#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA6	23460	genome.wustl.edu	37	17	67077227	67077227	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr17:67077227G>A	ENST00000284425.2	-	37	4850	c.4676C>T	c.(4675-4677)aCc>aTc	p.T1559I	ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1559					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					TTTGTGAAAGGTCTGTGATAG	0.358																																						dbGAP											0													120.0	124.0	123.0					17																	67077227		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.4676C>T	17.37:g.67077227G>A	ENSP00000284425:p.Thr1559Ile		Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.T1559I	ENST00000284425.2	37	c.4676	CCDS11683.1	17	.	.	.	.	.	.	.	.	.	.	G	14.50	2.553441	0.45487	.	.	ENSG00000154262	ENST00000284425;ENST00000446604	T	0.74421	-0.84	5.26	5.26	0.73747	.	0.256209	0.27117	N	0.020851	T	0.57829	0.2080	N	0.04787	-0.16	0.80722	D	1	B	0.15473	0.013	B	0.17722	0.019	T	0.57596	-0.7784	10	0.72032	D	0.01	.	16.4014	0.83642	0.0:0.0:1.0:0.0	.	1559	Q8N139	ABCA6_HUMAN	I	1559;419	ENSP00000284425:T1559I	ENSP00000284425:T1559I	T	-	2	0	ABCA6	64588822	0.976000	0.34144	1.000000	0.80357	0.431000	0.31685	6.782000	0.75073	2.738000	0.93877	0.655000	0.94253	ACC	ABCA6	-	NULL	ENSG00000154262		0.358	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	HGNC	protein_coding	OTTHUMT00000450463.1	627	0.00	0	G	NM_080284		67077227	67077227	-1	no_errors	ENST00000284425	ensembl	human	known	69_37n	missense	679	25.36	231	SNP	1.000	A
ACSBG1	23205	genome.wustl.edu	37	15	78485847	78485847	+	Splice_Site	SNP	C	C	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr15:78485847C>A	ENST00000258873.4	-	5	869		c.e5+1		ACSBG1_ENST00000541759.1_Intron|ACSBG1_ENST00000560817.1_Intron|ACSBG1_ENST00000558828.1_5'Flank	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1						long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						CTTCCCCAAACCTTCAGGATC	0.582																																						dbGAP											0													110.0	109.0	109.0					15																	78485847		2196	4293	6489	-	-	-	SO:0001630	splice_region_variant	0			AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.663+1G>T	15.37:g.78485847C>A			B2RB61|O75126|Q76N27|Q9HC26	Splice_Site	SNP	-	e5+1	ENST00000258873.4	37	c.663+1	CCDS10298.1	15	.	.	.	.	.	.	.	.	.	.	C	16.58	3.162404	0.57368	.	.	ENSG00000103740	ENST00000258873	.	.	.	3.76	2.79	0.32731	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.9748	0.41777	0.2489:0.7511:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ACSBG1	76272902	1.000000	0.71417	0.766000	0.31476	0.977000	0.68977	6.796000	0.75145	0.788000	0.33755	0.655000	0.94253	.	ACSBG1	-	-	ENSG00000103740		0.582	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSBG1	HGNC	protein_coding	OTTHUMT00000289802.2	47	0.00	0	C	NM_015162	Intron	78485847	78485847	-1	no_errors	ENST00000258873	ensembl	human	known	69_37n	splice_site	26	29.73	11	SNP	0.947	A
ADCY9	115	genome.wustl.edu	37	16	4163947	4163947	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr16:4163947G>C	ENST00000294016.3	-	2	2035	c.1497C>G	c.(1495-1497)atC>atG	p.I499M		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	499	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TCATGCCCAGGATGCCGCAAA	0.557																																						dbGAP											0													124.0	127.0	126.0					16																	4163947		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.1497C>G	16.37:g.4163947G>C	ENSP00000294016:p.Ile499Met		A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.I499M	ENST00000294016.3	37	c.1497	CCDS32382.1	16	.	.	.	.	.	.	.	.	.	.	G	13.00	2.106455	0.37145	.	.	ENSG00000162104	ENST00000294016	T	0.81078	-1.45	5.28	-1.07	0.09968	Adenylyl cyclase class-3/4/guanylyl cyclase, conserved site (1);Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	T	0.74068	0.3668	M	0.74467	2.265	0.46396	D	0.999029	P	0.36683	0.565	B	0.34590	0.186	T	0.68526	-0.5385	10	0.87932	D	0	.	6.5518	0.22438	0.2574:0.0:0.5379:0.2047	.	499	O60503	ADCY9_HUMAN	M	499	ENSP00000294016:I499M	ENSP00000294016:I499M	I	-	3	3	ADCY9	4103948	0.826000	0.29277	0.964000	0.40570	0.633000	0.38033	0.067000	0.14510	-0.029000	0.13827	-0.324000	0.08512	ATC	ADCY9	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	ENSG00000162104		0.557	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY9	HGNC	protein_coding	OTTHUMT00000438076.1	31	0.00	0	G			4163947	4163947	-1	no_errors	ENST00000294016	ensembl	human	known	69_37n	missense	21	46.15	18	SNP	1.000	C
AP3M2	10947	genome.wustl.edu	37	8	42012278	42012278	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr8:42012278A>G	ENST00000518421.1	+	3	364	c.73A>G	c.(73-75)Agc>Ggc	p.S25G	AP3M2_ENST00000174653.3_Missense_Mutation_p.S25G|AP3M2_ENST00000520685.1_Intron|AP3M2_ENST00000517922.1_Missense_Mutation_p.S25G|AP3M2_ENST00000396926.3_Missense_Mutation_p.S25G|RP11-589C21.5_ENST00000564481.1_RNA	NM_001134296.1	NP_001127768.1	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	25					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|stomach(1)	17	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			AAGTGTGGTCAGCCGTTCTGT	0.453																																						dbGAP											0													82.0	80.0	81.0					8																	42012278		2203	4300	6503	-	-	-	SO:0001583	missense	0			D38293	CCDS6125.1	8p11.2	2008-07-07			ENSG00000070718	ENSG00000070718			570	protein-coding gene	gene with protein product		610469				7601449	Standard	NM_006803		Approved	CLA20, AP47B	uc003xoo.3	P53677	OTTHUMG00000164060	ENST00000518421.1:c.73A>G	8.37:g.42012278A>G	ENSP00000428787:p.Ser25Gly		B2RCR0|D3DSY2|Q7Z472	Missense_Mutation	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu	p.S25G	ENST00000518421.1	37	c.73	CCDS6125.1	8	.	.	.	.	.	.	.	.	.	.	A	15.87	2.961603	0.53400	.	.	ENSG00000070718	ENST00000518421;ENST00000174653;ENST00000396926;ENST00000522288;ENST00000517922	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.06	5.36	5.36	0.76844	Longin-like (1);AP complex, mu/sigma subunit (1);	0.077521	0.85682	D	0.000000	T	0.71945	0.3400	L	0.53617	1.68	0.80722	D	1	B;B	0.17038	0.006;0.02	B;B	0.23852	0.021;0.049	T	0.66586	-0.5886	10	0.26408	T	0.33	-18.9724	10.5812	0.45257	0.8562:0.0:0.0:0.1438	.	25;25	E7ER80;P53677	.;AP3M2_HUMAN	G	25	ENSP00000428787:S25G;ENSP00000174653:S25G;ENSP00000380132:S25G;ENSP00000429435:S25G	ENSP00000174653:S25G	S	+	1	0	AP3M2	42131435	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.982000	0.76173	2.040000	0.60383	0.454000	0.30748	AGC	AP3M2	-	pfam_AP_mu_sigma_su,superfamily_Longin-like_dom,pirsf_Clathrin_mu,prints_Clathrin_mu	ENSG00000070718		0.453	AP3M2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AP3M2	HGNC	protein_coding	OTTHUMT00000376996.1	61	0.00	0	A			42012278	42012278	+1	no_errors	ENST00000174653	ensembl	human	known	69_37n	missense	68	23.60	21	SNP	1.000	G
ARHGEF15	22899	genome.wustl.edu	37	17	8224297	8224298	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr17:8224297_8224298insC	ENST00000361926.3	+	16	2622_2623	c.2512_2513insC	c.(2512-2514)gccfs	p.A838fs	ARHGEF15_ENST00000421050.1_Frame_Shift_Ins_p.A838fs|AC135178.7_ENST00000458568.1_RNA	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	838					negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						CACCCCCAATGCCCCCCCACCC	0.574																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.2519dupC	17.37:g.8224304_8224304dupC	ENSP00000355026:p.Ala838fs		A8K6G1|Q8N449|Q9H8B4	Frame_Shift_Ins	INS	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	p.P841fs	ENST00000361926.3	37	c.2512_2513	CCDS11139.1	17																																																																																			ARHGEF15	-	NULL	ENSG00000198844		0.574	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF15	HGNC	protein_coding	OTTHUMT00000226993.2	33	0.00	0	-	NM_173728		8224297	8224298	+1	no_errors	ENST00000361926	ensembl	human	known	69_37n	frame_shift_ins	31	11.43	4	INS	0.000:0.001	C
ARID1B	57492	genome.wustl.edu	37	6	157527623	157527623	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr6:157527623A>C	ENST00000350026.5	+	19	5310	c.5309A>C	c.(5308-5310)aAg>aCg	p.K1770T	ARID1B_ENST00000367148.1_Missense_Mutation_p.K1823T|ARID1B_ENST00000346085.5_Missense_Mutation_p.K1783T|ARID1B_ENST00000275248.4_Missense_Mutation_p.K1765T	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1770					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CAAGCCAGTAAGTTCGACAAG	0.507																																						dbGAP											0													72.0	73.0	73.0					6																	157527623		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.5309A>C	6.37:g.157527623A>C	ENSP00000055163:p.Lys1770Thr		Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.K1823T	ENST00000350026.5	37	c.5468	CCDS5251.2	6	.	.	.	.	.	.	.	.	.	.	A	15.59	2.878841	0.51801	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.03635	4.2;4.2;4.18;4.2;3.86	5.16	3.99	0.46301	.	0.046355	0.85682	D	0.000000	T	0.06554	0.0168	M	0.75777	2.31	0.58432	D	0.999994	D;D;D	0.56746	0.961;0.977;0.977	P;P;P	0.55923	0.617;0.787;0.714	T	0.03034	-1.1080	10	0.87932	D	0	.	11.0158	0.47687	0.9261:0.0:0.0739:0.0	.	1770;1783;1765	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	T	1783;1770;1823;1765;1292	ENSP00000344546:K1783T;ENSP00000055163:K1770T;ENSP00000356116:K1823T;ENSP00000275248:K1765T;ENSP00000412835:K1292T	ENSP00000275248:K1765T	K	+	2	0	ARID1B	157569315	1.000000	0.71417	0.937000	0.37676	0.971000	0.66376	4.209000	0.58493	0.790000	0.33803	0.383000	0.25322	AAG	ARID1B	-	NULL	ENSG00000049618		0.507	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1	181	0.00	0	A	NM_020732		157527623	157527623	+1	no_errors	ENST00000367148	ensembl	human	known	69_37n	missense	32	79.22	122	SNP	1.000	C
ARIH1	25820	genome.wustl.edu	37	15	72855839	72855839	+	Silent	SNP	T	T	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr15:72855839T>C	ENST00000379887.4	+	7	1223	c.909T>C	c.(907-909)ttT>ttC	p.F303F		NM_005744.3	NP_005735.2	Q9Y4X5	ARI1_HUMAN	ariadne RBR E3 ubiquitin protein ligase 1	303				F -> S (in Ref. 9; CAA08817). {ECO:0000305}.	cytokine-mediated signaling pathway (GO:0019221)|protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ubiquitin ligase complex (GO:0000151)	small conjugating protein ligase activity (GO:0019787)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	14						GGCGCCAATTTTGGTAAGCAA	0.398																																						dbGAP											0													96.0	89.0	92.0					15																	72855839		2198	4297	6495	-	-	-	SO:0001819	synonymous_variant	0			AF072832	CCDS10244.1	15q24	2013-10-03	2013-10-03		ENSG00000166233	ENSG00000166233			689	protein-coding gene	gene with protein product	"""ariadne, Drosophila, homolog of"""	605624	"""ariadne (Drosophila) homolog, ubiquitin-conjugating enzyme E2-binding protein, 1"", ""ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)"""			10521492, 24058416	Standard	NM_005744		Approved	HARI, HHARI, UBCH7BP, ARI	uc002aut.4	Q9Y4X5	OTTHUMG00000133474	ENST00000379887.4:c.909T>C	15.37:g.72855839T>C			B2R6U3|O76026|Q9H3T6|Q9UEN0|Q9UP39	Silent	SNP	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC,pfscan_Znf_RING	p.F303	ENST00000379887.4	37	c.909	CCDS10244.1	15																																																																																			ARIH1	-	pfam_Znf_C6HC,smart_Znf_C6HC,smart_Znf_RING	ENSG00000166233		0.398	ARIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARIH1	HGNC	protein_coding	OTTHUMT00000257350.1	113	0.00	0	T	NM_005744		72855839	72855839	+1	no_errors	ENST00000379887	ensembl	human	known	69_37n	silent	95	39.10	61	SNP	0.999	C
ASTN1	460	genome.wustl.edu	37	1	176863946	176863946	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:176863946A>T	ENST00000367654.3	-	17	2927	c.2716T>A	c.(2716-2718)Tct>Act	p.S906T	ASTN1_ENST00000361833.2_Missense_Mutation_p.S898T|ASTN1_ENST00000367657.3_Missense_Mutation_p.S898T|ASTN1_ENST00000424564.2_Missense_Mutation_p.S898T	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	906					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CGCTCCTCAGACTCATCTGAT	0.527																																						dbGAP											0													98.0	101.0	100.0					1																	176863946		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2716T>A	1.37:g.176863946A>T	ENSP00000356626:p.Ser906Thr		A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_EGF-like,smart_MACPF,pfscan_Fibronectin_type3	p.S906T	ENST00000367654.3	37	c.2716		1	.	.	.	.	.	.	.	.	.	.	A	12.97	2.096518	0.36952	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.15256	2.44;2.86;2.86;2.45	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.27933	0.0688	L	0.43152	1.355	0.80722	D	1	P;P	0.52577	0.954;0.954	D;D	0.66351	0.943;0.943	T	0.03008	-1.1083	10	0.02654	T	1	-12.843	15.1374	0.72579	1.0:0.0:0.0:0.0	.	898;898	O14525-2;B1AJS1	.;.	T	898;898;906;898;898	ENSP00000356629:S898T;ENSP00000354536:S898T;ENSP00000356626:S906T;ENSP00000395041:S898T	ENSP00000354536:S898T	S	-	1	0	ASTN1	175130569	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.443000	0.90320	2.133000	0.65898	0.533000	0.62120	TCT	ASTN1	-	smart_MACPF	ENSG00000152092		0.527	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		185	0.00	0	A	NM_004319		176863946	176863946	-1	no_errors	ENST00000367654	ensembl	human	known	69_37n	missense	226	23.91	71	SNP	1.000	T
ASTN1	460	genome.wustl.edu	37	1	176918359	176918359	+	Silent	SNP	C	C	A	rs34739197		TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:176918359C>A	ENST00000367654.3	-	12	2251	c.2040G>T	c.(2038-2040)ccG>ccT	p.P680P	ASTN1_ENST00000361833.2_Silent_p.P672P|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000367657.3_Silent_p.P672P|ASTN1_ENST00000424564.2_Silent_p.P672P	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	680	EGF-like 3.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TGGGGTCGTCCGGGAAGGGCG	0.612											OREG0014004	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													78.0	75.0	76.0					1																	176918359		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2040G>T	1.37:g.176918359C>A		1934	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	superfamily_Fibronectin_type3,smart_EGF-like,smart_MACPF,pfscan_Fibronectin_type3	p.P680	ENST00000367654.3	37	c.2040		1																																																																																			ASTN1	-	smart_EGF-like	ENSG00000152092		0.612	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		79	0.00	0	C	NM_004319		176918359	176918359	-1	no_errors	ENST00000367654	ensembl	human	known	69_37n	silent	112	27.10	42	SNP	0.478	A
ATRX	546	genome.wustl.edu	37	X	76849193	76849193	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chrX:76849193C>G	ENST00000373344.5	-	26	6297	c.6083G>C	c.(6082-6084)cGa>cCa	p.R2028P	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.R1990P	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2028	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with MECP2.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.R2028P(1)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						CTCTGCCATTCGAAGAATTTC	0.343			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																															dbGAP		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	2	Substitution - Missense(1)|Unknown(1)	haematopoietic_and_lymphoid_tissue(1)|bone(1)											70.0	67.0	68.0					X																	76849193		2203	4296	6499	-	-	-	SO:0001583	missense	0			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6083G>C	X.37:g.76849193C>G	ENSP00000362441:p.Arg2028Pro		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R2028P	ENST00000373344.5	37	c.6083	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	C	17.42	3.385031	0.61956	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.92699	-3.09;-3.09	5.45	5.45	0.79879	Helicase, C-terminal (1);	0.000000	0.64402	D	0.000002	D	0.94155	0.8125	L	0.37507	1.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.984	D	0.94946	0.8095	10	0.72032	D	0.01	-4.4598	18.3664	0.90392	0.0:1.0:0.0:0.0	.	1990;2028	P46100-4;P46100	.;ATRX_HUMAN	P	2028;1990	ENSP00000362441:R2028P;ENSP00000378967:R1990P	ENSP00000362441:R2028P	R	-	2	0	ATRX	76735849	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.437000	0.80417	2.278000	0.76064	0.529000	0.55759	CGA	ATRX	-	pfscan_Helicase_C	ENSG00000085224		0.343	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	304	0.00	0	C	NM_000489		76849193	76849193	-1	no_errors	ENST00000373344	ensembl	human	known	69_37n	missense	240	14.29	40	SNP	1.000	G
BMS1	9790	genome.wustl.edu	37	10	43288536	43288536	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr10:43288536G>T	ENST00000374518.5	+	8	1096	c.1033G>T	c.(1033-1035)Gtg>Ttg	p.V345L		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	345					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						AGTTGGGGGTGTGCTGTATGA	0.478																																						dbGAP											0													132.0	124.0	127.0					10																	43288536		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.1033G>T	10.37:g.43288536G>T	ENSP00000363642:p.Val345Leu		Q5QPT5|Q86XJ9	Missense_Mutation	SNP	pfam_BMS1_TSR1_C,pfam_AARP2CN,pfam_ProtSyn_GTP-bd,smart_AARP2CN	p.V345L	ENST00000374518.5	37	c.1033	CCDS7199.1	10	.	.	.	.	.	.	.	.	.	.	g	11.87	1.766761	0.31320	.	.	ENSG00000165733	ENST00000374518	T	0.11385	2.78	5.51	5.51	0.81932	.	0.188336	0.44483	D	0.000458	T	0.07773	0.0195	L	0.31157	0.91	0.29693	N	0.840758	B	0.23891	0.093	B	0.22152	0.038	T	0.17410	-1.0370	10	0.19590	T	0.45	.	8.6911	0.34267	0.0825:0.0:0.7638:0.1537	.	345	Q14692	BMS1_HUMAN	L	345	ENSP00000363642:V345L	ENSP00000363642:V345L	V	+	1	0	BMS1	42608542	0.998000	0.40836	1.000000	0.80357	0.992000	0.81027	2.212000	0.42835	2.636000	0.89361	0.573000	0.79308	GTG	BMS1	-	NULL	ENSG00000165733		0.478	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMS1	HGNC	protein_coding	OTTHUMT00000047690.2	357	0.00	0	G	NM_014753		43288536	43288536	+1	no_errors	ENST00000374518	ensembl	human	known	69_37n	missense	195	41.96	141	SNP	0.990	T
BOD1L1	259282	genome.wustl.edu	37	4	13603397	13603397	+	Silent	SNP	G	G	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr4:13603397G>T	ENST00000040738.5	-	10	5262	c.5127C>A	c.(5125-5127)ggC>ggA	p.G1709G		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1709						nucleus (GO:0005634)	DNA binding (GO:0003677)										TTCCCTGGGAGCCATCCACCT	0.428																																						dbGAP											0													175.0	181.0	179.0					4																	13603397		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.5127C>A	4.37:g.13603397G>T			Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	NULL	p.G1709	ENST00000040738.5	37	c.5127	CCDS3411.2	4																																																																																			BOD1L1	-	NULL	ENSG00000038219		0.428	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	462	0.00	0	G	NM_148894		13603397	13603397	-1	no_errors	ENST00000040738	ensembl	human	known	69_37n	silent	301	59.19	438	SNP	0.009	T
BTBD1	53339	genome.wustl.edu	37	15	83687554	83687554	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr15:83687554T>G	ENST00000261721.4	-	7	1397	c.1195A>C	c.(1195-1197)Agt>Cgt	p.S399R	RP11-382A20.5_ENST00000566841.1_RNA|BTBD1_ENST00000379403.2_Missense_Mutation_p.L369F|RP11-382A20.7_ENST00000570202.1_RNA	NM_001011885.1|NM_025238.3	NP_001011885.1|NP_079514.1	Q9H0C5	BTBD1_HUMAN	BTB (POZ) domain containing 1	399					protein ubiquitination (GO:0016567)|regulation of protein binding (GO:0043393)	cytoplasmic mRNA processing body (GO:0000932)|protein complex (GO:0043234)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	10				all cancers(203;0.000186)		CCATCACAACTAAAGCCGGTA	0.393																																						dbGAP											0													172.0	142.0	152.0					15																	83687554		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF355402	CCDS10322.1, CCDS32313.1	15q24	2013-01-08			ENSG00000064726	ENSG00000064726		"""BTB/POZ domain containing"""	1120	protein-coding gene	gene with protein product		608530					Standard	XM_006720573		Approved		uc002bjn.3	Q9H0C5	OTTHUMG00000147364	ENST00000261721.4:c.1195A>C	15.37:g.83687554T>G	ENSP00000261721:p.Ser399Arg		A6NMI8|Q9BX71|Q9NWN4	Missense_Mutation	SNP	pfam_PHR,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.S399R	ENST00000261721.4	37	c.1195	CCDS10322.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.34|17.34	3.365555|3.365555	0.61513|0.61513	.|.	.|.	ENSG00000064726|ENSG00000064726	ENST00000379403|ENST00000261721	T|T	0.77620|0.77489	-1.11|-1.1	5.23|5.23	5.23|5.23	0.72850|0.72850	.|PHR (1);	.|0.044312	.|0.85682	.|D	.|0.000000	D|D	0.85944|0.85944	0.5815|0.5815	M|M	0.83118|0.83118	2.625|2.625	0.34376|0.34376	D|D	0.692628|0.692628	P|P	0.35033|0.51933	0.481|0.949	B|P	0.41374|0.57960	0.355|0.83	D|D	0.89060|0.89060	0.3462|0.3462	9|10	0.02654|0.25106	T|T	1|0.35	-19.6963|-19.6963	15.1237|15.1237	0.72465|0.72465	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	369|399	A6NMI8|Q9H0C5	.|BTBD1_HUMAN	F|R	369|399	ENSP00000368713:L369F|ENSP00000261721:S399R	ENSP00000368713:L369F|ENSP00000261721:S399R	L|S	-|-	3|1	2|0	BTBD1|BTBD1	81478558|81478558	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	7.975000|7.975000	0.88055|0.88055	1.983000|1.983000	0.57843|0.57843	0.460000|0.460000	0.39030|0.39030	TTA|AGT	BTBD1	-	pfam_PHR	ENSG00000064726		0.393	BTBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD1	HGNC	protein_coding	OTTHUMT00000304008.1	57	0.00	0	T			83687554	83687554	-1	no_errors	ENST00000261721	ensembl	human	known	69_37n	missense	48	28.36	19	SNP	1.000	G
CCDC184	387856	genome.wustl.edu	37	12	48578200	48578200	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr12:48578200C>T	ENST00000316554.3	+	1	835	c.295C>T	c.(295-297)Cag>Tag	p.Q99*		NM_001013635.3	NP_001013657.3	Q52MB2	CC184_HUMAN		99						cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)	4						TGCGCCCCGCCAGGGCGGCTT	0.682																																						dbGAP											0													22.0	23.0	23.0					12																	48578200		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0																														ENST00000316554.3:c.295C>T	12.37:g.48578200C>T	ENSP00000320849:p.Gln99*		Q96MK5|Q96N39	Nonsense_Mutation	SNP	NULL	p.Q99*	ENST00000316554.3	37	c.295	CCDS31785.1	12	.	.	.	.	.	.	.	.	.	.	C	38	7.244485	0.98161	.	.	ENSG00000177875	ENST00000316554	.	.	.	5.24	5.24	0.73138	.	0.000000	0.51477	D	0.000092	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.3205	14.1772	0.65549	0.0:1.0:0.0:0.0	.	.	.	.	X	99	.	ENSP00000320849:Q99X	Q	+	1	0	C12orf68	46864467	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	3.473000	0.53122	2.718000	0.92993	0.650000	0.86243	CAG	C12orf68	-	NULL	ENSG00000177875		0.682	C12orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf68	HGNC	protein_coding	OTTHUMT00000406514.1	8	0.00	0	C			48578200	48578200	+1	no_errors	ENST00000316554	ensembl	human	known	69_37n	nonsense	12	33.33	6	SNP	1.000	T
C5	727	genome.wustl.edu	37	9	123759853	123759853	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr9:123759853T>C	ENST00000223642.1	-	21	2791	c.2762A>G	c.(2761-2763)gAa>gGa	p.E921G	C5_ENST00000466280.1_5'Flank	NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	921					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	TACTAAGATTTCTTTTCCAAA	0.408																																						dbGAP											0													50.0	48.0	49.0					9																	123759853		2203	4300	6503	-	-	-	SO:0001583	missense	0			M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.2762A>G	9.37:g.123759853T>C	ENSP00000223642:p.Glu921Gly		Q14CJ0|Q27I61	Missense_Mutation	SNP	pfam_A2M_comp,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_A-macroglobulin_rcpt-bd,pfam_Netrin_module_non-TIMP,pfam_A2M_N,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain,prints_Anaphylatoxn	p.E921G	ENST00000223642.1	37	c.2762	CCDS6826.1	9	.	.	.	.	.	.	.	.	.	.	T	18.17	3.565289	0.65651	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	T	0.34472	1.36	5.53	5.53	0.82687	.	0.244651	0.44097	D	0.000500	T	0.50582	0.1624	M	0.78049	2.395	0.40552	D	0.981127	D	0.59767	0.986	P	0.50970	0.655	T	0.59506	-0.7442	10	0.72032	D	0.01	.	13.3215	0.60436	0.0:0.0:0.0:1.0	.	921	P01031	CO5_HUMAN	G	921;992	ENSP00000223642:E921G	ENSP00000223642:E921G	E	-	2	0	C5	122799674	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	5.207000	0.65197	2.225000	0.72522	0.533000	0.62120	GAA	C5	-	NULL	ENSG00000106804		0.408	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5	HGNC	protein_coding	OTTHUMT00000053844.1	108	0.00	0	T	NM_001735		123759853	123759853	-1	no_errors	ENST00000223642	ensembl	human	known	69_37n	missense	144	11.66	19	SNP	1.000	C
CAMK2G	818	genome.wustl.edu	37	10	75612979	75612979	+	Silent	SNP	T	T	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr10:75612979T>C	ENST00000351293.3	-	4	303	c.246A>G	c.(244-246)gaA>gaG	p.E82E	CAMK2G_ENST00000423381.1_Silent_p.E82E|CAMK2G_ENST00000372765.1_Silent_p.E82E|CAMK2G_ENST00000444854.2_Intron|CAMK2G_ENST00000394762.2_Silent_p.E82E|CAMK2G_ENST00000322680.3_Silent_p.E82E|CAMK2G_ENST00000322635.3_Silent_p.E82E|CAMK2G_ENST00000472912.1_Intron|CAMK2G_ENST00000305762.7_Silent_p.E82E	NM_001222.3|NM_172173.2	NP_001213.2|NP_751913.1	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II gamma	82	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|dephosphorylation (GO:0016311)|G1/S transition of mitotic cell cycle (GO:0000082)|insulin secretion (GO:0030073)|interferon-gamma-mediated signaling pathway (GO:0060333)|nervous system development (GO:0007399)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of calcium ion transport (GO:0051924)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of skeletal muscle adaptation (GO:0014733)|synaptic transmission (GO:0007268)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-dependent protein serine/threonine phosphatase activity (GO:0004723)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			kidney(2)|large_intestine(2)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	15	Prostate(51;0.0112)				Bosutinib(DB06616)	GAAACCCTTCTTCAGAAATAC	0.507																																						dbGAP											0													122.0	109.0	113.0					10																	75612979		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U81554	CCDS7336.1, CCDS7337.1, CCDS7338.1, CCDS73153.1	10q22	2008-10-30	2008-10-30		ENSG00000148660	ENSG00000148660			1463	protein-coding gene	gene with protein product		602123	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma"""	CAMKG		8287681	Standard	NM_001204492		Approved		uc001jvm.2	Q13555	OTTHUMG00000018492	ENST00000351293.3:c.246A>G	10.37:g.75612979T>C			O00561|O15378|Q13279|Q13282|Q13556|Q5SQZ3|Q5SQZ4|Q5SWX4|Q7KYX5|Q8N4I3|Q8NIA4	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ca/CaM-dep_prot_kinase-assoc,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E82	ENST00000351293.3	37	c.246	CCDS7336.1	10																																																																																			CAMK2G	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000148660		0.507	CAMK2G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK2G	HGNC	protein_coding	OTTHUMT00000048715.1	72	0.00	0	T	NM_172169		75612979	75612979	-1	no_errors	ENST00000423381	ensembl	human	known	69_37n	silent	35	48.57	34	SNP	1.000	C
CASQ1	844	genome.wustl.edu	37	1	160165315	160165315	+	Silent	SNP	C	C	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:160165315C>T	ENST00000368078.3	+	5	838	c.642C>T	c.(640-642)ttC>ttT	p.F214F	CASQ1_ENST00000368079.3_Silent_p.F208F|CASQ1_ENST00000467691.1_5'Flank			P31415	CASQ1_HUMAN	calsequestrin 1 (fast-twitch, skeletal muscle)	214					endoplasmic reticulum organization (GO:0007029)|ion transmembrane transport (GO:0034220)|protein polymerization (GO:0051258)|regulation of sequestering of calcium ion (GO:0051282)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to heat (GO:0009408)|response to organic substance (GO:0010033)|sarcomere organization (GO:0045214)|skeletal muscle tissue development (GO:0007519)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna lumen (GO:0014804)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	21	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCGCCACCTTCGACAGCAAGG	0.552																																						dbGAP											0													139.0	132.0	134.0					1																	160165315		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			S73775	CCDS1198.1, CCDS1198.2	1q21	2011-10-19			ENSG00000143318	ENSG00000143318		"""Protein disulfide isomerases"""	1512	protein-coding gene	gene with protein product	"""calsequestrin 1, fast-twitch, skeletal muscle"", ""calmitine"""	114250		CASQ		8406504, 2321095	Standard	NM_001231		Approved	PDIB1	uc010pja.2	P31415	OTTHUMG00000031607	ENST00000368078.3:c.642C>T	1.37:g.160165315C>T			B1AKZ2|B2R863|Q8TBW7	Silent	SNP	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin	p.F214	ENST00000368078.3	37	c.642	CCDS1198.2	1																																																																																			CASQ1	-	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin	ENSG00000143318		0.552	CASQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASQ1	HGNC	protein_coding	OTTHUMT00000077412.1	144	0.00	0	C	NM_001231		160165315	160165315	+1	no_errors	ENST00000368078	ensembl	human	known	69_37n	silent	365	14.12	60	SNP	0.997	T
CCDC150	284992	genome.wustl.edu	37	2	197521456	197521456	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr2:197521456T>G	ENST00000389175.4	+	3	411	c.276T>G	c.(274-276)atT>atG	p.I92M	CCDC150_ENST00000423093.2_Intron|CCDC150_ENST00000472405.2_5'UTR|CCDC150_ENST00000272831.7_Intron	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	92										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						AAACAGATATTTTATGGAAGA	0.418																																						dbGAP											0													99.0	95.0	96.0					2																	197521456		1825	4085	5910	-	-	-	SO:0001583	missense	0				CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.276T>G	2.37:g.197521456T>G	ENSP00000373827:p.Ile92Met		Q6P5U6|Q6P663|Q8N8V5	Missense_Mutation	SNP	NULL	p.I92M	ENST00000389175.4	37	c.276	CCDS46478.1	2	.	.	.	.	.	.	.	.	.	.	T	11.72	1.722079	0.30503	.	.	ENSG00000144395	ENST00000389175;ENST00000536389	T	0.30448	1.53	5.03	2.64	0.31445	.	1.298450	0.05104	N	0.487774	T	0.27629	0.0679	L	0.51422	1.61	0.80722	D	1	B;B	0.18166	0.009;0.026	B;B	0.16289	0.01;0.015	T	0.27536	-1.0071	10	0.42905	T	0.14	-0.0438	2.5627	0.04776	0.15:0.0821:0.1562:0.6117	.	92;92	Q8NCX0;F5H6M2	CC150_HUMAN;.	M	92	ENSP00000373827:I92M	ENSP00000373827:I92M	I	+	3	3	CCDC150	197229701	0.002000	0.14202	0.869000	0.34112	0.939000	0.58152	-0.223000	0.09177	0.402000	0.25451	0.533000	0.62120	ATT	CCDC150	-	NULL	ENSG00000144395		0.418	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CCDC150	HGNC	protein_coding	OTTHUMT00000335377.2	112	0.00	0	T	NM_001080539		197521456	197521456	+1	no_errors	ENST00000389175	ensembl	human	known	69_37n	missense	68	44.26	54	SNP	0.938	G
CCS	9973	genome.wustl.edu	37	11	66366957	66366958	+	Frame_Shift_Ins	INS	-	-	G	rs61731811	byFrequency	TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr11:66366957_66366958insG	ENST00000533244.1	+	4	719_720	c.278_279insG	c.(277-282)ctggggfs	p.LG93fs	CCS_ENST00000310190.4_Frame_Shift_Ins_p.LG74fs	NM_005125.1	NP_005116.1	O14618	CCS_HUMAN	copper chaperone for superoxide dismutase	93	Superoxide dismutase-like.				copper ion transmembrane transport (GO:0035434)|intracellular copper ion transport (GO:0015680)|positive regulation of oxidoreductase activity (GO:0051353)|removal of superoxide radicals (GO:0019430)|superoxide metabolic process (GO:0006801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|protein disulfide oxidoreductase activity (GO:0015035)|superoxide dismutase activity (GO:0004784)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|large_intestine(2)|lung(3)|stomach(1)	9						GTGGCCATCCTGGGGGGGCCTG	0.644																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF002210	CCDS8146.1	11q13.2	2012-09-20			ENSG00000173992	ENSG00000173992			1613	protein-coding gene	gene with protein product		603864				9295278	Standard	NM_005125		Approved		uc001oir.3	O14618	OTTHUMG00000167238	ENST00000533244.1:c.285dupG	11.37:g.66366964_66366964dupG	ENSP00000436318:p.Leu93fs		Q2M366|Q8NEV0	Frame_Shift_Ins	INS	pfam_SOD_Cu_Zn_dom,pfam_HeavyMe-assoc_HMA,superfamily_SOD_Cu_Zn_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_SOD_Cu_Zn_dom	p.P96fs	ENST00000533244.1	37	c.278_279	CCDS8146.1	11																																																																																			CCS	-	pfam_SOD_Cu_Zn_dom,superfamily_SOD_Cu_Zn_dom	ENSG00000173992		0.644	CCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCS	HGNC	protein_coding	OTTHUMT00000393826.1	21	0.00	0	-	NM_005125		66366957	66366958	+1	no_errors	ENST00000533244	ensembl	human	known	69_37n	frame_shift_ins	29	12.12	4	INS	1.000:0.968	G
CD300LG	146894	genome.wustl.edu	37	17	41931337	41931338	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr17:41931337_41931338insC	ENST00000317310.4	+	4	685_686	c.644_645insC	c.(643-648)cgccccfs	p.RP215fs	CD300LG_ENST00000377203.4_Frame_Shift_Ins_p.RP181fs|CD300LG_ENST00000586233.1_Frame_Shift_Ins_p.RP130fs|CD300LG_ENST00000539718.1_Frame_Shift_Ins_p.RP215fs|CD300LG_ENST00000293396.8_Frame_Shift_Ins_p.RP130fs	NM_145273.3	NP_660316.2	Q6UXG3	CLM9_HUMAN	CD300 molecule-like family member g	215					immune system process (GO:0002376)|immunoglobulin transcytosis in epithelial cells (GO:0002414)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|skin(4)	19		Breast(137;0.0199)		BRCA - Breast invasive adenocarcinoma(366;0.115)		GGGAGCTCCCGCCCCCCCATGC	0.629																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC025395	CCDS11470.1, CCDS54131.1, CCDS54132.1, CCDS54133.1	17q21.31	2013-01-11	2006-03-29					"""Immunoglobulin superfamily / V-set domain containing"""	30455	protein-coding gene	gene with protein product	"""nepmucin"""	610520	"""CD300 antigen like family member G"""			16876123, 16754720	Standard	NM_001168322		Approved	Trem4, CLM9	uc002iem.3	Q6UXG3		ENST00000317310.4:c.651dupC	17.37:g.41931344_41931344dupC	ENSP00000321005:p.Arg215fs		B4DNY5|F5H7P9|F8W9M3|Q8IX38|Q8IX39|Q8TA95	Frame_Shift_Ins	INS	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.M218fs	ENST00000317310.4	37	c.644_645	CCDS11470.1	17																																																																																			CD300LG	-	NULL	ENSG00000161649		0.629	CD300LG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD300LG	HGNC	protein_coding	OTTHUMT00000457646.1	57	0.00	0	-	NM_145273		41931337	41931338	+1	no_errors	ENST00000317310	ensembl	human	known	69_37n	frame_shift_ins	50	10.71	6	INS	0.000:0.000	C
CD38	952	genome.wustl.edu	37	4	15818253	15818253	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr4:15818253C>A	ENST00000226279.3	+	2	490	c.353C>A	c.(352-354)cCt>cAt	p.P118H		NM_001775.2	NP_001766.2	P28907	CD38_HUMAN	CD38 molecule	118					apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|female pregnancy (GO:0007565)|long term synaptic depression (GO:0060292)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone resorption (GO:0045779)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell growth (GO:0030307)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hydroperoxide (GO:0033194)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|phosphorus-oxygen lyase activity (GO:0016849)|transferase activity (GO:0016740)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|stomach(1)	14						CAGACCGTACCTTGCAACAAG	0.383																																						dbGAP											0													106.0	99.0	101.0					4																	15818253		2203	4300	6503	-	-	-	SO:0001583	missense	0			D84276	CCDS3417.1	4p15.32	2010-05-04	2006-03-28		ENSG00000004468	ENSG00000004468	3.2.2.5	"""CD molecules"""	1667	protein-coding gene	gene with protein product	"""ADP-ribosyl cyclase 1"", ""NAD(+) nucleosidase"""	107270	"""CD38 antigen (p45)"""			9074508, 2319135	Standard	NM_001775		Approved		uc003gol.1	P28907	OTTHUMG00000048206	ENST00000226279.3:c.353C>A	4.37:g.15818253C>A	ENSP00000226279:p.Pro118His		O00121|O00122|Q96HY4	Missense_Mutation	SNP	pfam_ADP-ribosyl_cyclase	p.P118H	ENST00000226279.3	37	c.353	CCDS3417.1	4	.	.	.	.	.	.	.	.	.	.	C	13.18	2.160123	0.38119	.	.	ENSG00000004468	ENST00000226279;ENST00000540195;ENST00000510674	T;T	0.63744	-0.06;-0.06	5.57	4.54	0.55810	NAD(P)-binding domain (1);	0.111190	0.64402	D	0.000007	T	0.80265	0.4591	M	0.86420	2.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.83146	-0.0106	10	0.87932	D	0	-21.1516	12.2942	0.54836	0.0:0.905:0.0:0.095	.	118;118	P28907;B2R880	CD38_HUMAN;.	H	118;118;12	ENSP00000226279:P118H;ENSP00000423047:P12H	ENSP00000226279:P118H	P	+	2	0	CD38	15427351	0.691000	0.27709	0.821000	0.32701	0.141000	0.21300	1.936000	0.40183	2.624000	0.88883	0.563000	0.77884	CCT	CD38	-	pfam_ADP-ribosyl_cyclase	ENSG00000004468		0.383	CD38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD38	HGNC	protein_coding	OTTHUMT00000250322.2	287	0.00	0	C	NM_001775		15818253	15818253	+1	no_errors	ENST00000226279	ensembl	human	known	69_37n	missense	363	25.15	122	SNP	0.887	A
CSMD2	114784	genome.wustl.edu	37	1	34190272	34190272	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:34190272G>T	ENST00000373381.4	-	18	2905	c.2729C>A	c.(2728-2730)cCa>cAa	p.P910Q		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	870	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGGGATTCCTGGATCCAGACA	0.542																																						dbGAP											0													73.0	69.0	70.0					1																	34190272		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.2729C>A	1.37:g.34190272G>T	ENSP00000362479:p.Pro910Gln		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.P910Q	ENST00000373381.4	37	c.2729		1	.	.	.	.	.	.	.	.	.	.	G	31	5.076478	0.94000	.	.	ENSG00000121904	ENST00000373381	D	0.84873	-1.91	5.74	5.74	0.90152	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.95056	0.8399	H	0.95187	3.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.95918	0.8928	10	0.72032	D	0.01	.	18.9071	0.92467	0.0:0.0:1.0:0.0	.	870;910	Q7Z408;E7EUA6	CSMD2_HUMAN;.	Q	910	ENSP00000362479:P910Q	ENSP00000241312:P870Q	P	-	2	0	CSMD2	33962859	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.869000	0.99810	2.707000	0.92482	0.655000	0.94253	CCA	CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.542	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		103	0.00	0	G	NM_052896		34190272	34190272	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	79	34.71	42	SNP	1.000	T
DENND1B	163486	genome.wustl.edu	37	1	197564409	197564409	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:197564409C>T	ENST00000367396.3	-	14	1145	c.976G>A	c.(976-978)Gta>Ata	p.V326I	DENND1B_ENST00000400967.2_Missense_Mutation_p.V296I|DENND1B_ENST00000235453.4_Missense_Mutation_p.V296I	NM_144977.4	NP_659414.2	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B	326	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|kidney(2)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	22						GCCCTAGCTACTCCATCACCC	0.428																																						dbGAP											0													207.0	195.0	199.0					1																	197564409		1869	4118	5987	-	-	-	SO:0001583	missense	0			BC016588	CCDS41452.2, CCDS72996.1, CCDS72997.1	1q31.3	2012-10-03	2005-08-17	2005-08-17	ENSG00000213047	ENSG00000213047		"""DENN/MADD domain containing"""	28404	protein-coding gene	gene with protein product		613292	"""family with sequence similarity 31, member B"", ""chromosome 1 open reading frame 218"""	FAM31B, C1orf218		12477932	Standard	NM_144977		Approved	MGC27044, FLJ20054	uc021pgu.1	Q6P3S1	OTTHUMG00000035653	ENST00000367396.3:c.976G>A	1.37:g.197564409C>T	ENSP00000356366:p.Val326Ile		B5MD89|D3PFD5|Q5T3B8|Q5T3B9|Q5T3C1|Q5TAI8|Q6B0I8|Q8NDT1|Q8TBE6|Q9H774|Q9NXU2	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.V326I	ENST00000367396.3	37	c.976	CCDS41452.2	1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.691226	0.68271	.	.	ENSG00000213047	ENST00000542760;ENST00000450419;ENST00000235453;ENST00000367396;ENST00000400967	T;T;T	0.49432	0.78;0.78;0.78	6.07	5.16	0.70880	dDENN (3);	0.059722	0.64402	D	0.000003	T	0.62159	0.2405	M	0.75447	2.3	0.45015	D	0.998035	P;P;B	0.44260	0.83;0.51;0.007	P;P;B	0.50617	0.646;0.629;0.072	T	0.65837	-0.6071	10	0.52906	T	0.07	-13.7617	17.3981	0.87452	0.0:0.8752:0.1248:0.0	.	326;326;296	Q6P3S1-5;Q6P3S1;Q6P3S1-4	.;DEN1B_HUMAN;.	I	326;306;296;326;296	ENSP00000235453:V296I;ENSP00000356366:V326I;ENSP00000383751:V296I	ENSP00000235453:V296I	V	-	1	0	DENND1B	195831032	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.771000	0.68881	1.555000	0.49500	0.655000	0.94253	GTA	DENND1B	-	pfam_dDENN_dom,smart_dDENN_dom,pfscan_dDENN_dom	ENSG00000213047		0.428	DENND1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND1B	HGNC	protein_coding	OTTHUMT00000086539.1	557	0.00	0	C	NM_144977		197564409	197564409	-1	no_errors	ENST00000367396	ensembl	human	known	69_37n	missense	763	13.18	116	SNP	1.000	T
CR2	1380	genome.wustl.edu	37	1	207640226	207640226	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:207640226G>C	ENST00000367058.3	+	2	603	c.414G>C	c.(412-414)tgG>tgC	p.W138C	CR2_ENST00000458541.2_Missense_Mutation_p.W138C|CR2_ENST00000367059.3_Missense_Mutation_p.W138C|CR2_ENST00000367057.3_Missense_Mutation_p.W138C	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	138	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						ATAATATGTGGGGGCCGACAC	0.468																																						dbGAP											0													79.0	77.0	78.0					1																	207640226		2203	4300	6503	-	-	-	SO:0001583	missense	0			M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.414G>C	1.37:g.207640226G>C	ENSP00000356025:p.Trp138Cys		C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.W138C	ENST00000367058.3	37	c.414	CCDS1478.1	1	.	.	.	.	.	.	.	.	.	.	G	13.52	2.261596	0.39995	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11	5.0	5.0	0.66597	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	D	0.97595	0.9212	H	0.98646	4.29	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98229	1.0482	9	0.66056	D	0.02	.	13.6796	0.62476	0.0:0.0:1.0:0.0	.	138;138;138	Q5SR47;P20023;P20023-3	.;CR2_HUMAN;.	C	138	ENSP00000356025:W138C;ENSP00000356024:W138C;ENSP00000356026:W138C;ENSP00000404222:W138C	ENSP00000356024:W138C	W	+	3	0	CR2	205706849	1.000000	0.71417	0.999000	0.59377	0.116000	0.19942	4.231000	0.58639	2.607000	0.88179	0.655000	0.94253	TGG	CR2	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000117322		0.468	CR2-001	KNOWN	basic|CCDS	protein_coding	CR2	HGNC	protein_coding	OTTHUMT00000088274.1	97	0.00	0	G	NM_001877		207640226	207640226	+1	no_errors	ENST00000367057	ensembl	human	known	69_37n	missense	250	20.38	64	SNP	1.000	C
DFNB31	25861	genome.wustl.edu	37	9	117188598	117188598	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr9:117188598G>C	ENST00000362057.3	-	4	1227	c.1059C>G	c.(1057-1059)atC>atG	p.I353M	DFNB31_ENST00000265134.6_De_novo_Start_InFrame|DFNB31_ENST00000374059.3_5'Flank	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	353	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TCACTGTCAGGATGAGGTGCC	0.592																																						dbGAP											0													95.0	81.0	86.0					9																	117188598		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.1059C>G	9.37:g.117188598G>C	ENSP00000354623:p.Ile353Met		A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.I353M	ENST00000362057.3	37	c.1059	CCDS6806.1	9	.	.	.	.	.	.	.	.	.	.	G	6.476	0.455967	0.12283	.	.	ENSG00000095397	ENST00000362057	T	0.26660	1.72	5.05	3.19	0.36642	PDZ/DHR/GLGF (3);	0.212785	0.47093	N	0.000244	T	0.15998	0.0385	N	0.16166	0.38	0.80722	D	1	B;B	0.17852	0.024;0.024	B;B	0.25759	0.063;0.063	T	0.04347	-1.0958	10	0.13853	T	0.58	-15.39	15.0999	0.72266	0.0:0.4065:0.5934:0.0	.	353;353	B9EGE6;Q9P202	.;WHRN_HUMAN	M	353	ENSP00000354623:I353M	ENSP00000354623:I353M	I	-	3	3	DFNB31	116228419	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	1.175000	0.31944	0.547000	0.28938	-1.169000	0.01745	ATC	DFNB31	-	pfam_PDZ,superfamily_PDZ,smart_PDZ	ENSG00000095397		0.592	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNB31	HGNC	protein_coding	OTTHUMT00000053776.2	88	0.00	0	G	NM_015404		117188598	117188598	-1	no_errors	ENST00000362057	ensembl	human	known	69_37n	missense	78	51.55	83	SNP	1.000	C
DNAJC11	55735	genome.wustl.edu	37	1	6727803	6727804	+	Frame_Shift_Del	DEL	TC	TC	-	rs374290353		TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:6727803_6727804delTC	ENST00000377577.5	-	4	466_467	c.343_344delGA	c.(343-345)gaafs	p.E116fs	DNAJC11_ENST00000377573.5_Frame_Shift_Del_p.E26fs|DNAJC11_ENST00000294401.7_Frame_Shift_Del_p.E116fs|DNAJC11_ENST00000349363.6_Frame_Shift_Del_p.E78fs|DNAJC11_ENST00000542246.1_Frame_Shift_Del_p.E78fs	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	116						extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		TCTCCTCTCTTCTCTCTCTCTC	0.505																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.343_344delGA	1.37:g.6727813_6727814delTC	ENSP00000366800:p.Glu116fs		Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Frame_Shift_Del	DEL	pfam_DnaJ-like_C11_C,pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.E115fs	ENST00000377577.5	37	c.344_343	CCDS87.1	1																																																																																			DNAJC11	-	NULL	ENSG00000007923		0.505	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC11	HGNC	protein_coding	OTTHUMT00000004216.3	21	0.00	0	TC	NM_018198		6727803	6727804	-1	no_errors	ENST00000377577	ensembl	human	known	69_37n	frame_shift_del	27	12.90	4	DEL	1.000:1.000	-
DNAJB4	11080	genome.wustl.edu	37	1	78478898	78478898	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:78478898G>A	ENST00000370763.5	+	2	632	c.375G>A	c.(373-375)atG>atA	p.M125I	GIPC2_ENST00000476882.1_Intron|DNAJB4_ENST00000487931.1_3'UTR	NM_007034.3	NP_008965.2	Q9UDY4	DNJB4_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 4	125					protein folding (GO:0006457)|response to heat (GO:0009408)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|unfolded protein binding (GO:0051082)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						CTGAAGAAATGGAAATAGATG	0.453																																						dbGAP											0													167.0	167.0	167.0					1																	78478898		2203	4300	6503	-	-	-	SO:0001583	missense	0			U40992	CCDS684.1	1p31.1	2011-09-02			ENSG00000162616	ENSG00000162616		"""Heat shock proteins / DNAJ (HSP40)"""	14886	protein-coding gene	gene with protein product		611327				9546042, 11147971	Standard	NM_007034		Approved	HLJ1	uc001dij.3	Q9UDY4	OTTHUMG00000040905	ENST00000370763.5:c.375G>A	1.37:g.78478898G>A	ENSP00000359799:p.Met125Ile		B2R824|Q13431	Missense_Mutation	SNP	pfam_DnaJ_C,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_HSP40/DnaJ_pept-bd,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.M125I	ENST00000370763.5	37	c.375	CCDS684.1	1	.	.	.	.	.	.	.	.	.	.	G	16.85	3.237280	0.58886	.	.	ENSG00000162616	ENST00000426517;ENST00000370763	T;T	0.63913	-0.07;0.37	5.26	5.26	0.73747	.	0.124512	0.85682	D	0.000000	T	0.45034	0.1322	L	0.49699	1.58	0.80722	D	1	B	0.21606	0.058	B	0.25506	0.061	T	0.44251	-0.9340	10	0.18276	T	0.48	.	18.928	0.92553	0.0:0.0:1.0:0.0	.	125	Q9UDY4	DNJB4_HUMAN	I	125	ENSP00000399494:M125I;ENSP00000359799:M125I	ENSP00000359799:M125I	M	+	3	0	DNAJB4	78251486	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.864000	0.99589	2.439000	0.82584	0.644000	0.83932	ATG	DNAJB4	-	NULL	ENSG00000162616		0.453	DNAJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB4	HGNC	protein_coding	OTTHUMT00000098248.3	337	0.00	0	G			78478898	78478898	+1	no_errors	ENST00000370763	ensembl	human	known	69_37n	missense	246	36.99	145	SNP	1.000	A
DSC2	1824	genome.wustl.edu	37	18	28660146	28660146	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr18:28660146C>T	ENST00000280904.6	-	10	1879	c.1436G>A	c.(1435-1437)cGc>cAc	p.R479H	DSC2_ENST00000251081.6_Missense_Mutation_p.R479H	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	479	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TTCTTTCATGCGAACAGTCTG	0.433																																						dbGAP											0													183.0	158.0	167.0					18																	28660146		2203	4300	6503	-	-	-	SO:0001583	missense	0			X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1436G>A	18.37:g.28660146C>T	ENSP00000280904:p.Arg479His			Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmocollin,prints_Desmo_cadherin	p.R479H	ENST00000280904.6	37	c.1436	CCDS11892.1	18	.	.	.	.	.	.	.	.	.	.	C	12.48	1.949963	0.34377	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.52983	0.64;0.64	5.92	-1.48	0.08745	Cadherin (3);Cadherin-like (1);	0.314430	0.17442	N	0.174074	T	0.40094	0.1103	L	0.49256	1.55	0.09310	N	1	B;B	0.17852	0.014;0.024	B;B	0.17979	0.02;0.011	T	0.40739	-0.9547	10	0.56958	D	0.05	.	12.9349	0.58307	0.0:0.4417:0.0:0.5583	.	479;479	Q02487;Q02487-2	DSC2_HUMAN;.	H	479;479;245;492	ENSP00000251081:R479H;ENSP00000280904:R479H	ENSP00000251081:R479H	R	-	2	0	DSC2	26914144	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.461000	0.06712	-0.330000	0.08514	-0.137000	0.14449	CGC	DSC2	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000134755		0.433	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSC2	HGNC	protein_coding	OTTHUMT00000254943.1	279	0.36	1	C	NM_004949		28660146	28660146	-1	no_errors	ENST00000280904	ensembl	human	known	69_37n	missense	60	63.91	108	SNP	0.000	T
DYNC2H1	79659	genome.wustl.edu	37	11	103106512	103106512	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr11:103106512G>T	ENST00000375735.2	+	62	9823	c.9679G>T	c.(9679-9681)Gaa>Taa	p.E3227*	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Nonsense_Mutation_p.E3227*	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3227					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AACCTGTTTGGAAGAATGGAC	0.348																																						dbGAP											0													91.0	86.0	88.0					11																	103106512		1830	4100	5930	-	-	-	SO:0001587	stop_gained	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.9679G>T	11.37:g.103106512G>T	ENSP00000364887:p.Glu3227*		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Nonsense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.E3227*	ENST00000375735.2	37	c.9679	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	G	51	18.264782	0.99902	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	.	.	.	5.59	5.59	0.84812	.	0.280991	0.39759	N	0.001275	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.6495	0.95795	0.0:0.0:1.0:0.0	.	.	.	.	X	3227	.	ENSP00000364887:E3227X	E	+	1	0	DYNC2H1	102611722	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	6.892000	0.75644	2.643000	0.89663	0.579000	0.79373	GAA	DYNC2H1	-	NULL	ENSG00000187240		0.348	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	213	0.00	0	G	XM_370652		103106512	103106512	+1	no_errors	ENST00000398093	ensembl	human	known	69_37n	nonsense	156	35.54	86	SNP	1.000	T
EPHB6	2051	genome.wustl.edu	37	7	142562162	142562162	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr7:142562162G>T	ENST00000392957.2	+	7	1391	c.604G>T	c.(604-606)Ggg>Tgg	p.G202W	EPHB6_ENST00000411471.2_Intron|EPHB6_ENST00000442129.1_Missense_Mutation_p.G202W	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	202	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					GCGGAGCTTTGGGCCTCTCAC	0.662																																						dbGAP											0													118.0	129.0	125.0					7																	142562162		2203	4299	6502	-	-	-	SO:0001583	missense	0			D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.604G>T	7.37:g.142562162G>T	ENSP00000376684:p.Gly202Trp		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.G202W	ENST00000392957.2	37	c.604	CCDS5873.2	7	.	.	.	.	.	.	.	.	.	.	G	28.7	4.942709	0.92526	.	.	ENSG00000106123	ENST00000392957;ENST00000442129	T;T	0.15487	2.42;2.42	6.08	6.08	0.98989	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.49305	D	0.000155	T	0.49167	0.1541	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.48175	-0.9058	10	0.87932	D	0	.	19.6516	0.95815	0.0:0.0:1.0:0.0	.	202	O15197	EPHB6_HUMAN	W	202	ENSP00000376684:G202W;ENSP00000410789:G202W	ENSP00000376684:G202W	G	+	1	0	EPHB6	142272284	1.000000	0.71417	0.981000	0.43875	0.920000	0.55202	7.826000	0.86716	2.894000	0.99253	0.655000	0.94253	GGG	EPHB6	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom	ENSG00000106123		0.662	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB6	HGNC	protein_coding	OTTHUMT00000341329.1	57	0.00	0	G			142562162	142562162	+1	no_errors	ENST00000392957	ensembl	human	known	69_37n	missense	26	40.00	18	SNP	1.000	T
ESYT1	23344	genome.wustl.edu	37	12	56531336	56531336	+	Silent	SNP	T	T	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr12:56531336T>C	ENST00000394048.5	+	18	2256	c.1992T>C	c.(1990-1992)cgT>cgC	p.R664R	ESYT1_ENST00000541590.1_Silent_p.R674R|ESYT1_ENST00000267113.4_Silent_p.R674R	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	664	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						CCAAAGACCGTTTCTTGGGGG	0.542																																						dbGAP											0													161.0	164.0	163.0					12																	56531336		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.1992T>C	12.37:g.56531336T>C			A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_C2_dom,pfscan_C2_membr_targeting	p.R674	ENST00000394048.5	37	c.2022	CCDS8904.1	12																																																																																			ESYT1	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000139641		0.542	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ESYT1	HGNC	protein_coding	OTTHUMT00000407906.1	205	0.00	0	T	NM_015292		56531336	56531336	+1	no_errors	ENST00000267113	ensembl	human	known	69_37n	silent	154	39.92	103	SNP	0.998	C
F5	2153	genome.wustl.edu	37	1	169484814	169484814	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:169484814C>A	ENST00000367797.3	-	24	6597	c.6396G>T	c.(6394-6396)aaG>aaT	p.K2132N	F5_ENST00000367796.3_Missense_Mutation_p.K2137N	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	2132	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	TTGCCGTTATCTTCTTGATCT	0.388																																						dbGAP											0													132.0	125.0	128.0					1																	169484814		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.6396G>T	1.37:g.169484814C>A	ENSP00000356771:p.Lys2132Asn		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.K2137N	ENST00000367797.3	37	c.6411	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.691723	0.48097	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.98362	-4.89;-4.89	5.61	1.08	0.20341	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.048087	0.85682	D	0.000000	D	0.97204	0.9086	L	0.50993	1.605	0.47037	D	0.999299	D	0.89917	1.0	D	0.85130	0.997	D	0.95788	0.8822	9	0.72032	D	0.01	-17.8388	7.8702	0.29561	0.118:0.6637:0.0:0.2183	.	2132	P12259	FA5_HUMAN	N	2132;2137	ENSP00000356771:K2132N;ENSP00000356770:K2137N	ENSP00000356770:K2137N	K	-	3	2	F5	167751438	1.000000	0.71417	1.000000	0.80357	0.471000	0.32888	2.337000	0.43947	0.316000	0.23135	-0.518000	0.04402	AAG	F5	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000198734		0.388	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	251	0.00	0	C	NM_000130		169484814	169484814	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	missense	430	17.27	90	SNP	1.000	A
FAM167A	83648	genome.wustl.edu	37	8	11301766	11301766	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr8:11301766C>A	ENST00000528897.1	-	2	774	c.155G>T	c.(154-156)aGg>aTg	p.R52M	FAM167A_ENST00000284486.4_Missense_Mutation_p.R52M|FAM167A_ENST00000531564.1_5'Flank|FAM167A_ENST00000534308.1_Missense_Mutation_p.R52M			Q96KS9	F167A_HUMAN	family with sequence similarity 167, member A	52										breast(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)	9						CTCCTCCAGCCTGGCCTGCCA	0.701																																						dbGAP											0													40.0	47.0	44.0					8																	11301766		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5981.1	8p23-p22	2010-08-27	2008-06-11	2008-06-11	ENSG00000154319	ENSG00000154319			15549	protein-coding gene	gene with protein product		610085	"""chromosome 8 open reading frame 13"""	C8orf13			Standard	NM_053279		Approved		uc003wtw.2	Q96KS9	OTTHUMG00000129361	ENST00000528897.1:c.155G>T	8.37:g.11301766C>A	ENSP00000436655:p.Arg52Met		A8K3T9|Q3SXY1|Q3SXY3|Q8N3M3|Q9NSR0	Missense_Mutation	SNP	pfam_FAM167	p.R52M	ENST00000528897.1	37	c.155	CCDS5981.1	8	.	.	.	.	.	.	.	.	.	.	C	20.1	3.934436	0.73442	.	.	ENSG00000154319	ENST00000284486;ENST00000534308;ENST00000528897;ENST00000531804	T;T;T;T	0.08984	3.03;3.03;3.03;3.03	5.07	-0.732	0.11147	.	0.515942	0.21398	N	0.075188	T	0.12561	0.0305	M	0.69823	2.125	0.35809	D	0.823721	P	0.52842	0.956	P	0.46975	0.533	T	0.23904	-1.0175	10	0.87932	D	0	-3.8249	8.9857	0.35992	0.0:0.305:0.0:0.695	.	52	Q96KS9	F167A_HUMAN	M	52	ENSP00000284486:R52M;ENSP00000432232:R52M;ENSP00000436655:R52M;ENSP00000431951:R52M	ENSP00000284486:R52M	R	-	2	0	FAM167A	11339176	1.000000	0.71417	0.990000	0.47175	0.996000	0.88848	1.404000	0.34623	-0.039000	0.13602	0.655000	0.94253	AGG	FAM167A	-	NULL	ENSG00000154319		0.701	FAM167A-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	FAM167A	HGNC	protein_coding	OTTHUMT00000383901.1	20	0.00	0	C			11301766	11301766	-1	no_errors	ENST00000284486	ensembl	human	known	69_37n	missense	11	57.69	15	SNP	0.973	A
FAM180A	389558	genome.wustl.edu	37	7	135433316	135433316	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr7:135433316T>A	ENST00000338588.3	-	1	278	c.13A>T	c.(13-15)Atg>Ttg	p.M5L	FAM180A_ENST00000415751.1_Missense_Mutation_p.M5L|FAM180A_ENST00000435869.1_5'UTR	NM_205855.3	NP_995327.1	Q6UWF9	F180A_HUMAN	family with sequence similarity 180, member A	5						extracellular region (GO:0005576)				endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)	14						AGCAGCAACATCTTCCAATGC	0.483																																						dbGAP											0													203.0	203.0	203.0					7																	135433316		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC091736, AK290250, AK310180, AY358803	CCDS5841.1	7q33	2008-07-25			ENSG00000189320	ENSG00000189320			33773	protein-coding gene	gene with protein product						12975309, 12690205	Standard	NM_205855		Approved	HWKM1940, UNQ1940	uc003vtd.3	Q6UWF9	OTTHUMG00000155537	ENST00000338588.3:c.13A>T	7.37:g.135433316T>A	ENSP00000342336:p.Met5Leu		B2RP85	Missense_Mutation	SNP	NULL	p.M5L	ENST00000338588.3	37	c.13	CCDS5841.1	7	.	.	.	.	.	.	.	.	.	.	T	0.470	-0.884731	0.02530	.	.	ENSG00000189320	ENST00000338588;ENST00000415751	T;T	0.27402	1.67;1.67	5.25	0.303	0.15791	.	0.530450	0.19330	N	0.116907	T	0.15132	0.0365	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.17289	-1.0374	10	0.35671	T	0.21	-8.1551	7.4307	0.27126	0.0:0.3878:0.0:0.6122	.	5	Q6UWF9	F180A_HUMAN	L	5	ENSP00000342336:M5L;ENSP00000395467:M5L	ENSP00000342336:M5L	M	-	1	0	FAM180A	135083856	0.986000	0.35501	0.017000	0.16124	0.012000	0.07955	0.449000	0.21744	-0.102000	0.12197	-0.269000	0.10298	ATG	FAM180A	-	NULL	ENSG00000189320		0.483	FAM180A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM180A	HGNC	protein_coding	OTTHUMT00000340554.2	384	0.00	0	T	NM_205855		135433316	135433316	-1	no_errors	ENST00000338588	ensembl	human	known	69_37n	missense	261	36.25	149	SNP	0.440	A
NUTM2B	729262	genome.wustl.edu	37	10	81471609	81471609	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr10:81471609A>G	ENST00000429828.1	+	7	2388	c.2005A>G	c.(2005-2007)Atg>Gtg	p.M669V	RP11-119F19.2_ENST00000601369.1_RNA|RP11-119F19.2_ENST00000596088.1_RNA|RP11-119F19.2_ENST00000600376.1_RNA|NUTM2B_ENST00000372321.1_Intron|NUTM2B_ENST00000448135.1_Intron	NM_001278495.1	NP_001265424.1	A6NNL0	NTM2B_HUMAN	NUT family member 2B	669																	AGGGGTTGGCATGGAAACCTG	0.597																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS60574.1	10q22.3	2014-08-13	2013-03-14	2013-03-14	ENSG00000188199	ENSG00000188199			23445	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member B"""	FAM22B			Standard	NM_001278495		Approved	bA119F19.1		A6NNL0	OTTHUMG00000018572	ENST00000429828.1:c.2005A>G	10.37:g.81471609A>G	ENSP00000394623:p.Met669Val		A6NM73	Missense_Mutation	SNP	NULL	p.M669V	ENST00000429828.1	37	c.2005		10	.	.	.	.	.	.	.	.	.	.	a	0.258	-1.001820	0.02128	.	.	ENSG00000188199	ENST00000429828;ENST00000342531	T	0.10960	2.82	1.38	-2.43	0.06522	.	3.050000	0.00851	N	0.001824	T	0.06371	0.0164	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21518	-1.0243	7	0.23891	T	0.37	.	3.7209	0.08456	0.3105:0.4104:0.2791:0.0	.	.	.	.	V	669;412	ENSP00000394623:M669V	ENSP00000344811:M412V	M	+	1	0	FAM22B	81141615	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.683000	0.01934	-1.234000	0.02548	-0.582000	0.04134	ATG	FAM22B	-	NULL	ENSG00000188199		0.597	NUTM2B-201	KNOWN	basic|appris_principal	protein_coding	FAM22B	HGNC	protein_coding		72	0.00	0	A	NG_012780		81471609	81471609	+1	no_errors	ENST00000429828	ensembl	human	known	69_37n	missense	63	16.00	12	SNP	0.000	G
FAT3	120114	genome.wustl.edu	37	11	92531007	92531007	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr11:92531007A>C	ENST00000298047.6	+	9	4845	c.4828A>C	c.(4828-4830)Act>Cct	p.T1610P	FAT3_ENST00000525166.1_Missense_Mutation_p.T1460P|FAT3_ENST00000409404.2_Missense_Mutation_p.T1610P			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1610	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTTAGGGAACACTGGGAACAT	0.398										TCGA Ovarian(4;0.039)																												dbGAP											0													86.0	82.0	83.0					11																	92531007		1941	4143	6084	-	-	-	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.4828A>C	11.37:g.92531007A>C	ENSP00000298047:p.Thr1610Pro		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.T1610P	ENST00000298047.6	37	c.4828		11	.	.	.	.	.	.	.	.	.	.	A	15.47	2.843084	0.51057	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.57273	0.41;0.41;0.41	5.81	5.81	0.92471	.	.	.	.	.	T	0.56262	0.1973	N	0.17474	0.49	0.80722	D	1	D	0.76494	0.999	D	0.67382	0.951	T	0.56709	-0.7934	9	0.32370	T	0.25	.	16.1671	0.81777	1.0:0.0:0.0:0.0	.	1610	Q8TDW7-3	.	P	1610;1610;1460	ENSP00000298047:T1610P;ENSP00000387040:T1610P;ENSP00000432586:T1460P	ENSP00000298047:T1610P	T	+	1	0	FAT3	92170655	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	6.299000	0.72770	2.224000	0.72417	0.528000	0.53228	ACT	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.398	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		171	0.58	1	A	NM_001008781		92531007	92531007	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	missense	119	35.48	66	SNP	1.000	C
FSIP2	401024	genome.wustl.edu	37	2	186670216	186670216	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr2:186670216C>T	ENST00000424728.1	+	17	16183	c.16183C>T	c.(16183-16185)Caa>Taa	p.Q5395*	FSIP2_ENST00000343098.5_Nonsense_Mutation_p.Q5484*			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5395										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						ATTCAGGATTCAACCACTTTT	0.383																																						dbGAP											0													112.0	102.0	105.0					2																	186670216		1864	4096	5960	-	-	-	SO:0001587	stop_gained	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.16183C>T	2.37:g.186670216C>T	ENSP00000401306:p.Gln5395*		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Nonsense_Mutation	SNP	NULL	p.Q5484*	ENST00000424728.1	37	c.16450		2	.	.	.	.	.	.	.	.	.	.	C	56	26.483361	0.99969	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	.	.	.	5.28	4.34	0.51931	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.2135	0.43156	0.2114:0.7886:0.0:0.0	.	.	.	.	X	5484;5395	.	ENSP00000344403:Q5484X	Q	+	1	0	FSIP2	186378461	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	2.102000	0.41796	2.749000	0.94314	0.460000	0.39030	CAA	FSIP2	-	NULL	ENSG00000188738		0.383	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	291	0.00	0	C	NM_173651		186670216	186670216	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	nonsense	213	34.95	115	SNP	1.000	T
FN1	2335	genome.wustl.edu	37	2	216271007	216271007	+	Silent	SNP	C	C	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr2:216271007C>A	ENST00000359671.1	-	19	3205	c.2940G>T	c.(2938-2940)gtG>gtT	p.V980V	FN1_ENST00000336916.4_Silent_p.V980V|FN1_ENST00000346544.3_Silent_p.V980V|FN1_ENST00000323926.6_Silent_p.V980V|FN1_ENST00000357009.2_Silent_p.V980V|FN1_ENST00000421182.1_Silent_p.V980V|FN1_ENST00000345488.5_Silent_p.V980V|FN1_ENST00000357867.4_Silent_p.V980V|FN1_ENST00000446046.1_Silent_p.V980V|FN1_ENST00000443816.1_Silent_p.V980V|FN1_ENST00000356005.4_Silent_p.V980V|FN1_ENST00000354785.4_Silent_p.V980V|FN1_ENST00000432072.2_Silent_p.V980V			P02751	FINC_HUMAN	fibronectin 1	980	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.			V -> L (in Ref. 5; CAD97791). {ECO:0000305}.	acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	TCCCATGGCTCACTGCAAAGA	0.552																																						dbGAP											0													71.0	74.0	73.0					2																	216271007		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.2940G>T	2.37:g.216271007C>A			B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibronectin_type1,pfam_FN_type2_col-bd,superfamily_Kringle-like,superfamily_Fibronectin_type3,smart_Fibronectin_type1,smart_FN_type2_col-bd,smart_Fibronectin_type3,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Fibronectin_type3	p.V980	ENST00000359671.1	37	c.2940		2																																																																																			FN1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000115414		0.552	FN1-204	KNOWN	basic	protein_coding	FN1	HGNC	protein_coding		125	0.00	0	C	NM_212476		216271007	216271007	-1	no_errors	ENST00000354785	ensembl	human	known	69_37n	silent	75	34.78	40	SNP	0.826	A
GCN1L1	10985	genome.wustl.edu	37	12	120591040	120591040	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr12:120591040C>A	ENST00000300648.6	-	33	4051	c.4039G>T	c.(4039-4041)Gcc>Tcc	p.A1347S	MIR4498_ENST00000577599.1_RNA	NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1347					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTGGAGAGGGCAGCGATGAGC	0.597																																						dbGAP											0													66.0	72.0	70.0					12																	120591040		2049	4175	6224	-	-	-	SO:0001583	missense	0			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.4039G>T	12.37:g.120591040C>A	ENSP00000300648:p.Ala1347Ser		A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	pfam_DUF3554,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.A1347S	ENST00000300648.6	37	c.4039	CCDS41847.1	12	.	.	.	.	.	.	.	.	.	.	C	29.1	4.974028	0.92919	.	.	ENSG00000089154	ENST00000300648	T	0.37915	1.17	5.7	5.7	0.88788	Armadillo-like helical (1);Armadillo-type fold (2);	0.055834	0.64402	D	0.000001	T	0.49864	0.1582	L	0.60904	1.88	0.80722	D	1	D	0.55800	0.973	P	0.51945	0.685	T	0.37842	-0.9688	10	0.40728	T	0.16	-18.7154	19.8377	0.96663	0.0:1.0:0.0:0.0	.	1347	Q92616	GCN1L_HUMAN	S	1347	ENSP00000300648:A1347S	ENSP00000300648:A1347S	A	-	1	0	GCN1L1	119075423	1.000000	0.71417	0.985000	0.45067	0.916000	0.54674	5.831000	0.69330	2.711000	0.92665	0.561000	0.74099	GCC	GCN1L1	-	superfamily_ARM-type_fold	ENSG00000089154		0.597	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCN1L1	HGNC	protein_coding	OTTHUMT00000403592.1	19	0.00	0	C			120591040	120591040	-1	no_errors	ENST00000300648	ensembl	human	known	69_37n	missense	9	47.06	8	SNP	1.000	A
GNAS	2778	genome.wustl.edu	37	20	57486002	57486003	+	3'UTR	INS	-	-	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr20:57486002_57486003insC	ENST00000371085.3	+	0	1727_1728				GNAS_ENST00000371102.4_3'UTR|GNAS_ENST00000306090.10_3'UTR|GNAS_ENST00000371100.4_3'UTR|GNAS_ENST00000354359.7_3'UTR|GNAS_ENST00000371095.3_3'UTR|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000265620.7_3'UTR|GNAS_ENST00000371075.3_3'UTR	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus						activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			ACCTTTCCCTTCCCCCGAGTGA	0.396			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	dbGAP		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.*119->C	20.37:g.57486007_57486007dupC			A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	RNA	INS	-	NULL	ENST00000371085.3	37	NULL	CCDS13472.1	20																																																																																			GNAS	-	-	ENSG00000087460		0.396	GNAS-015	KNOWN	basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080431.2	25	0.00	0	-	NM_000516		57486002	57486003	+1	no_errors	ENST00000464624	ensembl	human	known	69_37n	rna	33	10.81	4	INS	0.083:0.111	C
GOLGA4	2803	genome.wustl.edu	37	3	37367243	37367243	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr3:37367243A>G	ENST00000361924.2	+	14	4240	c.3866A>G	c.(3865-3867)aAt>aGt	p.N1289S	GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000356847.4_Missense_Mutation_p.N1311S	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	1289	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AATACACTAAATATTTCTTTT	0.338																																						dbGAP											0													38.0	39.0	39.0					3																	37367243		2172	4293	6465	-	-	-	SO:0001583	missense	0			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.3866A>G	3.37:g.37367243A>G	ENSP00000354486:p.Asn1289Ser		F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,superfamily_t-SNARE,superfamily_Prefoldin,smart_GRIP,pfscan_GRIP	p.N1289S	ENST00000361924.2	37	c.3866	CCDS2666.1	3	.	.	.	.	.	.	.	.	.	.	A	0.116	-1.131853	0.01756	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	T;T;T	0.22134	1.97;1.97;1.97	5.2	-3.53	0.04667	.	0.397673	0.18467	N	0.140346	T	0.12220	0.0297	L	0.48362	1.52	0.09310	N	1	B;B;B;B	0.14438	0.003;0.001;0.001;0.01	B;B;B;B	0.08055	0.003;0.002;0.002;0.003	T	0.40515	-0.9559	10	0.09843	T	0.71	.	6.9794	0.24694	0.2842:0.3536:0.3622:0.0	.	1289;1289;1311;1289	Q13439-3;Q13439-4;F8W8Q7;Q13439	.;.;.;GOGA4_HUMAN	S	1289;1311;1160	ENSP00000354486:N1289S;ENSP00000349305:N1311S;ENSP00000405842:N1160S	ENSP00000349305:N1311S	N	+	2	0	GOLGA4	37342247	0.000000	0.05858	0.030000	0.17652	0.483000	0.33249	-0.374000	0.07484	-0.435000	0.07264	0.460000	0.39030	AAT	GOLGA4	-	NULL	ENSG00000144674		0.338	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGA4	HGNC	protein_coding	OTTHUMT00000253339.2	229	0.00	0	A	NM_002078		37367243	37367243	+1	no_errors	ENST00000361924	ensembl	human	known	69_37n	missense	52	77.82	186	SNP	0.009	G
GPR161	23432	genome.wustl.edu	37	1	168073818	168073818	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:168073818T>C	ENST00000367838.1	-	4	584	c.271A>G	c.(271-273)Agg>Ggg	p.R91G	GPR161_ENST00000546300.1_Intron|GPR161_ENST00000367836.1_Intron|GPR161_ENST00000539777.1_Intron|GPR161_ENST00000537209.1_Missense_Mutation_p.R111G|GPR161_ENST00000271357.5_Missense_Mutation_p.R91G|GPR161_ENST00000361697.2_Missense_Mutation_p.R91G|GPR161_ENST00000367835.1_Missense_Mutation_p.R91G	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	91					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					ATCCATTCCCTGCGGATGGAG	0.557																																						dbGAP											0													179.0	162.0	168.0					1																	168073818		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.271A>G	1.37:g.168073818T>C	ENSP00000356812:p.Arg91Gly		B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.R111G	ENST00000367838.1	37	c.331	CCDS1268.1	1	.	.	.	.	.	.	.	.	.	.	T	11.11	1.542280	0.27563	.	.	ENSG00000143147	ENST00000367838;ENST00000271357;ENST00000367835;ENST00000537209;ENST00000361697	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	5.25	1.18	0.20946	GPCR, rhodopsin-like superfamily (1);	0.050966	0.85682	D	0.000000	T	0.04907	0.0132	N	0.12443	0.215	0.45634	D	0.998569	B;B;B;B	0.16802	0.015;0.019;0.012;0.015	B;B;B;B	0.22152	0.022;0.038;0.006;0.013	T	0.36866	-0.9730	9	0.02654	T	1	-19.9262	12.8152	0.57660	0.0:0.0:0.5276:0.4724	.	111;111;91;91	F5GXD6;B7Z5Z6;Q8N6U8-2;Q8N6U8	.;.;.;GP161_HUMAN	G	91;91;91;111;91	ENSP00000356812:R91G;ENSP00000271357:R91G;ENSP00000356809:R91G;ENSP00000441039:R111G;ENSP00000355194:R91G	ENSP00000271357:R91G	R	-	1	2	GPR161	166340442	0.967000	0.33354	0.771000	0.31576	0.868000	0.49771	0.729000	0.26028	0.798000	0.33994	0.459000	0.35465	AGG	GPR161	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000143147		0.557	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR161	HGNC	protein_coding	OTTHUMT00000083829.1	112	0.00	0	T	NM_007369		168073818	168073818	-1	no_errors	ENST00000537209	ensembl	human	known	69_37n	missense	153	17.65	33	SNP	0.956	C
HECTD4	283450	genome.wustl.edu	37	12	112622033	112622034	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr12:112622033_112622034insAA	ENST00000430131.2	-	60	10615_10616	c.9470_9471insTT	c.(9469-9471)cagfs	p.Q3157fs	HECTD4_ENST00000377560.5_Frame_Shift_Ins_p.Q3407fs|HECTD4_ENST00000550722.1_Frame_Shift_Ins_p.Q3433fs			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3157					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CGGCGAGGGGCTGGTTGTCCAG	0.609																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.9470_9471insTT	12.37:g.112622033_112622034insAA	ENSP00000404379:p.Gln3157fs		L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Frame_Shift_Ins	INS	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl,smart_HECT,pfscan_HECT	p.Q3407fs	ENST00000430131.2	37	c.10221_10220		12																																																																																			HECTD4	-	NULL	ENSG00000173064		0.609	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		34	0.00	0	-	NM_173813		112622033	112622034	-1	no_errors	ENST00000377560	ensembl	human	known	69_37n	frame_shift_ins	20	44.44	16	INS	1.000:1.000	AA
HGSNAT	138050	genome.wustl.edu	37	8	43054635	43054635	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr8:43054635C>A	ENST00000458501.2	+	18	1915	c.1915C>A	c.(1915-1917)Cag>Aag	p.Q639K	HGSNAT_ENST00000521576.1_Missense_Mutation_p.Q328K|HGSNAT_ENST00000297798.7_Missense_Mutation_p.Q343K|HGSNAT_ENST00000379644.4_Missense_Mutation_p.Q611K			Q68CP4	HGNAT_HUMAN	heparan-alpha-glucosaminide N-acetyltransferase	639					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lysosomal transport (GO:0007041)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	heparan-alpha-glucosaminide N-acetyltransferase activity (GO:0015019)|transferase activity, transferring acyl groups (GO:0016746)			cervix(1)|endometrium(2)|large_intestine(4)|lung(6)	13	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			GCACCTGACTCAGAACATCGT	0.493																																						dbGAP											0													57.0	57.0	57.0					8																	43054635		2201	4299	6500	-	-	-	SO:0001583	missense	0				CCDS47852.1	8p11.1	2011-11-16	2006-09-05	2006-08-16	ENSG00000165102	ENSG00000165102	2.3.1.78		26527	protein-coding gene	gene with protein product		610453	"""transmembrane protein 76"""	TMEM76		17033958, 16960811	Standard	NM_152419		Approved	FLJ32731, HGNAT	uc003xpx.4	Q68CP4	OTTHUMG00000164102	ENST00000458501.2:c.1915C>A	8.37:g.43054635C>A	ENSP00000389524:p.Gln639Lys		B4E2V0	Missense_Mutation	SNP	pfam_DUF1624	p.Q639K	ENST00000458501.2	37	c.1915		8	.	.	.	.	.	.	.	.	.	.	C	12.72	2.021166	0.35701	.	.	ENSG00000165102	ENST00000458501;ENST00000379644;ENST00000521576;ENST00000297798	T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.71854	0.3389	M	0.80982	2.52	0.58432	D	0.999999	P	0.41710	0.76	B	0.38264	0.269	T	0.73294	-0.4028	10	0.29301	T	0.29	-14.0341	16.4286	0.83832	0.0:1.0:0.0:0.0	.	639	Q68CP4	HGNAT_HUMAN	K	639;611;328;343	ENSP00000389524:Q639K;ENSP00000368965:Q611K;ENSP00000429029:Q328K;ENSP00000297798:Q343K	ENSP00000297798:Q343K	Q	+	1	0	HGSNAT	43173792	1.000000	0.71417	0.921000	0.36526	0.023000	0.10783	7.319000	0.79040	2.455000	0.83008	0.563000	0.77884	CAG	HGSNAT	-	NULL	ENSG00000165102		0.493	HGSNAT-202	KNOWN	basic	protein_coding	HGSNAT	HGNC	protein_coding		80	0.00	0	C	XM_372038		43054635	43054635	+1	no_errors	ENST00000458501	ensembl	human	known	69_37n	missense	51	34.62	27	SNP	0.999	A
HIST1H2AI	8329	genome.wustl.edu	37	6	27776369	27776369	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr6:27776369A>T	ENST00000358739.3	+	1	471	c.382A>T	c.(382-384)Aag>Tag	p.K128*	HIST1H3H_ENST00000369163.2_5'Flank|HIST1H2BL_ENST00000377401.2_5'Flank	NM_003509.2	NP_003500.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ai	128						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			lung(3)	3						CCACAAGGCGAAGGGCAAGTA	0.532																																						dbGAP											0													60.0	61.0	61.0					6																	27776369		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			Z83742	CCDS4626.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000196747	ENSG00000196747		"""Histones / Replication-dependent"""	4725	protein-coding gene	gene with protein product		602787	"""H2A histone family, member C"", ""histone 1, H2ai"""	H2AFC		9439656, 12408966	Standard	NM_003509		Approved	H2A/c		P0C0S8	OTTHUMG00000014484	ENST00000358739.3:c.382A>T	6.37:g.27776369A>T	ENSP00000351589:p.Lys128*		P02261|Q2M1R2|Q76PA6	Nonsense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.K128*	ENST00000358739.3	37	c.382	CCDS4626.1	6	.	.	.	.	.	.	.	.	.	.	.	28.2	4.899509	0.91962	.	.	ENSG00000196747	ENST00000358739	.	.	.	4.67	4.67	0.58626	.	0.000000	0.41938	D	0.000781	.	.	.	.	.	.	0.28470	N	0.915448	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9951	0.64392	1.0:0.0:0.0:0.0	.	.	.	.	X	128	.	ENSP00000351589:K128X	K	+	1	0	HIST1H2AI	27884348	0.964000	0.33143	0.778000	0.31720	0.917000	0.54804	4.276000	0.58933	2.038000	0.60285	0.459000	0.35465	AAG	HIST1H2AI	-	NULL	ENSG00000196747		0.532	HIST1H2AI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AI	HGNC	protein_coding	OTTHUMT00000040152.1	69	0.00	0	A	NM_003509		27776369	27776369	+1	no_errors	ENST00000358739	ensembl	human	known	69_37n	nonsense	50	40.70	35	SNP	1.000	T
HLA-G	3135	genome.wustl.edu	37	6	29797223	29797223	+	Missense_Mutation	SNP	C	C	A	rs200736395		TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr6:29797223C>A	ENST00000360323.6	+	4	672	c.648C>A	c.(646-648)caC>caA	p.H216Q	HLA-G_ENST00000428701.1_Missense_Mutation_p.H216Q|HLA-G_ENST00000376815.3_Intron|HLA-G_ENST00000376818.3_Missense_Mutation_p.H124Q|HLA-G_ENST00000376828.2_Missense_Mutation_p.H221Q			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	216	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						TGACCCACCACCCTGTCTTTG	0.577																																						dbGAP											0													101.0	106.0	105.0					6																	29797223		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.648C>A	6.37:g.29797223C>A	ENSP00000353472:p.His216Gln			Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.H221Q	ENST00000360323.6	37	c.663	CCDS4668.1	6	.	.	.	.	.	.	.	.	.	.	.	8.014	0.758129	0.15846	.	.	ENSG00000204632	ENST00000376828;ENST00000428701;ENST00000360323;ENST00000376818	T;T;T;T	0.14022	2.54;2.54;2.54;5.74	1.72	1.72	0.24424	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.354493	0.19961	U	0.102219	T	0.21267	0.0512	M	0.84511	2.7	0.09310	N	1	B;D;B	0.71674	0.286;0.998;0.082	B;D;B	0.68353	0.213;0.957;0.04	T	0.01715	-1.1289	10	0.87932	D	0	.	6.8578	0.24050	0.0:1.0:0.0:0.0	.	221;124;216	Q5RJ85;Q31611;P17693	.;.;HLAG_HUMAN	Q	221;216;216;124	ENSP00000366024:H221Q;ENSP00000412927:H216Q;ENSP00000353472:H216Q;ENSP00000366014:H124Q	ENSP00000353472:H216Q	H	+	3	2	HLA-G	29905202	0.040000	0.19996	0.066000	0.19879	0.009000	0.06853	0.593000	0.23999	0.952000	0.37798	0.298000	0.19748	CAC	HLA-G	-	pfscan_Ig-like	ENSG00000204632		0.577	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-G	HGNC	protein_coding	OTTHUMT00000076286.2	181	0.00	0	C	NM_002127		29797223	29797223	+1	no_errors	ENST00000376828	ensembl	human	known	69_37n	missense	130	34.16	69	SNP	0.038	A
HOXA3	3200	genome.wustl.edu	37	7	27148052	27148053	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr7:27148052_27148053insG	ENST00000396352.4	-	3	1012_1013	c.813_814insC	c.(811-816)cccggafs	p.G272fs	HOXA-AS2_ENST00000518088.1_RNA|HOXA3_ENST00000317201.2_Frame_Shift_Ins_p.G272fs|HOXA3_ENST00000521401.1_5'Flank	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	272					angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						CCACCGGCTCCGGGGGGCACGG	0.619																																					Esophageal Squamous(136;1368 1743 5685 7935 50360)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.814dupC	7.37:g.27148058_27148058dupG	ENSP00000379640:p.Gly272fs		A4D181	Frame_Shift_Ins	INS	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.G271fs	ENST00000396352.4	37	c.814_813	CCDS5404.1	7																																																																																			HOXA3	-	NULL	ENSG00000105997		0.619	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA3	HGNC	protein_coding	OTTHUMT00000358708.2	54	0.00	0	-			27148052	27148053	-1	no_errors	ENST00000317201	ensembl	human	known	69_37n	frame_shift_ins	43	10.42	5	INS	1.000:0.001	G
HRNR	388697	genome.wustl.edu	37	1	152188961	152188961	+	Missense_Mutation	SNP	C	C	T	rs76879172	byFrequency	TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:152188961C>T	ENST00000368801.2	-	3	5219	c.5144G>A	c.(5143-5145)cGc>cAc	p.R1715H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1715					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGTCGGCCGCGGCTAGGGGA	0.647																																						dbGAP											0													7.0	3.0	4.0					1																	152188961		1110	2292	3402	-	-	-	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5144G>A	1.37:g.152188961C>T	ENSP00000357791:p.Arg1715His		Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.R1715H	ENST00000368801.2	37	c.5144	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	C	1.262	-0.615454	0.03663	.	.	ENSG00000197915	ENST00000368801	T	0.01599	4.74	2.32	-4.63	0.03359	.	.	.	.	.	T	0.00356	0.0011	L	0.34521	1.04	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46428	-0.9192	9	0.21540	T	0.41	.	1.2928	0.02063	0.2591:0.3289:0.2605:0.1515	.	1715	Q86YZ3	HORN_HUMAN	H	1715	ENSP00000357791:R1715H	ENSP00000357791:R1715H	R	-	2	0	HRNR	150455585	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-7.777000	0.00030	-2.947000	0.00295	-1.735000	0.00691	CGC	HRNR	-	NULL	ENSG00000197915		0.647	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	32	0.00	0	C	XM_373868		152188961	152188961	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	missense	69	17.86	15	SNP	0.000	T
HYDIN	54768	genome.wustl.edu	37	16	70942229	70942229	+	Silent	SNP	G	G	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr16:70942229G>A	ENST00000393567.2	-	49	8472	c.8322C>T	c.(8320-8322)atC>atT	p.I2774I		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2774					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				AAGTTCCTAGGATCTCAAAGT	0.468																																						dbGAP											0													15.0	14.0	15.0					16																	70942229		1782	4031	5813	-	-	-	SO:0001819	synonymous_variant	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.8322C>T	16.37:g.70942229G>A			A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	superfamily_PapD-like	p.I2773	ENST00000393567.2	37	c.8319	CCDS59269.1	16																																																																																			HYDIN	-	NULL	ENSG00000157423		0.468	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	41	0.00	0	G			70942229	70942229	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	silent	79	15.96	15	SNP	0.997	A
INTS12	57117	genome.wustl.edu	37	4	106613283	106613283	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr4:106613283C>T	ENST00000451321.2	-	5	986	c.507G>A	c.(505-507)atG>atA	p.M169I	INTS12_ENST00000340139.5_Missense_Mutation_p.M169I|INTS12_ENST00000394735.1_Missense_Mutation_p.M169I	NM_001142471.1	NP_001135943.1	Q96CB8	INT12_HUMAN	integrator complex subunit 12	169					snRNA processing (GO:0016180)	integrator complex (GO:0032039)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(123;5.12e-07)		CAGATGCCACCATCATTTGCC	0.418																																						dbGAP											0													72.0	61.0	65.0					4																	106613283		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3671.1	4q24	2013-01-28	2006-03-15	2006-03-15	ENSG00000138785	ENSG00000138785		"""Zinc fingers, PHD-type"""	25067	protein-coding gene	gene with protein product	"""hypothetical nuclear factor SBBI22"""	611355	"""PHD finger protein 22"""	PHF22		16239144	Standard	NM_020395		Approved	SBBI22, INT12	uc010ilr.3	Q96CB8	OTTHUMG00000131215	ENST00000451321.2:c.507G>A	4.37:g.106613283C>T	ENSP00000415433:p.Met169Ile		B2RC48|Q3B6Z3|Q9HD71	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.M169I	ENST00000451321.2	37	c.507	CCDS3671.1	4	.	.	.	.	.	.	.	.	.	.	C	11.59	1.683641	0.29872	.	.	ENSG00000138785	ENST00000394735;ENST00000340139;ENST00000451321	D;D;D	0.86865	-2.18;-2.18;-2.18	5.46	-10.9	0.00192	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.046622	0.85682	D	0.000000	T	0.62551	0.2437	N	0.14661	0.345	0.09310	N	0.999996	B	0.10296	0.003	B	0.10450	0.005	T	0.54833	-0.8234	10	0.21540	T	0.41	-7.569	3.2655	0.06864	0.1994:0.4288:0.1912:0.1805	.	169	Q96CB8	INT12_HUMAN	I	169	ENSP00000378221:M169I;ENSP00000340737:M169I;ENSP00000415433:M169I	ENSP00000340737:M169I	M	-	3	0	INTS12	106832732	0.000000	0.05858	0.422000	0.26621	0.957000	0.61999	-2.774000	0.00777	-2.390000	0.00586	-0.868000	0.02995	ATG	INTS12	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000138785		0.418	INTS12-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	INTS12	HGNC	protein_coding	OTTHUMT00000318624.1	115	0.00	0	C	NM_020395		106613283	106613283	-1	no_errors	ENST00000340139	ensembl	human	known	69_37n	missense	22	69.86	51	SNP	0.002	T
KCNK10	54207	genome.wustl.edu	37	14	88729861	88729861	+	Silent	SNP	G	G	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr14:88729861G>C	ENST00000340700.5	-	2	523	c.72C>G	c.(70-72)ccC>ccG	p.P24P	KCNK10_ENST00000312350.5_Silent_p.P29P|KCNK10_ENST00000319231.5_Silent_p.P29P	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	24					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						TGGCGCTCTTGGGCTGGCACA	0.582																																						dbGAP											0													33.0	39.0	37.0					14																	88729861		2200	4296	6496	-	-	-	SO:0001819	synonymous_variant	0			AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.72C>G	14.37:g.88729861G>C			B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Silent	SNP	pfam_Ion_trans_2,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.P29	ENST00000340700.5	37	c.87	CCDS9880.1	14																																																																																			KCNK10	-	prints_2pore_dom_K_chnl_TREK	ENSG00000100433		0.582	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK10	HGNC	protein_coding	OTTHUMT00000410167.1	45	0.00	0	G	NM_021161		88729861	88729861	-1	no_errors	ENST00000312350	ensembl	human	known	69_37n	silent	9	76.32	29	SNP	1.000	C
KIAA1109	84162	genome.wustl.edu	37	4	123151230	123151230	+	Silent	SNP	C	C	A	rs374730216		TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr4:123151230C>A	ENST00000264501.4	+	26	3560	c.3187C>A	c.(3187-3189)Cgg>Agg	p.R1063R	KIAA1109_ENST00000495260.1_3'UTR|KIAA1109_ENST00000455637.1_Silent_p.R1063R|KIAA1109_ENST00000388738.3_Silent_p.R1063R			Q2LD37	K1109_HUMAN	KIAA1109	1063					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TGCAGTGCTACGGAGGGCCTA	0.433																																						dbGAP											0													92.0	92.0	92.0					4																	123151230		1888	4116	6004	-	-	-	SO:0001819	synonymous_variant	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.3187C>A	4.37:g.123151230C>A			Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	pfam_MMADHC	p.T894K	ENST00000264501.4	37	c.2681	CCDS43267.1	4	.	.	.	.	.	.	.	.	.	.	C	7.984	0.751832	0.15778	.	.	ENSG00000138688	ENST00000424425	.	.	.	5.59	3.86	0.44501	.	.	.	.	.	T	0.69949	0.3168	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67868	-0.5559	4	.	.	.	.	14.7276	0.69357	0.3945:0.6055:0.0:0.0	.	.	.	.	K	894	.	.	T	+	2	0	KIAA1109	123370680	0.910000	0.30920	0.653000	0.29593	0.964000	0.63967	1.917000	0.39996	0.708000	0.31955	-0.133000	0.14855	ACG	KIAA1109	-	NULL	ENSG00000138688		0.433	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	149	0.00	0	C	NM_020797		123151230	123151230	+1	no_start_codon:pseudogene	ENST00000424425	ensembl	human	novel	69_37n	missense	117	34.27	61	SNP	0.983	A
KIAA1958	158405	genome.wustl.edu	37	9	115337155	115337155	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr9:115337155C>A	ENST00000337530.6	+	2	1091	c.795C>A	c.(793-795)gaC>gaA	p.D265E	KIAA1958_ENST00000374244.3_Missense_Mutation_p.D265E|KIAA1958_ENST00000536272.1_Missense_Mutation_p.D265E	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	265										endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						CGGAGCTAGACCCACACGGTA	0.542																																						dbGAP											0													241.0	213.0	222.0					9																	115337155		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.795C>A	9.37:g.115337155C>A	ENSP00000336940:p.Asp265Glu		B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Missense_Mutation	SNP	pfam_DUF3504,superfamily_Integrase_Lambda-type_N	p.D265E	ENST00000337530.6	37	c.795	CCDS35108.1	9	.	.	.	.	.	.	.	.	.	.	C	9.829	1.187809	0.21954	.	.	ENSG00000165185	ENST00000337530;ENST00000374244;ENST00000536272	T;T;T	0.41758	0.99;0.99;0.99	6.07	4.22	0.49857	.	0.067648	0.64402	D	0.000011	T	0.19087	0.0458	N	0.08118	0	0.39466	D	0.967655	B;B	0.14012	0.009;0.004	B;B	0.14578	0.011;0.007	T	0.08680	-1.0710	10	0.25106	T	0.35	-10.9977	4.7308	0.12964	0.1222:0.6278:0.1185:0.1314	.	265;265	B7ZKW6;Q8N8K9	.;K1958_HUMAN	E	265	ENSP00000336940:D265E;ENSP00000363362:D265E;ENSP00000440504:D265E	ENSP00000336940:D265E	D	+	3	2	KIAA1958	114376976	0.627000	0.27129	1.000000	0.80357	0.998000	0.95712	0.118000	0.15605	1.577000	0.49804	0.655000	0.94253	GAC	KIAA1958	-	NULL	ENSG00000165185		0.542	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	KIAA1958	HGNC	protein_coding	OTTHUMT00000053690.1	373	0.00	0	C	NM_133465		115337155	115337155	+1	no_errors	ENST00000536272	ensembl	human	known	69_37n	missense	441	44.53	354	SNP	0.999	A
KIR3DL1	3811	genome.wustl.edu	37	19	55325383	55325383	+	Intron	SNP	T	T	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr19:55325383T>A	ENST00000538269.1	+	2	61				KIR3DL1_ENST00000391728.4_5'Flank|KIR3DL1_ENST00000358178.4_5'Flank|KIR3DL1_ENST00000326542.7_5'Flank|KIR2DL4_ENST00000345540.5_Silent_p.S282S|KIR2DL4_ENST00000463062.1_3'UTR|KIR2DL4_ENST00000396293.1_Silent_p.S170S|KIR2DL4_ENST00000346587.4_Silent_p.S187S|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000359085.4_3'UTR|KIR3DL1_ENST00000541392.1_Intron|KIR2DL4_ENST00000396284.2_Silent_p.S337S|KIR2DL4_ENST00000357494.4_Silent_p.S265S			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		CTGGCCCTTCTCAGAGGAGCA	0.512																																						dbGAP											0													14.0	22.0	19.0					19																	55325383		1578	3634	5212	-	-	-	SO:0001627	intron_variant	0			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-3606T>A	19.37:g.55325383T>A			O43473|Q14946|Q16541	Silent	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.S337	ENST00000538269.1	37	c.1011		19																																																																																			KIR2DL4	-	NULL	ENSG00000189013		0.512	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	KIR2DL4	HGNC	protein_coding		227	0.00	0	T	NM_013289		55325383	55325383	+1	no_errors	ENST00000396284	ensembl	human	known	69_37n	silent	183	38.05	113	SNP	0.003	A
L1CAM	3897	genome.wustl.edu	37	X	153128304	153128304	+	Silent	SNP	G	G	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chrX:153128304G>A	ENST00000370060.1	-	29	3777	c.3588C>T	c.(3586-3588)aaC>aaT	p.N1196N	L1CAM_ENST00000370057.3_Silent_p.N1196N|L1CAM_ENST00000361699.4_Silent_p.N1192N|L1CAM_ENST00000361981.3_Silent_p.N1187N|L1CAM_ENST00000538883.1_Silent_p.N1194N|L1CAM_ENST00000370055.1_Silent_p.N1187N|L1CAM_ENST00000543994.1_Silent_p.N1198N	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	1196					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGATGTCCCCGTTGAGCGATG	0.612																																						dbGAP											0													65.0	48.0	54.0					X																	153128304		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.3588C>T	X.37:g.153128304G>A			A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.N1198	ENST00000370060.1	37	c.3594	CCDS14733.1	X																																																																																			L1CAM	-	NULL	ENSG00000198910		0.612	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	L1CAM	HGNC	protein_coding	OTTHUMT00000061094.2	22	0.00	0	G	NM_024003		153128304	153128304	-1	no_errors	ENST00000543994	ensembl	human	known	69_37n	silent	15	31.82	7	SNP	0.796	A
MALAT1	378938	genome.wustl.edu	37	11	65268662	65268662	+	lincRNA	SNP	G	G	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr11:65268662G>A	ENST00000534336.1	+	0	3430				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		GTAGAGTTTGGATGTGTAACT	0.383																																						dbGAP											0													46.0	52.0	50.0					11																	65268662		874	1988	2862	-	-	-			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65268662G>A				RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.383	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	64	0.00	0	G	NR_002819		65268662	65268662	+1	no_errors	ENST00000534336	ensembl	human	known	69_37n	rna	51	37.80	31	SNP	0.002	A
MCOLN3	55283	genome.wustl.edu	37	1	85506801	85506801	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:85506801T>C	ENST00000370589.2	-	3	340	c.288A>G	c.(286-288)atA>atG	p.I96M	WDR63_ENST00000370596.1_Intron|MCOLN3_ENST00000370587.1_Missense_Mutation_p.I96M|MCOLN3_ENST00000341115.4_Intron	NM_018298.10	NP_060768.8	Q8TDD5	MCLN3_HUMAN	mucolipin 3	96					auditory receptor cell differentiation (GO:0042491)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|locomotory behavior (GO:0007626)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(6)|kidney(3)|large_intestine(9)|lung(12)|prostate(3)|skin(1)	34				all cancers(265;0.00957)|Epithelial(280;0.0254)		GTTTGAATGCTATAGTATTCT	0.378																																						dbGAP											0													169.0	150.0	156.0					1																	85506801		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF475085	CCDS701.1, CCDS58009.1	1p22.3	2011-12-16			ENSG00000055732	ENSG00000055732		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13358	protein-coding gene	gene with protein product		607400				16382100	Standard	NM_018298		Approved	TRPML3, FLJ11006, TRP-ML3	uc001dkp.3	Q8TDD5	OTTHUMG00000009955	ENST00000370589.2:c.288A>G	1.37:g.85506801T>C	ENSP00000359621:p.Ile96Met		Q5T4H5|Q5T4H6|Q9NV09	Missense_Mutation	SNP	pfam_PKD1_2_channel	p.I96M	ENST00000370589.2	37	c.288	CCDS701.1	1	.	.	.	.	.	.	.	.	.	.	T	5.183	0.219362	0.09863	.	.	ENSG00000055732	ENST00000370589;ENST00000302814;ENST00000370587	T;T	0.53640	0.61;0.61	5.76	0.41	0.16387	.	0.291186	0.42420	D	0.000718	T	0.11367	0.0277	N	0.25789	0.76	0.80722	D	1	B;B	0.14805	0.011;0.004	B;B	0.17979	0.02;0.008	T	0.10154	-1.0642	10	0.30854	T	0.27	0.2055	1.2982	0.02074	0.3441:0.1289:0.1087:0.4182	.	96;96	B1ANB7;Q8TDD5	.;MCLN3_HUMAN	M	96	ENSP00000359621:I96M;ENSP00000359619:I96M	ENSP00000304843:I96M	I	-	3	3	MCOLN3	85279389	0.999000	0.42202	0.861000	0.33841	0.396000	0.30629	0.582000	0.23834	0.078000	0.16900	-0.274000	0.10170	ATA	MCOLN3	-	NULL	ENSG00000055732		0.378	MCOLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCOLN3	HGNC	protein_coding	OTTHUMT00000027569.2	224	0.00	0	T	NM_018298		85506801	85506801	-1	no_errors	ENST00000302814	ensembl	human	known	69_37n	missense	46	69.54	105	SNP	0.933	C
MARK1	4139	genome.wustl.edu	37	1	220825377	220825377	+	Missense_Mutation	SNP	G	G	A	rs79027592	byFrequency	TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:220825377G>A	ENST00000366917.4	+	15	1887	c.1621G>A	c.(1621-1623)Gcc>Acc	p.A541T	MARK1_ENST00000366918.4_Missense_Mutation_p.A519T|MARK1_ENST00000402574.1_Missense_Mutation_p.A406T					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		CTCTTCTGTGGCCTCTGCTGT	0.483																																						dbGAP											0													100.0	93.0	96.0					1																	220825377		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1621G>A	1.37:g.220825377G>A	ENSP00000355884:p.Ala541Thr			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase-assoc_KA1,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A541T	ENST00000366917.4	37	c.1621	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.586294	0.28268	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.32988	1.43;1.43;1.43	5.71	2.41	0.29592	.	0.131094	0.52532	D	0.000063	T	0.20780	0.0500	L	0.38531	1.155	0.09310	N	0.999997	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.0;0.001	T	0.14980	-1.0453	10	0.30854	T	0.27	.	7.9097	0.29782	0.215:0.0:0.6667:0.1183	.	541;406;541;519	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	T	406;519;541	ENSP00000386017:A406T;ENSP00000355885:A519T;ENSP00000355884:A541T	ENSP00000355884:A541T	A	+	1	0	MARK1	218892000	1.000000	0.71417	0.341000	0.25589	0.972000	0.66771	2.717000	0.47227	0.788000	0.33755	-0.251000	0.11542	GCC	MARK1	-	NULL	ENSG00000116141		0.483	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1	123	0.00	0	G			220825377	220825377	+1	no_errors	ENST00000366917	ensembl	human	known	69_37n	missense	85	23.42	26	SNP	0.052	A
MED12	9968	genome.wustl.edu	37	X	70339989	70339989	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chrX:70339989G>T	ENST00000374080.3	+	4	554	c.522G>T	c.(520-522)aaG>aaT	p.K174N	MED12_ENST00000374102.1_Missense_Mutation_p.K174N|MED12_ENST00000333646.6_Missense_Mutation_p.K174N			Q93074	MED12_HUMAN	mediator complex subunit 12	174					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CTGAGACCAAGGTTAAGAAGA	0.488			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													118.0	111.0	113.0					X																	70339989		2042	4167	6209	-	-	-	SO:0001583	missense	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.522G>T	X.37:g.70339989G>T	ENSP00000363193:p.Lys174Asn		O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.K174N	ENST00000374080.3	37	c.522	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	.	15.86	2.956813	0.53293	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.62232	0.04;0.05;0.05;0.06	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.78679	0.4321	M	0.76170	2.325	0.50313	D	0.999864	B;D;B;B	0.71674	0.066;0.998;0.095;0.105	B;D;B;B	0.76071	0.048;0.987;0.079;0.037	T	0.81581	-0.0867	10	0.87932	D	0	-19.6858	15.7853	0.78297	0.0:0.0:1.0:0.0	.	174;21;174;174	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	N	174;174;174;174;142	ENSP00000333125:K174N;ENSP00000363215:K174N;ENSP00000363193:K174N;ENSP00000414203:K142N	ENSP00000333125:K174N	K	+	3	2	MED12	70256714	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.018000	0.57174	2.348000	0.79779	0.600000	0.82982	AAG	MED12	-	NULL	ENSG00000184634		0.488	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	230	0.00	0	G	NM_005120		70339989	70339989	+1	no_errors	ENST00000333646	ensembl	human	known	69_37n	missense	113	24.16	36	SNP	1.000	T
MGAM	8972	genome.wustl.edu	37	7	141708438	141708438	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr7:141708438C>T	ENST00000549489.2	+	3	355	c.260C>T	c.(259-261)tCt>tTt	p.S87F	MGAM_ENST00000475668.2_Missense_Mutation_p.S87F	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	87					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ACTCCTGTTTCTGCTGAATGT	0.468																																						dbGAP											0													93.0	91.0	92.0					7																	141708438		1887	4107	5994	-	-	-	SO:0001583	missense	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.260C>T	7.37:g.141708438C>T	ENSP00000447378:p.Ser87Phe		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.S87F	ENST00000549489.2	37	c.260	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	C	9.838	1.190198	0.21954	.	.	ENSG00000257335	ENST00000465654;ENST00000549489;ENST00000497673;ENST00000475668	T;D;T	0.89746	-0.83;-2.56;0.57	4.18	3.29	0.37713	P-type trefoil (1);	0.969977	0.08428	N	0.947350	T	0.79650	0.4482	N	0.08118	0	0.09310	N	1	P	0.38300	0.626	B	0.39738	0.308	T	0.70927	-0.4739	10	0.59425	D	0.04	.	8.426	0.32729	0.0:0.8926:0.0:0.1074	.	87	O43451	MGA_HUMAN	F	87	ENSP00000419372:S87F;ENSP00000447378:S87F;ENSP00000417103:S87F	ENSP00000373973:S87F	S	+	2	0	MGAM	141354907	0.019000	0.18553	0.049000	0.19019	0.021000	0.10359	1.725000	0.38074	1.324000	0.45282	0.655000	0.94253	TCT	MGAM	-	NULL	ENSG00000257335		0.468	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	162	0.00	0	C			141708438	141708438	+1	no_errors	ENST00000549489	ensembl	human	known	69_37n	missense	101	41.62	72	SNP	0.054	T
MTHFD1	4522	genome.wustl.edu	37	14	64898551	64898551	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr14:64898551T>A	ENST00000545908.1	+	15	1863	c.1634T>A	c.(1633-1635)tTc>tAc	p.F545Y	MTHFD1_ENST00000216605.8_Missense_Mutation_p.F489Y|CTD-2555O16.2_ENST00000556640.1_RNA			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	489	Formyltetrahydrofolate synthetase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	GTGAGAAGGTTCTCTGACATC	0.378																																					Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	dbGAP											0													113.0	104.0	107.0					14																	64898551		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.1634T>A	14.37:g.64898551T>A	ENSP00000438588:p.Phe545Tyr		B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	pfam_Formate_THF_ligase,pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.F545Y	ENST00000545908.1	37	c.1634		14	.	.	.	.	.	.	.	.	.	.	T	33	5.193480	0.94960	.	.	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605;ENST00000555252	T;T;T;T	0.28454	2.46;2.51;2.49;1.61	5.73	5.73	0.89815	.	0.049381	0.85682	D	0.000000	T	0.70842	0.3270	H	0.97440	4.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.996;0.997;0.993	T	0.82325	-0.0513	10	0.87932	D	0	-18.6211	16.3143	0.82909	0.0:0.0:0.0:1.0	.	545;489;489	F5H2F4;P11586;G3V2B8	.;C1TC_HUMAN;.	Y	545;489;545;469	ENSP00000438588:F545Y;ENSP00000450560:F489Y;ENSP00000216605:F545Y;ENSP00000451309:F469Y	ENSP00000216605:F489Y	F	+	2	0	MTHFD1	63968304	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.817000	0.86213	2.313000	0.78055	0.454000	0.30748	TTC	MTHFD1	-	pfam_Formate_THF_ligase	ENSG00000100714		0.378	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	MTHFD1	HGNC	protein_coding	OTTHUMT00000412167.1	159	0.00	0	T			64898551	64898551	+1	no_errors	ENST00000216605	ensembl	human	known	69_37n	missense	33	70.27	78	SNP	1.000	A
MOAP1	64112	genome.wustl.edu	37	14	93650587	93650587	+	Start_Codon_SNP	SNP	T	T	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr14:93650587T>A	ENST00000556883.1	-	2	485	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	TMEM251_ENST00000415050.2_5'Flank|MOAP1_ENST00000298894.4_Start_Codon_SNP_p.M1L|RP11-371E8.4_ENST00000557574.1_5'Flank|TMEM251_ENST00000283534.4_5'Flank			Q96BY2	MOAP1_HUMAN	modulator of apoptosis 1	1					apoptotic signaling pathway (GO:0097190)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of apoptotic process (GO:0043065)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:0001844)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	13		all_cancers(154;0.00528)|Acute lymphoblastic leukemia(33;0.0497)|all_epithelial(191;0.125)|all_neural(303;0.13)		Epithelial(152;0.178)|all cancers(159;0.2)|COAD - Colon adenocarcinoma(157;0.204)		ctcaaagtcatggtgcccgaa	0.498																																						dbGAP											0													68.0	75.0	73.0					14																	93650587		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			BC015044	CCDS9908.1	14q32.12	2012-02-09			ENSG00000165943	ENSG00000165943		"""Paraneoplastic Ma antigens"""	16658	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 4"""	609485				11060313	Standard	NM_022151		Approved	MAP-1, PNMA4	uc001ybj.3	Q96BY2	OTTHUMG00000169184	ENST00000556883.1:c.1A>T	14.37:g.93650587T>A	ENSP00000451594:p.Met1Leu		B2RDF6|Q9H833|Q9HAS1	Missense_Mutation	SNP	NULL	p.M1L	ENST00000556883.1	37	c.1	CCDS9908.1	14	.	.	.	.	.	.	.	.	.	.	T	13.53	2.265533	0.40095	.	.	ENSG00000165943	ENST00000298894;ENST00000556883	T;T	0.13420	2.59;2.59	3.23	0.884	0.19182	.	.	.	.	.	T	0.12178	0.0296	.	.	.	0.20403	N	0.999905	B	0.32203	0.36	B	0.37267	0.245	T	0.31364	-0.9946	8	0.72032	D	0.01	-4.2549	4.9039	0.13788	0.0:0.2616:0.0:0.7384	.	1	Q96BY2	MOAP1_HUMAN	L	1	ENSP00000298894:M1L;ENSP00000451594:M1L	ENSP00000298894:M1L	M	-	1	0	MOAP1	92720340	0.112000	0.22096	0.004000	0.12327	0.006000	0.05464	-0.197000	0.09518	0.191000	0.20236	0.529000	0.55759	ATG	MOAP1	-	NULL	ENSG00000165943		0.498	MOAP1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MOAP1	HGNC	protein_coding	OTTHUMT00000412685.1	79	0.00	0	T		Missense_Mutation	93650587	93650587	-1	no_errors	ENST00000298894	ensembl	human	known	69_37n	missense	10	68.75	22	SNP	0.005	A
MXD1	4084	genome.wustl.edu	37	2	70165321	70165321	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr2:70165321A>C	ENST00000264444.2	+	6	831	c.571A>C	c.(571-573)Agc>Cgc	p.S191R	MXD1_ENST00000540449.1_Missense_Mutation_p.S181R|MXD1_ENST00000465446.1_3'UTR	NM_001202513.1|NM_001202514.1|NM_002357.3	NP_001189442.1|NP_001189443.1|NP_002348.1	Q05195	MAD1_HUMAN	MAX dimerization protein 1	191					cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						CGAGCGGGGCAGCATGCAGAG	0.557																																						dbGAP											0													117.0	111.0	113.0					2																	70165321		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1896.1, CCDS56123.1	2p13-p12	2010-07-07		2005-02-11	ENSG00000059728	ENSG00000059728		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	6761	protein-coding gene	gene with protein product		600021		MAD		7829091	Standard	NM_002357		Approved	MAD1, bHLHc58	uc002sfy.3	Q05195	OTTHUMG00000129646	ENST00000264444.2:c.571A>C	2.37:g.70165321A>C	ENSP00000264444:p.Ser191Arg		B2R6V8|B7ZLI6|D6W5G2|Q6FI41	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.S191R	ENST00000264444.2	37	c.571	CCDS1896.1	2	.	.	.	.	.	.	.	.	.	.	A	29.6	5.016277	0.93404	.	.	ENSG00000059728	ENST00000435990;ENST00000264444;ENST00000540449	T;T;T	0.60797	0.22;0.16;0.28	5.34	5.34	0.76211	.	0.113557	0.85682	D	0.000000	T	0.74756	0.3758	M	0.78456	2.415	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	P;D;D	0.66196	0.852;0.942;0.942	T	0.78523	-0.2171	10	0.87932	D	0	.	14.5724	0.68220	1.0:0.0:0.0:0.0	.	181;190;191	B7ZLI6;B7ZLI7;Q05195	.;.;MAD1_HUMAN	R	159;191;181	ENSP00000410672:S159R;ENSP00000264444:S191R;ENSP00000443935:S181R	ENSP00000264444:S191R	S	+	1	0	MXD1	70018825	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.030000	0.93725	2.367000	0.80283	0.528000	0.53228	AGC	MXD1	-	NULL	ENSG00000059728		0.557	MXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXD1	HGNC	protein_coding	OTTHUMT00000251845.3	71	0.00	0	A	NM_002357		70165321	70165321	+1	no_errors	ENST00000264444	ensembl	human	known	69_37n	missense	39	43.48	30	SNP	1.000	C
NFATC2	4773	genome.wustl.edu	37	20	50092025	50092025	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr20:50092025G>T	ENST00000396009.3	-	4	1724	c.1505C>A	c.(1504-1506)cCc>cAc	p.P502H	NFATC2_ENST00000371564.3_Missense_Mutation_p.P502H|NFATC2_ENST00000610033.1_Missense_Mutation_p.P283H|NFATC2_ENST00000414705.1_Missense_Mutation_p.P482H|NFATC2_ENST00000609507.1_Missense_Mutation_p.P283H|NFATC2_ENST00000609943.1_Missense_Mutation_p.P482H	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	502	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					GGGCTCCAAGGGTATCTCCAG	0.577																																						dbGAP											0													196.0	202.0	200.0					20																	50092025		2203	4300	6503	-	-	-	SO:0001583	missense	0			U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.1505C>A	20.37:g.50092025G>T	ENSP00000379330:p.Pro502His		B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	pfam_RHD,pfam_IPT_TIG_rcpt,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,prints_NFAT,pfscan_RHD	p.P502H	ENST00000396009.3	37	c.1505	CCDS13437.1	20	.	.	.	.	.	.	.	.	.	.	G	27.5	4.836187	0.91117	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000371567;ENST00000414705	T;T;T	0.41400	1.0;1.0;1.0	5.36	5.36	0.76844	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.68659	0.3025	M	0.81802	2.56	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	T	0.73129	-0.4080	10	0.87932	D	0	-14.7006	19.0969	0.93255	0.0:0.0:1.0:0.0	.	482;482;502;502	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	H	502;502;283;482	ENSP00000360619:P502H;ENSP00000379330:P502H;ENSP00000396471:P482H	ENSP00000360619:P502H	P	-	2	0	NFATC2	49525432	1.000000	0.71417	0.912000	0.35992	0.967000	0.64934	9.731000	0.98807	2.496000	0.84212	0.650000	0.86243	CCC	NFATC2	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD	ENSG00000101096		0.577	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFATC2	HGNC	protein_coding	OTTHUMT00000079730.2	119	0.00	0	G	NM_012340		50092025	50092025	-1	no_errors	ENST00000396009	ensembl	human	known	69_37n	missense	169	24.89	56	SNP	1.000	T
NPM3	10360	genome.wustl.edu	37	10	103542241	103542241	+	Silent	SNP	T	T	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr10:103542241T>C	ENST00000370110.5	-	3	340	c.318A>G	c.(316-318)caA>caG	p.Q106Q	NPM3_ENST00000474993.1_5'UTR	NM_006993.2	NP_008924.1	O75607	NPM3_HUMAN	nucleophosmin/nucleoplasmin 3	106					rRNA processing (GO:0006364)|rRNA transcription (GO:0009303)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			large_intestine(3)|lung(1)|skin(1)	5		Colorectal(252;0.122)		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)		TCACCATGGGTTGGCAGGACA	0.572																																						dbGAP											0													137.0	120.0	126.0					10																	103542241		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY049737	CCDS7519.1	10q24.31	2009-08-27	2009-08-27		ENSG00000107833	ENSG00000107833			7931	protein-coding gene	gene with protein product		606456				11722795	Standard	NM_006993		Approved		uc001ktt.3	O75607	OTTHUMG00000018942	ENST00000370110.5:c.318A>G	10.37:g.103542241T>C			Q9UNY6	Silent	SNP	pfam_Nucleoplasmin,superfamily_Nucleoplasmin_core	p.Q106	ENST00000370110.5	37	c.318	CCDS7519.1	10																																																																																			NPM3	-	pfam_Nucleoplasmin,superfamily_Nucleoplasmin_core	ENSG00000107833		0.572	NPM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPM3	HGNC	protein_coding	OTTHUMT00000050003.2	13	0.00	0	T	NM_006993		103542241	103542241	-1	no_errors	ENST00000370110	ensembl	human	known	69_37n	silent	10	54.55	12	SNP	0.865	C
NR3C2	4306	genome.wustl.edu	37	4	149356793	149356793	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr4:149356793C>G	ENST00000358102.3	-	2	1582	c.1220G>C	c.(1219-1221)aGc>aCc	p.S407T	NR3C2_ENST00000511528.1_Missense_Mutation_p.S407T|NR3C2_ENST00000344721.4_Missense_Mutation_p.S407T|NR3C2_ENST00000512865.1_Missense_Mutation_p.S407T|NR3C2_ENST00000355292.3_Missense_Mutation_p.S407T	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	407	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	ACATGAGCTGCTAAAAGCTCC	0.408																																					Melanoma(27;428 957 40335 51025 51111)	dbGAP											0													86.0	90.0	89.0					4																	149356793		2203	4300	6503	-	-	-	SO:0001583	missense	0			M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.1220G>C	4.37:g.149356793C>G	ENSP00000350815:p.Ser407Thr		B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.S407T	ENST00000358102.3	37	c.1220	CCDS3772.1	4	.	.	.	.	.	.	.	.	.	.	C	13.49	2.251526	0.39797	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000512865;ENST00000544252;ENST00000342437;ENST00000511528	D;D;D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.23;-2.23;-2.63	5.16	5.16	0.70880	.	0.157435	0.64402	D	0.000001	T	0.81833	0.4906	N	0.19112	0.55	0.45528	D	0.998483	B;P	0.45078	0.181;0.85	B;B	0.32393	0.046;0.145	T	0.82143	-0.0603	9	.	.	.	.	19.009	0.92865	0.0:1.0:0.0:0.0	.	407;407	B0ZBF5;B0ZBF6	.;.	T	407	ENSP00000341390:S407T;ENSP00000347441:S407T;ENSP00000350815:S407T;ENSP00000423510:S407T;ENSP00000343907:S407T;ENSP00000421481:S407T	.	S	-	2	0	NR3C2	149576243	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	4.485000	0.60279	2.564000	0.86499	0.655000	0.94253	AGC	NR3C2	-	NULL	ENSG00000151623		0.408	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NR3C2	HGNC	protein_coding	OTTHUMT00000364986.1	192	0.00	0	C			149356793	149356793	-1	no_errors	ENST00000355292	ensembl	human	known	69_37n	missense	95	43.11	72	SNP	1.000	G
OR4F17	81099	genome.wustl.edu	37	19	110808	110808	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr19:110808T>A	ENST00000585993.1	+	2	269	c.130T>A	c.(130-132)Tct>Act	p.S44T	OR4F17_ENST00000318050.3_Missense_Mutation_p.S44T			Q8NGA8	O4F17_HUMAN	olfactory receptor, family 4, subfamily F, member 17	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(2)	2		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AACAGTGGTATCTGACTCCCA	0.438																																						dbGAP											0													2.0	1.0	1.0					19																	110808		681	1180	1861	-	-	-	SO:0001583	missense	0			AC005605	CCDS32854.1	19p13.3	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	15381	protein-coding gene	gene with protein product				OR4F19, OR4F11P, OR4F18			Standard	NM_001005240		Approved		uc002loc.1	Q8NGA8		ENST00000585993.1:c.130T>A	19.37:g.110808T>A	ENSP00000467301:p.Ser44Thr		B2RNE8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S44T	ENST00000585993.1	37	c.130	CCDS32854.1	19	.	.	.	.	.	.	.	.	.	.	.	0.210	-1.037117	0.02013	.	.	ENSG00000176695	ENST00000442916;ENST00000318050	T	0.01228	5.14	2.37	1.27	0.21489	GPCR, rhodopsin-like superfamily (1);	0.636305	0.12846	U	0.434384	T	0.01189	0.0039	L	0.38692	1.165	0.09310	N	1	B	0.19817	0.039	B	0.15052	0.012	T	0.49093	-0.8975	10	0.16420	T	0.52	.	3.0515	0.06171	0.2477:0.0:0.2538:0.4985	.	44	Q8NGA8	O4F17_HUMAN	T	92;44	ENSP00000315047:S44T	ENSP00000315047:S44T	S	+	1	0	OR4F17	61808	0.000000	0.05858	0.212000	0.23672	0.470000	0.32858	-1.830000	0.01699	0.295000	0.22570	0.323000	0.21402	TCT	OR4F17	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176695		0.438	OR4F17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F17	HGNC	protein_coding	OTTHUMT00000451410.1	383	0.00	0	T			110808	110808	+1	no_errors	ENST00000318050	ensembl	human	known	69_37n	missense	452	30.57	199	SNP	0.000	A
PGM5	5239	genome.wustl.edu	37	9	71007317	71007317	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr9:71007317G>A	ENST00000396396.1	+	6	1200	c.971G>A	c.(970-972)tGc>tAc	p.C324Y	PGM5_ENST00000604870.2_3'UTR|PGM5_ENST00000396392.1_Missense_Mutation_p.C324Y	NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	324					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						AACCTCTCTTGCATTCCATAT	0.522																																						dbGAP											0													10.0	11.0	11.0					9																	71007317		2129	4239	6368	-	-	-	SO:0001583	missense	0			L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.971G>A	9.37:g.71007317G>A	ENSP00000379678:p.Cys324Tyr		B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_a/b/a-II,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	p.C324Y	ENST00000396396.1	37	c.971	CCDS6622.2	9	.	.	.	.	.	.	.	.	.	.	.	12.10	1.835634	0.32421	.	.	ENSG00000154330	ENST00000396396;ENST00000396392	T;T	0.42131	0.98;0.98	4.69	4.69	0.59074	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);Alpha-D-phosphohexomutase, alpha/beta/alpha domain III (1);	0.167253	0.52532	D	0.000061	T	0.64821	0.2633	M	0.87328	2.875	0.80722	D	1	D	0.58970	0.984	D	0.65323	0.934	T	0.66204	-0.5982	10	0.13108	T	0.6	.	16.3757	0.83387	0.0:0.0:1.0:0.0	.	324	Q15124	PGM5_HUMAN	Y	324	ENSP00000379678:C324Y;ENSP00000379674:C324Y	ENSP00000379674:C324Y	C	+	2	0	PGM5	70197137	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	3.785000	0.55424	2.160000	0.67779	0.555000	0.69702	TGC	PGM5	-	pfam_A-D-PHexomutase_a/b/a-III,superfamily_A-D-PHexomutase_a/b/a-I/II/III	ENSG00000154330		0.522	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PGM5	HGNC	protein_coding	OTTHUMT00000052548.2	65	0.00	0	G	NM_021965		71007317	71007317	+1	no_errors	ENST00000396396	ensembl	human	known	69_37n	missense	44	48.84	42	SNP	1.000	A
POC1B	282809	genome.wustl.edu	37	12	89818992	89818992	+	Silent	SNP	G	G	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr12:89818992G>T	ENST00000313546.3	-	11	1406	c.1278C>A	c.(1276-1278)ctC>ctA	p.L426L	POC1B_ENST00000393179.4_Silent_p.L296L|POC1B_ENST00000541909.1_3'UTR|POC1B_ENST00000378528.2_3'UTR|POC1B_ENST00000549035.1_Silent_p.L384L|POC1B_ENST00000546740.1_5'UTR	NM_172240.2	NP_758440.1	Q8TC44	POC1B_HUMAN	POC1 centriolar protein B	426					cell proliferation (GO:0008283)|cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	14						CAGTCACAGCGAGAGGTATGC	0.443																																						dbGAP											0													256.0	199.0	218.0					12																	89818992		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL832918	CCDS31869.1, CCDS55859.1	12q21.33	2014-05-02	2013-08-21	2010-03-26	ENSG00000139323	ENSG00000139323		"""WD repeat domain containing"""	30836	protein-coding gene	gene with protein product		614784	"""WD repeat domain 51B"", ""POC1 centriolar protein homolog B (Chlamydomonas)"""	WDR51B		19109428	Standard	NM_172240		Approved	TUWD12, FLJ14923		Q8TC44	OTTHUMG00000169944	ENST00000313546.3:c.1278C>A	12.37:g.89818992G>T			G3V1X0	Silent	SNP	pfam_WD40_repeat,pfam_TIF2A_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L426	ENST00000313546.3	37	c.1278	CCDS31869.1	12																																																																																			POC1B	-	NULL	ENSG00000139323		0.443	POC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POC1B	HGNC	protein_coding	OTTHUMT00000406637.1	303	0.00	0	G	NM_172240		89818992	89818992	-1	no_errors	ENST00000313546	ensembl	human	known	69_37n	silent	233	35.46	128	SNP	0.002	T
PPRC1	23082	genome.wustl.edu	37	10	103901076	103901077	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr10:103901076_103901077insC	ENST00000278070.2	+	5	2850_2851	c.2811_2812insC	c.(2812-2814)cccfs	p.P938fs	PPRC1_ENST00000370012.1_5'Flank|PPRC1_ENST00000413464.2_Frame_Shift_Ins_p.P938fs	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	938	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		ATCCTTGCCTGCCCCCCCCACC	0.604																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.2819dupC	10.37:g.103901084_103901084dupC	ENSP00000278070:p.Pro938fs		Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Frame_Shift_Ins	INS	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P940fs	ENST00000278070.2	37	c.2811_2812	CCDS7529.1	10																																																																																			PPRC1	-	NULL	ENSG00000148840		0.604	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPRC1	HGNC	protein_coding	OTTHUMT00000050021.1	54	0.00	0	-	NM_015062		103901076	103901077	+1	no_errors	ENST00000278070	ensembl	human	known	69_37n	frame_shift_ins	77	10.47	9	INS	0.999:0.998	C
PRX	57716	genome.wustl.edu	37	19	40901629	40901629	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr19:40901629C>T	ENST00000324001.7	-	7	2900	c.2630G>A	c.(2629-2631)gGc>gAc	p.G877D	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	877					axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTCTCCCTTGCCCATTTTAGC	0.642																																						dbGAP											0													37.0	45.0	42.0					19																	40901629		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.2630G>A	19.37:g.40901629C>T	ENSP00000326018:p.Gly877Asp		Q9BXL9|Q9HCF2	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.G877D	ENST00000324001.7	37	c.2630	CCDS33028.1	19	.	.	.	.	.	.	.	.	.	.	C	6.646	0.487713	0.12641	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.01068	5.38	4.38	0.653	0.17828	.	0.582497	0.14650	N	0.306671	T	0.02012	0.0063	L	0.29908	0.895	0.09310	N	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.47886	-0.9082	10	0.11182	T	0.66	-4.0262	4.4614	0.11668	0.0:0.4121:0.3211:0.2668	.	877	Q9BXM0	PRAX_HUMAN	D	877	ENSP00000326018:G877D	ENSP00000326018:G877D	G	-	2	0	PRX	45593469	0.038000	0.19896	0.015000	0.15790	0.062000	0.15995	0.041000	0.13927	0.287000	0.22375	0.650000	0.86243	GGC	PRX	-	NULL	ENSG00000105227		0.642	PRX-001	KNOWN	basic|CCDS	protein_coding	PRX	HGNC	protein_coding	OTTHUMT00000462582.1	75	0.00	0	C	NM_020956		40901629	40901629	-1	no_errors	ENST00000324001	ensembl	human	known	69_37n	missense	53	50.93	55	SNP	0.014	T
PSD	5662	genome.wustl.edu	37	10	104165135	104165135	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr10:104165135C>T	ENST00000020673.5	-	12	2820	c.2294G>A	c.(2293-2295)cGa>cAa	p.R765Q	PSD_ENST00000406432.1_Missense_Mutation_p.R765Q	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	765	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		GTGCACCTTTCGCACCAGGGC	0.672																																						dbGAP											0													84.0	92.0	89.0					10																	104165135		2203	4300	6503	-	-	-	SO:0001583	missense	0			X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.2294G>A	10.37:g.104165135C>T	ENSP00000020673:p.Arg765Gln		B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7,prints_PH_dom-spectrin-type	p.R765Q	ENST00000020673.5	37	c.2294	CCDS31272.1	10	.	.	.	.	.	.	.	.	.	.	C	33	5.270069	0.95429	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.35048	1.33;1.33	4.21	4.21	0.49690	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.69708	0.3141	M	0.93678	3.445	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.97110	0.992;1.0	T	0.80390	-0.1402	10	0.87932	D	0	.	16.7445	0.85468	0.0:1.0:0.0:0.0	.	765;668	A5PKW4;Q86YI3	PSD1_HUMAN;.	Q	765;668;765	ENSP00000020673:R765Q;ENSP00000384830:R765Q	ENSP00000020673:R765Q	R	-	2	0	PSD	104155125	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.434000	0.80377	2.178000	0.69098	0.561000	0.74099	CGA	PSD	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000059915		0.672	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD	HGNC	protein_coding	OTTHUMT00000050041.2	110	0.00	0	C			104165135	104165135	-1	no_errors	ENST00000020673	ensembl	human	known	69_37n	missense	58	39.58	38	SNP	1.000	T
PSKH2	85481	genome.wustl.edu	37	8	87076599	87076599	+	Silent	SNP	G	G	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr8:87076599G>C	ENST00000276616.2	-	2	521	c.447C>G	c.(445-447)ctC>ctG	p.L149L	PSKH2_ENST00000517981.1_5'UTR	NM_033126.1	NP_149117.1	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	149	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|kidney(11)|large_intestine(2)|lung(26)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(1)	47			STAD - Stomach adenocarcinoma(118;0.129)			CCTGAGCAATGAGTCGATCAA	0.498																																						dbGAP											0													71.0	73.0	73.0					8																	87076599		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY037806	CCDS6240.1	8q21.13	2004-06-03				ENSG00000147613			18997	protein-coding gene	gene with protein product							Standard	NM_033126		Approved		uc011lfy.2	Q96QS6		ENST00000276616.2:c.447C>G	8.37:g.87076599G>C			A0AV22	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L149	ENST00000276616.2	37	c.447	CCDS6240.1	8																																																																																			PSKH2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000147613		0.498	PSKH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSKH2	HGNC	protein_coding	OTTHUMT00000374628.1	140	0.00	0	G	NM_033126		87076599	87076599	-1	no_errors	ENST00000276616	ensembl	human	known	69_37n	silent	192	49.07	185	SNP	0.998	C
PVRL2	5819	genome.wustl.edu	37	19	45389459	45389459	+	Missense_Mutation	SNP	G	G	A	rs533933961		TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr19:45389459G>A	ENST00000252483.5	+	8	1330	c.1330G>A	c.(1330-1332)Gcc>Acc	p.A444T	CTB-129P6.4_ENST00000585408.1_RNA	NM_001042724.1	NP_001036189.1	Q92692	PVRL2_HUMAN	poliovirus receptor-related 2 (herpesvirus entry mediator B)	444					acrosome assembly (GO:0001675)|adherens junction organization (GO:0034332)|adhesion of symbiont to host (GO:0044406)|cell junction assembly (GO:0034329)|cell part morphogenesis (GO:0032990)|cell-cell junction organization (GO:0045216)|cilium organization (GO:0044782)|coreceptor-mediated virion attachment to host cell (GO:0046814)|cytoskeleton organization (GO:0007010)|establishment of mitochondrion localization (GO:0051654)|fertilization (GO:0009566)|fusion of virus membrane with host plasma membrane (GO:0019064)|homophilic cell adhesion (GO:0007156)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|sperm mitochondrion organization (GO:0030382)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|large_intestine(6)|lung(5)	13	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		TGATGCTGGCGCCTCATGCAC	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		17458	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													42.0	43.0	43.0					19																	45389459		1890	4111	6001	-	-	-	SO:0001583	missense	0			X80038	CCDS12645.1, CCDS42576.1	19q13.32	2013-01-29			ENSG00000130202	ENSG00000130202		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9707	protein-coding gene	gene with protein product		600798		HVEB		7622062, 10196354	Standard	NM_001042724		Approved	PVRR2, PRR2, CD112	uc002ozw.1	Q92692	OTTHUMG00000180839	ENST00000252483.5:c.1330G>A	19.37:g.45389459G>A	ENSP00000252483:p.Ala444Thr		A8K5L5|O75455|Q6IBI6|Q96J29	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.A444T	ENST00000252483.5	37	c.1330	CCDS42576.1	19	.	.	.	.	.	.	.	.	.	.	G	9.279	1.047769	0.19827	.	.	ENSG00000130202	ENST00000252483	D	0.83837	-1.77	5.23	-3.84	0.04256	.	1.234300	0.05819	N	0.615488	T	0.64516	0.2605	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.49872	-0.8893	10	0.18710	T	0.47	.	10.7633	0.46277	0.546:0.0:0.454:0.0	.	444	Q92692	PVRL2_HUMAN	T	444	ENSP00000252483:A444T	ENSP00000252483:A444T	A	+	1	0	PVRL2	50081299	0.000000	0.05858	0.000000	0.03702	0.083000	0.17756	-0.149000	0.10204	-0.417000	0.07461	-1.430000	0.01095	GCC	PVRL2	-	NULL	ENSG00000130202		0.617	PVRL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PVRL2	HGNC	protein_coding	OTTHUMT00000453231.1	39	0.00	0	G	NM_002856		45389459	45389459	+1	no_errors	ENST00000252483	ensembl	human	known	69_37n	missense	16	38.46	10	SNP	0.000	A
RELN	5649	genome.wustl.edu	37	7	103185571	103185571	+	Splice_Site	SNP	C	C	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr7:103185571C>T	ENST00000428762.1	-	42	6682	c.6523G>A	c.(6523-6525)Ggt>Agt	p.G2175S	RELN_ENST00000424685.2_Splice_Site_p.G2175S|RELN_ENST00000343529.5_Splice_Site_p.G2175S	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2175					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AAAAGACTACCTTCGAAATCA	0.313																																					NSCLC(146;835 1944 15585 22231 52158)	dbGAP											0													95.0	98.0	97.0					7																	103185571		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6523+1G>A	7.37:g.103185571C>T			A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom,pfscan_Reeler_dom	p.G2175S	ENST00000428762.1	37	c.6523	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	15.40	2.823494	0.50739	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.28666	1.6;1.6;1.6	5.5	5.5	0.81552	Neuraminidase (1);	0.114493	0.64402	D	0.000014	T	0.42404	0.1201	L	0.31664	0.95	0.80722	D	1	P;D	0.58620	0.849;0.983	P;P	0.60541	0.702;0.876	T	0.06499	-1.0823	9	.	.	.	.	19.7526	0.96273	0.0:1.0:0.0:0.0	.	2175;2175	P78509-2;P78509	.;RELN_HUMAN	S	2175	ENSP00000392423:G2175S;ENSP00000345694:G2175S;ENSP00000388446:G2175S	.	G	-	1	0	RELN	102972807	1.000000	0.71417	1.000000	0.80357	0.317000	0.28152	7.219000	0.78000	2.745000	0.94114	0.491000	0.48974	GGT	RELN	-	superfamily_Neuraminidase	ENSG00000189056		0.313	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	122	0.00	0	C	NM_005045	Missense_Mutation	103185571	103185571	-1	no_errors	ENST00000424685	ensembl	human	known	69_37n	missense	69	42.50	51	SNP	1.000	T
RNF19A	25897	genome.wustl.edu	37	8	101271468	101271468	+	Silent	SNP	G	G	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr8:101271468G>A	ENST00000519449.1	-	11	2149	c.1833C>T	c.(1831-1833)ggC>ggT	p.G611G	RNF19A_ENST00000523255.1_5'UTR|RNF19A_ENST00000341084.2_Silent_p.G611G	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	611					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			CCATACTGTTGCCTTCTCTGA	0.418											OREG0018897	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													91.0	82.0	85.0					8																	101271468		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.1833C>T	8.37:g.101271468G>A		1357	A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Silent	SNP	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC,pfscan_Znf_RING	p.G611	ENST00000519449.1	37	c.1833	CCDS6286.1	8																																																																																			RNF19A	-	NULL	ENSG00000034677		0.418	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF19A	HGNC	protein_coding	OTTHUMT00000380004.1	271	0.00	0	G	NM_015435		101271468	101271468	-1	no_errors	ENST00000341084	ensembl	human	known	69_37n	silent	705	11.53	92	SNP	0.995	A
RRN3P1	730092	genome.wustl.edu	37	16	21810986	21810986	+	RNA	SNP	C	C	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr16:21810986C>T	ENST00000546471.1	-	0	2000							Q2M238	RN3P1_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 1																		TTCAGGTTTCCGCTCAAAAGC	0.433																																						dbGAP											0																																										-	-	-			0					16p12.2	2012-10-16			ENSG00000248124	ENSG00000248124			30548	pseudogene	pseudogene						12477932	Standard	NR_003370		Approved		uc010vbl.1	Q2M238	OTTHUMG00000170417		16.37:g.21810986C>T			A8K6T4|B3KWX9|O75704	RNA	SNP	-	NULL	ENST00000546471.1	37	NULL		16																																																																																			RRN3P1	-	-	ENSG00000248124		0.433	RRN3P1-002	KNOWN	basic	processed_transcript	RRN3P1	HGNC	pseudogene	OTTHUMT00000409035.1	46	0.00	0	C	NR_003370		21810986	21810986	-1	no_errors	ENST00000546471	ensembl	human	known	69_37n	rna	27	41.30	19	SNP	1.000	T
SALL1	6299	genome.wustl.edu	37	16	51175777	51175777	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr16:51175777A>T	ENST00000251020.4	-	2	389	c.356T>A	c.(355-357)cTt>cAt	p.L119H	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.L22H|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	119					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TTCCCTGTCAAGTCCGTTGTG	0.557																																					GBM(103;1352 1446 1855 4775 8890)	dbGAP											0													101.0	104.0	103.0					16																	51175777		2198	4300	6498	-	-	-	SO:0001583	missense	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.356T>A	16.37:g.51175777A>T	ENSP00000251020:p.Leu119His		Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L119H	ENST00000251020.4	37	c.356	CCDS10747.1	16	.	.	.	.	.	.	.	.	.	.	A	10.04	1.242180	0.22796	.	.	ENSG00000103449	ENST00000251020;ENST00000440970	T;T	0.08546	3.26;3.08	5.21	-1.45	0.08828	.	0.423252	0.28332	N	0.015737	T	0.08758	0.0217	L	0.59436	1.845	0.43399	D	0.995526	P	0.42375	0.778	B	0.41946	0.371	T	0.11641	-1.0579	10	0.51188	T	0.08	.	6.6158	0.22776	0.4806:0.1378:0.3816:0.0	.	119	Q9NSC2	SALL1_HUMAN	H	119;22	ENSP00000251020:L119H;ENSP00000407914:L22H	ENSP00000251020:L119H	L	-	2	0	SALL1	49733278	0.997000	0.39634	0.001000	0.08648	0.474000	0.32979	2.203000	0.42752	-0.610000	0.05716	-0.375000	0.07067	CTT	SALL1	-	NULL	ENSG00000103449		0.557	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	148	0.00	0	A	NM_002968		51175777	51175777	-1	no_errors	ENST00000251020	ensembl	human	known	69_37n	missense	34	67.92	72	SNP	0.640	T
SELP	6403	genome.wustl.edu	37	1	169578747	169578747	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:169578747C>G	ENST00000263686.6	-	8	1365	c.1328G>C	c.(1327-1329)tGt>tCt	p.C443S	SELP_ENST00000367791.2_Intron|SELP_ENST00000367792.2_Missense_Mutation_p.C381S|SELP_ENST00000458599.2_Missense_Mutation_p.C381S|SELP_ENST00000367786.2_Missense_Mutation_p.C381S|SELP_ENST00000367788.2_Missense_Mutation_p.C381S|SELP_ENST00000367794.2_Missense_Mutation_p.C381S|SELP_ENST00000367793.2_Missense_Mutation_p.C381S	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	443	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	AGTACCTTGACAGACTGGGGC	0.483																																						dbGAP											0													152.0	126.0	135.0					1																	169578747		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.1328G>C	1.37:g.169578747C>G	ENSP00000263686:p.Cys443Ser		Q5R344|Q8IVD1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.C443S	ENST00000263686.6	37	c.1328	CCDS1282.1	1	.	.	.	.	.	.	.	.	.	.	C	16.69	3.192667	0.58017	.	.	ENSG00000174175	ENST00000367790;ENST00000426706;ENST00000367789;ENST00000263686;ENST00000544572;ENST00000367793;ENST00000367794;ENST00000367792;ENST00000367788;ENST00000367786;ENST00000458599	D;D;D;D;D;D	0.99778	-6.73;-6.73;-6.73;-6.73;-6.73;-6.73	5.74	5.74	0.90152	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000004	D	0.99908	0.9956	H	0.99357	4.53	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.96278	0.9204	10	0.87932	D	0	-19.1605	16.6595	0.85237	0.0:1.0:0.0:0.0	.	443;443;443	Q6NUL9;P16109;G3V1U2	.;LYAM3_HUMAN;.	S	443;442;381;443;443;381;381;381;381;381;366	ENSP00000263686:C443S;ENSP00000356767:C381S;ENSP00000356768:C381S;ENSP00000356766:C381S;ENSP00000356762:C381S;ENSP00000356760:C381S	ENSP00000263686:C443S	C	-	2	0	SELP	167845371	1.000000	0.71417	0.966000	0.40874	0.127000	0.20565	6.545000	0.73883	2.712000	0.92718	0.650000	0.86243	TGT	SELP	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	ENSG00000174175		0.483	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SELP	HGNC	protein_coding	OTTHUMT00000083916.4	140	0.00	0	C	NM_003005		169578747	169578747	-1	no_errors	ENST00000263686	ensembl	human	known	69_37n	missense	331	17.46	70	SNP	0.997	G
SERTAD3	29946	genome.wustl.edu	37	19	40947861	40947861	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr19:40947861G>A	ENST00000322354.3	-	2	623	c.127C>T	c.(127-129)Cgc>Tgc	p.R43C	CTC-492K19.4_ENST00000599050.1_RNA|SERTAD3_ENST00000392028.4_Missense_Mutation_p.R43C|SERTAD3_ENST00000601217.1_5'Flank	NM_203344.2	NP_976219.1	Q9UJW9	SRTD3_HUMAN	SERTA domain containing 3	43	SERTA. {ECO:0000255|PROSITE- ProRule:PRU00396}.				negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.R43C(1)		kidney(1)|large_intestine(4)|lung(2)	7			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CCCAGGCTGCGCTGGACTTTG	0.637																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											31.0	27.0	28.0					19																	40947861		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF192529	CCDS12558.1	19q13.2	2008-02-05				ENSG00000167565			17931	protein-coding gene	gene with protein product	"""RPA-binding trans-activator"""	612125				10982866, 11331592	Standard	NM_013368		Approved	RBT1	uc002onv.4	Q9UJW9		ENST00000322354.3:c.127C>T	19.37:g.40947861G>A	ENSP00000325414:p.Arg43Cys		B3KQB3|Q96CQ2	Missense_Mutation	SNP	pfam_SERTA,pfscan_SERTA	p.R43C	ENST00000322354.3	37	c.127	CCDS12558.1	19	.	.	.	.	.	.	.	.	.	.	G	10.80	1.451727	0.26074	.	.	ENSG00000167565	ENST00000322354;ENST00000392028	.	.	.	4.88	3.84	0.44239	.	0.197941	0.30949	N	0.008542	T	0.35068	0.0919	N	0.08118	0	0.54753	D	0.99998	D	0.60575	0.988	P	0.50537	0.643	T	0.34850	-0.9812	9	0.66056	D	0.02	-16.0624	10.4785	0.44678	0.0:0.0:0.8066:0.1934	.	43	Q9UJW9	SRTD3_HUMAN	C	43	.	ENSP00000325414:R43C	R	-	1	0	SERTAD3	45639701	0.998000	0.40836	0.966000	0.40874	0.952000	0.60782	1.544000	0.36158	1.264000	0.44198	0.655000	0.94253	CGC	SERTAD3	-	pfam_SERTA,pfscan_SERTA	ENSG00000167565		0.637	SERTAD3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	SERTAD3	HGNC	protein_coding	OTTHUMT00000462573.1	46	0.00	0	G	NM_013368		40947861	40947861	-1	no_errors	ENST00000322354	ensembl	human	known	69_37n	missense	21	54.35	25	SNP	0.973	A
SETDB1	9869	genome.wustl.edu	37	1	150921875	150921875	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:150921875A>C	ENST00000271640.5	+	12	1644	c.1454A>C	c.(1453-1455)aAg>aCg	p.K485T	SETDB1_ENST00000459773.1_Intron|SETDB1_ENST00000368969.4_Missense_Mutation_p.K485T	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	485					bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			CAGTCACGGAAGCAGGTAGCC	0.473																																						dbGAP											0													117.0	121.0	119.0					1																	150921875		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.1454A>C	1.37:g.150921875A>C	ENSP00000271640:p.Lys485Thr		A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	pfam_SET_dom,pfam_Pre-SET_dom,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Tudor,smart_Methyl_CpG_DNA-bd,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Methyl_CpG_DNA-bd,pfscan_SET_dom,pfscan_Pre-SET_dom,pfscan_Post-SET_dom	p.K485T	ENST00000271640.5	37	c.1454	CCDS44217.1	1	.	.	.	.	.	.	.	.	.	.	A	18.47	3.630995	0.67015	.	.	ENSG00000143379	ENST00000271640;ENST00000534805;ENST00000368969;ENST00000498193	D;T;D;T	0.88664	-2.41;1.37;-2.41;1.07	4.86	4.86	0.63082	.	0.257379	0.44688	D	0.000427	D	0.85948	0.5816	N	0.24115	0.695	0.80722	D	1	D;B;D;D	0.62365	0.991;0.103;0.982;0.97	P;B;P;P	0.60345	0.761;0.058;0.873;0.749	D	0.88199	0.2882	10	0.52906	T	0.07	.	14.6281	0.68638	1.0:0.0:0.0:0.0	.	485;486;485;485	E9PRF4;E9PQM8;Q15047-3;Q15047	.;.;.;SETB1_HUMAN	T	485;486;485;485	ENSP00000271640:K485T;ENSP00000436148:K486T;ENSP00000357965:K485T;ENSP00000432348:K485T	ENSP00000271640:K485T	K	+	2	0	SETDB1	149188499	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.016000	0.76393	2.046000	0.60703	0.459000	0.35465	AAG	SETDB1	-	NULL	ENSG00000143379		0.473	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SETDB1	HGNC	protein_coding	OTTHUMT00000084717.2	165	0.00	0	A			150921875	150921875	+1	no_errors	ENST00000271640	ensembl	human	known	69_37n	missense	292	19.34	70	SNP	1.000	C
SLC16A6	9120	genome.wustl.edu	37	17	66267701	66267701	+	Silent	SNP	G	G	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr17:66267701G>C	ENST00000327268.4	-	6	764	c.600C>G	c.(598-600)ctC>ctG	p.L200L	SLC16A6_ENST00000580666.1_Silent_p.L200L|ARSG_ENST00000448504.2_Intron	NM_001174166.1	NP_001167637.1	O15403	MOT7_HUMAN	solute carrier family 16, member 6	200					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			large_intestine(3)|lung(8)|prostate(1)|skin(1)|urinary_tract(2)	15	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	AGATGGGTCTGAGCAGTGCTC	0.468																																						dbGAP											0													111.0	106.0	107.0					17																	66267701		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U79745	CCDS11675.1	17q24.2	2013-07-18	2013-07-18		ENSG00000108932	ENSG00000108932		"""Solute carriers"""	10927	protein-coding gene	gene with protein product		603880	"""solute carrier family 16 (monocarboxylic acid transporters), member 6"", ""solute carrier family 16, member 6 (monocarboxylic acid transporter 7)"""			9425115	Standard	NM_004694		Approved	MCT6, MCT7	uc002jgz.2	O15403	OTTHUMG00000179812	ENST00000327268.4:c.600C>G	17.37:g.66267701G>C			Q6P1X3	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L200	ENST00000327268.4	37	c.600	CCDS11675.1	17																																																																																			SLC16A6	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000108932		0.468	SLC16A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC16A6	HGNC	protein_coding	OTTHUMT00000448323.1	76	0.00	0	G	NM_004694		66267701	66267701	-1	no_errors	ENST00000327268	ensembl	human	known	69_37n	silent	89	29.13	37	SNP	0.052	C
SLITRK3	22865	genome.wustl.edu	37	3	164906133	164906133	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr3:164906133G>A	ENST00000475390.1	-	2	2929	c.2486C>T	c.(2485-2487)aCc>aTc	p.T829I	SLITRK3_ENST00000241274.3_Missense_Mutation_p.T829I			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	829					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						CGTCACTATGGTGTTAAGCTG	0.557										HNSCC(40;0.11)																												dbGAP											0													108.0	106.0	107.0					3																	164906133		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2486C>T	3.37:g.164906133G>A	ENSP00000420091:p.Thr829Ile		Q1RMY6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.T829I	ENST00000475390.1	37	c.2486	CCDS3197.1	3	.	.	.	.	.	.	.	.	.	.	G	17.85	3.490936	0.64074	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.62941	-0.01;-0.01	5.33	5.33	0.75918	.	0.000000	0.38959	N	0.001519	T	0.69646	0.3134	L	0.27053	0.805	0.58432	D	0.999997	D	0.71674	0.998	D	0.73708	0.981	T	0.72070	-0.4401	10	0.62326	D	0.03	-14.1925	17.9523	0.89057	0.0:0.0:1.0:0.0	.	829	O94933	SLIK3_HUMAN	I	829	ENSP00000420091:T829I;ENSP00000241274:T829I	ENSP00000241274:T829I	T	-	2	0	SLITRK3	166388827	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.971000	0.70440	2.778000	0.95560	0.655000	0.94253	ACC	SLITRK3	-	NULL	ENSG00000121871		0.557	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLITRK3	HGNC	protein_coding	OTTHUMT00000350126.1	347	0.00	0	G	NM_014926		164906133	164906133	-1	no_errors	ENST00000241274	ensembl	human	known	69_37n	missense	148	56.98	196	SNP	1.000	A
SORCS3	22986	genome.wustl.edu	37	10	107015559	107015559	+	Splice_Site	SNP	G	G	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr10:107015559G>A	ENST00000369701.3	+	24	3564	c.3337G>A	c.(3337-3339)Gct>Act	p.A1113T		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	1113					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GCTGACGTTAGGTGAGTGCCA	0.453																																					NSCLC(116;1497 1690 7108 13108 14106)	dbGAP											0													93.0	80.0	84.0					10																	107015559		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.3337+1G>A	10.37:g.107015559G>A			Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.A1113T	ENST00000369701.3	37	c.3337	CCDS7558.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.551387	0.96501	.	.	ENSG00000156395	ENST00000369701	T	0.17854	2.25	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.39708	0.1088	L	0.55481	1.735	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.00847	-1.1542	9	.	.	.	.	20.2786	0.98501	0.0:0.0:1.0:0.0	.	1113	Q9UPU3	SORC3_HUMAN	T	1113	ENSP00000358715:A1113T	.	A	+	1	0	SORCS3	107005549	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.420000	0.97426	2.868000	0.98415	0.557000	0.71058	GCT	SORCS3	-	NULL	ENSG00000156395		0.453	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS3	HGNC	protein_coding	OTTHUMT00000050221.1	144	0.00	0	G	NM_014978	Missense_Mutation	107015559	107015559	+1	no_errors	ENST00000369701	ensembl	human	known	69_37n	missense	88	35.29	48	SNP	1.000	A
STAT4	6775	genome.wustl.edu	37	2	192012876	192012876	+	Silent	SNP	C	C	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr2:192012876C>T	ENST00000392320.2	-	2	368	c.54G>A	c.(52-54)gtG>gtA	p.V18V	STAT4_ENST00000409995.1_Silent_p.V18V|STAT4_ENST00000358470.4_Silent_p.V18V	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4	18					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			AGAATTGATCCACCTGCTCCA	0.363																																						dbGAP											0													124.0	119.0	121.0					2																	192012876		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.54G>A	2.37:g.192012876C>T			Q96NZ6	Silent	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.V18	ENST00000392320.2	37	c.54	CCDS2310.1	2																																																																																			STAT4	-	pfam_STAT_TF_prot_interaction,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction	ENSG00000138378		0.363	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STAT4	HGNC	protein_coding	OTTHUMT00000335586.1	352	0.00	0	C	NM_003151		192012876	192012876	-1	no_errors	ENST00000358470	ensembl	human	known	69_37n	silent	177	34.69	94	SNP	0.938	T
STK10	6793	genome.wustl.edu	37	5	171488230	171488230	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr5:171488230C>G	ENST00000176763.5	-	14	2468	c.2125G>C	c.(2125-2127)Gcc>Ccc	p.A709P		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	709					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTCTTCATGGCCAGCTCCAGG	0.607																																						dbGAP											0													149.0	133.0	139.0					5																	171488230		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.2125G>C	5.37:g.171488230C>G	ENSP00000176763:p.Ala709Pro		A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	SNP	pfam_PKK,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A709P	ENST00000176763.5	37	c.2125	CCDS34290.1	5	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046898	0.75846	.	.	ENSG00000072786	ENST00000176763;ENST00000545839	T	0.33865	1.39	4.99	4.99	0.66335	.	0.057015	0.64402	D	0.000001	T	0.47192	0.1432	M	0.74881	2.28	0.45914	D	0.998754	B	0.25719	0.132	B	0.36244	0.22	T	0.51196	-0.8736	10	0.59425	D	0.04	.	15.7898	0.78345	0.0:1.0:0.0:0.0	.	709	O94804	STK10_HUMAN	P	709	ENSP00000176763:A709P	ENSP00000176763:A709P	A	-	1	0	STK10	171420835	0.934000	0.31675	1.000000	0.80357	0.992000	0.81027	1.781000	0.38644	2.299000	0.77371	0.455000	0.32223	GCC	STK10	-	pfam_PKK	ENSG00000072786		0.607	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK10	HGNC	protein_coding	OTTHUMT00000372374.2	109	0.00	0	C	NM_005990		171488230	171488230	-1	no_errors	ENST00000176763	ensembl	human	known	69_37n	missense	55	41.67	40	SNP	1.000	G
SYT15	83849	genome.wustl.edu	37	10	46965117	46965117	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr10:46965117delG	ENST00000374321.4	-	6	894	c.828delC	c.(826-828)cccfs	p.P276fs	SYT15_ENST00000374325.3_Frame_Shift_Del_p.P276fs|RP11-38L15.3_ENST00000506914.1_RNA|SYT15_ENST00000374323.4_Frame_Shift_Del_p.P329fs|SYT15_ENST00000503753.1_Frame_Shift_Del_p.P276fs	NM_031912.4	NP_114118.2	Q9BQS2	SYT15_HUMAN	synaptotagmin XV	276						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(5)|kidney(2)|lung(5)	13						CAAACTCCGAGGGGGGCTGGG	0.642																																					Ovarian(57;1152 1428 19651 37745)	dbGAP											0													48.0	57.0	54.0					10																	46965117		2095	4237	6332	-	-	-	SO:0001589	frameshift_variant	0			AJ303363	CCDS73103.1, CCDS73104.1	10q11.1	2013-01-21			ENSG00000204176	ENSG00000204176		"""Synaptotagmins"""	17167	protein-coding gene	gene with protein product		608081				11543631	Standard	NM_031912		Approved	CHR10SYT	uc001jea.3	Q9BQS2	OTTHUMG00000018103	ENST00000374321.4:c.828delC	10.37:g.46965117delG	ENSP00000363441:p.Pro276fs		A5D6W8|Q5VY53|Q5VY55|Q7Z439|Q7Z440	Frame_Shift_Del	DEL	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.S330fs	ENST00000374321.4	37	c.987	CCDS44376.1	10																																																																																			SYT15	-	NULL	ENSG00000204176		0.642	SYT15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT15	HGNC	protein_coding	OTTHUMT00000367008.1	23	0.00	0	G	NM_031912		46965117	46965117	-1	no_errors	ENST00000374323	ensembl	human	known	69_37n	frame_shift_del	21	14.81	4	DEL	1.000	-
TAAR5	9038	genome.wustl.edu	37	6	132910035	132910035	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr6:132910035C>T	ENST00000258034.2	-	1	842	c.791G>A	c.(790-792)tGc>tAc	p.C264Y		NM_003967.2	NP_003958.2	O14804	TAAR5_HUMAN	trace amine associated receptor 5	264					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|trimethylamine receptor activity (GO:1990081)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	32	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		GGGCAGCCAGCACAAGAGGTA	0.512																																						dbGAP											0													77.0	79.0	78.0					6																	132910035		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF021818	CCDS5156.1	6q23.2	2012-08-08			ENSG00000135569	ENSG00000135569		"""GPCR / Class A : Trace amine associated receptors"""	30236	protein-coding gene	gene with protein product		607405				9464258, 15718104	Standard	NM_003967		Approved	PNR	uc003qdk.2	O14804	OTTHUMG00000015581	ENST00000258034.2:c.791G>A	6.37:g.132910035C>T	ENSP00000258034:p.Cys264Tyr		D8KZS1|Q2M1V1|Q4VBL1|Q5VUQ3|Q6NTA8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Trace_amine_rcpt	p.C264Y	ENST00000258034.2	37	c.791	CCDS5156.1	6	.	.	.	.	.	.	.	.	.	.	C	33	5.265903	0.95399	.	.	ENSG00000135569	ENST00000258034	T	0.54279	0.58	5.58	3.73	0.42828	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.81113	0.4755	H	0.99238	4.48	0.51767	D	0.99993	D	0.67145	0.996	D	0.70487	0.969	D	0.90265	0.4303	10	0.87932	D	0	-19.8578	16.4649	0.84076	0.0:0.7546:0.2454:0.0	.	264	O14804	TAAR5_HUMAN	Y	264	ENSP00000258034:C264Y	ENSP00000258034:C264Y	C	-	2	0	TAAR5	132951728	0.888000	0.30383	1.000000	0.80357	0.963000	0.63663	1.857000	0.39399	1.589000	0.49982	0.655000	0.94253	TGC	TAAR5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000135569		0.512	TAAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAAR5	HGNC	protein_coding	OTTHUMT00000042257.1	128	0.00	0	C	NM_003967		132910035	132910035	-1	no_errors	ENST00000258034	ensembl	human	known	69_37n	missense	39	74.84	116	SNP	1.000	T
TAB3	257397	genome.wustl.edu	37	X	30872538	30872538	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chrX:30872538delG	ENST00000378933.1	-	3	1421	c.1244delC	c.(1243-1245)tctfs	p.S416fs	TAB3_ENST00000378932.2_Frame_Shift_Del_p.S416fs|TAB3_ENST00000378930.3_Frame_Shift_Del_p.S416fs|TAB3_ENST00000288422.2_Frame_Shift_Del_p.S416fs|TAB3_ENST00000378928.1_5'Flank|TAB3-AS2_ENST00000445240.1_RNA	NM_152787.3	NP_690000.2	Q8N5C8	TAB3_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 3	416	Pro-rich.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|skin(1)	27						TGGTTGACTAGATATCCCTCT	0.443																																					Pancreas(164;1598 1985 29022 43301 49529)	dbGAP											0													217.0	189.0	198.0					X																	30872538		2202	4300	6502	-	-	-	SO:0001589	frameshift_variant	0			AY331591	CCDS14226.1	Xp21.2	2010-02-05	2010-02-05	2010-02-05	ENSG00000157625	ENSG00000157625			30681	protein-coding gene	gene with protein product	"""TAK1 binding protein 3"""	300480	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 3"""	MAP3K7IP3		14633987, 14670075	Standard	XM_005274482		Approved		uc004dcj.3	Q8N5C8	OTTHUMG00000021329	ENST00000378933.1:c.1244delC	X.37:g.30872538delG	ENSP00000368215:p.Ser416fs		A6NDD9|Q6VQR0	Frame_Shift_Del	DEL	pfam_CUE,pfam_Znf_RanBP2,superfamily_UBA-like,smart_CUE,smart_Znf_RanBP2,pfscan_CUE,pfscan_Znf_RanBP2	p.S415fs	ENST00000378933.1	37	c.1244	CCDS14226.1	X																																																																																			TAB3	-	NULL	ENSG00000157625		0.443	TAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB3	HGNC	protein_coding	OTTHUMT00000056173.1	150	0.00	0	G	NM_152787		30872538	30872538	-1	no_errors	ENST00000288422	ensembl	human	known	69_37n	frame_shift_del	113	20.28	29	DEL	0.999	-
TAB3	257397	genome.wustl.edu	37	X	30873405	30873405	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chrX:30873405G>T	ENST00000378933.1	-	3	554	c.377C>A	c.(376-378)tCa>tAa	p.S126*	TAB3_ENST00000378932.2_Nonsense_Mutation_p.S126*|TAB3_ENST00000378930.3_Nonsense_Mutation_p.S126*|TAB3_ENST00000288422.2_Nonsense_Mutation_p.S126*|TAB3_ENST00000378928.1_5'Flank|TAB3-AS2_ENST00000445240.1_RNA	NM_152787.3	NP_690000.2	Q8N5C8	TAB3_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 3	126					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|skin(1)	27						AGCTGGAGCTGAGTGTGGTTC	0.448																																					Pancreas(164;1598 1985 29022 43301 49529)	dbGAP											0													170.0	118.0	136.0					X																	30873405		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			AY331591	CCDS14226.1	Xp21.2	2010-02-05	2010-02-05	2010-02-05	ENSG00000157625	ENSG00000157625			30681	protein-coding gene	gene with protein product	"""TAK1 binding protein 3"""	300480	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 3"""	MAP3K7IP3		14633987, 14670075	Standard	XM_005274482		Approved		uc004dcj.3	Q8N5C8	OTTHUMG00000021329	ENST00000378933.1:c.377C>A	X.37:g.30873405G>T	ENSP00000368215:p.Ser126*		A6NDD9|Q6VQR0	Nonsense_Mutation	SNP	pfam_CUE,pfam_Znf_RanBP2,superfamily_UBA-like,smart_CUE,smart_Znf_RanBP2,pfscan_CUE,pfscan_Znf_RanBP2	p.S126*	ENST00000378933.1	37	c.377	CCDS14226.1	X	.	.	.	.	.	.	.	.	.	.	G	38	7.264902	0.98175	.	.	ENSG00000157625	ENST00000378933;ENST00000378930;ENST00000288422;ENST00000378932	.	.	.	5.04	5.04	0.67666	.	0.058900	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.7156	17.8276	0.88671	0.0:0.0:1.0:0.0	.	.	.	.	X	126	.	ENSP00000288422:S126X	S	-	2	0	TAB3	30783326	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.420000	0.97426	2.229000	0.72834	0.600000	0.82982	TCA	TAB3	-	NULL	ENSG00000157625		0.448	TAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB3	HGNC	protein_coding	OTTHUMT00000056173.1	171	0.00	0	G	NM_152787		30873405	30873405	-1	no_errors	ENST00000288422	ensembl	human	known	69_37n	nonsense	136	32.67	66	SNP	1.000	T
TGFBRAP1	9392	genome.wustl.edu	37	2	105883873	105883873	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr2:105883873G>T	ENST00000393359.2	-	12	2976	c.2550C>A	c.(2548-2550)aaC>aaA	p.N850K	TGFBRAP1_ENST00000258449.1_Missense_Mutation_p.N850K|AC012360.2_ENST00000595531.1_5'Flank			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	850					intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						ATGAGCTGGGGTTTGTGTGTC	0.527																																					Esophageal Squamous(183;794 2019 9730 21801 48859)	dbGAP											0													113.0	99.0	104.0					2																	105883873		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.2550C>A	2.37:g.105883873G>T	ENSP00000377027:p.Asn850Lys		A8K5R7|D3DVJ8|O60466	Missense_Mutation	SNP	pfam_VPS39/TGF_beta_rcpt-assoc_2,pfam_VPS39/TGF_beta_rcpt-assoc_1,pfam_Clathrin_H-chain/VPS_repeat,pfam_Citron	p.N850K	ENST00000393359.2	37	c.2550	CCDS2067.1	2	.	.	.	.	.	.	.	.	.	.	G	10.83	1.461541	0.26248	.	.	ENSG00000135966	ENST00000393359;ENST00000258449;ENST00000543724	T;T	0.40225	1.04;1.04	5.5	2.69	0.31865	.	0.600559	0.17904	N	0.158081	T	0.25121	0.0610	L	0.38175	1.15	0.09310	N	0.999999	B;B	0.27625	0.183;0.003	B;B	0.22386	0.039;0.003	T	0.27191	-1.0081	10	0.06099	T	0.92	-7.5615	7.582	0.27970	0.1485:0.2551:0.5964:0.0	.	305;850	B3KMM9;Q8WUH2	.;TGFA1_HUMAN	K	850;850;305	ENSP00000377027:N850K;ENSP00000258449:N850K	ENSP00000258449:N850K	N	-	3	2	TGFBRAP1	105250305	1.000000	0.71417	0.071000	0.20095	0.888000	0.51559	1.212000	0.32394	0.278000	0.22164	0.557000	0.71058	AAC	TGFBRAP1	-	NULL	ENSG00000135966		0.527	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBRAP1	HGNC	protein_coding	OTTHUMT00000253354.2	105	0.00	0	G	NM_004257		105883873	105883873	-1	no_errors	ENST00000258449	ensembl	human	known	69_37n	missense	55	36.05	31	SNP	0.217	T
TGM5	9333	genome.wustl.edu	37	15	43525859	43525859	+	Silent	SNP	C	C	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr15:43525859C>T	ENST00000220420.5	-	12	1909	c.1902G>A	c.(1900-1902)caG>caA	p.Q634Q	TGM5_ENST00000349114.4_Silent_p.Q552Q	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	634					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	TGGAGAGTGGCTGGTTCACAA	0.498																																						dbGAP											0													65.0	62.0	63.0					15																	43525859		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.1902G>A	15.37:g.43525859C>T			O43549|Q0VF40|Q9UEZ4	Silent	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.Q634	ENST00000220420.5	37	c.1902	CCDS32212.1	15																																																																																			TGM5	-	pfam_Transglutaminase_C,superfamily_Transglutaminase_C	ENSG00000104055		0.498	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM5	HGNC	protein_coding	OTTHUMT00000432257.1	101	0.00	0	C	NM_004245		43525859	43525859	-1	no_errors	ENST00000220420	ensembl	human	known	69_37n	silent	71	31.73	33	SNP	0.996	T
TMEM132A	54972	genome.wustl.edu	37	11	60699533	60699534	+	Frame_Shift_Ins	INS	-	-	G	rs61745629|rs183954132	byFrequency	TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr11:60699533_60699534insG	ENST00000453848.2	+	7	1448_1449	c.1290_1291insG	c.(1291-1293)gggfs	p.G431fs	TMEM132A_ENST00000005286.4_Frame_Shift_Ins_p.G432fs			Q24JP5	T132A_HUMAN	transmembrane protein 132A	431						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						CTGTGGACGGCGGGGGGGCCTT	0.644																																						dbGAP											0									,	6,4258		0,6,2126					,	-7.6	0.0			59	6,8248		0,6,4121	no	frameshift,frameshift	TMEM132A	NM_178031.2,NM_017870.3	,	0,12,6247	A1A1,A1R,RR		0.0727,0.1407,0.0959	,	,		12,12506				-	-	-	SO:0001589	frameshift_variant	0			AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.1297dupG	11.37:g.60699540_60699540dupG	ENSP00000405823:p.Gly431fs		Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Frame_Shift_Ins	INS	NULL	p.A433fs	ENST00000453848.2	37	c.1293_1294	CCDS44618.1	11																																																																																			TMEM132A	-	NULL	ENSG00000006118		0.644	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	TMEM132A	HGNC	protein_coding	OTTHUMT00000396352.1	29	0.00	0	-	NM_017870		60699533	60699534	+1	no_errors	ENST00000005286	ensembl	human	known	69_37n	frame_shift_ins	13	13.33	2	INS	0.001:0.988	G
TYK2	7297	genome.wustl.edu	37	19	10463112	10463113	+	Frame_Shift_Ins	INS	-	-	G	rs373614901		TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr19:10463112_10463113insG	ENST00000525621.1	-	23	3796_3797	c.3315_3316insC	c.(3313-3318)cccacgfs	p.T1106fs	TYK2_ENST00000264818.6_Frame_Shift_Ins_p.T1106fs|TYK2_ENST00000529422.1_Intron|TYK2_ENST00000524462.1_Frame_Shift_Ins_p.T921fs	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	1106	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			GCTCTCACCGTGGGGGGGCTCT	0.599																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.3316dupC	19.37:g.10463119_10463119dupG	ENSP00000431885:p.Thr1106fs		Q6QB10|Q96CH0	Frame_Shift_Ins	INS	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_TYK2_N	p.T1105fs	ENST00000525621.1	37	c.3316_3315	CCDS12236.1	19																																																																																			TYK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_Prot_kinase_cat_dom	ENSG00000105397		0.599	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	HGNC	protein_coding	OTTHUMT00000389443.1	30	0.00	0	-			10463112	10463113	-1	no_errors	ENST00000264818	ensembl	human	known	69_37n	frame_shift_ins	17	15.00	3	INS	0.001:0.001	G
ULBP1	80329	genome.wustl.edu	37	6	150290226	150290226	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr6:150290226C>T	ENST00000229708.3	+	3	398	c.355C>T	c.(355-357)Ctc>Ttc	p.L119F		NM_025218.2	NP_079494.1	Q9BZM6	N2DL1_HUMAN	UL16 binding protein 1	119	MHC class I alpha-2 like.				antigen processing and presentation (GO:0019882)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of immune response (GO:0050776)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	natural killer cell lectin-like receptor binding (GO:0046703)			large_intestine(3)|lung(5)|pancreas(1)|skin(1)	10		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.14e-11)		GGCAGAGCCCCTCACCCTGCA	0.552																																						dbGAP											0													73.0	73.0	73.0					6																	150290226		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF304377	CCDS5223.1	6q25	2003-04-29			ENSG00000111981	ENSG00000111981			14893	protein-coding gene	gene with protein product		605697				11239445, 11827464	Standard	XM_005267151		Approved	RAET1I	uc003qnp.3	Q9BZM6	OTTHUMG00000015810	ENST00000229708.3:c.355C>T	6.37:g.150290226C>T	ENSP00000229708:p.Leu119Phe		Q5VY81|Q8IZW3|Q8IZX6	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	p.L119F	ENST00000229708.3	37	c.355	CCDS5223.1	6	.	.	.	.	.	.	.	.	.	.	c	10.85	1.466523	0.26335	.	.	ENSG00000111981	ENST00000367345;ENST00000229708	T;T	0.00653	5.96;5.96	2.22	0.273	0.15650	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.	.	.	.	T	0.00906	0.0030	M	0.77313	2.365	0.09310	N	1	D	0.71674	0.998	D	0.68943	0.961	T	0.49615	-0.8921	9	0.66056	D	0.02	.	3.2619	0.06851	0.0:0.5446:0.2806:0.1748	.	119	Q9BZM6	N2DL1_HUMAN	F	119	ENSP00000356314:L119F;ENSP00000229708:L119F	ENSP00000229708:L119F	L	+	1	0	ULBP1	150331919	0.000000	0.05858	0.001000	0.08648	0.023000	0.10783	-0.055000	0.11807	0.052000	0.16007	0.398000	0.26397	CTC	ULBP1	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000111981		0.552	ULBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULBP1	HGNC	protein_coding	OTTHUMT00000042677.2	70	0.00	0	C			150290226	150290226	+1	no_errors	ENST00000229708	ensembl	human	known	69_37n	missense	22	73.17	60	SNP	0.001	T
VCAN	1462	genome.wustl.edu	37	5	82832924	82832924	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr5:82832924A>C	ENST00000265077.3	+	8	4667	c.4102A>C	c.(4102-4104)Atg>Ctg	p.M1368L	VCAN_ENST00000512590.2_Intron|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.M381L|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000513016.1_3'UTR	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1368	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GCATGATCTAATGGCTGAAAT	0.363																																						dbGAP											0													83.0	86.0	85.0					5																	82832924		2203	4300	6503	-	-	-	SO:0001583	missense	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.4102A>C	5.37:g.82832924A>C	ENSP00000265077:p.Met1368Leu		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EGF-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Link,smart_EGF-like,smart_EGF-like_Ca-bd,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.M1368L	ENST00000265077.3	37	c.4102	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	A	0.012	-1.665274	0.00765	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	D;D;T	0.82711	-1.58;-1.64;3.54	5.21	-2.84	0.05751	.	0.712624	0.13135	N	0.411083	T	0.55481	0.1923	N	0.08118	0	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.51568	-0.8689	10	0.02654	T	1	.	5.8979	0.18949	0.2141:0.3156:0.0:0.4703	.	381;1368	P13611-2;P13611	.;CSPG2_HUMAN	L	1368;381;381	ENSP00000265077:M1368L;ENSP00000340062:M381L;ENSP00000426251:M381L	ENSP00000265077:M1368L	M	+	1	0	VCAN	82868680	0.031000	0.19500	0.655000	0.29622	0.139000	0.21198	0.109000	0.15417	-0.038000	0.13624	0.528000	0.53228	ATG	VCAN	-	NULL	ENSG00000038427		0.363	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	198	0.00	0	A	NM_004385		82832924	82832924	+1	no_errors	ENST00000265077	ensembl	human	known	69_37n	missense	135	42.06	98	SNP	0.003	C
ZNF112	7771	genome.wustl.edu	37	19	44831696	44831696	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr19:44831696T>C	ENST00000337401.4	-	5	2720	c.2632A>G	c.(2632-2634)Att>Gtt	p.I878V	ZNF112_ENST00000536500.1_Missense_Mutation_p.I895V|ZNF112_ENST00000354340.4_Missense_Mutation_p.I872V	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	878					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										CTTTGATGAATGAGAAGACCT	0.413																																						dbGAP											0													100.0	93.0	95.0					19																	44831696		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.2632A>G	19.37:g.44831696T>C	ENSP00000337081:p.Ile878Val		A4FU53|Q9HCA7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I895V	ENST00000337401.4	37	c.2683	CCDS54276.1	19	.	.	.	.	.	.	.	.	.	.	T	5.092	0.202634	0.09652	.	.	ENSG00000062370	ENST00000337401;ENST00000412927;ENST00000354340;ENST00000536500;ENST00000253426	T;T;T	0.08193	3.12;3.12;3.12	5.27	3.1	0.35709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34580	N	0.003855	T	0.03348	0.0097	N	0.11698	0.16	0.09310	N	1	B;B;B	0.20887	0.029;0.049;0.029	B;B;B	0.20184	0.012;0.028;0.012	T	0.45279	-0.9272	10	0.02654	T	1	-13.1399	5.4682	0.16656	0.1329:0.1577:0.0:0.7094	.	877;895;878	B4DYT4;F5GWS7;Q9UJU3	.;.;ZF112_HUMAN	V	878;878;872;895;877	ENSP00000337081:I878V;ENSP00000346305:I872V;ENSP00000441990:I895V	ENSP00000253426:I877V	I	-	1	0	ZNF285	49523536	0.000000	0.05858	0.736000	0.30914	0.480000	0.33159	-1.724000	0.01865	0.902000	0.36520	0.460000	0.39030	ATT	ZFP112	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000062370		0.413	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFP112	HGNC	protein_coding	OTTHUMT00000460744.1	253	0.00	0	T	NM_013380		44831696	44831696	-1	no_errors	ENST00000536500	ensembl	human	known	69_37n	missense	205	36.81	120	SNP	0.002	C
ZNF572	137209	genome.wustl.edu	37	8	125989263	125989263	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr8:125989263A>T	ENST00000319286.5	+	3	907	c.753A>T	c.(751-753)aaA>aaT	p.K251N		NM_152412.2	NP_689625.2	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	251					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	31	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			TCTGCGGAAAAGGCTTCAGTC	0.443										HNSCC(60;0.17)																												dbGAP											0													67.0	67.0	67.0					8																	125989263		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX537876	CCDS6354.1	8q24.13	2013-09-20			ENSG00000180938	ENSG00000180938		"""Zinc fingers, C2H2-type"""	26758	protein-coding gene	gene with protein product							Standard	NM_152412		Approved	FLJ38002	uc003yrr.3	Q7Z3I7	OTTHUMG00000164988	ENST00000319286.5:c.753A>T	8.37:g.125989263A>T	ENSP00000319305:p.Lys251Asn		A1L4F1|Q8N1Q0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K251N	ENST00000319286.5	37	c.753	CCDS6354.1	8	.	.	.	.	.	.	.	.	.	.	A	17.59	3.427826	0.62733	.	.	ENSG00000180938	ENST00000319286	T	0.07908	3.15	4.95	3.81	0.43845	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.121926	0.37053	N	0.002274	T	0.32071	0.0817	M	0.92833	3.35	0.27222	N	0.959626	D	0.69078	0.997	D	0.66979	0.948	T	0.27971	-1.0058	10	0.87932	D	0	-13.2207	8.3875	0.32510	0.9076:0.0:0.0924:0.0	.	251	Q7Z3I7	ZN572_HUMAN	N	251	ENSP00000319305:K251N	ENSP00000319305:K251N	K	+	3	2	ZNF572	126058444	0.024000	0.19004	1.000000	0.80357	0.991000	0.79684	0.401000	0.20948	0.940000	0.37473	0.533000	0.62120	AAA	ZNF572	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000180938		0.443	ZNF572-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF572	HGNC	protein_coding	OTTHUMT00000381359.1	219	0.00	0	A	NM_152412		125989263	125989263	+1	no_errors	ENST00000319286	ensembl	human	known	69_37n	missense	528	14.29	88	SNP	1.000	T
ZNF831	128611	genome.wustl.edu	37	20	57769139	57769140	+	Frame_Shift_Ins	INS	-	-	G	rs55786258	byFrequency	TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr20:57769139_57769140insG	ENST00000371030.2	+	1	3065_3066	c.3065_3066insG	c.(3064-3069)ttggggfs	p.LG1022fs		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1022							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.D1025fs*9(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GGGGCACAGTTGGGGGGGGACA	0.678																																						dbGAP											1	Insertion - Frameshift(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3073dupG	20.37:g.57769147_57769147dupG	ENSP00000360069:p.Leu1022fs		Q5TDR4|Q8TCP0	Frame_Shift_Ins	INS	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D1025fs	ENST00000371030.2	37	c.3065_3066	CCDS42894.1	20																																																																																			ZNF831	-	NULL	ENSG00000124203		0.678	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	HGNC	protein_coding	OTTHUMT00000079916.2	18	0.00	0	-	NM_178457		57769139	57769140	+1	no_errors	ENST00000371030	ensembl	human	novel	69_37n	frame_shift_ins	26	13.33	4	INS	0.000:0.000	G
ZSWIM5	57643	genome.wustl.edu	37	1	45516799	45516799	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A07L-01A-11W-A019-09	TCGA-A8-A07L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4cc86f29-061e-4058-8e8f-4c48191f52aa	44a4c963-3b68-4537-a0da-e47fe5f1d7ac	g.chr1:45516799T>A	ENST00000359600.5	-	5	1584	c.1379A>T	c.(1378-1380)cAt>cTt	p.H460L		NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5	460						extracellular space (GO:0005615)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					GGGCAGCTCATGTCCATAGTT	0.527																																						dbGAP											0													91.0	91.0	91.0					1																	45516799		2042	4191	6233	-	-	-	SO:0001583	missense	0			AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.1379A>T	1.37:g.45516799T>A	ENSP00000352614:p.His460Leu		Q5SXQ9	Missense_Mutation	SNP	pfscan_Znf_SWIM	p.H460L	ENST00000359600.5	37	c.1379	CCDS41319.1	1	.	.	.	.	.	.	.	.	.	.	T	9.322	1.058225	0.19987	.	.	ENSG00000162415	ENST00000359600	T	0.41758	0.99	4.84	4.84	0.62591	.	0.184787	0.56097	D	0.000040	T	0.20414	0.0491	N	0.03608	-0.345	0.35650	D	0.811671	B	0.02656	0.0	B	0.01281	0.0	T	0.17289	-1.0374	10	0.11485	T	0.65	-12.8991	15.1438	0.72633	0.0:0.0:0.0:1.0	.	460	Q9P217	ZSWM5_HUMAN	L	460	ENSP00000352614:H460L	ENSP00000352614:H460L	H	-	2	0	ZSWIM5	45289386	0.999000	0.42202	1.000000	0.80357	0.987000	0.75469	3.053000	0.49901	2.133000	0.65898	0.533000	0.62120	CAT	ZSWIM5	-	NULL	ENSG00000162415		0.527	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM5	HGNC	protein_coding	OTTHUMT00000024823.2	144	0.00	0	T	XM_046581		45516799	45516799	-1	no_errors	ENST00000359600	ensembl	human	known	69_37n	missense	93	47.75	85	SNP	1.000	A
