#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTRT3	84517	genome.wustl.edu	37	3	169485849	169485849	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr3:169485849T>A	ENST00000330368.2	-	2	864	c.490A>T	c.(490-492)Atc>Ttc	p.I164F	RP11-816J6.3_ENST00000602879.1_RNA	NM_032487.4	NP_115876.3	Q9BYD9	ACTT3_HUMAN	actin-related protein T3	164						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)											CCCTCAAAGATGGGCACACTC	0.522																																						dbGAP											0													109.0	98.0	102.0					3																	169485849		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK055346	CCDS3206.1	3q26.2	2012-04-10			ENSG00000184378	ENSG00000184378			24022	protein-coding gene	gene with protein product	"""actin related protein M1"""	608534				11750065, 18692047	Standard	NM_032487		Approved	ARPM1	uc003ffs.2	Q9BYD9		ENST00000330368.2:c.490A>T	3.37:g.169485849T>A	ENSP00000333037:p.Ile164Phe		Q96IS0|Q96NJ0	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.I164F	ENST00000330368.2	37	c.490	CCDS3206.1	3	.	.	.	.	.	.	.	.	.	.	T	11.97	1.796388	0.31777	.	.	ENSG00000184378	ENST00000330368	D	0.96136	-3.92	4.84	2.46	0.29980	.	0.230516	0.30791	N	0.008876	D	0.96787	0.8951	M	0.82923	2.615	0.45056	D	0.998078	P	0.46784	0.884	P	0.60345	0.873	D	0.95686	0.8736	10	0.87932	D	0	.	8.4008	0.32586	0.0:0.1648:0.0:0.8352	.	164	Q9BYD9	ARPM1_HUMAN	F	164	ENSP00000333037:I164F	ENSP00000333037:I164F	I	-	1	0	AC078802.1	170968543	0.998000	0.40836	1.000000	0.80357	0.374000	0.29953	1.115000	0.31209	0.445000	0.26639	0.533000	0.62120	ATC	ACTRT3	-	pfam_Actin-like,smart_Actin-like	ENSG00000184378		0.522	ACTRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTRT3	HGNC	protein_coding	OTTHUMT00000467797.1	50	0.00	0	T	NM_032487		169485849	169485849	-1	no_errors	ENST00000330368	ensembl	human	known	69_37n	missense	190	11.98	26	SNP	1.000	A
AEBP1	165	genome.wustl.edu	37	7	44152266	44152266	+	Missense_Mutation	SNP	C	C	G	rs144799697	byFrequency	TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr7:44152266C>G	ENST00000223357.3	+	18	2632	c.2327C>G	c.(2326-2328)gCc>gGc	p.A776G	MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000450684.2_Missense_Mutation_p.A351G	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	776	Interaction with PTEN. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.A776V(1)		NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						TACGATATGGCCCGCACGCCT	0.652																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											34.0	39.0	37.0					7																	44152266		2203	4299	6502	-	-	-	SO:0001583	missense	0			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.2327C>G	7.37:g.44152266C>G	ENSP00000223357:p.Ala776Gly		Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.A776G	ENST00000223357.3	37	c.2327	CCDS5476.1	7	.	.	.	.	.	.	.	.	.	.	C	10.03	1.238667	0.22711	.	.	ENSG00000106624	ENST00000223357;ENST00000450684	T;T	0.03181	4.02;4.02	5.08	5.08	0.68730	Peptidase M14, carboxypeptidase A (2);	0.283952	0.36665	N	0.002469	T	0.02571	0.0078	N	0.04355	-0.22	0.29216	N	0.874274	B;B	0.20780	0.029;0.048	B;B	0.33960	0.01;0.173	T	0.29119	-1.0022	10	0.46703	T	0.11	-34.3984	7.9417	0.29963	0.1608:0.757:0.0:0.0821	.	351;776	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	G	776;351	ENSP00000223357:A776G;ENSP00000398878:A351G	ENSP00000223357:A776G	A	+	2	0	AEBP1	44118791	0.895000	0.30542	1.000000	0.80357	0.094000	0.18550	1.631000	0.37092	2.533000	0.85409	0.491000	0.48974	GCC	AEBP1	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000106624		0.652	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AEBP1	HGNC	protein_coding	OTTHUMT00000250993.2	27	0.00	0	C	NM_001129		44152266	44152266	+1	no_errors	ENST00000223357	ensembl	human	known	69_37n	missense	4	69.23	9	SNP	0.998	G
AKAP4	8852	genome.wustl.edu	37	X	49957662	49957662	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chrX:49957662C>T	ENST00000376056.2	-	5	1825	c.1675G>A	c.(1675-1677)Gaa>Aaa	p.E559K	AKAP4_ENST00000376064.3_Missense_Mutation_p.E559K|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Missense_Mutation_p.E185K|AKAP4_ENST00000358526.2_Missense_Mutation_p.E568K					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					GGACAGTCTTCTTCACATGTA	0.478																																						dbGAP											0													147.0	113.0	125.0					X																	49957662		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.1675G>A	X.37:g.49957662C>T	ENSP00000365224:p.Glu559Lys			Missense_Mutation	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.E568K	ENST00000376056.2	37	c.1702	CCDS14330.1	X	.	.	.	.	.	.	.	.	.	.	C	11.06	1.528140	0.27299	.	.	ENSG00000147081	ENST00000376056;ENST00000376058;ENST00000358526;ENST00000376064;ENST00000448865	T;T;T;T;T	0.43294	2.72;1.32;2.72;2.72;0.95	5.07	4.21	0.49690	A-kinase anchor 110kDa, C-terminal (1);	0.439896	0.19144	N	0.121618	T	0.35451	0.0932	L	0.57536	1.79	0.09310	N	1	P;P	0.38300	0.626;0.626	B;B	0.34489	0.132;0.184	T	0.19418	-1.0306	9	.	.	.	-5.5203	8.6796	0.34201	0.0:0.8909:0.0:0.1091	.	568;185	Q5JQC9;A6ND82	AKAP4_HUMAN;.	K	559;185;568;559;185	ENSP00000365224:E559K;ENSP00000365226:E185K;ENSP00000351327:E568K;ENSP00000365232:E559K;ENSP00000402403:E185K	.	E	-	1	0	AKAP4	49844402	0.977000	0.34250	0.012000	0.15200	0.144000	0.21451	3.952000	0.56691	0.935000	0.37341	0.525000	0.51046	GAA	AKAP4	-	pfam_AKAP_110_C,smart_AKAP_110	ENSG00000147081		0.478	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP4	HGNC	protein_coding	OTTHUMT00000056552.1	201	0.00	0	C	NM_003886		49957662	49957662	-1	no_errors	ENST00000358526	ensembl	human	known	69_37n	missense	90	39.60	59	SNP	0.051	T
AKAP9	10142	genome.wustl.edu	37	7	91709195	91709195	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr7:91709195G>C	ENST00000359028.2	+	32	8009	c.7784G>C	c.(7783-7785)aGa>aCa	p.R2595T	AKAP9_ENST00000358100.2_Missense_Mutation_p.R2595T|AKAP9_ENST00000356239.3_Missense_Mutation_p.R2583T			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2595	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GAACCTGAAAGAACAAATATT	0.353			T	BRAF	papillary thyroid																																	dbGAP		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													56.0	60.0	58.0					7																	91709195		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.7784G>C	7.37:g.91709195G>C	ENSP00000351922:p.Arg2595Thr		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB-like	p.R2595T	ENST00000359028.2	37	c.7784		7	.	.	.	.	.	.	.	.	.	.	G	2.777	-0.254276	0.05829	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.03468	4.02;4.02;4.01;3.92	4.16	2.2	0.27929	.	0.173853	0.28006	N	0.016963	T	0.04907	0.0132	M	0.62723	1.935	0.09310	N	1	B;P;P;P	0.51933	0.034;0.808;0.949;0.879	B;B;B;B	0.43274	0.04;0.158;0.31;0.414	T	0.37407	-0.9707	10	0.15066	T	0.55	.	9.7573	0.40510	0.0814:0.1408:0.7779:0.0	.	2587;2595;2583;2575	Q99996-6;Q99996;Q99996-2;Q99996-3	.;AKAP9_HUMAN;.;.	T	2583;2595;2595;2587;429	ENSP00000348573:R2583T;ENSP00000351922:R2595T;ENSP00000350813:R2595T;ENSP00000378042:R429T	ENSP00000348573:R2583T	R	+	2	0	AKAP9	91547131	0.100000	0.21855	0.004000	0.12327	0.079000	0.17450	0.974000	0.29436	1.118000	0.41863	0.591000	0.81541	AGA	AKAP9	-	NULL	ENSG00000127914		0.353	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		49	0.00	0	G	NM_005751		91709195	91709195	+1	no_errors	ENST00000359028	ensembl	human	known	69_37n	missense	32	77.93	113	SNP	0.011	C
ANKRD30B	374860	genome.wustl.edu	37	18	14782608	14782608	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr18:14782608T>C	ENST00000358984.4	+	12	1745	c.1565T>C	c.(1564-1566)gTa>gCa	p.V522A	ANKRD30B_ENST00000447268.2_Missense_Mutation_p.V522A|ANKRD30B_ENST00000579292.1_Intron	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	522										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						AATAGAGAAGTAGAAGGTAAG	0.318																																						dbGAP											0													72.0	64.0	67.0					18																	14782608		692	1579	2271	-	-	-	SO:0001583	missense	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1565T>C	18.37:g.14782608T>C	ENSP00000351875:p.Val522Ala		B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V522A	ENST00000358984.4	37	c.1565	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	N	2.650	-0.282201	0.05642	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	T;T	0.05139	3.49;3.49	1.11	-0.132	0.13489	.	.	.	.	.	T	0.07863	0.0197	L	0.29908	0.895	0.09310	N	1	P	0.46395	0.877	P	0.53518	0.728	T	0.30149	-0.9988	9	0.45353	T	0.12	.	3.0377	0.06128	0.0:0.2875:0.0:0.7125	.	522	F8WAG3	.	A	522	ENSP00000351875:V522A;ENSP00000399031:V522A	ENSP00000351875:V522A	V	+	2	0	ANKRD30B	14772608	0.971000	0.33674	0.021000	0.16686	0.327000	0.28475	1.014000	0.29950	-0.013000	0.14199	0.076000	0.15429	GTA	ANKRD30B	-	NULL	ENSG00000180777		0.318	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	91	0.00	0	T	NM_001145029		14782608	14782608	+1	no_errors	ENST00000358984	ensembl	human	known	69_37n	missense	56	51.72	60	SNP	0.026	C
ANKRD36C	400986	genome.wustl.edu	37	2	96546190	96546190	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr2:96546190G>C	ENST00000456556.1	-	58	3538	c.3454C>G	c.(3454-3456)Caa>Gaa	p.Q1152E	ANKRD36C_ENST00000419039.2_Missense_Mutation_p.Q179E|ANKRD36C_ENST00000295246.5_Missense_Mutation_p.Q573E|ANKRD36C_ENST00000420871.2_Missense_Mutation_p.Q403E			Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	1152							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						GTGGATGTTTGTACATCTTTC	0.308																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.3454C>G	2.37:g.96546190G>C	ENSP00000403302:p.Gln1152Glu		C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q1152E	ENST00000456556.1	37	c.3454		2	.	.	.	.	.	.	.	.	.	.	g	9.981	1.228068	0.22542	.	.	ENSG00000174501	ENST00000420871;ENST00000456556;ENST00000419039;ENST00000295246	T;T;T;T	0.37584	4.0;1.19;3.98;1.68	1.4	1.4	0.22301	.	.	.	.	.	T	0.27524	0.0676	N	0.22421	0.69	0.09310	N	1	B	0.31730	0.337	B	0.40256	0.324	T	0.31420	-0.9944	9	0.52906	T	0.07	.	6.2663	0.20928	0.0:0.0:1.0:0.0	.	1152	Q5JPF3	AN36C_HUMAN	E	403;1152;179;573	ENSP00000415231:Q403E;ENSP00000403302:Q1152E;ENSP00000407838:Q179E;ENSP00000295246:Q573E	ENSP00000295246:Q573E	Q	-	1	0	AC073995.2	95909917	0.001000	0.12720	0.014000	0.15608	0.246000	0.25737	0.705000	0.25675	1.086000	0.41228	0.194000	0.17425	CAA	ANKRD36C	-	NULL	ENSG00000174501		0.308	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2	208	0.00	0	G	NM_001010914		96546190	96546190	-1	no_errors	ENST00000456556	ensembl	human	known	69_37n	missense	479	27.53	182	SNP	0.027	C
ANKS1B	56899	genome.wustl.edu	37	12	99192725	99192725	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr12:99192725C>G	ENST00000547776.2	-	21	3253	c.3254G>C	c.(3253-3255)tGt>tCt	p.C1085S	ANKS1B_ENST00000332712.7_Missense_Mutation_p.C275S|ANKS1B_ENST00000547446.1_Missense_Mutation_p.C220S|ANKS1B_ENST00000546960.1_Missense_Mutation_p.C311S|ANKS1B_ENST00000333732.7_Missense_Mutation_p.C115S|ANKS1B_ENST00000549493.2_Missense_Mutation_p.C335S|ANKS1B_ENST00000546568.1_Missense_Mutation_p.C251S|ANKS1B_ENST00000550693.2_Missense_Mutation_p.C275S|ANKS1B_ENST00000549025.2_Missense_Mutation_p.C183S|ANKS1B_ENST00000329257.7_Missense_Mutation_p.C1085S|ANKS1B_ENST00000549558.2_Missense_Mutation_p.C251S|ANKS1B_ENST00000547010.1_Missense_Mutation_p.C601S|ANKS1B_ENST00000341752.7_Missense_Mutation_p.C91S	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	1085	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.					cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		CATTTTTGCACAAGCATCTTG	0.323																																						dbGAP											0													109.0	104.0	106.0					12																	99192725		1818	4075	5893	-	-	-	SO:0001583	missense	0			AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.3254G>C	12.37:g.99192725C>G	ENSP00000449629:p.Cys1085Ser		A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_PTyr_interaction_dom,pfam_SAM_2,pfam_PTB,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,smart_PTyr_interaction_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PTyr_interaction_dom,pfscan_SAM,prints_Ankyrin_rpt	p.C1085S	ENST00000547776.2	37	c.3254	CCDS55872.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.1|25.1	4.600228|4.600228	0.87055|0.87055	.|.	.|.	ENSG00000185046|ENSG00000185046	ENST00000341752;ENST00000549558;ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702;ENST00000550693;ENST00000549025;ENST00000549493;ENST00000547446;ENST00000333732;ENST00000546568;ENST00000332712;ENST00000407362;ENST00000546960|ENST00000550778	T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.19394|.	2.15;2.15;2.15;2.15;2.15;2.15;2.15;2.15;2.15;2.15;2.15;2.15;2.15|.	5.93|5.93	5.93|5.93	0.95920|0.95920	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73705|0.73705	0.3621|0.3621	L|L	0.57536|0.57536	1.79|1.79	0.58432|0.58432	D|D	0.999994|0.999994	D;D;D;D;D;D;P;D;D;B;P;D;B|.	0.76494|.	0.989;0.99;0.992;0.989;0.997;0.992;0.934;0.999;0.99;0.34;0.72;0.997;0.364|.	D;D;D;D;D;D;P;D;D;B;P;D;B|.	0.81914|.	0.985;0.988;0.993;0.915;0.995;0.993;0.84;0.974;0.988;0.257;0.639;0.994;0.439|.	T|T	0.68716|0.68716	-0.5335|-0.5335	10|5	0.87932|.	D|.	0|.	-8.0814|-8.0814	20.3409|20.3409	0.98764|0.98764	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	220;115;115;311;275;225;299;251;335;183;601;1085;251|.	F8VPM3;F8VR14;B7Z9I9;Q7Z6G8-4;Q7Z6G8-5;B1VKB5;F8VQW6;Q7Z6G8-2;Q7Z6G8-3;F8VZR9;Q7Z6G8-6;Q7Z6G8;Q7Z6G8-7|.	.;.;.;.;.;.;.;.;.;.;.;ANS1B_HUMAN;.|.	S|L	91;251;1085;601;1085;600;275;183;335;220;115;251;275;176;311|357	ENSP00000345510:C91S;ENSP00000448993:C251S;ENSP00000449629:C1085S;ENSP00000448512:C601S;ENSP00000331381:C1085S;ENSP00000447999:C275S;ENSP00000447312:C183S;ENSP00000448203:C335S;ENSP00000450015:C220S;ENSP00000331256:C115S;ENSP00000448205:C251S;ENSP00000332683:C275S;ENSP00000447839:C311S|.	ENSP00000331381:C1085S|.	C|V	-|-	2|1	0|0	ANKS1B|ANKS1B	97716856|97716856	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.158000|7.158000	0.77470|0.77470	2.814000|2.814000	0.96858|0.96858	0.655000|0.655000	0.94253|0.94253	TGT|GTG	ANKS1B	-	pfam_PTyr_interaction_dom,pfam_PTB,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	ENSG00000185046		0.323	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ANKS1B	HGNC	protein_coding	OTTHUMT00000408421.3	462	0.00	0	C	NM_020140		99192725	99192725	-1	no_errors	ENST00000329257	ensembl	human	known	69_37n	missense	195	12.16	27	SNP	1.000	G
ARRDC2	27106	genome.wustl.edu	37	19	18120412	18120412	+	Silent	SNP	G	G	C	rs549541387		TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr19:18120412G>C	ENST00000222250.4	+	4	644	c.501G>C	c.(499-501)gcG>gcC	p.A167A	ARRDC2_ENST00000379656.3_Silent_p.A162A|ARRDC2_ENST00000608009.1_3'UTR	NM_015683.1	NP_056498.1	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2	167					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)	12						CACCTCAAGCGGGGGCTCGGG	0.587																																						dbGAP											0													88.0	75.0	80.0					19																	18120412		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12370.1, CCDS32956.1	19p13.12	2008-02-05				ENSG00000105643			25225	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015683		Approved	CLONE24945, PP2703	uc002nhv.3	Q8TBH0		ENST00000222250.4:c.501G>C	19.37:g.18120412G>C			B2RBG9|O95895|Q6ZRV9|Q8WYG6	Silent	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.A167	ENST00000222250.4	37	c.501	CCDS12370.1	19																																																																																			ARRDC2	-	superfamily_Ig_E-set	ENSG00000105643		0.587	ARRDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC2	HGNC	protein_coding	OTTHUMT00000466845.1	38	0.00	0	G	NM_015683		18120412	18120412	+1	no_errors	ENST00000222250	ensembl	human	known	69_37n	silent	21	36.36	12	SNP	0.233	C
ASNSD1	54529	genome.wustl.edu	37	2	190531576	190531576	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr2:190531576C>T	ENST00000260952.4	+	4	1131	c.718C>T	c.(718-720)Cct>Tct	p.P240S	ASNSD1_ENST00000607062.1_Intron	NM_019048.2	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	240					asparagine biosynthetic process (GO:0006529)|glutamine metabolic process (GO:0006541)		asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(3)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			TCTTGAAAAACCTGTTGTTCC	0.363																																						dbGAP											0													75.0	81.0	79.0					2																	190531576		2201	4300	6501	-	-	-	SO:0001583	missense	0			AY116969	CCDS2300.1	2q32.2	2012-09-20			ENSG00000138381	ENSG00000138381			24910	protein-coding gene	gene with protein product							Standard	NM_019048		Approved	NS3TP1, FLJ20752, NBLA00058	uc002uqt.3	Q9NWL6	OTTHUMG00000132665	ENST00000260952.4:c.718C>T	2.37:g.190531576C>T	ENSP00000260952:p.Pro240Ser		D3DPH6|Q3LIC3|Q4ZG45	Missense_Mutation	SNP	pfam_Asn_synthase	p.P240S	ENST00000260952.4	37	c.718	CCDS2300.1	2	.	.	.	.	.	.	.	.	.	.	C	17.77	3.472354	0.63737	.	.	ENSG00000138381	ENST00000260952;ENST00000420250	T;T	0.28895	1.59;1.59	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.55497	0.1924	M	0.76002	2.32	0.80722	D	1	D	0.69078	0.997	P	0.61874	0.895	T	0.39210	-0.9625	10	0.28530	T	0.3	-3.9831	20.8794	0.99867	0.0:1.0:0.0:0.0	.	240	Q9NWL6	ASND1_HUMAN	S	240	ENSP00000260952:P240S;ENSP00000406790:P240S	ENSP00000260952:P240S	P	+	1	0	ASNSD1	190239821	1.000000	0.71417	0.275000	0.24674	0.854000	0.48673	5.723000	0.68492	2.941000	0.99782	0.655000	0.94253	CCT	ASNSD1	-	NULL	ENSG00000138381		0.363	ASNSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASNSD1	HGNC	protein_coding	OTTHUMT00000255919.3	38	0.00	0	C	NM_019048		190531576	190531576	+1	no_errors	ENST00000260952	ensembl	human	known	69_37n	missense	35	22.22	10	SNP	1.000	T
ASTN1	460	genome.wustl.edu	37	1	176992609	176992609	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr1:176992609G>T	ENST00000367654.3	-	7	1580	c.1369C>A	c.(1369-1371)Ccc>Acc	p.P457T	ASTN1_ENST00000424564.2_Missense_Mutation_p.P457T|ASTN1_ENST00000361833.2_Missense_Mutation_p.P457T|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000367657.3_Missense_Mutation_p.P457T	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	457					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						ATGGCCCAGGGTCCGCTGGAG	0.637																																						dbGAP											0													35.0	33.0	34.0					1																	176992609		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1369C>A	1.37:g.176992609G>T	ENSP00000356626:p.Pro457Thr		A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_EGF-like,smart_MACPF,pfscan_Fibronectin_type3	p.P457T	ENST00000367654.3	37	c.1369		1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.863942	0.91511	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.15139	2.45;2.87;2.86;2.46	5.91	5.91	0.95273	.	0.049675	0.85682	D	0.000000	T	0.27205	0.0667	L	0.27053	0.805	0.80722	D	1	D;P;P	0.61080	0.989;0.933;0.844	P;P;B	0.55923	0.787;0.461;0.366	T	0.00754	-1.1580	10	0.87932	D	0	-28.6889	19.8914	0.96931	0.0:0.0:1.0:0.0	.	457;457;457	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	T	457	ENSP00000356629:P457T;ENSP00000354536:P457T;ENSP00000356626:P457T;ENSP00000395041:P457T	ENSP00000354536:P457T	P	-	1	0	ASTN1	175259232	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.644000	0.98468	2.813000	0.96785	0.655000	0.94253	CCC	ASTN1	-	NULL	ENSG00000152092		0.637	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		120	0.00	0	G	NM_004319		176992609	176992609	-1	no_errors	ENST00000367654	ensembl	human	known	69_37n	missense	15	65.91	29	SNP	1.000	T
BACH2	60468	genome.wustl.edu	37	6	90660843	90660844	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr6:90660843_90660844insG	ENST00000257749.4	-	7	1688_1689	c.981_982insC	c.(979-984)gcctgcfs	p.C328fs	BACH2_ENST00000343122.3_Frame_Shift_Ins_p.C328fs|RP3-512E2.2_ENST00000445838.1_RNA|BACH2_ENST00000537989.1_Frame_Shift_Ins_p.C328fs|RP3-512E2.2_ENST00000413986.1_RNA	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	328						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		CTCTCCAGGCAGGCGGCCCCAG	0.634																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.982dupC	6.37:g.90660845_90660845dupG	ENSP00000257749:p.Cys328fs		E1P518|Q59H70|Q5T793|Q9NTS5	Frame_Shift_Ins	INS	pfam_BTB_POZ,pfam_bZIP_1,pfam_bZIP_2,superfamily_BTB/POZ_fold,superfamily_Euk_TF_DNA-bd,smart_BTB/POZ-like,smart_bZIP,pfscan_BTB/POZ-like,pfscan_bZIP	p.C327fs	ENST00000257749.4	37	c.982_981	CCDS5026.1	6																																																																																			BACH2	-	NULL	ENSG00000112182		0.634	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BACH2	HGNC	protein_coding	OTTHUMT00000041522.2	62	0.00	0	-	NM_021813		90660843	90660844	-1	no_errors	ENST00000257749	ensembl	human	known	69_37n	frame_shift_ins	36	10.00	4	INS	0.998:0.989	G
BNC2	54796	genome.wustl.edu	37	9	16738360	16738360	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr9:16738360C>A	ENST00000380672.4	-	2	184	c.127G>T	c.(127-129)Gag>Tag	p.E43*	BNC2_ENST00000380667.2_Nonsense_Mutation_p.E43*|BNC2_ENST00000545497.1_Intron|BNC2_ENST00000380666.2_Nonsense_Mutation_p.E43*	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		CAACATACCTCAATTTGAGAT	0.398																																						dbGAP											0													145.0	123.0	130.0					9																	16738360		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.127G>T	9.37:g.16738360C>A	ENSP00000370047:p.Glu43*			Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E43*	ENST00000380672.4	37	c.127	CCDS6482.2	9	.	.	.	.	.	.	.	.	.	.	C	18.51	3.640740	0.67244	.	.	ENSG00000173068	ENST00000380672;ENST00000456672;ENST00000436939;ENST00000380667;ENST00000380666;ENST00000540340	.	.	.	3.82	2.72	0.32119	.	2.197070	0.01991	N	0.045541	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	2.9903	5.6999	0.17877	0.0:0.8088:0.0:0.1912	.	.	.	.	X	43	.	ENSP00000370041:E43X	E	-	1	0	BNC2	16728360	0.003000	0.15002	0.364000	0.25888	0.076000	0.17211	0.643000	0.24750	0.930000	0.37217	0.579000	0.79373	GAG	BNC2	-	NULL	ENSG00000173068		0.398	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BNC2	HGNC	protein_coding	OTTHUMT00000216901.5	308	0.00	0	C	NM_017637		16738360	16738360	-1	no_errors	ENST00000380672	ensembl	human	known	69_37n	nonsense	177	42.16	129	SNP	0.496	A
BRD9	65980	genome.wustl.edu	37	5	870649	870649	+	Silent	SNP	C	C	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr5:870649C>T	ENST00000467963.1	-	14	1630	c.1464G>A	c.(1462-1464)gaG>gaA	p.E488E	BRD9_ENST00000388890.4_Silent_p.E372E|BRD9_ENST00000483173.1_Silent_p.E435E|BRD9_ENST00000323510.4_Silent_p.E392E	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	488					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			TCGACATGAACTCCAGAACAG	0.483																																						dbGAP											0													146.0	127.0	134.0					5																	870649		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.1464G>A	5.37:g.870649C>T			A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Missense_Mutation	SNP	pfam_DUF3512	p.S109N	ENST00000467963.1	37	c.326	CCDS34127.2	5																																																																																			BRD9	-	pfam_DUF3512	ENSG00000028310		0.483	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD9	HGNC	protein_coding	OTTHUMT00000354113.1	142	0.00	0	C	NM_023924		870649	870649	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000519112	ensembl	human	known	69_37n	missense	61	49.17	59	SNP	0.722	T
CADM4	199731	genome.wustl.edu	37	19	44130299	44130299	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr19:44130299G>A	ENST00000222374.2	-	5	689	c.641C>T	c.(640-642)aCg>aTg	p.T214M	CADM4_ENST00000593506.1_5'Flank	NM_145296.1	NP_660339.1	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4	214	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	12		Prostate(69;0.0199)				CACGTACTGCGTCTGCTTGCT	0.637																																						dbGAP											0													119.0	83.0	96.0					19																	44130299		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF363368	CCDS12627.1	19q13.32	2013-01-29	2007-02-07	2007-02-07		ENSG00000105767		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30825	protein-coding gene	gene with protein product	"""nectin-like 4"""	609744	"""immunoglobulin superfamily, member 4C"""	IGSF4C		11536053	Standard	NM_145296		Approved	TSLL2, Necl-4, SynCAM4	uc002oxc.1	Q8NFZ8		ENST00000222374.2:c.641C>T	19.37:g.44130299G>A	ENSP00000222374:p.Thr214Met		B2R7L5|Q9Y4A4	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_CD80_C2-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like	p.T214M	ENST00000222374.2	37	c.641	CCDS12627.1	19	.	.	.	.	.	.	.	.	.	.	G	15.20	2.761610	0.49468	.	.	ENSG00000105767	ENST00000222374	D	0.86769	-2.17	5.63	5.63	0.86233	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.069389	0.64402	D	0.000011	D	0.87402	0.6168	L	0.55990	1.75	0.33314	D	0.566501	D	0.61080	0.989	P	0.47470	0.548	D	0.90392	0.4396	10	0.42905	T	0.14	.	17.1812	0.86855	0.0:0.0:1.0:0.0	.	214	Q8NFZ8	CADM4_HUMAN	M	214	ENSP00000222374:T214M	ENSP00000222374:T214M	T	-	2	0	CADM4	48822139	1.000000	0.71417	1.000000	0.80357	0.218000	0.24690	4.821000	0.62679	2.664000	0.90586	0.591000	0.81541	ACG	CADM4	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000105767		0.637	CADM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CADM4	HGNC	protein_coding	OTTHUMT00000463352.1	59	0.00	0	G	NM_145296		44130299	44130299	-1	no_errors	ENST00000222374	ensembl	human	known	69_37n	missense	66	29.03	27	SNP	1.000	A
CASP8AP2	9994	genome.wustl.edu	37	6	90583529	90583529	+	RNA	SNP	G	G	T	rs370975833		TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr6:90583529G>T	ENST00000551025.1	+	0	14688									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TTACAGATAAGTTGCTGAATT	0.323																																					Colon(187;1656 2025 17045 31481 39901)	dbGAP											0													51.0	52.0	52.0					6																	90583529		1812	4065	5877	-	-	-			0			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90583529G>T				RNA	SNP	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			CASP8AP2	-	-	ENSG00000118412		0.323	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript		43	0.00	0	G	NM_001137667		90583529	90583529	+1	no_errors	ENST00000237177	ensembl	human	known	69_37n	rna	96	30.43	42	SNP	1.000	T
CASZ1	54897	genome.wustl.edu	37	1	10707928	10707928	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr1:10707928G>A	ENST00000377022.3	-	16	3744	c.3427C>T	c.(3427-3429)Ccc>Tcc	p.P1143S	CASZ1_ENST00000344008.5_Missense_Mutation_p.P1143S|RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1143	Pro-rich.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GTTGCCAAGGGCGAGGCGGGC	0.642																																						dbGAP											0													75.0	79.0	78.0					1																	10707928		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.3427C>T	1.37:g.10707928G>A	ENSP00000366221:p.Pro1143Ser		Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P1143S	ENST00000377022.3	37	c.3427	CCDS41246.1	1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519827	0.85495	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	5.65	4.74	0.60224	.	0.099330	0.64402	N	0.000001	T	0.62011	0.2393	L	0.60455	1.87	0.40496	D	0.980591	P;B	0.51537	0.946;0.433	P;B	0.48840	0.592;0.066	T	0.68104	-0.5497	9	0.72032	D	0.01	-28.3309	14.2312	0.65892	0.0711:0.0:0.9289:0.0	.	1143;1143	Q86V15-2;Q86V15	.;CASZ1_HUMAN	S	1143	.	ENSP00000339445:P1143S	P	-	1	0	CASZ1	10630515	1.000000	0.71417	0.993000	0.49108	0.982000	0.71751	6.567000	0.73983	1.388000	0.46506	0.655000	0.94253	CCC	CASZ1	-	NULL	ENSG00000130940		0.642	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	27	0.00	0	G	NM_017766		10707928	10707928	-1	no_errors	ENST00000377022	ensembl	human	known	69_37n	missense	47	51.04	49	SNP	0.999	A
CCS	9973	genome.wustl.edu	37	11	66367007	66367007	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr11:66367007C>G	ENST00000533244.1	+	4	769	c.328C>G	c.(328-330)Cct>Gct	p.P110A	CCS_ENST00000310190.4_Missense_Mutation_p.P91A	NM_005125.1	NP_005116.1	O14618	CCS_HUMAN	copper chaperone for superoxide dismutase	110	Superoxide dismutase-like.				copper ion transmembrane transport (GO:0035434)|intracellular copper ion transport (GO:0015680)|positive regulation of oxidoreductase activity (GO:0051353)|removal of superoxide radicals (GO:0019430)|superoxide metabolic process (GO:0006801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|protein disulfide oxidoreductase activity (GO:0015035)|superoxide dismutase activity (GO:0004784)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|large_intestine(2)|lung(3)|stomach(1)	9						ACAGCTGACCCCTGAGCGCTG	0.612																																						dbGAP											0													36.0	35.0	35.0					11																	66367007		2200	4295	6495	-	-	-	SO:0001583	missense	0			AF002210	CCDS8146.1	11q13.2	2012-09-20			ENSG00000173992	ENSG00000173992			1613	protein-coding gene	gene with protein product		603864				9295278	Standard	NM_005125		Approved		uc001oir.3	O14618	OTTHUMG00000167238	ENST00000533244.1:c.328C>G	11.37:g.66367007C>G	ENSP00000436318:p.Pro110Ala		Q2M366|Q8NEV0	Missense_Mutation	SNP	pfam_SOD_Cu_Zn_dom,pfam_HeavyMe-assoc_HMA,superfamily_SOD_Cu_Zn_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_SOD_Cu_Zn_dom	p.P110A	ENST00000533244.1	37	c.328	CCDS8146.1	11	.	.	.	.	.	.	.	.	.	.	C	7.781	0.709577	0.15239	.	.	ENSG00000173992	ENST00000533244;ENST00000310190	T;T	0.44482	0.92;0.92	5.23	4.31	0.51392	Superoxide dismutase, copper/zinc binding domain (3);	0.336327	0.31577	N	0.007418	T	0.21022	0.0506	N	0.14661	0.345	0.28874	N	0.894799	B	0.06786	0.001	B	0.06405	0.002	T	0.19031	-1.0318	10	0.07325	T	0.83	.	8.7599	0.34667	0.0:0.897:0.0:0.103	.	110	O14618	CCS_HUMAN	A	110;91	ENSP00000436318:P110A;ENSP00000307870:P91A	ENSP00000307870:P91A	P	+	1	0	CCS	66123583	0.097000	0.21791	0.512000	0.27736	0.827000	0.46813	1.366000	0.34193	1.419000	0.47118	0.655000	0.94253	CCT	CCS	-	pfam_SOD_Cu_Zn_dom,superfamily_SOD_Cu_Zn_dom	ENSG00000173992		0.612	CCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCS	HGNC	protein_coding	OTTHUMT00000393826.1	76	0.00	0	C	NM_005125		66367007	66367007	+1	no_errors	ENST00000533244	ensembl	human	known	69_37n	missense	7	46.15	6	SNP	0.920	G
CDK5RAP1	51654	genome.wustl.edu	37	20	31948286	31948286	+	Silent	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr20:31948286G>A	ENST00000357886.4	-	14	1749	c.1596C>T	c.(1594-1596)cgC>cgT	p.R532R	CDK5RAP1_ENST00000544843.1_3'UTR|CDK5RAP1_ENST00000346416.2_Silent_p.R518R|CDK5RAP1_ENST00000473997.1_Silent_p.R428R|CDK5RAP1_ENST00000339269.5_Silent_p.R441R			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	532	CDK5R1-binding.|TRAM.				brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						CAGTGGCAGAGCGTTTACTGA	0.498																																						dbGAP											0													78.0	72.0	74.0					20																	31948286		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.1596C>T	20.37:g.31948286G>A			A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Missense_Mutation	SNP	pfam_TRAM_dom,pfscan_TRAM_dom	p.A187V	ENST00000357886.4	37	c.560		20	.	.	.	.	.	.	.	.	.	.	G	9.376	1.071689	0.20147	.	.	ENSG00000101391	ENST00000427097	.	.	.	5.05	4.09	0.47781	.	.	.	.	.	T	0.60457	0.2270	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58092	-0.7697	4	.	.	.	-9.1428	10.375	0.44077	0.0962:0.0:0.9038:0.0	.	.	.	.	V	187	.	.	A	-	2	0	CDK5RAP1	31411947	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.350000	0.44063	1.337000	0.45525	0.655000	0.94253	GCT	CDK5RAP1	-	pfam_TRAM_dom,pfscan_TRAM_dom	ENSG00000101391		0.498	CDK5RAP1-011	KNOWN	basic	protein_coding	CDK5RAP1	HGNC	protein_coding	OTTHUMT00000078697.1	63	0.00	0	G	NM_016408		31948286	31948286	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000427097	ensembl	human	putative	69_37n	missense	64	35.35	35	SNP	1.000	A
CEL	1056	genome.wustl.edu	37	9	135946377	135946377	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr9:135946377C>A	ENST00000372080.4	+	11	1513	c.1497C>A	c.(1495-1497)gaC>gaA	p.D499E	CEL_ENST00000351304.7_Missense_Mutation_p.D430E	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	496					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		TCTGCAGGGACCCCAACATGG	0.637																																						dbGAP											0													35.0	44.0	41.0					9																	135946377		2052	4214	6266	-	-	-	SO:0001583	missense	0			M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.1497C>A	9.37:g.135946377C>A	ENSP00000361151:p.Asp499Glu		Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.D499E	ENST00000372080.4	37	c.1497	CCDS43896.1	9	.	.	.	.	.	.	.	.	.	.	C	18.60	3.658916	0.67586	.	.	ENSG00000170835	ENST00000372080;ENST00000351304;ENST00000303626	T;T	0.60672	0.17;0.17	5.04	5.04	0.67666	Carboxylesterase, type B (1);	0.047449	0.85682	D	0.000000	T	0.74458	0.3719	M	0.78223	2.4	0.21897	N	0.999487	D	0.89917	1.0	D	0.85130	0.997	T	0.67726	-0.5596	10	0.87932	D	0	.	11.5144	0.50513	0.0:0.9118:0.0:0.0882	.	496	P19835	CEL_HUMAN	E	499;430;498	ENSP00000361151:D499E;ENSP00000342217:D430E	ENSP00000304021:D498E	D	+	3	2	CEL	134936198	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	1.186000	0.32078	2.351000	0.79841	0.297000	0.19635	GAC	CEL	-	pfam_CarbesteraseB	ENSG00000170835		0.637	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	HGNC	protein_coding	OTTHUMT00000054823.1	43	0.00	0	C			135946377	135946377	+1	no_errors	ENST00000372080	ensembl	human	known	69_37n	missense	32	37.25	19	SNP	1.000	A
CEP76	79959	genome.wustl.edu	37	18	12678227	12678227	+	Missense_Mutation	SNP	G	G	A	rs200920017		TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr18:12678227G>A	ENST00000262127.2	-	10	1729	c.1504C>T	c.(1504-1506)Cct>Tct	p.P502S	CEP76_ENST00000423709.2_Missense_Mutation_p.P427S|PSMG2_ENST00000585331.2_Intron|PSMG2_ENST00000589405.1_Intron	NM_024899.2	NP_079175.2	Q8TAP6	CEP76_HUMAN	centrosomal protein 76kDa	502					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GTAGCTCCAGGAGCACACACA	0.443													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17939	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													252.0	235.0	241.0					18																	12678227		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC026307	CCDS11861.1, CCDS62390.1	18p11.21	2014-02-20	2005-12-01	2005-12-01	ENSG00000101624	ENSG00000101624			25727	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 9"""	C18orf9		14654843	Standard	NM_024899		Approved	HsT1705, FLJ12542	uc002kri.4	Q8TAP6	OTTHUMG00000131701	ENST00000262127.2:c.1504C>T	18.37:g.12678227G>A	ENSP00000262127:p.Pro502Ser		B0YJB2|B4DXG5|B4DZW1|Q658N5|Q9H9U7	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.P502S	ENST00000262127.2	37	c.1504	CCDS11861.1	18	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	13.03	2.114025	0.37339	.	.	ENSG00000101624	ENST00000262127;ENST00000423709	D;D	0.90069	-2.61;-2.61	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.86280	0.5895	L	0.54323	1.7	0.80722	D	1	B;B	0.25955	0.085;0.138	B;B	0.21917	0.023;0.037	T	0.82277	-0.0537	10	0.11182	T	0.66	-8.4781	19.7116	0.96098	0.0:0.0:1.0:0.0	.	427;502	Q8TAP6-2;Q8TAP6	.;CEP76_HUMAN	S	502;427	ENSP00000262127:P502S;ENSP00000403074:P427S	ENSP00000262127:P502S	P	-	1	0	CEP76	12668227	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	7.876000	0.87215	2.660000	0.90430	0.591000	0.81541	CCT	CEP76	-	NULL	ENSG00000101624		0.443	CEP76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP76	HGNC	protein_coding	OTTHUMT00000254611.1	186	0.00	0	G	NM_024899		12678227	12678227	-1	no_errors	ENST00000262127	ensembl	human	known	69_37n	missense	141	46.99	125	SNP	1.000	A
CKAP5	9793	genome.wustl.edu	37	11	46811734	46811734	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr11:46811734T>C	ENST00000529230.1	-	15	1813	c.1767A>G	c.(1765-1767)atA>atG	p.I589M	CKAP5_ENST00000415402.1_Missense_Mutation_p.I589M|CKAP5_ENST00000312055.5_Missense_Mutation_p.I589M|CKAP5_ENST00000354558.3_Missense_Mutation_p.I589M			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	589					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						CACATACTTCTATCTGTAAGA	0.383																																					Ovarian(4;85 273 2202 4844 13323)	dbGAP											0													55.0	54.0	54.0					11																	46811734		2201	4299	6500	-	-	-	SO:0001583	missense	0				CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.1767A>G	11.37:g.46811734T>C	ENSP00000432768:p.Ile589Met		Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.I589M	ENST00000529230.1	37	c.1767	CCDS31477.1	11	.	.	.	.	.	.	.	.	.	.	T	14.36	2.511754	0.44660	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558	T;T;T;T	0.43688	0.94;0.94;0.95;0.95	5.35	-3.74	0.04385	.	0.623042	0.18173	N	0.149392	T	0.24392	0.0591	L	0.36672	1.1	0.36456	D	0.866397	B;B;B	0.23591	0.088;0.001;0.036	B;B;B	0.29598	0.104;0.001;0.034	T	0.04752	-1.0929	10	0.46703	T	0.11	-6.4757	1.348	0.02167	0.3306:0.1262:0.1092:0.434	.	589;589;589	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	M	589	ENSP00000432768:I589M;ENSP00000395302:I589M;ENSP00000310227:I589M;ENSP00000346566:I589M	ENSP00000310227:I589M	I	-	3	3	CKAP5	46768310	0.994000	0.37717	0.986000	0.45419	0.945000	0.59286	0.319000	0.19522	-0.633000	0.05545	0.528000	0.53228	ATA	CKAP5	-	NULL	ENSG00000175216		0.383	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP5	HGNC	protein_coding	OTTHUMT00000390679.1	74	0.00	0	T	NM_014756		46811734	46811734	-1	no_errors	ENST00000415402	ensembl	human	known	69_37n	missense	98	47.87	90	SNP	0.922	C
COL15A1	1306	genome.wustl.edu	37	9	101796852	101796852	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr9:101796852T>G	ENST00000375001.3	+	17	2488	c.2065T>G	c.(2065-2067)Tca>Gca	p.S689A		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	689	Collagen-like 2.|Triple-helical region 2 (COL2).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GCCTAATGGCTCAGTTGGTGA	0.348																																						dbGAP											0													29.0	30.0	30.0					9																	101796852		2181	4296	6477	-	-	-	SO:0001583	missense	0			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.2065T>G	9.37:g.101796852T>G	ENSP00000364140:p.Ser689Ala		Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	pfam_Collagenase_NC10/endostatin,pfam_Collagen,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.S689A	ENST00000375001.3	37	c.2065	CCDS35081.1	9	.	.	.	.	.	.	.	.	.	.	T	14.12	2.440274	0.43326	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	D	0.93366	-3.21	5.11	2.81	0.32909	.	0.281928	0.35407	N	0.003226	D	0.88804	0.6536	N	0.05592	-0.015	0.27026	N	0.964358	D	0.57257	0.979	D	0.74023	0.982	T	0.79692	-0.1697	10	0.09338	T	0.73	-15.3749	6.3414	0.21324	0.0:0.1697:0.0:0.8303	.	689	P39059	COFA1_HUMAN	A	689;659	ENSP00000364140:S689A	ENSP00000364140:S689A	S	+	1	0	COL15A1	100836673	0.896000	0.30565	0.992000	0.48379	0.989000	0.77384	1.077000	0.30741	1.908000	0.55244	0.533000	0.62120	TCA	COL15A1	-	pfam_Collagen	ENSG00000204291		0.348	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL15A1	HGNC	protein_coding	OTTHUMT00000053386.3	24	0.00	0	T	NM_001855		101796852	101796852	+1	no_errors	ENST00000375001	ensembl	human	known	69_37n	missense	24	22.58	7	SNP	0.966	G
COL16A1	1307	genome.wustl.edu	37	1	32157643	32157644	+	In_Frame_Ins	INS	-	-	CGT	rs200545130	byFrequency	TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr1:32157643_32157644insCGT	ENST00000373672.3	-	17	1735_1736	c.1219_1220insACG	c.(1219-1221)gga>gACGga	p.406_407insD	COL16A1_ENST00000373668.3_In_Frame_Ins_p.406_407insD|COL16A1_ENST00000271069.6_In_Frame_Ins_p.406_407insD	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	406	Collagen-like 1.|Triple-helical region 9 (COL9) with 3 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CTTGATGCCTCCGTCGCCCTTC	0.644																																					Colon(143;498 1786 21362 25193 36625)	dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.1217_1219dupACG	1.37:g.32157644_32157646dupCGT	ENSP00000362776:p.Asp406_Asp406dup		Q16593|Q59F89|Q71RG9	In_Frame_Ins	INS	pfam_Collagen,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.407in_frame_insD	ENST00000373672.3	37	c.1220_1219	CCDS41297.1	1																																																																																			COL16A1	-	pfam_Collagen	ENSG00000084636		0.644	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL16A1	HGNC	protein_coding	OTTHUMT00000011057.2	40	0.00	0	-	NM_001856		32157643	32157644	-1	no_errors	ENST00000271069	ensembl	human	known	69_37n	in_frame_ins	15	50.00	15	INS	0.820:0.786	CGT
COL18A1	80781	genome.wustl.edu	37	21	46888327	46888327	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr21:46888327C>A	ENST00000359759.4	+	2	1544	c.1523C>A	c.(1522-1524)tCa>tAa	p.S508*	COL18A1_ENST00000400337.2_Nonsense_Mutation_p.S93*|COL18A1_ENST00000355480.5_Nonsense_Mutation_p.S273*			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	508	Laminin G-like.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CGTGACTTCTCACTGCTGTTC	0.637																																						dbGAP											0													78.0	91.0	87.0					21																	46888327		2095	4224	6319	-	-	-	SO:0001587	stop_gained	0				CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.1523C>A	21.37:g.46888327C>A	ENSP00000352798:p.Ser508*		A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Nonsense_Mutation	SNP	pfam_Collagenase_NC10/endostatin,pfam_DUF959_COL18_N,pfam_Collagen,pfam_Frizzled_dom,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl,superfamily_Frizzled_dom,smart_Frizzled_dom,smart_Laminin_G,pfscan_Frizzled_dom	p.S508*	ENST00000359759.4	37	c.1523		21	.	.	.	.	.	.	.	.	.	.	C	36	5.778366	0.96929	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645	.	.	.	4.5	4.5	0.54988	.	0.138765	0.49305	D	0.000156	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.1401	0.81517	0.0:1.0:0.0:0.0	.	.	.	.	X	93;93;273;508;508	.	ENSP00000347665:S273X	S	+	2	0	COL18A1	45712755	1.000000	0.71417	0.930000	0.37139	0.148000	0.21650	5.487000	0.66863	2.211000	0.71520	0.655000	0.94253	TCA	COL18A1	-	superfamily_ConA-like_lec_gl,smart_Laminin_G	ENSG00000182871		0.637	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	HGNC	protein_coding	OTTHUMT00000206827.1	45	0.00	0	C			46888327	46888327	+1	no_errors	ENST00000359759	ensembl	human	known	69_37n	nonsense	53	26.39	19	SNP	1.000	A
CRB3	92359	genome.wustl.edu	37	19	6465589	6465589	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr19:6465589T>C	ENST00000598494.1	+	3	647	c.116T>C	c.(115-117)gTt>gCt	p.V39A	CRB3_ENST00000308243.7_Missense_Mutation_p.V39A|CRB3_ENST00000600229.1_Missense_Mutation_p.V39A|CRB3_ENST00000356762.3_Missense_Mutation_p.V39A			Q9BUF7	CRUM3_HUMAN	crumbs family member 3	39					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|protein localization to plasma membrane (GO:0072659)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)|SH3 domain binding (GO:0017124)			endometrium(1)|large_intestine(1)|lung(1)	3						AATAGCACTGTTTTGCCTTCA	0.507																																						dbGAP											0													415.0	334.0	361.0					19																	6465589		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF503290	CCDS12166.1, CCDS12167.1	19p13.3	2014-02-06	2014-02-06		ENSG00000130545	ENSG00000130545			20237	protein-coding gene	gene with protein product		609737	"""crumbs homolog 3 (Drosophila)"""				Standard	XM_005259680		Approved	MGC17303	uc002mez.3	Q9BUF7	OTTHUMG00000181828	ENST00000598494.1:c.116T>C	19.37:g.6465589T>C	ENSP00000469707:p.Val39Ala		A8KA91|D6W643|Q8N0V8|Q8WVA0	Missense_Mutation	SNP	NULL	p.V39A	ENST00000598494.1	37	c.116	CCDS12167.1	19	.	.	.	.	.	.	.	.	.	.	T	8.510	0.866360	0.17250	.	.	ENSG00000130545	ENST00000356762;ENST00000308243	.	.	.	3.16	-3.93	0.04143	.	3.154850	0.01056	N	0.004546	T	0.33585	0.0868	L	0.44542	1.39	0.09310	N	1	B;B	0.24426	0.103;0.103	B;B	0.22601	0.04;0.04	T	0.16335	-1.0406	9	0.41790	T	0.15	4.3747	5.9555	0.19271	0.1742:0.5701:0.0:0.2557	.	39;39	Q9BUF7-2;Q9BUF7	.;CRUM3_HUMAN	A	39	.	ENSP00000310123:V39A	V	+	2	0	CRB3	6416589	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.869000	0.04232	-1.053000	0.03218	0.533000	0.62120	GTT	CRB3	-	NULL	ENSG00000130545		0.507	CRB3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	CRB3	HGNC	protein_coding	OTTHUMT00000457837.1	93	0.00	0	T			6465589	6465589	+1	no_errors	ENST00000356762	ensembl	human	known	69_37n	missense	145	35.84	81	SNP	0.000	C
DHX57	90957	genome.wustl.edu	37	2	39046255	39046255	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr2:39046255T>A	ENST00000295373.6	-	18	3449	c.3323A>T	c.(3322-3324)aAc>aTc	p.N1108I		NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	1108							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				CTTTTTCTGGTTAGCTTCTTC	0.348																																					Melanoma(191;1090 2095 4375 23729 47341)	dbGAP											0													68.0	69.0	69.0					2																	39046255		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.3323A>T	2.37:g.39046255T>A	ENSP00000295373:p.Asn1108Ile		A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	pfam_RWD-domain,pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Znf_CCCH,superfamily_UBA-like,superfamily_UBQ-conjugating_enzyme/RWD,smart_Znf_CCCH,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.N1108I	ENST00000295373.6	37	c.3323	CCDS1800.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.5|20.5	4.003406|4.003406	0.74932|0.74932	.|.	.|.	ENSG00000163214|ENSG00000163214	ENST00000295373|ENST00000452978	T|.	0.30448|.	1.53|.	4.97|4.97	4.97|4.97	0.65823|0.65823	Helicase-associated domain (2);|.	0.000000|.	0.64402|.	D|.	0.000017|.	T|.	0.60274|.	0.2256|.	L|L	0.52573|0.52573	1.65|1.65	0.58432|0.58432	D|D	0.999999|0.999999	P;B|.	0.37688|.	0.605;0.131|.	P;B|.	0.45610|.	0.487;0.063|.	T|.	0.58787|.	-0.7575|.	10|.	0.62326|.	D|.	0.03|.	.|.	10.8134|10.8134	0.46559|0.46559	0.1415:0.0:0.0:0.8585|0.1415:0.0:0.0:0.8585	.|.	1108;500|.	Q6P158;Q59G60|.	DHX57_HUMAN;.|.	I|Y	1108|431	ENSP00000295373:N1108I|.	ENSP00000295373:N1108I|.	N|X	-|-	2|3	0|2	DHX57|DHX57	38899759|38899759	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	5.921000|5.921000	0.70028|0.70028	2.001000|2.001000	0.58596|0.58596	0.533000|0.533000	0.62120|0.62120	AAC|TAA	DHX57	-	pfam_Helicase-assoc_dom,smart_Helicase-assoc_dom	ENSG00000163214		0.348	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX57	HGNC	protein_coding	OTTHUMT00000219940.2	109	0.00	0	T	NM_145646		39046255	39046255	-1	no_errors	ENST00000295373	ensembl	human	known	69_37n	missense	462	11.32	59	SNP	1.000	A
DARS	1615	genome.wustl.edu	37	2	136678156	136678156	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr2:136678156C>A	ENST00000264161.4	-	10	1041	c.826G>T	c.(826-828)Gac>Tac	p.D276Y	DARS_ENST00000537273.1_Missense_Mutation_p.D176Y	NM_001349.2	NP_001340.2	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase	276					aspartyl-tRNA aminoacylation (GO:0006422)|gene expression (GO:0010467)|protein complex assembly (GO:0006461)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacylase activity (GO:0004046)|aspartate-tRNA ligase activity (GO:0004815)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(2)	15				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	GTATTAGAGTCTTCCGCTCTG	0.318																																						dbGAP											0													97.0	97.0	97.0					2																	136678156		2202	4300	6502	-	-	-	SO:0001583	missense	0			J05032	CCDS2180.1	2q21.3	2011-07-01			ENSG00000115866	ENSG00000115866	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	2678	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 1, cytoplasmic"""	603084				2674137	Standard	NM_001349		Approved		uc002tux.1	P14868	OTTHUMG00000131741	ENST00000264161.4:c.826G>T	2.37:g.136678156C>A	ENSP00000264161:p.Asp276Tyr		A8K3J2|D3DP77|Q2TNI3|Q32Q69|Q53HV4|Q53YC5|Q68CR9|Q9BW52	Missense_Mutation	SNP	pfam_aa-tRNA-synt_II,pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,pfscan_aa-tRNA-synth_II,prints_Asp/Asn-tRNA-synth_IIb,tigrfam_Asp-tRNA-synth_arc/euk	p.D276Y	ENST00000264161.4	37	c.826	CCDS2180.1	2	.	.	.	.	.	.	.	.	.	.	C	25.5	4.643178	0.87859	.	.	ENSG00000115866	ENST00000264161;ENST00000537273	T;T	0.49139	0.79;0.79	5.59	5.59	0.84812	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.085601	0.85682	D	0.000000	T	0.77287	0.4108	M	0.93062	3.375	0.80722	D	1	D	0.65815	0.995	D	0.71184	0.972	T	0.82248	-0.0551	10	0.87932	D	0	-14.7526	19.9542	0.97213	0.0:1.0:0.0:0.0	.	276	P14868	SYDC_HUMAN	Y	276;176	ENSP00000264161:D276Y;ENSP00000444192:D176Y	ENSP00000264161:D276Y	D	-	1	0	DARS	136394626	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.772000	0.85439	2.788000	0.95919	0.585000	0.79938	GAC	DARS	-	pfam_aa-tRNA-synt_II,pfscan_aa-tRNA-synth_II,prints_Asp/Asn-tRNA-synth_IIb,tigrfam_Asp-tRNA-synth_arc/euk	ENSG00000115866		0.318	DARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DARS	HGNC	protein_coding	OTTHUMT00000254660.5	101	0.00	0	C	NM_001349		136678156	136678156	-1	no_errors	ENST00000264161	ensembl	human	known	69_37n	missense	66	65.80	127	SNP	1.000	A
DISP2	85455	genome.wustl.edu	37	15	40661498	40661498	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr15:40661498C>T	ENST00000267889.3	+	8	3272	c.3185C>T	c.(3184-3186)gCc>gTc	p.A1062V	RP11-64K12.4_ENST00000558421.1_RNA|LINC00594_ENST00000561261.1_lincRNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	1062					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		ACCAGCTGCGCCACAGCCGTG	0.612																																						dbGAP											0													60.0	61.0	61.0					15																	40661498		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.3185C>T	15.37:g.40661498C>T	ENSP00000267889:p.Ala1062Val		Q6AHW3|Q9C0C1	Missense_Mutation	SNP	pfscan_SSD	p.A1062V	ENST00000267889.3	37	c.3185	CCDS10056.1	15	.	.	.	.	.	.	.	.	.	.	C	23.6	4.435514	0.83885	.	.	ENSG00000140323	ENST00000267889	D	0.92348	-3.02	4.88	4.88	0.63580	.	0.054385	0.85682	D	0.000000	D	0.95411	0.8510	M	0.69823	2.125	0.52099	D	0.999942	D	0.76494	0.999	D	0.65684	0.937	D	0.95763	0.8802	10	0.72032	D	0.01	-25.0531	18.2241	0.89911	0.0:1.0:0.0:0.0	.	1062	A7MBM2	DISP2_HUMAN	V	1062	ENSP00000267889:A1062V	ENSP00000267889:A1062V	A	+	2	0	DISP2	38448790	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	7.637000	0.83313	2.527000	0.85204	0.511000	0.50034	GCC	DISP2	-	NULL	ENSG00000140323		0.612	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DISP2	HGNC	protein_coding	OTTHUMT00000252249.1	14	0.00	0	C	NM_033510		40661498	40661498	+1	no_errors	ENST00000267889	ensembl	human	known	69_37n	missense	14	58.82	20	SNP	1.000	T
DNAH2	146754	genome.wustl.edu	37	17	7663178	7663178	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr17:7663178A>T	ENST00000572933.1	+	17	4167	c.2707A>T	c.(2707-2709)Acc>Tcc	p.T903S	DNAH2_ENST00000389173.2_Missense_Mutation_p.T903S			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	903	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCTCTTTTCCACCATCTCTGT	0.532																																						dbGAP											0													299.0	269.0	279.0					17																	7663178		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.2707A>T	17.37:g.7663178A>T	ENSP00000458355:p.Thr903Ser		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.T903S	ENST00000572933.1	37	c.2707	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	A	8.971	0.972927	0.18736	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.22134	1.97	5.35	4.24	0.50183	.	0.296229	0.30118	N	0.010367	T	0.12603	0.0306	N	0.22421	0.69	0.80722	D	1	B	0.17465	0.022	B	0.16289	0.015	T	0.08207	-1.0733	10	0.10377	T	0.69	.	10.6057	0.45392	0.8556:0.0:0.0:0.1444	.	903	Q9P225	DYH2_HUMAN	S	903	ENSP00000373825:T903S	ENSP00000353818:T903S	T	+	1	0	DNAH2	7603903	1.000000	0.71417	0.998000	0.56505	0.332000	0.28634	3.644000	0.54381	0.838000	0.34948	0.402000	0.26972	ACC	DNAH2	-	NULL	ENSG00000183914		0.532	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	188	0.00	0	A	NM_020877		7663178	7663178	+1	no_errors	ENST00000389173	ensembl	human	known	69_37n	missense	171	32.16	82	SNP	1.000	T
DNAH6	1768	genome.wustl.edu	37	2	84897461	84897461	+	Missense_Mutation	SNP	G	G	T	rs568827217		TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr2:84897461G>T	ENST00000237449.6	+	38	6324	c.6316G>T	c.(6316-6318)Gca>Tca	p.A2106S	DNAH6_ENST00000602588.1_Missense_Mutation_p.A127S|DNAH6_ENST00000398278.2_Missense_Mutation_p.A2106S|DNAH6_ENST00000389394.3_Missense_Mutation_p.A2106S			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2106	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GTCTGTGATTGCAAAAGGATT	0.313																																						dbGAP											0													84.0	77.0	79.0					2																	84897461		692	1590	2282	-	-	-	SO:0001583	missense	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.6316G>T	2.37:g.84897461G>T	ENSP00000237449:p.Ala2106Ser		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.A2106S	ENST00000237449.6	37	c.6316	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845650	0.71603	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.56941	0.43;0.43;0.43	5.07	2.3	0.28687	ATPase, AAA+ type, core (1);	.	.	.	.	T	0.58452	0.2123	M	0.82056	2.57	0.42026	D	0.991003	P;B	0.35307	0.494;0.294	B;B	0.41946	0.371;0.343	T	0.59716	-0.7402	9	0.66056	D	0.02	.	10.0016	0.41931	0.2287:0.0:0.7713:0.0	.	2106;2106	Q9C0G6;Q9C0G6-4	DYH6_HUMAN;.	S	2106	ENSP00000374045:A2106S;ENSP00000381326:A2106S;ENSP00000237449:A2106S	ENSP00000237449:A2106S	A	+	1	0	DNAH6	84750972	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.121000	0.41977	0.258000	0.21686	-0.149000	0.13747	GCA	DNAH6	-	smart_AAA+_ATPase	ENSG00000115423		0.313	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	170	0.00	0	G	NM_001370		84897461	84897461	+1	no_errors	ENST00000237449	ensembl	human	known	69_37n	missense	160	15.34	29	SNP	1.000	T
DST	667	genome.wustl.edu	37	6	56458895	56458895	+	Missense_Mutation	SNP	G	G	T	rs368463876		TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr6:56458895G>T	ENST00000361203.3	-	44	11666	c.11659C>A	c.(11659-11661)Cct>Act	p.P3887T	DST_ENST00000312431.6_Missense_Mutation_p.P3887T|DST_ENST00000421834.2_Missense_Mutation_p.P1801T|DST_ENST00000370754.5_Missense_Mutation_p.P4067T|DST_ENST00000244364.6_Missense_Mutation_p.P1475T|DST_ENST00000370788.2_Missense_Mutation_p.P1801T|DST_ENST00000446842.2_Missense_Mutation_p.P3563T|DST_ENST00000370769.4_Missense_Mutation_p.P3889T			Q03001	DYST_HUMAN	dystonin	3887					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTTTCTTCAGGAGAGAGATAC	0.433																																						dbGAP											0													116.0	105.0	109.0					6																	56458895		1923	4137	6060	-	-	-	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.11659C>A	6.37:g.56458895G>T	ENSP00000354508:p.Pro3887Thr		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.P4067T	ENST00000361203.3	37	c.12199		6	.	.	.	.	.	.	.	.	.	.	G	10.88	1.476742	0.26511	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14	5.55	4.66	0.58398	.	0.295883	0.23883	N	0.043627	T	0.39384	0.1076	M	0.72894	2.215	0.28458	N	0.915991	P;P;P;B;P	0.43094	0.799;0.63;0.786;0.099;0.779	B;B;P;B;P	0.54431	0.395;0.434;0.752;0.04;0.69	T	0.26430	-1.0103	9	0.40728	T	0.16	.	10.1666	0.42884	0.0717:0.0:0.7913:0.137	.	1801;3889;4067;3887;1475	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	T	1475;4067;3889;1801;3563;3887;1801;3887	ENSP00000244364:P1475T;ENSP00000359790:P4067T;ENSP00000359805:P3889T;ENSP00000400883:P1801T;ENSP00000393645:P3563T;ENSP00000307959:P3887T;ENSP00000359824:P1801T;ENSP00000354508:P3887T	ENSP00000244364:P1475T	P	-	1	0	DST	56566854	1.000000	0.71417	0.096000	0.21009	0.507000	0.33981	4.058000	0.57463	2.770000	0.95276	0.650000	0.86243	CCT	DST	-	superfamily_ABC_transptrTM_dom_typ1	ENSG00000151914		0.433	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	92	0.00	0	G	NM_001723		56458895	56458895	-1	no_errors	ENST00000370754	ensembl	human	known	69_37n	missense	129	23.67	40	SNP	0.122	T
EDNRB	1910	genome.wustl.edu	37	13	78492256	78492256	+	Silent	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr13:78492256G>A	ENST00000334286.5	-	1	689	c.453C>T	c.(451-453)atC>atT	p.I151I	EDNRB_ENST00000446573.1_Silent_p.I151I|EDNRB_ENST00000475537.1_5'Flank|RNF219-AS1_ENST00000607862.1_RNA|EDNRB_ENST00000377211.4_Silent_p.I241I	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	151					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	TGTCAATGACGATGTGCAGCA	0.512																																						dbGAP											0													130.0	120.0	123.0					13																	78492256		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.453C>T	13.37:g.78492256G>A			A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_ETB_rcpt,prints_Endthln_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Bombsn_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.I151	ENST00000334286.5	37	c.453	CCDS9461.1	13																																																																																			EDNRB	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000136160		0.512	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EDNRB	HGNC	protein_coding	OTTHUMT00000276505.1	79	0.00	0	G			78492256	78492256	-1	no_errors	ENST00000334286	ensembl	human	known	69_37n	silent	78	14.29	13	SNP	0.875	A
EIF1AX	1964	genome.wustl.edu	37	X	20148683	20148683	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chrX:20148683T>G	ENST00000379607.5	-	6	583	c.380A>C	c.(379-381)gAt>gCt	p.D127A	EIF1AX_ENST00000379593.1_Missense_Mutation_p.D99A	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked	127					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(2)|lung(1)|ovary(1)|prostate(1)	5						CTGAATTTCATCATCATCTCC	0.328																																						dbGAP											0													169.0	135.0	147.0					X																	20148683		2203	4294	6497	-	-	-	SO:0001583	missense	0			L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674			3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A		8106356, 9381176	Standard	NM_001412		Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.380A>C	X.37:g.20148683T>G	ENSP00000368927:p.Asp127Ala		B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	Missense_Mutation	SNP	pfam_RNA-binding_domain_S1_IF1,superfamily_NA-bd_OB-fold-like,smart_TIF_eIF-1A,pfscan_RNA-binding_domain_S1_IF1,tigrfam_TIF_eIF-1A	p.D127A	ENST00000379607.5	37	c.380	CCDS14196.1	X	.	.	.	.	.	.	.	.	.	.	T	17.51	3.408656	0.62399	.	.	ENSG00000173674	ENST00000379607;ENST00000379593	T;T	0.49139	0.79;0.79	4.82	4.82	0.62117	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.70833	0.3269	M	0.86651	2.83	0.58432	D	0.999998	P	0.46784	0.884	D	0.66084	0.941	T	0.73600	-0.3931	9	0.42905	T	0.14	-33.2733	13.594	0.61978	0.0:0.0:0.0:1.0	.	127	P47813	IF1AX_HUMAN	A	127;99	ENSP00000368927:D127A;ENSP00000368912:D99A	ENSP00000368912:D99A	D	-	2	0	EIF1AX	20058604	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.286000	0.78671	1.582000	0.49881	0.481000	0.45027	GAT	EIF1AX	-	superfamily_NA-bd_OB-fold-like	ENSG00000173674		0.328	EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF1AX	HGNC	protein_coding	OTTHUMT00000058913.1	121	0.00	0	T			20148683	20148683	-1	no_errors	ENST00000379607	ensembl	human	known	69_37n	missense	144	39.50	94	SNP	1.000	G
ELOVL6	79071	genome.wustl.edu	37	4	110972768	110972768	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr4:110972768G>T	ENST00000394607.3	-	5	687	c.524C>A	c.(523-525)gCc>gAc	p.A175D	ELOVL6_ENST00000302274.3_Missense_Mutation_p.A175D			Q9H5J4	ELOV6_HUMAN	ELOVL fatty acid elongase 6	175					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty acid biosynthetic process (GO:0042759)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	8				OV - Ovarian serous cystadenocarcinoma(123;0.00462)		GTACATCACGGCGTGCACGCC	0.522																																						dbGAP											0													72.0	63.0	66.0					4																	110972768		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027031	CCDS3690.1	4q25	2011-05-25	2011-05-25		ENSG00000170522	ENSG00000170522			15829	protein-coding gene	gene with protein product		611546	"""ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"""			11567032	Standard	NM_024090		Approved	FLJ23378, MGC5487, LCE	uc003hzz.3	Q9H5J4	OTTHUMG00000132547	ENST00000394607.3:c.524C>A	4.37:g.110972768G>T	ENSP00000378105:p.Ala175Asp		Q4W5L0|Q8NCD1	Missense_Mutation	SNP	pfam_GNS1_SUR4	p.A175D	ENST00000394607.3	37	c.524	CCDS3690.1	4	.	.	.	.	.	.	.	.	.	.	G	15.89	2.965630	0.53507	.	.	ENSG00000170522	ENST00000394607;ENST00000302274	T;T	0.26373	1.74;1.74	5.97	5.13	0.70059	.	0.187635	0.56097	D	0.000025	T	0.58337	0.2115	M	0.89715	3.055	0.80722	D	1	D	0.63046	0.992	D	0.73380	0.98	T	0.67476	-0.5661	10	0.56958	D	0.05	-3.0271	15.2299	0.73378	0.0672:0.0:0.9328:0.0	.	175	Q9H5J4	ELOV6_HUMAN	D	175	ENSP00000378105:A175D;ENSP00000304736:A175D	ENSP00000304736:A175D	A	-	2	0	ELOVL6	111192217	1.000000	0.71417	0.214000	0.23707	0.001000	0.01503	9.807000	0.99171	1.534000	0.49203	-0.140000	0.14226	GCC	ELOVL6	-	pfam_GNS1_SUR4	ENSG00000170522		0.522	ELOVL6-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ELOVL6	HGNC	protein_coding	OTTHUMT00000255748.1	56	0.00	0	G	NM_024090		110972768	110972768	-1	no_errors	ENST00000394607	ensembl	human	known	69_37n	missense	28	17.65	6	SNP	1.000	T
ENO3	2027	genome.wustl.edu	37	17	4856110	4856110	+	Missense_Mutation	SNP	C	C	G	rs141245336		TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr17:4856110C>G	ENST00000323997.6	+	3	238	c.106C>G	c.(106-108)Ccc>Gcc	p.P36A	ENO3_ENST00000519584.1_Missense_Mutation_p.P36A|ENO3_ENST00000518175.1_Missense_Mutation_p.P36A	NM_001976.4|NM_053013.3	NP_001967.3|NP_443739.3	P13929	ENOB_HUMAN	enolase 3 (beta, muscle)	36					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|response to drug (GO:0042493)|skeletal muscle tissue regeneration (GO:0043403)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			cervix(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)	15						AGCAGCTGTGCCCAGTGGGGC	0.597																																						dbGAP											0													26.0	27.0	27.0					17																	4856110		2203	4300	6503	-	-	-	SO:0001583	missense	0			X16504	CCDS11062.1, CCDS54070.1	17p13.2	2013-09-19	2004-11-22		ENSG00000108515	ENSG00000108515	4.2.1.11		3354	protein-coding gene	gene with protein product		131370	"""enolase 3, (beta, muscle)"""				Standard	NM_001976		Approved		uc002gab.4	P13929	OTTHUMG00000099394	ENST00000323997.6:c.106C>G	17.37:g.4856110C>G	ENSP00000324105:p.Pro36Ala		B4DUI6|B4DUM6|D3DTL2|E7ENK8|Q96AE2	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N,pfam_MeAsp_NH4-lyase_C,pirsf_Enolase,prints_Enolase,tigrfam_Enolase	p.P36A	ENST00000323997.6	37	c.106	CCDS11062.1	17	.	.	.	.	.	.	.	.	.	.	C	28.5	4.927798	0.92389	.	.	ENSG00000108515	ENST00000522798;ENST00000519602;ENST00000323997;ENST00000522249;ENST00000519584;ENST00000518175	T;T;T;T;T;T	0.56444	0.46;0.46;0.46;0.46;0.46;0.46	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.81578	0.4852	H	0.97564	4.03	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.73708	0.975;0.981	D	0.88150	0.2850	10	0.87932	D	0	-7.8537	15.2036	0.73159	0.0:1.0:0.0:0.0	.	36;36	P13929-3;D3DTL2	.;.	A	36	ENSP00000428502:P36A;ENSP00000430055:P36A;ENSP00000324105:P36A;ENSP00000428811:P36A;ENSP00000430636:P36A;ENSP00000431087:P36A	ENSP00000324105:P36A	P	+	1	0	ENO3	4796856	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.294000	0.78760	2.460000	0.83146	0.655000	0.94253	CCC	ENO3	-	pfam_Enolase_N,pirsf_Enolase,prints_Enolase,tigrfam_Enolase	ENSG00000108515		0.597	ENO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENO3	HGNC	protein_coding	OTTHUMT00000216851.2	188	0.53	1	C			4856110	4856110	+1	no_errors	ENST00000323997	ensembl	human	known	69_37n	missense	58	21.62	16	SNP	1.000	G
ENPP5	59084	genome.wustl.edu	37	6	46129132	46129132	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr6:46129132T>G	ENST00000371383.2	-	5	1625	c.1365A>C	c.(1363-1365)ttA>ttC	p.L455F	ENPP5_ENST00000230565.3_Missense_Mutation_p.L455F					ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)											endometrium(3)|kidney(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	12						GACTGTGAATTAAATGCTTAA	0.353																																						dbGAP											0													51.0	52.0	51.0					6																	46129132		2203	4299	6502	-	-	-	SO:0001583	missense	0			AL035701	CCDS4915.1	6p21.1-p11.2	2010-06-24	2010-06-24		ENSG00000112796	ENSG00000112796			13717	protein-coding gene	gene with protein product						11027689	Standard	XM_005249259		Approved		uc003oxz.1	Q9UJA9	OTTHUMG00000014781	ENST00000371383.2:c.1365A>C	6.37:g.46129132T>G	ENSP00000360436:p.Leu455Phe			Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.L455F	ENST00000371383.2	37	c.1365	CCDS4915.1	6	.	.	.	.	.	.	.	.	.	.	T	13.88	2.368020	0.42003	.	.	ENSG00000112796	ENST00000371383;ENST00000230565	T;T	0.76060	-0.99;-0.99	5.85	5.85	0.93711	.	0.081322	0.50627	D	0.000101	T	0.52191	0.1719	L	0.47716	1.5	0.37004	D	0.895402	B	0.25521	0.128	B	0.23275	0.045	T	0.56866	-0.7908	10	0.39692	T	0.17	-14.203	9.5165	0.39109	0.157:0.0:0.0:0.843	.	455	Q9UJA9	ENPP5_HUMAN	F	455	ENSP00000360436:L455F;ENSP00000230565:L455F	ENSP00000230565:L455F	L	-	3	2	ENPP5	46237091	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.092000	0.50207	2.238000	0.73509	0.533000	0.62120	TTA	ENPP5	-	NULL	ENSG00000112796		0.353	ENPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP5	HGNC	protein_coding	OTTHUMT00000040779.2	97	0.00	0	T			46129132	46129132	-1	no_errors	ENST00000230565	ensembl	human	known	69_37n	missense	22	72.50	58	SNP	1.000	G
EPHB2	2048	genome.wustl.edu	37	1	23191470	23191470	+	Silent	SNP	C	C	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr1:23191470C>T	ENST00000400191.3	+	5	1086	c.1068C>T	c.(1066-1068)ctC>ctT	p.L356L	MIR4253_ENST00000581187.1_RNA|EPHB2_ENST00000374630.3_Silent_p.L356L|EPHB2_ENST00000374632.3_Silent_p.L356L|EPHB2_ENST00000544305.1_Silent_p.L356L|EPHB2_ENST00000465676.1_3'UTR|EPHB2_ENST00000374627.1_Silent_p.L350L	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	356	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		GAGAGGACCTCGTCTACAACA	0.652																																						dbGAP											0													65.0	71.0	69.0					1																	23191470		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.1068C>T	1.37:g.23191470C>T			O43477|Q5T0U6|Q5T0U7|Q5T0U8	Silent	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.L356	ENST00000400191.3	37	c.1068		1																																																																																			EPHB2	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000133216		0.652	EPHB2-001	KNOWN	basic	protein_coding	EPHB2	HGNC	protein_coding	OTTHUMT00000008060.2	30	0.00	0	C	NM_017449		23191470	23191470	+1	no_errors	ENST00000400191	ensembl	human	known	69_37n	silent	6	73.91	17	SNP	0.907	T
EPPK1	83481	genome.wustl.edu	37	8	144940540	144940540	+	Silent	SNP	G	G	A	rs56034452		TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr8:144940540G>A	ENST00000525985.1	-	2	6953	c.6882C>T	c.(6880-6882)ggC>ggT	p.G2294G				P58107	EPIPL_HUMAN	epiplakin 1	2294						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTGGATCTCGCCGCCCACCA	0.706																																						dbGAP											0													90.0	89.0	90.0					8																	144940540		2176	4252	6428	-	-	-	SO:0001819	synonymous_variant	0			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6882C>T	8.37:g.144940540G>A			Q76E58|Q9NSU9	Silent	SNP	pfam_Plectin_repeat,smart_Plectin_repeat	p.G2294	ENST00000525985.1	37	c.6882		8																																																																																			EPPK1	-	pfam_Plectin_repeat,smart_Plectin_repeat	ENSG00000227184		0.706	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	EPPK1	HGNC	protein_coding	OTTHUMT00000382675.1	31	0.00	0	G	NM_031308		144940540	144940540	-1	no_errors	ENST00000525985	ensembl	human	known	69_37n	silent	95	12.84	14	SNP	0.998	A
ERBB4	2066	genome.wustl.edu	37	2	212989493	212989493	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr2:212989493T>A	ENST00000342788.4	-	2	528	c.218A>T	c.(217-219)gAc>gTc	p.D73V	ERBB4_ENST00000402597.1_Missense_Mutation_p.D73V|ERBB4_ENST00000436443.1_Missense_Mutation_p.D73V	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	73					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	GAAGGAGAGGTCCCGGTTGTG	0.512										TSP Lung(8;0.080)																												dbGAP											0													140.0	122.0	128.0					2																	212989493		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.218A>T	2.37:g.212989493T>A	ENSP00000342235:p.Asp73Val		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D73V	ENST00000342788.4	37	c.218	CCDS2394.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.2|26.2	4.717710|4.717710	0.89205|0.89205	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597;ENST00000435846|ENST00000260943	T;T;T;T|.	0.80480|.	-1.38;-1.38;-1.38;-1.38|.	5.43|5.43	5.43|5.43	0.79202|0.79202	EGF receptor, L domain (1);|.	0.115357|.	0.64402|.	D|.	0.000008|.	T|T	0.78194|0.78194	0.4245|0.4245	M|M	0.84326|0.84326	2.69|2.69	0.80722|0.80722	D|D	1|1	P;P;P;P|.	0.51791|.	0.859;0.948;0.859;0.884|.	B;P;B;P|.	0.56514|.	0.422;0.8;0.422;0.558|.	T|T	0.80616|0.80616	-0.1303|-0.1303	10|5	0.87932|.	D|.	0|.	.|.	15.4814|15.4814	0.75530|0.75530	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	73;73;73;73|.	Q15303-4;Q15303-2;Q15303-3;Q15303|.	.;.;.;ERBB4_HUMAN|.	V|S	73;73;73;14|73	ENSP00000342235:D73V;ENSP00000403204:D73V;ENSP00000385565:D73V;ENSP00000405564:D14V|.	ENSP00000342235:D73V|.	D|T	-|-	2|1	0|0	ERBB4|ERBB4	212697738|212697738	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	7.990000|7.990000	0.88215|0.88215	2.061000|2.061000	0.61500|0.61500	0.533000|0.533000	0.62120|0.62120	GAC|ACC	ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_EGF_rcpt_L	ENSG00000178568		0.512	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1	126	0.00	0	T	NM_001042599		212989493	212989493	-1	no_errors	ENST00000342788	ensembl	human	known	69_37n	missense	106	32.48	51	SNP	1.000	A
ESR2	2100	genome.wustl.edu	37	14	64746760	64746760	+	Silent	SNP	T	T	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr14:64746760T>G	ENST00000341099.4	-	3	891	c.474A>C	c.(472-474)ggA>ggC	p.G158G	ESR2_ENST00000555483.1_Intron|ESR2_ENST00000357782.2_Silent_p.G158G|ESR2_ENST00000555278.1_Silent_p.G158G|ESR2_ENST00000557772.1_Silent_p.G158G|ESR2_ENST00000358599.5_Silent_p.G158G|ESR2_ENST00000553796.1_Silent_p.G158G|ESR2_ENST00000267525.6_Silent_p.G158G|ESR2_ENST00000353772.3_Silent_p.G158G|ESR2_ENST00000542956.1_Silent_p.G158G|ESR2_ENST00000554572.1_Silent_p.G158G	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	158					brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	CATAGTGATATCCCGATGCGT	0.463																																						dbGAP											0													244.0	233.0	237.0					14																	64746760		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.474A>C	14.37:g.64746760T>G			A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Estrogen_rcpt_beta_N,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	p.G158	ENST00000341099.4	37	c.474	CCDS9762.1	14																																																																																			ESR2	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	ENSG00000140009		0.463	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESR2	HGNC	protein_coding	OTTHUMT00000280621.1	97	0.00	0	T			64746760	64746760	-1	no_errors	ENST00000341099	ensembl	human	known	69_37n	silent	39	48.00	36	SNP	0.985	G
ETS2	2114	genome.wustl.edu	37	21	40186899	40186899	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr21:40186899A>T	ENST00000360214.3	+	6	959	c.499A>T	c.(499-501)Atc>Ttc	p.I167F	ETS2_ENST00000360938.3_Missense_Mutation_p.I167F	NM_001256295.1	NP_001243224.1	P15036	ETS2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 2	167	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				GGAGCAAATGATCAAAGGTAC	0.507																																						dbGAP											0													137.0	138.0	138.0					21																	40186899		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13659.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157557	ENSG00000157557			3489	protein-coding gene	gene with protein product		164740	"""v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)"""			17986575	Standard	NM_001256295		Approved		uc002yxf.3	P15036	OTTHUMG00000090769	ENST00000360214.3:c.499A>T	21.37:g.40186899A>T	ENSP00000353344:p.Ile167Phe		A6NM68|D3DSH6|Q53Y89	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pirsf_Transforming_factor_C-ets,pfscan_Ets,prints_Ets	p.I167F	ENST00000360214.3	37	c.499	CCDS13659.1	21	.	.	.	.	.	.	.	.	.	.	A	13.67	2.306212	0.40795	.	.	ENSG00000157557	ENST00000360214;ENST00000360938;ENST00000432278;ENST00000456966	T;T;T;T	0.30714	1.57;1.57;1.52;1.57	5.11	3.93	0.45458	Sterile alpha motif/pointed domain (2);Pointed domain (3);	0.343978	0.35495	N	0.003171	T	0.30293	0.0760	L	0.46157	1.445	0.42839	D	0.994045	B;B	0.24043	0.096;0.012	B;B	0.33890	0.172;0.011	T	0.05869	-1.0859	10	0.27082	T	0.32	.	12.1895	0.54261	0.8571:0.1429:0.0:0.0	.	167;167	P15036;C9JAG2	ETS2_HUMAN;.	F	167	ENSP00000353344:I167F;ENSP00000354194:I167F;ENSP00000401273:I167F;ENSP00000411086:I167F	ENSP00000353344:I167F	I	+	1	0	ETS2	39108769	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.772000	0.55325	0.858000	0.35431	0.533000	0.62120	ATC	ETS2	-	pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,pirsf_Transforming_factor_C-ets	ENSG00000157557		0.507	ETS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETS2	HGNC	protein_coding	OTTHUMT00000207544.1	58	0.00	0	A			40186899	40186899	+1	no_errors	ENST00000360214	ensembl	human	known	69_37n	missense	123	15.75	23	SNP	1.000	T
FAM115A	9747	genome.wustl.edu	37	7	143573579	143573579	+	Silent	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr7:143573579C>A	ENST00000479870.1	-	2	331	c.123G>T	c.(121-123)gtG>gtT	p.V41V	FAM115A_ENST00000355951.2_Silent_p.V41V|FAM115A_ENST00000392900.3_Intron	NM_001206938.1|NM_001206941.1|NM_014719.2	NP_001193867.1|NP_001193870.1|NP_055534	Q9Y4C2	F115A_HUMAN	family with sequence similarity 115, member A	41										NS(1)|endometrium(1)|lung(5)	7	Melanoma(164;0.0903)					CCATGTCATTCACCATCACAG	0.552																																						dbGAP											0													111.0	87.0	95.0					7																	143573579		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018281	CCDS5886.1, CCDS56514.1	7q35	2011-05-03	2006-03-23	2006-03-23	ENSG00000198420	ENSG00000198420			22201	protein-coding gene	gene with protein product						9872452	Standard	NM_014719		Approved	KIAA0738	uc003wdo.2	Q9Y4C2	OTTHUMG00000157773	ENST00000479870.1:c.123G>T	7.37:g.143573579C>A			A8K6E0|Q75KM8|Q75KM9|Q7L665|Q9BW63	Silent	SNP	NULL	p.V41	ENST00000479870.1	37	c.123	CCDS5886.1	7																																																																																			FAM115A	-	NULL	ENSG00000198420		0.552	FAM115A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM115A	HGNC	protein_coding	OTTHUMT00000349583.1	121	0.82	1	C	NM_014719		143573579	143573579	-1	no_errors	ENST00000479870	ensembl	human	known	69_37n	silent	39	18.75	9	SNP	1.000	A
FAM149B1	317662	genome.wustl.edu	37	10	74953317	74953317	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr10:74953317G>A	ENST00000242505.6	+	5	682	c.508G>A	c.(508-510)Gaa>Aaa	p.E170K	Y_RNA_ENST00000362331.1_RNA	NM_173348.1	NP_775483.1	Q96BN6	F149B_HUMAN	family with sequence similarity 149, member B1	170										breast(2)|endometrium(1)|kidney(1)|stomach(3)	7						CGCTTCATATGAAACAACCTT	0.373																																						dbGAP											0													167.0	126.0	139.0					10																	74953317		692	1591	2283	-	-	-	SO:0001583	missense	0			AB023191	CCDS44435.1	10q22.2	2008-10-27	2007-11-14	2007-11-14	ENSG00000138286	ENSG00000138286			29162	protein-coding gene	gene with protein product			"""KIAA0974"""	KIAA0974		10231032	Standard	NM_173348		Approved		uc009xqz.3	Q96BN6	OTTHUMG00000067794	ENST00000242505.6:c.508G>A	10.37:g.74953317G>A	ENSP00000242505:p.Glu170Lys		Q9Y2I0	Missense_Mutation	SNP	pfam_DUF3719	p.E170K	ENST00000242505.6	37	c.508	CCDS44435.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.21|14.21	2.467395|2.467395	0.43839|0.43839	.|.	.|.	ENSG00000138286|ENSG00000138286	ENST00000242505|ENST00000372955	T|.	0.42900|.	0.96|.	4.76|4.76	4.76|4.76	0.60689|0.60689	.|.	0.494819|.	0.20834|.	N|.	0.084835|.	T|T	0.61813|0.61813	0.2377|0.2377	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	P;P;P|.	0.44521|.	0.837;0.822;0.787|.	P;B;B|.	0.46543|.	0.52;0.423;0.298|.	T|T	0.59958|0.59958	-0.7356|-0.7356	10|5	0.33141|.	T|.	0.24|.	-6.3937|-6.3937	13.28|13.28	0.60208|0.60208	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	148;170;170|.	B4E0M2;Q96BN6;Q96BN6-2|.	.;F149B_HUMAN;.|.	K|I	170|110	ENSP00000242505:E170K|.	ENSP00000242505:E170K|.	E|M	+|+	1|3	0|0	FAM149B1|FAM149B1	74623323|74623323	0.892000|0.892000	0.30473|0.30473	0.683000|0.683000	0.30040|0.30040	0.433000|0.433000	0.31745|0.31745	3.656000|3.656000	0.54467|0.54467	2.184000|2.184000	0.69523|0.69523	0.591000|0.591000	0.81541|0.81541	GAA|ATG	FAM149B1	-	pfam_DUF3719	ENSG00000138286		0.373	FAM149B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM149B1	HGNC	protein_coding	OTTHUMT00000145438.1	117	0.85	1	G	NM_173348		74953317	74953317	+1	no_errors	ENST00000242505	ensembl	human	known	69_37n	missense	95	24.60	31	SNP	0.919	A
FAM49B	51571	genome.wustl.edu	37	8	130861491	130861491	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr8:130861491C>G	ENST00000519824.2	-	10	1111	c.838G>C	c.(838-840)Gat>Cat	p.D280H	FAM49B_ENST00000522746.1_Missense_Mutation_p.D280H|FAM49B_ENST00000519110.1_Missense_Mutation_p.D280H|FAM49B_ENST00000401979.2_Missense_Mutation_p.D280H|FAM49B_ENST00000522941.1_Missense_Mutation_p.D134H|FAM49B_ENST00000522250.1_Missense_Mutation_p.D134H|FAM49B_ENST00000517654.1_Missense_Mutation_p.D280H|FAM49B_ENST00000519540.1_Missense_Mutation_p.D280H|FAM49B_ENST00000523509.1_Missense_Mutation_p.D280H	NM_016623.4	NP_057707.3	Q9NUQ9	FA49B_HUMAN	family with sequence similarity 49, member B	280						cilium (GO:0005929)|extracellular vesicular exosome (GO:0070062)				kidney(1)|large_intestine(6)|lung(4)|prostate(1)	12	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			TAACTTACATCAATTTTGGAA	0.368																																						dbGAP											0													85.0	82.0	83.0					8																	130861491		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF208851	CCDS6361.1	8q24	2004-08-20				ENSG00000153310			25216	protein-coding gene	gene with protein product							Standard	NM_001256763		Approved	BM-009	uc003ysu.4	Q9NUQ9		ENST00000519824.2:c.838G>C	8.37:g.130861491C>G	ENSP00000429150:p.Asp280His		Q96AZ5|Q9NW21|Q9NZE7	Missense_Mutation	SNP	pfam_DUF1394	p.D280H	ENST00000519824.2	37	c.838	CCDS6361.1	8	.	.	.	.	.	.	.	.	.	.	C	24.1	4.492017	0.84962	.	.	ENSG00000153310	ENST00000522746;ENST00000523509;ENST00000401979;ENST00000519110;ENST00000522250;ENST00000519824;ENST00000517654;ENST00000519540;ENST00000522941	T;T;T;T;T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.76550	0.4003	M	0.87547	2.89	0.80722	D	1	D	0.69078	0.997	D	0.71184	0.972	T	0.78155	-0.2314	10	0.46703	T	0.11	-19.409	18.6619	0.91474	0.0:1.0:0.0:0.0	.	280	Q9NUQ9	FA49B_HUMAN	H	280;280;280;280;134;280;280;280;134	ENSP00000428117:D280H;ENSP00000429802:D280H;ENSP00000384880:D280H;ENSP00000429078:D280H;ENSP00000429978:D134H;ENSP00000429150:D280H;ENSP00000430674:D280H;ENSP00000429499:D280H;ENSP00000430433:D134H	ENSP00000384880:D280H	D	-	1	0	FAM49B	130930673	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	7.750000	0.85110	2.647000	0.89833	0.460000	0.39030	GAT	FAM49B	-	pfam_DUF1394	ENSG00000153310		0.368	FAM49B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM49B	HGNC	protein_coding	OTTHUMT00000380390.2	106	0.00	0	C	NM_016623		130861491	130861491	-1	no_errors	ENST00000401979	ensembl	human	known	69_37n	missense	64	56.16	82	SNP	1.000	G
FAM71B	153745	genome.wustl.edu	37	5	156590407	156590407	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr5:156590407C>G	ENST00000302938.4	-	2	964	c.869G>C	c.(868-870)aGt>aCt	p.S290T		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	290	Ala-rich.					nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGTTGCAGGACTCATTGCTGC	0.552																																						dbGAP											0													135.0	116.0	122.0					5																	156590407		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.869G>C	5.37:g.156590407C>G	ENSP00000305596:p.Ser290Thr		Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	pfam_DUF3699	p.S290T	ENST00000302938.4	37	c.869	CCDS4335.1	5	.	.	.	.	.	.	.	.	.	.	C	9.275	1.046731	0.19748	.	.	ENSG00000170613	ENST00000302938	T	0.04156	3.69	3.57	2.69	0.31865	.	0.858196	0.10107	N	0.715234	T	0.05044	0.0135	L	0.48642	1.525	0.09310	N	1	P	0.44195	0.828	B	0.36244	0.22	T	0.38436	-0.9661	10	0.49607	T	0.09	-0.4259	7.3595	0.26737	0.0:0.8793:0.0:0.1207	.	290	Q8TC56	FA71B_HUMAN	T	290	ENSP00000305596:S290T	ENSP00000305596:S290T	S	-	2	0	FAM71B	156522985	0.002000	0.14202	0.001000	0.08648	0.014000	0.08584	1.485000	0.35519	1.056000	0.40484	0.655000	0.94253	AGT	FAM71B	-	NULL	ENSG00000170613		0.552	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71B	HGNC	protein_coding	OTTHUMT00000252570.2	39	0.00	0	C	NM_130899		156590407	156590407	-1	no_errors	ENST00000302938	ensembl	human	known	69_37n	missense	16	67.35	33	SNP	0.001	G
FAT3	120114	genome.wustl.edu	37	11	92592379	92592379	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr11:92592379T>A	ENST00000298047.6	+	20	11566	c.11549T>A	c.(11548-11550)cTt>cAt	p.L3850H	FAT3_ENST00000525166.1_Missense_Mutation_p.L3700H|FAT3_ENST00000409404.2_Missense_Mutation_p.L3850H|FAT3_ENST00000533797.1_Missense_Mutation_p.L185H			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3850	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AAATATCGGCTTTCTGAAAAT	0.388										TCGA Ovarian(4;0.039)																												dbGAP											0													94.0	91.0	92.0					11																	92592379		1837	4089	5926	-	-	-	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.11549T>A	11.37:g.92592379T>A	ENSP00000298047:p.Leu3850His		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.L3850H	ENST00000298047.6	37	c.11549		11	.	.	.	.	.	.	.	.	.	.	T	24.2	4.500049	0.85176	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51	5.32	5.32	0.75619	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	.	.	.	.	T	0.80303	0.4598	M	0.62088	1.915	0.80722	D	1	D;B	0.71674	0.998;0.023	P;B	0.62298	0.9;0.04	T	0.80821	-0.1211	9	0.46703	T	0.11	.	15.5715	0.76341	0.0:0.0:0.0:1.0	.	3850;3850	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	H	3850;3850;3700;185	ENSP00000298047:L3850H;ENSP00000387040:L3850H;ENSP00000432586:L3700H;ENSP00000436399:L185H	ENSP00000298047:L3850H	L	+	2	0	FAT3	92232027	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.590000	0.82653	2.151000	0.67156	0.533000	0.62120	CTT	FAT3	-	superfamily_ConA-like_lec_gl,pfscan_Laminin_G	ENSG00000165323		0.388	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		168	0.00	0	T	NM_001008781		92592379	92592379	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	missense	60	65.12	112	SNP	1.000	A
MROH5	389690	genome.wustl.edu	37	8	142489350	142489350	+	RNA	SNP	C	C	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr8:142489350C>T	ENST00000430863.1	-	0	1132					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		GGGCCTGCTCCTGCCAAACTG	0.647																																						dbGAP											0													22.0	27.0	25.0					8																	142489350		1968	4131	6099	-	-	-			0					8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142489350C>T				Missense_Mutation	SNP	NULL	p.R351K	ENST00000430863.1	37	c.1052		8																																																																																			AC100803.1	-	NULL	ENSG00000226807		0.647	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	FLJ43860	Clone_based_vega_gene	polymorphic_pseudogene	OTTHUMT00000342412.4	47	0.00	0	C	NM_207414		142489350	142489350	-1	pseudogene	ENST00000430863	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	0.548	T
FLNC	2318	genome.wustl.edu	37	7	128491632	128491632	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr7:128491632G>A	ENST00000325888.8	+	35	6053	c.5792G>A	c.(5791-5793)cGc>cAc	p.R1931H	FLNC_ENST00000346177.6_Missense_Mutation_p.R1898H|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1931					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						ATCATCGTGCGCTTCGATGAC	0.587																																						dbGAP											0													88.0	98.0	95.0					7																	128491632		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5792G>A	7.37:g.128491632G>A	ENSP00000327145:p.Arg1931His		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.R1931H	ENST00000325888.8	37	c.5792	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	G	25.7	4.668335	0.88348	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.85013	-1.93;-1.93	5.7	5.7	0.88788	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.055371	0.64402	D	0.000003	D	0.91040	0.7181	M	0.80982	2.52	0.47374	D	0.999409	D;D	0.63880	0.984;0.993	P;P	0.60345	0.799;0.873	D	0.91843	0.5485	10	0.87932	D	0	.	13.5192	0.61557	0.0803:0.0:0.9197:0.0	.	1898;1931	Q14315-2;Q14315	.;FLNC_HUMAN	H	1931;1898	ENSP00000327145:R1931H;ENSP00000344002:R1898H	ENSP00000327145:R1931H	R	+	2	0	FLNC	128278868	0.953000	0.32496	1.000000	0.80357	0.777000	0.43975	3.037000	0.49775	2.688000	0.91661	0.655000	0.94253	CGC	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.587	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	60	0.00	0	G			128491632	128491632	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	missense	61	16.22	12	SNP	1.000	A
FMNL1	752	genome.wustl.edu	37	17	43314958	43314958	+	Silent	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr17:43314958G>A	ENST00000331495.3	+	9	1182	c.846G>A	c.(844-846)gtG>gtA	p.V282V	CTD-2020K17.3_ENST00000587534.1_RNA|CTD-2020K17.3_ENST00000393507.2_RNA|FMNL1_ENST00000592006.1_3'UTR|FMNL1_ENST00000328118.3_Silent_p.V282V	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	282	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						TGTGCTTGGTGCGGGGAGGAC	0.587																																					GBM(164;1247 1997 8702 11086 51972)	dbGAP											0													141.0	133.0	136.0					17																	43314958		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.846G>A	17.37:g.43314958G>A			D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	Silent	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.V282	ENST00000331495.3	37	c.846	CCDS11497.1	17																																																																																			FMNL1	-	superfamily_ARM-type_fold	ENSG00000184922		0.587	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMNL1	HGNC	protein_coding	OTTHUMT00000450198.1	123	0.00	0	G	NM_005892		43314958	43314958	+1	no_errors	ENST00000328118	ensembl	human	known	69_37n	silent	27	76.92	90	SNP	1.000	A
FMO1	2326	genome.wustl.edu	37	1	171251162	171251162	+	Silent	SNP	C	C	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr1:171251162C>T	ENST00000354841.4	+	6	1004	c.873C>T	c.(871-873)cgC>cgT	p.R291R	FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000367750.3_Silent_p.R291R|FMO1_ENST00000402921.2_Silent_p.R228R	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	291					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	TCCCAGGACGCATCATCACTG	0.418																																						dbGAP											0													78.0	71.0	74.0					1																	171251162		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.873C>T	1.37:g.171251162C>T			A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Silent	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.R291	ENST00000354841.4	37	c.873	CCDS1294.1	1																																																																																			FMO1	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase_1	ENSG00000010932		0.418	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO1	HGNC	protein_coding	OTTHUMT00000086212.1	69	0.00	0	C	NM_002021		171251162	171251162	+1	no_errors	ENST00000354841	ensembl	human	known	69_37n	silent	93	22.50	27	SNP	0.127	T
FRMD6	122786	genome.wustl.edu	37	14	52171538	52171538	+	Missense_Mutation	SNP	G	G	T	rs201228025		TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr14:52171538G>T	ENST00000344768.5	+	6	639	c.443G>T	c.(442-444)cGa>cTa	p.R148L	FRMD6_ENST00000395718.2_Missense_Mutation_p.R140L|FRMD6_ENST00000554167.1_Missense_Mutation_p.R71L|FRMD6_ENST00000356218.4_Missense_Mutation_p.R140L			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	148	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					TGTGTGCTCCGAGAGGAGGCC	0.448																																						dbGAP											0													68.0	65.0	66.0					14																	52171538		2203	4300	6503	-	-	-	SO:0001583	missense	0			BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.443G>T	14.37:g.52171538G>T	ENSP00000343899:p.Arg148Leu		D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.R148L	ENST00000344768.5	37	c.443	CCDS58318.1	14	.	.	.	.	.	.	.	.	.	.	G	17.92	3.505829	0.64410	.	.	ENSG00000139926	ENST00000356218;ENST00000395718;ENST00000344768;ENST00000555936;ENST00000554167;ENST00000557405	T;T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13;-1.13	5.32	4.22	0.49857	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.051293	0.85682	D	0.000000	T	0.81403	0.4815	M	0.69823	2.125	0.80722	D	1	B;P;P	0.34699	0.409;0.464;0.454	B;B;B	0.44085	0.165;0.44;0.366	T	0.83058	-0.0149	10	0.54805	T	0.06	.	14.8439	0.70246	0.0818:0.0:0.9182:0.0	.	71;148;140	G3V4T7;Q96NE9;Q96NE9-2	.;FRMD6_HUMAN;.	L	140;140;148;79;71;38	ENSP00000348550:R140L;ENSP00000379068:R140L;ENSP00000343899:R148L;ENSP00000451453:R79L;ENSP00000451977:R71L;ENSP00000450667:R38L	ENSP00000343899:R148L	R	+	2	0	FRMD6	51241288	1.000000	0.71417	0.993000	0.49108	0.984000	0.73092	5.676000	0.68131	2.483000	0.83821	0.603000	0.83216	CGA	FRMD6	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000139926		0.448	FRMD6-002	KNOWN	basic|CCDS	protein_coding	FRMD6	HGNC	protein_coding	OTTHUMT00000276881.1	110	0.00	0	G	NM_152330		52171538	52171538	+1	no_errors	ENST00000344768	ensembl	human	known	69_37n	missense	14	58.82	20	SNP	0.997	T
FRMD7	90167	genome.wustl.edu	37	X	131212279	131212279	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chrX:131212279C>A	ENST00000298542.4	-	12	1941	c.1766G>T	c.(1765-1767)aGg>aTg	p.R589M	FRMD7_ENST00000464296.1_Missense_Mutation_p.R574M|FRMD7_ENST00000370879.1_Missense_Mutation_p.R469M	NM_194277.2	NP_919253.1	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	589					regulation of neuron projection development (GO:0010975)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Acute lymphoblastic leukemia(192;0.000127)					GCTCTGGGACCTTTTAGGGGT	0.433																																						dbGAP											0													112.0	101.0	104.0					X																	131212279		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL161984	CCDS35397.1	Xq26.2	2014-09-17	2006-09-01	2006-09-01	ENSG00000165694	ENSG00000165694			8079	protein-coding gene	gene with protein product		300628	"""nystagmus 1, congenital"""	NYS, NYS1		2063919, 17013395	Standard	NM_194277		Approved	FLJ43346	uc004ewn.3	Q6ZUT3	OTTHUMG00000022421	ENST00000298542.4:c.1766G>T	X.37:g.131212279C>A	ENSP00000298542:p.Arg589Met		C0LLJ3|Q5JX99	Missense_Mutation	SNP	pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM-adjacent,pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.R589M	ENST00000298542.4	37	c.1766	CCDS35397.1	X	.	.	.	.	.	.	.	.	.	.	C	16.80	3.223052	0.58668	.	.	ENSG00000165694	ENST00000370879;ENST00000298542;ENST00000464296	D;D;D	0.90900	-2.75;-2.37;-2.46	5.26	5.26	0.73747	.	0.000000	0.64402	D	0.000010	D	0.94948	0.8366	M	0.71036	2.16	0.38144	D	0.93853	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.994	D	0.96404	0.9299	10	0.87932	D	0	.	18.0207	0.89253	0.0:1.0:0.0:0.0	.	574;589	Q6ZUT3-2;Q6ZUT3	.;FRMD7_HUMAN	M	469;589;574	ENSP00000359916:R469M;ENSP00000298542:R589M;ENSP00000417996:R574M	ENSP00000298542:R589M	R	-	2	0	FRMD7	131039960	0.999000	0.42202	0.997000	0.53966	0.694000	0.40290	5.868000	0.69605	2.190000	0.69967	0.594000	0.82650	AGG	FRMD7	-	NULL	ENSG00000165694		0.433	FRMD7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD7	HGNC	protein_coding	OTTHUMT00000355031.1	155	0.00	0	C	NM_194277		131212279	131212279	-1	no_errors	ENST00000298542	ensembl	human	known	69_37n	missense	60	50.82	62	SNP	1.000	A
FST	10468	genome.wustl.edu	37	5	52779526	52779526	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr5:52779526A>G	ENST00000256759.3	+	3	853	c.470A>G	c.(469-471)gAa>gGa	p.E157G	FST_ENST00000396947.3_Missense_Mutation_p.E157G	NM_013409.2	NP_037541.1	P19883	FST_HUMAN	follistatin	157	Kazal-like 1. {ECO:0000255|PROSITE- ProRule:PRU00798}.				BMP signaling pathway (GO:0030509)|female gonad development (GO:0008585)|gamete generation (GO:0007276)|hair follicle morphogenesis (GO:0031069)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinocyte proliferation (GO:0043616)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|pattern specification process (GO:0007389)|positive regulation of hair follicle development (GO:0051798)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	activin binding (GO:0048185)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|urinary_tract(1)	15		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				CCAGAACTGGAAGTCCAGTAC	0.502																																						dbGAP											0													59.0	55.0	56.0					5																	52779526		2203	4300	6503	-	-	-	SO:0001583	missense	0			M19481	CCDS3959.1, CCDS43315.1	5q11.2	2008-02-05			ENSG00000134363	ENSG00000134363			3971	protein-coding gene	gene with protein product		136470				10411917, 3380788	Standard	NM_006350		Approved	FS	uc003jpd.3	P19883	OTTHUMG00000131183	ENST00000256759.3:c.470A>G	5.37:g.52779526A>G	ENSP00000256759:p.Glu157Gly		B5BU94|Q9BTH0	Missense_Mutation	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,pfam_Follistatin/Osteonectin_EGF,superfamily_TB_dom,smart_Fol_N,smart_Prot_inh_Kazal	p.E157G	ENST00000256759.3	37	c.470	CCDS3959.1	5	.	.	.	.	.	.	.	.	.	.	A	26.4	4.730627	0.89390	.	.	ENSG00000134363	ENST00000256759;ENST00000511025;ENST00000396947;ENST00000504226	T;T;T	0.04317	3.65;3.65;3.65	5.76	5.76	0.90799	Proteinase inhibitor I1, Kazal (2);	0.136499	0.64402	D	0.000003	T	0.07369	0.0186	L	0.35288	1.05	0.80722	D	1	P	0.44380	0.834	P	0.45167	0.472	T	0.38929	-0.9638	10	0.38643	T	0.18	-19.0179	16.0772	0.80976	1.0:0.0:0.0:0.0	.	157	P19883	FST_HUMAN	G	157;157;157;29	ENSP00000256759:E157G;ENSP00000380151:E157G;ENSP00000426315:E29G	ENSP00000256759:E157G	E	+	2	0	FST	52815283	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.108000	0.94275	2.199000	0.70637	0.402000	0.26972	GAA	FST	-	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal	ENSG00000134363		0.502	FST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FST	HGNC	protein_coding	OTTHUMT00000253906.1	81	0.00	0	A	NM_013409		52779526	52779526	+1	no_errors	ENST00000256759	ensembl	human	known	69_37n	missense	46	33.33	23	SNP	1.000	G
FYCO1	79443	genome.wustl.edu	37	3	46021263	46021263	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr3:46021263G>T	ENST00000296137.2	-	4	427	c.222C>A	c.(220-222)ttC>ttA	p.F74L	FYCO1_ENST00000535325.1_Missense_Mutation_p.F74L	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	74	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		GGCAGGCACAGAAGTAATCCC	0.522																																						dbGAP											0													196.0	177.0	183.0					3																	46021263		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.222C>A	3.37:g.46021263G>T	ENSP00000296137:p.Phe74Leu		B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	pfam_Znf_FYVE,pfam_Run,superfamily_GOLD,superfamily_Znf_FYVE_PHD,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Znf_FYVE,pfscan_GOLD,pfscan_Run,pfscan_Znf_FYVE-rel	p.F74L	ENST00000296137.2	37	c.222	CCDS2734.1	3	.	.	.	.	.	.	.	.	.	.	G	18.75	3.689632	0.68271	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.26660	1.72;1.72	5.6	4.71	0.59529	RUN (2);	0.000000	0.85682	D	0.000000	T	0.21347	0.0514	N	0.21097	0.63	0.51767	D	0.999938	B;B	0.31625	0.145;0.332	B;B	0.35813	0.137;0.211	T	0.06991	-1.0796	10	0.87932	D	0	-27.2782	13.2688	0.60150	0.0749:0.0:0.9251:0.0	.	74;74	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	L	74	ENSP00000296137:F74L;ENSP00000441178:F74L	ENSP00000296137:F74L	F	-	3	2	FYCO1	45996267	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.646000	0.61411	1.334000	0.45468	0.585000	0.79938	TTC	FYCO1	-	pfam_Run,pfscan_Run	ENSG00000163820		0.522	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FYCO1	HGNC	protein_coding	OTTHUMT00000257320.2	240	0.00	0	G	NM_024513		46021263	46021263	-1	no_errors	ENST00000535325	ensembl	human	known	69_37n	missense	163	22.38	47	SNP	1.000	T
GIMAP7	168537	genome.wustl.edu	37	7	150217141	150217141	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr7:150217141A>G	ENST00000313543.4	+	2	236	c.79A>G	c.(79-81)Acc>Gcc	p.T27A		NM_153236.3	NP_694968.1	Q8NHV1	GIMA7_HUMAN	GTPase, IMAP family member 7	27	AIG1-type G.				GTP catabolic process (GO:0006184)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)			breast(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AACAGCGAACACCATCCTTGG	0.512																																						dbGAP											0													72.0	64.0	66.0					7																	150217141		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC027613	CCDS5903.1	7q36.1	2014-04-04			ENSG00000179144	ENSG00000179144		"""GTPases, IMAP"""	22404	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 7"""					15474311	Standard	NM_153236		Approved	MGC27027, IAN7	uc003whk.3	Q8NHV1	OTTHUMG00000157626	ENST00000313543.4:c.79A>G	7.37:g.150217141A>G	ENSP00000315474:p.Thr27Ala			Missense_Mutation	SNP	pfam_AIG1	p.T27A	ENST00000313543.4	37	c.79	CCDS5903.1	7	.	.	.	.	.	.	.	.	.	.	A	17.18	3.325099	0.60634	.	.	ENSG00000179144	ENST00000313543	T	0.05447	3.44	5.09	2.64	0.31445	AIG1 (1);	0.059780	0.64402	D	0.000003	T	0.14743	0.0356	L	0.56199	1.76	0.30913	N	0.728852	D	0.71674	0.998	D	0.72982	0.979	T	0.05338	-1.0891	10	0.66056	D	0.02	.	4.3382	0.11097	0.7335:0.0:0.0932:0.1733	.	27	Q8NHV1	GIMA7_HUMAN	A	27	ENSP00000315474:T27A	ENSP00000315474:T27A	T	+	1	0	GIMAP7	149848074	1.000000	0.71417	0.940000	0.37924	0.590000	0.36582	4.822000	0.62686	0.386000	0.24997	0.533000	0.62120	ACC	GIMAP7	-	pfam_AIG1	ENSG00000179144		0.512	GIMAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP7	HGNC	protein_coding	OTTHUMT00000349277.1	76	0.00	0	A	NM_153236		150217141	150217141	+1	no_errors	ENST00000313543	ensembl	human	known	69_37n	missense	14	48.28	14	SNP	1.000	G
GPATCH1	55094	genome.wustl.edu	37	19	33585132	33585132	+	Silent	SNP	A	A	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr19:33585132A>G	ENST00000170564.2	+	5	824	c.510A>G	c.(508-510)ggA>ggG	p.G170G		NM_018025.2	NP_060495.2	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	170	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|prostate(4)|skin(4)	40	Esophageal squamous(110;0.137)					AAGGACAAGGAGTTGGTCCTC	0.373																																					Pancreas(67;88 1713 4567 18227)	dbGAP											0													111.0	114.0	113.0					19																	33585132		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF434677	CCDS12428.1	19q13.12	2013-01-28		2006-12-13		ENSG00000076650		"""G patch domain containing"""	24658	protein-coding gene	gene with protein product	"""evolutionarily conserved G patch domain containing"""			GPATC1		12477932	Standard	NM_018025		Approved	ECGP, FLJ10206, FLJ38686	uc002nug.1	Q9BRR8		ENST00000170564.2:c.510A>G	19.37:g.33585132A>G			Q8IZV6|Q8N3B7|Q9NW94	Silent	SNP	pfam_DUF1604,pfam_G_patch_dom,superfamily_C-type_lectin_fold,pfscan_G_patch_dom	p.G170	ENST00000170564.2	37	c.510	CCDS12428.1	19																																																																																			GPATCH1	-	pfam_G_patch_dom,superfamily_C-type_lectin_fold,pfscan_G_patch_dom	ENSG00000076650		0.373	GPATCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH1	HGNC	protein_coding	OTTHUMT00000450834.1	139	0.00	0	A	NM_018025		33585132	33585132	+1	no_errors	ENST00000170564	ensembl	human	known	69_37n	silent	171	30.77	76	SNP	1.000	G
HDAC5	10014	genome.wustl.edu	37	17	42170479	42170479	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr17:42170479G>A	ENST00000393622.2	-	6	953	c.622C>T	c.(622-624)Cca>Tca	p.P208S	HDAC5_ENST00000336057.5_Missense_Mutation_p.P208S|HDAC5_ENST00000225983.6_Missense_Mutation_p.P209S|HDAC5_ENST00000586802.1_Missense_Mutation_p.P208S	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	208					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		GGGTGCTGTGGGAGGGAATGG	0.597																																						dbGAP											0													66.0	73.0	71.0					17																	42170479		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.622C>T	17.37:g.42170479G>A	ENSP00000377244:p.Pro208Ser		C9JFV9|O60340|O60528|Q96DY4	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.P209S	ENST00000393622.2	37	c.625	CCDS45696.1	17	.	.	.	.	.	.	.	.	.	.	G	9.631	1.136420	0.21123	.	.	ENSG00000108840	ENST00000225983;ENST00000393622;ENST00000336057	T;T;T	0.49720	0.79;0.79;0.77	4.37	4.37	0.52481	.	0.000000	0.40469	N	0.001098	T	0.29256	0.0728	N	0.11756	0.17	0.41551	D	0.988574	B;B;B;B	0.25312	0.123;0.075;0.045;0.027	B;B;B;B	0.22386	0.039;0.017;0.013;0.01	T	0.10132	-1.0643	10	0.15066	T	0.55	-7.5951	15.8174	0.78615	0.0:0.0:1.0:0.0	.	208;208;209;208	Q9UQL6-2;B4DGT4;Q9UQL6-3;Q9UQL6	.;.;.;HDAC5_HUMAN	S	209;208;208	ENSP00000225983:P209S;ENSP00000377244:P208S;ENSP00000337290:P208S	ENSP00000225983:P209S	P	-	1	0	HDAC5	39526005	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.198000	0.51035	2.267000	0.75376	0.561000	0.74099	CCA	HDAC5	-	pirsf_Histone_deAcase_II_euk	ENSG00000108840		0.597	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC5	HGNC	protein_coding	OTTHUMT00000457686.1	91	0.00	0	G	NM_001015053		42170479	42170479	-1	no_errors	ENST00000225983	ensembl	human	known	69_37n	missense	125	17.76	27	SNP	1.000	A
HDGFRP2	84717	genome.wustl.edu	37	19	4496327	4496327	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr19:4496327C>A	ENST00000301284.4	+	10	1317	c.1253C>A	c.(1252-1254)tCc>tAc	p.S418Y	HDGFRP2_ENST00000586684.1_Missense_Mutation_p.S418Y	NM_001001520.1|NM_032631.2	NP_001001520|NP_116020.1	Q7Z4V5	HDGR2_HUMAN		418					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										AAGCCGCAGTCCTCAAGCACA	0.607																																						dbGAP											0													57.0	76.0	70.0					19																	4496327		2026	4180	6206	-	-	-	SO:0001583	missense	0																														ENST00000301284.4:c.1253C>A	19.37:g.4496327C>A	ENSP00000301284:p.Ser418Tyr		I3L080|K7EQZ6|Q96GI5|Q9BW08	Missense_Mutation	SNP	pfam_LEDGF,pfam_PWWP,smart_PWWP,pfscan_PWWP	p.S418Y	ENST00000301284.4	37	c.1253	CCDS42472.1	19	.	.	.	.	.	.	.	.	.	.	C	11.95	1.792106	0.31685	.	.	ENSG00000167674	ENST00000301284;ENST00000398364	T	0.47528	0.84	4.8	-3.5	0.04710	.	2.869460	0.01178	N	0.007035	T	0.26882	0.0658	N	0.14661	0.345	0.09310	N	1	B;B	0.33379	0.41;0.41	B;B	0.29440	0.102;0.102	T	0.11108	-1.0601	10	0.56958	D	0.05	.	3.2242	0.06726	0.2949:0.3344:0.0:0.3706	.	418;418	C9JEE1;Q7Z4V5	.;HDGR2_HUMAN	Y	418;404	ENSP00000301284:S418Y	ENSP00000301284:S418Y	S	+	2	0	AC011498.1	4447327	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.030000	0.13688	-0.925000	0.03775	-0.258000	0.10820	TCC	CTB-50L17.10	-	NULL	ENSG00000167674		0.607	HDGFRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HDGFRP2	Clone_based_vega_gene	protein_coding	OTTHUMT00000458642.1	147	0.00	0	C			4496327	4496327	+1	no_errors	ENST00000301284	ensembl	human	known	69_37n	missense	50	45.05	41	SNP	0.000	A
HERC4	26091	genome.wustl.edu	37	10	69832857	69832857	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr10:69832857G>T	ENST00000395198.3	-	3	256	c.9C>A	c.(7-9)tgC>tgA	p.C3*	HERC4_ENST00000412272.2_Nonsense_Mutation_p.C3*|HERC4_ENST00000373700.4_Nonsense_Mutation_p.C3*|HERC4_ENST00000395187.2_Nonsense_Mutation_p.C3*|HERC4_ENST00000492996.2_Nonsense_Mutation_p.C3*	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	3					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						CATTTCCCCAGCACAACATGC	0.393																																						dbGAP											0													69.0	66.0	67.0					10																	69832857		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.9C>A	10.37:g.69832857G>T	ENSP00000378624:p.Cys3*		Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Nonsense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,superfamily_HECT,superfamily_Reg_csome_cond/b-lactamase_inh,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.C3*	ENST00000395198.3	37	c.9	CCDS41533.1	10	.	.	.	.	.	.	.	.	.	.	G	38	6.834735	0.97873	.	.	ENSG00000148634	ENST00000412272;ENST00000395198;ENST00000373700;ENST00000395187;ENST00000513996;ENST00000492996;ENST00000506515	.	.	.	4.8	2.94	0.34122	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.3927	0.38383	0.2332:0.0:0.7668:0.0	.	.	.	.	X	3	.	.	C	-	3	2	HERC4	69502863	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.804000	0.38873	0.452000	0.26830	0.591000	0.81541	TGC	HERC4	-	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens	ENSG00000148634		0.393	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC4	HGNC	protein_coding	OTTHUMT00000359262.1	88	0.00	0	G	NM_015601		69832857	69832857	-1	no_errors	ENST00000395198	ensembl	human	known	69_37n	nonsense	88	32.82	43	SNP	1.000	T
HKR1	284459	genome.wustl.edu	37	19	37853955	37853955	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr19:37853955C>T	ENST00000324411.4	+	6	1527	c.1258C>T	c.(1258-1260)Caa>Taa	p.Q420*	HKR1_ENST00000591471.1_Nonsense_Mutation_p.Q147*|HKR1_ENST00000392153.3_Nonsense_Mutation_p.Q401*|HKR1_ENST00000541583.2_Nonsense_Mutation_p.Q359*|HKR1_ENST00000589392.1_Nonsense_Mutation_p.Q402*|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000544914.1_Nonsense_Mutation_p.Q147*	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	420					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGAGTGTGAGCAAGGCTTTAG	0.502																																						dbGAP											0													98.0	101.0	100.0					19																	37853955		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1258C>T	19.37:g.37853955C>T	ENSP00000315505:p.Gln420*		A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q420*	ENST00000324411.4	37	c.1258	CCDS12502.1	19	.	.	.	.	.	.	.	.	.	.	C	37	6.131794	0.97310	.	.	ENSG00000181666	ENST00000544914;ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	.	.	.	3.08	1.89	0.25635	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.7451	0.28864	0.463:0.537:0.0:0.0	.	.	.	.	X	147;401;456;420;359	.	ENSP00000315505:Q420X	Q	+	1	0	HKR1	42545795	0.050000	0.20438	0.952000	0.39060	0.990000	0.78478	3.000000	0.49481	1.719000	0.51432	0.650000	0.86243	CAA	HKR1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181666		0.502	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HKR1	HGNC	protein_coding	OTTHUMT00000458375.1	89	0.00	0	C	NM_181786		37853955	37853955	+1	no_errors	ENST00000324411	ensembl	human	known	69_37n	nonsense	119	34.07	62	SNP	0.975	T
HPS5	11234	genome.wustl.edu	37	11	18313238	18313238	+	Missense_Mutation	SNP	T	T	C	rs557601138		TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr11:18313238T>C	ENST00000349215.3	-	16	2468	c.2191A>G	c.(2191-2193)Agt>Ggt	p.S731G	HPS5_ENST00000396253.3_Missense_Mutation_p.S617G|HPS5_ENST00000352460.3_5'UTR|HPS5_ENST00000438420.2_Missense_Mutation_p.S617G	NM_181507.1	NP_852608.1	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5	731					blood coagulation (GO:0007596)|organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						CGAAGACCACTTGCAATGGCG	0.418									Hermansky-Pudlak syndrome																													dbGAP											0													172.0	160.0	164.0					11																	18313238		2199	4293	6492	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	AB023234	CCDS7836.1, CCDS7837.1	11p14	2014-06-18			ENSG00000110756	ENSG00000110756			17022	protein-coding gene	gene with protein product		607521				10231032, 10094488	Standard	NM_181507		Approved		uc001mod.1	Q9UPZ3	OTTHUMG00000166612	ENST00000349215.3:c.2191A>G	11.37:g.18313238T>C	ENSP00000265967:p.Ser731Gly		A8K6J8|A8K8S1|D3DQX9|D3DQY0|O95942|Q8N4U0	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,pirsf_BLOC-2_complex_Hps5_subunit	p.S731G	ENST00000349215.3	37	c.2191	CCDS7836.1	11	.	.	.	.	.	.	.	.	.	.	T	3.751	-0.051490	0.07407	.	.	ENSG00000110756	ENST00000396253;ENST00000438420;ENST00000349215	T;T;T	0.77358	-1.09;-1.09;-1.09	5.56	0.341	0.15991	.	1.071390	0.07039	N	0.829859	T	0.56673	0.2001	N	0.08118	0	0.09310	N	1	B	0.17852	0.024	B	0.20577	0.03	T	0.41124	-0.9526	10	0.25106	T	0.35	.	6.1154	0.20124	0.0:0.3238:0.343:0.3332	.	731	Q9UPZ3	HPS5_HUMAN	G	617;617;731	ENSP00000379552:S617G;ENSP00000399590:S617G;ENSP00000265967:S731G	ENSP00000265967:S731G	S	-	1	0	HPS5	18269814	0.000000	0.05858	0.000000	0.03702	0.095000	0.18619	0.084000	0.14891	0.024000	0.15214	0.533000	0.62120	AGT	HPS5	-	pirsf_BLOC-2_complex_Hps5_subunit	ENSG00000110756		0.418	HPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS5	HGNC	protein_coding	OTTHUMT00000390808.1	176	0.00	0	T	NM_181507		18313238	18313238	-1	no_errors	ENST00000349215	ensembl	human	known	69_37n	missense	177	28.51	71	SNP	0.000	C
HUNK	30811	genome.wustl.edu	37	21	33355870	33355870	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr21:33355870A>G	ENST00000270112.2	+	8	1565	c.1205A>G	c.(1204-1206)aAg>aGg	p.K402R	HUNK_ENST00000465574.1_3'UTR	NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	402					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						CTCTGCTACAAGACCCGGCTC	0.483																																						dbGAP											0													59.0	63.0	62.0					21																	33355870		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.1205A>G	21.37:g.33355870A>G	ENSP00000270112:p.Lys402Arg			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K402R	ENST00000270112.2	37	c.1205	CCDS13610.1	21	.	.	.	.	.	.	.	.	.	.	A	19.38	3.815765	0.70912	.	.	ENSG00000142149	ENST00000270112;ENST00000439107	T	0.69685	-0.42	4.82	4.82	0.62117	.	0.127320	0.50627	D	0.000104	T	0.56572	0.1994	L	0.27053	0.805	0.43047	D	0.994643	D	0.53151	0.958	P	0.47827	0.558	T	0.54022	-0.8355	10	0.25106	T	0.35	-23.776	10.7255	0.46066	0.8576:0.0:0.0:0.1424	.	402	P57058	HUNK_HUMAN	R	402;16	ENSP00000270112:K402R	ENSP00000270112:K402R	K	+	2	0	HUNK	32277741	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.710000	0.37920	2.144000	0.66660	0.533000	0.62120	AAG	HUNK	-	NULL	ENSG00000142149		0.483	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUNK	HGNC	protein_coding	OTTHUMT00000192782.1	160	0.00	0	A	NM_014586		33355870	33355870	+1	no_errors	ENST00000270112	ensembl	human	known	69_37n	missense	139	22.78	41	SNP	1.000	G
IFIT1B	439996	genome.wustl.edu	37	10	91143779	91143779	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr10:91143779G>T	ENST00000371809.3	+	2	789	c.709G>T	c.(709-711)Gaa>Taa	p.E237*	LIPA_ENST00000371837.1_Intron	NM_001010987.2	NP_001010987.1	Q5T764	IFT1B_HUMAN	interferon-induced protein with tetratricopeptide repeats 1B	237										endometrium(2)|large_intestine(3)|lung(8)	13						AGCTGAAGGAGAAAAGTACAT	0.433																																						dbGAP											0													162.0	173.0	170.0					10																	91143779		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS31242.1	10q23.31	2014-05-22	2010-03-22	2010-03-22	ENSG00000204010	ENSG00000204010		"""Tetratricopeptide (TTC) repeat domain containing"""	23442	protein-coding gene	gene with protein product			"""interferon-induced protein with tetratricopeptide repeats 1-like"""	IFIT1L			Standard	NM_001010987		Approved	bA149I23.6	uc001kgh.3	Q5T764	OTTHUMG00000018709	ENST00000371809.3:c.709G>T	10.37:g.91143779G>T	ENSP00000360874:p.Glu237*		A7E245	Nonsense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E237*	ENST00000371809.3	37	c.709	CCDS31242.1	10	.	.	.	.	.	.	.	.	.	.	G	13.56	2.274605	0.40194	.	.	ENSG00000204010	ENST00000371809	.	.	.	4.05	2.15	0.27550	.	0.440630	0.23782	N	0.044606	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	9.1239	0.36803	0.1812:0.0:0.8188:0.0	.	.	.	.	X	237	.	ENSP00000360874:E237X	E	+	1	0	IFIT1B	91133759	0.997000	0.39634	0.860000	0.33809	0.063000	0.16089	1.666000	0.37460	0.348000	0.23949	0.557000	0.71058	GAA	IFIT1B	-	pfscan_TPR-contain_dom	ENSG00000204010		0.433	IFIT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIT1B	HGNC	protein_coding	OTTHUMT00000049296.3	135	0.00	0	G	NM_001010987		91143779	91143779	+1	no_errors	ENST00000371809	ensembl	human	known	69_37n	nonsense	59	41.00	41	SNP	0.988	T
IGSF10	285313	genome.wustl.edu	37	3	151165107	151165107	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr3:151165107G>C	ENST00000282466.3	-	4	2661	c.2662C>G	c.(2662-2664)Caa>Gaa	p.Q888E		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	888					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GATGAATGTTGATTGGTTGTG	0.428																																						dbGAP											0													357.0	356.0	356.0					3																	151165107		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.2662C>G	3.37:g.151165107G>C	ENSP00000282466:p.Gln888Glu		Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.Q888E	ENST00000282466.3	37	c.2662	CCDS3160.1	3	.	.	.	.	.	.	.	.	.	.	G	2.297	-0.361190	0.05103	.	.	ENSG00000152580	ENST00000282466	T	0.65916	-0.18	5.41	4.53	0.55603	.	0.536026	0.15865	N	0.240805	T	0.33990	0.0882	N	0.08118	0	0.09310	N	1	B	0.15473	0.013	B	0.10450	0.005	T	0.29366	-1.0014	10	0.05351	T	0.99	.	6.9843	0.24719	0.0706:0.1267:0.6716:0.1311	.	888	Q6WRI0	IGS10_HUMAN	E	888	ENSP00000282466:Q888E	ENSP00000282466:Q888E	Q	-	1	0	IGSF10	152647797	0.002000	0.14202	0.001000	0.08648	0.332000	0.28634	1.179000	0.31993	1.252000	0.44001	0.591000	0.81541	CAA	IGSF10	-	NULL	ENSG00000152580		0.428	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1	216	0.00	0	G	NM_178822		151165107	151165107	-1	no_errors	ENST00000282466	ensembl	human	known	69_37n	missense	122	47.86	112	SNP	0.003	C
IFNLR1	163702	genome.wustl.edu	37	1	24496055	24496055	+	Silent	SNP	C	C	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr1:24496055C>T	ENST00000327535.1	-	3	231	c.219G>A	c.(217-219)gaG>gaA	p.E73E	IFNLR1_ENST00000374421.3_Silent_p.E73E|IFNLR1_ENST00000374419.1_De_novo_Start_OutOfFrame|IFNLR1_ENST00000374418.3_Silent_p.E73E|IFNLR1_ENST00000327575.2_Silent_p.E73E	NM_170743.3|NM_173064.2	NP_734464.1|NP_775087.1	Q8IU57	INLR1_HUMAN	interferon, lambda receptor 1	73	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mucosal immune response (GO:0002385)|negative regulation of cell proliferation (GO:0008285)|regulation of defense response to virus by host (GO:0050691)|response to type III interferon (GO:0034342)	integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)											TTCCCGCACACTCTTCCACTT	0.582																																						dbGAP											0													93.0	89.0	90.0					1																	24496055		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY129153	CCDS248.1, CCDS249.1, CCDS250.1	1p36.11	2012-11-27	2012-11-26	2012-11-26	ENSG00000185436	ENSG00000185436		"""Interferons"""	18584	protein-coding gene	gene with protein product	"""interferon lambda receptor 1"""	607404	"""interleukin 28 receptor, alpha"", ""interleukin 28 receptor, alpha (interferon, lambda receptor)"""	IL28RA			Standard	NM_173064		Approved	CRF2/12, IFNLR, IL-28R1	uc001bis.3	Q8IU57	OTTHUMG00000003036	ENST00000327535.1:c.219G>A	1.37:g.24496055C>T			Q5VTX5|Q5VTX7|Q5VTX8|Q6ZML8|Q8IV66|Q8IZI7|Q8IZI8	Silent	SNP	superfamily_Fibronectin_type3	p.E73	ENST00000327535.1	37	c.219	CCDS248.1	1																																																																																			IL28RA	-	superfamily_Fibronectin_type3	ENSG00000185436		0.582	IFNLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL28RA	HGNC	protein_coding	OTTHUMT00000008402.1	47	0.00	0	C	NM_170743		24496055	24496055	-1	no_errors	ENST00000327535	ensembl	human	known	69_37n	silent	22	38.89	14	SNP	0.000	T
IQGAP2	10788	genome.wustl.edu	37	5	75993880	75993880	+	Silent	SNP	G	G	C	rs374869048		TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr5:75993880G>C	ENST00000274364.6	+	33	4572	c.4275G>C	c.(4273-4275)ctG>ctC	p.L1425L	IQGAP2_ENST00000396234.3_Silent_p.L921L|IQGAP2_ENST00000502745.1_Silent_p.L921L|CTD-2384B11.2_ENST00000507514.1_RNA|IQGAP2_ENST00000379730.3_Silent_p.L927L	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1425					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AGCAGACCCTGAATGCACTTA	0.323																																						dbGAP											0													77.0	75.0	76.0					5																	75993880		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.4275G>C	5.37:g.75993880G>C			A8K4V1|B7Z8A4|J3KR91	Silent	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_Rsp5_WWP,pfscan_RasGAP	p.L1425	ENST00000274364.6	37	c.4275	CCDS34188.1	5																																																																																			IQGAP2	-	pfam_RasGAP_C	ENSG00000145703		0.323	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP2	HGNC	protein_coding	OTTHUMT00000368877.1	143	0.00	0	G	NM_006633		75993880	75993880	+1	no_errors	ENST00000274364	ensembl	human	known	69_37n	silent	55	61.81	89	SNP	1.000	C
LCE2D	353141	genome.wustl.edu	37	1	152636666	152636666	+	Missense_Mutation	SNP	C	C	T	rs550712261		TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr1:152636666C>T	ENST00000368784.1	+	2	140	c.85C>T	c.(85-87)Ccc>Tcc	p.P29S		NM_178430.2	NP_848517.1	Q5TA82	LCE2D_HUMAN	late cornified envelope 2D	29	Cys-rich.				keratinization (GO:0031424)					large_intestine(1)|lung(7)|prostate(2)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACCTAAGTGTCCCCCCAAATG	0.597													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14777	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													115.0	121.0	119.0					1																	152636666		2203	4300	6503	-	-	-	SO:0001583	missense	0			BI670513	CCDS1018.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000187223	ENSG00000187223		"""Late cornified envelopes"""	16518	protein-coding gene	gene with protein product		612612	"""small proline rich-like (epidermal differentiation complex) 1A"""	SPRL1A		11698679	Standard	NM_178430		Approved	LEP12	uc001fag.4	Q5TA82	OTTHUMG00000014400	ENST00000368784.1:c.85C>T	1.37:g.152636666C>T	ENSP00000357773:p.Pro29Ser		A1L4M8	Missense_Mutation	SNP	NULL	p.P29S	ENST00000368784.1	37	c.85	CCDS1018.1	1	.	.	.	.	.	.	.	.	.	.	C	0.022	-1.416684	0.01136	.	.	ENSG00000187223	ENST00000368784	T	0.12774	2.65	2.11	1.1	0.20463	.	.	.	.	.	T	0.07773	0.0195	M	0.88241	2.94	0.09310	N	1	P	0.47962	0.903	B	0.37508	0.252	T	0.17077	-1.0381	9	0.87932	D	0	.	5.3162	0.15856	0.3365:0.6635:0.0:0.0	.	29	Q5TA82	LCE2D_HUMAN	S	29	ENSP00000357773:P29S	ENSP00000357773:P29S	P	+	1	0	LCE2D	150903290	0.013000	0.17824	0.006000	0.13384	0.053000	0.15095	0.610000	0.24253	0.043000	0.15746	0.305000	0.20034	CCC	LCE2D	-	NULL	ENSG00000187223		0.597	LCE2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE2D	HGNC	protein_coding	OTTHUMT00000040058.1	320	0.31	1	C	NM_178430		152636666	152636666	+1	no_errors	ENST00000368784	ensembl	human	known	69_37n	missense	435	35.50	240	SNP	0.080	T
ITPKB	3707	genome.wustl.edu	37	1	226825421	226825421	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr1:226825421G>A	ENST00000272117.3	-	6	2583	c.2584C>T	c.(2584-2586)Cga>Tga	p.R862*	ITPKB_ENST00000429204.1_Nonsense_Mutation_p.R862*			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	862					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				AGAGTGGTTCGAATGGCCTTC	0.552											OREG0014299	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(84;110 1851 5306 33547)	dbGAP											0													87.0	81.0	83.0					1																	226825421		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.2584C>T	1.37:g.226825421G>A	ENSP00000272117:p.Arg862*	2315	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Nonsense_Mutation	SNP	pfam_IPK	p.R862*	ENST00000272117.3	37	c.2584	CCDS1555.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.770953	0.98480	.	.	ENSG00000143772	ENST00000272117;ENST00000429204	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.383	18.5233	0.90962	0.0:0.0:1.0:0.0	.	.	.	.	X	862	.	ENSP00000272117:R862X	R	-	1	2	ITPKB	224892044	0.872000	0.30054	0.914000	0.36105	0.922000	0.55478	1.401000	0.34589	2.640000	0.89533	0.655000	0.94253	CGA	ITPKB	-	pfam_IPK	ENSG00000143772		0.552	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	HGNC	protein_coding	OTTHUMT00000091632.1	155	0.00	0	G	NM_002221		226825421	226825421	-1	no_errors	ENST00000272117	ensembl	human	known	69_37n	nonsense	77	49.02	75	SNP	0.991	A
LDB2	9079	genome.wustl.edu	37	4	16507531	16507532	+	Intron	DNP	GG	GG	CT			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr4:16507531_16507532GG>CT	ENST00000304523.5	-	7	1215				RP11-446J8.1_ENST00000512370.1_RNA|LDB2_ENST00000503178.2_Intron|LDB2_ENST00000515064.1_Intron|LDB2_ENST00000441778.2_Missense_Mutation_p.T322K|LDB2_ENST00000502640.1_Intron	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2						epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						GGCCAGAAGGGGTCACTGCTGT	0.554											OREG0016126	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.892_892delinsCT	4.37:g.16507531_16507532delinsCT		710	O60619|O75480	Silent|Missense_Mutation	SNP	NULL	p.T322|p.T322N	ENST00000304523.5	37	c.966|c.965	CCDS3420.1	4																																																																																			LDB2	-	NULL	ENSG00000169744		0.554	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDB2	HGNC	protein_coding	OTTHUMT00000250321.2	186|182	0.00	0	G			16507531|16507532	16507531|16507532	-1	no_errors	ENST00000441778	ensembl	human	known	69_37n	silent|missense	62|63	19.23	15	SNP	1.000	C|T
LPCAT3	10162	genome.wustl.edu	37	12	7087665	7087665	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr12:7087665C>T	ENST00000261407.4	-	9	963	c.878G>A	c.(877-879)gGa>gAa	p.G293E	U47924.30_ENST00000606112.1_lincRNA|LPCAT3_ENST00000535021.1_5'UTR	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3	293					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						AATGCATACTCCTTCCTGAGA	0.488																																						dbGAP											0													77.0	74.0	75.0					12																	7087665		2203	4300	6503	-	-	-	SO:0001583	missense	0			U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970	ENST00000261407.4:c.878G>A	12.37:g.7087665C>T	ENSP00000261407:p.Gly293Glu		B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	Missense_Mutation	SNP	pfam_MBOAT_fam	p.G293E	ENST00000261407.4	37	c.878	CCDS8572.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.124460	0.94429	.	.	ENSG00000111684	ENST00000261407	T	0.74842	-0.88	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.89873	0.6841	M	0.91249	3.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91040	0.4870	10	0.72032	D	0.01	-15.9356	20.1865	0.98220	0.0:1.0:0.0:0.0	.	293	Q6P1A2	MBOA5_HUMAN	E	293	ENSP00000261407:G293E	ENSP00000261407:G293E	G	-	2	0	LPCAT3	6957926	1.000000	0.71417	0.999000	0.59377	0.900000	0.52787	6.981000	0.76166	2.775000	0.95449	0.655000	0.94253	GGA	LPCAT3	-	pfam_MBOAT_fam	ENSG00000111684		0.488	LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT3	HGNC	protein_coding	OTTHUMT00000401812.1	81	0.00	0	C	NM_005768		7087665	7087665	-1	no_errors	ENST00000261407	ensembl	human	known	69_37n	missense	74	59.78	110	SNP	1.000	T
MAP3K12	7786	genome.wustl.edu	37	12	53876961	53876963	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr12:53876961_53876963delGAG	ENST00000267079.2	-	12	1750_1752	c.1525_1527delCTC	c.(1525-1527)ctcdel	p.L509del	MAP3K12_ENST00000547488.1_In_Frame_Del_p.L542del|MAP3K12_ENST00000547035.1_In_Frame_Del_p.L542del	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	509					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						ACTCCGTCTTGAGGATATCTGGC	0.527																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.1525_1527delCTC	12.37:g.53876961_53876963delGAG	ENSP00000267079:p.Leu509del		B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	In_Frame_Del	DEL	pirsf_MAP3K12_MAP3K13,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L509in_frame_del	ENST00000267079.2	37	c.1527_1525	CCDS8860.1	12																																																																																			MAP3K12	-	pirsf_MAP3K12_MAP3K13	ENSG00000139625		0.527	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP3K12	HGNC	protein_coding	OTTHUMT00000406267.1	79	0.00	0	GAG	NM_006301		53876961	53876963	-1	no_errors	ENST00000267079	ensembl	human	known	69_37n	in_frame_del	12	75.00	39	DEL	1.000:1.000:1.000	-
LGR5	8549	genome.wustl.edu	37	12	71978445	71978445	+	Silent	SNP	G	G	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr12:71978445G>C	ENST00000266674.5	+	18	2966	c.2655G>C	c.(2653-2655)gtG>gtC	p.V885V	LGR5_ENST00000540815.2_Silent_p.V861V|LGR5_ENST00000536515.1_Silent_p.V813V|RP11-186F10.2_ENST00000546601.1_RNA			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	885					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						CCAGTTCCGTGCCATCACCAG	0.448																																						dbGAP											0													140.0	132.0	135.0					12																	71978445		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.2655G>C	12.37:g.71978445G>C			D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Silent	SNP	pfam_Leu-rich_rpt,pfam_7TM_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pfscan_GPCR_Rhodpsn_supfam,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn	p.V885	ENST00000266674.5	37	c.2655	CCDS9000.1	12																																																																																			LGR5	-	NULL	ENSG00000139292		0.448	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR5	HGNC	protein_coding	OTTHUMT00000404744.1	138	0.00	0	G	NM_003667		71978445	71978445	+1	no_errors	ENST00000266674	ensembl	human	known	69_37n	silent	54	53.04	61	SNP	0.000	C
MCC	4163	genome.wustl.edu	37	5	112458465	112458465	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr5:112458465T>A	ENST00000302475.4	-	4	936	c.373A>T	c.(373-375)Aac>Tac	p.N125Y	MCC_ENST00000408903.3_Missense_Mutation_p.N315Y|MCC_ENST00000515367.2_Missense_Mutation_p.N62Y|MCC_ENST00000514701.3_5'UTR	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	125					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		GAGTCCTCGTTGACCTCGTGT	0.507																																						dbGAP											0													166.0	134.0	145.0					5																	112458465		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.373A>T	5.37:g.112458465T>A	ENSP00000305617:p.Asn125Tyr		D3DT05|Q6ZR04	Missense_Mutation	SNP	pfam_USH1C-bd_PDZ_domain,superfamily_tRNA-bd_arm	p.N125Y	ENST00000302475.4	37	c.373	CCDS4111.1	5	.	.	.	.	.	.	.	.	.	.	T	19.66	3.869045	0.72065	.	.	ENSG00000171444	ENST00000302475;ENST00000515367;ENST00000408903	T;T;T	0.79749	-1.3;2.39;1.22	5.76	5.76	0.90799	.	0.049642	0.85682	D	0.000000	T	0.80581	0.4650	N	0.22421	0.69	0.58432	D	0.999998	D;P;D;P	0.58620	0.971;0.91;0.983;0.91	B;B;P;B	0.56700	0.446;0.248;0.804;0.446	T	0.83111	-0.0123	10	0.62326	D	0.03	-29.7788	15.7436	0.77920	0.0:0.0:0.0:1.0	.	125;87;315;125	B7Z6G0;B3KTX0;P23508-2;P23508	.;.;.;CRCM_HUMAN	Y	125;62;315	ENSP00000305617:N125Y;ENSP00000421615:N62Y;ENSP00000386227:N315Y	ENSP00000305617:N125Y	N	-	1	0	MCC	112486364	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.327000	0.72910	2.200000	0.70718	0.460000	0.39030	AAC	MCC	-	NULL	ENSG00000171444		0.507	MCC-001	KNOWN	basic|CCDS	protein_coding	MCC	HGNC	protein_coding	OTTHUMT00000250736.3	149	0.00	0	T	NM_001085377		112458465	112458465	-1	no_errors	ENST00000302475	ensembl	human	known	69_37n	missense	93	13.89	15	SNP	1.000	A
MCM3AP	8888	genome.wustl.edu	37	21	47663506	47663506	+	Silent	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr21:47663506G>A	ENST00000397708.1	-	25	5423	c.5169C>T	c.(5167-5169)agC>agT	p.S1723S	MCM3AP_ENST00000291688.1_Silent_p.S1723S|MCM3AP-AS1_ENST00000591223.1_RNA|MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP_ENST00000467026.1_5'UTR|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP-AS1_ENST00000421927.1_RNA|MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP-AS1_ENST00000455567.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1723	Acetyltransferase.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					AGGGACTCTTGCTCTTCCACC	0.582																																						dbGAP											0													67.0	63.0	64.0					21																	47663506		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.5169C>T	21.37:g.47663506G>A			C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Silent	SNP	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.S1723	ENST00000397708.1	37	c.5169	CCDS13734.1	21																																																																																			MCM3AP	-	NULL	ENSG00000160294		0.582	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM3AP	HGNC	protein_coding	OTTHUMT00000207254.1	132	0.00	0	G	NM_003906		47663506	47663506	-1	no_errors	ENST00000291688	ensembl	human	known	69_37n	silent	95	25.78	33	SNP	0.004	A
MCOLN1	57192	genome.wustl.edu	37	19	7593049	7593049	+	Silent	SNP	G	G	A	rs200484869		TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr19:7593049G>A	ENST00000264079.6	+	7	908	c.783G>A	c.(781-783)acG>acA	p.T261T		NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1	261					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CACAGATCACGTTTGACAACA	0.622													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17153	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													91.0	84.0	86.0					19																	7593049		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1		ENST00000264079.6:c.783G>A	19.37:g.7593049G>A			D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Silent	SNP	pfam_PKD1_2_channel,superfamily_Glycoside_hydrolase_SF	p.T261	ENST00000264079.6	37	c.783	CCDS12180.1	19																																																																																			MCOLN1	-	NULL	ENSG00000090674		0.622	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCOLN1	HGNC	protein_coding	OTTHUMT00000458974.2	92	0.00	0	G	NM_020533		7593049	7593049	+1	no_errors	ENST00000264079	ensembl	human	known	69_37n	silent	45	35.71	25	SNP	0.297	A
MED12L	116931	genome.wustl.edu	37	3	151107820	151107820	+	Silent	SNP	C	C	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr3:151107820C>G	ENST00000474524.1	+	36	5438	c.5400C>G	c.(5398-5400)tcC>tcG	p.S1800S	MED12L_ENST00000273432.4_Silent_p.S1660S	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1800						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CGCCTATCTCCTCCCAAATGA	0.463																																						dbGAP											0													177.0	174.0	175.0					3																	151107820		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.5400C>G	3.37:g.151107820C>G			Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.S1800	ENST00000474524.1	37	c.5400	CCDS33876.1	3																																																																																			MED12L	-	NULL	ENSG00000144893		0.463	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2	135	0.00	0	C	NM_053002		151107820	151107820	+1	no_errors	ENST00000474524	ensembl	human	known	69_37n	silent	137	34.60	73	SNP	1.000	G
MECOM	2122	genome.wustl.edu	37	3	168833701	168833701	+	Silent	SNP	C	C	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr3:168833701C>T	ENST00000464456.1	-	7	2595	c.1395G>A	c.(1393-1395)gcG>gcA	p.A465A	MECOM_ENST00000264674.3_Silent_p.A530A|MECOM_ENST00000460814.1_Silent_p.A465A|MECOM_ENST00000392736.3_Silent_p.A465A|MECOM_ENST00000494292.1_Silent_p.A653A|MECOM_ENST00000433243.2_Silent_p.A466A|MECOM_ENST00000468789.1_Silent_p.A465A|MECOM_ENST00000472280.1_Silent_p.A466A	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A465A(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						CTCCTGACACCGCAGTCTGCT	0.393																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											289.0	261.0	270.0					3																	168833701		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.1395G>A	3.37:g.168833701C>T			Q13466|Q6FH90	Silent	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.A653	ENST00000464456.1	37	c.1959	CCDS54669.1	3																																																																																			MECOM	-	NULL	ENSG00000085276		0.393	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	MECOM	HGNC	protein_coding	OTTHUMT00000351519.1	750	0.00	0	C	NM_005241, NM_004991		168833701	168833701	-1	no_errors	ENST00000494292	ensembl	human	known	69_37n	silent	456	49.61	450	SNP	0.998	T
MICAL3	57553	genome.wustl.edu	37	22	18293576	18293576	+	Silent	SNP	T	T	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr22:18293576T>G	ENST00000441493.2	-	28	5801	c.5449A>C	c.(5449-5451)Aga>Cga	p.R1817R	XXbac-B461K10.4_ENST00000476405.1_RNA|MICAL3_ENST00000580469.1_5'UTR	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1817					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GTGTAGGTTCTTGGCTGGAGA	0.617																																						dbGAP											0													69.0	71.0	70.0					22																	18293576		2161	4274	6435	-	-	-	SO:0001819	synonymous_variant	0			AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.5449A>C	22.37:g.18293576T>G			B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	pfam_DUF3585	p.K110T	ENST00000441493.2	37	c.329	CCDS46659.1	22	.	.	.	.	.	.	.	.	.	.	T	16.45	3.126644	0.56721	.	.	ENSG00000093100	ENST00000252134	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	T	0.70491	0.3230	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70267	-0.4919	4	.	.	.	.	14.656	0.68833	0.0:0.0:0.0:1.0	.	.	.	.	H	798	.	.	Q	-	3	2	XXbac-B461K10.4	16673576	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	5.963000	0.70372	1.861000	0.53984	0.379000	0.24179	CAA	MICAL3	-	NULL	ENSG00000243156		0.617	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL3	HGNC	protein_coding	OTTHUMT00000447351.1	52	0.00	0	T			18293576	18293576	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000577821	ensembl	human	novel	69_37n	missense	75	23.47	23	SNP	1.000	G
MSI2	124540	genome.wustl.edu	37	17	55674274	55674274	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr17:55674274T>C	ENST00000284073.2	+	8	709	c.500T>C	c.(499-501)gTc>gCc	p.V167A	MSI2_ENST00000322684.3_Missense_Mutation_p.V163A|MSI2_ENST00000416426.2_Missense_Mutation_p.V145A|MSI2_ENST00000442934.2_Missense_Mutation_p.V106A|MSI2_ENST00000579180.1_Missense_Mutation_p.V63A|MSI2_ENST00000579505.1_3'UTR	NM_138962.2	NP_620412.1	Q96DH6	MSI2H_HUMAN	musashi RNA-binding protein 2	167	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	7	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		GTGGAGAAAGTCTGTGAGATT	0.413			T	HOXA9	CML																																	dbGAP		Dom	yes		17	17q23.2	124540	musashi homolog 2 (Drosophila)		L	0													117.0	115.0	116.0					17																	55674274		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001526	CCDS11596.1, CCDS11597.1	17q23.2	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	18585	protein-coding gene	gene with protein product		607897	"""musashi homolog 2 (Drosophila)"""			11588182	Standard	NM_138962		Approved		uc002iuz.1	Q96DH6		ENST00000284073.2:c.500T>C	17.37:g.55674274T>C	ENSP00000284073:p.Val167Ala		Q7Z6M7|Q8N9T4	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.V167A	ENST00000284073.2	37	c.500	CCDS11596.1	17	.	.	.	.	.	.	.	.	.	.	T	20.2	3.958161	0.73902	.	.	ENSG00000153944	ENST00000416426;ENST00000284073;ENST00000322684;ENST00000442934	T;T;T;T	0.52983	3.5;0.64;3.5;3.5	5.83	5.83	0.93111	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.52468	0.1736	N	0.16130	0.375	0.80722	D	1	D;P;B	0.76494	0.999;0.904;0.349	D;P;B	0.76071	0.987;0.69;0.17	T	0.55915	-0.8065	10	0.39692	T	0.17	.	16.1905	0.81986	0.0:0.0:0.0:1.0	.	145;163;167	B4DHE8;Q96DH6-2;Q96DH6	.;.;MSI2H_HUMAN	A	145;167;163;106	ENSP00000414671:V145A;ENSP00000284073:V167A;ENSP00000313616:V163A;ENSP00000392607:V106A	ENSP00000284073:V167A	V	+	2	0	MSI2	53029273	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.671000	0.83941	2.212000	0.71576	0.533000	0.62120	GTC	MSI2	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000153944		0.413	MSI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSI2	HGNC	protein_coding	OTTHUMT00000441813.1	129	0.00	0	T			55674274	55674274	+1	no_errors	ENST00000284073	ensembl	human	known	69_37n	missense	221	34.62	117	SNP	1.000	C
MX2	4600	genome.wustl.edu	37	21	42748967	42748967	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr21:42748967T>G	ENST00000330714.3	+	2	318	c.134T>G	c.(133-135)tTt>tGt	p.F45C	MX2_ENST00000543692.1_Missense_Mutation_p.F45C	NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	45					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				CAAATGATGTTTCCTCCAAAC	0.483																																						dbGAP											0													89.0	94.0	93.0					21																	42748967		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.134T>G	21.37:g.42748967T>G	ENSP00000333657:p.Phe45Cys		B7Z5D3|D3DSI7	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,superfamily_CH-domain,smart_Dynamin_GTPase,smart_GED,prints_Dynamin	p.F45C	ENST00000330714.3	37	c.134	CCDS13672.1	21	.	.	.	.	.	.	.	.	.	.	T	0.390	-0.924134	0.02377	.	.	ENSG00000183486	ENST00000330714;ENST00000436410;ENST00000435611;ENST00000543692;ENST00000418103	D;D	0.91945	-2.52;-2.94	2.57	-5.14	0.02875	.	3.977660	0.00883	N	0.002157	D	0.83022	0.5164	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.68334	-0.5436	10	0.38643	T	0.18	.	1.9576	0.03379	0.3469:0.3871:0.1291:0.1369	.	45	P20592	MX2_HUMAN	C	45	ENSP00000333657:F45C;ENSP00000446017:F45C	ENSP00000333657:F45C	F	+	2	0	MX2	41670837	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.797000	0.00763	-3.842000	0.00100	-1.145000	0.01858	TTT	MX2	-	NULL	ENSG00000183486		0.483	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MX2	HGNC	protein_coding	OTTHUMT00000195147.1	108	0.00	0	T	NM_002463		42748967	42748967	+1	no_errors	ENST00000330714	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	0.000	G
MYO5C	55930	genome.wustl.edu	37	15	52553129	52553129	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr15:52553129C>A	ENST00000261839.7	-	10	1404	c.1243G>T	c.(1243-1245)Gag>Tag	p.E415*	MYO5C_ENST00000443683.2_Nonsense_Mutation_p.E358*|MYO5C_ENST00000541028.1_5'Flank	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	415	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TTAATTCTCTCCACAATGAAG	0.473																																						dbGAP											0													128.0	124.0	125.0					15																	52553129		1952	4142	6094	-	-	-	SO:0001587	stop_gained	0			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.1243G>T	15.37:g.52553129C>A	ENSP00000261839:p.Glu415*		Q6P1W8	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E415*	ENST00000261839.7	37	c.1243	CCDS42036.1	15	.	.	.	.	.	.	.	.	.	.	C	33	5.222625	0.95139	.	.	ENSG00000128833	ENST00000261839;ENST00000443683	.	.	.	5.78	5.78	0.91487	.	0.328975	0.36519	N	0.002552	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	20.0051	0.97433	0.0:1.0:0.0:0.0	.	.	.	.	X	415;358	.	ENSP00000261839:E415X	E	-	1	0	MYO5C	50340421	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.966000	0.40481	2.739000	0.93911	0.561000	0.74099	GAG	MYO5C	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000128833		0.473	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	HGNC	protein_coding	OTTHUMT00000419562.1	175	0.00	0	C	NM_018728		52553129	52553129	-1	no_errors	ENST00000261839	ensembl	human	known	69_37n	nonsense	87	13.00	13	SNP	1.000	A
NAP1L2	4674	genome.wustl.edu	37	X	72434297	72434297	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chrX:72434297G>A	ENST00000373517.3	-	1	387	c.32C>T	c.(31-33)tCa>tTa	p.S11L	NAP1L2_ENST00000536638.1_Intron	NM_021963.3	NP_068798.1	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	11					nucleosome assembly (GO:0006334)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of neuron differentiation (GO:0045666)|regulation of stem cell division (GO:2000035)	nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(12)|skin(3)	29	Renal(35;0.156)					ACTGGATTCTGACAGCTCCTT	0.542																																						dbGAP											0													52.0	58.0	56.0					X																	72434297		2179	4190	6369	-	-	-	SO:0001583	missense	0			AF136178	CCDS14423.1	Xq13	2008-02-05			ENSG00000186462	ENSG00000186462			7638	protein-coding gene	gene with protein product		300026				8789438	Standard	NM_021963		Approved	BPX, MGC26243	uc004ebi.3	Q9ULW6	OTTHUMG00000021827	ENST00000373517.3:c.32C>T	X.37:g.72434297G>A	ENSP00000362616:p.Ser11Leu		B2RE61|B4E161|Q8TAN6	Missense_Mutation	SNP	pfam_NAP_family	p.S11L	ENST00000373517.3	37	c.32	CCDS14423.1	X	.	.	.	.	.	.	.	.	.	.	g	0.360	-0.939719	0.02322	.	.	ENSG00000186462	ENST00000373517	T	0.29655	1.56	2.94	1.93	0.25924	.	1.336430	0.06283	N	0.697753	T	0.12475	0.0303	N	0.08118	0	0.19575	N	0.999968	B	0.02656	0.0	B	0.01281	0.0	T	0.29882	-0.9997	10	0.02654	T	1	-8.3847	3.5421	0.07815	0.3045:0.0:0.6955:0.0	.	11	Q9ULW6	NP1L2_HUMAN	L	11	ENSP00000362616:S11L	ENSP00000362616:S11L	S	-	2	0	NAP1L2	72351022	0.969000	0.33509	0.212000	0.23672	0.167000	0.22549	0.856000	0.27818	0.500000	0.27991	0.544000	0.68410	TCA	NAP1L2	-	NULL	ENSG00000186462		0.542	NAP1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L2	HGNC	protein_coding	OTTHUMT00000057225.1	33	0.00	0	G	NM_021963		72434297	72434297	-1	no_errors	ENST00000373517	ensembl	human	known	69_37n	missense	9	65.38	17	SNP	0.199	A
NBEAL2	23218	genome.wustl.edu	37	3	47033996	47033996	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr3:47033996G>C	ENST00000450053.3	+	10	1243	c.1064G>C	c.(1063-1065)gGg>gCg	p.G355A	NBEAL2_ENST00000292309.5_Missense_Mutation_p.G355A|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	355					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CCCCCCGAGGGGGACAGTGAC	0.637																																						dbGAP											0													27.0	29.0	28.0					3																	47033996		1878	4092	5970	-	-	-	SO:0001583	missense	0			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.1064G>C	3.37:g.47033996G>C	ENSP00000415034:p.Gly355Ala		O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G355A	ENST00000450053.3	37	c.1064	CCDS46817.1	3	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152337	0.57259	.	.	ENSG00000160796	ENST00000292309;ENST00000450053	T;T	0.58652	0.32;0.32	5.24	5.24	0.73138	Armadillo-type fold (1);	.	.	.	.	T	0.48223	0.1488	L	0.44542	1.39	0.80722	D	1	B	0.22480	0.07	B	0.19148	0.024	T	0.48234	-0.9053	9	0.54805	T	0.06	.	9.879	0.41222	0.0925:0.0:0.9075:0.0	.	355	Q6ZNJ1	NBEL2_HUMAN	A	355	ENSP00000292309:G355A;ENSP00000415034:G355A	ENSP00000292309:G355A	G	+	2	0	NBEAL2	47009000	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.879000	0.56138	2.456000	0.83038	0.643000	0.83706	GGG	NBEAL2	-	superfamily_ARM-type_fold	ENSG00000160796		0.637	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3	23	0.00	0	G	XM_291064		47033996	47033996	+1	no_errors	ENST00000450053	ensembl	human	known	69_37n	missense	26	44.68	21	SNP	1.000	C
NHSL2	340527	genome.wustl.edu	37	X	71358701	71358701	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chrX:71358701C>A	ENST00000373677.1	+	2	1467	c.205C>A	c.(205-207)Cct>Act	p.P69T	NHSL2_ENST00000510661.1_Missense_Mutation_p.P204T|NHSL2_ENST00000535692.1_Missense_Mutation_p.P69T|NHSL2_ENST00000540800.1_Missense_Mutation_p.P435T			Q5HYW2	NHSL2_HUMAN	NHS-like 2	69										NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					ACCTCTGGTTCCTAAGGAGGC	0.522																																						dbGAP											0													53.0	45.0	47.0					X																	71358701		2203	4300	6503	-	-	-	SO:0001583	missense	0					Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.205C>A	X.37:g.71358701C>A	ENSP00000362781:p.Pro69Thr		B2RN94	Missense_Mutation	SNP	NULL	p.P435T	ENST00000373677.1	37	c.1303		X	.	.	.	.	.	.	.	.	.	.	C	4.612	0.113822	0.08831	.	.	ENSG00000204131	ENST00000540800;ENST00000373677;ENST00000510661;ENST00000535692	T;T;T;T	0.41065	1.61;1.02;1.01;1.02	5.73	2.69	0.31865	.	0.489229	0.20338	N	0.094294	T	0.29223	0.0727	L	0.44542	1.39	0.24437	N	0.994546	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.12156	0.005;0.004;0.007	T	0.12708	-1.0537	10	0.37606	T	0.19	-4.3508	3.5444	0.07823	0.4094:0.4072:0.0:0.1834	.	435;204;69	F5H593;D6RBM4;Q5HYW2	.;.;NHSL2_HUMAN	T	435;69;204;69	ENSP00000444617:P435T;ENSP00000362781:P69T;ENSP00000424079:P204T;ENSP00000444914:P69T	ENSP00000362781:P69T	P	+	1	0	NHSL2	71275426	0.000000	0.05858	0.995000	0.50966	0.960000	0.62799	0.295000	0.19065	1.150000	0.42419	-0.351000	0.07748	CCT	NHSL2	-	NULL	ENSG00000204131		0.522	NHSL2-001	KNOWN	basic	protein_coding	NHSL2	HGNC	protein_coding	OTTHUMT00000057170.1	115	0.00	0	C	NM_001013627		71358701	71358701	+1	no_errors	ENST00000540800	ensembl	human	known	69_37n	missense	16	44.83	13	SNP	0.561	A
OAS1	4938	genome.wustl.edu	37	12	113346375	113346375	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr12:113346375G>C	ENST00000202917.5	+	2	478	c.215G>C	c.(214-216)gGc>gCc	p.G72A	RP1-71H24.1_ENST00000552784.1_RNA|OAS1_ENST00000445409.2_Missense_Mutation_p.G72A|OAS1_ENST00000553185.1_Missense_Mutation_p.G72A|OAS1_ENST00000452357.2_Missense_Mutation_p.G72A|OAS1_ENST00000551241.1_Missense_Mutation_p.G72A	NM_016816.2	NP_058132.2	P00973	OAS1_HUMAN	2'-5'-oligoadenylate synthetase 1, 40/46kDa	72					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|protein oligomerization (GO:0051259)|purine nucleotide biosynthetic process (GO:0006164)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)|skin(1)	16						ACCCTCAGAGGCCGATCTGAC	0.483																																						dbGAP											0													64.0	66.0	66.0					12																	113346375		2203	4300	6503	-	-	-	SO:0001583	missense	0			X04371	CCDS31905.1, CCDS41838.1, CCDS44980.1	12q24.2	2014-05-21	2011-07-21				2.7.7.-		8086	protein-coding gene	gene with protein product		164350	"""2',5'-oligoadenylate synthetase 1 (40-46 kD)"""	OIAS		9344649, 9325053	Standard	XM_006719434		Approved	OIASI, IFI-4	uc001tud.3	P00973		ENST00000202917.5:c.215G>C	12.37:g.113346375G>C	ENSP00000202917:p.Gly72Ala		A8K4N8|P04820|P29080|P29081|P78485|P78486|Q16700|Q16701|Q1PG42|Q3ZM01|Q53GC5|Q53YA4|Q6A1Z3|Q6IPC6|Q6P7N9|Q96J61	Missense_Mutation	SNP	pfam_2-5-oligoAdlate_synth_1_dom2/C,pfam_Nucleotidyltransferase,pfscan_2-5-oligoadenylate_synth_N	p.G72A	ENST00000202917.5	37	c.215	CCDS41838.1	12	.	.	.	.	.	.	.	.	.	.	G	14.50	2.555394	0.45487	.	.	ENSG00000089127	ENST00000202917;ENST00000445409;ENST00000452357;ENST00000549820;ENST00000551241;ENST00000377508;ENST00000553185;ENST00000550689	T;T;T;T;T;T	0.13657	2.57;2.57;2.57;2.57;2.57;2.57	4.46	1.62	0.23740	2-5-oligoadenylate synthetase, N-terminal (1);Nucleotidyl transferase domain (1);2-5-oligoadenylate synthetase, conserved site (1);	0.504964	0.18341	N	0.144193	T	0.38852	0.1056	M	0.91612	3.225	0.09310	N	1	D;D;D;D;D;D	0.69078	0.971;0.997;0.99;0.997;0.996;0.99	D;D;P;D;D;D	0.74674	0.949;0.984;0.886;0.984;0.973;0.953	T	0.15093	-1.0449	10	0.72032	D	0.01	-23.6117	6.5333	0.22339	0.309:0.0:0.691:0.0	.	72;72;72;72;72;72	B4DWE7;E7EMI9;F8VXY3;P00973;P00973-3;P00973-2	.;.;.;OAS1_HUMAN;.;.	A	72;72;72;72;72;72;72;68	ENSP00000202917:G72A;ENSP00000388001:G72A;ENSP00000415721:G72A;ENSP00000448790:G72A;ENSP00000448001:G72A;ENSP00000448348:G68A	ENSP00000202917:G72A	G	+	2	0	OAS1	111830758	0.009000	0.17119	0.056000	0.19401	0.729000	0.41735	0.576000	0.23744	0.247000	0.21414	0.455000	0.32223	GGC	OAS1	-	pfam_Nucleotidyltransferase,pfscan_2-5-oligoadenylate_synth_N	ENSG00000089127		0.483	OAS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OAS1	HGNC	protein_coding	OTTHUMT00000405896.2	202	0.00	0	G			113346375	113346375	+1	no_errors	ENST00000445409	ensembl	human	known	69_37n	missense	133	33.17	66	SNP	0.147	C
TENM1	10178	genome.wustl.edu	37	X	123695609	123695609	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chrX:123695609C>T	ENST00000371130.3	-	14	2409	c.2346G>A	c.(2344-2346)tgG>tgA	p.W782*	TENM1_ENST00000422452.2_Nonsense_Mutation_p.W782*	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	782	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ACACACAGTGCCAACCATTTT	0.473																																						dbGAP											0													204.0	158.0	173.0					X																	123695609		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.2346G>A	X.37:g.123695609C>T	ENSP00000360171:p.Trp782*		B2RTR5|Q5JZ17	Nonsense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.W782*	ENST00000371130.3	37	c.2346	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	41	8.925481	0.99004	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	.	.	.	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.4118	0.90554	0.0:1.0:0.0:0.0	.	.	.	.	X	782	.	ENSP00000360171:W782X	W	-	3	0	ODZ1	123523290	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.772000	0.85439	2.376000	0.81061	0.594000	0.82650	TGG	ODZ1	-	smart_EGF-like,pfscan_EG-like_dom	ENSG00000009694		0.473	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	407	0.49	2	C	NM_014253		123695609	123695609	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	nonsense	80	46.67	70	SNP	1.000	T
OR5M10	390167	genome.wustl.edu	37	11	56344871	56344871	+	Silent	SNP	G	G	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr11:56344871G>T	ENST00000526812.2	-	1	392	c.327C>A	c.(325-327)atC>atA	p.I109I		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	109						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						AAAACTCAGTGATCACTAGGG	0.438																																						dbGAP											0													173.0	157.0	162.0					11																	56344871		2006	4188	6194	-	-	-	SO:0001819	synonymous_variant	0			BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.327C>A	11.37:g.56344871G>T			B9EIL9	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I109	ENST00000526812.2	37	c.327	CCDS53630.1	11																																																																																			OR5M10	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000254834		0.438	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M10	HGNC	protein_coding	OTTHUMT00000391609.1	266	0.00	0	G	NM_001004741		56344871	56344871	-1	no_errors	ENST00000526812	ensembl	human	known	69_37n	silent	151	48.99	145	SNP	0.001	T
OR4D10	390197	genome.wustl.edu	37	11	59245434	59245434	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr11:59245434T>C	ENST00000530162.1	+	1	589	c.532T>C	c.(532-534)Tac>Cac	p.Y178H		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TGACACTTTCTACTGTGATGT	0.502																																						dbGAP											0													110.0	110.0	110.0					11																	59245434		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.532T>C	11.37:g.59245434T>C	ENSP00000436424:p.Tyr178His		B2RNH6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Y178H	ENST00000530162.1	37	c.532	CCDS53636.1	11	.	.	.	.	.	.	.	.	.	.	T	14.76	2.631763	0.46944	.	.	ENSG00000254466	ENST00000530162	T	0.00130	8.69	4.71	4.71	0.59529	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00552	0.0018	M	0.87456	2.885	0.26490	N	0.974952	D	0.69078	0.997	D	0.79108	0.992	T	0.42207	-0.9465	9	0.62326	D	0.03	.	13.31	0.60374	0.0:0.0:0.0:1.0	.	178	Q8NGI6	OR4DA_HUMAN	H	178	ENSP00000436424:Y178H	ENSP00000436424:Y178H	Y	+	1	0	OR4D10	59002010	0.533000	0.26354	1.000000	0.80357	0.435000	0.31806	3.715000	0.54897	1.873000	0.54277	0.533000	0.62120	TAC	OR4D10	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000254466		0.502	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D10	HGNC	protein_coding	OTTHUMT00000394235.1	151	0.00	0	T	NM_001004705		59245434	59245434	+1	no_errors	ENST00000530162	ensembl	human	known	69_37n	missense	166	17.73	36	SNP	0.995	C
PAGE1	8712	genome.wustl.edu	37	X	49459343	49459343	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chrX:49459343G>A	ENST00000376150.3	-	2	163	c.31C>T	c.(31-33)Cgt>Tgt	p.R11C		NM_003785.3	NP_003776.2	O75459	PAGE1_HUMAN	P antigen family, member 1 (prostate associated)	11					cellular defense response (GO:0006968)					endometrium(1)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	7	Ovarian(276;0.236)					ATTGGTCTACGCCGATAGATT	0.353																																						dbGAP											0													80.0	66.0	71.0					X																	49459343		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF058989	CCDS14327.1	Xp11.23	2009-06-17	2005-01-26	2005-01-27	ENSG00000068985	ENSG00000068985			4107	protein-coding gene	gene with protein product		300288	"""G antigen, family B, 1 (prostate associated)"""	GAGEB1		9651357, 9724777	Standard	NM_003785		Approved	PAGE-1, GAGE-9, CT16.3	uc004dom.3	O75459	OTTHUMG00000033224	ENST00000376150.3:c.31C>T	X.37:g.49459343G>A	ENSP00000365320:p.Arg11Cys		Q6FGM3|Q9BSS7	Missense_Mutation	SNP	pfam_GAGE	p.R11C	ENST00000376150.3	37	c.31	CCDS14327.1	X	.	.	.	.	.	.	.	.	.	.	G	9.892	1.204577	0.22205	.	.	ENSG00000068985	ENST00000376150	T	0.10382	2.88	1.08	0.167	0.15006	.	.	.	.	.	T	0.11110	0.0271	L	0.43152	1.355	0.09310	N	1	D	0.61697	0.99	P	0.48425	0.577	T	0.19484	-1.0304	9	0.56958	D	0.05	.	3.1913	0.06618	0.3217:0.0:0.6783:0.0	.	11	O75459	GAGB1_HUMAN	C	11	ENSP00000365320:R11C	ENSP00000365320:R11C	R	-	1	0	PAGE1	49346054	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.207000	0.09384	-0.010000	0.14271	0.384000	0.25694	CGT	PAGE1	-	pfam_GAGE	ENSG00000068985		0.353	PAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAGE1	HGNC	protein_coding	OTTHUMT00000081210.1	157	0.00	0	G			49459343	49459343	-1	no_errors	ENST00000376150	ensembl	human	known	69_37n	missense	82	41.01	57	SNP	0.000	A
PASK	23178	genome.wustl.edu	37	2	242076654	242076654	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr2:242076654C>A	ENST00000405260.1	-	7	1600	c.902G>T	c.(901-903)gGa>gTa	p.G301V	PASK_ENST00000358649.4_Missense_Mutation_p.G301V|PASK_ENST00000539818.1_Missense_Mutation_p.G85V|PASK_ENST00000544142.1_Missense_Mutation_p.G115V|PASK_ENST00000234040.4_Missense_Mutation_p.G301V|PASK_ENST00000403638.3_Missense_Mutation_p.G301V	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	301					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		CCTGGCTCTTCCAACAGACCT	0.572																																						dbGAP											0													77.0	77.0	77.0					2																	242076654		2203	4300	6503	-	-	-	SO:0001583	missense	0			U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.902G>T	2.37:g.242076654C>A	ENSP00000384016:p.Gly301Val		G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Nonsense_Mutation	SNP	NULL	p.E116*	ENST00000405260.1	37	c.346	CCDS2545.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.72|18.72	3.683899|3.683899	0.68157|0.68157	.|.	.|.	ENSG00000115687|ENSG00000115687	ENST00000433589|ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818;ENST00000403638;ENST00000415234	.|T;T;T;T;T;T;T	.|0.69685	.|1.09;-0.42;1.09;1.09;1.09;1.09;-0.42	5.26|5.26	4.37|4.37	0.52481|0.52481	.|.	.|0.000000	.|0.50627	.|D	.|0.000120	.|T	.|0.79458	.|0.4449	M|M	0.73217|0.73217	2.22|2.22	0.48901|0.48901	D|D	0.999726|0.999726	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.998;1.0	.|D;D;D;D;D	.|0.97110	.|0.999;1.0;1.0;0.993;0.999	.|T	.|0.79512	.|-0.1773	.|10	.|0.45353	.|T	.|0.12	.|.	13.0385|13.0385	0.58885|0.58885	0.0:0.8377:0.1623:0.0|0.0:0.8377:0.1623:0.0	.|.	.|266;115;301;301;301	.|B7Z7R6;F5GYW7;Q96RG2-2;G5E9F1;Q96RG2	.|.;.;.;.;PASK_HUMAN	X|V	116|301;115;301;301;85;301;85	.|ENSP00000234040:G301V;ENSP00000441374:G115V;ENSP00000384016:G301V;ENSP00000351475:G301V;ENSP00000443083:G85V;ENSP00000384438:G301V;ENSP00000400734:G85V	.|ENSP00000234040:G301V	E|G	-|-	1|2	0|0	PASK|PASK	241725327|241725327	0.947000|0.947000	0.32204|0.32204	0.829000|0.829000	0.32907|0.32907	0.945000|0.945000	0.59286|0.59286	4.972000|4.972000	0.63756|0.63756	1.188000|1.188000	0.43014|0.43014	0.467000|0.467000	0.42956|0.42956	GAA|GGA	PASK	-	NULL	ENSG00000115687		0.572	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PASK	HGNC	protein_coding	OTTHUMT00000323753.1	43	0.00	0	C	NM_015148		242076654	242076654	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000433589	ensembl	human	novel	69_37n	nonsense	6	77.78	21	SNP	0.920	A
PKHD1L1	93035	genome.wustl.edu	37	8	110457322	110457322	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr8:110457322T>C	ENST00000378402.5	+	38	5328	c.5224T>C	c.(5224-5226)Tca>Cca	p.S1742P		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1742	IPT/TIG 9.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CTGCACCTTTTCATACTTAGA	0.453										HNSCC(38;0.096)																												dbGAP											0													134.0	127.0	129.0					8																	110457322		1892	4128	6020	-	-	-	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5224T>C	8.37:g.110457322T>C	ENSP00000367655:p.Ser1742Pro		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.S1742P	ENST00000378402.5	37	c.5224	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	T	16.55	3.155266	0.57259	.	.	ENSG00000205038	ENST00000378402	T	0.77750	-1.12	6.17	5.0	0.66597	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.577501	0.17670	N	0.165989	T	0.77096	0.4080	M	0.73598	2.24	0.19575	N	0.999965	B	0.29552	0.248	B	0.31390	0.129	T	0.66705	-0.5856	10	0.36615	T	0.2	.	11.7707	0.51956	0.0:0.0:0.1474:0.8526	.	1742	Q86WI1	PKHL1_HUMAN	P	1742	ENSP00000367655:S1742P	ENSP00000367655:S1742P	S	+	1	0	PKHD1L1	110526498	0.058000	0.20735	0.983000	0.44433	0.975000	0.68041	0.547000	0.23299	1.120000	0.41904	0.533000	0.62120	TCA	PKHD1L1	-	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt	ENSG00000205038		0.453	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	106	0.00	0	T	NM_177531		110457322	110457322	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	missense	132	46.77	116	SNP	0.657	C
PNPLA3	80339	genome.wustl.edu	37	22	44328855	44328855	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr22:44328855C>T	ENST00000216180.3	+	4	757	c.584C>T	c.(583-585)cCt>cTt	p.P195L	PNPLA3_ENST00000478713.1_3'UTR|PNPLA3_ENST00000423180.2_Missense_Mutation_p.P191L	NM_025225.2	NP_079501.2	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3	195					acylglycerol acyl-chain remodeling (GO:0036155)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	diolein transacylation activity (GO:0051265)|mono-olein transacylation activity (GO:0051264)|phospholipase A2 activity (GO:0004623)|triglyceride lipase activity (GO:0004806)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|prostate(1)|skin(1)|stomach(2)	19		Ovarian(80;0.024)|all_neural(38;0.0416)				GACATCTGCCCTAAAGTCAAG	0.507																																						dbGAP											0													215.0	174.0	188.0					22																	44328855		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14054.1	22q13.31	2014-03-14	2006-05-26	2006-05-26	ENSG00000100344	ENSG00000100344	3.1.1.3	"""Patatin-like phospholipase domain containing"""	18590	protein-coding gene	gene with protein product		609567	"""chromosome 22 open reading frame 20"", ""adiponutrin"""	C22orf20, ADPN		16799181, 19029121	Standard	NM_025225		Approved	dJ796I17.1, FLJ22012, adiponutrin, iPLA2epsilon	uc003bei.1	Q9NST1	OTTHUMG00000150555	ENST00000216180.3:c.584C>T	22.37:g.44328855C>T	ENSP00000216180:p.Pro195Leu		B0QYI0|B2RCL3|B3KW00|Q6P1A1|Q96CB4	Missense_Mutation	SNP	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	p.P195L	ENST00000216180.3	37	c.584	CCDS14054.1	22	.	.	.	.	.	.	.	.	.	.	C	33	5.199851	0.94997	.	.	ENSG00000100344	ENST00000216180;ENST00000423180	T;T	0.76578	-1.03;-1.03	5.57	5.57	0.84162	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.000000	0.64402	D	0.000002	D	0.90208	0.6939	M	0.88906	2.99	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91698	0.5371	10	0.87932	D	0	-29.1685	18.1362	0.89619	0.0:1.0:0.0:0.0	.	195	Q9NST1	PLPL3_HUMAN	L	195;191	ENSP00000216180:P195L;ENSP00000397987:P191L	ENSP00000216180:P195L	P	+	2	0	PNPLA3	42660188	1.000000	0.71417	0.975000	0.42487	0.877000	0.50540	6.930000	0.75858	2.614000	0.88457	0.655000	0.94253	CCT	PNPLA3	-	superfamily_Acyl_Trfase/lysoPLipase	ENSG00000100344		0.507	PNPLA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PNPLA3	HGNC	protein_coding	OTTHUMT00000318891.1	120	0.00	0	C	NM_025225		44328855	44328855	+1	no_errors	ENST00000216180	ensembl	human	known	69_37n	missense	133	10.74	16	SNP	1.000	T
POLA1	5422	genome.wustl.edu	37	X	24745162	24745162	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chrX:24745162C>A	ENST00000379059.3	+	14	1502	c.1487C>A	c.(1486-1488)cCt>cAt	p.P496H	POLA1_ENST00000493342.1_3'UTR|POLA1_ENST00000379068.3_Missense_Mutation_p.P502H	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	496					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	ATCAAAGGACCTTGTTGGCTT	0.378																																						dbGAP											0													75.0	69.0	71.0					X																	24745162		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.1487C>A	X.37:g.24745162C>A	ENSP00000368349:p.Pro496His		Q86UQ7	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_Znf_DNA-dir_DNA_pol_B_alpha,pfam_DNA_pol_a_cat_su_N,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.P502H	ENST00000379059.3	37	c.1505	CCDS14214.1	X	.	.	.	.	.	.	.	.	.	.	C	21.4	4.148064	0.78001	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.48201	0.82;0.82	5.25	5.25	0.73442	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.157661	0.64402	N	0.000018	T	0.75079	0.3801	H	0.96691	3.865	0.80722	D	1	P;B	0.50443	0.935;0.226	P;B	0.53549	0.729;0.278	D	0.84799	0.0783	10	0.87932	D	0	-4.3915	17.9998	0.89195	0.0:1.0:0.0:0.0	.	502;496	A6NMQ1;P09884	.;DPOLA_HUMAN	H	502;496	ENSP00000368358:P502H;ENSP00000368349:P496H	ENSP00000368349:P496H	P	+	2	0	POLA1	24655083	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.077000	0.76814	2.441000	0.82636	0.600000	0.82982	CCT	POLA1	-	pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,tigrfam_DNA-dir_DNA_pol_B_pol2	ENSG00000101868		0.378	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POLA1	HGNC	protein_coding	OTTHUMT00000056111.1	193	0.00	0	C	NM_016937		24745162	24745162	+1	no_errors	ENST00000379068	ensembl	human	known	69_37n	missense	62	39.81	41	SNP	1.000	A
PPP3CB	5532	genome.wustl.edu	37	10	75230840	75230840	+	Missense_Mutation	SNP	G	G	A	rs1141282	byFrequency	TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr10:75230840G>A	ENST00000360663.5	-	6	908	c.797C>T	c.(796-798)tCt>tTt	p.S266F	PPP3CB_ENST00000394828.2_Missense_Mutation_p.S266F|PPP3CB_ENST00000342558.3_Missense_Mutation_p.S266F|PPP3CB_ENST00000495897.1_5'UTR|PPP3CB_ENST00000394822.2_Missense_Mutation_p.S284F|PPP3CB_ENST00000545874.1_Missense_Mutation_p.S180F|PPP3CB_ENST00000394829.2_Missense_Mutation_p.S266F			P16298	PP2BB_HUMAN	protein phosphatase 3, catalytic subunit, beta isozyme	266	Catalytic.				axon extension (GO:0048675)|calcium ion-dependent exocytosis (GO:0017156)|cellular response to drug (GO:0035690)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|innate immune response (GO:0045087)|learning (GO:0007612)|locomotion involved in locomotory behavior (GO:0031987)|memory (GO:0007613)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of transcription, DNA-templated (GO:0045893)|protein dephosphorylation (GO:0006470)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|signal transduction (GO:0007165)|social behavior (GO:0035176)|T cell activation (GO:0042110)|T cell differentiation (GO:0030217)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)	calcineurin complex (GO:0005955)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein phosphatase 2B binding (GO:0030346)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(7)|skin(1)|urinary_tract(1)	22	Prostate(51;0.0119)					ATAAAAATAAGAACATCCTCG	0.299																																						dbGAP											0													37.0	39.0	38.0					10																	75230840		2202	4299	6501	-	-	-	SO:0001583	missense	0			M29551	CCDS7328.1, CCDS44436.1, CCDS44437.1	10q22.2	2010-03-17	2010-03-05		ENSG00000107758	ENSG00000107758	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9315	protein-coding gene	gene with protein product	"""calcineurin A beta"", ""protein phosphatase 2B, catalytic subunit, beta isoform"""	114106	"""protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform (calcineurin A beta)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform"""	CALNB		1659808, 2558868	Standard	XM_005269944		Approved	CALNA2, CNA2, PP2Bbeta	uc001juf.3	P16298	OTTHUMG00000018472	ENST00000360663.5:c.797C>T	10.37:g.75230840G>A	ENSP00000353881:p.Ser266Phe		P16299|Q5F2F9|Q8N1F0|Q8N3W4	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.S266F	ENST00000360663.5	37	c.797	CCDS7328.1	10	.	.	.	.	.	.	.	.	.	.	G	20.2	3.954822	0.73902	.	.	ENSG00000107758	ENST00000360663;ENST00000394829;ENST00000394828;ENST00000342558;ENST00000545874;ENST00000394822	T;T;T;T;T;T	0.07327	3.2;3.2;3.2;3.2;3.2;3.2	5.47	5.47	0.80525	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);Metallophosphoesterase domain (1);	0.155907	0.45361	D	0.000366	T	0.53222	0.1783	H	0.99811	4.8	0.80722	D	1	B;P;D;B;P	0.76494	0.185;0.552;0.999;0.119;0.948	B;P;D;B;P	0.70487	0.187;0.708;0.969;0.118;0.889	T	0.77757	-0.2468	10	0.87932	D	0	.	19.3293	0.94278	0.0:0.0:1.0:0.0	rs1141282;rs3205202	284;180;266;266;266	P16298-2;F5H0F8;P16298-3;Q8N1F0;P16298	.;.;.;.;PP2BB_HUMAN	F	266;266;266;266;180;284	ENSP00000353881:S266F;ENSP00000378306:S266F;ENSP00000378305:S266F;ENSP00000343147:S266F;ENSP00000439876:S180F;ENSP00000378299:S284F	ENSP00000343147:S266F	S	-	2	0	PPP3CB	74900846	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.808000	0.99193	2.574000	0.86865	0.563000	0.77884	TCT	PPP3CB	-	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase	ENSG00000107758		0.299	PPP3CB-001	KNOWN	basic|CCDS	protein_coding	PPP3CB	HGNC	protein_coding	OTTHUMT00000048669.1	100	0.00	0	G	NM_021132		75230840	75230840	-1	no_errors	ENST00000394829	ensembl	human	known	69_37n	missense	66	41.59	47	SNP	1.000	A
PRDM1	639	genome.wustl.edu	37	6	106553637	106553637	+	Silent	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr6:106553637C>A	ENST00000369096.4	+	5	1836	c.1602C>A	c.(1600-1602)acC>acA	p.T534T	PRDM1_ENST00000369091.2_Silent_p.T498T|PRDM1_ENST00000369089.3_Silent_p.T400T	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	534	Interaction with PIAS1.				cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		CCAAAGCTACCTCAGCAGCGA	0.592			"""D, N, Mis, F, S"""		DLBCL																																	dbGAP		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	0													43.0	46.0	45.0					6																	106553637		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.1602C>A	6.37:g.106553637C>A			B2REA6|E1P5E0|Q86WM7	Silent	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pirsf_Znf_PRDM1,pfscan_SET_dom,pfscan_Znf_C2H2	p.T534	ENST00000369096.4	37	c.1602	CCDS5054.2	6																																																																																			PRDM1	-	pirsf_Znf_PRDM1	ENSG00000057657		0.592	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM1	HGNC	protein_coding	OTTHUMT00000041661.3	33	0.00	0	C			106553637	106553637	+1	no_errors	ENST00000369096	ensembl	human	known	69_37n	silent	24	27.27	9	SNP	1.000	A
PREX1	57580	genome.wustl.edu	37	20	47251259	47251259	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr20:47251259T>A	ENST00000371941.3	-	33	4244	c.4222A>T	c.(4222-4224)Aat>Tat	p.N1408Y	PREX1_ENST00000396220.1_Missense_Mutation_p.N1408Y	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1408					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			AAGGTGACATTGTCCAGCTCT	0.577																																						dbGAP											0													153.0	109.0	124.0					20																	47251259		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.4222A>T	20.37:g.47251259T>A	ENSP00000361009:p.Asn1408Tyr		E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.N1408Y	ENST00000371941.3	37	c.4222	CCDS13410.1	20	.	.	.	.	.	.	.	.	.	.	T	20.1	3.934700	0.73442	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.42900	0.96;0.96	5.22	4.12	0.48240	.	0.221678	0.30134	N	0.010335	T	0.36853	0.0982	L	0.46157	1.445	0.30998	N	0.720624	B;B	0.14012	0.009;0.005	B;B	0.13407	0.009;0.009	T	0.40384	-0.9566	10	0.62326	D	0.03	.	11.5702	0.50829	0.1339:0.0:0.0:0.8661	.	1408;705	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	Y	1408	ENSP00000361009:N1408Y;ENSP00000379522:N1408Y	ENSP00000361009:N1408Y	N	-	1	0	PREX1	46684666	1.000000	0.71417	0.915000	0.36163	0.971000	0.66376	5.935000	0.70145	0.816000	0.34421	-0.378000	0.06908	AAT	PREX1	-	NULL	ENSG00000124126		0.577	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PREX1	HGNC	protein_coding	OTTHUMT00000079623.1	135	0.00	0	T	NM_020820		47251259	47251259	-1	no_errors	ENST00000371941	ensembl	human	known	69_37n	missense	69	23.33	21	SNP	1.000	A
PREX2	80243	genome.wustl.edu	37	8	68982088	68982088	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr8:68982088C>T	ENST00000288368.4	+	13	1739	c.1462C>T	c.(1462-1464)Cgt>Tgt	p.R488C	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	488					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						ATTATATTGTCGTCTTCATAG	0.294																																						dbGAP											0													190.0	196.0	194.0					8																	68982088		2203	4295	6498	-	-	-	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1462C>T	8.37:g.68982088C>T	ENSP00000288368:p.Arg488Cys		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R488C	ENST00000288368.4	37	c.1462	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	C	23.5	4.420300	0.83559	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.14266	2.52	5.66	5.66	0.87406	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.114351	0.64402	D	0.000010	T	0.26991	0.0661	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.00885	-1.1527	10	0.87932	D	0	.	15.325	0.74154	0.1404:0.8596:0.0:0.0	.	488;488;488	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	C	488	ENSP00000288368:R488C	ENSP00000288368:R488C	R	+	1	0	PREX2	69144642	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.723000	0.47277	2.692000	0.91855	0.644000	0.83932	CGT	PREX2	-	NULL	ENSG00000046889		0.294	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	211	0.47	1	C	NM_025170		68982088	68982088	+1	no_errors	ENST00000288368	ensembl	human	known	69_37n	missense	684	13.64	108	SNP	1.000	T
PSKH1	5681	genome.wustl.edu	37	16	67942933	67942933	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr16:67942933T>A	ENST00000291041.5	+	2	451	c.281T>A	c.(280-282)gTt>gAt	p.V94D		NM_006742.2	NP_006733.1	P11801	KPSH1_HUMAN	protein serine kinase H1	94						cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|large_intestine(1)|lung(7)|pancreas(1)	12		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0044)|Epithelial(162;0.0197)|all cancers(182;0.128)		GACCCACGTGTTACAGCTAAG	0.617																																						dbGAP											0													70.0	66.0	67.0					16																	67942933		2198	4300	6498	-	-	-	SO:0001583	missense	0			M14504	CCDS10851.1	16q22.1	2008-02-05			ENSG00000159792	ENSG00000159792			9529	protein-coding gene	gene with protein product		177015				8268911	Standard	NM_006742		Approved		uc002euv.3	P11801	OTTHUMG00000137548	ENST00000291041.5:c.281T>A	16.37:g.67942933T>A	ENSP00000291041:p.Val94Asp		Q9NY19	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V94D	ENST00000291041.5	37	c.281	CCDS10851.1	16	.	.	.	.	.	.	.	.	.	.	T	24.0	4.477938	0.84747	.	.	ENSG00000159792	ENST00000291041	T	0.40756	1.02	5.56	5.56	0.83823	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.63604	0.2525	M	0.73217	2.22	0.80722	D	1	D	0.76494	0.999	D	0.70487	0.969	T	0.67699	-0.5603	10	0.87932	D	0	-16.5878	15.3835	0.74679	0.0:0.0:0.0:1.0	.	94	P11801	KPSH1_HUMAN	D	94	ENSP00000291041:V94D	ENSP00000291041:V94D	V	+	2	0	PSKH1	66500434	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.698000	0.84413	2.133000	0.65898	0.533000	0.62120	GTT	PSKH1	-	superfamily_Kinase-like_dom	ENSG00000159792		0.617	PSKH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSKH1	HGNC	protein_coding	OTTHUMT00000268882.3	66	0.00	0	T	NM_006742		67942933	67942933	+1	no_errors	ENST00000291041	ensembl	human	known	69_37n	missense	37	42.19	27	SNP	1.000	A
PZP	5858	genome.wustl.edu	37	12	9321484	9321484	+	Silent	SNP	T	T	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr12:9321484T>A	ENST00000261336.2	-	17	2116	c.2088A>T	c.(2086-2088)gtA>gtT	p.V696V	PZP_ENST00000539983.1_5'Flank|PZP_ENST00000381997.2_Silent_p.V565V	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	696	Bait region.				female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						ATCCTTGACCTACTGCTCCTG	0.378																																					Melanoma(125;1402 1695 4685 34487 38571)	dbGAP											0													125.0	125.0	125.0					12																	9321484		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.2088A>T	12.37:g.9321484T>A			A6ND27|Q15273|Q2NKL2|Q7M4N7	Silent	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.V696	ENST00000261336.2	37	c.2088	CCDS8600.1	12																																																																																			PZP	-	NULL	ENSG00000126838		0.378	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	HGNC	protein_coding	OTTHUMT00000337624.1	279	0.00	0	T	NM_002864		9321484	9321484	-1	no_errors	ENST00000261336	ensembl	human	known	69_37n	silent	346	11.51	45	SNP	0.000	A
RAPGEF6	51735	genome.wustl.edu	37	5	130778206	130778206	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr5:130778206C>A	ENST00000509018.1	-	23	3651	c.3446G>T	c.(3445-3447)aGa>aTa	p.R1149I	RAPGEF6_ENST00000308008.6_Missense_Mutation_p.R1149I|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.R1162I|RAPGEF6_ENST00000512052.1_Missense_Mutation_p.R872I|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.R1199I|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.R1157I|RAPGEF6_ENST00000296859.6_Missense_Mutation_p.R1157I	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	1149					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		TTTGGCTGATCTTTTCTCACT	0.423																																					Melanoma(168;435 1955 13113 13877 23213)	dbGAP											0													154.0	143.0	146.0					5																	130778206		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.3446G>T	5.37:g.130778206C>A	ENSP00000421684:p.Arg1149Ile		A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_PDZ,pfam_Ras-assoc,pfam_cNMP-bd_dom,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_PDZ,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_PDZ,smart_Ras-assoc,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_PDZ,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R1149I	ENST00000509018.1	37	c.3446	CCDS34225.1	5	.	.	.	.	.	.	.	.	.	.	C	19.09	3.760544	0.69763	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000512052;ENST00000308008;ENST00000514667	T;T;T;T;T;T;T	0.30981	1.73;1.66;1.66;1.74;1.52;1.51;1.83	5.94	1.18	0.20946	Ras guanine nucleotide exchange factor, domain (1);	0.092361	0.64402	D	0.000001	T	0.48259	0.1490	M	0.74258	2.255	0.80722	D	1	P;B;D;P;P;P;B	0.56746	0.597;0.41;0.977;0.843;0.843;0.719;0.41	P;B;P;P;P;P;B	0.61397	0.474;0.299;0.888;0.474;0.602;0.674;0.395	T	0.46034	-0.9220	10	0.72032	D	0.01	.	10.7911	0.46434	0.0:0.692:0.0:0.308	.	1157;1157;1149;872;1199;1162;1149	A3KN82;B7ZML2;Q8TEU7-2;D6RE77;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;.;.;RPGF6_HUMAN	I	1149;1162;1157;1157;1162;872;1149;1199	ENSP00000421684:R1149I;ENSP00000309298:R1162I;ENSP00000426081:R1157I;ENSP00000296859:R1157I;ENSP00000426910:R872I;ENSP00000311419:R1149I;ENSP00000426948:R1199I	ENSP00000426948:R1199I	R	-	2	0	RAPGEF6;FNIP1	130806105	0.980000	0.34600	0.993000	0.49108	0.638000	0.38207	0.267000	0.18552	-0.072000	0.12864	-0.244000	0.11960	AGA	RAPGEF6	-	superfamily_Ras_GEF_dom	ENSG00000158987		0.423	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF6	HGNC	protein_coding	OTTHUMT00000370059.1	167	0.00	0	C	NM_016340		130778206	130778206	-1	no_errors	ENST00000509018	ensembl	human	known	69_37n	missense	62	50.00	62	SNP	1.000	A
RBM4B	83759	genome.wustl.edu	37	11	66444335	66444335	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr11:66444335A>T	ENST00000525754.1	-	1	884	c.216T>A	c.(214-216)aaT>aaA	p.N72K	RBM4B_ENST00000310046.4_Missense_Mutation_p.N72K|RBM4B_ENST00000524637.1_Missense_Mutation_p.N72K|RBM4B_ENST00000531969.1_Missense_Mutation_p.N72K|RBM4B_ENST00000531036.2_Missense_Mutation_p.N72K			Q9BQ04	RBM4B_HUMAN	RNA binding motif protein 4B	72	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|entrainment of circadian clock by photoperiod (GO:0043153)|mRNA processing (GO:0006397)|positive regulation of gene expression (GO:0010628)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(4)|lung(1)|urinary_tract(2)	10						CTTTGCTCTTATTCTTGCTGG	0.498																																						dbGAP											0													285.0	254.0	264.0					11																	66444335		2200	4295	6495	-	-	-	SO:0001583	missense	0			AK095158	CCDS8149.1, CCDS66144.1	11q13	2013-02-12	2006-01-25	2006-01-25				"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	28842	protein-coding gene	gene with protein product			"""RNA binding motif protein 30"""	RBM30		12477932	Standard	XR_247213		Approved	MGC10871, ZCCHC15, RBM4L, ZCRB3B, ZCCHC21B	uc001ojb.3	Q9BQ04		ENST00000525754.1:c.216T>A	11.37:g.66444335A>T	ENSP00000433071:p.Asn72Lys		B3KT83	Missense_Mutation	SNP	pfam_RRM_dom,pfam_Znf_CCHC,smart_RRM_dom,smart_Znf_CCHC,pfscan_Znf_CCHC,pfscan_RRM_dom	p.N72K	ENST00000525754.1	37	c.216	CCDS8149.1	11	.	.	.	.	.	.	.	.	.	.	A	16.04	3.008652	0.54361	.	.	ENSG00000173914	ENST00000525754;ENST00000310046;ENST00000531969;ENST00000524637	T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77	5.67	-1.1	0.09872	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.146633	0.64402	D	0.000003	T	0.66167	0.2762	L	0.58583	1.82	0.38491	D	0.94798	B	0.18610	0.029	B	0.14578	0.011	T	0.59161	-0.7506	10	0.33141	T	0.24	-29.1046	12.6833	0.56934	0.228:0.0:0.772:0.0	.	72	Q9BQ04	RBM4B_HUMAN	K	72	ENSP00000433071:N72K;ENSP00000310471:N72K;ENSP00000435239:N72K;ENSP00000433113:N72K	ENSP00000310471:N72K	N	-	3	2	RBM4B	66200911	0.965000	0.33210	0.998000	0.56505	0.993000	0.82548	0.642000	0.24735	-0.128000	0.11641	0.454000	0.30748	AAT	RBM4B	-	pfscan_RRM_dom	ENSG00000173914		0.498	RBM4B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RBM4B	HGNC	protein_coding	OTTHUMT00000393851.1	127	0.00	0	A	NM_031492		66444335	66444335	-1	no_errors	ENST00000310046	ensembl	human	known	69_37n	missense	217	37.28	129	SNP	1.000	T
RETSAT	54884	genome.wustl.edu	37	2	85570864	85570864	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr2:85570864G>A	ENST00000295802.4	-	10	1703	c.1591C>T	c.(1591-1593)Cga>Tga	p.R531*	RETSAT_ENST00000457495.2_Nonsense_Mutation_p.R470*|RETSAT_ENST00000263854.6_Missense_Mutation_p.P475L|RETSAT_ENST00000475624.2_5'UTR	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	531					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	CAGGCACCTCGGGGAGCAGCC	0.627																																						dbGAP											0													43.0	45.0	44.0					2																	85570864		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.1591C>T	2.37:g.85570864G>A	ENSP00000295802:p.Arg531*		A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Nonsense_Mutation	SNP	pfam_Amino_oxidase,pfam_FAD_bind_dom,pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_mOase_FAD-bd	p.R531*	ENST00000295802.4	37	c.1591	CCDS1972.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.61|15.61	2.883709|2.883709	0.51908|0.51908	.|.	.|.	ENSG00000042445|ENSG00000042445	ENST00000263854|ENST00000295802;ENST00000457495	.|.	.|.	.|.	5.02|5.02	4.14|4.14	0.48551|0.48551	.|.	.|0.429133	.|0.23951	.|N	.|0.042952	T|.	0.20047|.	0.0482|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.18935|.	-1.0321|.	5|.	0.30078|0.07813	T|T	0.28|0.8	-1.4112|-1.4112	11.5524|11.5524	0.50729|0.50729	0.0883:0.0:0.9117:0.0|0.0883:0.0:0.9117:0.0	.|.	.|.	.|.	.|.	L|X	475|531;470	.|.	ENSP00000263854:P475L|ENSP00000295802:R531X	P|R	-|-	2|1	0|2	RETSAT|RETSAT	85424375|85424375	0.043000|0.043000	0.20138|0.20138	0.046000|0.046000	0.18839|0.18839	0.520000|0.520000	0.34377|0.34377	1.708000|1.708000	0.37899|0.37899	1.250000|1.250000	0.43966|0.43966	-0.258000|-0.258000	0.10820|0.10820	CCG|CGA	RETSAT	-	NULL	ENSG00000042445		0.627	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RETSAT	HGNC	protein_coding	OTTHUMT00000252489.1	108	0.00	0	G	NM_017750		85570864	85570864	-1	no_errors	ENST00000295802	ensembl	human	known	69_37n	nonsense	63	35.05	34	SNP	0.011	A
RIC8A	60626	genome.wustl.edu	37	11	209698	209698	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr11:209698G>T	ENST00000526104.1	+	3	1768	c.424G>T	c.(424-426)Gtg>Ttg	p.V142L	BET1L_ENST00000382762.3_5'Flank|BET1L_ENST00000529614.2_5'Flank|RIC8A_ENST00000527696.1_Missense_Mutation_p.V136L|BET1L_ENST00000410108.1_5'Flank|RIC8A_ENST00000325207.5_Missense_Mutation_p.V142L|BET1L_ENST00000325147.9_5'Flank|BET1L_ENST00000332865.6_5'Flank|BET1L_ENST00000486280.1_5'Flank			Q9NPQ8	RIC8A_HUMAN	RIC8 guanine nucleotide exchange factor A	142					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|basement membrane organization (GO:0071711)|cell migration involved in gastrulation (GO:0042074)|cell-cell adhesion involved in gastrulation (GO:0070586)|in utero embryonic development (GO:0001701)|vasculature development (GO:0001944)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)	13		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CCGCCTAGTGGTGAAGCTCAC	0.602																																						dbGAP											0													48.0	44.0	46.0					11																	209698		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022870	CCDS7690.1, CCDS65982.1	11p15.5	2013-08-05	2013-08-05		ENSG00000177963	ENSG00000177963			29550	protein-coding gene	gene with protein product		609146	"""resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)"""			10985349, 11230166	Standard	XM_005253052		Approved	synembryn, synembryn-A	uc001lof.3	Q9NPQ8	OTTHUMG00000119069	ENST00000526104.1:c.424G>T	11.37:g.209698G>T	ENSP00000432008:p.Val142Leu		Q0P508|Q2T9J1|Q7Z352|Q96EZ1|Q96SZ2|Q9H064|Q9H5H3|Q9H9E7	Missense_Mutation	SNP	pfam_Gua_nucleotide_exch_fac_Ric8,superfamily_ARM-type_fold,prints_Synembryn	p.V142L	ENST00000526104.1	37	c.424		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.34|15.34	2.803701|2.803701	0.50315|0.50315	.|.	.|.	ENSG00000177963|ENSG00000177963	ENST00000526104;ENST00000325207;ENST00000528357;ENST00000530889;ENST00000527696;ENST00000527468|ENST00000527728	T;T;T|.	0.48522|.	0.81;0.81;0.81|.	4.56|4.56	3.64|3.64	0.41730|0.41730	Armadillo-type fold (1);|.	0.631482|.	0.16092|.	N|.	0.230014|.	T|T	0.53318|0.53318	0.1789|0.1789	L|L	0.34521|0.34521	1.04|1.04	0.40031|0.40031	D|D	0.975537|0.975537	B;B;B|.	0.25667|.	0.029;0.131;0.107|.	B;B;B|.	0.19666|.	0.015;0.026;0.023|.	T|T	0.50516|0.50516	-0.8819|-0.8819	10|5	0.29301|.	T|.	0.29|.	-25.0774|-25.0774	12.5892|12.5892	0.56434|0.56434	0.083:0.0:0.917:0.0|0.083:0.0:0.917:0.0	.|.	136;142;142|.	Q9NPQ8-2;Q9NPQ8;Q9NPQ8-3|.	.;RIC8A_HUMAN;.|.	L|C	142;142;118;146;136;32|23	ENSP00000432008:V142L;ENSP00000325941:V142L;ENSP00000434833:V136L|.	ENSP00000325941:V142L|.	V|W	+|+	1|3	0|0	RIC8A|RIC8A	199698|199698	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.500000|0.500000	0.33767|0.33767	3.081000|3.081000	0.50120|0.50120	1.226000|1.226000	0.43582|0.43582	-0.291000|-0.291000	0.09656|0.09656	GTG|TGG	RIC8A	-	pfam_Gua_nucleotide_exch_fac_Ric8,superfamily_ARM-type_fold	ENSG00000177963		0.602	RIC8A-002	KNOWN	basic|appris_candidate	protein_coding	RIC8A	HGNC	protein_coding	OTTHUMT00000384761.1	44	0.00	0	G	NM_021932		209698	209698	+1	no_errors	ENST00000325207	ensembl	human	known	69_37n	missense	33	31.25	15	SNP	1.000	T
RPL18	6141	genome.wustl.edu	37	19	49119404	49119404	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr19:49119404C>A	ENST00000549920.1	-	5	745	c.353G>T	c.(352-354)gGc>gTc	p.G118V	FAM83E_ENST00000595110.1_5'Flank|FAM83E_ENST00000263266.3_5'Flank|RPL18_ENST00000552588.1_Missense_Mutation_p.G89V|RPL18_ENST00000549273.1_Missense_Mutation_p.G118V|RPL18_ENST00000550645.1_Intron	NM_000979.3	NP_000970.1	Q07020	RL18_HUMAN	ribosomal protein L18	118					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|kidney(2)	3		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.89e-05)|all cancers(93;0.00011)|GBM - Glioblastoma multiforme(486;0.0061)|Epithelial(262;0.0154)		GAGGATCTTGCCCCCTGCCCT	0.652																																						dbGAP											0													69.0	63.0	65.0					19																	49119404		2203	4300	6503	-	-	-	SO:0001583	missense	0			L11566	CCDS12726.1, CCDS58669.1	19q13	2011-04-06				ENSG00000063177		"""L ribosomal proteins"""	10310	protein-coding gene	gene with protein product	"""60S ribosomal protein L18"""	604179				8218404	Standard	NM_000979		Approved	L18	uc002pjq.2	Q07020	OTTHUMG00000169760	ENST00000549920.1:c.353G>T	19.37:g.49119404C>A	ENSP00000447001:p.Gly118Val		F8VWC5|Q8WTZ6	Missense_Mutation	SNP	pfam_Ribosomal_L18e/L15P,superfamily_Ribosomal_L18e/L15P	p.G118V	ENST00000549920.1	37	c.353	CCDS12726.1	19	.	.	.	.	.	.	.	.	.	.	C	34	5.320900	0.95682	.	.	ENSG00000063177	ENST00000549920;ENST00000552588;ENST00000549273;ENST00000550973	.	.	.	5.25	5.25	0.73442	Ribosomal protein L18e/L15P (2);	0.000000	0.85682	D	0.000000	D	0.90494	0.7022	H	0.98487	4.245	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93908	0.7194	9	0.87932	D	0	-29.536	16.7117	0.85387	0.0:1.0:0.0:0.0	.	118	Q07020	RL18_HUMAN	V	118;89;118;66	.	ENSP00000449610:G118V	G	-	2	0	RPL18	53811216	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.882000	0.75589	2.627000	0.88993	0.467000	0.42956	GGC	RPL18	-	pfam_Ribosomal_L18e/L15P,superfamily_Ribosomal_L18e/L15P	ENSG00000063177		0.652	RPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL18	HGNC	protein_coding	OTTHUMT00000405732.2	92	0.00	0	C	NM_000979		49119404	49119404	-1	no_errors	ENST00000549920	ensembl	human	known	69_37n	missense	35	40.68	24	SNP	1.000	A
RUFY3	22902	genome.wustl.edu	37	4	71654523	71654524	+	Splice_Site	INS	-	-	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr4:71654523_71654524insA	ENST00000226328.4	+	11	1635_1636	c.1072_1073insA	c.(1072-1074)gat>gAat	p.D358fs	RUFY3_ENST00000381006.3_Splice_Site_p.D358fs|RUFY3_ENST00000502653.1_Splice_Site_p.D305fs|RUFY3_ENST00000417478.2_Splice_Site_p.D418fs|RUFY3_ENST00000536664.1_Splice_Site_p.D342fs	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3	358					negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			TTGGGGGCAGGATGTTGAGAAA	0.441																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910	ENST00000226328.4:c.1072-1->A	4.37:g.71654524_71654524dupA			B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Frame_Shift_Ins	INS	pfam_Run,superfamily_Prefoldin,smart_Run,pfscan_Run	p.D418fs	ENST00000226328.4	37	c.1252_1253	CCDS3547.1	4																																																																																			RUFY3	-	NULL	ENSG00000018189		0.441	RUFY3-001	KNOWN	basic|CCDS	protein_coding	RUFY3	HGNC	protein_coding	OTTHUMT00000252161.2	98	0.00	0	-	NM_014961	Frame_Shift_Ins	71654523	71654524	+1	no_errors	ENST00000417478	ensembl	human	known	69_37n	frame_shift_ins	74	26.00	26	INS	1.000:1.000	A
SAGE1	55511	genome.wustl.edu	37	X	134995008	134995008	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chrX:134995008A>G	ENST00000370709.3	+	19	2667	c.2667A>G	c.(2665-2667)atA>atG	p.I889M	SAGE1_ENST00000537770.1_Missense_Mutation_p.I513M|SAGE1_ENST00000324447.3_Missense_Mutation_p.I889M|SAGE1_ENST00000535938.1_Missense_Mutation_p.I889M			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	889						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					TTAAAGAAATAGATTCCCACT	0.378																																						dbGAP											0													49.0	43.0	45.0					X																	134995008		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.2667A>G	X.37:g.134995008A>G	ENSP00000359743:p.Ile889Met		Q5JNW0	Missense_Mutation	SNP	NULL	p.I889M	ENST00000370709.3	37	c.2667	CCDS14652.1	X	.	.	.	.	.	.	.	.	.	.	A	11.73	1.727209	0.30593	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000537770;ENST00000370709	T;T;T;T	0.39592	1.07;1.07;1.11;1.07	1.73	0.275	0.15659	.	0.629307	0.14442	U	0.319348	T	0.34687	0.0906	N	0.25485	0.75	0.09310	N	1	B;D	0.55605	0.14;0.972	B;P	0.52217	0.163;0.693	T	0.18304	-1.0341	10	0.87932	D	0	.	4.542	0.12061	0.7087:0.0:0.0:0.2913	.	513;889	F5H2Z8;Q9NXZ1	.;SAGE1_HUMAN	M	889;889;513;889	ENSP00000323191:I889M;ENSP00000445959:I889M;ENSP00000438276:I513M;ENSP00000359743:I889M	ENSP00000323191:I889M	I	+	3	3	SAGE1	134822674	0.000000	0.05858	0.001000	0.08648	0.303000	0.27691	-0.226000	0.09139	-0.160000	0.11002	0.150000	0.16122	ATA	SAGE1	-	NULL	ENSG00000181433		0.378	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAGE1	HGNC	protein_coding	OTTHUMT00000058448.1	59	0.00	0	A	NM_018666		134995008	134995008	+1	no_errors	ENST00000324447	ensembl	human	known	69_37n	missense	36	53.85	42	SNP	0.006	G
SCAP	22937	genome.wustl.edu	37	3	47463968	47463968	+	Silent	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr3:47463968G>A	ENST00000265565.5	-	10	1621	c.1209C>T	c.(1207-1209)atC>atT	p.I403I	SCAP_ENST00000465628.1_5'Flank|SCAP_ENST00000441517.2_Silent_p.I148I|SCAP_ENST00000545718.1_Silent_p.I11I	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	403	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		AGCCGATGAGGATGATGCCCA	0.612																																					Pancreas(149;978 1908 29304 37806 46700)	dbGAP											0													218.0	185.0	197.0					3																	47463968		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.1209C>T	3.37:g.47463968G>A			Q8N2E0|Q8WUA1	Missense_Mutation	SNP	NULL	p.P142S	ENST00000265565.5	37	c.424	CCDS2755.2	3																																																																																			SCAP	-	NULL	ENSG00000114650		0.612	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAP	HGNC	protein_coding	OTTHUMT00000246872.2	59	0.00	0	G	NM_012235		47463968	47463968	-1	no_errors	ENST00000320017	ensembl	human	known	69_37n	missense	15	51.61	16	SNP	1.000	A
SCN1A	6323	genome.wustl.edu	37	2	166850747	166850747	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr2:166850747C>G	ENST00000303395.4	-	25	4760	c.4761G>C	c.(4759-4761)gaG>gaC	p.E1587D	AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.E1559D|SCN1A_ENST00000423058.2_Missense_Mutation_p.E1587D|SCN1A_ENST00000375405.3_Missense_Mutation_p.E1576D|AC010127.3_ENST00000595647.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1587					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCAGTACACACTCTCCAGTAA	0.373																																						dbGAP											0													134.0	106.0	116.0					2																	166850747		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4761G>C	2.37:g.166850747C>G	ENSP00000303540:p.Glu1587Asp		E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.E1587D	ENST00000303395.4	37	c.4761	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	C	19.69	3.874948	0.72180	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.98192	-4.78;-4.78;-4.78;-4.78	5.9	0.388	0.16264	.	0.000000	0.85682	D	0.000000	D	0.99077	0.9683	H	0.97158	3.95	0.43503	D	0.99575	D	0.89917	1.0	D	0.87578	0.998	D	0.98611	1.0663	10	0.87932	D	0	.	8.8635	0.35272	0.0:0.4594:0.0:0.5406	.	1576	P35498-2	.	D	1587;1587;1576;1559	ENSP00000407030:E1587D;ENSP00000303540:E1587D;ENSP00000364554:E1576D;ENSP00000386312:E1559D	ENSP00000303540:E1587D	E	-	3	2	SCN1A	166558993	0.945000	0.32115	0.999000	0.59377	0.962000	0.63368	0.050000	0.14120	0.122000	0.18314	0.650000	0.86243	GAG	SCN1A	-	pfam_Ion_trans_dom	ENSG00000144285		0.373	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	HGNC	protein_coding	OTTHUMT00000102661.1	163	0.00	0	C	NM_006920		166850747	166850747	-1	no_errors	ENST00000303395	ensembl	human	known	69_37n	missense	148	22.11	42	SNP	0.997	G
SH3PXD2B	285590	genome.wustl.edu	37	5	171765983	171765983	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr5:171765983G>A	ENST00000311601.5	-	13	2296	c.2126C>T	c.(2125-2127)gCc>gTc	p.A709V	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	709					adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCTGTCCTGGGCGCGGCCAGG	0.627																																						dbGAP											0													34.0	37.0	36.0					5																	171765983		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.2126C>T	5.37:g.171765983G>A	ENSP00000309714:p.Ala709Val		B6F0V2|Q9P2Q1	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Phox,pfam_SH3-like_bac,pfam_DUF1058,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.A709V	ENST00000311601.5	37	c.2126	CCDS34291.1	5	.	.	.	.	.	.	.	.	.	.	G	5.215	0.225136	0.09916	.	.	ENSG00000174705	ENST00000311601	T	0.60797	0.16	5.42	2.59	0.31030	.	1.139100	0.06466	N	0.730349	T	0.39682	0.1087	N	0.19112	0.55	0.21064	N	0.999791	B	0.02656	0.0	B	0.01281	0.0	T	0.24404	-1.0161	9	.	.	.	-1.3909	4.8659	0.13607	0.2615:0.1636:0.5749:0.0	.	709	A1X283	SPD2B_HUMAN	V	709	ENSP00000309714:A709V	.	A	-	2	0	SH3PXD2B	171698588	0.953000	0.32496	0.840000	0.33206	0.196000	0.23810	1.761000	0.38440	0.233000	0.21120	0.561000	0.74099	GCC	SH3PXD2B	-	NULL	ENSG00000174705		0.627	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3PXD2B	HGNC	protein_coding	OTTHUMT00000372449.1	64	0.00	0	G	NM_017963		171765983	171765983	-1	no_errors	ENST00000311601	ensembl	human	known	69_37n	missense	32	15.79	6	SNP	0.709	A
SLC5A11	115584	genome.wustl.edu	37	16	24919344	24919344	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr16:24919344C>A	ENST00000347898.3	+	13	1948	c.1326C>A	c.(1324-1326)agC>agA	p.S442R	SLC5A11_ENST00000567758.1_Missense_Mutation_p.S407R|SLC5A11_ENST00000565769.1_Missense_Mutation_p.S378R|SLC5A11_ENST00000539472.1_Missense_Mutation_p.S378R|SLC5A11_ENST00000568579.1_Missense_Mutation_p.S372R|SLC5A11_ENST00000449109.2_Missense_Mutation_p.S286R|SLC5A11_ENST00000545376.1_Missense_Mutation_p.S372R|SLC5A11_ENST00000569071.1_Missense_Mutation_p.S286R|SLC5A11_ENST00000424767.2_Missense_Mutation_p.S407R	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11											endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		TCCAGGCCAGCCAGGGCGGCC	0.587																																						dbGAP											0													113.0	121.0	118.0					16																	24919344		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.1326C>A	16.37:g.24919344C>A	ENSP00000289932:p.Ser442Arg			Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.S442R	ENST00000347898.3	37	c.1326	CCDS10625.1	16	.	.	.	.	.	.	.	.	.	.	C	19.17	3.775350	0.70107	.	.	ENSG00000158865	ENST00000347898;ENST00000449109;ENST00000424767;ENST00000545376;ENST00000539472	D;D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31;-2.31	5.08	4.12	0.48240	.	0.118725	0.85682	D	0.000000	D	0.91553	0.7332	M	0.81341	2.54	0.58432	D	0.999997	D;D;D;D	0.76494	0.988;0.993;0.978;0.999	P;D;D;D	0.71656	0.89;0.917;0.917;0.974	D	0.90966	0.4816	10	0.56958	D	0.05	.	6.8248	0.23876	0.0:0.8081:0.0:0.1919	.	372;407;442;286	B7Z329;Q8WWX8-2;Q8WWX8;Q05BF1	.;.;SC5AB_HUMAN;.	R	442;286;407;372;378	ENSP00000289932:S442R;ENSP00000389606:S286R;ENSP00000416782:S407R;ENSP00000441384:S372R;ENSP00000441018:S378R	ENSP00000289932:S442R	S	+	3	2	SLC5A11	24826845	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.255000	0.32909	2.370000	0.80446	0.591000	0.81541	AGC	SLC5A11	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000158865		0.587	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A11	HGNC	protein_coding	OTTHUMT00000214091.3	41	0.00	0	C	NM_052944		24919344	24919344	+1	no_errors	ENST00000347898	ensembl	human	known	69_37n	missense	71	17.24	15	SNP	1.000	A
SPDYE4	388333	genome.wustl.edu	37	17	8660710	8660710	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr17:8660710C>G	ENST00000328794.6	-	2	386	c.210G>C	c.(208-210)gaG>gaC	p.E70D		NM_001128076.1	NP_001121548.1	A6NLX3	SPDE4_HUMAN	speedy/RINGO cell cycle regulator family member E4	70										breast(1)|endometrium(2)|kidney(1)	4						CGCGCTCCAActccagctcct	0.617																																						dbGAP											0													69.0	72.0	71.0					17																	8660710		692	1591	2283	-	-	-	SO:0001583	missense	0			BC146949	CCDS45609.1	17p13.1	2013-05-08	2013-05-08			ENSG00000183318		"""Speedy homologs"""	35463	protein-coding gene	gene with protein product			"""speedy homolog E4 (Xenopus laevis)"""				Standard	NM_001128076		Approved		uc010cnz.1	A6NLX3		ENST00000328794.6:c.210G>C	17.37:g.8660710C>G	ENSP00000329522:p.Glu70Asp		B2RUZ6	Missense_Mutation	SNP	pfam_Cell_cycle_regulatory_Spy1	p.E70D	ENST00000328794.6	37	c.210	CCDS45609.1	17	.	.	.	.	.	.	.	.	.	.	C	6.780	0.512933	0.12944	.	.	ENSG00000183318	ENST00000328794	.	.	.	0.956	-0.156	0.13391	.	1.612970	0.03877	N	0.276629	T	0.25195	0.0612	N	0.25647	0.755	0.09310	N	1	P	0.39782	0.688	B	0.36959	0.237	T	0.20773	-1.0265	9	0.54805	T	0.06	.	4.7987	0.13284	0.0:0.6017:0.3983:0.0	.	70	A6NLX3	SPDE4_HUMAN	D	70	.	ENSP00000329522:E70D	E	-	3	2	SPDYE4	8601435	0.020000	0.18652	0.001000	0.08648	0.001000	0.01503	-0.412000	0.07132	-0.029000	0.13827	-0.463000	0.05309	GAG	SPDYE4	-	NULL	ENSG00000183318		0.617	SPDYE4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPDYE4	HGNC	protein_coding	OTTHUMT00000442494.1	227	0.00	0	C	NM_001128076		8660710	8660710	-1	no_errors	ENST00000328794	ensembl	human	known	69_37n	missense	47	29.85	20	SNP	0.001	G
SPG20	23111	genome.wustl.edu	37	13	36886599	36886599	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr13:36886599G>C	ENST00000451493.1	-	7	1716	c.1499C>G	c.(1498-1500)aCt>aGt	p.T500S	SPG20_ENST00000355182.4_Missense_Mutation_p.T500S|SPG20_ENST00000438666.2_Missense_Mutation_p.T500S|SPG20_ENST00000494062.2_Missense_Mutation_p.T500S	NM_001142295.1	NP_001135767.1	Q8N0X7	SPG20_HUMAN	spastic paraplegia 20 (Troyer syndrome)	500					abscission (GO:0009838)|adipose tissue development (GO:0060612)|cell death (GO:0008219)|cell division (GO:0051301)|lipid particle organization (GO:0034389)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of collateral sprouting in absence of injury (GO:0048698)|neuromuscular process (GO:0050905)|regulation of mitochondrial membrane potential (GO:0051881)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|midbody (GO:0030496)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ubiquitin protein ligase binding (GO:0031625)	p.T500I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	27		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		ATTTGCTACAGTGCAAACTCC	0.333																																						dbGAP											1	Substitution - Missense(1)	lung(1)											111.0	110.0	110.0					13																	36886599		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011182	CCDS9356.1	13q13.1	2008-07-04	2007-04-23		ENSG00000133104	ENSG00000133104			18514	protein-coding gene	gene with protein product	"""spartin"""	607111				6022528, 12134148	Standard	NM_001142294		Approved	KIAA0610, TAHCCP1	uc001uvm.3	Q8N0X7	OTTHUMG00000016730	ENST00000451493.1:c.1499C>G	13.37:g.36886599G>C	ENSP00000414147:p.Thr500Ser		O60349|Q86Y67|Q9H1T2|Q9H1T3	Missense_Mutation	SNP	pfam_Senescence/spartin,pfam_MIT,smart_MIT	p.T500S	ENST00000451493.1	37	c.1499	CCDS9356.1	13	.	.	.	.	.	.	.	.	.	.	G	10.23	1.293589	0.23564	.	.	ENSG00000133104	ENST00000438666;ENST00000355182;ENST00000451493;ENST00000423217	D;D;D	0.88046	-2.33;-2.33;-2.33	6.16	6.16	0.99307	Senescence/spartin-associated (1);	0.475483	0.24172	N	0.040885	T	0.76111	0.3942	N	0.05078	-0.115	0.31600	N	0.65285	B;B	0.12630	0.006;0.006	B;B	0.15052	0.012;0.012	T	0.64655	-0.6356	10	0.11182	T	0.66	-13.7585	20.8598	0.99761	0.0:0.0:1.0:0.0	.	500;500	A8K6Q9;Q8N0X7	.;SPG20_HUMAN	S	500	ENSP00000406061:T500S;ENSP00000347314:T500S;ENSP00000414147:T500S	ENSP00000347314:T500S	T	-	2	0	SPG20	35784599	1.000000	0.71417	0.972000	0.41901	0.977000	0.68977	4.859000	0.62954	2.937000	0.99478	0.650000	0.86243	ACT	SPG20	-	pfam_Senescence/spartin	ENSG00000133104		0.333	SPG20-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SPG20	HGNC	protein_coding	OTTHUMT00000044494.2	146	0.00	0	G			36886599	36886599	-1	no_errors	ENST00000355182	ensembl	human	known	69_37n	missense	116	20.00	29	SNP	0.909	C
STK11IP	114790	genome.wustl.edu	37	2	220479214	220479214	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr2:220479214G>T	ENST00000456909.1	+	23	2905	c.2815G>T	c.(2815-2817)Gac>Tac	p.D939Y	STK11IP_ENST00000295641.10_Missense_Mutation_p.D950Y			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	950					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCTGGAAAAAGACTCATCCTT	0.552																																						dbGAP											0													91.0	94.0	93.0					2																	220479214		1976	4156	6132	-	-	-	SO:0001583	missense	0			AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.2815G>T	2.37:g.220479214G>T	ENSP00000389383:p.Asp939Tyr		Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	NULL	p.D939Y	ENST00000456909.1	37	c.2815		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.16|15.16	2.750807|2.750807	0.49257|0.49257	.|.	.|.	ENSG00000144589|ENSG00000144589	ENST00000456909;ENST00000295641|ENST00000447191	T;T|.	0.06933|.	3.25;3.24|.	4.81|4.81	3.03|3.03	0.35002|0.35002	.|.	0.396368|.	0.27591|.	N|.	0.018683|.	T|T	0.44350|0.44350	0.1289|0.1289	L|L	0.57536|0.57536	1.79|1.79	0.09310|0.09310	N|N	1|1	P|.	0.41848|.	0.763|.	P|.	0.52267|.	0.694|.	T|T	0.31336|0.31336	-0.9947|-0.9947	10|6	0.72032|0.44086	D|T	0.01|0.13	-2.9156|-2.9156	7.577|7.577	0.27942|0.27942	0.1923:0.0:0.8077:0.0|0.1923:0.0:0.8077:0.0	.|.	950|.	Q8N1F8|.	S11IP_HUMAN|.	Y|N	939;950|38	ENSP00000389383:D939Y;ENSP00000295641:D950Y|.	ENSP00000295641:D950Y|ENSP00000406371:K38N	D|K	+|+	1|3	0|2	STK11IP|STK11IP	220187458|220187458	0.416000|0.416000	0.25424|0.25424	0.001000|0.001000	0.08648|0.08648	0.908000|0.908000	0.53690|0.53690	3.273000|3.273000	0.51623|0.51623	0.638000|0.638000	0.30545|0.30545	-0.137000|-0.137000	0.14449|0.14449	GAC|AAG	STK11IP	-	NULL	ENSG00000144589		0.552	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	STK11IP	HGNC	protein_coding	OTTHUMT00000131432.1	29	0.00	0	G	NM_052902		220479214	220479214	+1	no_errors	ENST00000456909	ensembl	human	novel	69_37n	missense	127	43.56	98	SNP	0.002	T
SYNC	81493	genome.wustl.edu	37	1	33160900	33160900	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr1:33160900C>G	ENST00000409190.3	-	2	1257	c.799G>C	c.(799-801)Gtg>Ctg	p.V267L	SYNC_ENST00000373484.3_Missense_Mutation_p.V267L	NM_030786.2	NP_110413	Q9H7C4	SYNCI_HUMAN	syncoilin, intermediate filament protein	267	Coil 1b.				intermediate filament-based process (GO:0045103)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural molecule activity (GO:0005198)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						AACTGAGCCACGTCCTGCTGG	0.562																																						dbGAP											0													22.0	20.0	20.0					1																	33160900		692	1591	2283	-	-	-	SO:0001583	missense	0			AK024707	CCDS367.2, CCDS53294.1	1p35.1	2013-01-16	2008-09-19	2008-09-19	ENSG00000162520	ENSG00000162520		"""Intermediate filaments type III"""	28897	protein-coding gene	gene with protein product		611750	"""syncoilin, intermediate filament 1"""	SYNC1		11053421	Standard	NM_030786		Approved	SYNCOILIN	uc001bvt.2	Q9H7C4	OTTHUMG00000008087	ENST00000409190.3:c.799G>C	1.37:g.33160900C>G	ENSP00000386439:p.Val267Leu		B4DNK8|B4DY58|C9IY41	Missense_Mutation	SNP	pfam_F	p.V267L	ENST00000409190.3	37	c.799	CCDS367.2	1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.466520	0.63625	.	.	ENSG00000162520	ENST00000373484;ENST00000409190	D;D	0.86769	-2.17;-2.17	4.32	4.32	0.51571	Filament (1);	.	.	.	.	T	0.80121	0.4565	N	0.12182	0.205	0.35292	D	0.782289	P;D	0.53462	0.503;0.96	B;P	0.47528	0.322;0.549	D	0.84947	0.0869	9	0.46703	T	0.11	-10.8839	12.853	0.57869	0.0:0.8218:0.1782:0.0	.	267;267	Q9H7C4-2;Q9H7C4	.;SYNCI_HUMAN	L	267	ENSP00000362583:V267L;ENSP00000386439:V267L	ENSP00000362583:V267L	V	-	1	0	SYNC	32933487	0.992000	0.36948	0.995000	0.50966	0.961000	0.63080	2.906000	0.48735	2.148000	0.66965	0.313000	0.20887	GTG	SYNC	-	pfam_F	ENSG00000162520		0.562	SYNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNC	HGNC	protein_coding	OTTHUMT00000022129.3	50	0.00	0	C	NM_030786		33160900	33160900	-1	no_errors	ENST00000409190	ensembl	human	known	69_37n	missense	5	79.17	19	SNP	0.993	G
TAS1R3	83756	genome.wustl.edu	37	1	1268387	1268387	+	Nonsense_Mutation	SNP	C	C	G	rs142857537		TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr1:1268387C>G	ENST00000339381.5	+	4	1394	c.1362C>G	c.(1360-1362)taC>taG	p.Y454*		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	454					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		ACATGGAGTACGACCTGAAGC	0.652																																						dbGAP											0													57.0	55.0	56.0					1																	1268387		2200	4295	6495	-	-	-	SO:0001587	stop_gained	0			AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.1362C>G	1.37:g.1268387C>G	ENSP00000344411:p.Tyr454*		Q5TA49|Q8NGW9	Nonsense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3	p.Y454*	ENST00000339381.5	37	c.1362	CCDS30556.1	1	.	.	.	.	.	.	.	.	.	.	C	14.23	2.474790	0.43942	.	.	ENSG00000169962	ENST00000339381	.	.	.	4.86	-7.96	0.01144	.	0.336114	0.28042	N	0.016828	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3463	0.60575	0.0:0.7206:0.1065:0.1729	.	.	.	.	X	454	.	ENSP00000344411:Y454X	Y	+	3	2	TAS1R3	1258250	0.000000	0.05858	0.029000	0.17559	0.614000	0.37383	-2.348000	0.01094	-1.557000	0.01692	-0.464000	0.05259	TAC	TAS1R3	-	pfam_ANF_lig-bd_rcpt	ENSG00000169962		0.652	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS1R3	HGNC	protein_coding	OTTHUMT00000008493.1	9	0.00	0	C			1268387	1268387	+1	no_errors	ENST00000339381	ensembl	human	known	69_37n	nonsense	4	78.95	15	SNP	0.060	G
TARS2	80222	genome.wustl.edu	37	1	150469292	150469292	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr1:150469292G>A	ENST00000369064.3	+	9	962	c.928G>A	c.(928-930)Gag>Aag	p.E310K	TARS2_ENST00000438568.2_3'UTR|TARS2_ENST00000606933.1_Intron|TARS2_ENST00000369054.2_Intron|TARS2_ENST00000463555.1_Intron	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	310					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	CCAGGAACAGGAGCTCTTCTT	0.532																																						dbGAP											0													79.0	73.0	75.0					1																	150469292		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.928G>A	1.37:g.150469292G>A	ENSP00000358060:p.Glu310Lys		Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,pfscan_aa-tRNA-synth_II,prints_Thr-tRNA-synth_IIa,tigrfam_Thr-tRNA-synth_IIa	p.E310K	ENST00000369064.3	37	c.928	CCDS952.1	1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.286528	0.80803	.	.	ENSG00000143374	ENST00000369064	.	.	.	5.38	4.45	0.53987	.	0.058338	0.64402	D	0.000003	T	0.41190	0.1148	L	0.54965	1.715	0.80722	D	1	P	0.42827	0.791	B	0.37989	0.262	T	0.52305	-0.8593	9	0.66056	D	0.02	-18.1562	15.671	0.77274	0.0:0.1377:0.8623:0.0	.	310	Q9BW92	SYTM_HUMAN	K	310	.	ENSP00000358060:E310K	E	+	1	0	TARS2	148735916	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.302000	0.78861	1.465000	0.48006	0.655000	0.94253	GAG	TARS2	-	tigrfam_Thr-tRNA-synth_IIa	ENSG00000143374		0.532	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS2	HGNC	protein_coding	OTTHUMT00000035847.1	160	0.00	0	G	NM_025150		150469292	150469292	+1	no_errors	ENST00000369064	ensembl	human	known	69_37n	missense	231	14.39	39	SNP	1.000	A
THBS3	7059	genome.wustl.edu	37	1	155176016	155176016	+	Silent	SNP	G	G	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr1:155176016G>C	ENST00000368378.3	-	2	281	c.261C>G	c.(259-261)gcC>gcG	p.A87A	THBS3_ENST00000486260.1_5'UTR|RP11-263K19.4_ENST00000453136.1_RNA|RP11-263K19.4_ENST00000430312.1_RNA|THBS3_ENST00000457183.2_Silent_p.A87A|MTX1_ENST00000316721.4_5'Flank|RP11-263K19.4_ENST00000422665.1_RNA|THBS3_ENST00000541990.1_5'UTR|MTX1_ENST00000368376.3_5'Flank	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	87	Laminin G-like.				bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CTACAACAGAGGCCTCCAGCC	0.547																																						dbGAP											0													109.0	104.0	105.0					1																	155176016		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.261C>G	1.37:g.155176016G>C			B1AVR8|B4DQ20|Q8WV34	Silent	SNP	pfam_Thrombospondin_C,pfam_Thbs/COMP_coiled-coil,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.A87	ENST00000368378.3	37	c.261	CCDS1099.1	1																																																																																			THBS3	-	superfamily_ConA-like_lec_gl,smart_Laminin_G	ENSG00000169231		0.547	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS3	HGNC	protein_coding	OTTHUMT00000086856.1	70	0.00	0	G	NM_007112		155176016	155176016	-1	no_errors	ENST00000368378	ensembl	human	known	69_37n	silent	158	22.17	45	SNP	1.000	C
TM4SF1	4071	genome.wustl.edu	37	3	149095318	149095318	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr3:149095318C>A	ENST00000305366.3	-	1	334	c.17G>T	c.(16-18)tGt>tTt	p.C6F	TM4SF1_ENST00000472441.1_5'Flank|TM4SF1-AS1_ENST00000496491.1_RNA|TM4SF1-AS1_ENST00000484046.1_RNA	NM_014220.2	NP_055035.1	P30408	T4S1_HUMAN	transmembrane 4 L six family member 1	6						integral component of plasma membrane (GO:0005887)				endometrium(3)|large_intestine(1)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			GCATCGTGCACACTTCCCATA	0.502																																						dbGAP											0													141.0	141.0	141.0					3																	149095318		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90657	CCDS3143.1	3q21-q25	2005-03-21	2005-03-21		ENSG00000169908	ENSG00000169908			11853	protein-coding gene	gene with protein product		191155	"""transmembrane 4 superfamily member 1"""	M3S1		1565644	Standard	NM_014220		Approved	L6	uc003exb.1	P30408	OTTHUMG00000159597	ENST00000305366.3:c.17G>T	3.37:g.149095318C>A	ENSP00000304277:p.Cys6Phe		Q6IB51	Missense_Mutation	SNP	pfam_L6_membrane	p.C6F	ENST00000305366.3	37	c.17	CCDS3143.1	3	.	.	.	.	.	.	.	.	.	.	C	14.08	2.427977	0.43122	.	.	ENSG00000169908	ENST00000305366;ENST00000383054	T	0.37752	1.18	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.62612	0.2442	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61486	-0.7053	10	0.44086	T	0.13	-23.1491	19.4015	0.94632	0.0:1.0:0.0:0.0	.	6	P30408	T4S1_HUMAN	F	6	ENSP00000304277:C6F	ENSP00000304277:C6F	C	-	2	0	TM4SF1	150578008	0.989000	0.36119	0.097000	0.21041	0.004000	0.04260	3.963000	0.56773	2.585000	0.87301	0.655000	0.94253	TGT	TM4SF1	-	pfam_L6_membrane	ENSG00000169908		0.502	TM4SF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM4SF1	HGNC	protein_coding	OTTHUMT00000356368.1	227	0.00	0	C			149095318	149095318	-1	no_errors	ENST00000305366	ensembl	human	known	69_37n	missense	102	44.57	82	SNP	0.976	A
TNP1	7141	genome.wustl.edu	37	2	217724400	217724400	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr2:217724400G>C	ENST00000236979.2	-	2	187	c.158C>G	c.(157-159)tCc>tGc	p.S53C	AC007563.5_ENST00000607591.1_RNA|AC007563.5_ENST00000447289.1_RNA	NM_003284.3	NP_003275.1	P09430	STP1_HUMAN	transition protein 1 (during histone to protamine replacement)	53					chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|fertilization, exchange of chromosomal proteins (GO:0035042)|multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|sexual reproduction (GO:0019953)|single strand break repair (GO:0000012)|sperm motility (GO:0030317)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|spermatid nucleus elongation (GO:0007290)	male germ cell nucleus (GO:0001673)|nucleosome (GO:0000786)	DNA binding (GO:0003677)			large_intestine(1)|lung(1)|stomach(1)	3		Renal(207;0.0822)		Epithelial(149;8.97e-07)|all cancers(144;2.46e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCACAAGTGGGAGCGGTAATT	0.522																																						dbGAP											0													100.0	109.0	106.0					2																	217724400		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2406.1	2q35-q36	2008-06-03			ENSG00000118245	ENSG00000118245			11951	protein-coding gene	gene with protein product		190231				2249851	Standard	NM_003284		Approved		uc002vgk.3	P09430	OTTHUMG00000133057	ENST00000236979.2:c.158C>G	2.37:g.217724400G>C	ENSP00000236979:p.Ser53Cys			Missense_Mutation	SNP	pfam_Nuclear_transition_prot1	p.S53C	ENST00000236979.2	37	c.158	CCDS2406.1	2	.	.	.	.	.	.	.	.	.	.	G	12.45	1.941025	0.34283	.	.	ENSG00000118245	ENST00000236979	.	.	.	5.29	5.29	0.74685	.	0.000000	0.51477	D	0.000082	T	0.75087	0.3802	.	.	.	0.33620	D	0.604704	D	0.89917	1.0	D	0.87578	0.998	T	0.82594	-0.0380	8	0.87932	D	0	-5.9927	14.3158	0.66450	0.0:0.0:1.0:0.0	.	53	P09430	STP1_HUMAN	C	53	.	ENSP00000236979:S53C	S	-	2	0	TNP1	217432645	1.000000	0.71417	1.000000	0.80357	0.444000	0.32077	4.230000	0.58632	2.759000	0.94783	0.555000	0.69702	TCC	TNP1	-	pfam_Nuclear_transition_prot1	ENSG00000118245		0.522	TNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNP1	HGNC	protein_coding	OTTHUMT00000256673.1	191	0.00	0	G	NM_003284		217724400	217724400	-1	no_errors	ENST00000236979	ensembl	human	known	69_37n	missense	118	38.54	74	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7578213	7578214	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr17:7578213_7578214delAA	ENST00000269305.4	-	6	824_825	c.635_636delTT	c.(634-636)tttfs	p.F212fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.F212fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.F212fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.F212fs|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Frame_Shift_Del_p.F212fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.F212fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	212	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		F -> I (in sporadic cancers; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in a sporadic cancer; somatic mutation).|F -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F212fs*3(12)|p.0?(8)|p.?(5)|p.R213fs*35(3)|p.F212S(2)|p.F212L(2)|p.D208fs*1(1)|p.R209_R213delRNTFR(1)|p.F119fs*3(1)|p.T211fs*28(1)|p.D207_R213delDDRNTFR(1)|p.D207_V216del10(1)|p.T211_S215delTFRHS(1)|p.F80fs*3(1)|p.F212Y(1)|p.R120fs*35(1)|p.R209fs*6(1)|p.R81fs*>11(1)|p.D208_V216delDRNTFRHSV(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACTATGTCGAAAAGTGTTTCT	0.535		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	45	Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Substitution - Missense(5)	large_intestine(8)|oesophagus(8)|upper_aerodigestive_tract(5)|biliary_tract(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|breast(4)|central_nervous_system(2)|lung(2)|stomach(1)|soft_tissue(1)|liver(1)	GRCh37	CD011205	TP53	D																																				-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.635_636delTT	17.37:g.7578215_7578216delAA	ENSP00000269305:p.Phe212fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.F212fs	ENST00000269305.4	37	c.636_635	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.535	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	452	0.00	0	AA	NM_000546		7578213	7578214	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	67	58.48	100	DEL	0.000:0.000	-
TRAPPC9	83696	genome.wustl.edu	37	8	141285887	141285887	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr8:141285887A>C	ENST00000438773.2	-	15	2281	c.2148T>G	c.(2146-2148)gaT>gaG	p.D716E	TRAPPC9_ENST00000389327.3_Missense_Mutation_p.D707E|TRAPPC9_ENST00000389328.4_Missense_Mutation_p.D814E	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	716					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						TAGATATTTCATCACCAGAAG	0.338																																						dbGAP											0													78.0	73.0	75.0					8																	141285887		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.2148T>G	8.37:g.141285887A>C	ENSP00000405060:p.Asp716Glu		Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	pfam_TRAPP_II_complex_Trs120	p.D814E	ENST00000438773.2	37	c.2442	CCDS55278.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.20|12.20	1.867697|1.867697	0.32977|0.32977	.|.	.|.	ENSG00000167632|ENSG00000167632	ENST00000389328;ENST00000389327;ENST00000438773|ENST00000520857	.|.	.|.	.|.	4.44|4.44	-0.902|-0.902	0.10537|0.10537	.|.	0.216400|.	0.41294|.	D|.	0.000912|.	T|.	0.38931|.	0.1059|.	N|N	0.25094|0.25094	0.71|0.71	0.38461|0.38461	D|D	0.947229|0.947229	B;B;B;B|.	0.13145|.	0.001;0.002;0.007;0.001|.	B;B;B;B|.	0.17722|.	0.005;0.005;0.019;0.004|.	T|.	0.17048|.	-1.0382|.	9|.	0.10902|.	T|.	0.67|.	.|.	9.317|9.317	0.37941|0.37941	0.5212:0.0:0.4788:0.0|0.5212:0.0:0.4788:0.0	.|.	814;716;707;814|.	A6NIF0;Q96Q05;Q96Q05-3;Q96Q05-2|.	.;TPPC9_HUMAN;.;.|.	E|G	814;707;716|560	.|.	ENSP00000373978:D707E|.	D|X	-|-	3|1	2|0	TRAPPC9|TRAPPC9	141355069|141355069	0.843000|0.843000	0.29541|0.29541	0.320000|0.320000	0.25306|0.25306	0.998000|0.998000	0.95712|0.95712	-0.000000|-0.000000	0.12993|0.12993	-0.320000|-0.320000	0.08640|0.08640	0.533000|0.533000	0.62120|0.62120	GAT|TGA	TRAPPC9	-	pfam_TRAPP_II_complex_Trs120	ENSG00000167632		0.338	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	TRAPPC9	HGNC	protein_coding	OTTHUMT00000377749.1	211	0.00	0	A	NM_031466		141285887	141285887	-1	no_errors	ENST00000389328	ensembl	human	known	69_37n	missense	105	28.57	42	SNP	0.989	C
TRIM46	80128	genome.wustl.edu	37	1	155156289	155156289	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr1:155156289G>A	ENST00000334634.4	+	10	1903	c.1903G>A	c.(1903-1905)Ggg>Agg	p.G635R	MUC1_ENST00000462215.1_5'Flank|TRIM46_ENST00000368382.1_Missense_Mutation_p.G612R|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000545012.1_Missense_Mutation_p.G509R|TRIM46_ENST00000392451.2_3'UTR|TRIM46_ENST00000468878.1_3'UTR	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	635	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CCCGGACAGCGGGCACGACAG	0.622																																						dbGAP											0													54.0	51.0	52.0					1																	155156289		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.1903G>A	1.37:g.155156289G>A	ENSP00000334657:p.Gly635Arg		A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Fibronectin_type3,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.G635R	ENST00000334634.4	37	c.1903	CCDS1097.1	1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010657	0.75046	.	.	ENSG00000163462	ENST00000430513;ENST00000545012;ENST00000368382;ENST00000334634	D;T;T	0.83075	-1.68;-1.16;-1.17	3.66	3.66	0.41972	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.000000	0.64402	D	0.000001	D	0.87229	0.6125	M	0.67397	2.05	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.88754	0.3252	10	0.87932	D	0	.	13.2723	0.60167	0.0:0.0:1.0:0.0	.	635	Q7Z4K8	TRI46_HUMAN	R	593;509;612;635	ENSP00000440254:G509R;ENSP00000357366:G612R;ENSP00000334657:G635R	ENSP00000334657:G635R	G	+	1	0	TRIM46	153422913	1.000000	0.71417	0.948000	0.38648	0.762000	0.43233	8.994000	0.93529	2.065000	0.61736	0.313000	0.20887	GGG	TRIM46	-	superfamily_ConA-like_lec_gl,pfscan_B30.2/SPRY	ENSG00000163462		0.622	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM46	HGNC	protein_coding	OTTHUMT00000086728.1	20	0.00	0	G	NM_025058		155156289	155156289	+1	no_errors	ENST00000334634	ensembl	human	known	69_37n	missense	11	80.36	45	SNP	1.000	A
TULP3	7289	genome.wustl.edu	37	12	3018748	3018748	+	Splice_Site	SNP	T	T	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr12:3018748T>A	ENST00000448120.2	+	2	144		c.e2+2		TULP3_ENST00000397132.2_Splice_Site	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3						anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			GATTATCAGGTGAGCAGAGTC	0.408																																						dbGAP											0													209.0	195.0	199.0					12																	3018748		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.93+2T>A	12.37:g.3018748T>A			B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Splice_Site	SNP	-	e2+2	ENST00000448120.2	37	c.93+2	CCDS8519.1	12	.	.	.	.	.	.	.	.	.	.	T	11.26	1.584879	0.28268	.	.	ENSG00000078246	ENST00000535226;ENST00000228245;ENST00000448120;ENST00000397132	.	.	.	4.59	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3223	0.43773	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TULP3	2889009	1.000000	0.71417	1.000000	0.80357	0.150000	0.21749	3.112000	0.50368	1.929000	0.55896	0.533000	0.62120	.	TULP3	-	-	ENSG00000078246		0.408	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TULP3	HGNC	protein_coding	OTTHUMT00000398468.1	165	0.00	0	T	NM_003324	Intron	3018748	3018748	+1	no_errors	ENST00000228245	ensembl	human	known	69_37n	splice_site	351	12.20	51	SNP	0.998	A
VILL	50853	genome.wustl.edu	37	3	38035842	38035842	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr3:38035842G>A	ENST00000283713.6	+	4	492	c.226G>A	c.(226-228)Gcg>Acg	p.A76T	VILL_ENST00000383759.2_Missense_Mutation_p.A76T|VILL_ENST00000465644.1_Intron			O15195	VILL_HUMAN	villin-like	76					actin filament capping (GO:0051693)|cytoskeleton organization (GO:0007010)	actin cytoskeleton (GO:0015629)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|urinary_tract(2)	28				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		GCAGGGCGCTGCGGAGGCCTT	0.711																																						dbGAP											0													12.0	16.0	14.0					3																	38035842		2179	4270	6449	-	-	-	SO:0001583	missense	0				CCDS2670.2	3p21	2004-07-28			ENSG00000136059	ENSG00000136059			30906	protein-coding gene	gene with protein product						9179494	Standard	XM_005265191		Approved		uc003chl.3	O15195	OTTHUMG00000130814	ENST00000283713.6:c.226G>A	3.37:g.38035842G>A	ENSP00000283713:p.Ala76Thr		A8MZP1|Q9BT80|Q9BWH7	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Gelsolin	p.A76T	ENST00000283713.6	37	c.226	CCDS2670.2	3	.	.	.	.	.	.	.	.	.	.	G	22.6	4.314525	0.81358	.	.	ENSG00000136059	ENST00000283713;ENST00000416303;ENST00000492491;ENST00000383759;ENST00000356246	T;T;T;T	0.61742	0.08;0.08;0.08;0.08	3.89	1.96	0.26148	Gelsolin domain (1);	0.339834	0.33534	N	0.004818	T	0.73644	0.3613	M	0.89968	3.075	0.35747	D	0.819094	P	0.45011	0.848	P	0.54100	0.742	T	0.82598	-0.0378	10	0.87932	D	0	-5.1493	12.5105	0.56003	0.0:0.323:0.677:0.0	.	76	O15195	VILL_HUMAN	T	76	ENSP00000283713:A76T;ENSP00000393661:A76T;ENSP00000427355:A76T;ENSP00000373266:A76T	ENSP00000283713:A76T	A	+	1	0	VILL	38010846	1.000000	0.71417	0.001000	0.08648	0.015000	0.08874	4.455000	0.60075	0.374000	0.24650	0.563000	0.77884	GCG	VILL	-	pfam_Gelsolin_dom,smart_Gelsolin	ENSG00000136059		0.711	VILL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VILL	HGNC	protein_coding	OTTHUMT00000253360.3	16	0.00	0	G	NM_015873		38035842	38035842	+1	no_errors	ENST00000283713	ensembl	human	known	69_37n	missense	3	75.00	9	SNP	0.943	A
VPS54	51542	genome.wustl.edu	37	2	64148377	64148377	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr2:64148377T>C	ENST00000272322.4	-	13	1986	c.1832A>G	c.(1831-1833)cAt>cGt	p.H611R	VPS54_ENST00000354504.3_Missense_Mutation_p.H458R|VPS54_ENST00000409558.4_Missense_Mutation_p.H599R			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	611					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)				endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						AGCTCGATCATGGCATATATC	0.323																																						dbGAP											0													63.0	67.0	66.0					2																	64148377		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.1832A>G	2.37:g.64148377T>C	ENSP00000272322:p.His611Arg		Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Missense_Mutation	SNP	pfam_Vps54,pfam_Vacuolar_sorting-assoc_54	p.H611R	ENST00000272322.4	37	c.1832	CCDS33208.1	2	.	.	.	.	.	.	.	.	.	.	T	23.5	4.423568	0.83559	.	.	ENSG00000143952	ENST00000354504;ENST00000272322;ENST00000409558;ENST00000483277;ENST00000394400	T;T;T	0.34667	1.35;1.37;1.37	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.64416	0.2596	M	0.86268	2.805	0.80722	D	1	D;D;D	0.89917	1.0;0.996;0.998	D;D;D	0.91635	0.999;0.959;0.982	T	0.67829	-0.5569	10	0.44086	T	0.13	.	15.736	0.77842	0.0:0.0:0.0:1.0	.	458;611;599	Q9P1Q0-3;Q9P1Q0;Q9P1Q0-4	.;VPS54_HUMAN;.	R	458;611;599;599;611	ENSP00000346499:H458R;ENSP00000272322:H611R;ENSP00000386980:H599R	ENSP00000272322:H611R	H	-	2	0	VPS54	64001881	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.535000	0.82014	2.128000	0.65567	0.533000	0.62120	CAT	VPS54	-	NULL	ENSG00000143952		0.323	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS54	HGNC	protein_coding	OTTHUMT00000327062.2	82	0.00	0	T	NM_016516		64148377	64148377	-1	no_errors	ENST00000272322	ensembl	human	known	69_37n	missense	100	50.74	103	SNP	1.000	C
WHSC1	7468	genome.wustl.edu	37	4	1953848	1953848	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr4:1953848C>G	ENST00000382895.3	+	13	2458	c.2027C>G	c.(2026-2028)cCg>cGg	p.P676R	WHSC1_ENST00000482415.2_3'UTR|WHSC1_ENST00000382888.3_5'UTR|WHSC1_ENST00000508803.1_Missense_Mutation_p.P676R|WHSC1_ENST00000382892.2_Missense_Mutation_p.P676R|WHSC1_ENST00000382891.5_Missense_Mutation_p.P676R	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	676					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		TGTGAGAAGCCGGGCAGCCTC	0.652			T	IGH@	MM																																	dbGAP		Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	0													46.0	46.0	46.0					4																	1953848		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.2027C>G	4.37:g.1953848C>G	ENSP00000372351:p.Pro676Arg		A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	pfam_PWWP,pfam_SET_dom,pfam_Znf_PHD-finger,pfam_HMG_superfamily,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_PWWP,smart_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_HMG_superfamily	p.P676R	ENST00000382895.3	37	c.2027	CCDS33940.1	4	.	.	.	.	.	.	.	.	.	.	C	11.76	1.735798	0.30774	.	.	ENSG00000109685	ENST00000508803;ENST00000382891;ENST00000382892;ENST00000382895	D;D;D;D	0.95001	-3.58;-3.58;-3.58;-3.58	5.31	5.31	0.75309	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.634133	0.14413	N	0.321162	D	0.89784	0.6815	L	0.29908	0.895	0.80722	D	1	B	0.26708	0.157	B	0.18561	0.022	D	0.85802	0.1374	10	0.37606	T	0.19	.	12.6782	0.56906	0.0:0.9239:0.0:0.076	.	676	O96028	NSD2_HUMAN	R	676	ENSP00000423972:P676R;ENSP00000372347:P676R;ENSP00000372348:P676R;ENSP00000372351:P676R	ENSP00000372347:P676R	P	+	2	0	WHSC1	1923646	0.260000	0.24053	0.363000	0.25875	0.979000	0.70002	3.767000	0.55288	2.637000	0.89404	0.650000	0.86243	CCG	WHSC1	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Znf_RING,pfscan_Znf_PHD-finger	ENSG00000109685		0.652	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1	HGNC	protein_coding	OTTHUMT00000366269.2	50	0.00	0	C	NM_133330		1953848	1953848	+1	no_errors	ENST00000382891	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	0.219	G
WDR17	116966	genome.wustl.edu	37	4	177071740	177071740	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr4:177071740G>C	ENST00000280190.4	+	17	2528	c.2372G>C	c.(2371-2373)aGa>aCa	p.R791T	WDR17_ENST00000508596.1_Missense_Mutation_p.R767T|WDR17_ENST00000393643.2_Missense_Mutation_p.R767T|WDR17_ENST00000507824.2_Missense_Mutation_p.R774T			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	791										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		ATTAAATTTAGAACAGTGAGT	0.284																																						dbGAP											0													74.0	73.0	74.0					4																	177071740		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.2372G>C	4.37:g.177071740G>C	ENSP00000280190:p.Arg791Thr		E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R791T	ENST00000280190.4	37	c.2372	CCDS3825.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.21|13.21	2.169307|2.169307	0.38315|0.38315	.|.	.|.	ENSG00000150627|ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824|ENST00000443118	T;T;T|.	0.57107|.	0.45;0.47;0.42|.	5.82|5.82	2.78|2.78	0.32641|0.32641	.|.	0.109579|.	0.56097|.	D|.	0.000023|.	T|.	0.46927|.	0.1418|.	L|L	0.47716|0.47716	1.5|1.5	0.28363|0.28363	N|N	0.920368|0.920368	P;P;P|.	0.42078|.	0.611;0.77;0.77|.	B;B;B|.	0.38921|.	0.223;0.285;0.285|.	T|.	0.38714|.	-0.9648|.	10|.	0.56958|.	D|.	0.05|.	-21.361|-21.361	11.0596|11.0596	0.47940|0.47940	0.3347:0.0:0.6653:0.0|0.3347:0.0:0.6653:0.0	.|.	767;767;791|.	E7EP77;E7EQX0;Q8IZU2|.	.;.;WDR17_HUMAN|.	T|Y	767;767;791;774|33	ENSP00000422763:R767T;ENSP00000377258:R767T;ENSP00000280190:R791T|.	ENSP00000280190:R791T|.	R|X	+|+	2|3	0|2	WDR17|WDR17	177308734|177308734	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.951000|0.951000	0.60555|0.60555	2.548000|2.548000	0.45794|0.45794	0.829000|0.829000	0.34733|0.34733	-0.119000|-0.119000	0.15052|0.15052	AGA|TAG	WDR17	-	NULL	ENSG00000150627		0.284	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	96	0.00	0	G			177071740	177071740	+1	no_errors	ENST00000280190	ensembl	human	known	69_37n	missense	49	53.33	56	SNP	1.000	C
XPNPEP3	63929	genome.wustl.edu	37	22	41282335	41282335	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr22:41282335G>C	ENST00000357137.4	+	4	692	c.608G>C	c.(607-609)tGg>tCg	p.W203S	XPNPEP3_ENST00000544094.1_Missense_Mutation_p.W180S|XPNPEP3_ENST00000541156.1_Missense_Mutation_p.W203S|XPNPEP3_ENST00000414396.1_Missense_Mutation_p.W203S	NM_022098.3	NP_071381.1	Q9NQH7	XPP3_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 3, putative	203					glomerular filtration (GO:0003094)|protein processing (GO:0016485)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metallopeptidase activity (GO:0008237)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	17						AACATGGTTTGGTATGACTGG	0.433																																					Ovarian(145;306 1841 7037 21878 30110)	dbGAP											0													109.0	106.0	107.0					22																	41282335		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14007.1, CCDS74869.1	22q13.2	2010-07-20			ENSG00000196236	ENSG00000196236			28052	protein-coding gene	gene with protein product		613553				15708373, 20179356	Standard	NM_022098		Approved	APP3, NPHPL1	uc003azh.3	Q9NQH7	OTTHUMG00000151312	ENST00000357137.4:c.608G>C	22.37:g.41282335G>C	ENSP00000349658:p.Trp203Ser		B2R9G1|B7Z790|B7Z7B2|Q6I9V9|Q8NDA6|Q9BV27|Q9BVH0	Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Aminopep_P_N,superfamily_Pept_M24_structural-domain	p.W203S	ENST00000357137.4	37	c.608	CCDS14007.1	22	.	.	.	.	.	.	.	.	.	.	G	23.2	4.389893	0.82902	.	.	ENSG00000196236	ENST00000541156;ENST00000414396;ENST00000357137;ENST00000544094	T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0	5.86	5.86	0.93980	Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89577	0.6755	M	0.90198	3.095	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.964;1.0	D	0.90698	0.4618	10	0.87932	D	0	.	20.1996	0.98256	0.0:0.0:1.0:0.0	.	203;203	Q9NQH7-5;Q9NQH7	.;XPP3_HUMAN	S	203;203;203;180	ENSP00000443682:W203S;ENSP00000397110:W203S;ENSP00000349658:W203S;ENSP00000441942:W180S	ENSP00000349658:W203S	W	+	2	0	XPNPEP3	39612281	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.512000	0.81728	2.776000	0.95493	0.650000	0.86243	TGG	XPNPEP3	-	pfam_Aminopep_P_N	ENSG00000196236		0.433	XPNPEP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP3	HGNC	protein_coding	OTTHUMT00000322201.2	87	0.00	0	G	NM_022098		41282335	41282335	+1	no_errors	ENST00000357137	ensembl	human	known	69_37n	missense	39	45.07	32	SNP	1.000	C
ZBTB17	7709	genome.wustl.edu	37	1	16272250	16272250	+	Silent	SNP	A	A	C	rs848217	byFrequency	TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr1:16272250A>C	ENST00000375743.4	-	6	853	c.621T>G	c.(619-621)gcT>gcG	p.A207A	ZBTB17_ENST00000479282.1_5'Flank|ZBTB17_ENST00000537142.1_Silent_p.A125A|ZBTB17_ENST00000375733.2_Silent_p.A207A|ZBTB17_ENST00000448462.2_Silent_p.A144A	NM_003443.2	NP_003434.2	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17	207					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|ectoderm development (GO:0007398)|endoplasmic reticulum unfolded protein response (GO:0030968)|gastrulation with mouth forming second (GO:0001702)|negative regulation of cell cycle (GO:0045786)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)	15		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		CAGCTTCTGCAGCAGCCATGC	0.687																																						dbGAP											0													31.0	34.0	33.0					1																	16272250		2199	4290	6489	-	-	-	SO:0001819	synonymous_variant	0			U20647	CCDS165.1, CCDS55576.1, CCDS72712.1	1p36.13	2013-01-08	2004-07-16	2004-07-16	ENSG00000116809	ENSG00000116809		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12936	protein-coding gene	gene with protein product		604084	"""zinc finger protein 151 (pHZ-67)"", ""zinc finger protein 60"""	ZNF151, ZNF60			Standard	NM_003443		Approved	MIZ1, pHZ-67	uc001axl.4	Q13105	OTTHUMG00000009377	ENST00000375743.4:c.621T>G	1.37:g.16272250A>C			A0AV07|B4DXB4|B7ZLQ9|F5H411|Q15932|Q5JYB2|Q9NUC9	Silent	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.A207	ENST00000375743.4	37	c.621	CCDS165.1	1																																																																																			ZBTB17	-	NULL	ENSG00000116809		0.687	ZBTB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB17	HGNC	protein_coding	OTTHUMT00000025998.1	12	0.00	0	A	NM_003443		16272250	16272250	-1	no_errors	ENST00000375733	ensembl	human	known	69_37n	silent	3	54.55	6	SNP	0.181	C
ZBTB39	9880	genome.wustl.edu	37	12	57398550	57398550	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr12:57398550G>A	ENST00000300101.2	-	2	237	c.152C>T	c.(151-153)gCa>gTa	p.A51V		NM_014830.2	NP_055645.1	O15060	ZBT39_HUMAN	zinc finger and BTB domain containing 39	51	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(3)|prostate(1)	16						GTAGCCAGCTGCACAGGCCAG	0.572																																						dbGAP											0													100.0	105.0	103.0					12																	57398550		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002350	CCDS31839.1	12q13.3	2013-01-09				ENSG00000166860		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	29014	protein-coding gene	gene with protein product						9205841	Standard	NM_014830		Approved	KIAA0352, ZNF922	uc001sml.2	O15060		ENST00000300101.2:c.152C>T	12.37:g.57398550G>A	ENSP00000300101:p.Ala51Val		A7MD38|Q9UD98	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.A51V	ENST00000300101.2	37	c.152	CCDS31839.1	12	.	.	.	.	.	.	.	.	.	.	G	19.89	3.911852	0.72983	.	.	ENSG00000166860	ENST00000300101	T	0.68025	-0.3	5.93	5.93	0.95920	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.053275	0.64402	D	0.000001	T	0.74876	0.3774	L	0.35487	1.065	0.58432	D	0.999999	D	0.71674	0.998	D	0.69824	0.966	T	0.76462	-0.2950	10	0.87932	D	0	-11.2538	17.8376	0.88704	0.0:0.0:1.0:0.0	.	51	O15060	ZBT39_HUMAN	V	51	ENSP00000300101:A51V	ENSP00000300101:A51V	A	-	2	0	ZBTB39	55684817	1.000000	0.71417	0.555000	0.28281	0.961000	0.63080	6.564000	0.73969	2.815000	0.96918	0.561000	0.74099	GCA	ZBTB39	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000166860		0.572	ZBTB39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB39	HGNC	protein_coding	OTTHUMT00000411214.1	156	0.00	0	G	NM_014830		57398550	57398550	-1	no_errors	ENST00000300101	ensembl	human	known	69_37n	missense	30	55.22	37	SNP	0.991	A
ZBTB48	3104	genome.wustl.edu	37	1	6642356	6642356	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr1:6642356A>G	ENST00000377674.4	+	3	1087	c.929A>G	c.(928-930)aAc>aGc	p.N310S		NM_001278647.1|NM_001278648.1|NM_005341.2	NP_001265576.1|NP_001265577.1|NP_005332.1	P10074	ZBT48_HUMAN	zinc finger and BTB domain containing 48	310					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.35e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00109)|STAD - Stomach adenocarcinoma(132;0.017)|READ - Rectum adenocarcinoma(331;0.0642)		AAAGTCCACAACAGGTAAACG	0.498																																					Esophageal Squamous(125;1449 1657 4031 29866 49542)	dbGAP											0													79.0	86.0	84.0					1																	6642356		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC013573	CCDS84.1	1p36.3	2013-01-08	2006-09-20	2006-09-20	ENSG00000204859	ENSG00000204859		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4930	protein-coding gene	gene with protein product		165270	"""GLI-Kruppel family member HKR3"""	HKR3		2850480, 8661141	Standard	NM_001278647		Approved	ZNF855	uc001anx.3	P10074	OTTHUMG00000001438	ENST00000377674.4:c.929A>G	1.37:g.6642356A>G	ENSP00000366902:p.Asn310Ser		Q5SY19	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.N310S	ENST00000377674.4	37	c.929	CCDS84.1	1	.	.	.	.	.	.	.	.	.	.	A	9.300	1.052854	0.19907	.	.	ENSG00000204859	ENST00000319084;ENST00000377674	T;T	0.52057	0.68;2.3	5.52	5.52	0.82312	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.38108	0.1028	L	0.28649	0.875	0.58432	D	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.13656	-1.0501	10	0.42905	T	0.14	-34.5047	14.8275	0.70125	1.0:0.0:0.0:0.0	.	310	P10074	ZBT48_HUMAN	S	310	ENSP00000313416:N310S;ENSP00000366902:N310S	ENSP00000313416:N310S	N	+	2	0	ZBTB48	6564943	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.396000	0.90190	2.102000	0.63906	0.459000	0.35465	AAC	ZBTB48	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204859		0.498	ZBTB48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB48	HGNC	protein_coding	OTTHUMT00000004193.1	53	0.00	0	A	NM_005341		6642356	6642356	+1	no_errors	ENST00000377674	ensembl	human	known	69_37n	missense	31	61.73	50	SNP	1.000	G
ZFHX4	79776	genome.wustl.edu	37	8	77617392	77617392	+	Missense_Mutation	SNP	G	G	T	rs545258517		TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr8:77617392G>T	ENST00000521891.2	+	2	1517	c.1069G>T	c.(1069-1071)Gat>Tat	p.D357Y	ZFHX4_ENST00000050961.6_Missense_Mutation_p.D357Y|ZFHX4_ENST00000455469.2_Missense_Mutation_p.D357Y|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000518282.1_Missense_Mutation_p.D357Y	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	357					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CATAGGACCCGATCCAACCTT	0.458										HNSCC(33;0.089)																												dbGAP											0													98.0	91.0	93.0					8																	77617392		1830	4090	5920	-	-	-	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1069G>T	8.37:g.77617392G>T	ENSP00000430497:p.Asp357Tyr		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.D357Y	ENST00000521891.2	37	c.1069	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	G	13.50	2.255976	0.39896	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.55930	0.49;0.54;0.5;0.5	5.53	5.53	0.82687	.	0.000000	0.45867	U	0.000329	T	0.66157	0.2761	L	0.36672	1.1	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.91635	0.998;0.999;0.999;0.964	T	0.65598	-0.6129	10	0.56958	D	0.05	.	19.6556	0.95837	0.0:0.0:1.0:0.0	.	357;357;357;357	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	Y	357	ENSP00000430497:D357Y;ENSP00000399605:D357Y;ENSP00000050961:D357Y;ENSP00000430848:D357Y	ENSP00000050961:D357Y	D	+	1	0	ZFHX4	77779947	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	9.263000	0.95617	2.882000	0.98803	0.655000	0.94253	GAT	ZFHX4	-	NULL	ENSG00000091656		0.458	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	226	0.00	0	G	NM_024721		77617392	77617392	+1	no_errors	ENST00000521891	ensembl	human	known	69_37n	missense	294	27.59	112	SNP	1.000	T
ZFR	51663	genome.wustl.edu	37	5	32355898	32355898	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr5:32355898T>C	ENST00000265069.8	-	20	3295	c.3193A>G	c.(3193-3195)Aaa>Gaa	p.K1065E	ZFR_ENST00000510369.1_5'UTR	NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	1065	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		TTGTCTTTTTTCCCCTCAGCT	0.348																																						dbGAP											0													146.0	140.0	142.0					5																	32355898		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.3193A>G	5.37:g.32355898T>C	ENSP00000265069:p.Lys1065Glu		B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Missense_Mutation	SNP	pfam_DZF,pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.K1065E	ENST00000265069.8	37	c.3193	CCDS34139.1	5	.	.	.	.	.	.	.	.	.	.	T	15.43	2.831610	0.50845	.	.	ENSG00000056097	ENST00000265069	T	0.09630	2.96	5.53	5.53	0.82687	.	0.044868	0.85682	D	0.000000	T	0.21022	0.0506	L	0.29908	0.895	0.80722	D	1	P	0.52842	0.956	P	0.62184	0.899	T	0.00928	-1.1511	10	0.72032	D	0.01	.	15.6498	0.77081	0.0:0.0:0.0:1.0	.	1065	Q96KR1	ZFR_HUMAN	E	1065	ENSP00000265069:K1065E	ENSP00000265069:K1065E	K	-	1	0	ZFR	32391655	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.104000	0.64026	0.477000	0.44152	AAA	ZFR	-	NULL	ENSG00000056097		0.348	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR	HGNC	protein_coding	OTTHUMT00000366586.1	136	0.00	0	T			32355898	32355898	-1	no_errors	ENST00000265069	ensembl	human	known	69_37n	missense	192	23.51	59	SNP	1.000	C
ZNF283	284349	genome.wustl.edu	37	19	44351903	44351903	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr19:44351903T>A	ENST00000324461.7	+	7	1447	c.1150T>A	c.(1150-1152)Ttt>Att	p.F384I	ZNF283_ENST00000588797.1_Missense_Mutation_p.F245I	NM_181845.1	NP_862828.1	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	384					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(4)	8		Prostate(69;0.0352)				TGGAAAGGCTTTTTGTTGGGG	0.408																																						dbGAP											0													100.0	117.0	112.0					19																	44351903		2168	4282	6450	-	-	-	SO:0001583	missense	0			AK098175	CCDS46097.1, CCDS74387.1	19q13.31	2013-01-08			ENSG00000167637	ENSG00000167637		"""Zinc fingers, C2H2-type"", ""-"""	13077	protein-coding gene	gene with protein product						12743021	Standard	NM_181845		Approved		uc002oxr.4	Q8N7M2		ENST00000324461.7:c.1150T>A	19.37:g.44351903T>A	ENSP00000327314:p.Phe384Ile		B4DGZ5|B7WP04|Q6RFR9|Q86WM6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F384I	ENST00000324461.7	37	c.1150	CCDS46097.1	19	.	.	.	.	.	.	.	.	.	.	T	19.98	3.927639	0.73327	.	.	ENSG00000167637	ENST00000324461	T	0.46451	0.87	2.99	2.99	0.34606	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.72095	0.3418	H	0.96208	3.785	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78981	-0.1989	9	0.72032	D	0.01	.	10.5165	0.44892	0.0:0.0:0.0:1.0	.	384	Q8N7M2	ZN283_HUMAN	I	384	ENSP00000327314:F384I	ENSP00000327314:F384I	F	+	1	0	ZNF283	49043743	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	6.941000	0.75922	1.374000	0.46228	0.379000	0.24179	TTT	ZNF283	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167637		0.408	ZNF283-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF283	HGNC	protein_coding	OTTHUMT00000459909.1	111	0.00	0	T	NM_181845		44351903	44351903	+1	no_errors	ENST00000324461	ensembl	human	known	69_37n	missense	203	21.24	55	SNP	0.952	A
ZNF233	353355	genome.wustl.edu	37	19	44777622	44777622	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr19:44777622G>A	ENST00000391958.2	+	5	936	c.809G>A	c.(808-810)gGc>gAc	p.G270D	ZNF233_ENST00000334152.1_Missense_Mutation_p.G252D|ZNF235_ENST00000589799.1_Intron|ZNF233_ENST00000592581.1_3'UTR	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	270					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				TTAAGTGTTGGCTCTAATCTT	0.433																																						dbGAP											0													83.0	77.0	79.0					19																	44777622		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.809G>A	19.37:g.44777622G>A	ENSP00000375820:p.Gly270Asp		B2RN78|B2RN79|Q86WL8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G270D	ENST00000391958.2	37	c.809	CCDS33047.1	19	.	.	.	.	.	.	.	.	.	.	G	4.195	0.034935	0.08101	.	.	ENSG00000159915	ENST00000334152;ENST00000391958;ENST00000280305	T;T	0.06068	3.35;3.64	3.28	-6.56	0.01848	.	.	.	.	.	T	0.02970	0.0088	N	0.17631	0.505	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30822	-0.9965	9	0.33141	T	0.24	.	1.2515	0.01983	0.3907:0.1698:0.099:0.3404	.	270	A6NK53	ZN233_HUMAN	D	252;270;191	ENSP00000334957:G252D;ENSP00000375820:G270D	ENSP00000280305:G191D	G	+	2	0	ZNF233	49469462	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.820000	0.04457	-4.147000	0.00070	-0.241000	0.12123	GGC	ZNF233	-	NULL	ENSG00000159915		0.433	ZNF233-001	KNOWN	basic|CCDS	protein_coding	ZNF233	HGNC	protein_coding	OTTHUMT00000460737.1	81	0.00	0	G	NM_181756		44777622	44777622	+1	no_errors	ENST00000391958	ensembl	human	known	69_37n	missense	72	30.48	32	SNP	0.000	A
ZNF514	84874	genome.wustl.edu	37	2	95815408	95815408	+	Silent	SNP	A	A	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr2:95815408A>T	ENST00000295208.2	-	5	1284	c.822T>A	c.(820-822)tcT>tcA	p.S274S	MRPS5_ENST00000475040.1_5'Flank|ZNF514_ENST00000411425.1_Silent_p.S274S	NM_032788.1	NP_116177.1	Q96K75	ZN514_HUMAN	zinc finger protein 514	274					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(4)|lung(6)|urinary_tract(1)	11						GCAGAACAAGAGACGAACTCT	0.413																																						dbGAP											0													80.0	87.0	85.0					2																	95815408		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL832263	CCDS2011.1	2q11.2	2013-01-08			ENSG00000144026	ENSG00000144026		"""Zinc fingers, C2H2-type"", ""-"""	25894	protein-coding gene	gene with protein product							Standard	NM_032788		Approved	FLJ14457	uc002sue.1	Q96K75	OTTHUMG00000130391	ENST00000295208.2:c.822T>A	2.37:g.95815408A>T			Q5JPJ3	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S274	ENST00000295208.2	37	c.822	CCDS2011.1	2																																																																																			ZNF514	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000144026		0.413	ZNF514-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF514	HGNC	protein_coding	OTTHUMT00000252769.1	212	0.47	1	A	NM_032788		95815408	95815408	-1	no_errors	ENST00000295208	ensembl	human	known	69_37n	silent	180	17.43	38	SNP	0.039	T
ZNF69	7620	genome.wustl.edu	37	19	12015904	12015904	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr19:12015904G>A	ENST00000429654.2	+	4	832	c.692G>A	c.(691-693)tGt>tAt	p.C231Y	ZNF69_ENST00000340180.5_Intron			Q9UC07	ZNF69_HUMAN	zinc finger protein 69	231					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|skin(2)	4				Lung(535;0.011)		GCCTTCCATTGTCTCAGTTTA	0.363																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			X60076	CCDS32914.1	19p13.2	2013-01-08	2006-05-12		ENSG00000198429	ENSG00000198429		"""Zinc fingers, C2H2-type"", ""-"""	13138	protein-coding gene	gene with protein product		194543	"""zinc finger protein 69 (Cos5)"""			1639391	Standard	NM_021915		Approved	Cos5	uc002mst.4	Q9UC07	OTTHUMG00000156526	ENST00000429654.2:c.692G>A	19.37:g.12015904G>A	ENSP00000402985:p.Cys231Tyr		Q86VA7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C231Y	ENST00000429654.2	37	c.692		19	.	.	.	.	.	.	.	.	.	.	g	0.001	-3.114400	0.00032	.	.	ENSG00000198429	ENST00000429654	T	0.35789	1.29	0.928	-1.86	0.07760	.	.	.	.	.	T	0.10723	0.0262	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23190	-1.0195	6	0.02654	T	1	.	3.1274	0.06412	0.2618:0.0:0.2671:0.4711	.	.	.	.	Y	231	ENSP00000402985:C231Y	ENSP00000402985:C231Y	C	+	2	0	ZNF69	11876904	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.782000	0.00772	-1.401000	0.02058	-0.491000	0.04670	TGT	ZNF69	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198429		0.363	ZNF69-002	KNOWN	basic|appris_principal	protein_coding	ZNF69	HGNC	protein_coding	OTTHUMT00000344082.1	117	0.00	0	G	NM_021915		12015904	12015904	+1	no_errors	ENST00000429654	ensembl	human	known	69_37n	missense	155	36.07	88	SNP	0.000	A
ZNF732	654254	genome.wustl.edu	37	4	266210	266210	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07C-01A-11D-A045-09	TCGA-A8-A07C-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6ab33f67-b69d-4a2d-a424-841f5fbf1ee7	63565009-d197-4c5b-9dec-e8de2e4daece	g.chr4:266210G>T	ENST00000419098.1	-	4	446	c.436C>A	c.(436-438)Cat>Aat	p.H146N		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	146					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						ACTTTGACATGTACATTACAC	0.318																																						dbGAP											0													201.0	165.0	176.0					4																	266210		692	1591	2283	-	-	-	SO:0001583	missense	0			AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.436C>A	4.37:g.266210G>T	ENSP00000415774:p.His146Asn			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H146N	ENST00000419098.1	37	c.436	CCDS46990.1	4	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.513027	0.00975	.	.	ENSG00000186777	ENST00000419098	T	0.04917	3.53	0.937	-0.775	0.10988	.	.	.	.	.	T	0.03783	0.0107	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41124	-0.9526	9	0.46703	T	0.11	.	5.3005	0.15776	0.2537:0.0:0.7463:0.0	.	146	B4DXR9	ZN732_HUMAN	N	146	ENSP00000415774:H146N	ENSP00000415774:H146N	H	-	1	0	ZNF732	256210	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.151000	0.16283	-0.520000	0.06435	-0.515000	0.04445	CAT	ZNF732	-	NULL	ENSG00000186777		0.318	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF732	HGNC	protein_coding	OTTHUMT00000357937.2	176	0.00	0	G	NM_001137608		266210	266210	-1	no_errors	ENST00000419098	ensembl	human	known	69_37n	missense	109	66.46	216	SNP	0.000	T
