0.71279|0.71279	0.455000|0.455000	0.32223|0.32223	CAG|AGA	PTPRQ	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	ENSG00000139304		0.393	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding		58	0.00	0	A	NM_001145026		81067076	81067076	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000532722	ensembl	human	novel	69_37n	nonsense	25	19.35	6	SNP	1.000	T
RAD51AP2	729475	genome.wustl.edu	37	2	17697546	17697546	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr2:17697546A>G	ENST00000399080.2	-	1	2160	c.2137T>C	c.(2137-2139)Tgt>Cgt	p.C713R		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	713										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TGTTGAGGACAACTCATATTC	0.323																																						dbGAP											0													72.0	68.0	69.0					2																	17697546		1818	4075	5893	-	-	-	SO:0001583	missense	0			AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.2137T>C	2.37:g.17697546A>G	ENSP00000382030:p.Cys713Arg			Missense_Mutation	SNP	NULL	p.C713R	ENST00000399080.2	37	c.2137	CCDS42656.1	2	.	.	.	.	.	.	.	.	.	.	A	0.304	-0.972200	0.02215	.	.	ENSG00000214842	ENST00000399080	T	0.25250	1.81	3.76	2.56	0.30785	.	.	.	.	.	T	0.32882	0.0844	L	0.27053	0.805	0.19300	N	0.999977	D	0.64830	0.994	P	0.62740	0.906	T	0.11108	-1.0601	9	0.87932	D	0	.	9.9714	0.41757	0.8289:0.1711:0.0:0.0	.	713	Q09MP3	R51A2_HUMAN	R	713	ENSP00000382030:C713R	ENSP00000382030:C713R	C	-	1	0	RAD51AP2	17561027	0.000000	0.05858	0.055000	0.19348	0.015000	0.08874	0.058000	0.14301	0.770000	0.33336	0.482000	0.46254	TGT	RAD51AP2	-	NULL	ENSG00000214842		0.323	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD51AP2	HGNC	protein_coding	OTTHUMT00000323801.3	47	0.00	0	A	NM_001099218		17697546	17697546	-1	no_errors	ENST00000399080	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	0.012	G
RAD51AP2	729475	genome.wustl.edu	37	2	17697546	17697546	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr2:17697546A>G	ENST00000399080.2	-	1	2160	c.2137T>C	c.(2137-2139)Tgt>Cgt	p.C713R		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	713										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TGTTGAGGACAACTCATATTC	0.323																																						dbGAP											0													72.0	68.0	69.0					2																	17697546		1818	4075	5893	-	-	-	SO:0001583	missense	0			AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.2137T>C	2.37:g.17697546A>G	ENSP00000382030:p.Cys713Arg			Missense_Mutation	SNP	NULL	p.C713R	ENST00000399080.2	37	c.2137	CCDS42656.1	2	.	.	.	.	.	.	.	.	.	.	A	0.304	-0.972200	0.02215	.	.	ENSG00000214842	ENST00000399080	T	0.25250	1.81	3.76	2.56	0.30785	.	.	.	.	.	T	0.32882	0.0844	L	0.27053	0.805	0.19300	N	0.999977	D	0.64830	0.994	P	0.62740	0.906	T	0.11108	-1.0601	9	0.87932	D	0	.	9.9714	0.41757	0.8289:0.1711:0.0:0.0	.	713	Q09MP3	R51A2_HUMAN	R	713	ENSP00000382030:C713R	ENSP00000382030:C713R	C	-	1	0	RAD51AP2	17561027	0.000000	0.05858	0.055000	0.19348	0.015000	0.08874	0.058000	0.14301	0.770000	0.33336	0.482000	0.46254	TGT	RAD51AP2	-	NULL	ENSG00000214842		0.323	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD51AP2	HGNC	protein_coding	OTTHUMT00000323801.3	46	0.00	0	A	NM_001099218		17697546	17697546	-1	no_errors	ENST00000399080	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	0.012	G
RFPL2	10739	genome.wustl.edu	37	22	32587157	32587157	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr22:32587157C>T	ENST00000400237.1	-	5	1674	c.739G>A	c.(739-741)Gtg>Atg	p.V247M	RFPL2_ENST00000248983.4_Missense_Mutation_p.V157M|RFPL2_ENST00000248980.4_Missense_Mutation_p.V186M|RFPL2_ENST00000489846.1_5'UTR|RFPL2_ENST00000400236.3_Missense_Mutation_p.V157M			O75678	RFPL2_HUMAN	ret finger protein-like 2	247	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						CTTGTTCCCACGTCCACCTCC	0.572																																						dbGAP											0													106.0	103.0	104.0					22																	32587157		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.739G>A	22.37:g.32587157C>T	ENSP00000383096:p.Val247Met			Missense_Mutation	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY	p.V247M	ENST00000400237.1	37	c.739	CCDS43009.2	22	.	.	.	.	.	.	.	.	.	.	C	10.57	1.386568	0.25031	.	.	ENSG00000128253	ENST00000248980;ENST00000248983;ENST00000400236;ENST00000400237	T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85	0.311	-0.622	0.11560	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.80919	0.4716	M	0.73372	2.23	0.19945	N	0.999946	D;D	0.89917	1.0;0.999	D;P	0.72338	0.977;0.904	T	0.68580	-0.5371	9	0.66056	D	0.02	.	4.8436	0.13503	0.3471:0.6528:0.0:1.0E-4	.	247;186	O75678;O75678-3	RFPL2_HUMAN;.	M	186;157;157;247	ENSP00000248980:V186M;ENSP00000248983:V157M;ENSP00000383095:V157M;ENSP00000383096:V247M	ENSP00000248980:V186M	V	-	1	0	RFPL2	30917157	0.581000	0.26741	0.020000	0.16555	0.020000	0.10135	1.773000	0.38563	-0.757000	0.04697	-0.779000	0.03376	GTG	RFPL2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY	ENSG00000128253		0.572	RFPL2-001	KNOWN	basic|CCDS	protein_coding	RFPL2	HGNC	protein_coding	OTTHUMT00000075262.2	167	0.00	0	C	NM_006605		32587157	32587157	-1	no_errors	ENST00000400237	ensembl	human	known	69_37n	missense	100	17.36	21	SNP	0.812	T
RFPL2	10739	genome.wustl.edu	37	22	32587157	32587157	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr22:32587157C>T	ENST00000400237.1	-	5	1674	c.739G>A	c.(739-741)Gtg>Atg	p.V247M	RFPL2_ENST00000248983.4_Missense_Mutation_p.V157M|RFPL2_ENST00000248980.4_Missense_Mutation_p.V186M|RFPL2_ENST00000489846.1_5'UTR|RFPL2_ENST00000400236.3_Missense_Mutation_p.V157M			O75678	RFPL2_HUMAN	ret finger protein-like 2	247	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						CTTGTTCCCACGTCCACCTCC	0.572																																						dbGAP											0													106.0	103.0	104.0					22																	32587157		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.739G>A	22.37:g.32587157C>T	ENSP00000383096:p.Val247Met			Missense_Mutation	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY	p.V247M	ENST00000400237.1	37	c.739	CCDS43009.2	22	.	.	.	.	.	.	.	.	.	.	C	10.57	1.386568	0.25031	.	.	ENSG00000128253	ENST00000248980;ENST00000248983;ENST00000400236;ENST00000400237	T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85	0.311	-0.622	0.11560	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.80919	0.4716	M	0.73372	2.23	0.19945	N	0.999946	D;D	0.89917	1.0;0.999	D;P	0.72338	0.977;0.904	T	0.68580	-0.5371	9	0.66056	D	0.02	.	4.8436	0.13503	0.3471:0.6528:0.0:1.0E-4	.	247;186	O75678;O75678-3	RFPL2_HUMAN;.	M	186;157;157;247	ENSP00000248980:V186M;ENSP00000248983:V157M;ENSP00000383095:V157M;ENSP00000383096:V247M	ENSP00000248980:V186M	V	-	1	0	RFPL2	30917157	0.581000	0.26741	0.020000	0.16555	0.020000	0.10135	1.773000	0.38563	-0.757000	0.04697	-0.779000	0.03376	GTG	RFPL2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY	ENSG00000128253		0.572	RFPL2-001	KNOWN	basic|CCDS	protein_coding	RFPL2	HGNC	protein_coding	OTTHUMT00000075262.2	155	0.00	0	C	NM_006605		32587157	32587157	-1	no_errors	ENST00000400237	ensembl	human	known	69_37n	missense	100	17.36	21	SNP	0.812	T
SLITRK6	84189	genome.wustl.edu	37	13	86369296	86369296	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr13:86369296T>A	ENST00000400286.2	-	2	1946	c.1348A>T	c.(1348-1350)Ata>Tta	p.I450L		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	450					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		CCTGGCAGTATTTCCTTAATG	0.358																																						dbGAP											0													83.0	80.0	81.0					13																	86369296		1815	4078	5893	-	-	-	SO:0001583	missense	0			AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.1348A>T	13.37:g.86369296T>A	ENSP00000383143:p.Ile450Leu		A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.I450L	ENST00000400286.2	37	c.1348	CCDS41903.1	13	.	.	.	.	.	.	.	.	.	.	T	12.28	1.890897	0.33348	.	.	ENSG00000184564	ENST00000400286	T	0.02085	4.46	5.71	4.46	0.54185	.	0.073801	0.52532	U	0.000070	T	0.01061	0.0035	N	0.02169	-0.655	0.38037	D	0.935351	B	0.10296	0.003	B	0.13407	0.009	T	0.56727	-0.7931	10	0.33940	T	0.23	-13.5565	6.7724	0.23601	0.0:0.0798:0.155:0.7652	.	450	Q9H5Y7	SLIK6_HUMAN	L	450	ENSP00000383143:I450L	ENSP00000383143:I450L	I	-	1	0	SLITRK6	85267297	1.000000	0.71417	0.988000	0.46212	0.566000	0.35808	3.342000	0.52159	2.180000	0.69256	0.533000	0.62120	ATA	SLITRK6	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000184564		0.358	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK6	HGNC	protein_coding	OTTHUMT00000045404.2	101	0.00	0	T	NM_032229		86369296	86369296	-1	no_errors	ENST00000400286	ensembl	human	known	69_37n	missense	59	21.33	16	SNP	1.000	A
SLITRK6	84189	genome.wustl.edu	37	13	86369296	86369296	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr13:86369296T>A	ENST00000400286.2	-	2	1946	c.1348A>T	c.(1348-1350)Ata>Tta	p.I450L		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	450					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		CCTGGCAGTATTTCCTTAATG	0.358																																						dbGAP											0													83.0	80.0	81.0					13																	86369296		1815	4078	5893	-	-	-	SO:0001583	missense	0			AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.1348A>T	13.37:g.86369296T>A	ENSP00000383143:p.Ile450Leu		A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.I450L	ENST00000400286.2	37	c.1348	CCDS41903.1	13	.	.	.	.	.	.	.	.	.	.	T	12.28	1.890897	0.33348	.	.	ENSG00000184564	ENST00000400286	T	0.02085	4.46	5.71	4.46	0.54185	.	0.073801	0.52532	U	0.000070	T	0.01061	0.0035	N	0.02169	-0.655	0.38037	D	0.935351	B	0.10296	0.003	B	0.13407	0.009	T	0.56727	-0.7931	10	0.33940	T	0.23	-13.5565	6.7724	0.23601	0.0:0.0798:0.155:0.7652	.	450	Q9H5Y7	SLIK6_HUMAN	L	450	ENSP00000383143:I450L	ENSP00000383143:I450L	I	-	1	0	SLITRK6	85267297	1.000000	0.71417	0.988000	0.46212	0.566000	0.35808	3.342000	0.52159	2.180000	0.69256	0.533000	0.62120	ATA	SLITRK6	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000184564		0.358	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK6	HGNC	protein_coding	OTTHUMT00000045404.2	93	0.00	0	T	NM_032229		86369296	86369296	-1	no_errors	ENST00000400286	ensembl	human	known	69_37n	missense	59	21.33	16	SNP	1.000	A
SMARCC1	6599	genome.wustl.edu	37	3	47702933	47702933	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr3:47702933C>T	ENST00000254480.5	-	21	2290	c.2171G>A	c.(2170-2172)cGg>cAg	p.R724Q	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	724					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		CTCCCGGACCCGAGAAAACTC	0.468																																						dbGAP											0													70.0	67.0	68.0					3																	47702933		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.2171G>A	3.37:g.47702933C>T	ENSP00000254480:p.Arg724Gln		Q17RS0|Q6P172|Q8IWH2	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.R724Q	ENST00000254480.5	37	c.2171	CCDS2758.1	3	.	.	.	.	.	.	.	.	.	.	C	24.0	4.483743	0.84854	.	.	ENSG00000173473	ENST00000254480	T	0.47869	0.83	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.57607	0.2065	M	0.80422	2.495	0.58432	D	0.999997	P	0.51351	0.944	B	0.43701	0.428	T	0.64474	-0.6399	10	0.56958	D	0.05	-9.5264	19.1705	0.93575	0.0:1.0:0.0:0.0	.	724	Q92922	SMRC1_HUMAN	Q	724	ENSP00000254480:R724Q	ENSP00000254480:R724Q	R	-	2	0	SMARCC1	47677937	0.999000	0.42202	0.975000	0.42487	0.993000	0.82548	4.071000	0.57556	2.771000	0.95319	0.650000	0.86243	CGG	SMARCC1	-	NULL	ENSG00000173473		0.468	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCC1	HGNC	protein_coding	OTTHUMT00000257491.1	30	0.00	0	C			47702933	47702933	-1	no_errors	ENST00000254480	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	T
SMARCC1	6599	genome.wustl.edu	37	3	47702933	47702933	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr3:47702933C>T	ENST00000254480.5	-	21	2290	c.2171G>A	c.(2170-2172)cGg>cAg	p.R724Q	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	724					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		CTCCCGGACCCGAGAAAACTC	0.468																																						dbGAP											0													70.0	67.0	68.0					3																	47702933		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.2171G>A	3.37:g.47702933C>T	ENSP00000254480:p.Arg724Gln		Q17RS0|Q6P172|Q8IWH2	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.R724Q	ENST00000254480.5	37	c.2171	CCDS2758.1	3	.	.	.	.	.	.	.	.	.	.	C	24.0	4.483743	0.84854	.	.	ENSG00000173473	ENST00000254480	T	0.47869	0.83	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.57607	0.2065	M	0.80422	2.495	0.58432	D	0.999997	P	0.51351	0.944	B	0.43701	0.428	T	0.64474	-0.6399	10	0.56958	D	0.05	-9.5264	19.1705	0.93575	0.0:1.0:0.0:0.0	.	724	Q92922	SMRC1_HUMAN	Q	724	ENSP00000254480:R724Q	ENSP00000254480:R724Q	R	-	2	0	SMARCC1	47677937	0.999000	0.42202	0.975000	0.42487	0.993000	0.82548	4.071000	0.57556	2.771000	0.95319	0.650000	0.86243	CGG	SMARCC1	-	NULL	ENSG00000173473		0.468	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCC1	HGNC	protein_coding	OTTHUMT00000257491.1	41	0.00	0	C			47702933	47702933	-1	no_errors	ENST00000254480	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	T
TBX3	6926	genome.wustl.edu	37	12	115114233	115114236	+	Frame_Shift_Del	DEL	TCTT	TCTT	-			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	TCTT	TCTT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr12:115114233_115114236delTCTT	ENST00000257566.3	-	6	1370_1373	c.981_984delAAGA	c.(979-984)gaaagafs	p.ER327fs	TBX3_ENST00000349155.2_Frame_Shift_Del_p.ER307fs	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	327					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		CCTTTTTGTGTCTTTCATCAAACA	0.505																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.981_984delAAGA	12.37:g.115114233_115114236delTCTT	ENSP00000257566:p.Glu327fs		Q8TB20|Q9UKF8	Frame_Shift_Del	DEL	pfam_TF_T-box,pfam_TBX,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.E327fs	ENST00000257566.3	37	c.984_981	CCDS9176.1	12																																																																																			TBX3	-	pfam_TBX	ENSG00000135111		0.505	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBX3	HGNC	protein_coding	OTTHUMT00000404947.2	73	0.00	0	TCTT	NM_016569, NM_005996		115114233	115114236	-1	no_errors	ENST00000257566	ensembl	human	known	69_37n	frame_shift_del	45	11.76	6	DEL	0.924:0.999:1.000:1.000	-
TBX3	6926	genome.wustl.edu	37	12	115114233	115114236	+	Frame_Shift_Del	DEL	TCTT	TCTT	-			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	TCTT	TCTT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr12:115114233_115114236delTCTT	ENST00000257566.3	-	6	1370_1373	c.981_984delAAGA	c.(979-984)gaaagafs	p.ER327fs	TBX3_ENST00000349155.2_Frame_Shift_Del_p.ER307fs	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	327					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		CCTTTTTGTGTCTTTCATCAAACA	0.505																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.981_984delAAGA	12.37:g.115114233_115114236delTCTT	ENSP00000257566:p.Glu327fs		Q8TB20|Q9UKF8	Frame_Shift_Del	DEL	pfam_TF_T-box,pfam_TBX,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.E327fs	ENST00000257566.3	37	c.984_981	CCDS9176.1	12																																																																																			TBX3	-	pfam_TBX	ENSG00000135111		0.505	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBX3	HGNC	protein_coding	OTTHUMT00000404947.2	60	0.00	0	TCTT	NM_016569, NM_005996		115114233	115114236	-1	no_errors	ENST00000257566	ensembl	human	known	69_37n	frame_shift_del	45	11.76	6	DEL	0.924:0.999:1.000:1.000	-
TMEM179	388021	genome.wustl.edu	37	14	105059982	105059982	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	a9f8fff2-6c84-4731-a120-0f4be959c62e	g.chr14:105059982G>A	ENST00000556573.1	-	4	777	c.536C>T	c.(535-537)gCc>gTc	p.A179V				Q6ZVK1	T179A_HUMAN	transmembrane protein 179	179						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|skin(1)	4			all cancers(16;0.00276)|OV - Ovarian serous cystadenocarcinoma(23;0.0262)|Epithelial(46;0.058)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.129)		CAGCCATGAGGCCCAGAGGCC	0.642																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK124477	CCDS66723.1, CCDS73688.1	14q32.33	2012-04-11	2006-10-16	2006-10-16	ENSG00000258986	ENSG00000258986			20137	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 90"""	C14orf90			Standard	NM_001286390		Approved	FLJ42486, TMEM179A	uc001yox.1	Q6ZVK1	OTTHUMG00000170829	ENST00000556573.1:c.536C>T	14.37:g.105059982G>A	ENSP00000450958:p.Ala179Val			Missense_Mutation	SNP	NULL	p.A179V	ENST00000556573.1	37	c.536		14	.	.	.	.	.	.	.	.	.	.	G	19.14	3.770013	0.69992	.	.	ENSG00000258986	ENST00000556573	T	0.30182	1.54	3.7	3.7	0.42460	.	.	.	.	.	T	0.49864	0.1582	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57734	-0.7760	6	0.66056	D	0.02	.	15.7916	0.78369	0.0:0.0:1.0:0.0	.	.	.	.	V	179	ENSP00000450958:A179V	ENSP00000397763:A179V	A	-	2	0	TMEM179	104131027	1.000000	0.71417	1.000000	0.80357	0.544000	0.35116	7.473000	0.81007	1.764000	0.52075	0.455000	0.32223	GCC	TMEM179	-	NULL	ENSG00000258986		0.642	TMEM179-002	KNOWN	basic|appris_principal	protein_coding	TMEM179	HGNC	protein_coding	OTTHUMT00000410585.1	128	0.00	0	G	NM_207379		105059982	105059982	-1	no_errors	ENST00000556573	ensembl	human	known	69_37n	missense	87	13.86	14	SNP	1.000	A
TMEM179	388021	genome.wustl.edu	37	14	105059982	105059982	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZX-01A-12D-A29N-09	TCGA-A7-A5ZX-11A-51D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e19a22f-97e3-4a9a-aa55-fb18dd6b674b	438bd1bb-c0b2-4760-a9ac-5ffd547cf382	g.chr14:105059982G>A	ENST00000556573.1	-	4	777	c.536C>T	c.(535-537)gCc>gTc	p.A179V				Q6ZVK1	T179A_HUMAN	transmembrane protein 179	179						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|skin(1)	4			all cancers(16;0.00276)|OV - Ovarian serous cystadenocarcinoma(23;0.0262)|Epithelial(46;0.058)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.129)		CAGCCATGAGGCCCAGAGGCC	0.642																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK124477	CCDS66723.1, CCDS73688.1	14q32.33	2012-04-11	2006-10-16	2006-10-16	ENSG00000258986	ENSG00000258986			20137	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 90"""	C14orf90			Standard	NM_001286390		Approved	FLJ42486, TMEM179A	uc001yox.1	Q6ZVK1	OTTHUMG00000170829	ENST00000556573.1:c.536C>T	14.37:g.105059982G>A	ENSP00000450958:p.Ala179Val			Missense_Mutation	SNP	NULL	p.A179V	ENST00000556573.1	37	c.536		14	.	.	.	.	.	.	.	.	.	.	G	19.14	3.770013	0.69992	.	.	ENSG00000258986	ENST00000556573	T	0.30182	1.54	3.7	3.7	0.42460	.	.	.	.	.	T	0.49864	0.1582	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57734	-0.7760	6	0.66056	D	0.02	.	15.7916	0.78369	0.0:0.0:1.0:0.0	.	.	.	.	V	179	ENSP00000450958:A179V	ENSP00000397763:A179V	A	-	2	0	TMEM179	104131027	1.000000	0.71417	1.000000	0.80357	0.544000	0.35116	7.473000	0.81007	1.764000	0.52075	0.455000	0.32223	GCC	TMEM179	-	NULL	ENSG00000258986		0.642	TMEM179-002	KNOWN	basic|appris_principal	protein_coding	TMEM179	HGNC	protein_coding	OTTHUMT00000410585.1	95	0.00	0	G	NM_207379		105059982	105059982	-1	no_errors	ENST00000556573	ensembl	human	known	69_37n	missense	87	13.86	14	SNP	1.000	A
