#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCG5	64240	genome.wustl.edu	37	2	44055180	44055181	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr2:44055180_44055181insC	ENST00000260645.1	-	5	714_715	c.575_576insG	c.(574-576)ggcfs	p.G192fs	ABCG5_ENST00000543989.1_5'UTR|ABCG5_ENST00000405322.1_Frame_Shift_Ins_p.G111fs	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	192	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CCGTGGAAATGCCCCCCAAGCT	0.589																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.576dupG	2.37:g.44055186_44055186dupC	ENSP00000260645:p.Gly192fs		Q2T9G2|Q96QZ2|Q96QZ3	Frame_Shift_Ins	INS	pfam_ABC_2_trans,pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.I193fs	ENST00000260645.1	37	c.576_575	CCDS1814.1	2																																																																																			ABCG5	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000138075		0.589	ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG5	HGNC	protein_coding	OTTHUMT00000250675.1	28	0.00	0	-	NM_022436		44055180	44055181	-1	no_errors	ENST00000260645	ensembl	human	known	69_37n	frame_shift_ins	16	11.11	2	INS	0.500:1.000	C
ACADVL	37	genome.wustl.edu	37	17	7123807	7123807	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr17:7123807C>T	ENST00000356839.5	+	3	342	c.163C>T	c.(163-165)Cac>Tac	p.H55Y	DLG4_ENST00000399510.2_5'Flank|ACADVL_ENST00000581562.1_3'UTR|ACADVL_ENST00000350303.5_Intron|ACADVL_ENST00000543245.2_Missense_Mutation_p.H78Y|MIR324_ENST00000362183.1_RNA	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain	55	Catalytic.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						GTCAGATTCCCACCCCTCTGA	0.592																																						dbGAP											0													68.0	70.0	69.0					17																	7123807		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.163C>T	17.37:g.7123807C>T	ENSP00000349297:p.His55Tyr		B4DEB6|F5H2A9|O76056|Q8WUL0	Missense_Mutation	SNP	pfam_Acyl-CoA_Oxase/DH_1,pfam_Acyl-CoA_DH_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCoA_DH/oxidase,superfamily_AcylCo_DH/oxidase_C	p.H55Y	ENST00000356839.5	37	c.163	CCDS11090.1	17	.	.	.	.	.	.	.	.	.	.	C	4.379	0.069983	0.08436	.	.	ENSG00000072778	ENST00000543245;ENST00000356839;ENST00000322910;ENST00000542255	D	0.96491	-4.03	5.52	-3.95	0.04118	.	1.299940	0.04875	N	0.446569	D	0.90007	0.6880	N	0.08118	0	0.09310	N	0.999994	B;B;B	0.23735	0.011;0.09;0.054	B;B;B	0.28709	0.014;0.093;0.043	T	0.82478	-0.0437	10	0.62326	D	0.03	.	8.2745	0.31864	0.1153:0.1959:0.6086:0.0802	.	101;78;55	G3V1M7;F5H2A9;P49748	.;.;ACADV_HUMAN	Y	78;101;55;101	ENSP00000438689:H78Y	ENSP00000325395:H55Y	H	+	1	0	ACADVL	7064531	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.644000	0.05415	-0.239000	0.09710	0.561000	0.74099	CAC	ACADVL	-	NULL	ENSG00000072778		0.592	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ACADVL	HGNC	protein_coding	OTTHUMT00000220001.5	32	0.00	0	C	NM_000018		7123807	7123807	+1	no_errors	ENST00000356839	ensembl	human	known	69_37n	missense	2	71.43	5	SNP	0.000	T
ALDH1A3	220	genome.wustl.edu	37	15	101438349	101438350	+	Frame_Shift_Ins	INS	-	-	G	rs142377552	byFrequency	TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr15:101438349_101438350insG	ENST00000329841.5	+	8	1374_1375	c.842_843insG	c.(841-846)ctggggfs	p.LG281fs	RP11-66B24.4_ENST00000560351.1_RNA|ALDH1A3_ENST00000346623.6_Frame_Shift_Ins_p.LG174fs	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3	281					embryonic eye morphogenesis (GO:0048048)|face development (GO:0060324)|inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|nucleus accumbens development (GO:0021768)|olfactory pit development (GO:0060166)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|positive regulation of apoptotic process (GO:0043065)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoic acid metabolic process (GO:0042573)|retinol metabolic process (GO:0042572)|righting reflex (GO:0060013)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|thyroid hormone binding (GO:0070324)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		Vitamin A(DB00162)	ACGCTGGAGCTGGGGGGGAAGA	0.569																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	1.2.1.5	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6		7698756	Standard	XR_111558		Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.849dupG	15.37:g.101438356_101438356dupG	ENSP00000332256:p.Leu281fs		Q6NT64	Frame_Shift_Ins	INS	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.K284fs	ENST00000329841.5	37	c.842_843	CCDS10389.1	15																																																																																			ALDH1A3	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000184254		0.569	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A3	HGNC	protein_coding	OTTHUMT00000313620.2	23	0.00	0	-			101438349	101438350	+1	no_errors	ENST00000329841	ensembl	human	known	69_37n	frame_shift_ins	19	13.64	3	INS	0.999:0.008	G
ANKRD34A	284615	genome.wustl.edu	37	1	145473724	145473724	+	Silent	SNP	C	C	T	rs144409534		TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr1:145473724C>T	ENST00000323397.4	+	4	1689	c.396C>T	c.(394-396)gaC>gaT	p.D132D	RP11-315I20.1_ENST00000600340.1_RNA	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	132						cytoplasm (GO:0005737)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CACTGCTGGACGCCTGCAAGG	0.652																																						dbGAP											0													38.0	33.0	35.0					1																	145473724		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.396C>T	1.37:g.145473724C>T			B3KSU3	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D132	ENST00000323397.4	37	c.396	CCDS30829.1	1																																																																																			ANKRD34A	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000181039		0.652	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD34A	HGNC	protein_coding	OTTHUMT00000038512.1	45	0.00	0	C			145473724	145473724	+1	no_errors	ENST00000323397	ensembl	human	known	69_37n	silent	35	12.50	5	SNP	0.307	T
BLM	641	genome.wustl.edu	37	15	91304296	91304296	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr15:91304296G>A	ENST00000355112.3	+	7	1811	c.1693G>A	c.(1693-1695)Gat>Aat	p.D565N	BLM_ENST00000560509.1_Missense_Mutation_p.D565N	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	565	Necessary for interaction with SPIDR.|Poly-Asp.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			TGATGATGATGATGACTGGGA	0.368			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																													dbGAP	yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	0													78.0	77.0	77.0					15																	91304296		2198	4298	6496	-	-	-	SO:0001583	missense	0	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.1693G>A	15.37:g.91304296G>A	ENSP00000347232:p.Asp565Asn		Q52M96	Missense_Mutation	SNP	pfam_RQC_domain,pfam_BDHCT,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/RNaseD_C,superfamily_HRDC-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_Helicase/RNaseD_C,pfscan_Helicase/RNaseD_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.D565N	ENST00000355112.3	37	c.1693	CCDS10363.1	15	.	.	.	.	.	.	.	.	.	.	G	19.54	3.847137	0.71603	.	.	ENSG00000197299	ENST00000355112;ENST00000536925	T	0.53857	0.6	5.87	4.88	0.63580	.	0.061438	0.64402	D	0.000009	T	0.51176	0.1659	L	0.32530	0.975	0.32875	D	0.509699	D;P;D	0.59767	0.986;0.651;0.961	P;B;P	0.51582	0.674;0.084;0.541	T	0.63466	-0.6631	10	0.62326	D	0.03	-1.8474	12.9688	0.58501	0.0:0.0:0.828:0.172	.	565;190;565	B2RAN0;B7ZKN7;P54132	.;.;BLM_HUMAN	N	565;218	ENSP00000347232:D565N	ENSP00000347232:D565N	D	+	1	0	BLM	89105300	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.951000	0.63610	2.767000	0.95098	0.591000	0.81541	GAT	BLM	-	NULL	ENSG00000197299		0.368	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLM	HGNC	protein_coding	OTTHUMT00000313495.1	127	0.00	0	G			91304296	91304296	+1	no_errors	ENST00000355112	ensembl	human	known	69_37n	missense	93	18.42	21	SNP	1.000	A
BLM	641	genome.wustl.edu	37	15	91304368	91304368	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr15:91304368G>T	ENST00000355112.3	+	7	1883	c.1765G>T	c.(1765-1767)Gaa>Taa	p.E589*	BLM_ENST00000560509.1_Nonsense_Mutation_p.E589*	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	589	Necessary for interaction with SPIDR.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			ACCCATCAAGGAAGGTCGGCC	0.408			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																													dbGAP	yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	0													72.0	72.0	72.0					15																	91304368		2198	4298	6496	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.1765G>T	15.37:g.91304368G>T	ENSP00000347232:p.Glu589*		Q52M96	Nonsense_Mutation	SNP	pfam_RQC_domain,pfam_BDHCT,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/RNaseD_C,superfamily_HRDC-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_Helicase/RNaseD_C,pfscan_Helicase/RNaseD_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.E589*	ENST00000355112.3	37	c.1765	CCDS10363.1	15	.	.	.	.	.	.	.	.	.	.	G	37	6.098966	0.97281	.	.	ENSG00000197299	ENST00000355112;ENST00000536925	.	.	.	5.87	4.96	0.65561	.	0.183297	0.47093	D	0.000245	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-0.4856	10.7528	0.46219	0.0869:0.0:0.9131:0.0	.	.	.	.	X	589;242	.	ENSP00000347232:E589X	E	+	1	0	BLM	89105372	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	4.891000	0.63185	1.481000	0.48307	0.591000	0.81541	GAA	BLM	-	NULL	ENSG00000197299		0.408	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLM	HGNC	protein_coding	OTTHUMT00000313495.1	115	0.00	0	G			91304368	91304368	+1	no_errors	ENST00000355112	ensembl	human	known	69_37n	nonsense	69	19.77	17	SNP	1.000	T
C7orf65	401335	genome.wustl.edu	37	7	47694923	47694923	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr7:47694923C>T	ENST00000408988.2	+	1	82	c.47C>T	c.(46-48)cCg>cTg	p.P16L		NM_001123065.1	NP_001116537.1	Q6ZTY9	CG065_HUMAN	chromosome 7 open reading frame 65	16										endometrium(1)|lung(2)	3						CGGCTCTGGCCGGGCCCCAGG	0.617																																						dbGAP											0													40.0	46.0	44.0					7																	47694923		1568	3582	5150	-	-	-	SO:0001583	missense	0				CCDS43580.1	7p12.3	2009-02-11			ENSG00000221845	ENSG00000221845			34432	protein-coding gene	gene with protein product							Standard	NM_001123065		Approved	FLJ44108	uc010kyp.1	Q6ZTY9	OTTHUMG00000155550	ENST00000408988.2:c.47C>T	7.37:g.47694923C>T	ENSP00000386198:p.Pro16Leu		A4D2F8	Missense_Mutation	SNP	NULL	p.P16L	ENST00000408988.2	37	c.47	CCDS43580.1	7	.	.	.	.	.	.	.	.	.	.	C	8.858	0.946207	0.18356	.	.	ENSG00000221845	ENST00000408988	.	.	.	1.56	1.56	0.23342	.	.	.	.	.	T	0.22205	0.0535	N	0.08118	0	0.09310	N	1	D	0.69078	0.997	P	0.52454	0.699	T	0.08659	-1.0711	8	0.87932	D	0	.	6.5515	0.22436	0.0:1.0:0.0:0.0	.	16	Q6ZTY9	CG065_HUMAN	L	16	.	ENSP00000386198:P16L	P	+	2	0	C7orf65	47661448	0.000000	0.05858	0.003000	0.11579	0.017000	0.09413	-0.956000	0.03865	1.163000	0.42636	0.655000	0.94253	CCG	C7orf65	-	NULL	ENSG00000221845		0.617	C7orf65-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	C7orf65	HGNC	protein_coding	OTTHUMT00000340616.1	14	0.00	0	C	NM_001123065		47694923	47694923	+1	no_errors	ENST00000408988	ensembl	human	putative	69_37n	missense	16	23.81	5	SNP	0.003	T
CCDC155	147872	genome.wustl.edu	37	19	49897775	49897775	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr19:49897775C>T	ENST00000447857.3	+	3	291	c.86C>T	c.(85-87)cCg>cTg	p.P29L		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	29						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						CTGGGAATGCCGGTCAGCTTG	0.612																																						dbGAP											0													83.0	89.0	87.0					19																	49897775		2121	4239	6360	-	-	-	SO:0001583	missense	0				CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.86C>T	19.37:g.49897775C>T	ENSP00000404220:p.Pro29Leu		Q96MC3	Missense_Mutation	SNP	NULL	p.P29L	ENST00000447857.3	37	c.86	CCDS46140.1	19	.	.	.	.	.	.	.	.	.	.	C	1.281	-0.610447	0.03690	.	.	ENSG00000161609	ENST00000447857	T	0.27104	1.69	4.96	-0.449	0.12226	.	0.417830	0.18315	N	0.144983	T	0.09730	0.0239	N	0.02736	-0.51	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.002	T	0.26677	-1.0096	10	0.36615	T	0.2	-6.5086	9.7479	0.40457	0.0:0.6754:0.0:0.3246	.	29;29	C9JGW3;Q8N6L0	.;CC155_HUMAN	L	29	ENSP00000404220:P29L	ENSP00000404220:P29L	P	+	2	0	CCDC155	54589587	0.000000	0.05858	0.211000	0.23655	0.019000	0.09904	-0.689000	0.05144	-0.211000	0.10124	-0.379000	0.06801	CCG	CCDC155	-	NULL	ENSG00000161609		0.612	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC155	HGNC	protein_coding	OTTHUMT00000465436.2	54	0.00	0	C	NM_144688		49897775	49897775	+1	no_errors	ENST00000447857	ensembl	human	known	69_37n	missense	78	21.21	21	SNP	0.052	T
CCND3	896	genome.wustl.edu	37	6	41908324	41908325	+	Splice_Site	INS	-	-	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr6:41908324_41908325insT	ENST00000372991.4	-	2	397		c.e2-1		CCND3_ENST00000510503.1_Splice_Site|CCND3_ENST00000415497.2_Intron|CCND3_ENST00000372987.4_Splice_Site|CCND3_ENST00000511642.1_Splice_Site|CCND3_ENST00000511686.1_Intron|CCND3_ENST00000414200.2_Intron|CCND3_ENST00000372988.4_Splice_Site	NM_001760.3	NP_001751.1	P30281	CCND3_HUMAN	cyclin D3						cell cycle (GO:0007049)|cell division (GO:0051301)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of protein phosphorylation (GO:0001934)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase binding (GO:0019901)			endometrium(2)|haematopoietic_and_lymphoid_tissue(13)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	20	Colorectal(47;0.121)		Epithelial(12;0.000178)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CCTCACATACCTGGGGGAGGGC	0.634			T	IGH@	MM																																	dbGAP		Dom	yes		6	6p21	896	cyclin D3		L	0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS4863.1, CCDS47425.1, CCDS47426.1, CCDS47427.1, CCDS75452.1	6p21	2008-08-26			ENSG00000112576	ENSG00000112576			1585	protein-coding gene	gene with protein product		123834				1386335	Standard	NM_001136125		Approved		uc003orn.3	P30281	OTTHUMG00000014690	ENST00000372991.4:c.199-1->A	6.37:g.41908325_41908325dupT			B2RD63|B3KQ22|E9PAS4|E9PB36|Q5T8J0|Q6FG62|Q96F49	Splice_Site	INS	-	e2-1	ENST00000372991.4	37	c.199-2_199-1	CCDS4863.1	6																																																																																			CCND3	-	-	ENSG00000112576		0.634	CCND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCND3	HGNC	protein_coding	OTTHUMT00000040540.2	11	0.00	0	-	NM_001760	Intron	41908324	41908325	-1	no_errors	ENST00000372991	ensembl	human	known	69_37n	splice_site_ins	4	33.33	2	INS	1.000:1.000	T
CCNG2	901	genome.wustl.edu	37	4	78081937	78081939	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	GAA	GAA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr4:78081937_78081939delGAA	ENST00000316355.5	+	4	696_698	c.340_342delGAA	c.(340-342)gaadel	p.E115del	CCNG2_ENST00000509972.1_In_Frame_Del_p.E115del|CCNG2_ENST00000502280.1_In_Frame_Del_p.E115del|CCNG2_ENST00000497512.1_3'UTR|CCNG2_ENST00000395640.1_In_Frame_Del_p.E115del|CCNG2_ENST00000354403.5_In_Frame_Del_p.E115del	NM_004354.2	NP_004345.1	Q16589	CCNG2_HUMAN	cyclin G2	115					cell cycle checkpoint (GO:0000075)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)				breast(1)|kidney(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						TAGAATAGTTGAAGAAGACTGCA	0.365																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			BC032518	CCDS3581.1	4q21.22	2009-05-07			ENSG00000138764	ENSG00000138764			1593	protein-coding gene	gene with protein product		603203				8806701	Standard	NM_004354		Approved		uc003hkq.4	Q16589	OTTHUMG00000130100	ENST00000316355.5:c.340_342delGAA	4.37:g.78081940_78081942delGAA	ENSP00000315743:p.Glu115del		B4DF25|Q6FGA7|Q6FGC6	In_Frame_Del	DEL	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.E115in_frame_del	ENST00000316355.5	37	c.340_342	CCDS3581.1	4																																																																																			CCNG2	-	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	ENSG00000138764		0.365	CCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNG2	HGNC	protein_coding	OTTHUMT00000252404.3	177	0.00	0	GAA	NM_004354		78081937	78081939	+1	no_errors	ENST00000316355	ensembl	human	known	69_37n	in_frame_del	133	21.30	36	DEL	1.000:1.000:1.000	-
CECR5	27440	genome.wustl.edu	37	22	17630576	17630576	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr22:17630576T>G	ENST00000336737.4	-	2	211	c.186A>C	c.(184-186)agA>agC	p.R62S	CECR5_ENST00000155674.5_Missense_Mutation_p.R32S|CECR5_ENST00000399852.3_Intron|CECR5_ENST00000480451.1_5'UTR	NM_033070.2	NP_149061.1	Q9BXW7	CECR5_HUMAN	cat eye syndrome chromosome region, candidate 5	62						mitochondrion (GO:0005739)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(10)|pancreas(1)|prostate(1)	21		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)				CAGGGATCACTCTGTGGCCCC	0.537																																						dbGAP											0													93.0	94.0	94.0					22																	17630576		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF273270	CCDS13741.1, CCDS33595.1	22q11.2	2008-06-12			ENSG00000069998	ENSG00000069998			1843	protein-coding gene	gene with protein product						11381032	Standard	NM_017829		Approved		uc002zmf.3	Q9BXW7	OTTHUMG00000150071	ENST00000336737.4:c.186A>C	22.37:g.17630576T>G	ENSP00000337358:p.Arg62Ser		B2RCK5|Q9BXW8|Q9NWA8|Q9NX41	Missense_Mutation	SNP	superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIA_CECR5,tigrfam_HAD-SF_hydro_IIA	p.R62S	ENST00000336737.4	37	c.186	CCDS33595.1	22	.	.	.	.	.	.	.	.	.	.	T	7.996	0.754268	0.15778	.	.	ENSG00000069998	ENST00000155674;ENST00000336737	T;T	0.29142	1.58;1.58	4.9	-5.76	0.02376	HAD-like domain (2);	0.450530	0.23985	N	0.042631	T	0.13200	0.0320	N	0.25647	0.755	0.36798	D	0.885194	B;B	0.15473	0.002;0.013	B;B	0.22152	0.007;0.038	T	0.19910	-1.0291	10	0.18276	T	0.48	-2.0984	3.5469	0.07832	0.0988:0.3595:0.3017:0.24	.	32;62	Q9BXW7-2;Q9BXW7	.;CECR5_HUMAN	S	32;62	ENSP00000155674:R32S;ENSP00000337358:R62S	ENSP00000155674:R32S	R	-	3	2	CECR5	16010576	0.000000	0.05858	0.028000	0.17463	0.929000	0.56500	-2.176000	0.01262	-1.615000	0.01573	-0.466000	0.05196	AGA	CECR5	-	superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIA_CECR5,tigrfam_HAD-SF_hydro_IIA	ENSG00000069998		0.537	CECR5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CECR5	HGNC	protein_coding	OTTHUMT00000316100.1	72	0.00	0	T	NM_017829		17630576	17630576	-1	no_errors	ENST00000336737	ensembl	human	known	69_37n	missense	41	33.87	21	SNP	0.012	G
CST3	1471	genome.wustl.edu	37	20	23614578	23614578	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr20:23614578G>A	ENST00000398411.1	-	3	498	c.416C>T	c.(415-417)tCg>tTg	p.S139L	CST3_ENST00000398409.1_Missense_Mutation_p.S139L|RP11-218C14.8_ENST00000602977.1_lincRNA|CST3_ENST00000376925.3_Missense_Mutation_p.S139L			P01034	CYTC_HUMAN	cystatin C	139					apoptotic process (GO:0006915)|brain development (GO:0007420)|cell activation (GO:0001775)|cellular response to hydrogen peroxide (GO:0070301)|circadian sleep/wake cycle, REM sleep (GO:0042747)|defense response (GO:0006952)|embryo implantation (GO:0007566)|extracellular fibril organization (GO:0043206)|eye development (GO:0001654)|negative regulation of blood vessel remodeling (GO:0060313)|negative regulation of cell death (GO:0060548)|negative regulation of collagen catabolic process (GO:0010711)|negative regulation of elastin catabolic process (GO:0060311)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extracellular matrix disassembly (GO:0010716)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|regulation of programmed cell death (GO:0043067)|regulation of tissue remodeling (GO:0034103)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient levels (GO:0031667)|response to toxic substance (GO:0009636)|salivary gland development (GO:0007431)|Sertoli cell development (GO:0060009)	basement membrane (GO:0005604)|cell projection (GO:0042995)|contractile fiber (GO:0043292)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|protease binding (GO:0002020)			large_intestine(2)|lung(1)|ovary(1)	4	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)					GGTGGATTTCGACAAGGTCAT	0.552																																						dbGAP											0													158.0	123.0	135.0					20																	23614578		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13158.1	20p11.2	2008-04-15	2008-04-15		ENSG00000101439	ENSG00000101439			2475	protein-coding gene	gene with protein product		604312	"""cystatin C (amyloid angiopathy and cerebral hemorrhage)"""			8486384	Standard	NM_000099		Approved		uc002wtn.1	P01034	OTTHUMG00000032080	ENST00000398411.1:c.416C>T	20.37:g.23614578G>A	ENSP00000381448:p.Ser139Leu		B2R5J9|D3DW42|Q6FGW9	Missense_Mutation	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.S139L	ENST00000398411.1	37	c.416	CCDS13158.1	20	.	.	.	.	.	.	.	.	.	.	G	3.654	-0.070890	0.07228	.	.	ENSG00000101439	ENST00000398411;ENST00000376925;ENST00000398409	T;T;T	0.11169	2.8;2.8;2.8	2.97	-2.48	0.06423	Proteinase inhibitor I25, cystatin (1);	1.254880	0.05743	N	0.601680	T	0.02342	0.0072	N	0.00355	-1.605	0.09310	N	1	B	0.14012	0.009	B	0.06405	0.002	T	0.44436	-0.9328	10	0.08599	T	0.76	.	8.1278	0.31010	0.342:0.0:0.658:0.0	.	139	P01034	CYTC_HUMAN	L	139	ENSP00000381448:S139L;ENSP00000366124:S139L;ENSP00000381446:S139L	ENSP00000366124:S139L	S	-	2	0	CST3	23562578	0.005000	0.15991	0.000000	0.03702	0.013000	0.08279	0.414000	0.21164	-0.587000	0.05890	0.484000	0.47621	TCG	CST3	-	smart_Prot_inh_cystat	ENSG00000101439		0.552	CST3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CST3	HGNC	protein_coding	OTTHUMT00000256831.1	63	0.00	0	G	NM_000099		23614578	23614578	-1	no_errors	ENST00000376925	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	0.000	A
CTR9	9646	genome.wustl.edu	37	11	10791787	10791787	+	Missense_Mutation	SNP	C	C	G	rs200624749		TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr11:10791787C>G	ENST00000361367.2	+	17	2566	c.2140C>G	c.(2140-2142)Cac>Gac	p.H714D		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	714					cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		GTTCTATAAGCACCAAAACAC	0.358																																						dbGAP											0													90.0	89.0	89.0					11																	10791787		2201	4294	6495	-	-	-	SO:0001583	missense	0			D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.2140C>G	11.37:g.10791787C>G	ENSP00000355013:p.His714Asp		D3DQV8|Q15015	Missense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.H714D	ENST00000361367.2	37	c.2140	CCDS7805.1	11	.	.	.	.	.	.	.	.	.	.	C	15.37	2.813258	0.50527	.	.	ENSG00000198730	ENST00000361367	T	0.72942	-0.7	6.02	6.02	0.97574	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.047561	0.85682	D	0.000000	T	0.72145	0.3424	M	0.77820	2.39	0.58432	D	0.999995	B	0.14438	0.01	B	0.08055	0.003	T	0.68135	-0.5489	10	0.12103	T	0.63	-24.2116	20.5407	0.99260	0.0:1.0:0.0:0.0	.	714	Q6PD62	CTR9_HUMAN	D	714	ENSP00000355013:H714D	ENSP00000355013:H714D	H	+	1	0	CTR9	10748363	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.962000	0.56766	2.865000	0.98341	0.655000	0.94253	CAC	CTR9	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000198730		0.358	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTR9	HGNC	protein_coding	OTTHUMT00000386215.1	125	0.00	0	C	NM_014633		10791787	10791787	+1	no_errors	ENST00000361367	ensembl	human	known	69_37n	missense	38	66.07	74	SNP	1.000	G
DNAH5	1767	genome.wustl.edu	37	5	13719037	13719037	+	Silent	SNP	G	G	A			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr5:13719037G>A	ENST00000265104.4	-	72	12557	c.12453C>T	c.(12451-12453)aaC>aaT	p.N4151N		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4151	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GTGGAGGATCGTTGGCAAATT	0.448									Kartagener syndrome																													dbGAP											0													131.0	130.0	130.0					5																	13719037		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.12453C>T	5.37:g.13719037G>A			Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.N4151	ENST00000265104.4	37	c.12453	CCDS3882.1	5																																																																																			DNAH5	-	pfam_Dynein_heavy	ENSG00000039139		0.448	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	182	0.00	0	G	NM_001369		13719037	13719037	-1	no_errors	ENST00000265104	ensembl	human	known	69_37n	silent	117	18.75	27	SNP	0.905	A
DNAH6	1768	genome.wustl.edu	37	2	84800662	84800662	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr2:84800662delC	ENST00000237449.6	+	11	1883	c.1875delC	c.(1873-1875)ttcfs	p.F625fs	DNAH6_ENST00000398278.2_Frame_Shift_Del_p.F625fs|DNAH6_ENST00000389394.3_Frame_Shift_Del_p.F625fs			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	625	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AGATATTCTTCAAGGAAAATG	0.343																																						dbGAP											0													92.0	101.0	98.0					2																	84800662		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.1875delC	2.37:g.84800662delC	ENSP00000237449:p.Phe625fs		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Frame_Shift_Del	DEL	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.F625fs	ENST00000237449.6	37	c.1875	CCDS46348.1	2																																																																																			DNAH6	-	NULL	ENSG00000115423		0.343	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	247	0.00	0	C	NM_001370		84800662	84800662	+1	no_errors	ENST00000237449	ensembl	human	known	69_37n	frame_shift_del	67	50.96	80	DEL	0.997	-
DYNC2H1	79659	genome.wustl.edu	37	11	103126208	103126208	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr11:103126208delA	ENST00000375735.2	+	67	10415	c.10271delA	c.(10270-10272)caafs	p.Q3425fs	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Frame_Shift_Del_p.Q3432fs	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3425	AAA 5. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AAACTATTACAACAGGAAGAA	0.323																																						dbGAP											0													57.0	48.0	51.0					11																	103126208		1801	4059	5860	-	-	-	SO:0001589	frameshift_variant	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10271delA	11.37:g.103126208delA	ENSP00000364887:p.Gln3425fs		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Frame_Shift_Del	DEL	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.Q3431fs	ENST00000375735.2	37	c.10292	CCDS53701.1	11																																																																																			DYNC2H1	-	NULL	ENSG00000187240		0.323	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	30	0.00	0	A	XM_370652		103126208	103126208	+1	no_errors	ENST00000398093	ensembl	human	known	69_37n	frame_shift_del	7	22.22	2	DEL	1.000	-
FAIM2	23017	genome.wustl.edu	37	12	50291851	50291851	+	Silent	SNP	G	G	A	rs544605160		TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr12:50291851G>A	ENST00000320634.3	-	3	328	c.234C>T	c.(232-234)aaC>aaT	p.N78N	FAIM2_ENST00000550890.1_Silent_p.N32N	NM_012306.3	NP_036438.2	Q9BWQ8	LFG2_HUMAN	Fas apoptotic inhibitory molecule 2	78					apoptotic process (GO:0006915)|cerebellar granular layer development (GO:0021681)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum development (GO:0021549)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of neuron apoptotic process (GO:0043523)|response to ischemia (GO:0002931)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|postsynaptic membrane (GO:0045211)				endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|skin(2)	14						TGGGGAAACCGTTGTCATAGC	0.542													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17267	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													113.0	92.0	99.0					12																	50291851		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023167	CCDS8791.1	12q13	2010-03-18				ENSG00000135472			17067	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 2"""	604306				10231032, 10535980	Standard	NM_012306		Approved	KIAA0950, LFG, NMP35, LIFEGUARD, TMBIM2, LFG2	uc001rvj.2	Q9BWQ8	OTTHUMG00000169808	ENST00000320634.3:c.234C>T	12.37:g.50291851G>A			A8K1W6|B3KR08|Q9UJY9|Q9Y2F7	Silent	SNP	pfam_Bax_inhibitor_1-related	p.N78	ENST00000320634.3	37	c.234	CCDS8791.1	12																																																																																			FAIM2	-	NULL	ENSG00000135472		0.542	FAIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAIM2	HGNC	protein_coding	OTTHUMT00000405984.1	52	0.00	0	G	NM_012306		50291851	50291851	-1	no_errors	ENST00000320634	ensembl	human	known	69_37n	silent	33	21.43	9	SNP	0.000	A
FAM58A	92002	genome.wustl.edu	37	X	152860004	152860004	+	Splice_Site	SNP	C	C	A			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chrX:152860004C>A	ENST00000370175.4	-	3	539		c.e3+1		FAM58A_ENST00000406277.2_Splice_Site			Q8N1B3	FA58A_HUMAN	family with sequence similarity 58, member A						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)					endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCAGTATGTACCTTGTGTGGA	0.542																																						dbGAP											0													101.0	92.0	95.0					X																	152860004		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC032121	CCDS76054.1	Xq28	2014-08-12	2012-11-30	2012-11-30	ENSG00000147382	ENSG00000262919			28434	protein-coding gene	gene with protein product	"""cyclin M"""	300708				18297069, 24218572	Standard	NM_152274		Approved	MGC29729, FLJ21610	uc011myr.2	Q8N1B3	OTTHUMG00000024206	ENST00000370175.4:c.764+1G>T	X.37:g.152860004C>A			Q2I380|Q330J9|Q96IU5|Q9BUU1	Splice_Site	SNP	-	e5+1	ENST00000370175.4	37	c.423+1		X	.	.	.	.	.	.	.	.	.	.	C	15.14	2.743691	0.49151	.	.	ENSG00000147382	ENST00000370175;ENST00000406277;ENST00000370171;ENST00000276345;ENST00000370173;ENST00000429336;ENST00000440428	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9834	0.80130	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAM58A	152513198	1.000000	0.71417	0.995000	0.50966	0.444000	0.32077	7.158000	0.77470	2.108000	0.64289	0.529000	0.55759	.	FAM58A	-	-	ENSG00000147382		0.542	FAM58A-006	KNOWN	sequence_error|basic	processed_transcript	FAM58A	HGNC	protein_coding	OTTHUMT00000060992.2	70	0.00	0	C	NM_152274	Intron	152860004	152860004	-1	no_errors	ENST00000406277	ensembl	human	known	69_37n	splice_site	26	16.13	5	SNP	1.000	A
FGD5	152273	genome.wustl.edu	37	3	14862541	14862541	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr3:14862541C>T	ENST00000285046.5	+	1	2073	c.1963C>T	c.(1963-1965)Cgc>Tgc	p.R655C	FGD5_ENST00000543601.1_Missense_Mutation_p.R414C	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	655					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						ATCCTTTAAGCGCTTCCTGGC	0.512																																						dbGAP											0													86.0	85.0	85.0					3																	14862541		1982	4156	6138	-	-	-	SO:0001583	missense	0			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.1963C>T	3.37:g.14862541C>T	ENSP00000285046:p.Arg655Cys		B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.R655C	ENST00000285046.5	37	c.1963	CCDS46767.1	3	.	.	.	.	.	.	.	.	.	.	C	11.71	1.718890	0.30503	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.81415	-1.49;-1.34	5.32	2.17	0.27698	.	0.236947	0.29192	N	0.012878	D	0.86686	0.5992	M	0.71581	2.175	0.49582	D	0.999806	D;D	0.89917	0.999;1.0	P;D	0.63192	0.88;0.912	D	0.87575	0.2480	10	0.87932	D	0	-19.6191	13.5805	0.61901	0.5308:0.4692:0.0:0.0	.	414;655	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	C	655;414	ENSP00000285046:R655C;ENSP00000445949:R414C	ENSP00000285046:R655C	R	+	1	0	FGD5	14837545	1.000000	0.71417	0.704000	0.30370	0.019000	0.09904	3.738000	0.55067	0.597000	0.29811	-0.169000	0.13324	CGC	FGD5	-	NULL	ENSG00000154783		0.512	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD5	HGNC	protein_coding	OTTHUMT00000340628.1	76	0.00	0	C	NM_152536		14862541	14862541	+1	no_errors	ENST00000285046	ensembl	human	known	69_37n	missense	117	34.08	61	SNP	0.977	T
FLT3	2322	genome.wustl.edu	37	13	28588649	28588649	+	Silent	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr13:28588649C>T	ENST00000241453.7	-	23	2880	c.2799G>A	c.(2797-2799)cgG>cgA	p.R933R	FLT3_ENST00000469894.1_5'UTR|FLT3_ENST00000380982.4_Silent_p.R936R|FLT3_ENST00000537084.1_Silent_p.R892R	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	933	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGAAGGATGGCCGTTTCCTTG	0.403			"""Mis, O"""		"""AML, ALL"""																																	dbGAP		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	0													94.0	88.0	90.0					13																	28588649		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.2799G>A	13.37:g.28588649C>T			A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.R936	ENST00000241453.7	37	c.2808	CCDS31953.1	13																																																																																			FLT3	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000122025		0.403	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLT3	HGNC	protein_coding	OTTHUMT00000044319.2	58	0.00	0	C			28588649	28588649	-1	no_errors	ENST00000380982	ensembl	human	known	69_37n	silent	55	14.06	9	SNP	0.805	T
GPATCH1	55094	genome.wustl.edu	37	19	33587282	33587282	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr19:33587282G>C	ENST00000170564.2	+	7	1096	c.782G>C	c.(781-783)gGt>gCt	p.G261A		NM_018025.2	NP_060495.2	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	261					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|prostate(4)|skin(4)	40	Esophageal squamous(110;0.137)					TTCAGTGGTGGTTCTGAGAGA	0.418																																					Pancreas(67;88 1713 4567 18227)	dbGAP											0													91.0	93.0	93.0					19																	33587282		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF434677	CCDS12428.1	19q13.12	2013-01-28		2006-12-13		ENSG00000076650		"""G patch domain containing"""	24658	protein-coding gene	gene with protein product	"""evolutionarily conserved G patch domain containing"""			GPATC1		12477932	Standard	NM_018025		Approved	ECGP, FLJ10206, FLJ38686	uc002nug.1	Q9BRR8		ENST00000170564.2:c.782G>C	19.37:g.33587282G>C	ENSP00000170564:p.Gly261Ala		Q8IZV6|Q8N3B7|Q9NW94	Missense_Mutation	SNP	pfam_DUF1604,pfam_G_patch_dom,superfamily_C-type_lectin_fold,pfscan_G_patch_dom	p.G261A	ENST00000170564.2	37	c.782	CCDS12428.1	19	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.072041	0.00379	.	.	ENSG00000076650	ENST00000170564	T	0.12147	2.71	5.32	-2.02	0.07388	.	0.583174	0.18532	N	0.138470	T	0.04952	0.0133	N	0.16478	0.41	0.09310	N	0.999994	B	0.14012	0.009	B	0.09377	0.004	T	0.40059	-0.9583	10	0.08599	T	0.76	-3.5546	3.4697	0.07562	0.1347:0.1948:0.4616:0.2089	.	261	Q9BRR8	GPTC1_HUMAN	A	261	ENSP00000170564:G261A	ENSP00000170564:G261A	G	+	2	0	GPATCH1	38279122	0.163000	0.22920	0.001000	0.08648	0.004000	0.04260	1.321000	0.33678	-0.037000	0.13646	-0.886000	0.02939	GGT	GPATCH1	-	NULL	ENSG00000076650		0.418	GPATCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH1	HGNC	protein_coding	OTTHUMT00000450834.1	103	0.00	0	G	NM_018025		33587282	33587282	+1	no_errors	ENST00000170564	ensembl	human	known	69_37n	missense	168	22.94	50	SNP	0.000	C
GPR97	222487	genome.wustl.edu	37	16	57717983	57717984	+	Frame_Shift_Ins	INS	-	-	G	rs148644149		TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr16:57717983_57717984insG	ENST00000333493.4	+	9	1182_1183	c.1021_1022insG	c.(1021-1023)cggfs	p.R341fs	RP11-405F3.4_ENST00000563062.1_RNA|GPR97_ENST00000450388.3_Frame_Shift_Ins_p.R221fs|GPR97_ENST00000327655.6_Frame_Shift_Ins_p.R131fs	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	341					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CTGCTGGGCCCGGGGGGCTGTC	0.604																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.1027dupG	16.37:g.57717989_57717989dupG	ENSP00000332900:p.Arg341fs		Q6ZMF4|Q86SL9|Q8IZF1	Frame_Shift_Ins	INS	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_orphan_rcpt_GPR56	p.A343fs	ENST00000333493.4	37	c.1021_1022	CCDS10786.1	16																																																																																			GPR97	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000182885		0.604	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR97	HGNC	protein_coding	OTTHUMT00000257333.2	46	0.00	0	-	NM_170776		57717983	57717984	+1	no_errors	ENST00000333493	ensembl	human	known	69_37n	frame_shift_ins	34	10.53	4	INS	0.000:0.000	G
GTSE1	51512	genome.wustl.edu	37	22	46712099	46712099	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr22:46712099G>C	ENST00000454366.1	+	7	1434	c.1222G>C	c.(1222-1224)Gag>Cag	p.E408Q		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	389					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		GCTGGCAGCGGAGCAGCTCAC	0.662																																					GBM(153;542 1915 12487 29016 50495)	dbGAP											0													29.0	34.0	33.0					22																	46712099		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.1222G>C	22.37:g.46712099G>C	ENSP00000415430:p.Glu408Gln		B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Missense_Mutation	SNP	NULL	p.E408Q	ENST00000454366.1	37	c.1222	CCDS14074.2	22	.	.	.	.	.	.	.	.	.	.	G	14.20	2.464921	0.43839	.	.	ENSG00000075218	ENST00000454366;ENST00000361934	T	0.08102	3.13	5.03	2.91	0.33838	.	1.648510	0.02982	N	0.145769	T	0.13927	0.0337	N	0.08118	0	0.09310	N	1	P;D	0.71674	0.612;0.998	B;D	0.69142	0.256;0.962	T	0.45338	-0.9268	10	0.44086	T	0.13	-14.1425	9.4119	0.38496	0.0801:0.145:0.775:0.0	.	389;368	Q9NYZ3;B4DZT6	GTSE1_HUMAN;.	Q	408;368	ENSP00000415430:E408Q	ENSP00000354634:E368Q	E	+	1	0	GTSE1	45090763	0.003000	0.15002	0.004000	0.12327	0.005000	0.04900	1.398000	0.34554	0.617000	0.30160	0.650000	0.86243	GAG	GTSE1	-	NULL	ENSG00000075218		0.662	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTSE1	HGNC	protein_coding	OTTHUMT00000318360.2	43	0.00	0	G	NM_016426		46712099	46712099	+1	no_errors	ENST00000454366	ensembl	human	known	69_37n	missense	59	27.16	22	SNP	0.004	C
GTSE1	51512	genome.wustl.edu	37	22	46712226	46712226	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr22:46712226G>A	ENST00000454366.1	+	7	1561	c.1349G>A	c.(1348-1350)aGa>aAa	p.R450K		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	431					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		AGAAGTATCAGACGGCGAGAT	0.438																																					GBM(153;542 1915 12487 29016 50495)	dbGAP											0													82.0	96.0	91.0					22																	46712226		2195	4297	6492	-	-	-	SO:0001583	missense	0			AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.1349G>A	22.37:g.46712226G>A	ENSP00000415430:p.Arg450Lys		B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Missense_Mutation	SNP	NULL	p.R450K	ENST00000454366.1	37	c.1349	CCDS14074.2	22	.	.	.	.	.	.	.	.	.	.	G	11.51	1.660777	0.29515	.	.	ENSG00000075218	ENST00000454366;ENST00000361934	T	0.06218	3.33	4.58	1.34	0.21922	.	0.610260	0.17061	N	0.188553	T	0.04543	0.0124	L	0.50333	1.59	0.09310	N	1	B;B	0.31459	0.093;0.324	B;B	0.31686	0.026;0.134	T	0.38373	-0.9664	10	0.02654	T	1	-8.5205	3.5473	0.07834	0.3756:0.0:0.454:0.1704	.	431;410	Q9NYZ3;B4DZT6	GTSE1_HUMAN;.	K	450;410	ENSP00000415430:R450K	ENSP00000354634:R410K	R	+	2	0	GTSE1	45090890	0.000000	0.05858	0.000000	0.03702	0.880000	0.50808	0.135000	0.15952	0.255000	0.21593	0.650000	0.86243	AGA	GTSE1	-	NULL	ENSG00000075218		0.438	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTSE1	HGNC	protein_coding	OTTHUMT00000318360.2	83	0.00	0	G	NM_016426		46712226	46712226	+1	no_errors	ENST00000454366	ensembl	human	known	69_37n	missense	103	28.47	41	SNP	0.000	A
GYG2	8908	genome.wustl.edu	37	X	2773101	2773101	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chrX:2773101C>T	ENST00000381163.3	+	6	767	c.485C>T	c.(484-486)cCg>cTg	p.P162L	GYG2_ENST00000398806.3_Missense_Mutation_p.P131L|GYG2-AS1_ENST00000445107.1_RNA|GYG2_ENST00000338623.5_Missense_Mutation_p.P162L|GYG2_ENST00000542787.1_Missense_Mutation_p.P162L|GYG2_ENST00000381161.1_3'UTR	NM_001079855.1|NM_001184702.1|NM_003918.2	NP_001073324.1|NP_001171631.1|NP_003909.2	O15488	GLYG2_HUMAN	glycogenin 2	162					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	glycogenin glucosyltransferase activity (GO:0008466)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CCCGGATGGCCGGATTGCTTC	0.567																																						dbGAP											0													108.0	91.0	97.0					X																	2773101		2203	4299	6502	-	-	-	SO:0001583	missense	0			U94361	CCDS14121.1, CCDS48074.1	Xp22.3	2013-02-22			ENSG00000056998	ENSG00000056998	2.4.1.186	"""Glycosyltransferase family 8 domain containing"""	4700	protein-coding gene	gene with protein product	"""glycogenin glucosyltransferase"""	300198				9857012	Standard	NM_001079855		Approved	GN-2	uc004cqs.1	O15488	OTTHUMG00000021079	ENST00000381163.3:c.485C>T	X.37:g.2773101C>T	ENSP00000370555:p.Pro162Leu		B7WNN6|O15485|O15486|O15487|O15489|O15490	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.P162L	ENST00000381163.3	37	c.485	CCDS14121.1	X	.	.	.	.	.	.	.	.	.	.	C	16.18	3.051529	0.55218	.	.	ENSG00000056998	ENST00000398806;ENST00000381163;ENST00000338623;ENST00000542787;ENST00000520904	T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85	3.47	3.47	0.39725	.	0.093937	0.45867	D	0.000334	T	0.76828	0.4042	H	0.95365	3.66	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.85132	0.0975	10	0.87932	D	0	.	14.664	0.68893	0.0:1.0:0.0:0.0	.	162;122;131;131;162	O15488-4;O15488-3;A8K8Y1;O15488-2;O15488	.;.;.;.;GLYG2_HUMAN	L	131;162;162;162;131	ENSP00000381786:P131L;ENSP00000370555:P162L;ENSP00000341273:P162L;ENSP00000446092:P162L;ENSP00000430764:P131L	ENSP00000341273:P162L	P	+	2	0	GYG2	2783101	1.000000	0.71417	0.157000	0.22605	0.110000	0.19582	6.126000	0.71635	1.519000	0.48950	0.600000	0.82982	CCG	GYG2	-	pfam_Glyco_trans_8	ENSG00000056998		0.567	GYG2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GYG2	HGNC	protein_coding	OTTHUMT00000055645.1	96	0.00	0	C	NM_003918		2773101	2773101	+1	no_errors	ENST00000381163	ensembl	human	known	69_37n	missense	48	17.24	10	SNP	0.998	T
HAO1	54363	genome.wustl.edu	37	20	7915232	7915232	+	Missense_Mutation	SNP	G	G	A	rs574704055		TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr20:7915232G>A	ENST00000378789.3	-	2	239	c.188C>T	c.(187-189)tCg>tTg	p.S63L		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	63	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						AACAGAAGTCGACAGATCTGT	0.453																																						dbGAP											0													72.0	64.0	67.0					20																	7915232		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.188C>T	20.37:g.7915232G>A	ENSP00000368066:p.Ser63Leu		Q14CQ0|Q9UPZ0|Q9Y3I7	Missense_Mutation	SNP	pfam_FMN-dep_DH,pfam_Glu_synth_centr_C,pirsf_Alpha-hydoxy_acid_DH_FMN	p.S63L	ENST00000378789.3	37	c.188	CCDS13100.1	20	.	.	.	.	.	.	.	.	.	.	G	34	5.358162	0.95854	.	.	ENSG00000101323	ENST00000378789	T	0.36699	1.24	5.87	5.87	0.94306	Aldolase-type TIM barrel (1);FMN-dependent dehydrogenase (1);	0.055892	0.85682	D	0.000000	T	0.71039	0.3293	H	0.95712	3.71	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.63283	0.913;0.913	T	0.79699	-0.1694	10	0.72032	D	0.01	-4.8538	18.9672	0.92701	0.0:0.0:1.0:0.0	.	63;63	A8K058;Q9UJM8	.;HAOX1_HUMAN	L	63	ENSP00000368066:S63L	ENSP00000368066:S63L	S	-	2	0	HAO1	7863232	1.000000	0.71417	0.997000	0.53966	0.926000	0.56050	8.282000	0.89907	2.780000	0.95670	0.655000	0.94253	TCG	HAO1	-	pfam_FMN-dep_DH,pirsf_Alpha-hydoxy_acid_DH_FMN	ENSG00000101323		0.453	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAO1	HGNC	protein_coding	OTTHUMT00000077926.2	181	0.00	0	G			7915232	7915232	-1	no_errors	ENST00000378789	ensembl	human	known	69_37n	missense	95	19.49	23	SNP	1.000	A
KDM4A	9682	genome.wustl.edu	37	1	44133570	44133570	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr1:44133570C>T	ENST00000372396.3	+	9	1177	c.1043C>T	c.(1042-1044)cCa>cTa	p.P348L		NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A	348					cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						CTGCCCACGCCAGAAGCAGCT	0.512																																						dbGAP											0													108.0	103.0	105.0					1																	44133570		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.1043C>T	1.37:g.44133570C>T	ENSP00000361473:p.Pro348Leu		Q5VVB1	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.P348L	ENST00000372396.3	37	c.1043	CCDS491.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.493426	0.96339	.	.	ENSG00000066135	ENST00000372396	T	0.15952	2.38	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.46464	0.1394	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.37267	-0.9713	10	0.51188	T	0.08	-5.7754	19.5966	0.95541	0.0:1.0:0.0:0.0	.	348;348	B4DT38;O75164	.;KDM4A_HUMAN	L	348	ENSP00000361473:P348L	ENSP00000361473:P348L	P	+	2	0	KDM4A	43906157	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	7.818000	0.86416	2.622000	0.88805	0.561000	0.74099	CCA	KDM4A	-	NULL	ENSG00000066135		0.512	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4A	HGNC	protein_coding	OTTHUMT00000019960.1	155	0.00	0	C	NM_014663		44133570	44133570	+1	no_errors	ENST00000372396	ensembl	human	known	69_37n	missense	105	26.06	37	SNP	1.000	T
LARP4B	23185	genome.wustl.edu	37	10	876875	876875	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr10:876875delT	ENST00000316157.3	-	8	833	c.793delA	c.(793-795)atafs	p.I265fs		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	265	RRM.				positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						TCACAGTTTATAAATTTTGGT	0.313																																						dbGAP											0													91.0	101.0	98.0					10																	876875		2201	4297	6498	-	-	-	SO:0001589	frameshift_variant	0			D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.793delA	10.37:g.876875delT	ENSP00000326128:p.Ile265fs		A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Frame_Shift_Del	DEL	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd	p.I265fs	ENST00000316157.3	37	c.793	CCDS31131.1	10																																																																																			LARP4B	-	NULL	ENSG00000107929		0.313	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP4B	HGNC	protein_coding	OTTHUMT00000046395.2	113	0.00	0	T	NM_015155		876875	876875	-1	no_errors	ENST00000316157	ensembl	human	known	69_37n	frame_shift_del	75	33.33	41	DEL	0.998	-
LARP4B	23185	genome.wustl.edu	37	10	876876	876876	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr10:876876A>C	ENST00000316157.3	-	8	832	c.792T>G	c.(790-792)ttT>ttG	p.F264L		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	264	RRM.				positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						CACAGTTTATAAATTTTGGTA	0.313																																						dbGAP											0													90.0	99.0	96.0					10																	876876		2201	4297	6498	-	-	-	SO:0001583	missense	0			D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.792T>G	10.37:g.876876A>C	ENSP00000326128:p.Phe264Leu		A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd	p.F264L	ENST00000316157.3	37	c.792	CCDS31131.1	10	.	.	.	.	.	.	.	.	.	.	A	14.79	2.640867	0.47153	.	.	ENSG00000107929	ENST00000316157	T	0.32515	1.45	4.94	-1.47	0.08772	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.35711	0.0941	L	0.27053	0.805	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.02553	-1.1142	10	0.35671	T	0.21	-11.0352	11.957	0.52986	0.519:0.0:0.481:0.0	.	264	Q92615	LAR4B_HUMAN	L	264	ENSP00000326128:F264L	ENSP00000326128:F264L	F	-	3	2	LARP4B	866876	0.989000	0.36119	0.996000	0.52242	0.977000	0.68977	0.487000	0.22356	-0.204000	0.10235	0.460000	0.39030	TTT	LARP4B	-	NULL	ENSG00000107929		0.313	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP4B	HGNC	protein_coding	OTTHUMT00000046395.2	114	0.00	0	A	NM_015155		876876	876876	-1	no_errors	ENST00000316157	ensembl	human	known	69_37n	missense	78	35.00	42	SNP	0.979	C
MAST4	375449	genome.wustl.edu	37	5	66461473	66461473	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr5:66461473A>C	ENST00000403625.2	+	29	6761	c.6466A>C	c.(6466-6468)Agc>Cgc	p.S2156R	MAST4_ENST00000403666.1_Missense_Mutation_p.S1967R|MAST4_ENST00000261569.7_Missense_Mutation_p.S1962R|MAST4_ENST00000405643.1_Missense_Mutation_p.S1977R|MAST4_ENST00000404260.3_Missense_Mutation_p.S2159R	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	2159	Pro-rich.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CAGTTCCCCAAGCCACGCTTC	0.662																																						dbGAP											0													17.0	22.0	20.0					5																	66461473		2008	4159	6167	-	-	-	SO:0001583	missense	0			AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.6466A>C	5.37:g.66461473A>C	ENSP00000385727:p.Ser2156Arg		A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.S2159R	ENST00000403625.2	37	c.6475	CCDS54861.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.51|13.51	2.259226|2.259226	0.39995|0.39995	.|.	.|.	ENSG00000069020|ENSG00000069020	ENST00000443808|ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569	.|T;T;T;T;T	.|0.65732	.|-0.15;-0.15;-0.17;-0.17;-0.15	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.584073	.|0.17682	.|N	.|0.165582	T|T	0.48714|0.48714	0.1515|0.1515	L|L	0.32530|0.32530	0.975|0.975	0.09310|0.09310	N|N	1|1	.|P;P	.|0.45474	.|0.779;0.859	.|B;B	.|0.40009	.|0.168;0.316	T|T	0.52275|0.52275	-0.8597|-0.8597	5|10	.|0.66056	.|D	.|0.02	-10.5808|-10.5808	6.847|6.847	0.23994|0.23994	0.8703:0.0:0.1297:0.0|0.8703:0.0:0.1297:0.0	.|.	.|2159;1967	.|O15021;O15021-3	.|MAST4_HUMAN;.	T|R	1212|2159;2156;1967;1977;1977;1962	.|ENSP00000385048:S2159R;ENSP00000385727:S2156R;ENSP00000384313:S1967R;ENSP00000384099:S1977R;ENSP00000261569:S1962R	.|ENSP00000261569:S1962R	K|S	+|+	2|1	0|0	MAST4|MAST4	66497229|66497229	0.003000|0.003000	0.15002|0.15002	0.203000|0.203000	0.23512|0.23512	0.023000|0.023000	0.10783|0.10783	0.908000|0.908000	0.28545|0.28545	2.109000|2.109000	0.64355|0.64355	0.533000|0.533000	0.62120|0.62120	AAG|AGC	MAST4	-	NULL	ENSG00000069020		0.662	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	MAST4	HGNC	protein_coding	OTTHUMT00000326324.2	17	0.00	0	A			66461473	66461473	+1	no_errors	ENST00000404260	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	0.005	C
MEIS1	4211	genome.wustl.edu	37	2	66798466	66798467	+	3'UTR	INS	-	-	C	rs200212828		TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr2:66798466_66798467insC	ENST00000272369.9	+	0	1756_1757				MEIS1_ENST00000444274.2_3'UTR|MEIS1_ENST00000488550.1_3'UTR|MEIS1_ENST00000495021.2_3'UTR|MEIS1_ENST00000407092.2_Frame_Shift_Ins_p.P402fs|MEIS1_ENST00000398506.2_Frame_Shift_Ins_p.P400fs|AC007392.3_ENST00000433396.1_lincRNA	NM_002398.2	NP_002389.1	O00470	MEIS1_HUMAN	Meis homeobox 1						angiogenesis (GO:0001525)|definitive hemopoiesis (GO:0060216)|lens morphogenesis in camera-type eye (GO:0002089)|megakaryocyte development (GO:0035855)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron differentiation (GO:0045665)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	24						AACCCCAGATGCCCCCCCATCC	0.574																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS46309.1	2p14	2011-06-20	2007-02-15		ENSG00000143995	ENSG00000143995		"""Homeoboxes / TALE class"""	7000	protein-coding gene	gene with protein product		601739	"""Meis1 (mouse) homolog"", ""Meis1, myeloid ecotropic viral integration site 1 homolog (mouse)"""			7565694	Standard	NM_002398		Approved		uc002sdu.3	O00470	OTTHUMG00000150714	ENST00000272369.9:c.*127->C	2.37:g.66798473_66798473dupC			A8MV50	Frame_Shift_Ins	INS	pfam_Homeodomain,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.H403fs	ENST00000272369.9	37	c.1203_1204	CCDS46309.1	2																																																																																			MEIS1	-	NULL	ENSG00000143995		0.574	MEIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEIS1	HGNC	protein_coding	OTTHUMT00000319725.4	34	0.00	0	-	NM_002398		66798466	66798467	+1	no_errors	ENST00000407092	ensembl	human	known	69_37n	frame_shift_ins	17	10.53	2	INS	1.000:1.000	C
MFSD4	148808	genome.wustl.edu	37	1	205568262	205568262	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr1:205568262T>C	ENST00000367147.4	+	9	1465	c.1372T>C	c.(1372-1374)Ttc>Ctc	p.F458L	MFSD4_ENST00000536357.1_Missense_Mutation_p.F371L|MFSD4_ENST00000478555.1_3'UTR|MFSD4_ENST00000539267.1_Missense_Mutation_p.I434T	NM_181644.4	NP_857595.3	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing 4	458					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			TTGGCAGATATTCCAGGCTCA	0.468																																						dbGAP											0													390.0	352.0	365.0					1																	205568262		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC036549	CCDS1455.1	1q32.1	2008-02-05			ENSG00000174514	ENSG00000174514			25433	protein-coding gene	gene with protein product							Standard	NM_181644		Approved	DKFZp761N1114, FLJ34577, UNQ3064, FLJ25004	uc001hcv.4	Q8N468	OTTHUMG00000037197	ENST00000367147.4:c.1372T>C	1.37:g.205568262T>C	ENSP00000356115:p.Phe458Leu		B7Z8X3|Q6UY25|Q8NAY0|Q8TCP4	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.F458L	ENST00000367147.4	37	c.1372	CCDS1455.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.61|15.61	2.884806|2.884806	0.51908|0.51908	.|.	.|.	ENSG00000174514|ENSG00000174514	ENST00000367147;ENST00000536357|ENST00000539267	T;T|T	0.79454|0.24538	-1.27;0.98|1.85	5.64|5.64	4.41|4.41	0.53225|0.53225	Major facilitator superfamily domain, general substrate transporter (1);|.	0.198649|.	0.51477|.	D|.	0.000082|.	T|T	0.34832|0.34832	0.0911|0.0911	L|L	0.60455|0.60455	1.87|1.87	0.26398|0.26398	N|N	0.976469|0.976469	B;B;B|.	0.28400|.	0.031;0.21;0.083|.	B;B;B|.	0.35859|.	0.009;0.212;0.012|.	T|T	0.19095|0.19095	-1.0316|-1.0316	10|7	0.11182|0.66056	T|D	0.66|0.02	1.152|1.152	9.4098|9.4098	0.38485|0.38485	0.2012:0.0:0.0:0.7988|0.2012:0.0:0.0:0.7988	.|.	403;371;458|.	B7Z8X0;B7Z8X3;Q8N468|.	.;.;MFSD4_HUMAN|.	L|T	458;371|434	ENSP00000356115:F458L;ENSP00000440183:F371L|ENSP00000445329:I434T	ENSP00000356115:F458L|ENSP00000445329:I434T	F|I	+|+	1|2	0|0	MFSD4|MFSD4	203834885|203834885	0.999000|0.999000	0.42202|0.42202	0.947000|0.947000	0.38551|0.38551	0.985000|0.985000	0.73830|0.73830	3.828000|3.828000	0.55753|0.55753	2.148000|2.148000	0.66965|0.66965	0.460000|0.460000	0.39030|0.39030	TTC|ATT	MFSD4	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000174514		0.468	MFSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD4	HGNC	protein_coding	OTTHUMT00000090391.1	256	0.00	0	T	NM_181644		205568262	205568262	+1	no_errors	ENST00000367147	ensembl	human	known	69_37n	missense	332	12.14	46	SNP	0.934	C
LINCMD1	101154644	genome.wustl.edu	37	6	52013759	52013759	+	lincRNA	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr6:52013759C>T	ENST00000418518.2	-	0	238				MIR133B_ENST00000362210.1_RNA																							GCTGGTCAAACGGAACCAAGT	0.527																																						dbGAP											0													74.0	71.0	72.0					6																	52013759		1568	3582	5150	-	-	-			0																															6.37:g.52013759C>T				RNA	SNP	-	NULL	ENST00000418518.2	37	NULL		6																																																																																			MIR133B	-	-	ENSG00000199080		0.527	MIR133BHG-001	KNOWN	basic	lincRNA	MIR133B	HGNC	lincRNA	OTTHUMT00000040895.1	100	0.00	0	C			52013759	52013759	+1	no_errors	ENST00000362210	ensembl	human	known	69_37n	rna	53	11.67	7	SNP	1.000	T
MST1L	11223	genome.wustl.edu	37	1	17086183	17086183	+	RNA	SNP	T	T	G	rs61769735	byFrequency	TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr1:17086183T>G	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.?(2)									CCTCGGACCCTTAGATGGACC	0.652																																						dbGAP											2	Unknown(2)	kidney(2)																																								-	-	-			0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17086183T>G			B7WPB1|Q13209	Splice_Site	SNP	-	e7-2	ENST00000455405.2	37	c.716-2		1	.	.	.	.	.	.	.	.	.	.	.	6.643	0.487109	0.12641	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	rs61769735	.	.	.	.	-1	.	.	.	-	.	.	MST1P9	16958770	0.699000	0.27786	0.000000	0.03702	0.000000	0.00434	0.557000	0.23454	0.000000	0.14550	0.000000	0.15137	.	MST1P9	-	-	ENSG00000186715		0.652	MST1L-002	KNOWN	basic	processed_transcript	MST1P9	HGNC	pseudogene	OTTHUMT00000400328.1	31	0.00	0	T	NM_001271733		17086183	17086183	-1	no_errors	ENST00000334998	ensembl	human	known	69_37n	splice_site	9	30.77	4	SNP	0.997	G
NIM1K	167359	genome.wustl.edu	37	5	43280303	43280303	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr5:43280303delG	ENST00000512796.1	+	4	2282	c.783delG	c.(781-783)ttgfs	p.L261fs	NIM1_ENST00000326035.2_Frame_Shift_Del_p.L261fs			Q8IY84	NIM1_HUMAN		261	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)										GGGTGCTTTTGTACTTCATGG	0.547																																						dbGAP											0													90.0	79.0	83.0					5																	43280303		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0																														ENST00000512796.1:c.783delG	5.37:g.43280303delG	ENSP00000420849:p.Leu261fs		B3KVM1	Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L261fs	ENST00000512796.1	37	c.783	CCDS3943.1	5																																																																																			AC114947.1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000177453		0.547	NIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NIM1	Clone_based_vega_gene	protein_coding	OTTHUMT00000368017.1	210	0.00	0	G			43280303	43280303	+1	no_errors	ENST00000326035	ensembl	human	known	69_37n	frame_shift_del	92	36.00	54	DEL	0.724	-
NR4A2	4929	genome.wustl.edu	37	2	157186373	157186374	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr2:157186373_157186374insG	ENST00000339562.4	-	3	687_688	c.325_326insC	c.(325-327)cagfs	p.Q109fs	NR4A2_ENST00000409572.1_Frame_Shift_Ins_p.Q109fs|NR4A2_ENST00000429376.1_Frame_Shift_Ins_p.Q46fs|NR4A2_ENST00000426264.1_Frame_Shift_Ins_p.Q46fs|NR4A2_ENST00000409108.2_Frame_Shift_Ins_p.Q109fs|NR4A2_ENST00000539077.1_Frame_Shift_Ins_p.Q120fs	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	109	Gln-rich.				adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.Q109fs*3(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						CTCCTCAGACTGGGGGGGCAGG	0.604																																						dbGAP											1	Insertion - Frameshift(1)	ovary(1)																																								-	-	-	SO:0001589	frameshift_variant	0			X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.326dupC	2.37:g.157186380_157186380dupG	ENSP00000344479:p.Gln109fs		Q16311|Q53RZ2|Q6NXU0	Frame_Shift_Ins	INS	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_NURR_rcpt,prints_Nuc_orph_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt	p.Q120fs	ENST00000339562.4	37	c.359_358	CCDS2201.1	2																																																																																			NR4A2	-	prints_NURR_rcpt	ENSG00000153234		0.604	NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR4A2	HGNC	protein_coding	OTTHUMT00000254909.2	45	0.00	0	-			157186373	157186374	-1	no_errors	ENST00000539077	ensembl	human	known	69_37n	frame_shift_ins	17	19.05	4	INS	1.000:1.000	G
NRXN1	9378	genome.wustl.edu	37	2	51254940	51254941	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr2:51254940_51254941insC	ENST00000406316.2	-	2	1947_1948	c.471_472insG	c.(469-474)gggctgfs	p.L158fs	NRXN1_ENST00000405581.1_Frame_Shift_Ins_p.L158fs|NRXN1_ENST00000402717.3_Frame_Shift_Ins_p.L158fs|NRXN1_ENST00000401669.2_Frame_Shift_Ins_p.L158fs|NRXN1_ENST00000405472.3_Frame_Shift_Ins_p.L158fs|NRXN1_ENST00000404971.1_Frame_Shift_Ins_p.L158fs|NRXN1_ENST00000406859.3_Frame_Shift_Ins_p.L158fs	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	158	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.I465fs*15(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TCCGGGGGCAGCCCCCCGACGA	0.658																																						dbGAP											1	Deletion - Frameshift(1)	upper_aerodigestive_tract(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.472dupG	2.37:g.51254946_51254946dupC	ENSP00000384311:p.Leu158fs		A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Frame_Shift_Ins	INS	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.L157fs	ENST00000406316.2	37	c.472_471	CCDS54360.1	2																																																																																			NRXN1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000179915		0.658	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	19	0.00	0	-			51254940	51254941	-1	no_errors	ENST00000402717	ensembl	human	known	69_37n	frame_shift_ins	3	50.00	3	INS	0.999:0.996	C
NWD1	284434	genome.wustl.edu	37	19	16902312	16902312	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr19:16902312C>T	ENST00000552788.1	+	12	3092	c.3092C>T	c.(3091-3093)aCg>aTg	p.T1031M	NWD1_ENST00000523826.1_Missense_Mutation_p.T825M|NWD1_ENST00000524140.2_Missense_Mutation_p.T1031M|NWD1_ENST00000379808.3_Missense_Mutation_p.T1031M|NWD1_ENST00000339803.6_Missense_Mutation_p.T896M|NWD1_ENST00000549814.1_Missense_Mutation_p.T1031M			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	1031							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						AGCTCAGCTACGGGAAAACTT	0.542																																						dbGAP											0													104.0	85.0	91.0					19																	16902312		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.3092C>T	19.37:g.16902312C>T	ENSP00000447224:p.Thr1031Met		C9J021|Q68CT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T1031M	ENST00000552788.1	37	c.3092		19	.	.	.	.	.	.	.	.	.	.	C	9.850	1.193418	0.22037	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.53423	1.35;0.62;1.35;3.06;0.99;3.06	5.34	2.07	0.26955	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.246709	0.38720	N	0.001584	T	0.26231	0.0640	N	0.19112	0.55	0.09310	N	1	P;P;D	0.53151	0.822;0.939;0.958	B;B;B	0.38378	0.074;0.272;0.194	T	0.14531	-1.0469	10	0.51188	T	0.08	-5.7544	7.2985	0.26408	0.0:0.7234:0.0:0.2766	.	1031;1031;896	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	M	896;1031;1031;1031;825;1031;896	ENSP00000428579:T1031M;ENSP00000447548:T1031M;ENSP00000369136:T1031M;ENSP00000428955:T825M;ENSP00000447224:T1031M;ENSP00000340159:T896M	ENSP00000340159:T896M	T	+	2	0	NWD1	16763312	0.268000	0.24133	0.321000	0.25320	0.001000	0.01503	1.741000	0.38238	0.252000	0.21531	-0.768000	0.03414	ACG	NWD1	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000188039		0.542	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	42	0.00	0	C	NM_001007525		16902312	16902312	+1	no_errors	ENST00000379808	ensembl	human	known	69_37n	missense	66	50.00	66	SNP	0.038	T
OR9Q1	219956	genome.wustl.edu	37	11	57947558	57947558	+	Silent	SNP	C	C	A			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr11:57947558C>A	ENST00000335397.3	+	3	958	c.642C>A	c.(640-642)atC>atA	p.I214I		NM_001005212.3	NP_001005212.1	Q8NGQ5	OR9Q1_HUMAN	olfactory receptor, family 9, subfamily Q, member 1	214						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I214I(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Breast(21;0.222)				TGGTGGTGATCTTGGTGTCCT	0.512																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											234.0	192.0	206.0					11																	57947558		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065734	CCDS31543.1	11q12.1	2012-08-09				ENSG00000186509		"""GPCR / Class A : Olfactory receptors"""	14724	protein-coding gene	gene with protein product							Standard	NM_001005212		Approved		uc001nmj.3	Q8NGQ5		ENST00000335397.3:c.642C>A	11.37:g.57947558C>A			Q2TAN3|Q96RA7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.I214	ENST00000335397.3	37	c.642	CCDS31543.1	11																																																																																			OR9Q1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186509		0.512	OR9Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9Q1	HGNC	protein_coding	OTTHUMT00000394538.2	281	0.00	0	C	NM_001005212		57947558	57947558	+1	no_errors	ENST00000335397	ensembl	human	known	69_37n	silent	125	26.47	45	SNP	0.002	A
OTC	5009	genome.wustl.edu	37	X	38212026	38212026	+	Splice_Site	SNP	G	G	A	rs68031618|rs72558496		TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chrX:38212026G>A	ENST00000039007.4	+	1	229	c.77G>A	c.(76-78)cGg>cAg	p.R26Q	TM4SF2_ENST00000465127.1_Intron|OTC_ENST00000488812.1_3'UTR	NM_000531.5	NP_000522.3	P00480	OTC_HUMAN	ornithine carbamoyltransferase	26			R -> Q (in OTCD). {ECO:0000269|PubMed:2474822}.		ammonia homeostasis (GO:0097272)|arginine biosynthetic process (GO:0006526)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|liver development (GO:0001889)|midgut development (GO:0007494)|ornithine catabolic process (GO:0006593)|protein homotrimerization (GO:0070207)|response to biotin (GO:0070781)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|ornithine carbamoyltransferase activity (GO:0004585)|phosphate ion binding (GO:0042301)|phospholipid binding (GO:0005543)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22					L-Citrulline(DB00155)|L-Ornithine(DB00129)	CGAAATTTTCGGTAAGTGATG	0.388																																						dbGAP											0			GRCh37	CM062968|CM910273	OTC	M	rs68031618						120.0	99.0	107.0					X																	38212026		2202	4300	6502	-	-	-	SO:0001630	splice_region_variant	0			K02100	CCDS14247.1	Xp21.1	2014-06-28			ENSG00000036473	ENSG00000036473	2.1.3.3		8512	protein-coding gene	gene with protein product		300461					Standard	NM_000531		Approved		uc004def.4	P00480	OTTHUMG00000022727	ENST00000039007.4:c.77+1G>A	X.37:g.38212026G>A			A8K9P2|D3DWB0|Q3KNR1|Q6B0I1|Q9NYJ5	Missense_Mutation	SNP	pfam_Asp_carbamoyltransf_Asp/Orn-bd,pfam_Asp/Orn_carbamoyltranf_P-bd,superfamily_Asp/Orn_carbamoylTrfase,prints_Orn/put_carbamltrans,prints_Asp/Orn_carbamoylTrfase,prints_Asp_carbamoyltransf_euk,tigrfam_Orn/put_carbamltrans	p.R26Q	ENST00000039007.4	37	c.77	CCDS14247.1	X	.	.	.	.	.	.	.	.	.	.	G	12.02	1.812829	0.32053	.	.	ENSG00000036473	ENST00000039007	D	0.99089	-5.41	5.88	3.76	0.43208	.	0.900916	0.09648	N	0.773990	D	0.94693	0.8288	N	0.08118	0	0.25992	A	0.0177689	B	0.09022	0.002	B	0.04013	0.001	D	0.92832	0.6281	9	0.14252	T	0.57	0.8989	6.4005	0.21636	0.1074:0.0:0.7068:0.1858	.	26	P00480	OTC_HUMAN	Q	26	ENSP00000039007:R26Q	ENSP00000039007:R26Q	R	+	2	0	OTC	38096970	0.999000	0.42202	0.995000	0.50966	0.704000	0.40688	1.609000	0.36858	1.212000	0.43366	0.600000	0.82982	CGG	OTC	-	NULL	ENSG00000036473		0.388	OTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTC	HGNC	protein_coding	OTTHUMT00000059006.2	98	0.00	0	G		Missense_Mutation	38212026	38212026	+1	no_errors	ENST00000039007	ensembl	human	known	69_37n	missense	86	34.85	46	SNP	0.992	A
PCDHA1	56147	genome.wustl.edu	37	5	140167380	140167380	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr5:140167380G>A	ENST00000504120.2	+	1	1505	c.1505G>A	c.(1504-1506)cGc>cAc	p.R502H	PCDHA1_ENST00000394633.3_Missense_Mutation_p.R502H|PCDHA1_ENST00000378133.3_Missense_Mutation_p.R502H	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	502	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGGCGAGCGCGCGCTGTCG	0.682																																						dbGAP											0													54.0	57.0	56.0					5																	140167380		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1505G>A	5.37:g.140167380G>A	ENSP00000420840:p.Arg502His		O75288|Q9NRT7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R502H	ENST00000504120.2	37	c.1505	CCDS54913.1	5	.	.	.	.	.	.	.	.	.	.	g	12.40	1.927158	0.34002	.	.	ENSG00000204970	ENST00000504120;ENST00000394633;ENST00000378133	T;T;T	0.60920	0.15;0.15;0.15	3.63	3.63	0.41609	Cadherin (4);Cadherin-like (1);	0.000000	0.41605	U	0.000842	T	0.44519	0.1297	L	0.49455	1.56	0.22787	N	0.998736	P;B;P	0.41748	0.639;0.226;0.761	B;B;B	0.33690	0.168;0.06;0.14	T	0.40403	-0.9565	10	0.33940	T	0.23	.	9.7898	0.40699	0.0:0.0:0.6256:0.3744	.	502;502;502	Q9Y5I3;Q9Y5I3-2;Q9Y5I3-3	PCDA1_HUMAN;.;.	H	502	ENSP00000420840:R502H;ENSP00000378129:R502H;ENSP00000367373:R502H	ENSP00000367373:R502H	R	+	2	0	PCDHA1	140147564	0.955000	0.32602	0.998000	0.56505	0.902000	0.53008	0.961000	0.29267	1.768000	0.52137	0.549000	0.68633	CGC	PCDHA1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204970		0.682	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHA1	HGNC	protein_coding	OTTHUMT00000389127.1	38	0.00	0	G	NM_018900		140167380	140167380	+1	no_errors	ENST00000504120	ensembl	human	known	69_37n	missense	10	44.44	8	SNP	0.819	A
PCDHB8	56128	genome.wustl.edu	37	5	140559119	140559119	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr5:140559119G>A	ENST00000239444.2	+	1	1749	c.1504G>A	c.(1504-1506)Gcc>Acc	p.A502T	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	502	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTGCCCCTCGCCTCCCTGGT	0.672																																						dbGAP											0													95.0	148.0	130.0					5																	140559119		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1504G>A	5.37:g.140559119G>A	ENSP00000239444:p.Ala502Thr		B9EGV1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A502T	ENST00000239444.2	37	c.1504	CCDS4250.1	5	.	.	.	.	.	.	.	.	.	.	g	4.629	0.116854	0.08881	.	.	ENSG00000120322	ENST00000239444	T	0.01821	4.62	4.22	0.82	0.18793	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01765	0.0056	N	0.21617	0.685	0.22982	N	0.998477	B	0.18741	0.03	B	0.17979	0.02	T	0.45071	-0.9286	9	0.38643	T	0.18	.	12.612	0.56556	0.0:0.0:0.4209:0.5791	.	502	Q9UN66	PCDB8_HUMAN	T	502	ENSP00000239444:A502T	ENSP00000239444:A502T	A	+	1	0	PCDHB8	140539303	0.000000	0.05858	0.011000	0.14972	0.235000	0.25334	-1.077000	0.03416	0.249000	0.21456	-1.347000	0.01240	GCC	PCDHB8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120322		0.672	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2	245	0.00	0	G	NM_019120		140559119	140559119	+1	no_errors	ENST00000239444	ensembl	human	known	69_37n	missense	85	11.34	11	SNP	0.588	A
PI4K2B	55300	genome.wustl.edu	37	4	25256819	25256819	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr4:25256819T>C	ENST00000264864.6	+	3	745	c.556T>C	c.(556-558)Tac>Cac	p.Y186H	PI4K2B_ENST00000512921.1_Missense_Mutation_p.Y90H	NM_018323.3	NP_060793.2	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta	186	PI3K/PI4K.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|skin(3)	15		Breast(46;0.173)				TAATCAGGGGTACCTTTCCGA	0.458																																						dbGAP											0													75.0	73.0	74.0					4																	25256819		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001967	CCDS3433.1	4p15.31	2009-05-07			ENSG00000038210	ENSG00000038210			18215	protein-coding gene	gene with protein product		612101				11923287	Standard	NM_018323		Approved	PI4KIIB, FLJ11105, PIK42B	uc003grk.2	Q8TCG2	OTTHUMG00000128564	ENST00000264864.6:c.556T>C	4.37:g.25256819T>C	ENSP00000264864:p.Tyr186His		Q9NUW2	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom	p.Y186H	ENST00000264864.6	37	c.556	CCDS3433.1	4	.	.	.	.	.	.	.	.	.	.	T	21.4	4.150699	0.78001	.	.	ENSG00000038210	ENST00000512921;ENST00000264864;ENST00000537420	D;D	0.91407	-2.84;-2.84	6.07	6.07	0.98685	Phosphatidylinositol 3-/4-kinase, catalytic (1);	0.052873	0.85682	D	0.000000	D	0.97084	0.9047	H	0.96943	3.91	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.98227	1.0481	10	0.72032	D	0.01	-9.7132	16.6288	0.85011	0.0:0.0:0.0:1.0	.	186	Q8TCG2	P4K2B_HUMAN	H	90;186;155	ENSP00000423373:Y90H;ENSP00000264864:Y186H	ENSP00000264864:Y186H	Y	+	1	0	PI4K2B	24865917	1.000000	0.71417	0.926000	0.36857	0.414000	0.31173	7.997000	0.88414	2.326000	0.78906	0.533000	0.62120	TAC	PI4K2B	-	pfam_PI3/4_kinase_cat_dom	ENSG00000038210		0.458	PI4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PI4K2B	HGNC	protein_coding	OTTHUMT00000250415.1	97	0.00	0	T	NM_018323		25256819	25256819	+1	no_errors	ENST00000264864	ensembl	human	known	69_37n	missense	73	13.10	11	SNP	1.000	C
PIK3R6	146850	genome.wustl.edu	37	17	8726792	8726792	+	Missense_Mutation	SNP	C	C	T	rs139293791	byFrequency	TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr17:8726792C>T	ENST00000311434.9	-	14	1777	c.1538G>A	c.(1537-1539)cGg>cAg	p.R513Q	PIK3R6_ENST00000434064.2_5'UTR	NM_001010855.2	NP_001010855.1	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	513					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of MAP kinase activity (GO:0043406)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)										GTCCACAGTCCGGGATGTGTC	0.527													C|||	13	0.00259585	0.0008	0.0	5008	,	,		15702	0.0119		0.0	False		,,,				2504	0.0					dbGAP											0													92.0	98.0	96.0					17																	8726792		1984	4184	6168	-	-	-	SO:0001583	missense	0			AK091819	CCDS73985.1	17p13.1	2013-01-31	2008-02-04	2008-02-04	ENSG00000174083	ENSG00000276231			27101	protein-coding gene	gene with protein product		611462	"""chromosome 17 open reading frame 38"""	C17orf38		16476736	Standard	NM_001010855		Approved	FLJ34500, HsT41028, p87PIKAP	uc002glq.1	Q5UE93	OTTHUMG00000132861	ENST00000311434.9:c.1538G>A	17.37:g.8726792C>T	ENSP00000475670:p.Arg513Gln		Q658R3	RNA	SNP	-	NULL	ENST00000311434.9	37	NULL		17																																																																																			PIK3R6	-	-	ENSG00000174083		0.527	PIK3R6-201	KNOWN	basic|appris_principal	protein_coding	PIK3R6	HGNC	protein_coding		32	0.00	0	C	NM_001010855		8726792	8726792	-1	no_errors	ENST00000311434	ensembl	human	known	69_37n	rna	4	50.00	4	SNP	0.000	T
PLOD3	8985	genome.wustl.edu	37	7	100855926	100855927	+	Frame_Shift_Ins	INS	-	-	G	rs138002558	byFrequency	TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr7:100855926_100855927insG	ENST00000223127.3	-	9	1287_1288	c.889_890insC	c.(889-891)cggfs	p.R297fs		NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	297					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)	p.R297fs*61(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	CAGAAACACCCGGGGGGGAGGC	0.639																																						dbGAP											2	Deletion - Frameshift(2)	large_intestine(2)																																								-	-	-	SO:0001589	frameshift_variant	0			AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.890dupC	7.37:g.100855933_100855933dupG	ENSP00000223127:p.Arg297fs		B2R6W6|Q540C3	Frame_Shift_Ins	INS	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.R297fs	ENST00000223127.3	37	c.890_889	CCDS5715.1	7																																																																																			PLOD3	-	NULL	ENSG00000106397		0.639	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLOD3	HGNC	protein_coding	OTTHUMT00000347470.1	14	0.00	0	-			100855926	100855927	-1	no_errors	ENST00000223127	ensembl	human	known	69_37n	frame_shift_ins	13	18.75	3	INS	1.000:1.000	G
PON1	5444	genome.wustl.edu	37	7	94944672	94944672	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr7:94944672G>T	ENST00000222381.3	-	4	563	c.332C>A	c.(331-333)tCa>tAa	p.S111*	PON1_ENST00000542556.1_Nonsense_Mutation_p.S111*	NM_000446.5	NP_000437.3	P27169	PON1_HUMAN	paraoxonase 1	111					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|dephosphorylation (GO:0016311)|organophosphate catabolic process (GO:0046434)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of binding (GO:0051099)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of transporter activity (GO:0032411)|response to external stimulus (GO:0009605)|response to toxic substance (GO:0009636)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|intracellular membrane-bounded organelle (GO:0043231)|spherical high-density lipoprotein particle (GO:0034366)	aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|endometrium(2)|large_intestine(6)|lung(11)|pancreas(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	27	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Cefazolin(DB01327)	AGGGTTAAATGAAGATACATC	0.343																																					GBM(119;715 1622 17358 22490 33240)	dbGAP											0													110.0	104.0	106.0					7																	94944672		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF539592	CCDS5638.1	7q21.3	2014-03-14			ENSG00000005421	ENSG00000005421	3.1.1.2	"""Paraoxonases"""	9204	protein-coding gene	gene with protein product	"""esterase A"", ""arylesterase 1"""	168820		PON		8661009, 15450851	Standard	NM_000446		Approved	ESA	uc003uns.3	P27169	OTTHUMG00000153894	ENST00000222381.3:c.332C>A	7.37:g.94944672G>T	ENSP00000222381:p.Ser111*		B2RA40|Q16052|Q6B0J6|Q9UCB1	Nonsense_Mutation	SNP	pfam_Arylesterase,pfam_SGL,pfam_Strictosidine_synth_cons-reg,prints_Arylesterase,prints_Paraoxonase1	p.S111*	ENST00000222381.3	37	c.332	CCDS5638.1	7	.	.	.	.	.	.	.	.	.	.	G	35	5.416545	0.96092	.	.	ENSG00000005421	ENST00000222381;ENST00000542556	.	.	.	5.06	5.06	0.68205	.	0.125924	0.56097	D	0.000030	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.0561	19.0004	0.92830	0.0:0.0:1.0:0.0	.	.	.	.	X	111	.	ENSP00000222381:S111X	S	-	2	0	PON1	94782608	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	8.975000	0.93437	2.804000	0.96469	0.650000	0.86243	TCA	PON1	-	NULL	ENSG00000005421		0.343	PON1-001	KNOWN	basic|CCDS	protein_coding	PON1	HGNC	protein_coding	OTTHUMT00000332865.2	217	0.00	0	G	NM_000446		94944672	94944672	-1	no_errors	ENST00000222381	ensembl	human	known	69_37n	nonsense	129	11.64	17	SNP	1.000	T
PROKR1	10887	genome.wustl.edu	37	2	68882405	68882405	+	Silent	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr2:68882405C>T	ENST00000303786.3	+	3	1299	c.879C>T	c.(877-879)taC>taT	p.Y293Y	PROKR1_ENST00000394342.2_Silent_p.Y293Y			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	293					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						TCACCGCCTACGTGCTATGCT	0.597																																						dbGAP											0													122.0	94.0	104.0					2																	68882405		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.879C>T	2.37:g.68882405C>T			A5JUU2|Q53QT9|Q8NFJ7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.Y293	ENST00000303786.3	37	c.879	CCDS1889.1	2																																																																																			PROKR1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000169618		0.597	PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROKR1	HGNC	protein_coding	OTTHUMT00000251760.2	93	0.00	0	C			68882405	68882405	+1	no_errors	ENST00000303786	ensembl	human	known	69_37n	silent	17	70.69	41	SNP	1.000	T
RDH12	145226	genome.wustl.edu	37	14	68192813	68192813	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr14:68192813T>C	ENST00000551171.1	+	6	713	c.389T>C	c.(388-390)aTg>aCg	p.M130T	RDH12_ENST00000267502.3_Missense_Mutation_p.M130T|RDH12_ENST00000539142.1_Missense_Mutation_p.M130T	NM_152443.2	NP_689656.2	Q96NR8	RDH12_HUMAN	retinol dehydrogenase 12 (all-trans/9-cis/11-cis)	130					photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	intracellular (GO:0005622)|photoreceptor inner segment membrane (GO:0060342)	retinol dehydrogenase activity (GO:0004745)			large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(4)	12				all cancers(60;0.000704)|OV - Ovarian serous cystadenocarcinoma(108;0.00161)|BRCA - Breast invasive adenocarcinoma(234;0.00953)	Vitamin A(DB00162)	GGAGTAATGATGTGTCCATAT	0.468																																						dbGAP											0													190.0	182.0	185.0					14																	68192813		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054835	CCDS9787.1	14q24.1	2013-02-14	2006-05-09		ENSG00000139988	ENSG00000139988	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19977	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 2"""	608830	"""retinol dehydrogenase 12 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_152443		Approved	FLJ30273, SDR7C2, LCA13, RP53	uc001xjz.4	Q96NR8		ENST00000551171.1:c.389T>C	14.37:g.68192813T>C	ENSP00000449079:p.Met130Thr		B2RDA2|Q8TAW6	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.M130T	ENST00000551171.1	37	c.389	CCDS9787.1	14	.	.	.	.	.	.	.	.	.	.	T	13.75	2.331549	0.41297	.	.	ENSG00000139988	ENST00000551171;ENST00000267502;ENST00000539142	D;D;D	0.86865	-2.18;-2.18;-2.18	6.04	4.9	0.64082	NAD(P)-binding domain (1);	0.173319	0.64402	D	0.000009	D	0.83468	0.5261	N	0.20807	0.61	0.42993	D	0.994494	P	0.35575	0.51	P	0.50231	0.635	T	0.78226	-0.2286	10	0.22706	T	0.39	.	8.1097	0.30907	0.0:0.0676:0.135:0.7974	.	130	Q96NR8	RDH12_HUMAN	T	130	ENSP00000449079:M130T;ENSP00000267502:M130T;ENSP00000438715:M130T	ENSP00000267502:M130T	M	+	2	0	RDH12	67262566	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	4.183000	0.58317	1.103000	0.41568	0.460000	0.39030	ATG	RDH12	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase	ENSG00000139988		0.468	RDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RDH12	HGNC	protein_coding	OTTHUMT00000406918.1	191	0.00	0	T			68192813	68192813	+1	no_errors	ENST00000267502	ensembl	human	known	69_37n	missense	167	15.66	31	SNP	1.000	C
LINC00969	440993	genome.wustl.edu	37	3	195393030	195393030	+	lincRNA	SNP	A	A	G	rs202038141		TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr3:195393030A>G	ENST00000445430.1	+	0	741									long intergenic non-protein coding RNA 969																		CGCACTGTGCATACAGGACGG	0.423																																						dbGAP											0																																										-	-	-			0			AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195393030A>G				RNA	SNP	-	NULL	ENST00000445430.1	37	NULL		3																																																																																			SDHAP2	-	-	ENSG00000215837		0.423	LINC00969-038	KNOWN	basic	lincRNA	SDHAP2	HGNC	lincRNA	OTTHUMT00000341951.1	29	0.00	0	A			195393030	195393030	+1	no_errors	ENST00000429897	ensembl	human	known	69_37n	rna	31	18.42	7	SNP	1.000	G
SLC7A3	84889	genome.wustl.edu	37	X	70145947	70145947	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chrX:70145947C>A	ENST00000374299.3	-	11	1846	c.1702G>T	c.(1702-1704)Gcc>Tcc	p.A568S	SLC7A3_ENST00000298085.4_Missense_Mutation_p.A568S			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	568					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CCAAATCGGGCCCAGGTACCA	0.478																																						dbGAP											0													62.0	55.0	58.0					X																	70145947		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.1702G>T	X.37:g.70145947C>A	ENSP00000363417:p.Ala568Ser		D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	pfam_AA-permease_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	p.A568S	ENST00000374299.3	37	c.1702	CCDS14404.1	X	.	.	.	.	.	.	.	.	.	.	C	16.35	3.098143	0.56183	.	.	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.88124	-2.34;-2.34	4.88	4.02	0.46733	.	0.740090	0.13551	N	0.379485	D	0.89058	0.6607	M	0.79123	2.44	0.32482	N	0.541366	B	0.28760	0.221	B	0.38921	0.285	D	0.89901	0.4044	10	0.59425	D	0.04	.	11.4702	0.50264	0.0:0.911:0.0:0.089	.	568	Q8WY07	CTR3_HUMAN	S	568	ENSP00000363417:A568S;ENSP00000298085:A568S	ENSP00000298085:A568S	A	-	1	0	SLC7A3	70062672	0.210000	0.23517	1.000000	0.80357	0.922000	0.55478	0.689000	0.25437	1.173000	0.42796	0.436000	0.28706	GCC	SLC7A3	-	tigrfam_Cat_AA_permease	ENSG00000165349		0.478	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A3	HGNC	protein_coding	OTTHUMT00000057080.1	92	0.00	0	C	NM_032803		70145947	70145947	-1	no_errors	ENST00000298085	ensembl	human	known	69_37n	missense	80	34.96	43	SNP	0.999	A
SLC6A14	11254	genome.wustl.edu	37	X	115584214	115584214	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chrX:115584214G>T	ENST00000371900.4	+	9	1280	c.1192G>T	c.(1192-1194)Gct>Tct	p.A398S		NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	398					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	CTATCCAGAGGCTCTAGCCCA	0.338																																						dbGAP											0													169.0	145.0	153.0					X																	115584214		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.1192G>T	X.37:g.115584214G>T	ENSP00000360967:p.Ala398Ser		Q5H942	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.A398S	ENST00000371900.4	37	c.1192	CCDS14570.1	X	.	.	.	.	.	.	.	.	.	.	G	32	5.112388	0.94339	.	.	ENSG00000087916	ENST00000371900	T	0.78126	-1.15	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.89608	0.6764	M	0.86740	2.835	0.54753	D	0.999983	D	0.89917	1.0	D	0.97110	1.0	D	0.91182	0.4977	10	0.87932	D	0	.	16.2289	0.82318	0.0:0.0:1.0:0.0	.	398	Q9UN76	S6A14_HUMAN	S	398	ENSP00000360967:A398S	ENSP00000360967:A398S	A	+	1	0	SLC6A14	115498242	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.447000	0.97595	2.436000	0.82500	0.594000	0.82650	GCT	SLC6A14	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000087916		0.338	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A14	HGNC	protein_coding	OTTHUMT00000057986.1	315	0.00	0	G			115584214	115584214	+1	no_errors	ENST00000371900	ensembl	human	known	69_37n	missense	252	17.05	52	SNP	1.000	T
SMOX	54498	genome.wustl.edu	37	20	4163035	4163035	+	Silent	SNP	C	C	A			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr20:4163035C>A	ENST00000305958.4	+	5	1134	c.909C>A	c.(907-909)ggC>ggA	p.G303G	SMOX_ENST00000379460.2_Silent_p.G303G|SMOX_ENST00000278795.3_Intron|SMOX_ENST00000339123.6_Intron|SMOX_ENST00000346595.2_Intron	NM_175839.2	NP_787033.1	Q9NWM0	SMOX_HUMAN	spermine oxidase	303					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	N1-acetylspermine:oxygen oxidoreductase (N1-acetylspermidine-forming) activity (GO:0052895)|norspermine:oxygen oxidoreductase activity (GO:0052894)|polyamine oxidase activity (GO:0046592)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(7)|lung(5)|skin(2)|urinary_tract(1)	26					Spermine(DB00127)	CCCGGGGGGGCAGGTGGGATG	0.672																																						dbGAP											0													38.0	39.0	39.0					20																	4163035		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000753	CCDS13075.1, CCDS13076.1, CCDS13077.1, CCDS13078.1, CCDS74702.1	20p13	2003-10-15	2003-10-15	2003-10-15	ENSG00000088826	ENSG00000088826			15862	protein-coding gene	gene with protein product		615854	"""chromosome 20 open reading frame 16"""	C20orf16		11454677, 12398765	Standard	NM_175839		Approved	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO	uc002wkp.3	Q9NWM0	OTTHUMG00000031777	ENST00000305958.4:c.909C>A	20.37:g.4163035C>A			A2A2P5|A2A2P6|A8BE87|D3DVZ4|Q5TE26|Q5TE27|Q6UY28|Q8IX00|Q96LC3|Q96LC4|Q96QT3|Q9BW38|Q9H6H1|Q9NP51|Q9NPY1|Q9NPY2	Silent	SNP	pfam_Amino_oxidase,pfam_FAD-dep_OxRdtase,pfam_FAD_bind_dom	p.G303	ENST00000305958.4	37	c.909	CCDS13075.1	20																																																																																			SMOX	-	NULL	ENSG00000088826		0.672	SMOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SMOX	HGNC	protein_coding	OTTHUMT00000077806.1	44	0.00	0	C	NM_175842		4163035	4163035	+1	no_errors	ENST00000305958	ensembl	human	known	69_37n	silent	31	23.81	10	SNP	0.000	A
STAT5A	6776	genome.wustl.edu	37	17	40451780	40451780	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr17:40451780C>T	ENST00000345506.4	+	7	1204	c.562C>T	c.(562-564)Cag>Tag	p.Q188*	STAT5A_ENST00000590949.1_Nonsense_Mutation_p.Q188*|STAT5A_ENST00000452307.2_Nonsense_Mutation_p.Q188*|STAT5A_ENST00000588868.1_Nonsense_Mutation_p.Q188*|STAT5A_ENST00000546010.2_Nonsense_Mutation_p.Q158*	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	188					2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		TCAGTTTGCCCAGCTGGCCCA	0.612																																						dbGAP											0													61.0	64.0	63.0					17																	40451780		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.562C>T	17.37:g.40451780C>T	ENSP00000341208:p.Gln188*		Q1KLZ6	Nonsense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.Q188*	ENST00000345506.4	37	c.562	CCDS11424.1	17	.	.	.	.	.	.	.	.	.	.	C	15.57	2.871473	0.51695	.	.	ENSG00000126561	ENST00000345506;ENST00000546010;ENST00000540577;ENST00000452307	.	.	.	4.78	3.81	0.43845	.	0.414587	0.27826	N	0.017685	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-10.941	14.4055	0.67079	0.1489:0.8511:0.0:0.0	.	.	.	.	X	188;158;190;188	.	ENSP00000341208:Q188X	Q	+	1	0	STAT5A	37705306	0.969000	0.33509	0.758000	0.31321	0.027000	0.11550	2.297000	0.43593	0.972000	0.38314	-0.475000	0.04921	CAG	STAT5A	-	pfam_STAT_TF_alpha,superfamily_STAT_TF_coiled-coil	ENSG00000126561		0.612	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT5A	HGNC	protein_coding	OTTHUMT00000319804.1	21	0.00	0	C	NM_003152		40451780	40451780	+1	no_errors	ENST00000345506	ensembl	human	known	69_37n	nonsense	14	39.13	9	SNP	1.000	T
TBL1X	6907	genome.wustl.edu	37	X	9661244	9661244	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chrX:9661244C>T	ENST00000217964.7	+	10	1587	c.947C>T	c.(946-948)aCg>aTg	p.T316M	TBL1X_ENST00000424279.1_Missense_Mutation_p.T265M|TBL1X_ENST00000407597.2_Missense_Mutation_p.T316M|TBL1X_ENST00000536365.1_Missense_Mutation_p.T265M|TBL1X_ENST00000380961.1_Missense_Mutation_p.T265M	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	316				T -> A (in Ref. 2; BAF82098). {ECO:0000305}.	canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				AGAATATGGACGGAAGATGGT	0.493																																						dbGAP											0													169.0	150.0	157.0					X																	9661244		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.947C>T	X.37:g.9661244C>T	ENSP00000217964:p.Thr316Met		A8K044|A8K4J7|Q86UY2	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T316M	ENST00000217964.7	37	c.947	CCDS14133.1	X	.	.	.	.	.	.	.	.	.	.	C	15.26	2.779479	0.49891	.	.	ENSG00000101849	ENST00000407597;ENST00000424279;ENST00000536365;ENST00000380961;ENST00000217964	T;T;T;T;T	0.81330	-1.48;3.52;3.52;3.52;-1.48	4.56	3.69	0.42338	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.68174	0.2972	L	0.33339	1.005	0.58432	D	0.999991	P;B	0.37398	0.593;0.41	B;B	0.29524	0.103;0.103	T	0.68640	-0.5355	10	0.59425	D	0.04	.	12.1871	0.54245	0.0:0.9136:0.0:0.0864	.	279;316	Q59F53;O60907	.;TBL1X_HUMAN	M	316;265;265;265;316	ENSP00000385988:T316M;ENSP00000394097:T265M;ENSP00000445317:T265M;ENSP00000370348:T265M;ENSP00000217964:T316M	ENSP00000217964:T316M	T	+	2	0	TBL1X	9621244	1.000000	0.71417	0.811000	0.32455	0.798000	0.45092	7.285000	0.78660	0.859000	0.35456	0.600000	0.82982	ACG	TBL1X	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000101849		0.493	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	TBL1X	HGNC	protein_coding	OTTHUMT00000055709.1	84	0.00	0	C	NM_005647		9661244	9661244	+1	no_errors	ENST00000217964	ensembl	human	known	69_37n	missense	54	35.71	30	SNP	1.000	T
TBX3	6926	genome.wustl.edu	37	12	115118704	115118706	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	TGT	TGT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr12:115118704_115118706delTGT	ENST00000257566.3	-	2	1024_1026	c.635_637delACA	c.(634-639)aacatt>att	p.N212del	TBX3_ENST00000349155.2_In_Frame_Del_p.N212del	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	212					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N212delN(1)		breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		TTGTCTGAAATGTTGTTGGTGAG	0.438																																						dbGAP											1	Deletion - In frame(1)	breast(1)																																								-	-	-	SO:0001651	inframe_deletion	0			BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.635_637delACA	12.37:g.115118707_115118709delTGT	ENSP00000257566:p.Asn212del		Q8TB20|Q9UKF8	In_Frame_Del	DEL	pfam_TF_T-box,pfam_TBX,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.N212in_frame_del	ENST00000257566.3	37	c.637_635	CCDS9176.1	12																																																																																			TBX3	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box	ENSG00000135111		0.438	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBX3	HGNC	protein_coding	OTTHUMT00000404947.2	140	0.00	0	TGT	NM_016569, NM_005996		115118704	115118706	-1	no_errors	ENST00000257566	ensembl	human	known	69_37n	in_frame_del	48	31.43	22	DEL	1.000:1.000:1.000	-
TCEB3	6924	genome.wustl.edu	37	1	24082459	24082459	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr1:24082459C>T	ENST00000418390.2	+	8	2267	c.1996C>T	c.(1996-1998)Cgg>Tgg	p.R666W	TCEB3_ENST00000609199.1_Missense_Mutation_p.R640W	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	666	Activation domain. {ECO:0000250}.				gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		CCGAGAGCAGCGGCTACGAGT	0.512																																						dbGAP											0													71.0	67.0	69.0					1																	24082459		2203	4300	6503	-	-	-	SO:0001583	missense	0			L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.1996C>T	1.37:g.24082459C>T	ENSP00000395574:p.Arg666Trp		B2R7Q8|Q8IXH1	Missense_Mutation	SNP	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,pfscan_F-box_dom_cyclin-like	p.R666W	ENST00000418390.2	37	c.1996	CCDS239.2	1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.670732	0.88348	.	.	ENSG00000011007	ENST00000418390	T	0.33438	1.41	5.61	4.68	0.58851	.	0.120917	0.37715	N	0.001971	T	0.58337	0.2115	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65446	-0.6166	10	0.87932	D	0	-14.0902	13.743	0.62860	0.2797:0.7203:0.0:0.0	.	666	Q14241	ELOA1_HUMAN	W	666	ENSP00000395574:R666W	ENSP00000395574:R666W	R	+	1	2	TCEB3	23955046	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.260000	0.43267	1.457000	0.47850	0.462000	0.41574	CGG	TCEB3	-	pfam_RNA_pol_II_trans_fac_SIII_A	ENSG00000011007		0.512	TCEB3-001	KNOWN	basic|CCDS	protein_coding	TCEB3	HGNC	protein_coding	OTTHUMT00000008230.2	59	0.00	0	C	NM_003198		24082459	24082459	+1	no_errors	ENST00000418390	ensembl	human	known	69_37n	missense	82	20.39	21	SNP	1.000	T
TIMELESS	8914	genome.wustl.edu	37	12	56817240	56817240	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr12:56817240C>T	ENST00000553532.1	-	18	2260	c.2110G>A	c.(2110-2112)Gtt>Att	p.V704I	TIMELESS_ENST00000229201.4_Missense_Mutation_p.V703I|TIMELESS_ENST00000554616.1_Intron					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						TAGGCTCGAACGACAGTTGAA	0.512																																						dbGAP											0													112.0	98.0	103.0					12																	56817240		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.2110G>A	12.37:g.56817240C>T	ENSP00000450607:p.Val704Ile			Missense_Mutation	SNP	pfam_TIMELESS_C,pfam_Timeless	p.V704I	ENST00000553532.1	37	c.2110	CCDS8918.1	12	.	.	.	.	.	.	.	.	.	.	C	7.498	0.652000	0.14580	.	.	ENSG00000111602	ENST00000229201;ENST00000553532	T;T	0.09445	2.98;2.98	5.61	0.701	0.18104	.	0.183165	0.46758	N	0.000276	T	0.10121	0.0248	L	0.58810	1.83	0.80722	D	1	B	0.14438	0.01	B	0.06405	0.002	T	0.13045	-1.0524	10	0.35671	T	0.21	-9.5633	7.4646	0.27314	0.0:0.6697:0.1086:0.2217	.	704	Q9UNS1	TIM_HUMAN	I	703;704	ENSP00000229201:V703I;ENSP00000450607:V704I	ENSP00000229201:V704I	V	-	1	0	TIMELESS	55103507	0.022000	0.18835	0.046000	0.18839	0.026000	0.11368	0.348000	0.20031	-0.062000	0.13088	-0.254000	0.11334	GTT	TIMELESS	-	NULL	ENSG00000111602		0.512	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TIMELESS	HGNC	protein_coding	OTTHUMT00000409771.1	89	0.00	0	C	NM_003920		56817240	56817240	-1	no_errors	ENST00000553532	ensembl	human	known	69_37n	missense	85	15.84	16	SNP	0.650	T
TP53	7157	genome.wustl.edu	37	17	7577102	7577102	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr17:7577102C>T	ENST00000269305.4	-	8	1025	c.836G>A	c.(835-837)gGg>gAg	p.G279E	TP53_ENST00000420246.2_Missense_Mutation_p.G279E|TP53_ENST00000455263.2_Missense_Mutation_p.G279E|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.G279E|TP53_ENST00000445888.2_Missense_Mutation_p.G279E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	279	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> E (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).|G -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G279E(32)|p.0?(8)|p.G279V(4)|p.?(2)|p.G279fs*65(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.G279_R280delGR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.G279fs*26(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGTCTCTCCCAGGACAGGC	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	60	Substitution - Missense(36)|Deletion - Frameshift(8)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(2)	upper_aerodigestive_tract(16)|urinary_tract(8)|oesophagus(7)|breast(5)|bone(5)|haematopoietic_and_lymphoid_tissue(4)|skin(4)|large_intestine(3)|central_nervous_system(3)|ovary(2)|stomach(1)|lung(1)|liver(1)											75.0	65.0	68.0					17																	7577102		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.836G>A	17.37:g.7577102C>T	ENSP00000269305:p.Gly279Glu		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.G279E	ENST00000269305.4	37	c.836	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	26.6	4.753775	0.89753	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99898	-7.61;-7.61;-7.61;-7.61;-7.61;-7.61	5.13	4.16	0.48862	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.90425	3.115	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	0.999;0.991;0.999;1.0	D	0.96457	0.9338	10	0.87932	D	0	-22.6503	11.5187	0.50539	0.0:0.9131:0.0:0.0869	.	279;279;279;279	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	E	279;279;279;279;279;268;147	ENSP00000352610:G279E;ENSP00000269305:G279E;ENSP00000398846:G279E;ENSP00000391127:G279E;ENSP00000391478:G279E;ENSP00000425104:G147E	ENSP00000269305:G279E	G	-	2	0	TP53	7517827	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.862000	0.69560	1.390000	0.46547	0.462000	0.41574	GGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	66	0.00	0	C	NM_000546		7577102	7577102	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	32	53.62	37	SNP	1.000	T
TNS4	84951	genome.wustl.edu	37	17	38645003	38645003	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr17:38645003C>A	ENST00000254051.6	-	3	816	c.658G>T	c.(658-660)Ggt>Tgt	p.G220C		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	220	Ser-rich.				apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			GGGGAGAGACCCTCTGAGGGG	0.647																																						dbGAP											0													20.0	25.0	24.0					17																	38645003		2158	4265	6423	-	-	-	SO:0001583	missense	0			AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.658G>T	17.37:g.38645003C>A	ENSP00000254051:p.Gly220Cys		A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Missense_Mutation	SNP	pfam_PTB,pfam_SH2,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2	p.G220C	ENST00000254051.6	37	c.658	CCDS11368.1	17	.	.	.	.	.	.	.	.	.	.	C	3.120	-0.180801	0.06380	.	.	ENSG00000131746	ENST00000377816;ENST00000254051	T	0.18810	2.19	4.73	1.62	0.23740	.	2.518660	0.01483	N	0.016777	T	0.10895	0.0266	N	0.08118	0	0.09310	N	1	P	0.40619	0.724	B	0.34038	0.174	T	0.14090	-1.0485	10	0.56958	D	0.05	2.8294	4.5302	0.12001	0.0:0.4865:0.1559:0.3576	.	220	Q8IZW8	TENS4_HUMAN	C	220	ENSP00000254051:G220C	ENSP00000254051:G220C	G	-	1	0	TNS4	35898529	0.003000	0.15002	0.001000	0.08648	0.002000	0.02628	1.697000	0.37784	0.097000	0.17492	-0.253000	0.11424	GGT	TNS4	-	NULL	ENSG00000131746		0.647	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS4	HGNC	protein_coding	OTTHUMT00000257154.3	33	0.00	0	C	NM_032865		38645003	38645003	-1	no_errors	ENST00000254051	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	0.000	A
TPRG1	285386	genome.wustl.edu	37	3	188925244	188925244	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr3:188925244C>T	ENST00000345063.3	+	2	238	c.71C>T	c.(70-72)tCt>tTt	p.S24F	TPRG1_ENST00000433971.1_Missense_Mutation_p.S24F	NM_198485.3	NP_940887.1	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1	24						cytoplasm (GO:0005737)				endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|skin(2)|urinary_tract(1)	16	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		GACCAACCCTCTGAGACTGAC	0.468																																						dbGAP											0													171.0	152.0	158.0					3																	188925244		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK125682	CCDS3292.1	3q28	2008-02-04	2008-01-16	2008-01-16	ENSG00000188001	ENSG00000188001			24759	protein-coding gene	gene with protein product			"""family with sequence similarity 79, member B"""	FAM79B			Standard	NM_198485		Approved	FLJ41238, FLJ43694	uc003frw.2	Q6ZUI0	OTTHUMG00000156321	ENST00000345063.3:c.71C>T	3.37:g.188925244C>T	ENSP00000341031:p.Ser24Phe			Missense_Mutation	SNP	pfam_Inositol_phosphatase	p.S24F	ENST00000345063.3	37	c.71	CCDS3292.1	3	.	.	.	.	.	.	.	.	.	.	C	10.53	1.376948	0.24857	.	.	ENSG00000188001	ENST00000433971;ENST00000412373;ENST00000345063;ENST00000456832	.	.	.	5.83	4.96	0.65561	.	0.420327	0.27000	N	0.021427	T	0.41073	0.1143	N	0.20986	0.625	0.36562	D	0.8725	B	0.32338	0.365	B	0.37833	0.259	T	0.48433	-0.9036	9	0.30854	T	0.27	-6.2205	10.8536	0.46784	0.0:0.9141:0.0:0.0859	.	24	Q6ZUI0	TPRG1_HUMAN	F	24	.	ENSP00000341031:S24F	S	+	2	0	TPRG1	190407938	0.320000	0.24616	0.744000	0.31058	0.296000	0.27459	1.394000	0.34509	1.488000	0.48433	-0.136000	0.14681	TCT	TPRG1	-	NULL	ENSG00000188001		0.468	TPRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPRG1	HGNC	protein_coding	OTTHUMT00000343931.1	235	0.00	0	C	NM_198485		188925244	188925244	+1	no_errors	ENST00000345063	ensembl	human	known	69_37n	missense	100	40.48	68	SNP	0.922	T
TPTE2	93492	genome.wustl.edu	37	13	20041393	20041394	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr13:20041393_20041394insA	ENST00000400230.2	-	7	527_528	c.483_484insT	c.(481-486)tttgacfs	p.D162fs	TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000400103.2_Intron|TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000457266.2_Intron|TPTE2_ENST00000382975.4_Intron|TPTE2_ENST00000382977.4_Frame_Shift_Ins_p.D162fs|TPTE2_ENST00000382978.1_Intron			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	162					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		AACTTAATGTCAAAAAAAATGT	0.302																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.484dupT	13.37:g.20041401_20041401dupA	ENSP00000383089:p.Asp162fs		A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Frame_Shift_Ins	INS	pfam_Tensin_phosphatase_C2-dom,pfam_Ion_trans_dom,pfam_Dual-sp_phosphatase_cat-dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.D161fs	ENST00000400230.2	37	c.484_483	CCDS45014.1	13																																																																																			TPTE2	-	pfam_Ion_trans_dom	ENSG00000132958		0.302	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TPTE2	HGNC	protein_coding		167	0.00	0	-	NM_199254		20041393	20041394	-1	no_errors	ENST00000382977	ensembl	human	known	69_37n	frame_shift_ins	111	12.60	16	INS	0.051:0.027	A
UBE3D	90025	genome.wustl.edu	37	6	83767586	83767586	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr6:83767586C>T	ENST00000369747.3	-	2	355	c.233G>A	c.(232-234)gGa>gAa	p.G78E		NM_198920.1	NP_944602.1	Q7Z6J8	UBE3D_HUMAN	ubiquitin protein ligase E3D	78					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)										CAGGTGCAGTCCATCTCCAAC	0.468											OREG0017549	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													77.0	76.0	76.0					6																	83767586		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137544	CCDS34491.1	6q15	2012-02-24	2012-02-24	2012-02-24	ENSG00000118420	ENSG00000118420			21381	protein-coding gene	gene with protein product	"""UBCH10 binding protein with a hect-like domain"""	612495	"""chromosome 6 open reading frame 157"", ""ubiquitin-conjugating enzyme E2C binding protein"""	C6orf157, UBE2CBP		15749827	Standard	NM_198920		Approved	DKFZp434A1520, H10BH, YJR141W	uc003pjp.2	Q7Z6J8	OTTHUMG00000015108	ENST00000369747.3:c.233G>A	6.37:g.83767586C>T	ENSP00000358762:p.Gly78Glu	1224	B4DP63|Q5T4W2|Q6IPR4|Q75UG0|Q9NT42	Missense_Mutation	SNP	pfam_UBQ-conj_enz_E2-bd_prot	p.G78E	ENST00000369747.3	37	c.233	CCDS34491.1	6	.	.	.	.	.	.	.	.	.	.	C	20.3	3.973445	0.74246	.	.	ENSG00000118420	ENST00000369747	T	0.27720	1.65	5.27	5.27	0.74061	.	0.051258	0.85682	D	0.000000	T	0.40791	0.1131	L	0.58669	1.825	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.04065	-1.0980	10	0.21540	T	0.41	-19.9961	15.9353	0.79698	0.0:1.0:0.0:0.0	.	78;78	D6RD24;Q7Z6J8	.;UB2CB_HUMAN	E	78	ENSP00000358762:G78E	ENSP00000358762:G78E	G	-	2	0	UBE2CBP	83824305	0.916000	0.31088	0.969000	0.41365	0.777000	0.43975	4.243000	0.58721	2.751000	0.94390	0.650000	0.86243	GGA	UBE3D	-	pfam_UBQ-conj_enz_E2-bd_prot	ENSG00000118420		0.468	UBE3D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3D	HGNC	protein_coding	OTTHUMT00000041347.7	61	0.00	0	C	NM_198920		83767586	83767586	-1	no_errors	ENST00000369747	ensembl	human	known	69_37n	missense	18	40.00	12	SNP	0.984	T
WWP2	11060	genome.wustl.edu	37	16	69970309	69970309	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr16:69970309G>A	ENST00000359154.2	+	19	2172	c.2071G>A	c.(2071-2073)Ggc>Agc	p.G691S	WWP2_ENST00000568684.1_Missense_Mutation_p.G252S|WWP2_ENST00000544162.1_3'UTR|WWP2_ENST00000542271.1_Missense_Mutation_p.G575S|WWP2_ENST00000448661.1_Missense_Mutation_p.G691S|WWP2_ENST00000356003.2_Missense_Mutation_p.G691S	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	691	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GAAGGAGGGCGGCGAGAGCAT	0.597																																						dbGAP											0													86.0	75.0	79.0					16																	69970309		2198	4300	6498	-	-	-	SO:0001583	missense	0			BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.2071G>A	16.37:g.69970309G>A	ENSP00000352069:p.Gly691Ser		A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_WW_Rsp5_WWP	p.G691S	ENST00000359154.2	37	c.2071	CCDS10885.1	16	.	.	.	.	.	.	.	.	.	.	g	23.4	4.407728	0.83340	.	.	ENSG00000198373	ENST00000359154;ENST00000545099;ENST00000448661;ENST00000356003;ENST00000544162;ENST00000542271	T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94	5.56	4.61	0.57282	HECT (4);	0.046687	0.85682	D	0.000000	D	0.90621	0.7059	H	0.95850	3.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93838	0.7134	9	.	.	.	.	16.6588	0.85236	0.0:0.1298:0.8701:0.0	.	691	O00308	WWP2_HUMAN	S	691;252;691;691;578;575	ENSP00000352069:G691S;ENSP00000396871:G691S;ENSP00000348283:G691S;ENSP00000445616:G575S	.	G	+	1	0	WWP2	68527810	1.000000	0.71417	0.049000	0.19019	0.459000	0.32528	8.033000	0.88852	1.370000	0.46153	-0.121000	0.15023	GGC	WWP2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000198373		0.597	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWP2	HGNC	protein_coding	OTTHUMT00000268954.1	23	0.00	0	G	NM_007014		69970309	69970309	+1	no_errors	ENST00000356003	ensembl	human	known	69_37n	missense	1	80.00	4	SNP	0.998	A
ZNF292	23036	genome.wustl.edu	37	6	87969506	87969507	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr6:87969506_87969507delAG	ENST00000369577.3	+	8	6202_6203	c.6159_6160delAG	c.(6157-6162)acagaafs	p.E2054fs	ZNF292_ENST00000339907.4_Frame_Shift_Del_p.E2049fs	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	2054						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		CTGACAAAACAGAAAGTTCTTT	0.366																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.6159_6160delAG	6.37:g.87969506_87969507delAG	ENSP00000358590:p.Glu2054fs		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Frame_Shift_Del	DEL	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E2054fs	ENST00000369577.3	37	c.6159_6160	CCDS47457.1	6																																																																																			ZNF292	-	NULL	ENSG00000188994		0.366	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	106	0.00	0	AG	NM_015021		87969506	87969507	+1	no_errors	ENST00000369577	ensembl	human	known	69_37n	frame_shift_del	24	57.63	34	DEL	0.961:1.000	-
ZNF571	51276	genome.wustl.edu	37	19	38055754	38055754	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr19:38055754C>A	ENST00000328550.2	-	4	1675	c.1576G>T	c.(1576-1578)Ggt>Tgt	p.G526C	ZNF571-AS1_ENST00000587121.1_RNA|ZNF571-AS1_ENST00000589750.1_RNA|ZNF571_ENST00000451802.2_Missense_Mutation_p.G526C|ZNF571-AS1_ENST00000591430.1_RNA|ZNF571-AS1_ENST00000590838.1_RNA|ZNF571-AS1_ENST00000592392.1_RNA|ZNF571_ENST00000358744.3_Missense_Mutation_p.G526C|ZNF571_ENST00000590751.1_Intron|ZNF540_ENST00000592533.1_Intron|ZNF571-AS1_ENST00000586139.1_RNA|ZNF571-AS1_ENST00000585578.1_RNA|ZNF571-AS1_ENST00000589802.1_RNA|ZNF571_ENST00000593133.1_Missense_Mutation_p.G526C|ZNF571-AS1_ENST00000586013.1_RNA			Q7Z3V5	ZN571_HUMAN	zinc finger protein 571	526					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	25			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGTTTTTCACCTCTGTGAATT	0.393																																						dbGAP											0													84.0	88.0	87.0					19																	38055754		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161544	CCDS12505.1	19q13.12	2013-09-20			ENSG00000180479	ENSG00000180479		"""Zinc fingers, C2H2-type"", ""-"""	25000	protein-coding gene	gene with protein product						11042152	Standard	XM_005258977		Approved	HSPC059	uc002ogt.3	Q7Z3V5	OTTHUMG00000182016	ENST00000328550.2:c.1576G>T	19.37:g.38055754C>A	ENSP00000333660:p.Gly526Cys		Q2HIY0|Q3ZCU3|Q9NZX7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G526C	ENST00000328550.2	37	c.1576	CCDS12505.1	19	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172312	0.38315	.	.	ENSG00000180479	ENST00000328550;ENST00000451802;ENST00000358744	T;T;T	0.26660	1.72;1.72;1.72	3.78	2.74	0.32292	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.54902	0.1887	M	0.90019	3.08	0.32977	D	0.523106	D	0.89917	1.0	D	0.87578	0.998	T	0.68288	-0.5448	9	0.87932	D	0	.	10.0968	0.42480	0.0:0.896:0.0:0.104	.	526	Q7Z3V5	ZN571_HUMAN	C	526	ENSP00000333660:G526C;ENSP00000392638:G526C;ENSP00000351594:G526C	ENSP00000333660:G526C	G	-	1	0	ZNF571	42747594	0.022000	0.18835	0.635000	0.29338	0.303000	0.27691	2.536000	0.45693	0.774000	0.33427	0.460000	0.39030	GGT	ZNF571	-	pfscan_Znf_C2H2	ENSG00000180479		0.393	ZNF571-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF571	HGNC	protein_coding	OTTHUMT00000458669.1	346	0.00	0	C	NM_016536		38055754	38055754	-1	no_errors	ENST00000328550	ensembl	human	known	69_37n	missense	302	27.92	117	SNP	0.984	A
ZNF649	65251	genome.wustl.edu	37	19	52395062	52395062	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A06O-01A-11W-A019-09	TCGA-A8-A06O-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	29cd408e-a04b-418a-85e2-6ef95840ddbc	62c57a4a-eaa6-42ee-b8b2-80d44d3edcf8	g.chr19:52395062T>G	ENST00000354957.3	-	5	611	c.327A>C	c.(325-327)agA>agC	p.R109S	CTC-429C10.2_ENST00000600329.1_RNA|ZNF649_ENST00000600738.1_Missense_Mutation_p.R109S	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	109					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		ATTTCAAAGTTCTTCCGTGTT	0.408																																						dbGAP											0													141.0	138.0	139.0					19																	52395062		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.327A>C	19.37:g.52395062T>G	ENSP00000347043:p.Arg109Ser		A8MYJ5|B2RDC4|Q9H9N2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R109S	ENST00000354957.3	37	c.327	CCDS12843.1	19	.	.	.	.	.	.	.	.	.	.	T	10.48	1.361389	0.24684	.	.	ENSG00000198093	ENST00000354957	T	0.05580	3.42	2.49	1.46	0.22682	.	.	.	.	.	T	0.04048	0.0113	N	0.19112	0.55	0.09310	N	1	B	0.21381	0.055	B	0.12156	0.007	T	0.38564	-0.9655	9	0.41790	T	0.15	.	5.4137	0.16361	0.0:0.1585:0.0:0.8415	.	109	Q9BS31	ZN649_HUMAN	S	109	ENSP00000347043:R109S	ENSP00000347043:R109S	R	-	3	2	ZNF649	57086874	0.002000	0.14202	0.016000	0.15963	0.209000	0.24338	1.247000	0.32815	1.150000	0.42419	0.332000	0.21555	AGA	ZNF649	-	NULL	ENSG00000198093		0.408	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF649	HGNC	protein_coding	OTTHUMT00000461097.1	242	0.00	0	T	NM_023074		52395062	52395062	-1	no_errors	ENST00000354957	ensembl	human	known	69_37n	missense	234	14.91	41	SNP	0.206	G
