#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA4	24	genome.wustl.edu	37	1	94577116	94577116	+	Silent	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:94577116C>T	ENST00000370225.3	-	3	266	c.180G>A	c.(178-180)gcG>gcA	p.A60A	ABCA4_ENST00000535735.1_Silent_p.A60A	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	60			A -> E (in STGD1). {ECO:0000269|PubMed:10958763}.|A -> T (in STGD1). {ECO:0000269|PubMed:10958763}.|A -> V (in STGD1). {ECO:0000269|PubMed:10206579, ECO:0000269|PubMed:11527935}.		phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.A60A(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CTGAGGGCATCGCCTTGTTGG	0.512																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											68.0	68.0	68.0					1																	94577116		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.180G>A	1.37:g.94577116C>T			O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.A60	ENST00000370225.3	37	c.180	CCDS747.1	1																																																																																			ABCA4	-	tigrfam_Rim_ABC_transpt	ENSG00000198691		0.512	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	HGNC	protein_coding	OTTHUMT00000029320.1	99	0.00	0	C	NM_000350		94577116	94577116	-1	no_errors	ENST00000370225	ensembl	human	known	69_37n	silent	24	36.84	14	SNP	0.986	T
ABL1	25	genome.wustl.edu	37	9	133753849	133753849	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr9:133753849T>C	ENST00000318560.5	+	8	1699	c.1318T>C	c.(1318-1320)Tac>Cac	p.Y440H		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	440	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)	p.Y440H(1)		breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	CATGTCCCCTTACCCGGGAAT	0.493			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																	dbGAP		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	1	Substitution - Missense(1)	breast(1)											172.0	163.0	166.0					9																	133753849		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.1318T>C	9.37:g.133753849T>C	ENSP00000323315:p.Tyr440His		A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Missense_Mutation	SNP	pfam_F-actin_binding,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_F-actin_binding,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.Y459H	ENST00000318560.5	37	c.1375	CCDS35166.1	9	.	.	.	.	.	.	.	.	.	.	T	29.5	5.009022	0.93346	.	.	ENSG00000097007	ENST00000444970;ENST00000372348;ENST00000318560	T;T	0.64438	-0.1;-0.1	5.25	5.25	0.73442	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.128020	0.53938	D	0.000041	D	0.83394	0.5245	M	0.92459	3.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.87665	0.2537	10	0.87932	D	0	.	14.644	0.68745	0.0:0.0:0.0:1.0	.	440;477	P00519;Q59FK4	ABL1_HUMAN;.	H	255;459;440	ENSP00000361423:Y459H;ENSP00000323315:Y440H	ENSP00000323315:Y440H	Y	+	1	0	ABL1	132743670	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.997000	0.88414	2.111000	0.64477	0.533000	0.62120	TAC	ABL1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000097007		0.493	ABL1-001	KNOWN	basic|CCDS	protein_coding	ABL1	HGNC	protein_coding	OTTHUMT00000054684.1	354	0.00	0	T	NM_007313		133753849	133753849	+1	no_errors	ENST00000372348	ensembl	human	known	69_37n	missense	161	16.15	31	SNP	1.000	C
ADAMTS12	81792	genome.wustl.edu	37	5	33576371	33576371	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr5:33576371C>T	ENST00000504830.1	-	19	4095	c.3760G>A	c.(3760-3762)Gac>Aac	p.D1254N	ADAMTS12_ENST00000504582.1_5'Flank|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.D1169N	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1254	Spacer 2.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D1254N(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GGCTGGTGGTCTCCTCCCAGA	0.527										HNSCC(64;0.19)																												dbGAP											1	Substitution - Missense(1)	breast(1)											160.0	160.0	160.0					5																	33576371		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.3760G>A	5.37:g.33576371C>T	ENSP00000422554:p.Asp1254Asn		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.D1254N	ENST00000504830.1	37	c.3760	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	C	4.682	0.126765	0.08931	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.58652	0.32;0.32	5.47	1.02	0.19986	.	1.380650	0.04251	N	0.338632	T	0.38214	0.1032	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.14587	-1.0467	10	0.26408	T	0.33	.	1.5662	0.02605	0.1233:0.3485:0.2423:0.2858	.	1169;1254	P58397-3;P58397	.;ATS12_HUMAN	N	1254;1169	ENSP00000422554:D1254N;ENSP00000344847:D1169N	ENSP00000344847:D1169N	D	-	1	0	ADAMTS12	33612128	0.000000	0.05858	0.001000	0.08648	0.194000	0.23727	0.033000	0.13754	0.258000	0.21686	-0.768000	0.03414	GAC	ADAMTS12	-	NULL	ENSG00000151388		0.527	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2	609	0.16	1	C	NM_030955		33576371	33576371	-1	no_errors	ENST00000504830	ensembl	human	known	69_37n	missense	222	27.21	83	SNP	0.000	T
AKAP3	10566	genome.wustl.edu	37	12	4737716	4737716	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:4737716C>G	ENST00000545990.2	-	5	876	c.352G>C	c.(352-354)Ggg>Cgg	p.G118R	RP11-500M8.7_ENST00000536588.1_Intron|AKAP3_ENST00000228850.1_Missense_Mutation_p.G118R	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	118			G -> E (in dbSNP:rs2072355). {ECO:0000269|PubMed:10334916, ECO:0000269|PubMed:10529264, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)	p.G118R(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						ACTGAACTCCCGTTGCCAAGT	0.493																																						dbGAP											2	Substitution - Missense(2)	breast(2)											112.0	102.0	105.0					12																	4737716		2203	4300	6503	-	-	-	SO:0001583	missense	0			U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.352G>C	12.37:g.4737716C>G	ENSP00000440994:p.Gly118Arg		O75945|Q86X01|Q9UM61	Missense_Mutation	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.G118R	ENST00000545990.2	37	c.352	CCDS8531.1	12	.	.	.	.	.	.	.	.	.	.	C	5.504	0.278010	0.10403	.	.	ENSG00000111254	ENST00000228850;ENST00000545990;ENST00000540967	T;T;T	0.35973	3.24;3.24;1.28	4.7	-0.381	0.12485	.	0.707718	0.13280	N	0.399781	T	0.24624	0.0597	L	0.51422	1.61	0.09310	N	1	B	0.22414	0.069	B	0.15052	0.012	T	0.22452	-1.0216	10	0.20519	T	0.43	.	4.2115	0.10514	0.1554:0.4111:0.0:0.4335	.	118	O75969	AKAP3_HUMAN	R	118	ENSP00000228850:G118R;ENSP00000440994:G118R;ENSP00000442376:G118R	ENSP00000228850:G118R	G	-	1	0	AKAP3	4607977	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.298000	0.08265	-0.170000	0.10816	-0.726000	0.03593	GGG	AKAP3	-	smart_AKAP_110	ENSG00000111254		0.493	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP3	HGNC	protein_coding	OTTHUMT00000398911.2	465	0.00	0	C	NM_006422		4737716	4737716	-1	no_errors	ENST00000228850	ensembl	human	known	69_37n	missense	168	25.00	56	SNP	0.000	G
ANKRD26	22852	genome.wustl.edu	37	10	27324347	27324347	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr10:27324347G>C	ENST00000376087.4	-	24	3197	c.3032C>G	c.(3031-3033)tCt>tGt	p.S1011C	ANKRD26_ENST00000436985.2_Missense_Mutation_p.S1027C|ANKRD26_ENST00000376070.3_Missense_Mutation_p.S568C	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	1010					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)		p.S1011C(1)		breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						AGCCAATCTAGAATGGTATGA	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											234.0	210.0	218.0					10																	27324347		1898	4124	6022	-	-	-	SO:0001583	missense	0			AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.3032C>G	10.37:g.27324347G>C	ENSP00000365255:p.Ser1011Cys		A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Polyketide_synth_docking,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S1027C	ENST00000376087.4	37	c.3080	CCDS41499.1	10	.	.	.	.	.	.	.	.	.	.	G	4.929	0.172693	0.09391	.	.	ENSG00000107890	ENST00000376070;ENST00000376087;ENST00000436985	T;T;T	0.18016	2.24;2.24;2.24	5.64	5.64	0.86602	.	0.120245	0.36409	N	0.002602	T	0.25005	0.0607	L	0.42581	1.335	0.09310	N	1	B;B;D	0.55172	0.003;0.002;0.97	B;B;P	0.51487	0.005;0.002;0.671	T	0.09840	-1.0656	10	0.25751	T	0.34	.	17.189	0.86874	0.0:0.0:1.0:0.0	.	1011;1010;1027	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	C	568;1011;1027	ENSP00000365238:S568C;ENSP00000365255:S1011C;ENSP00000405112:S1027C	ENSP00000365238:S568C	S	-	2	0	ANKRD26	27364353	0.944000	0.32072	0.011000	0.14972	0.024000	0.10985	3.921000	0.56454	2.675000	0.91044	0.591000	0.81541	TCT	ANKRD26	-	NULL	ENSG00000107890		0.388	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD26	HGNC	protein_coding	OTTHUMT00000047296.1	587	0.00	0	G			27324347	27324347	-1	no_errors	ENST00000436985	ensembl	human	known	69_37n	missense	247	39.95	165	SNP	0.006	C
ANO10	55129	genome.wustl.edu	37	3	43640099	43640099	+	Missense_Mutation	SNP	C	C	G	rs571983239	byFrequency	TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr3:43640099C>G	ENST00000292246.3	-	4	567	c.397G>C	c.(397-399)Gaa>Caa	p.E133Q	ANO10_ENST00000414522.2_Missense_Mutation_p.E133Q|ANO10_ENST00000451430.2_Intron|ANO10_ENST00000350459.4_Missense_Mutation_p.E133Q|ANO10_ENST00000396091.3_Missense_Mutation_p.E67Q	NM_018075.3	NP_060545.3	Q9NW15	ANO10_HUMAN	anoctamin 10	133					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell death (GO:0008219)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)	p.E133Q(1)		NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(3)|skin(3)	29						CTAAGATTTTCAAGTTCATGT	0.313																																						dbGAP											1	Substitution - Missense(1)	breast(1)											124.0	119.0	121.0					3																	43640099		2203	4295	6498	-	-	-	SO:0001583	missense	0			AL832508	CCDS2710.2, CCDS56247.1, CCDS56248.1, CCDS56249.1, CCDS56250.1	3p22.1-p21.33	2014-04-09	2008-08-28	2008-08-28	ENSG00000160746	ENSG00000160746		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25519	protein-coding gene	gene with protein product		613726	"""transmembrane protein 16K"""	TMEM16K		12477932, 24692353	Standard	NM_001204831		Approved	FLJ10375, MGC47890, SCAR10	uc003cmv.3	Q9NW15	OTTHUMG00000133044	ENST00000292246.3:c.397G>C	3.37:g.43640099C>G	ENSP00000292246:p.Glu133Gln		A8K8K3|A8MV74|B3KTZ1|B3KY93|B4DJ83|B4DNK2|B7WP12|C9JHS1|Q8IXX9	Missense_Mutation	SNP	pfam_Anoctamin	p.E133Q	ENST00000292246.3	37	c.397	CCDS2710.2	3	.	.	.	.	.	.	.	.	.	.	C	29.7	5.030584	0.93575	.	.	ENSG00000160746	ENST00000292246;ENST00000350459;ENST00000396091;ENST00000414522;ENST00000427171;ENST00000444344;ENST00000456438;ENST00000413397;ENST00000439141	T;T;T;T;T;T	0.71934	0.19;-0.61;0.2;0.22;2.0;1.93	5.87	5.87	0.94306	.	0.096786	0.64402	D	0.000001	T	0.79046	0.4380	L	0.43152	1.355	0.80722	D	1	D;D;D;B	0.76494	0.986;0.999;0.977;0.248	P;D;P;B	0.65443	0.772;0.935;0.854;0.206	T	0.73300	-0.4026	10	0.25751	T	0.34	.	20.2192	0.98319	0.0:1.0:0.0:0.0	.	133;133;67;133	C9JHS1;Q9NW15-2;Q9NW15-3;Q9NW15	.;.;.;ANO10_HUMAN	Q	133;133;67;133;133;133;133;133;133	ENSP00000292246:E133Q;ENSP00000327767:E133Q;ENSP00000379398:E67Q;ENSP00000396990:E133Q;ENSP00000406432:E133Q;ENSP00000402010:E133Q	ENSP00000292246:E133Q	E	-	1	0	ANO10	43615103	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.861000	0.75478	2.780000	0.95670	0.655000	0.94253	GAA	ANO10	-	NULL	ENSG00000160746		0.313	ANO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO10	HGNC	protein_coding	OTTHUMT00000256649.2	294	0.00	0	C	NM_018075		43640099	43640099	-1	no_errors	ENST00000292246	ensembl	human	known	69_37n	missense	103	26.95	38	SNP	1.000	G
ARRDC3	57561	genome.wustl.edu	37	5	90669934	90669934	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr5:90669934C>T	ENST00000265138.3	-	6	1296	c.1030G>A	c.(1030-1032)Gaa>Aaa	p.E344K	ARRDC3_ENST00000503192.1_5'Flank	NM_020801.2	NP_065852.1	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	344					fat pad development (GO:0060613)|negative regulation of heat generation (GO:0031651)|negative regulation of locomotion involved in locomotory behavior (GO:0090327)|negative regulation of multicellular organismal metabolic process (GO:0044252)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|skin development (GO:0043588)|temperature homeostasis (GO:0001659)	endosome (GO:0005768)|plasma membrane (GO:0005886)	beta-3 adrenergic receptor binding (GO:0031699)	p.E344K(1)		breast(2)|endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	18		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		AAATTACCTTCAGGTCTTTCA	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											169.0	168.0	168.0					5																	90669934		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037797	CCDS34202.1	5q14.3	2013-10-11			ENSG00000113369	ENSG00000113369			29263	protein-coding gene	gene with protein product	"""alpha-arrestin 3"""	612464				10718198, 19605364	Standard	NM_020801		Approved	KIAA1376	uc003kjz.2	Q96B67	OTTHUMG00000162616	ENST00000265138.3:c.1030G>A	5.37:g.90669934C>T	ENSP00000265138:p.Glu344Lys		A8K6T8|Q9P2H1	Missense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.E344K	ENST00000265138.3	37	c.1030	CCDS34202.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.426639	0.96131	.	.	ENSG00000113369	ENST00000265138	T	0.09538	2.97	5.86	5.86	0.93980	Immunoglobulin E-set (1);	0.000000	0.85682	D	0.000000	T	0.13543	0.0328	L	0.59912	1.85	0.80722	D	1	P	0.46987	0.888	B	0.37015	0.239	T	0.09207	-1.0685	10	0.22706	T	0.39	.	20.1986	0.98248	0.0:1.0:0.0:0.0	.	344	Q96B67	ARRD3_HUMAN	K	344	ENSP00000265138:E344K	ENSP00000265138:E344K	E	-	1	0	ARRDC3	90705690	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.818000	0.86416	2.781000	0.95711	0.650000	0.86243	GAA	ARRDC3	-	superfamily_Ig_E-set	ENSG00000113369		0.353	ARRDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC3	HGNC	protein_coding	OTTHUMT00000369763.2	384	0.00	0	C	NM_020801		90669934	90669934	-1	no_errors	ENST00000265138	ensembl	human	known	69_37n	missense	50	37.80	31	SNP	1.000	T
ATP1A4	480	genome.wustl.edu	37	1	160121908	160121908	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:160121908C>G	ENST00000368081.4	+	1	549	c.78C>G	c.(76-78)atC>atG	p.I26M		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	26					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.I26M(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AAGGGCTTATCAAGAAAAAAA	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											86.0	82.0	83.0					1																	160121908		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.78C>G	1.37:g.160121908C>G	ENSP00000357060:p.Ile26Met		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.I26M	ENST00000368081.4	37	c.78	CCDS1197.1	1	.	.	.	.	.	.	.	.	.	.	C	3.017	-0.202568	0.06219	.	.	ENSG00000132681	ENST00000368081	D	0.93189	-3.18	3.03	-6.05	0.02172	.	.	.	.	.	T	0.64405	0.2595	N	0.08118	0	0.09310	N	1	B	0.26120	0.142	B	0.28139	0.086	T	0.63019	-0.6730	9	0.42905	T	0.14	.	1.1589	0.01802	0.4626:0.1183:0.2465:0.1726	.	26	Q13733	AT1A4_HUMAN	M	26	ENSP00000357060:I26M	ENSP00000357060:I26M	I	+	3	3	ATP1A4	158388532	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.043000	0.03535	-1.768000	0.01298	-1.114000	0.02060	ATC	ATP1A4	-	NULL	ENSG00000132681		0.507	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A4	HGNC	protein_coding	OTTHUMT00000077415.1	176	0.56	1	C	NM_144699		160121908	160121908	+1	no_errors	ENST00000368081	ensembl	human	known	69_37n	missense	57	31.76	27	SNP	0.000	G
ATF6	22926	genome.wustl.edu	37	1	161771862	161771862	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:161771862C>T	ENST00000367942.3	+	7	776	c.709C>T	c.(709-711)Cag>Tag	p.Q237*		NM_007348.3	NP_031374.2	P18850	ATF6A_HUMAN	activating transcription factor 6	237					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response (GO:0006990)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to stress (GO:0006950)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.Q237*(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(14)|ovary(3)|skin(1)|stomach(1)	34	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)		Pseudoephedrine(DB00852)	TTTGCTGTCTCAGCCTACTGT	0.498																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											132.0	116.0	121.0					1																	161771862		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB015856	CCDS1235.1	1q22-q23	2013-01-10			ENSG00000118217	ENSG00000118217		"""basic leucine zipper proteins"""	791	protein-coding gene	gene with protein product	"""activating transcription factor 6 alpha"""	605537				9837962, 9271374, 11256944	Standard	NM_007348		Approved	ATF6A	uc001gbs.3	P18850	OTTHUMG00000023961	ENST00000367942.3:c.709C>T	1.37:g.161771862C>T	ENSP00000356919:p.Gln237*		O15139|Q5VW62|Q6IPB5|Q9UEC9	Nonsense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,smart_bZIP,pfscan_bZIP	p.Q237*	ENST00000367942.3	37	c.709	CCDS1235.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.408764	0.97542	.	.	ENSG00000118217	ENST00000367942	.	.	.	5.75	4.84	0.62591	.	0.456813	0.25689	N	0.028955	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	-0.8713	12.7372	0.57232	0.0:0.9206:0.0:0.0794	.	.	.	.	X	237	.	ENSP00000356919:Q237X	Q	+	1	0	ATF6	160038486	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.399000	0.52586	1.434000	0.47414	0.655000	0.94253	CAG	ATF6	-	NULL	ENSG00000118217		0.498	ATF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF6	HGNC	protein_coding	OTTHUMT00000060304.2	377	0.00	0	C	NM_007348		161771862	161771862	+1	no_errors	ENST00000367942	ensembl	human	known	69_37n	nonsense	99	29.29	41	SNP	1.000	T
ATRX	546	genome.wustl.edu	37	X	76938228	76938229	+	Frame_Shift_Del	DEL	TC	TC	-	rs191682105		TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chrX:76938228_76938229delTC	ENST00000373344.5	-	9	2733_2734	c.2519_2520delGA	c.(2518-2520)agafs	p.R840fs	ATRX_ENST00000395603.3_Frame_Shift_Del_p.R802fs|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	840					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TATTTGGAATTCTTTTTTTGGT	0.351			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																															dbGAP		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)																																								-	-	-	SO:0001589	frameshift_variant	0			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.2519_2520delGA	X.37:g.76938228_76938229delTC	ENSP00000362441:p.Arg840fs		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Del	DEL	pfam_SNF2_N,pfam_Helicase_C,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R840fs	ENST00000373344.5	37	c.2520_2519	CCDS14434.1	X																																																																																			ATRX	-	NULL	ENSG00000085224		0.351	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	1299	0.00	0	TC	NM_000489		76938228	76938229	-1	no_errors	ENST00000373344	ensembl	human	known	69_37n	frame_shift_del	385	26.09	138	DEL	0.854:0.868	-
BAZ2A	11176	genome.wustl.edu	37	12	57006975	57006975	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:57006975A>C	ENST00000551812.1	-	5	1158	c.965T>G	c.(964-966)cTg>cGg	p.L322R	BAZ2A_ENST00000179765.5_Missense_Mutation_p.L290R|BAZ2A_ENST00000549884.1_Missense_Mutation_p.L320R|BAZ2A_ENST00000379441.3_Missense_Mutation_p.L292R	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	322					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.L322R(2)|p.L358R(1)		breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						TGCACCCATCAGCTCCGTGTC	0.473																																						dbGAP											3	Substitution - Missense(3)	breast(3)											142.0	143.0	142.0					12																	57006975		2042	4185	6227	-	-	-	SO:0001583	missense	0			AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.965T>G	12.37:g.57006975A>C	ENSP00000446880:p.Leu322Arg		B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_integrase-typ,superfamily_Znf_FYVE_PHD,smart_Methyl_CpG_DNA-bd,smart_AT_hook_DNA-bd_motif,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.L322R	ENST00000551812.1	37	c.965	CCDS44924.1	12	.	.	.	.	.	.	.	.	.	.	A	16.71	3.197482	0.58126	.	.	ENSG00000076108	ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549884	T;T;T;T	0.71817	-0.4;-0.4;-0.6;-0.6	5.14	5.14	0.70334	.	0.382752	0.24213	N	0.040514	T	0.71626	0.3362	N	0.14661	0.345	0.36720	D	0.881119	D;D	0.71674	0.998;0.997	D;D	0.69142	0.962;0.916	T	0.79748	-0.1673	10	0.87932	D	0	-18.5571	14.3813	0.66914	1.0:0.0:0.0:0.0	.	320;322	F8VU39;Q9UIF9	.;BAZ2A_HUMAN	R	292;290;322;320	ENSP00000368754:L292R;ENSP00000179765:L290R;ENSP00000446880:L322R;ENSP00000447941:L320R	ENSP00000179765:L290R	L	-	2	0	BAZ2A	55293242	1.000000	0.71417	1.000000	0.80357	0.306000	0.27790	4.976000	0.63785	2.291000	0.77112	0.533000	0.62120	CTG	BAZ2A	-	NULL	ENSG00000076108		0.473	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAZ2A	HGNC	protein_coding	OTTHUMT00000408561.1	396	0.75	3	A	NM_013449		57006975	57006975	-1	no_errors	ENST00000551812	ensembl	human	known	69_37n	missense	148	31.02	67	SNP	1.000	C
BDP1	55814	genome.wustl.edu	37	5	70806172	70806172	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr5:70806172G>A	ENST00000358731.4	+	17	3516	c.3253G>A	c.(3253-3255)Gag>Aag	p.E1085K	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	1085	9 X 55 AA repeats of G-R-R-X-I-S-P-X-E-N- G-X-E-E-V-K-P-X-X-E-M-E-T-D-L-K-X-T-G-R- E-X-X-X-R-E-K-T-X-E-X-X-D-A-X-E-E-I-D-X- D-L-E-E-T.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E1085K(1)		NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TGATGCCATTGAGGAAATAGA	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											82.0	81.0	82.0					5																	70806172		1813	4088	5901	-	-	-	SO:0001583	missense	0			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.3253G>A	5.37:g.70806172G>A	ENSP00000351575:p.Glu1085Lys		Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.E1085K	ENST00000358731.4	37	c.3253	CCDS43328.1	5	.	.	.	.	.	.	.	.	.	.	g	10.77	1.443272	0.25987	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	T	0.19532	2.14	3.28	1.42	0.22433	.	1.719840	0.03664	N	0.242994	T	0.16085	0.0387	L	0.38531	1.155	0.09310	N	0.999998	B;B;B	0.20550	0.046;0.046;0.01	B;B;B	0.15870	0.014;0.014;0.009	T	0.23476	-1.0187	10	0.16896	T	0.51	.	4.8687	0.13622	0.301:0.0:0.699:0.0	.	1085;1085;1085	A6H8Y1;A6H8Y1-2;A6H8Y1-4	BDP1_HUMAN;.;.	K	1085;665	ENSP00000351575:E1085K	ENSP00000351575:E1085K	E	+	1	0	BDP1	70841928	0.000000	0.05858	0.002000	0.10522	0.152000	0.21847	-0.502000	0.06390	0.377000	0.24735	0.185000	0.17295	GAG	BDP1	-	NULL	ENSG00000145734		0.443	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BDP1	HGNC	protein_coding	OTTHUMT00000374681.2	499	0.20	1	G	NM_018429		70806172	70806172	+1	no_errors	ENST00000358731	ensembl	human	known	69_37n	missense	199	28.42	79	SNP	0.003	A
BRDT	676	genome.wustl.edu	37	1	92443818	92443818	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:92443818G>A	ENST00000362005.3	+	8	1481	c.1063G>A	c.(1063-1065)Gat>Aat	p.D355N	BRDT_ENST00000370389.2_Missense_Mutation_p.D282N|BRDT_ENST00000394530.3_Missense_Mutation_p.D309N|BRDT_ENST00000402388.1_Missense_Mutation_p.D355N|BRDT_ENST00000484781.1_3'UTR|BRDT_ENST00000399546.2_Missense_Mutation_p.D355N	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	355	Bromo 2. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)	p.D355N(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		CAATCCTCCAGATCACGAAGT	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											98.0	95.0	96.0					1																	92443818		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.1063G>A	1.37:g.92443818G>A	ENSP00000354568:p.Asp355Asn		A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.D355N	ENST00000362005.3	37	c.1063	CCDS735.1	1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.656854	0.88154	.	.	ENSG00000137948	ENST00000362005;ENST00000370389;ENST00000399546;ENST00000539070;ENST00000394530;ENST00000426141;ENST00000402388	T;T;T;T;T;T	0.20332	2.08;2.08;2.08;2.08;2.08;2.08	5.11	5.11	0.69529	Bromodomain (6);	0.000000	0.64402	D	0.000001	T	0.39517	0.1081	M	0.66439	2.03	0.44042	D	0.996778	P;P;D;D	0.76494	0.835;0.835;0.987;0.999	P;P;D;D	0.83275	0.62;0.62;0.946;0.996	T	0.34129	-0.9841	10	0.87932	D	0	-14.2765	18.5233	0.90962	0.0:0.0:1.0:0.0	.	309;309;359;355	B7ZAX7;B7Z811;B7Z890;Q58F21	.;.;.;BRDT_HUMAN	N	355;282;355;355;309;355;355	ENSP00000354568:D355N;ENSP00000359416:D282N;ENSP00000387822:D355N;ENSP00000378038:D309N;ENSP00000404969:D355N;ENSP00000384051:D355N	ENSP00000354568:D355N	D	+	1	0	BRDT	92216406	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.650000	0.61440	2.384000	0.81235	0.650000	0.86243	GAT	BRDT	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	ENSG00000137948		0.368	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRDT	HGNC	protein_coding	OTTHUMT00000027980.2	211	0.00	0	G	NM_207189		92443818	92443818	+1	no_errors	ENST00000362005	ensembl	human	known	69_37n	missense	32	51.52	34	SNP	1.000	A
BTD	686	genome.wustl.edu	37	3	15686759	15686759	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr3:15686759C>G	ENST00000303498.5	+	4	1505	c.1396C>G	c.(1396-1398)Ctt>Gtt	p.L466V	BTD_ENST00000437172.1_Missense_Mutation_p.L468V|BTD_ENST00000383778.4_Missense_Mutation_p.L446V|BTD_ENST00000449107.1_Missense_Mutation_p.L468V	NM_000060.2|NM_001281723.1	NP_000051.1|NP_001268652.1	P43251	BTD_HUMAN	biotinidase	466					biotin metabolic process (GO:0006768)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleolus (GO:0005730)|perikaryon (GO:0043204)	biotin carboxylase activity (GO:0004075)|biotinidase activity (GO:0047708)	p.L466V(1)		breast(2)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	18						GTGTGGGGGTCTTGGCTTCGA	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											100.0	103.0	102.0					3																	15686759		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF018631	CCDS2628.1, CCDS63563.1, CCDS63564.1, CCDS63565.1	3p25	2007-03-26			ENSG00000169814	ENSG00000169814	3.5.1.12		1122	protein-coding gene	gene with protein product		609019				8001986	Standard	NM_001281723		Approved		uc003cah.3	P43251	OTTHUMG00000129861	ENST00000303498.5:c.1396C>G	3.37:g.15686759C>G	ENSP00000306477:p.Leu466Val		A6NHF2|B2R865|B4DFX1|B4DLJ9|B7Z7C9|F8W1Q3|Q96EM9	Missense_Mutation	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase	p.L466V	ENST00000303498.5	37	c.1396	CCDS2628.1	3	.	.	.	.	.	.	.	.	.	.	C	8.224	0.803053	0.16397	.	.	ENSG00000169814	ENST00000449107;ENST00000303498;ENST00000437172;ENST00000383778	D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23	5.58	3.76	0.43208	.	0.960141	0.08721	N	0.903431	D	0.83482	0.5264	M	0.65975	2.015	0.09310	N	1	B;B;B	0.31485	0.325;0.325;0.325	B;B;B	0.23852	0.049;0.049;0.049	T	0.68796	-0.5314	10	0.30078	T	0.28	-44.0565	7.34	0.26632	0.1283:0.6807:0.1236:0.0673	.	468;468;466	A6NHF2;B4DLJ9;P43251	.;.;BTD_HUMAN	V	468;466;468;446	ENSP00000388212:L468V;ENSP00000306477:L466V;ENSP00000400995:L468V;ENSP00000373288:L446V	ENSP00000306477:L466V	L	+	1	0	BTD	15661763	0.000000	0.05858	0.019000	0.16419	0.964000	0.63967	1.261000	0.32980	0.697000	0.31718	0.561000	0.74099	CTT	BTD	-	pirsf_Biotinidase_euk	ENSG00000169814		0.502	BTD-001	KNOWN	basic|CCDS	protein_coding	BTD	HGNC	protein_coding	OTTHUMT00000252103.2	268	0.00	0	C	NM_000060		15686759	15686759	+1	no_errors	ENST00000303498	ensembl	human	known	69_37n	missense	97	25.38	33	SNP	0.000	G
BSN	8927	genome.wustl.edu	37	3	49695519	49695519	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr3:49695519A>T	ENST00000296452.4	+	5	8644	c.8530A>T	c.(8530-8532)Aag>Tag	p.K2844*		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	2844					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.K2844*(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TCGCCCCATGAAGACCCTGCA	0.617																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											46.0	51.0	49.0					3																	49695519		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.8530A>T	3.37:g.49695519A>T	ENSP00000296452:p.Lys2844*		O43161|Q7LGH3	Nonsense_Mutation	SNP	pfam_Znf_piccolo,superfamily_Znf_FYVE_PHD	p.K2844*	ENST00000296452.4	37	c.8530	CCDS2800.1	3	.	.	.	.	.	.	.	.	.	.	A	49	16.011825	0.99852	.	.	ENSG00000164061	ENST00000296452	.	.	.	5.54	5.54	0.83059	.	0.046686	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.4623	15.6628	0.77203	1.0:0.0:0.0:0.0	.	.	.	.	X	2844	.	ENSP00000296452:K2844X	K	+	1	0	BSN	49670523	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.334000	0.96470	2.110000	0.64415	0.459000	0.35465	AAG	BSN	-	NULL	ENSG00000164061		0.617	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	HGNC	protein_coding	OTTHUMT00000258164.1	69	0.00	0	A	NM_003458		49695519	49695519	+1	no_errors	ENST00000296452	ensembl	human	known	69_37n	nonsense	8	38.46	5	SNP	1.000	T
C1orf85	112770	genome.wustl.edu	37	1	156264264	156264264	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:156264264C>T	ENST00000362007.1	-	3	497	c.471G>A	c.(469-471)tgG>tgA	p.W157*	C1orf85_ENST00000482579.1_5'Flank	NM_001256604.1|NM_001256609.1|NM_144580.2	NP_001243533.1|NP_001243538.1|NP_653181.1	Q8WWB7	NCUG1_HUMAN	chromosome 1 open reading frame 85	157					intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.W157*(1)		breast(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(2)|skin(3)	14	Hepatocellular(266;0.158)					TGATGTTGTTCCAAGAGAAAT	0.532																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											121.0	110.0	114.0					1																	156264264		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC011575	CCDS1139.1, CCDS72947.1, CCDS72948.1, CCDS72949.1	1q22	2014-08-07			ENSG00000198715	ENSG00000198715			29436	protein-coding gene	gene with protein product	"""kidney lysosomal membrane protein"""					12975309, 18021396, 19489740	Standard	NM_144580		Approved	MGC31963, NCU-G1	uc001foh.4	Q8WWB7	OTTHUMG00000019789	ENST00000362007.1:c.471G>A	1.37:g.156264264C>T	ENSP00000354553:p.Trp157*		A6NH16|B4DJN4|Q5SZX4|Q6UX96|Q8IV07|Q96F65	Nonsense_Mutation	SNP	NULL	p.W157*	ENST00000362007.1	37	c.471	CCDS1139.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.143627	0.94603	.	.	ENSG00000198715	ENST00000362007;ENST00000368264	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.5261	16.6002	0.84812	0.0:1.0:0.0:0.0	.	.	.	.	X	157;71	.	ENSP00000354553:W157X	W	-	3	0	C1orf85	154530888	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.423000	0.66458	2.521000	0.84997	0.448000	0.29417	TGG	C1orf85	-	NULL	ENSG00000198715		0.532	C1orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf85	HGNC	protein_coding	OTTHUMT00000052108.1	97	0.00	0	C	NM_144580		156264264	156264264	-1	no_errors	ENST00000362007	ensembl	human	known	69_37n	nonsense	55	20.00	14	SNP	1.000	T
C2orf71	388939	genome.wustl.edu	37	2	29296746	29296746	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr2:29296746C>T	ENST00000331664.5	-	1	381	c.382G>A	c.(382-384)Gac>Aac	p.D128N		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	128					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)		p.D128N(1)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						CCAGAAAAGTCTGCCCCTTGT	0.463																																						dbGAP											1	Substitution - Missense(1)	breast(1)											254.0	240.0	244.0					2																	29296746		2013	4181	6194	-	-	-	SO:0001583	missense	0				CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.382G>A	2.37:g.29296746C>T	ENSP00000332809:p.Asp128Asn			Missense_Mutation	SNP	NULL	p.D128N	ENST00000331664.5	37	c.382	CCDS42669.1	2	.	.	.	.	.	.	.	.	.	.	C	2.835	-0.241711	0.05906	.	.	ENSG00000179270	ENST00000331664	T	0.19250	2.16	4.5	3.61	0.41365	.	0.845326	0.10345	N	0.685809	T	0.12689	0.0308	N	0.14661	0.345	0.09310	N	1	B	0.30973	0.302	B	0.26969	0.075	T	0.20840	-1.0263	10	0.15952	T	0.53	-0.6776	13.3514	0.60603	0.0:0.6561:0.3439:0.0	.	128	A6NGG8	CB071_HUMAN	N	128	ENSP00000332809:D128N	ENSP00000332809:D128N	D	-	1	0	C2orf71	29150250	0.000000	0.05858	0.003000	0.11579	0.061000	0.15899	0.297000	0.19101	0.990000	0.38787	0.561000	0.74099	GAC	C2orf71	-	NULL	ENSG00000179270		0.463	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf71	HGNC	protein_coding	OTTHUMT00000324924.3	306	0.00	0	C	NM_001029883		29296746	29296746	-1	no_errors	ENST00000331664	ensembl	human	novel	69_37n	missense	118	23.38	36	SNP	0.002	T
C2orf68	388969	genome.wustl.edu	37	2	85836560	85836560	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr2:85836560G>A	ENST00000306336.5	-	3	420	c.376C>T	c.(376-378)Cag>Tag	p.Q126*	C2orf68_ENST00000478626.1_5'Flank|USP39_ENST00000450066.2_5'Flank|USP39_ENST00000459775.1_Intron	NM_001013649.3	NP_001013671.2	Q2NKX9	CB068_HUMAN	chromosome 2 open reading frame 68	126								p.Q126*(1)		breast(1)|central_nervous_system(1)|endometrium(1)	3						AGGCGTACCTGATAGACGATA	0.547																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											188.0	191.0	190.0					2																	85836560		2065	4211	6276	-	-	-	SO:0001587	stop_gained	0				CCDS42704.1	2p11.2	2008-07-18			ENSG00000168887	ENSG00000168887			34353	protein-coding gene	gene with protein product							Standard	NM_001013649		Approved		uc002sqc.2	Q2NKX9	OTTHUMG00000153088	ENST00000306336.5:c.376C>T	2.37:g.85836560G>A	ENSP00000304410:p.Gln126*		B4DT10|Q4G0J7|Q6ZVA6	Nonsense_Mutation	SNP	pfam_UPF0561	p.Q126*	ENST00000306336.5	37	c.376	CCDS42704.1	2	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371646	0.82573	.	.	ENSG00000168887	ENST00000306336	.	.	.	5.26	5.26	0.73747	.	0.746488	0.12757	N	0.441692	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-18.3833	14.2478	0.65999	0.0:0.0:1.0:0.0	.	.	.	.	X	126	.	ENSP00000304410:Q126X	Q	-	1	0	C2orf68	85690071	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.593000	0.54001	2.753000	0.94483	0.555000	0.69702	CAG	C2orf68	-	pfam_UPF0561	ENSG00000168887		0.547	C2orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf68	HGNC	protein_coding	OTTHUMT00000329451.1	233	0.00	0	G	NM_001013649		85836560	85836560	-1	no_errors	ENST00000306336	ensembl	human	known	69_37n	nonsense	59	31.40	27	SNP	1.000	A
IGF2BP2	10644	genome.wustl.edu	37	3	185434630	185434630	+	Intron	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr3:185434630C>G	ENST00000382199.2	-	3	335				C3orf65_ENST00000296270.1_3'UTR|IGF2BP2_ENST00000346192.3_Intron|IGF2BP2_ENST00000457616.2_Intron|IGF2BP2_ENST00000421047.2_Intron	NM_006548.4	NP_006539.3	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding protein 2						anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	20	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			CAGCCTGGATCAGAGCTCCGA	0.517																																						dbGAP											0													63.0	67.0	65.0					3																	185434630		2076	4214	6290	-	-	-	SO:0001627	intron_variant	0			BC021290	CCDS3273.2, CCDS33903.1	3q27.2	2013-02-12			ENSG00000073792	ENSG00000073792		"""RNA binding motif (RRM) containing"""	28867	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 2"""	608289				10190901, 9891060	Standard	NM_001007225		Approved	IMP-2	uc003fpo.3	Q9Y6M1	OTTHUMG00000074025	ENST00000382199.2:c.240-18495G>C	3.37:g.185434630C>G			A0A4Z0|B3FTN2|B3FTN3|B3FTN4	RNA	SNP	-	NULL	ENST00000382199.2	37	NULL	CCDS3273.2	3																																																																																			C3orf65	-	-	ENSG00000163915		0.517	IGF2BP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C3orf65	HGNC	protein_coding	OTTHUMT00000157087.2	106	0.00	0	C	NM_006548		185434630	185434630	+1	no_errors	ENST00000470754	ensembl	human	putative	69_37n	rna	35	36.84	21	SNP	0.067	G
CACNA1A	773	genome.wustl.edu	37	19	13339552	13339552	+	Silent	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr19:13339552G>A	ENST00000573710.2	-	37	5867	c.5589C>T	c.(5587-5589)ctC>ctT	p.L1863L	CACNA1A_ENST00000574822.1_5'Flank|CACNA1A_ENST00000360228.5_Intron	NM_001127221.1	NP_001120693.1	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1863					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.L1863L(2)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TGCCTAAGCCGAGAGGGGGAG	0.458																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											63.0	58.0	60.0					19																	13339552		1568	3582	5150	-	-	-	SO:0001819	synonymous_variant	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000573710.2:c.5589C>T	19.37:g.13339552G>A			J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.L1862	ENST00000573710.2	37	c.5586	CCDS45999.1	19																																																																																			CACNA1A	-	NULL	ENSG00000141837		0.458	CACNA1A-002	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000439639.2	123	0.00	0	G	NM_000068		13339552	13339552	-1	no_errors	ENST00000573710	ensembl	human	known	69_37n	silent	71	21.98	20	SNP	1.000	A
CACNA1B	774	genome.wustl.edu	37	9	140880937	140880937	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr9:140880937C>G	ENST00000371372.1	+	14	1987	c.1842C>G	c.(1840-1842)ttC>ttG	p.F614L	CACNA1B_ENST00000371363.1_Missense_Mutation_p.F614L|CACNA1B_ENST00000371355.4_Missense_Mutation_p.F615L|CACNA1B_ENST00000371357.1_Missense_Mutation_p.F615L|CACNA1B_ENST00000277551.2_Missense_Mutation_p.F614L|CACNA1B_ENST00000277549.5_5'UTR	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	614					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)	p.F614L(2)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GCCTGCTCTTCTTGCTCTTCC	0.622																																						dbGAP											2	Substitution - Missense(2)	lung(1)|breast(1)											71.0	77.0	75.0					9																	140880937		2129	4256	6385	-	-	-	SO:0001583	missense	0			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.1842C>G	9.37:g.140880937C>G	ENSP00000360423:p.Phe614Leu		B1AQK5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.F615L	ENST00000371372.1	37	c.1845	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	C	14.37	2.515642	0.44763	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.97688	-4.49;-4.49;-4.49;-4.49;-4.49	4.35	3.45	0.39498	.	0.000000	0.85682	D	0.000000	D	0.96738	0.8935	L	0.33137	0.985	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79108	0.992;0.992	D	0.93885	0.7174	10	0.10902	T	0.67	.	10.64	0.45588	0.0:0.8361:0.0:0.1639	.	614;614	B1AQK4;B1AQK6	.;.	L	614;614;614;615;615	ENSP00000360423:F614L;ENSP00000277551:F614L;ENSP00000360414:F614L;ENSP00000360408:F615L;ENSP00000360406:F615L	ENSP00000277551:F614L	F	+	3	2	CACNA1B	140000758	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.458000	0.45014	0.925000	0.37094	0.462000	0.41574	TTC	CACNA1B	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000148408		0.622	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	HGNC	protein_coding	OTTHUMT00000055380.1	47	0.00	0	C	NM_000718		140880937	140880937	+1	no_errors	ENST00000371355	ensembl	human	known	69_37n	missense	28	28.21	11	SNP	1.000	G
CASC5	57082	genome.wustl.edu	37	15	40943718	40943718	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr15:40943718G>C	ENST00000346991.5	+	21	6730	c.6340G>C	c.(6340-6342)Gac>Cac	p.D2114H	CASC5_ENST00000399668.2_Missense_Mutation_p.D2088H			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	2114	Necessary for kinetochore localization and for interaction with NSL1 and DSN1.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.D2114H(2)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TGCTCAAATAGACTTTATGCA	0.358																																						dbGAP											2	Substitution - Missense(2)	breast(2)											85.0	78.0	80.0					15																	40943718		1824	4093	5917	-	-	-	SO:0001583	missense	0			AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.6340G>C	15.37:g.40943718G>C	ENSP00000335463:p.Asp2114His		Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	NULL	p.D2114H	ENST00000346991.5	37	c.6340	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079002	0.55753	.	.	ENSG00000137812	ENST00000346991;ENST00000399668	T;T	0.05925	3.37;3.37	5.05	2.74	0.32292	.	0.426630	0.25014	N	0.033820	T	0.09818	0.0241	L	0.36672	1.1	0.22378	N	0.999158	P;P	0.52061	0.95;0.95	P;P	0.55999	0.789;0.789	T	0.07065	-1.0792	10	0.72032	D	0.01	.	5.5176	0.16916	0.2839:0.0:0.7161:0.0	.	2088;2114	Q8NG31-2;Q8NG31	.;CASC5_HUMAN	H	2114;2088	ENSP00000335463:D2114H;ENSP00000382576:D2088H	ENSP00000335463:D2114H	D	+	1	0	CASC5	38731010	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	1.419000	0.34793	1.239000	0.43787	0.655000	0.94253	GAC	CASC5	-	NULL	ENSG00000137812		0.358	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	HGNC	protein_coding	OTTHUMT00000390224.2	178	0.00	0	G	NM_144508		40943718	40943718	+1	no_errors	ENST00000346991	ensembl	human	known	69_37n	missense	67	26.37	24	SNP	0.989	C
CAPN3	825	genome.wustl.edu	37	15	42681294	42681294	+	Splice_Site	SNP	T	T	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr15:42681294T>C	ENST00000397163.3	+	5	1020	c.801T>C	c.(799-801)gaT>gaC	p.D267D	CAPN3_ENST00000318023.7_Splice_Site_p.D267D|CAPN3_ENST00000357568.3_Splice_Site_p.D267D|RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000356316.3_Splice_Site_p.D180D|CAPN3_ENST00000349748.3_Splice_Site_p.D267D	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	267	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.D180D(1)|p.D267D(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		GCTCCATTGATGTAAGTCTGG	0.527																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											76.0	77.0	77.0					15																	42681294		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.801+1T>C	15.37:g.42681294T>C			A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Silent	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_EF_hand_Ca-bd,prints_Calpain_cysteine_protease,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat	p.D267	ENST00000397163.3	37	c.801	CCDS45245.1	15																																																																																			CAPN3	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat	ENSG00000092529		0.527	CAPN3-009	KNOWN	basic|CCDS	protein_coding	CAPN3	HGNC	protein_coding	OTTHUMT00000421075.1	198	0.00	0	T		Silent	42681294	42681294	+1	no_errors	ENST00000397163	ensembl	human	known	69_37n	silent	79	20.79	21	SNP	1.000	C
CBFB	865	genome.wustl.edu	37	16	67100703	67100703	+	Splice_Site	SNP	T	T	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr16:67100703T>C	ENST00000290858.6	+	4	660		c.e4+2		CBFB_ENST00000412916.2_Splice_Site|CBFB_ENST00000561924.2_Splice_Site	NM_001755.2|NM_022845.2	NP_001746.1|NP_074036.1	Q13951	PEBB_HUMAN	core-binding factor, beta subunit						cell maturation (GO:0048469)|definitive hemopoiesis (GO:0060216)|lymphocyte differentiation (GO:0030098)|myeloid cell differentiation (GO:0030099)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.?(1)		breast(3)|large_intestine(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)		CGAGCCCAGGTAGGGTAACAT	0.443			T	MYH11	AML																																	dbGAP		Dom	yes		16	16q22	865	"""core-binding factor, beta subunit"""		L	1	Unknown(1)	breast(1)											130.0	108.0	116.0					16																	67100703		2200	4300	6500	-	-	-	SO:0001630	splice_region_variant	0			BC018509	CCDS10827.1, CCDS45508.1	16q22.1	2008-02-05			ENSG00000067955	ENSG00000067955			1539	protein-coding gene	gene with protein product		121360				8351518, 7587111	Standard	NM_001755		Approved	PEBP2B	uc002erb.3	Q13951	OTTHUMG00000137520	ENST00000290858.6:c.399+2T>C	16.37:g.67100703T>C			A8K347|Q13124|Q9HCT2	Splice_Site	SNP	-	e4+2	ENST00000290858.6	37	c.399+2	CCDS10827.1	16	.	.	.	.	.	.	.	.	.	.	T	24.1	4.495889	0.85069	.	.	ENSG00000067955	ENST00000290858;ENST00000412916	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5986	0.68424	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CBFB	65658204	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	7.813000	0.86123	2.140000	0.66376	0.459000	0.35465	.	CBFB	-	-	ENSG00000067955		0.443	CBFB-001	KNOWN	basic|CCDS	protein_coding	CBFB	HGNC	protein_coding	OTTHUMT00000268843.2	134	0.00	0	T	NM_001755	Intron	67100703	67100703	+1	no_errors	ENST00000290858	ensembl	human	known	69_37n	splice_site	34	39.29	22	SNP	1.000	C
CC2D1B	200014	genome.wustl.edu	37	1	52824025	52824025	+	Missense_Mutation	SNP	G	G	A	rs554593851		TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:52824025G>A	ENST00000371586.2	-	13	1577	c.1439C>T	c.(1438-1440)cCg>cTg	p.P480L	CC2D1B_ENST00000460261.1_5'UTR|CC2D1B_ENST00000284376.3_Missense_Mutation_p.P480L|CC2D1B_ENST00000438831.1_5'UTR	NM_032449.2	NP_115825.1	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	480						nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.P480L(1)		breast(1)|large_intestine(6)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	27						TTTATCAGCCGGGGCTGAATC	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		17055	0.0		0.0	False		,,,				2504	0.001					dbGAP											1	Substitution - Missense(1)	breast(1)											55.0	53.0	54.0					1																	52824025		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058739	CCDS30714.1	1p32.3	2008-02-05			ENSG00000154222	ENSG00000154222			29386	protein-coding gene	gene with protein product						11347906	Standard	NM_032449		Approved	KIAA1836	uc001ctq.2	Q5T0F9	OTTHUMG00000008102	ENST00000371586.2:c.1439C>T	1.37:g.52824025G>A	ENSP00000360642:p.Pro480Leu		Q49AE8|Q5T0F8|Q5T0G0|Q6ZNQ1|Q96AP3|Q96I04|Q96JJ1	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_DM14,smart_C2_Ca-dep	p.P480L	ENST00000371586.2	37	c.1439	CCDS30714.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.872|1.872	-0.460023|-0.460023	0.04508|0.04508	.|.	.|.	ENSG00000154222|ENSG00000154222	ENST00000371586;ENST00000284376;ENST00000371573|ENST00000438021;ENST00000450942	T;T|.	0.18657|.	2.2;2.2|.	4.14|4.14	-0.833|-0.833	0.10782|0.10782	.|.	0.920820|.	0.08992|.	N|.	0.864184|.	T|T	0.36054|0.36054	0.0953|0.0953	L|L	0.42245|0.42245	1.32|1.32	0.18873|0.18873	N|N	0.999987|0.999987	B;B;B|.	0.10296|.	0.002;0.003;0.001|.	B;B;B|.	0.11329|.	0.001;0.006;0.001|.	T|T	0.34775|0.34775	-0.9815|-0.9815	10|5	0.30854|.	T|.	0.27|.	0.094|0.094	8.3286|8.3286	0.32173|0.32173	0.4636:0.0:0.5364:0.0|0.4636:0.0:0.5364:0.0	.|.	266;480;480|.	Q5T0G1;Q5T0F9-2;Q5T0F9|.	.;.;C2D1B_HUMAN|.	L|W	480;480;394|267;400	ENSP00000360642:P480L;ENSP00000284376:P480L|.	ENSP00000284376:P480L|.	P|R	-|-	2|1	0|2	CC2D1B|CC2D1B	52596613|52596613	0.002000|0.002000	0.14202|0.14202	0.029000|0.029000	0.17559|0.17559	0.011000|0.011000	0.07611|0.07611	-0.244000|-0.244000	0.08903|0.08903	-0.136000|-0.136000	0.11475|0.11475	-0.215000|-0.215000	0.12644|0.12644	CCG|CGG	CC2D1B	-	NULL	ENSG00000154222		0.587	CC2D1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CC2D1B	HGNC	protein_coding	OTTHUMT00000022189.1	78	0.00	0	G	NM_032449		52824025	52824025	-1	no_errors	ENST00000371586	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	0.016	A
CCDC132	55610	genome.wustl.edu	37	7	92979203	92979203	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr7:92979203G>T	ENST00000305866.5	+	25	2449	c.2321G>T	c.(2320-2322)aGt>aTt	p.S774I	CCDC132_ENST00000544910.1_Missense_Mutation_p.S744I|CCDC132_ENST00000474412.1_3'UTR|CCDC132_ENST00000535481.1_Missense_Mutation_p.S494I|CCDC132_ENST00000541136.1_Missense_Mutation_p.V584L	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	774						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.S774I(1)		endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			TCAACCGCCAGTGAACTACGG	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											108.0	99.0	102.0					7																	92979203		1843	4089	5932	-	-	-	SO:0001583	missense	0			AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.2321G>T	7.37:g.92979203G>T	ENSP00000307666:p.Ser774Ile		B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	pfam_Vacuolar_sorting-assoc_54,pfam_DUF2451_C	p.S774I	ENST00000305866.5	37	c.2321	CCDS43617.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.97|12.97	2.095997|2.095997	0.36952|0.36952	.|.	.|.	ENSG00000004766|ENSG00000004766	ENST00000305866;ENST00000544910;ENST00000535481|ENST00000541136	.|.	.|.	.|.	5.37|5.37	5.37|5.37	0.77165|0.77165	Protein of unknown function DUF2451, C-terminal (1);|.	0.172346|.	0.64402|.	D|.	0.000008|.	T|T	0.61211|0.61211	0.2329|0.2329	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	P;P;P|.	0.40731|.	0.728;0.545;0.6|.	P;B;P|.	0.46144|.	0.505;0.372;0.505|.	T|T	0.57780|0.57780	-0.7752|-0.7752	9|6	0.41790|0.37606	T|T	0.15|0.19	-14.4294|-14.4294	14.7539|14.7539	0.69549|0.69549	0.0718:0.0:0.9282:0.0|0.0718:0.0:0.9282:0.0	.|.	494;744;774|.	B4DS55;F5H5U7;Q96JG6|.	.;.;CC132_HUMAN|.	I|L	774;744;494|584	.|.	ENSP00000307666:S774I|ENSP00000445766:V584L	S|V	+|+	2|1	0|0	CCDC132|CCDC132	92817139|92817139	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	6.642000|6.642000	0.74329|0.74329	2.697000|2.697000	0.92050|0.92050	0.585000|0.585000	0.79938|0.79938	AGT|GTG	CCDC132	-	pfam_DUF2451_C	ENSG00000004766		0.348	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC132	HGNC	protein_coding	OTTHUMT00000341687.1	471	0.00	0	G	NM_017667		92979203	92979203	+1	no_errors	ENST00000305866	ensembl	human	known	69_37n	missense	139	22.22	40	SNP	1.000	T
CCT4	10575	genome.wustl.edu	37	2	62104097	62104097	+	Silent	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr2:62104097C>T	ENST00000394440.3	-	7	1031	c.735G>A	c.(733-735)aaG>aaA	p.K245K	CCT4_ENST00000461540.2_5'UTR|CCT4_ENST00000544079.1_Silent_p.K215K|CCT4_ENST00000538252.1_Silent_p.K189K|AC107081.5_ENST00000425779.1_RNA|CCT4_ENST00000544185.1_Silent_p.K95K	NM_006430.3	NP_006421.2	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	245					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)	p.K245K(1)		breast(1)|large_intestine(2)|lung(6)|ovary(2)	11	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			TAAGCCCAATCTTGGCCTTTT	0.398																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											95.0	102.0	100.0					2																	62104097		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33206.1, CCDS58711.1	2p15	2011-09-02			ENSG00000115484	ENSG00000115484		"""Heat Shock Proteins / Chaperonins"""	1617	protein-coding gene	gene with protein product		605142				9819444	Standard	NM_001256721		Approved	Cctd	uc002sbo.4	P50991	OTTHUMG00000152166	ENST00000394440.3:c.735G>A	2.37:g.62104097C>T			B2R6I3|B7Z8B1|F5H5W3|O14870|Q53QP9|Q96C51	Silent	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_delta	p.K245	ENST00000394440.3	37	c.735	CCDS33206.1	2																																																																																			CCT4	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_delta	ENSG00000115484		0.398	CCT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT4	HGNC	protein_coding	OTTHUMT00000325548.2	325	0.00	0	C			62104097	62104097	-1	no_errors	ENST00000394440	ensembl	human	known	69_37n	silent	106	30.97	48	SNP	1.000	T
CCT6A	908	genome.wustl.edu	37	7	56128610	56128610	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr7:56128610G>A	ENST00000275603.4	+	11	1543	c.1324G>A	c.(1324-1326)Gat>Aat	p.D442N	SNORA15_ENST00000384439.1_RNA|CCT6A_ENST00000335503.3_Missense_Mutation_p.D397N|CCT6A_ENST00000462133.1_3'UTR|CCT6A_ENST00000540286.1_Missense_Mutation_p.D411N	NM_001762.3	NP_001753.1	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A (zeta 1)	442					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)	p.D442N(1)		breast(1)|cervix(2)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	15	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			AGCATTTGCTGATGCATTGCT	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											69.0	63.0	65.0					7																	56128610		2203	4300	6503	-	-	-	SO:0001583	missense	0			M94083	CCDS5523.1, CCDS34640.1	7p11.2	2011-09-02			ENSG00000146731	ENSG00000146731		"""Heat Shock Proteins / Chaperonins"""	1620	protein-coding gene	gene with protein product		104613		CCT6		1352881, 8034610	Standard	NM_001762		Approved	TTCP20, TCPZ, Cctz, HTR3, TCP20	uc003trl.1	P40227	OTTHUMG00000022842	ENST00000275603.4:c.1324G>A	7.37:g.56128610G>A	ENSP00000275603:p.Asp442Asn		A6NCD2|Q3KP28|Q75LP4|Q96S46	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_zeta	p.D442N	ENST00000275603.4	37	c.1324	CCDS5523.1	7	.	.	.	.	.	.	.	.	.	.	G	17.89	3.499607	0.64298	.	.	ENSG00000146731	ENST00000275603;ENST00000335503;ENST00000540286;ENST00000539340	T;T;T	0.78364	-1.17;-1.17;-1.17	5.44	5.44	0.79542	.	0.142736	0.64402	D	0.000008	T	0.79919	0.4529	M	0.73962	2.25	0.80722	D	1	B;B;B	0.15719	0.014;0.002;0.006	B;B;B	0.22753	0.041;0.021;0.016	T	0.77194	-0.2677	10	0.62326	D	0.03	-5.1875	18.236	0.89949	0.0:0.0:1.0:0.0	.	411;397;442	B4DPJ8;A6NCD2;P40227	.;.;TCPZ_HUMAN	N	442;397;411;300	ENSP00000275603:D442N;ENSP00000352019:D397N;ENSP00000438488:D411N	ENSP00000275603:D442N	D	+	1	0	CCT6A	56096104	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	9.513000	0.98010	2.544000	0.85801	0.563000	0.77884	GAT	CCT6A	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_zeta	ENSG00000146731		0.448	CCT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT6A	HGNC	protein_coding	OTTHUMT00000251526.2	121	0.00	0	G	NM_001762		56128610	56128610	+1	no_errors	ENST00000275603	ensembl	human	known	69_37n	missense	61	28.24	24	SNP	1.000	A
CDCA3	83461	genome.wustl.edu	37	12	6958758	6958758	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:6958758G>A	ENST00000538862.2	-	4	1416	c.515C>T	c.(514-516)tCa>tTa	p.S172L	CDCA3_ENST00000535406.1_Missense_Mutation_p.S172L|USP5_ENST00000229268.8_5'Flank|CDCA3_ENST00000604599.1_5'Flank|CDCA3_ENST00000229265.6_Missense_Mutation_p.S147L|CDCA3_ENST00000540683.1_Missense_Mutation_p.S172L|CDCA3_ENST00000422785.3_Missense_Mutation_p.S172L|USP5_ENST00000389231.5_5'Flank			Q99618	CDCA3_HUMAN	cell division cycle associated 3	172					mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)		p.S172L(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(1)|stomach(1)	8						AGGGTCCCTTGAGGGCTTGTC	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											115.0	119.0	117.0					12																	6958758		2203	4300	6503	-	-	-	SO:0001583	missense	0			BG354576	CCDS8565.1, CCDS73428.1	12p13.31	2010-07-20				ENSG00000111665			14624	protein-coding gene	gene with protein product	"""trigger of mitotic entry 1"""	607749				9074930, 12188893	Standard	XR_242988		Approved	TOME-1, GRCC8	uc001qrg.2	Q99618		ENST00000538862.2:c.515C>T	12.37:g.6958758G>A	ENSP00000442068:p.Ser172Leu		A8K5V6|D3DUS6	Missense_Mutation	SNP	NULL	p.S172L	ENST00000538862.2	37	c.515	CCDS8565.1	12	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.756589	0.00657	.	.	ENSG00000237240;ENSG00000111665;ENSG00000111665;ENSG00000111665;ENSG00000111665	ENST00000422785;ENST00000229265;ENST00000538862;ENST00000535406;ENST00000540683	.	.	.	5.2	-0.283	0.12874	.	0.791092	0.11427	N	0.565145	T	0.12050	0.0293	N	0.02315	-0.6	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.34279	-0.9835	9	0.07325	T	0.83	0.5683	8.3273	0.32165	0.4727:0.0:0.5273:0.0	.	172;172	Q99618;F8WDL1	CDCA3_HUMAN;.	L	172;147;172;172;172	.	ENSP00000229265:S147L	S	-	2	0	U47924.25;CDCA3	6829019	0.001000	0.12720	0.052000	0.19188	0.176000	0.22953	0.317000	0.19487	-0.114000	0.11936	-0.345000	0.07892	TCA	CDCA3	-	NULL	ENSG00000111665		0.517	CDCA3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA3	HGNC	protein_coding	OTTHUMT00000401940.2	300	0.33	1	G	NM_031299		6958758	6958758	-1	no_errors	ENST00000538862	ensembl	human	known	69_37n	missense	122	21.79	34	SNP	0.146	A
CDH13	1012	genome.wustl.edu	37	16	83704566	83704566	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr16:83704566T>C	ENST00000566620.1	+	9	1563	c.1273T>C	c.(1273-1275)Tct>Cct	p.S425P	CDH13_ENST00000428848.3_Missense_Mutation_p.S386P|CDH13_ENST00000268613.10_Missense_Mutation_p.S472P	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	425	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		AGGGATGCTTTCTGTTGTCAA	0.527																																						dbGAP											0													146.0	144.0	145.0					16																	83704566		1935	4126	6061	-	-	-	SO:0001583	missense	0			U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.1273T>C	16.37:g.83704566T>C	ENSP00000454435:p.Ser425Pro		A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S425P	ENST00000566620.1	37	c.1273	CCDS58486.1	16	.	.	.	.	.	.	.	.	.	.	T	14.92	2.678290	0.47886	.	.	ENSG00000140945	ENST00000268613;ENST00000428848;ENST00000536143;ENST00000538855;ENST00000540531	T	0.56275	0.47	5.75	5.75	0.90469	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.72542	0.3473	M	0.78223	2.4	0.80722	D	1	D;D;D	0.71674	0.99;0.997;0.998	P;D;D	0.70227	0.845;0.968;0.961	T	0.75906	-0.3152	9	0.62326	D	0.03	.	15.2283	0.73367	0.0:0.0:0.0:1.0	.	386;472;425	B7Z590;B7Z9B1;P55290	.;.;CAD13_HUMAN	P	472;425;386;127;115	ENSP00000268613:S472P	ENSP00000268613:S472P	S	+	1	0	CDH13	82262067	1.000000	0.71417	0.036000	0.18154	0.001000	0.01503	4.470000	0.60175	2.193000	0.70182	0.477000	0.44152	TCT	CDH13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000140945		0.527	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH13	HGNC	protein_coding	OTTHUMT00000432917.1	544	0.18	1	T	NM_001257		83704566	83704566	+1	no_errors	ENST00000566620	ensembl	human	known	69_37n	missense	268	13.55	42	SNP	0.900	C
CEP89	84902	genome.wustl.edu	37	19	33424376	33424376	+	Silent	SNP	C	C	T	rs375221653		TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr19:33424376C>T	ENST00000305768.5	-	8	955	c.867G>A	c.(865-867)gaG>gaA	p.E289E	CEP89_ENST00000590597.2_Silent_p.E289E	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	289					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.E289E(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						ACGACGCCTTCTCAGCCTCTT	0.393																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											220.0	198.0	206.0					19																	33424376		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.867G>A	19.37:g.33424376C>T			B9EGA6|Q8N5J8	Silent	SNP	NULL	p.E289	ENST00000305768.5	37	c.867	CCDS32987.1	19																																																																																			CEP89	-	NULL	ENSG00000121289		0.393	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP89	HGNC	protein_coding	OTTHUMT00000451300.2	656	0.00	0	C	NM_032816		33424376	33424376	-1	no_errors	ENST00000305768	ensembl	human	known	69_37n	silent	343	16.75	69	SNP	0.003	T
CHGB	1114	genome.wustl.edu	37	20	5903764	5903764	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr20:5903764G>A	ENST00000378961.4	+	4	1178	c.974G>A	c.(973-975)aGg>aAg	p.R325K		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	325						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)	p.R325K(1)		breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						GGGGAAAAGAGGGACCACCAT	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											44.0	47.0	46.0					20																	5903764		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.974G>A	20.37:g.5903764G>A	ENSP00000368244:p.Arg325Lys		A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Missense_Mutation	SNP	pfam_Granin,prints_Chromogranin_AB	p.R325K	ENST00000378961.4	37	c.974	CCDS13092.1	20	.	.	.	.	.	.	.	.	.	.	G	12.79	2.043858	0.36085	.	.	ENSG00000089199	ENST00000378961	T	0.04360	3.64	5.57	1.38	0.22167	.	0.417960	0.25783	N	0.028329	T	0.04272	0.0118	L	0.45137	1.4	0.09310	N	1	P	0.42785	0.79	B	0.37833	0.259	T	0.38090	-0.9677	10	0.41790	T	0.15	-6.2961	7.1476	0.25591	0.209:0.1239:0.6671:0.0	.	325	P05060	SCG1_HUMAN	K	325	ENSP00000368244:R325K	ENSP00000368244:R325K	R	+	2	0	CHGB	5851764	0.986000	0.35501	0.000000	0.03702	0.899000	0.52679	1.064000	0.30579	0.030000	0.15379	0.563000	0.77884	AGG	CHGB	-	pfam_Granin	ENSG00000089199		0.537	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHGB	HGNC	protein_coding	OTTHUMT00000077897.2	267	0.00	0	G	NM_001819		5903764	5903764	+1	no_errors	ENST00000378961	ensembl	human	known	69_37n	missense	95	31.65	44	SNP	0.042	A
COL14A1	7373	genome.wustl.edu	37	8	121180436	121180436	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr8:121180436G>C	ENST00000297848.3	+	5	656	c.386G>C	c.(385-387)aGa>aCa	p.R129T	COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000309791.4_Missense_Mutation_p.R129T|COL14A1_ENST00000247781.3_Missense_Mutation_p.R129T|COL14A1_ENST00000537875.1_Missense_Mutation_p.R129T	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.R129T(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CCAAAGCCCAGAGTCAAAGTT	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											90.0	96.0	94.0					8																	121180436		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.386G>C	8.37:g.121180436G>C	ENSP00000297848:p.Arg129Thr			Missense_Mutation	SNP	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.R129T	ENST00000297848.3	37	c.386	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	G	7.776	0.708539	0.15239	.	.	ENSG00000187955	ENST00000537875;ENST00000309791;ENST00000297848;ENST00000247781	T;D;D;D	0.87256	0.5;-2.09;-2.11;-2.23	5.52	3.44	0.39384	.	0.528166	0.21138	N	0.079527	T	0.69196	0.3084	N	0.08118	0	0.31414	N	0.675087	B	0.19817	0.039	B	0.21360	0.034	T	0.61715	-0.7006	10	0.16420	T	0.52	.	5.2029	0.15275	0.319:0.0:0.681:0.0	.	129	Q05707	COEA1_HUMAN	T	129	ENSP00000443974:R129T;ENSP00000311809:R129T;ENSP00000297848:R129T;ENSP00000247781:R129T	ENSP00000247781:R129T	R	+	2	0	COL14A1	121249617	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	2.684000	0.46951	1.298000	0.44778	0.561000	0.74099	AGA	COL14A1	-	NULL	ENSG00000187955		0.353	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2	1154	0.00	0	G	NM_021110		121180436	121180436	+1	no_errors	ENST00000297848	ensembl	human	known	69_37n	missense	593	17.18	123	SNP	1.000	C
DMXL2	23312	genome.wustl.edu	37	15	51778534	51778534	+	Splice_Site	SNP	C	C	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr15:51778534C>A	ENST00000251076.5	-	23	5505	c.5218G>T	c.(5218-5220)Gta>Tta	p.V1740L	DMXL2_ENST00000449909.3_Splice_Site_p.V1104L|RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000543779.2_Splice_Site_p.V1740L	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1740						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.V1740L(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TCAAGACATACCTGCAAATTT	0.289																																						dbGAP											1	Substitution - Missense(1)	breast(1)											46.0	49.0	48.0					15																	51778534		2194	4292	6486	-	-	-	SO:0001630	splice_region_variant	0			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.5218-1G>T	15.37:g.51778534C>A			B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V1740L	ENST00000251076.5	37	c.5218	CCDS10141.1	15	.	.	.	.	.	.	.	.	.	.	C	32	5.156079	0.94686	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.58060	0.36;0.36;0.36	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.76652	0.4017	M	0.82193	2.58	0.80722	D	1	D;D;D	0.89917	1.0;0.967;0.998	D;D;D	0.83275	0.996;0.97;0.994	T	0.79315	-0.1854	10	0.87932	D	0	.	19.7815	0.96417	0.0:1.0:0.0:0.0	.	1740;1104;1740	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	L	1740;1740;1104	ENSP00000251076:V1740L;ENSP00000441858:V1740L;ENSP00000400855:V1104L	ENSP00000251076:V1740L	V	-	1	0	DMXL2	49565826	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.614000	0.82996	2.746000	0.94184	0.655000	0.94253	GTA	DMXL2	-	pfam_Rav1p_C	ENSG00000104093		0.289	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	HGNC	protein_coding	OTTHUMT00000254671.2	254	0.39	1	C	NM_015263	Missense_Mutation	51778534	51778534	-1	no_errors	ENST00000543779	ensembl	human	known	69_37n	missense	77	32.76	38	SNP	1.000	A
DNAH2	146754	genome.wustl.edu	37	17	7736526	7736526	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr17:7736526G>C	ENST00000572933.1	+	85	14576	c.13116G>C	c.(13114-13116)aaG>aaC	p.K4372N	DNAH2_ENST00000389173.2_Missense_Mutation_p.K4372N			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	4372					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K4372N(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				AGAGCCGCAAGAAGAGCGCCA	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											34.0	35.0	34.0					17																	7736526		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.13116G>C	17.37:g.7736526G>C	ENSP00000458355:p.Lys4372Asn		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.K4372N	ENST00000572933.1	37	c.13116	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	18.03	3.532080	0.64972	.	.	ENSG00000183914	ENST00000389173	T	0.09538	2.97	3.9	2.92	0.33932	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.22975	0.0555	M	0.81341	2.54	0.80722	D	1	P	0.51933	0.949	P	0.53760	0.734	T	0.01225	-1.1413	10	0.56958	D	0.05	.	7.9294	0.29893	0.2066:0.0:0.7934:0.0	.	4372	Q9P225	DYH2_HUMAN	N	4372	ENSP00000373825:K4372N	ENSP00000373825:K4372N	K	+	3	2	DNAH2	7677251	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.630000	0.54273	0.995000	0.38917	0.484000	0.47621	AAG	DNAH2	-	pfam_Dynein_heavy	ENSG00000183914		0.632	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	59	0.00	0	G	NM_020877		7736526	7736526	+1	no_errors	ENST00000389173	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	1.000	C
DNAH3	55567	genome.wustl.edu	37	16	21042410	21042410	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr16:21042410A>T	ENST00000261383.3	-	37	5395	c.5396T>A	c.(5395-5397)aTt>aAt	p.I1799N	DNAH3_ENST00000415178.1_Missense_Mutation_p.I1799N	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1799	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.I1799N(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TTCAATCCAAATAGCATCCAC	0.408																																						dbGAP											2	Substitution - Missense(2)	breast(2)											108.0	98.0	101.0					16																	21042410		2201	4300	6501	-	-	-	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.5396T>A	16.37:g.21042410A>T	ENSP00000261383:p.Ile1799Asn		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.I1799N	ENST00000261383.3	37	c.5396	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	A	19.93	3.918693	0.73098	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	D;D	0.87809	-2.3;-2.3	5.65	5.65	0.86999	.	0.080103	0.48286	D	0.000187	D	0.85906	0.5806	L	0.55103	1.725	0.38414	D	0.946014	P	0.49961	0.93	B	0.42798	0.398	D	0.88990	0.3414	10	0.87932	D	0	.	15.8653	0.79060	1.0:0.0:0.0:0.0	.	1799	Q8TD57	DYH3_HUMAN	N	1799	ENSP00000261383:I1799N;ENSP00000394245:I1799N	ENSP00000261383:I1799N	I	-	2	0	DNAH3	20949911	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.332000	0.96446	2.137000	0.66172	0.533000	0.62120	ATT	DNAH3	-	NULL	ENSG00000158486		0.408	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	285	0.00	0	A	NM_017539		21042410	21042410	-1	no_errors	ENST00000261383	ensembl	human	known	69_37n	missense	146	14.53	25	SNP	1.000	T
DSP	1832	genome.wustl.edu	37	6	7567629	7567629	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr6:7567629C>T	ENST00000379802.3	+	9	1428	c.1087C>T	c.(1087-1089)Cag>Tag	p.Q363*	DSP_ENST00000418664.2_Nonsense_Mutation_p.Q363*	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	363	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.Q363*(1)		biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TTGGATTCTTCAGATCACCAA	0.383																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											214.0	204.0	207.0					6																	7567629		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.1087C>T	6.37:g.7567629C>T	ENSP00000369129:p.Gln363*		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Nonsense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.Q363*	ENST00000379802.3	37	c.1087	CCDS4501.1	6	.	.	.	.	.	.	.	.	.	.	C	42	9.170105	0.99089	.	.	ENSG00000096696	ENST00000379802;ENST00000418664;ENST00000397483	.	.	.	5.26	5.26	0.73747	.	0.000000	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.2208	0.93796	0.0:1.0:0.0:0.0	.	.	.	.	X	363;363;168	.	ENSP00000369129:Q363X	Q	+	1	0	DSP	7512628	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.772000	0.85439	2.594000	0.87642	0.591000	0.81541	CAG	DSP	-	smart_Spectrin/alpha-actinin	ENSG00000096696		0.383	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	HGNC	protein_coding	OTTHUMT00000039786.2	229	0.00	0	C	NM_004415		7567629	7567629	+1	no_errors	ENST00000379802	ensembl	human	known	69_37n	nonsense	129	28.33	51	SNP	1.000	T
DYDC2	84332	genome.wustl.edu	37	10	82122706	82122706	+	Splice_Site	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr10:82122706G>C	ENST00000372199.1	+	5	745		c.e5-1		DYDC2_ENST00000444807.2_Splice_Site|DYDC2_ENST00000372197.1_Splice_Site|DYDC2_ENST00000256039.2_Splice_Site|DYDC2_ENST00000372198.1_Splice_Site			Q96IM9	DYDC2_HUMAN	DPY30 domain containing 2									p.?(1)		breast(1)|large_intestine(3)|lung(6)|skin(1)	11			Colorectal(32;0.229)			CCTCACCCCAGAATAGGGAAA	0.498																																						dbGAP											1	Unknown(1)	breast(1)											137.0	143.0	141.0					10																	82122706		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC018606	CCDS7367.1, CCDS58088.1	10q23.1	2006-06-16			ENSG00000133665	ENSG00000133665			23468	protein-coding gene	gene with protein product						12477932	Standard	NM_032372		Approved	bA36D19.6, MGC16186	uc031pwk.1	Q96IM9	OTTHUMG00000018610	ENST00000372199.1:c.148-1G>C	10.37:g.82122706G>C			D3DWD6|Q5QP07|Q5QP11	Splice_Site	SNP	-	e3-1	ENST00000372199.1	37	c.190-1	CCDS7367.1	10	.	.	.	.	.	.	.	.	.	.	G	17.32	3.359065	0.61403	.	.	ENSG00000133665	ENST00000372199;ENST00000372198;ENST00000372197;ENST00000444807;ENST00000411538;ENST00000256039	.	.	.	4.97	4.07	0.47477	.	.	.	.	.	.	.	.	.	.	.	0.35539	D	0.802914	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.1774	0.37120	0.0986:0.0:0.9014:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DYDC2	82112686	0.623000	0.27094	0.013000	0.15412	0.880000	0.50808	2.829000	0.48128	1.456000	0.47831	0.467000	0.42956	.	DYDC2	-	-	ENSG00000133665		0.498	DYDC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYDC2	HGNC	protein_coding	OTTHUMT00000049063.1	458	0.00	0	G	NM_032372	Intron	82122706	82122706	+1	no_errors	ENST00000372198	ensembl	human	known	69_37n	splice_site	235	22.44	68	SNP	0.029	C
DYRK1A	1859	genome.wustl.edu	37	21	38884518	38884518	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr21:38884518C>T	ENST00000398960.2	+	11	2051	c.1976C>T	c.(1975-1977)tCt>tTt	p.S659F	DYRK1A_ENST00000338785.3_3'UTR|DYRK1A_ENST00000339659.4_Missense_Mutation_p.S650F|DYRK1A_ENST00000455387.2_Missense_Mutation_p.S431F	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	659	Ser/Thr-rich.				circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)	p.S659F(1)		breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						ACATCCCTGTCTTCCTCAACG	0.512																																					Melanoma(114;464 1602 31203 43785 45765)	dbGAP											1	Substitution - Missense(1)	breast(1)											172.0	147.0	155.0					21																	38884518		2203	4300	6503	-	-	-	SO:0001583	missense	0			U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.1976C>T	21.37:g.38884518C>T	ENSP00000381932:p.Ser659Phe		O60769|Q92582|Q92810|Q9UNM5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S659F	ENST00000398960.2	37	c.1976	CCDS42925.1	21	.	.	.	.	.	.	.	.	.	.	C	18.31	3.596793	0.66332	.	.	ENSG00000157540	ENST00000339659;ENST00000398960;ENST00000455387	T;T;T	0.58358	0.34;0.36;0.89	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.62502	0.2433	N	0.24115	0.695	0.80722	D	1	D;D	0.64830	0.99;0.994	D;D	0.74348	0.962;0.983	T	0.64846	-0.6311	10	0.59425	D	0.04	.	19.9093	0.97021	0.0:1.0:0.0:0.0	.	659;650	Q13627;Q13627-2	DYR1A_HUMAN;.	F	650;659;431	ENSP00000340373:S650F;ENSP00000381932:S659F;ENSP00000407854:S431F	ENSP00000340373:S650F	S	+	2	0	DYRK1A	37806388	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.398000	0.79919	2.713000	0.92767	0.655000	0.94253	TCT	DYRK1A	-	NULL	ENSG00000157540		0.512	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK1A	HGNC	protein_coding	OTTHUMT00000194804.1	304	0.00	0	C	NM_001396		38884518	38884518	+1	no_errors	ENST00000398960	ensembl	human	known	69_37n	missense	120	32.20	57	SNP	1.000	T
EGR3	1960	genome.wustl.edu	37	8	22548604	22548604	+	Silent	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr8:22548604C>T	ENST00000317216.2	-	2	903	c.546G>A	c.(544-546)gcG>gcA	p.A182A	EGR3_ENST00000522910.1_Silent_p.A144A|RP11-459E5.1_ENST00000523627.1_RNA|EGR3_ENST00000519492.1_3'UTR|EGR3_ENST00000524088.1_5'UTR	NM_001199881.1|NM_004430.2	NP_001186810.1|NP_004421.2	Q06889	EGR3_HUMAN	early growth response 3	182					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|circadian rhythm (GO:0007623)|endothelial cell chemotaxis (GO:0035767)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A182A(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Prostate(55;0.0421)|Breast(100;0.102)		Colorectal(74;0.0145)|BRCA - Breast invasive adenocarcinoma(99;0.053)|COAD - Colon adenocarcinoma(73;0.0608)		TGCTGTCCAACGCCGGCTTGG	0.607																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											61.0	63.0	63.0					8																	22548604		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X63741	CCDS6033.1, CCDS56528.1	8p23-p21	2013-01-08			ENSG00000179388	ENSG00000179388		"""Zinc fingers, C2H2-type"""	3240	protein-coding gene	gene with protein product	"""zinc finger protein pilot"""	602419				1906159, 11909874	Standard	NM_004430		Approved	PILOT	uc003xcm.1	Q06889	OTTHUMG00000097825	ENST00000317216.2:c.546G>A	8.37:g.22548604C>T			A8K8U9|B4DHJ5|E7EW38|Q2M3W2	Silent	SNP	pfam_DUF3446,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A182	ENST00000317216.2	37	c.546	CCDS6033.1	8																																																																																			EGR3	-	NULL	ENSG00000179388		0.607	EGR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGR3	HGNC	protein_coding	OTTHUMT00000215098.1	51	0.00	0	C	NM_004430		22548604	22548604	-1	no_errors	ENST00000317216	ensembl	human	known	69_37n	silent	8	38.46	5	SNP	0.961	T
EPHA4	2043	genome.wustl.edu	37	2	222365820	222365820	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr2:222365820G>C	ENST00000281821.2	-	4	937	c.896C>G	c.(895-897)tCt>tGt	p.S299C	EPHA4_ENST00000392071.4_Missense_Mutation_p.S248C|EPHA4_ENST00000409938.1_Missense_Mutation_p.S299C|EPHA4_ENST00000409854.1_Missense_Mutation_p.S299C	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	299	Cys-rich.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)	p.S299C(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TTCCCAGACAGAGTAGCTGTG	0.517																																						dbGAP											2	Substitution - Missense(2)	breast(2)											107.0	94.0	98.0					2																	222365820		2203	4300	6503	-	-	-	SO:0001583	missense	0			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.896C>G	2.37:g.222365820G>C	ENSP00000281821:p.Ser299Cys		A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.S299C	ENST00000281821.2	37	c.896	CCDS2447.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.3|29.3	4.998634|4.998634	0.93227|0.93227	.|.	.|.	ENSG00000116106|ENSG00000116106	ENST00000441679|ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	.|T;T;T;T	.|0.44881	.|0.91;0.91;0.91;0.91	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	.|0.050743	.|0.85682	.|D	.|0.000000	T|T	0.64951|0.64951	0.2645|0.2645	M|M	0.89840|0.89840	3.065|3.065	0.80722|0.80722	D|D	1|1	.|P	.|0.47962	.|0.903	.|P	.|0.49301	.|0.606	T|T	0.71066|0.71066	-0.4700|-0.4700	5|10	.|0.66056	.|D	.|0.02	.|.	20.6439|20.6439	0.99570|0.99570	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|299	.|P54764	.|EPHA4_HUMAN	V|C	36|299;299;299;248	.|ENSP00000281821:S299C;ENSP00000386276:S299C;ENSP00000386829:S299C;ENSP00000375923:S248C	.|ENSP00000281821:S299C	L|S	-|-	1|2	2|0	EPHA4|EPHA4	222074064|222074064	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.999000|0.999000	0.98932|0.98932	9.476000|9.476000	0.97823|0.97823	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	CTG|TCT	EPHA4	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Growth_fac_rcpt	ENSG00000116106		0.517	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	HGNC	protein_coding	OTTHUMT00000256836.3	177	0.00	0	G			222365820	222365820	-1	no_errors	ENST00000281821	ensembl	human	known	69_37n	missense	60	32.97	30	SNP	1.000	C
ERCC6L2	375748	genome.wustl.edu	37	9	98669392	98669392	+	Silent	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr9:98669392C>G	ENST00000288985.7	+	4	965	c.660C>G	c.(658-660)ctC>ctG	p.L220L	ERCC6L2_ENST00000437817.1_Silent_p.L31L|RNA5SP289_ENST00000362332.1_RNA|ERCC6L2_ENST00000466840.1_3'UTR	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	220	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)	p.L220L(1)									TTTCTGTCCTCTACAACTGGA	0.333																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											87.0	89.0	88.0					9																	98669392		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.660C>G	9.37:g.98669392C>G			A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L31	ENST00000288985.7	37	c.93	CCDS35072.1	9																																																																																			ERCC6L2	-	pfam_SNF2_N,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000182150		0.333	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ERCC6L2	HGNC	protein_coding	OTTHUMT00000053247.2	484	0.00	0	C	NM_001010895		98669392	98669392	+1	no_errors	ENST00000437817	ensembl	human	known	69_37n	silent	125	34.55	66	SNP	0.998	G
EXOC5	10640	genome.wustl.edu	37	14	57714369	57714369	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr14:57714369G>C	ENST00000413566.2	-	2	448	c.89C>G	c.(88-90)tCt>tGt	p.S30C	EXOC5_ENST00000340918.7_Missense_Mutation_p.S30C|EXOC5_ENST00000556911.1_5'Flank	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	30					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.S30C(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						TCCACCTCTAGAGCCTCCTCC	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											24.0	22.0	23.0					14																	57714369		1787	4062	5849	-	-	-	SO:0001583	missense	0			U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.89C>G	14.37:g.57714369G>C	ENSP00000389934:p.Ser30Cys		B2R6C5	Missense_Mutation	SNP	pfam_Sec10-like	p.S30C	ENST00000413566.2	37	c.89	CCDS45111.1	14	.	.	.	.	.	.	.	.	.	.	G	25.7	4.666867	0.88251	.	.	ENSG00000070367	ENST00000413566;ENST00000340918	T;T	0.75821	-0.97;-0.97	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.81437	0.4822	L	0.44542	1.39	0.80722	D	1	P;D	0.76494	0.702;0.999	P;P	0.61328	0.478;0.887	T	0.82078	-0.0635	10	0.62326	D	0.03	-13.5872	19.7394	0.96219	0.0:0.0:1.0:0.0	.	30;30	F8W9B8;O00471	.;EXOC5_HUMAN	C	30	ENSP00000389934:S30C;ENSP00000342100:S30C	ENSP00000342100:S30C	S	-	2	0	EXOC5	56784122	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.160000	0.94734	2.741000	0.93983	0.585000	0.79938	TCT	EXOC5	-	NULL	ENSG00000070367		0.363	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	EXOC5	HGNC	protein_coding	OTTHUMT00000412905.1	27	0.00	0	G	NM_006544		57714369	57714369	-1	no_errors	ENST00000413566	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	1.000	C
FAM179A	165186	genome.wustl.edu	37	2	29268249	29268249	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr2:29268249G>T	ENST00000379558.4	+	19	3046	c.2695G>T	c.(2695-2697)Gtg>Ttg	p.V899L	FAM179A_ENST00000465300.1_3'UTR|FAM179A_ENST00000403861.2_Missense_Mutation_p.V844L	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	899								p.V899L(1)|p.V197L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TGGCCGTGCGGTGCTGGATGT	0.607																																						dbGAP											2	Substitution - Missense(2)	breast(2)											96.0	93.0	94.0					2																	29268249		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.2695G>T	2.37:g.29268249G>T	ENSP00000368876:p.Val899Leu		Q6ZUF5	Missense_Mutation	SNP	pfam_CLASP_N_dom,superfamily_ARM-type_fold	p.V899L	ENST00000379558.4	37	c.2695	CCDS1769.2	2	.	.	.	.	.	.	.	.	.	.	G	8.097	0.775753	0.16051	.	.	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.13420	2.59;2.59	5.33	-3.11	0.05299	Armadillo-type fold (1);	0.556490	0.17367	N	0.176806	T	0.10078	0.0247	L	0.46157	1.445	0.19300	N	0.999979	B;B;B	0.21071	0.037;0.051;0.049	B;B;B	0.18561	0.022;0.01;0.008	T	0.20605	-1.0270	10	0.42905	T	0.14	.	7.6319	0.28245	0.3948:0.4617:0.1435:0.0	.	844;899;197	F8W8E4;Q6ZUX3;Q6ZUX3-3	.;F179A_HUMAN;.	L	899;844	ENSP00000368876:V899L;ENSP00000384699:V844L	ENSP00000368876:V899L	V	+	1	0	FAM179A	29121753	0.009000	0.17119	0.013000	0.15412	0.494000	0.33585	-0.037000	0.12164	-0.445000	0.07159	0.561000	0.74099	GTG	FAM179A	-	superfamily_ARM-type_fold	ENSG00000189350		0.607	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM179A	HGNC	protein_coding	OTTHUMT00000317848.4	158	0.00	0	G	NM_199280		29268249	29268249	+1	no_errors	ENST00000379558	ensembl	human	known	69_37n	missense	54	22.86	16	SNP	0.005	T
FAM186B	84070	genome.wustl.edu	37	12	49994808	49994808	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:49994808C>A	ENST00000257894.2	-	4	776	c.615G>T	c.(613-615)atG>atT	p.M205I	FAM186B_ENST00000544141.1_Missense_Mutation_p.M115I|PRPF40B_ENST00000508736.1_3'UTR|FAM186B_ENST00000551047.1_Missense_Mutation_p.M205I	NM_032130.2	NP_115506.1	Q8IYM0	F186B_HUMAN	family with sequence similarity 186, member B	205						protein complex (GO:0043234)		p.M205I(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CCTTCGTGTTCATGGTATGCT	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											153.0	102.0	119.0					12																	49994808		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136748	CCDS8788.1	12q13.12	2008-09-17	2008-09-17	2008-09-17	ENSG00000135436	ENSG00000135436			25296	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 25"""	C12orf25		11230166	Standard	NM_032130		Approved	DKFZP434J0113	uc001ruo.3	Q8IYM0	OTTHUMG00000167427	ENST00000257894.2:c.615G>T	12.37:g.49994808C>A	ENSP00000257894:p.Met205Ile		B4DZ15|Q8TCP7|Q9H0L3	Missense_Mutation	SNP	NULL	p.M205I	ENST00000257894.2	37	c.615	CCDS8788.1	12	.	.	.	.	.	.	.	.	.	.	C	0.595	-0.831595	0.02713	.	.	ENSG00000135436	ENST00000544141;ENST00000551047;ENST00000257894	T;T;T	0.40476	2.88;1.03;3.08	5.11	0.917	0.19380	.	0.482216	0.17981	N	0.155537	T	0.21468	0.0517	N	0.22421	0.69	0.09310	N	1	B;B	0.12013	0.001;0.005	B;B	0.06405	0.002;0.001	T	0.09930	-1.0652	9	.	.	.	-5.3715	3.4631	0.07540	0.0943:0.3248:0.4274:0.1535	.	115;205	B4DZ15;Q8IYM0	.;F186B_HUMAN	I	115;205;205	ENSP00000438569:M115I;ENSP00000448656:M205I;ENSP00000257894:M205I	.	M	-	3	0	FAM186B	48281075	0.000000	0.05858	0.005000	0.12908	0.001000	0.01503	-0.124000	0.10595	0.665000	0.31066	-0.171000	0.13296	ATG	FAM186B	-	NULL	ENSG00000135436		0.592	FAM186B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM186B	HGNC	protein_coding	OTTHUMT00000394583.2	237	0.00	0	C	NM_032130		49994808	49994808	-1	no_errors	ENST00000257894	ensembl	human	known	69_37n	missense	80	23.81	25	SNP	0.000	A
CCSER2	54462	genome.wustl.edu	37	10	86273469	86273469	+	3'UTR	SNP	A	A	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr10:86273469A>T	ENST00000224756.8	+	0	2860				CCSER2_ENST00000494144.1_3'UTR|CCSER2_ENST00000372088.2_Missense_Mutation_p.T864S	NM_001284243.1|NM_018999.2	NP_001271172.1|NP_061872.2	Q9H7U1	CCSE2_HUMAN	coiled-coil serine-rich protein 2						microtubule bundle formation (GO:0001578)	microtubule cytoskeleton (GO:0015630)											CTTAAACATTACTGTAAATGC	0.403																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS31235.1, CCDS60582.1, CCDS60583.1, CCDS73159.1	10q23.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000107771	ENSG00000107771			29197	protein-coding gene	gene with protein product			"""KIAA1128"", ""family with sequence similarity 190, member B"""	KIAA1128, FAM190B		10574461	Standard	XM_005269905		Approved		uc001kdh.1	Q9H7U1	OTTHUMG00000018641	ENST00000224756.8:c.*170A>T	10.37:g.86273469A>T			B4DFY4|B4DQU9|B7WPE8|D3DWE2|Q8N6E9|Q9H2S0|Q9ULU1	Missense_Mutation	SNP	NULL	p.T864S	ENST00000224756.8	37	c.2590	CCDS31235.1	10	.	.	.	.	.	.	.	.	.	.	A	8.805	0.933782	0.18206	.	.	ENSG00000107771	ENST00000372088	T	0.19105	2.17	6.04	4.92	0.64577	.	.	.	.	.	T	0.19805	0.0476	.	.	.	0.21740	N	0.999567	B;P	0.45531	0.4;0.86	B;P	0.44561	0.225;0.453	T	0.09271	-1.0682	8	0.33940	T	0.23	.	7.5353	0.27706	0.8376:0.0:0.1624:0.0	.	864;136	Q9H7U1-3;Q6N055	.;.	S	864	ENSP00000361160:T864S	ENSP00000361160:T864S	T	+	1	0	FAM190B	86263449	0.003000	0.15002	0.190000	0.23270	0.958000	0.62258	1.289000	0.33307	1.121000	0.41925	0.460000	0.39030	ACT	FAM190B	-	NULL	ENSG00000107771		0.403	CCSER2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM190B	HGNC	protein_coding	OTTHUMT00000049132.2	126	0.00	0	A	NM_018999		86273469	86273469	+1	no_errors	ENST00000372088	ensembl	human	known	69_37n	missense	35	59.09	52	SNP	0.067	T
BRINP3	339479	genome.wustl.edu	37	1	190234086	190234086	+	Missense_Mutation	SNP	G	G	A	rs200575097		TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:190234086G>A	ENST00000367462.3	-	4	758	c.527C>T	c.(526-528)aCg>aTg	p.T176M	RP11-547I7.1_ENST00000452178.1_RNA|BRINP3_ENST00000534846.1_Missense_Mutation_p.T74M	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	176	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.T176M(1)									CTGATGTAGCGTCTCCAGAGT	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											135.0	118.0	124.0					1																	190234086		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.527C>T	1.37:g.190234086G>A	ENSP00000356432:p.Thr176Met		B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.T176M	ENST00000367462.3	37	c.527	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	G	16.41	3.115191	0.56505	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.19105	2.46;2.17	5.75	4.84	0.62591	Membrane attack complex component/perforin (MACPF) domain (1);	0.167022	0.53938	D	0.000050	T	0.16811	0.0404	L	0.34521	1.04	0.36249	D	0.853788	P;P	0.43412	0.567;0.806	B;B	0.37833	0.168;0.259	T	0.16453	-1.0402	10	0.87932	D	0	.	12.3234	0.54997	0.0815:0.0:0.9185:0.0	.	74;176	B7Z260;Q76B58	.;FAM5C_HUMAN	M	176;74	ENSP00000356432:T176M;ENSP00000438022:T74M	ENSP00000356432:T176M	T	-	2	0	FAM5C	188500709	1.000000	0.71417	0.845000	0.33349	0.252000	0.25951	7.462000	0.80851	1.441000	0.47550	0.585000	0.79938	ACG	FAM5C	-	smart_MACPF	ENSG00000162670		0.478	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5C	HGNC	protein_coding	OTTHUMT00000086278.1	188	0.00	0	G	NM_199051		190234086	190234086	-1	no_errors	ENST00000367462	ensembl	human	known	69_37n	missense	77	20.41	20	SNP	0.997	A
FAM91A1	157769	genome.wustl.edu	37	8	124799973	124799973	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr8:124799973C>G	ENST00000334705.7	+	14	1507	c.1261C>G	c.(1261-1263)Ctt>Gtt	p.L421V	FAM91A1_ENST00000521166.1_Missense_Mutation_p.L421V	NM_144963.2	NP_659400	Q658Y4	F91A1_HUMAN	family with sequence similarity 91, member A1	421								p.L421V(1)		breast(4)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			GGACAGCTTTCTTATAGAACT	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	88.0	89.0					8																	124799973		1846	4099	5945	-	-	-	SO:0001583	missense	0			AK074370	CCDS6346.2	8q24.13	2005-10-04			ENSG00000176853	ENSG00000176853			26306	protein-coding gene	gene with protein product						12477932	Standard	XM_005250806		Approved	FLJ23790	uc003yqv.3	Q658Y4	OTTHUMG00000133021	ENST00000334705.7:c.1261C>G	8.37:g.124799973C>G	ENSP00000335082:p.Leu421Val		B6YY23|Q658T5|Q8TE89	Missense_Mutation	SNP	NULL	p.L421V	ENST00000334705.7	37	c.1261	CCDS6346.2	8	.	.	.	.	.	.	.	.	.	.	C	13.35	2.209762	0.39003	.	.	ENSG00000176853	ENST00000521166;ENST00000334705	T;T	0.36157	1.27;1.27	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.53254	0.1785	L	0.54863	1.705	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.75484	0.986;0.986	T	0.42120	-0.9470	10	0.35671	T	0.21	.	13.621	0.62136	0.0:0.9196:0.0:0.0804	.	421;421	E7ER68;Q658Y4	.;F91A1_HUMAN	V	421	ENSP00000429491:L421V;ENSP00000335082:L421V	ENSP00000335082:L421V	L	+	1	0	FAM91A1	124869154	1.000000	0.71417	0.997000	0.53966	0.660000	0.38997	2.064000	0.41432	2.785000	0.95823	0.655000	0.94253	CTT	FAM91A1	-	NULL	ENSG00000176853		0.358	FAM91A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM91A1	HGNC	protein_coding	OTTHUMT00000256607.1	231	0.00	0	C	NM_144963		124799973	124799973	+1	no_errors	ENST00000334705	ensembl	human	known	69_37n	missense	105	17.19	22	SNP	1.000	G
FBN1	2200	genome.wustl.edu	37	15	48720661	48720661	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr15:48720661A>T	ENST00000316623.5	-	57	7334	c.6879T>A	c.(6877-6879)aaT>aaA	p.N2293K		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2293	EGF-like 40; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.N2293K(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TCTGACATTCATTCTCATCTG	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											113.0	92.0	99.0					15																	48720661		2198	4296	6494	-	-	-	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.6879T>A	15.37:g.48720661A>T	ENSP00000325527:p.Asn2293Lys		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.N2293K	ENST00000316623.5	37	c.6879	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	A	20.5	4.005666	0.74932	.	.	ENSG00000166147	ENST00000316623;ENST00000389087	D	0.93811	-3.29	5.76	-6.55	0.01854	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.085998	0.85682	D	0.000000	D	0.94364	0.8188	M	0.91090	3.175	0.80722	D	1	P	0.42078	0.77	P	0.45998	0.5	D	0.92169	0.5742	10	0.87932	D	0	.	16.7449	0.85469	0.4288:0.0:0.5712:0.0	.	2293	P35555	FBN1_HUMAN	K	2293;861	ENSP00000325527:N2293K	ENSP00000325527:N2293K	N	-	3	2	FBN1	46507953	0.148000	0.22702	0.714000	0.30535	0.888000	0.51559	-0.178000	0.09782	-1.071000	0.03145	-0.375000	0.07067	AAT	FBN1	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	ENSG00000166147		0.488	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	193	0.00	0	A			48720661	48720661	-1	no_errors	ENST00000316623	ensembl	human	known	69_37n	missense	72	24.21	23	SNP	0.590	T
FANCI	55215	genome.wustl.edu	37	15	89843030	89843030	+	Splice_Site	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr15:89843030G>C	ENST00000310775.7	+	25	2722		c.e25-1		FANCI_ENST00000300027.8_Splice_Site	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I						cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)	p.?(2)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					TCCTGCTTCAGAGTCTTGCTA	0.398								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP											2	Unknown(2)	breast(2)											79.0	73.0	75.0					15																	89843030		2200	4299	6499	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.2637-1G>C	15.37:g.89843030G>C			A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Splice_Site	SNP	-	e24-1	ENST00000310775.7	37	c.2637-1	CCDS45346.1	15	.	.	.	.	.	.	.	.	.	.	G	18.84	3.708861	0.68615	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8251	0.96614	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FANCI	87644034	1.000000	0.71417	0.998000	0.56505	0.610000	0.37248	9.155000	0.94700	2.692000	0.91855	0.655000	0.94253	.	FANCI	-	-	ENSG00000140525		0.398	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCI	HGNC	protein_coding	OTTHUMT00000421140.1	260	0.00	0	G	NM_018193	Intron	89843030	89843030	+1	no_errors	ENST00000310775	ensembl	human	known	69_37n	splice_site	41	31.15	19	SNP	1.000	C
FBXL13	222235	genome.wustl.edu	37	7	102665560	102665560	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr7:102665560C>T	ENST00000313221.4	-	6	871	c.445G>A	c.(445-447)Gag>Aag	p.E149K	FBXL13_ENST00000436908.1_Missense_Mutation_p.E149K|FBXL13_ENST00000379306.3_Missense_Mutation_p.E149K|FBXL13_ENST00000393772.2_Missense_Mutation_p.E149K|FBXL13_ENST00000379305.3_Missense_Mutation_p.E149K|FBXL13_ENST00000455112.2_Missense_Mutation_p.E149K|FBXL13_ENST00000456695.1_Missense_Mutation_p.E149K|FBXL13_ENST00000471074.1_5'UTR|FBXL13_ENST00000379308.3_Missense_Mutation_p.E149K	NM_145032.3	NP_659469.3	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13	149								p.E149K(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|skin(3)|stomach(1)	27						TTTAGAGTCTCATCTACAAGA	0.328																																						dbGAP											1	Substitution - Missense(1)	breast(1)											57.0	56.0	56.0					7																	102665560		2202	4297	6499	-	-	-	SO:0001583	missense	0			BC031285	CCDS5726.1, CCDS47678.1, CCDS75649.1	7q22.1	2014-07-18			ENSG00000161040	ENSG00000161040		"""F-boxes / Leucine-rich repeats"""	21658	protein-coding gene	gene with protein product		609080					Standard	NM_145032		Approved	MGC21636, Fbl13	uc003vaq.2	Q8NEE6	OTTHUMG00000157224	ENST00000313221.4:c.445G>A	7.37:g.102665560C>T	ENSP00000321927:p.Glu149Lys		C9J565|C9J566|Q6UVW7|Q6UVW8|Q75MN5|Q86UJ5|Q8N7Y4|Q8TCL2|Q8WUF9|Q8WUG0	Missense_Mutation	SNP	smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom_cyclin-like	p.E149K	ENST00000313221.4	37	c.445	CCDS5726.1	7	.	.	.	.	.	.	.	.	.	.	C	3.119	-0.180954	0.06380	.	.	ENSG00000161040	ENST00000393772;ENST00000379308;ENST00000379306;ENST00000349747;ENST00000379305;ENST00000436908;ENST00000313221;ENST00000456695;ENST00000455112	T;T;T;T;T;T;T;T	0.08008	3.32;3.32;3.14;3.32;3.31;3.31;3.14;3.32	3.9	0.384	0.16244	.	2.166030	0.02363	N	0.077047	T	0.05868	0.0153	N	0.25647	0.755	0.09310	N	1	B;B;B	0.13594	0.006;0.008;0.003	B;B;B	0.08055	0.003;0.002;0.003	T	0.34153	-0.9840	10	0.13853	T	0.58	.	2.6575	0.05016	0.214:0.4685:0.0:0.3175	.	149;149;149	Q8NEE6-3;Q8NEE6-2;Q8NEE6	.;.;FXL13_HUMAN	K	149;149;149;76;149;149;149;149;149	ENSP00000377367:E149K;ENSP00000368610:E149K;ENSP00000368608:E149K;ENSP00000368607:E149K;ENSP00000388608:E149K;ENSP00000321927:E149K;ENSP00000409716:E149K;ENSP00000391550:E149K	ENSP00000321927:E149K	E	-	1	0	FBXL13	102452796	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.565000	0.05929	-0.044000	0.13491	0.561000	0.74099	GAG	FBXL13	-	NULL	ENSG00000161040		0.328	FBXL13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXL13	HGNC	protein_coding	OTTHUMT00000348001.1	216	0.00	0	C	NM_145032		102665560	102665560	-1	no_errors	ENST00000313221	ensembl	human	known	69_37n	missense	66	18.52	15	SNP	0.000	T
FGF5	2250	genome.wustl.edu	37	4	81188146	81188146	+	Silent	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr4:81188146C>T	ENST00000312465.7	+	1	394	c.168C>T	c.(166-168)tcC>tcT	p.S56S	FGF5_ENST00000456523.3_Silent_p.S56S	NM_004464.3	NP_004455.2	P12034	FGF5_HUMAN	fibroblast growth factor 5	56	Poly-Ser.				cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell differentiation (GO:0010001)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction involved in regulation of gene expression (GO:0023019)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	fibroblast growth factor receptor binding (GO:0005104)	p.S56S(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22						CTATGTCTTCCTCTTCTGCCT	0.642																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											62.0	61.0	61.0					4																	81188146		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M23534	CCDS3586.1, CCDS34021.1	4q21	2014-01-30			ENSG00000138675	ENSG00000138675		"""Endogenous ligands"""	3683	protein-coding gene	gene with protein product		165190				3211147, 2577873	Standard	NM_001291812		Approved		uc003hmd.3	P12034	OTTHUMG00000130288	ENST00000312465.7:c.168C>T	4.37:g.81188146C>T			B2R554|O75846|Q3Y8M3|Q8NF90	Silent	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_GF_heparin-bd,prints_IL1_HBGF	p.S56	ENST00000312465.7	37	c.168	CCDS34021.1	4																																																																																			FGF5	-	NULL	ENSG00000138675		0.642	FGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF5	HGNC	protein_coding	OTTHUMT00000252627.2	156	0.00	0	C			81188146	81188146	+1	no_errors	ENST00000312465	ensembl	human	known	69_37n	silent	63	16.00	12	SNP	0.304	T
CMTR2	55783	genome.wustl.edu	37	16	71317656	71317656	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr16:71317656delT	ENST00000338099.5	-	3	2504	c.2168delA	c.(2167-2169)cagfs	p.Q723fs	CMTR2_ENST00000434935.2_Frame_Shift_Del_p.Q723fs			Q8IYT2	CMTR2_HUMAN	cap methyltransferase 2	723					7-methylguanosine mRNA capping (GO:0006370)|cap2 mRNA methylation (GO:0097310)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)	p.Q723fs*20(1)									TGGCACAAACTGTAAAACCTG	0.428																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)											50.0	54.0	52.0					16																	71317656		2198	4300	6498	-	-	-	SO:0001589	frameshift_variant	0			BC035005	CCDS10898.1	16q22.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000180917	ENSG00000180917			25635	protein-coding gene	gene with protein product	"""adrift homolog (Drosophila)"""		"""FtsJ methyltransferase domain containing 1"""	FTSJD1		21310715	Standard	NM_018348		Approved	FLJ11171, AFT, MTr2	uc010cga.3	Q8IYT2	OTTHUMG00000137587	ENST00000338099.5:c.2168delA	16.37:g.71317656delT	ENSP00000337512:p.Gln723fs		B2RCD5|D3DWS1|Q8NE77|Q8NFR5|Q9H8Z4|Q9NUS3|Q9NXF5	Frame_Shift_Del	DEL	pfam_rRNA_MeTrfase_FtsJ_dom	p.Q723fs	ENST00000338099.5	37	c.2168	CCDS10898.1	16																																																																																			FTSJD1	-	NULL	ENSG00000180917		0.428	CMTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJD1	HGNC	protein_coding	OTTHUMT00000268984.2	261	0.00	0	T	NM_018348		71317656	71317656	-1	no_errors	ENST00000338099	ensembl	human	known	69_37n	frame_shift_del	49	40.86	38	DEL	1.000	-
GLB1L	79411	genome.wustl.edu	37	2	220104395	220104395	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr2:220104395C>T	ENST00000295759.7	-	9	1103	c.790G>A	c.(790-792)Gag>Aag	p.E264K	GLB1L_ENST00000356283.3_Missense_Mutation_p.E174K|GLB1L_ENST00000409640.1_Missense_Mutation_p.E174K|GLB1L_ENST00000497855.1_5'UTR|GLB1L_ENST00000392089.2_Missense_Mutation_p.E264K			Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like	264					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)	p.E264K(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTGTAGTACTCAGAGTTTACC	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											141.0	138.0	139.0					2																	220104395		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2437.1, CCDS74657.1	2q36.1	2008-02-05			ENSG00000163521	ENSG00000163521			28129	protein-coding gene	gene with protein product						12975309	Standard	XM_005246850		Approved	MGC10771	uc002vkm.3	Q6UWU2	OTTHUMG00000133133	ENST00000295759.7:c.790G>A	2.37:g.220104395C>T	ENSP00000295759:p.Glu264Lys		Q96DR0	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.E264K	ENST00000295759.7	37	c.790	CCDS2437.1	2	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522015	0.85600	.	.	ENSG00000163521	ENST00000295759;ENST00000409640;ENST00000392089;ENST00000356283	D;D;D;D	0.99399	-5.83;-5.83;-5.83;-5.83	5.64	5.64	0.86602	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	H	0.99487	4.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96779	0.9574	10	0.87932	D	0	-23.6352	19.8946	0.96949	0.0:1.0:0.0:0.0	.	174;264	Q6UWU2-2;Q6UWU2	.;GLB1L_HUMAN	K	264;174;264;174	ENSP00000295759:E264K;ENSP00000386354:E174K;ENSP00000375939:E264K;ENSP00000348628:E174K	ENSP00000295759:E264K	E	-	1	0	GLB1L	219812639	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.647000	0.83462	2.937000	0.99478	0.650000	0.86243	GAG	GLB1L	-	pfam_Glycoside_Hdrlase_35,superfamily_Glycoside_hydrolase_SF,prints_Glycoside_Hdrlase_35	ENSG00000163521		0.512	GLB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLB1L	HGNC	protein_coding	OTTHUMT00000256822.2	336	0.00	0	C	NM_024506		220104395	220104395	-1	no_errors	ENST00000295759	ensembl	human	known	69_37n	missense	116	12.03	16	SNP	1.000	T
GLI1	2735	genome.wustl.edu	37	12	57859009	57859009	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:57859009C>G	ENST00000228682.2	+	5	596	c.505C>G	c.(505-507)Cag>Gag	p.Q169E	GLI1_ENST00000546141.1_Missense_Mutation_p.Q128E|GLI1_ENST00000543426.1_Missense_Mutation_p.Q41E	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	169					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)	p.Q169E(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CCCACATCCTCAGTCCCGGGG	0.592																																					Pancreas(157;841 1936 10503 41495 50368)	dbGAP											1	Substitution - Missense(1)	breast(1)											49.0	46.0	47.0					12																	57859009		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.505C>G	12.37:g.57859009C>G	ENSP00000228682:p.Gln169Glu		D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q169E	ENST00000228682.2	37	c.505	CCDS8940.1	12	.	.	.	.	.	.	.	.	.	.	C	8.770	0.925737	0.18056	.	.	ENSG00000111087	ENST00000532291;ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	T;T;T;T;T	0.72167	-0.63;2.83;2.71;2.79;2.79	3.63	3.63	0.41609	.	0.157403	0.29631	N	0.011613	T	0.47040	0.1424	N	0.22421	0.69	0.31576	N	0.655772	B	0.30889	0.299	B	0.21151	0.033	T	0.49457	-0.8938	10	0.02654	T	1	.	10.9739	0.47454	0.0:1.0:0.0:0.0	.	169	P08151	GLI1_HUMAN	E	41;41;169;128;128;41	ENSP00000436671:Q41E;ENSP00000437607:Q41E;ENSP00000228682:Q169E;ENSP00000441006:Q128E;ENSP00000434408:Q128E	ENSP00000228682:Q169E	Q	+	1	0	GLI1	56145276	0.467000	0.25831	1.000000	0.80357	0.576000	0.36127	3.349000	0.52217	2.020000	0.59435	0.561000	0.74099	CAG	GLI1	-	NULL	ENSG00000111087		0.592	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI1	HGNC	protein_coding	OTTHUMT00000394197.1	141	0.00	0	C	NM_005269		57859009	57859009	+1	no_errors	ENST00000228682	ensembl	human	known	69_37n	missense	60	29.41	25	SNP	0.999	G
GOLPH3L	55204	genome.wustl.edu	37	1	150621202	150621202	+	Silent	SNP	T	T	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:150621202T>C	ENST00000271732.3	-	5	497	c.453A>G	c.(451-453)aaA>aaG	p.K151K	GOLPH3L_ENST00000540514.1_Silent_p.K107K	NM_018178.5	NP_060648.2	Q9H4A5	GLP3L_HUMAN	golgi phosphoprotein 3-like	151					Golgi organization (GO:0007030)|positive regulation of protein secretion (GO:0050714)	Golgi membrane (GO:0000139)|trans-Golgi network membrane (GO:0032588)	phosphatidylinositol-4-phosphate binding (GO:0070273)	p.K151K(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;1.2e-23)|all cancers(9;4.81e-23)|OV - Ovarian serous cystadenocarcinoma(6;1.93e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			GGTACTGTAATTTGAAGGGGT	0.383																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											82.0	84.0	83.0					1																	150621202		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ296153	CCDS966.1	1q21	2008-02-05			ENSG00000143457	ENSG00000143457			24882	protein-coding gene	gene with protein product		612208					Standard	NM_018178		Approved	GPP34R	uc001evj.2	Q9H4A5	OTTHUMG00000035009	ENST00000271732.3:c.453A>G	1.37:g.150621202T>C			B1AN09|B7Z6N3|Q9NVK0	Silent	SNP	pfam_GPP34	p.K151	ENST00000271732.3	37	c.453	CCDS966.1	1																																																																																			GOLPH3L	-	pfam_GPP34	ENSG00000143457		0.383	GOLPH3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLPH3L	HGNC	protein_coding	OTTHUMT00000084734.1	241	0.00	0	T	NM_018178		150621202	150621202	-1	no_errors	ENST00000271732	ensembl	human	known	69_37n	silent	121	17.69	26	SNP	1.000	C
COLGALT2	23127	genome.wustl.edu	37	1	183938428	183938428	+	Silent	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:183938428G>C	ENST00000361927.4	-	5	1178	c.807C>G	c.(805-807)gtC>gtG	p.V269V	COLGALT2_ENST00000546159.1_Silent_p.V269V	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	269					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)	p.V269V(1)									AGAAGGCAAAGACAATGATGT	0.488																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											108.0	96.0	100.0					1																	183938428		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.807C>G	1.37:g.183938428G>C			O60327|Q9BZR0	Silent	SNP	pfam_Glyco_trans_25	p.V269	ENST00000361927.4	37	c.807	CCDS1360.1	1																																																																																			GLT25D2	-	NULL	ENSG00000198756		0.488	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT25D2	HGNC	protein_coding	OTTHUMT00000086128.1	193	0.00	0	G	NM_015101		183938428	183938428	-1	no_errors	ENST00000361927	ensembl	human	known	69_37n	silent	48	31.43	22	SNP	1.000	C
GRIN3A	116443	genome.wustl.edu	37	9	104341570	104341570	+	Silent	SNP	A	A	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr9:104341570A>G	ENST00000361820.3	-	7	3439	c.2839T>C	c.(2839-2841)Ttg>Ctg	p.L947L		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	947					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.L947L(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	ATGGTGGTCAAAATGGACAGA	0.473																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											216.0	173.0	188.0					9																	104341570		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2839T>C	9.37:g.104341570A>G			B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Silent	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.L947	ENST00000361820.3	37	c.2839	CCDS6758.1	9																																																																																			GRIN3A	-	prints_NMDA_rcpt	ENSG00000198785		0.473	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	HGNC	protein_coding	OTTHUMT00000053453.1	272	0.00	0	A			104341570	104341570	-1	no_errors	ENST00000361820	ensembl	human	known	69_37n	silent	70	35.45	39	SNP	1.000	G
HAMP	57817	genome.wustl.edu	37	19	35775852	35775852	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr19:35775852G>C	ENST00000598398.1	+	4	458	c.162G>C	c.(160-162)caG>caC	p.Q54H	HAMP_ENST00000222304.3_Missense_Mutation_p.Q54H	NM_021175.2	NP_066998.1	P81172	HEPC_HUMAN	hepcidin antimicrobial peptide	54					cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|immune response (GO:0006955)|killing of cells of other organism (GO:0031640)	apical cortex (GO:0045179)|extracellular region (GO:0005576)		p.Q54H(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)	4	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCATGTTCCAGAGGCGAAGGA	0.577																																						dbGAP											1	Substitution - Missense(1)	breast(1)											159.0	148.0	152.0					19																	35775852		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF309489	CCDS12454.1	19q13.1	2014-09-17				ENSG00000105697			15598	protein-coding gene	gene with protein product		606464				11034317, 11113132	Standard	NM_021175		Approved	LEAP-1, HEPC, HFE2B, LEAP1	uc002nyw.3	P81172		ENST00000598398.1:c.162G>C	19.37:g.35775852G>C	ENSP00000471894:p.Gln54His		Q1HE14|Q9BY68	Missense_Mutation	SNP	pfam_Hepcidin	p.Q54H	ENST00000598398.1	37	c.162	CCDS12454.1	19	.	.	.	.	.	.	.	.	.	.	G	7.561	0.664625	0.14710	.	.	ENSG00000105697	ENST00000222304	D	0.88975	-2.45	4.51	0.961	0.19638	.	0.426252	0.20123	N	0.098756	D	0.82953	0.5149	.	.	.	0.09310	N	1	B	0.14438	0.01	B	0.15484	0.013	T	0.71437	-0.4593	9	0.45353	T	0.12	-0.1351	12.2297	0.54480	0.0:0.5711:0.4289:0.0	.	54	P81172	HEPC_HUMAN	H	54	ENSP00000222304:Q54H	ENSP00000222304:Q54H	Q	+	3	2	HAMP	40467692	0.012000	0.17670	0.008000	0.14137	0.031000	0.12232	0.255000	0.18333	0.120000	0.18254	0.561000	0.74099	CAG	HAMP	-	pfam_Hepcidin	ENSG00000105697		0.577	HAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAMP	HGNC	protein_coding	OTTHUMT00000466067.1	219	0.45	1	G	NM_021175		35775852	35775852	+1	no_errors	ENST00000222304	ensembl	human	known	69_37n	missense	30	30.23	13	SNP	0.030	C
HDHD1	8226	genome.wustl.edu	37	X	7023816	7023816	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chrX:7023816C>T	ENST00000381077.5	-	2	201	c.125G>A	c.(124-126)aGc>aAc	p.S42N	HDHD1_ENST00000498474.2_5'UTR|HDHD1_ENST00000412827.2_Missense_Mutation_p.S42N|HDHD1_ENST00000540122.1_Missense_Mutation_p.S42N|HDHD1_ENST00000424830.2_Missense_Mutation_p.S65N	NM_001178136.1|NM_012080.4	NP_001171607.1|NP_036212.3	Q08623	HDHD1_HUMAN	haloacid dehalogenase-like hydrolase domain containing 1	42					nucleotide metabolic process (GO:0009117)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)	p.S28N(1)		breast(2)|large_intestine(1)|lung(3)	6						TACATCCCAGCTGTATTTCTT	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											59.0	52.0	54.0					X																	7023816		1865	4093	5958	-	-	-	SO:0001583	missense	0			M86934	CCDS48075.1, CCDS48076.1, CCDS55366.1, CCDS55367.1	Xp22.32	2010-07-21	2010-07-21	2010-07-21	ENSG00000130021	ENSG00000130021			16818	protein-coding gene	gene with protein product		306480	"""family with sequence similarity 16, member A, X-linked"", ""haloacid dehalogenase-like hydrolase domain containing 1A"""	FAM16AX, HDHD1A		1734713, 1284467	Standard	NM_012080		Approved	DXF68S1E, GS1	uc011mhm.1	Q08623	OTTHUMG00000021101	ENST00000381077.5:c.125G>A	X.37:g.7023816C>T	ENSP00000370467:p.Ser42Asn		B2R7X6|B4DV93|B7Z6Q3|E9PAV8|F5GWZ2|Q53F84|Q96EB8	Missense_Mutation	SNP	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IA_v3	p.S65N	ENST00000381077.5	37	c.194	CCDS48075.1	X	.	.	.	.	.	.	.	.	.	.	c	4.622	0.115636	0.08831	.	.	ENSG00000130021	ENST00000381077;ENST00000544385;ENST00000412827;ENST00000424830;ENST00000540122;ENST00000486446	T;T;T;T;T	0.32272	3.37;1.46;3.37;3.37;3.37	4.01	1.14	0.20703	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.378437	0.31312	N	0.007878	T	0.20941	0.0504	N	0.25825	0.765	0.24983	N	0.99159	B;B;B;B;B	0.17852	0.024;0.001;0.004;0.009;0.001	B;B;B;B;B	0.16289	0.006;0.005;0.012;0.015;0.003	T	0.14699	-1.0463	10	0.20519	T	0.43	-24.9175	15.4798	0.75517	0.0:0.1882:0.8118:0.0	.	42;42;65;42;42	Q08623-3;Q08623-2;E9PAV8;E7EVH9;Q08623	.;.;.;.;HDHD1_HUMAN	N	42;58;42;65;42;42	ENSP00000370467:S42N;ENSP00000406260:S42N;ENSP00000396452:S65N;ENSP00000441208:S42N;ENSP00000430995:S42N	ENSP00000370467:S42N	S	-	2	0	HDHD1	7033816	1.000000	0.71417	0.035000	0.18076	0.278000	0.26855	2.316000	0.43761	-0.183000	0.10585	-0.223000	0.12442	AGC	HDHD1	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom	ENSG00000130021		0.423	HDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDHD1	HGNC	protein_coding	OTTHUMT00000055683.2	84	0.00	0	C	NM_012080		7023816	7023816	-1	no_errors	ENST00000424830	ensembl	human	known	69_37n	missense	56	13.85	9	SNP	0.988	T
MROH7	374977	genome.wustl.edu	37	1	55158189	55158189	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:55158189T>C	ENST00000421030.2	+	16	3089	c.2804T>C	c.(2803-2805)aTg>aCg	p.M935T	MROH7_ENST00000454855.2_Missense_Mutation_p.M453T|MROH7_ENST00000545244.1_Missense_Mutation_p.M503T|MROH7_ENST00000395690.2_Missense_Mutation_p.M935T|MROH7_ENST00000339553.5_Missense_Mutation_p.M935T|MROH7_ENST00000409996.1_Missense_Mutation_p.M503T|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.M935T	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	935						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.M935T(2)									TGGGAGCTCATGGAGCAGGTG	0.622																																						dbGAP											2	Substitution - Missense(2)	breast(2)											67.0	70.0	69.0					1																	55158189		2029	4198	6227	-	-	-	SO:0001583	missense	0			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.2804T>C	1.37:g.55158189T>C	ENSP00000396622:p.Met935Thr		A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.M935T	ENST00000421030.2	37	c.2804	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	T	12.60	1.985294	0.35036	.	.	ENSG00000184313	ENST00000421030;ENST00000545244;ENST00000414867;ENST00000339553;ENST00000409996;ENST00000454855;ENST00000395690	T;T;T;T;T;T	0.55413	0.52;0.52;0.52;0.52;0.52;0.52	4.37	4.37	0.52481	Armadillo-type fold (1);	0.445655	0.21431	N	0.074659	T	0.51312	0.1667	M	0.65975	2.015	0.33083	D	0.536903	P;P;B;P;P	0.45827	0.867;0.763;0.152;0.763;0.718	B;B;B;B;B	0.42282	0.382;0.215;0.107;0.295;0.152	T	0.69128	-0.5227	10	0.87932	D	0	-17.6029	9.8777	0.41213	0.0:0.0:0.0:1.0	.	935;935;503;935;90	F8W8P2;Q68CQ1;F5H7R4;Q68CQ1-9;Q69YY0	.;HEAT8_HUMAN;.;.;.	T	935;503;964;935;503;453;935	ENSP00000396622:M935T;ENSP00000442333:M503T;ENSP00000343211:M935T;ENSP00000387048:M503T;ENSP00000401130:M453T;ENSP00000379044:M935T	ENSP00000343211:M935T	M	+	2	0	HEATR8	54930777	0.998000	0.40836	1.000000	0.80357	0.701000	0.40568	3.765000	0.55272	1.832000	0.53329	0.379000	0.24179	ATG	HEATR8	-	superfamily_ARM-type_fold	ENSG00000184313		0.622	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR8	HGNC	protein_coding	OTTHUMT00000346978.1	78	0.00	0	T	NM_198547		55158189	55158189	+1	no_errors	ENST00000421030	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	1.000	C
HEATR1	55127	genome.wustl.edu	37	1	236748383	236748383	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:236748383C>T	ENST00000366582.3	-	17	2297	c.2183G>A	c.(2182-2184)aGa>aAa	p.R728K	HEATR1_ENST00000366581.2_Missense_Mutation_p.R728K	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	728					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.R728K(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			ACTGAAGACTCTTATCGCAAA	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											107.0	108.0	107.0					1																	236748383		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.2183G>A	1.37:g.236748383C>T	ENSP00000355541:p.Arg728Lys		Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	pfam_BP28_C_dom,pfam_U3snoRNP10,superfamily_ARM-type_fold	p.R728K	ENST00000366582.3	37	c.2183	CCDS31066.1	1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.454062	0.63290	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.65916	-0.06;-0.18	6.08	4.18	0.49190	Armadillo-type fold (1);	0.178052	0.64402	N	0.000011	T	0.41926	0.1180	N	0.25380	0.74	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.26360	-1.0105	10	0.02654	T	1	.	10.0229	0.42055	0.0:0.737:0.0:0.263	.	728	Q9H583	HEAT1_HUMAN	K	728	ENSP00000355541:R728K;ENSP00000355540:R728K	ENSP00000355540:R728K	R	-	2	0	HEATR1	234815006	0.999000	0.42202	0.975000	0.42487	0.642000	0.38348	1.196000	0.32198	0.865000	0.35603	0.591000	0.81541	AGA	HEATR1	-	superfamily_ARM-type_fold	ENSG00000119285		0.378	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	HGNC	protein_coding	OTTHUMT00000096635.1	259	0.00	0	C	XM_375853		236748383	236748383	-1	no_errors	ENST00000366582	ensembl	human	known	69_37n	missense	84	33.86	43	SNP	0.989	T
IL27RA	9466	genome.wustl.edu	37	19	14161686	14161686	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr19:14161686C>T	ENST00000263379.2	+	11	1644	c.1519C>T	c.(1519-1521)Cat>Tat	p.H507Y		NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	507	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)	p.H507Y(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						CCTCCGGCTTCATCTACCAGG	0.592																																					Colon(164;1849 1896 4443 37792 47834)	dbGAP											1	Substitution - Missense(1)	breast(1)											59.0	48.0	52.0					19																	14161686		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.1519C>T	19.37:g.14161686C>T	ENSP00000263379:p.His507Tyr		A0N0L1|O60624	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.H507Y	ENST00000263379.2	37	c.1519	CCDS12303.1	19	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.750688	0.00663	.	.	ENSG00000104998	ENST00000263379	T	0.52526	0.66	4.69	-0.512	0.11966	Fibronectin, type III (2);	0.577055	0.14479	N	0.317027	T	0.27765	0.0683	L	0.32530	0.975	0.09310	N	1	B	0.18310	0.027	B	0.11329	0.006	T	0.28038	-1.0056	10	0.07030	T	0.85	1.2623	7.5231	0.27639	0.0:0.5426:0.0:0.4574	.	507	Q6UWB1	I27RA_HUMAN	Y	507	ENSP00000263379:H507Y	ENSP00000263379:H507Y	H	+	1	0	IL27RA	14022686	0.622000	0.27085	0.127000	0.21898	0.444000	0.32077	0.185000	0.16958	0.082000	0.17018	0.461000	0.40582	CAT	IL27RA	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000104998		0.592	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL27RA	HGNC	protein_coding	OTTHUMT00000458539.1	80	0.00	0	C	NM_004843		14161686	14161686	+1	no_errors	ENST00000263379	ensembl	human	known	69_37n	missense	22	35.29	12	SNP	0.010	T
ITGA2	3673	genome.wustl.edu	37	5	52363035	52363035	+	Silent	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr5:52363035C>T	ENST00000296585.5	+	16	2174	c.2031C>T	c.(2029-2031)ctC>ctT	p.L677L		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	677					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)	p.L677L(2)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				AGATAATTCTCAAACTCTGCT	0.368																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											90.0	86.0	88.0					5																	52363035		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.2031C>T	5.37:g.52363035C>T			Q14595	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.L677	ENST00000296585.5	37	c.2031	CCDS3957.1	5																																																																																			ITGA2	-	pfam_Integrin_alpha-2	ENSG00000164171		0.368	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA2	HGNC	protein_coding	OTTHUMT00000253857.2	239	0.00	0	C	NM_002203		52363035	52363035	+1	no_errors	ENST00000296585	ensembl	human	known	69_37n	silent	64	17.95	14	SNP	0.081	T
ITGA7	3679	genome.wustl.edu	37	12	56082684	56082684	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:56082684C>G	ENST00000555728.1	-	23	3062	c.3034G>C	c.(3034-3036)Gac>Cac	p.D1012H	ITGA7_ENST00000394229.2_Missense_Mutation_p.D968H|ITGA7_ENST00000452168.2_Missense_Mutation_p.D875H|ITGA7_ENST00000394230.2_Missense_Mutation_p.D972H|ITGA7_ENST00000347027.6_Missense_Mutation_p.D962H|ITGA7_ENST00000257879.6_Missense_Mutation_p.D968H|ITGA7_ENST00000553804.1_Missense_Mutation_p.D972H|ITGA7_ENST00000257880.7_Missense_Mutation_p.D1012H			Q13683	ITA7_HUMAN	integrin, alpha 7	1012					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)	p.D968H(1)|p.D972H(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						GCCGCGCGGTCAAAGCTGTAG	0.587																																						dbGAP											2	Substitution - Missense(2)	breast(2)											72.0	73.0	73.0					12																	56082684		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.3034G>C	12.37:g.56082684C>G	ENSP00000452387:p.Asp1012His		B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.D1012H	ENST00000555728.1	37	c.3034		12	.	.	.	.	.	.	.	.	.	.	C	15.37	2.813645	0.50527	.	.	ENSG00000135424	ENST00000553804;ENST00000257879;ENST00000347027;ENST00000452168;ENST00000257880;ENST00000394230;ENST00000394229;ENST00000353687;ENST00000555728	T;T;T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7	5.45	5.45	0.79879	.	0.493320	0.21562	N	0.072551	T	0.68970	0.3059	M	0.75615	2.305	0.31819	N	0.626199	D;D;D;D	0.67145	0.984;0.967;0.996;0.988	P;P;D;P	0.71870	0.905;0.806;0.975;0.806	T	0.74630	-0.3601	10	0.72032	D	0.01	.	16.8474	0.85984	0.0:1.0:0.0:0.0	.	875;1012;972;1031	Q13683-13;Q13683;Q13683-3;Q4LE35	.;ITA7_HUMAN;.;.	H	972;968;962;875;1012;972;968;841;1012	ENSP00000452120:D972H;ENSP00000257879:D968H;ENSP00000343009:D962H;ENSP00000393844:D875H;ENSP00000257880:D1012H;ENSP00000377777:D972H;ENSP00000377776:D968H;ENSP00000452387:D1012H	ENSP00000257879:D968H	D	-	1	0	ITGA7	54368951	0.975000	0.34042	0.998000	0.56505	0.217000	0.24651	1.734000	0.38166	2.574000	0.86865	0.644000	0.83932	GAC	ITGA7	-	NULL	ENSG00000135424		0.587	ITGA7-014	KNOWN	basic	protein_coding	ITGA7	HGNC	protein_coding	OTTHUMT00000410138.1	121	0.00	0	C	NM_002206		56082684	56082684	-1	no_errors	ENST00000555728	ensembl	human	known	69_37n	missense	43	31.75	20	SNP	0.993	G
ITGA7	3679	genome.wustl.edu	37	12	56096685	56096685	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:56096685G>A	ENST00000555728.1	-	3	413	c.385C>T	c.(385-387)Cgg>Tgg	p.R129W	ITGA7_ENST00000394229.2_Missense_Mutation_p.R129W|ITGA7_ENST00000452168.2_Intron|ITGA7_ENST00000394230.2_Missense_Mutation_p.R129W|ITGA7_ENST00000347027.6_Missense_Mutation_p.R129W|ITGA7_ENST00000257879.6_Missense_Mutation_p.R129W|ITGA7_ENST00000553804.1_Missense_Mutation_p.R129W|ITGA7_ENST00000257880.7_Missense_Mutation_p.R129W			Q13683	ITA7_HUMAN	integrin, alpha 7	129					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)	p.R129W(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CCCTGGCTCCGAACACTGACT	0.522																																						dbGAP											2	Substitution - Missense(2)	breast(2)											119.0	103.0	109.0					12																	56096685		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.385C>T	12.37:g.56096685G>A	ENSP00000452387:p.Arg129Trp		B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.R129W	ENST00000555728.1	37	c.385		12	.	.	.	.	.	.	.	.	.	.	G	27.8	4.863827	0.91511	.	.	ENSG00000135424	ENST00000553804;ENST00000257879;ENST00000347027;ENST00000257880;ENST00000394230;ENST00000394229;ENST00000353687;ENST00000555728	T;T;T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62	4.97	3.95	0.45737	.	0.087960	0.45867	D	0.000332	T	0.79305	0.4423	M	0.77616	2.38	0.48452	D	0.999656	D;D;D	0.76494	0.989;0.993;0.999	P;P;P	0.59115	0.586;0.84;0.852	T	0.81404	-0.0948	10	0.87932	D	0	.	9.7442	0.40437	0.0:0.0:0.6611:0.3389	.	129;129;192	Q13683;Q13683-3;Q4LE35	ITA7_HUMAN;.;.	W	129	ENSP00000452120:R129W;ENSP00000257879:R129W;ENSP00000343009:R129W;ENSP00000257880:R129W;ENSP00000377777:R129W;ENSP00000377776:R129W;ENSP00000452387:R129W	ENSP00000257879:R129W	R	-	1	2	ITGA7	54382952	0.003000	0.15002	1.000000	0.80357	0.998000	0.95712	0.810000	0.27183	2.478000	0.83669	0.561000	0.74099	CGG	ITGA7	-	NULL	ENSG00000135424		0.522	ITGA7-014	KNOWN	basic	protein_coding	ITGA7	HGNC	protein_coding	OTTHUMT00000410138.1	233	0.00	0	G	NM_002206		56096685	56096685	-1	no_errors	ENST00000555728	ensembl	human	known	69_37n	missense	78	31.58	36	SNP	1.000	A
ITIH6	347365	genome.wustl.edu	37	X	54781528	54781528	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chrX:54781528C>T	ENST00000218436.6	-	9	3153	c.3124G>A	c.(3124-3126)Gat>Aat	p.D1042N		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	1042					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.D1042N(1)									GAATTGCCATCCCAGTTTGGA	0.493																																						dbGAP											1	Substitution - Missense(1)	breast(1)											95.0	79.0	84.0					X																	54781528		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.3124G>A	X.37:g.54781528C>T	ENSP00000218436:p.Asp1042Asn		A6NN03	Missense_Mutation	SNP	pfam_VIT,pfam_ITI_HC_C,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.D1042N	ENST00000218436.6	37	c.3124	CCDS14361.1	X	.	.	.	.	.	.	.	.	.	.	C	5.568	0.289560	0.10567	.	.	ENSG00000102313	ENST00000218436	T	0.02323	4.34	1.58	-0.375	0.12509	.	0.321820	0.14200	U	0.334779	T	0.01627	0.0052	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47058	-0.9146	10	0.26408	T	0.33	.	3.9449	0.09344	0.0:0.5199:0.0:0.4801	.	1042	Q6UXX5	ITH5L_HUMAN	N	1042	ENSP00000218436:D1042N	ENSP00000218436:D1042N	D	-	1	0	ITIH5L	54798253	0.003000	0.15002	0.021000	0.16686	0.450000	0.32258	-0.769000	0.04710	-0.229000	0.09854	0.287000	0.19450	GAT	ITIH6	-	NULL	ENSG00000102313		0.493	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH6	HGNC	protein_coding	OTTHUMT00000056814.2	382	0.26	1	C	NM_198510		54781528	54781528	-1	no_errors	ENST00000218436	ensembl	human	known	69_37n	missense	149	27.18	56	SNP	0.019	T
KCNA1	3736	genome.wustl.edu	37	12	5020629	5020629	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:5020629G>A	ENST00000382545.3	+	2	1192	c.85G>A	c.(85-87)Gac>Aac	p.D29N	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	29					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.D29N(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	CCGGCAGGCCGACCACGACGA	0.687																																						dbGAP											1	Substitution - Missense(1)	breast(1)											30.0	32.0	32.0					12																	5020629		2203	4299	6502	-	-	-	SO:0001583	missense	0			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.85G>A	12.37:g.5020629G>A	ENSP00000371985:p.Asp29Asn		A6NM83|Q3MIQ9	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv1.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1.3	p.D29N	ENST00000382545.3	37	c.85	CCDS8535.1	12	.	.	.	.	.	.	.	.	.	.	G	10.65	1.409091	0.25378	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	D	0.96041	-3.89	3.93	3.93	0.45458	.	0.637620	0.15993	N	0.234738	D	0.88662	0.6497	N	0.08118	0	0.35511	D	0.800614	B	0.18166	0.026	B	0.15870	0.014	D	0.86167	0.1597	10	0.19590	T	0.45	.	15.4851	0.75560	0.0:0.0:1.0:0.0	.	29	Q09470	KCNA1_HUMAN	N	29	ENSP00000371985:D29N	ENSP00000228858:D29N	D	+	1	0	KCNA1	4890890	1.000000	0.71417	0.471000	0.27229	0.527000	0.34593	4.370000	0.59517	2.201000	0.70794	0.555000	0.69702	GAC	KCNA1	-	prints_K_chnl_volt-dep_Kv1.3	ENSG00000111262		0.687	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KCNA1	HGNC	protein_coding	OTTHUMT00000103343.2	38	0.00	0	G	NM_000217		5020629	5020629	+1	no_errors	ENST00000382545	ensembl	human	known	69_37n	missense	19	45.95	17	SNP	0.954	A
KDM5C	8242	genome.wustl.edu	37	X	53240703	53240703	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chrX:53240703T>G	ENST00000375401.3	-	10	1909	c.1377A>C	c.(1375-1377)aaA>aaC	p.K459N	KDM5C_ENST00000375379.3_Missense_Mutation_p.K459N|KDM5C_ENST00000375383.3_Missense_Mutation_p.K418N|KDM5C_ENST00000404049.3_Missense_Mutation_p.K458N|KDM5C_ENST00000465402.1_5'Flank|KDM5C-IT1_ENST00000412242.1_RNA|KDM5C_ENST00000452825.3_Missense_Mutation_p.K392N	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	459					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.K459N(1)|p.K392N(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TTAGGTGCCGTTTACTGTCAC	0.458			"""N, F, S"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	2	Substitution - Missense(2)	breast(2)											92.0	64.0	74.0					X																	53240703		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.1377A>C	X.37:g.53240703T>G	ENSP00000364550:p.Lys459Asn		B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.K459N	ENST00000375401.3	37	c.1377	CCDS14351.1	X	.	.	.	.	.	.	.	.	.	.	T	16.81	3.225595	0.58668	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	D;D;D;D;D	0.86769	-2.17;-1.88;-1.88;-1.88;-2.02	5.79	2.6	0.31112	.	0.045370	0.85682	D	0.000000	T	0.82181	0.4981	L	0.41124	1.26	0.40735	D	0.982789	B;P;P	0.41710	0.182;0.76;0.76	B;P;B	0.44811	0.097;0.461;0.382	T	0.78510	-0.2176	10	0.46703	T	0.11	-28.7162	7.4316	0.27131	0.0:0.5888:0.0:0.4112	.	392;458;459	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	N	392;459;458;459;418	ENSP00000445176:K392N;ENSP00000364550:K459N;ENSP00000385394:K458N;ENSP00000364528:K459N;ENSP00000364532:K418N	ENSP00000364528:K459N	K	-	3	2	KDM5C	53257428	0.452000	0.25713	1.000000	0.80357	0.891000	0.51852	0.168000	0.16622	0.577000	0.29470	-1.026000	0.02426	AAA	KDM5C	-	NULL	ENSG00000126012		0.458	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	HGNC	protein_coding	OTTHUMT00000056737.2	135	0.00	0	T	NM_004187		53240703	53240703	-1	no_errors	ENST00000375401	ensembl	human	known	69_37n	missense	104	14.05	17	SNP	0.999	G
KIAA1324L	222223	genome.wustl.edu	37	7	86547849	86547849	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr7:86547849G>C	ENST00000450689.2	-	12	1687	c.1502C>G	c.(1501-1503)tCt>tGt	p.S501C	KIAA1324L_ENST00000444627.1_Missense_Mutation_p.S501C|KIAA1324L_ENST00000416314.1_Missense_Mutation_p.S334C|KIAA1324L_ENST00000490995.1_5'UTR|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.S261C	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	501						integral component of membrane (GO:0016021)		p.S501C(1)|p.S261C(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					TCCAGTCATAGATGTTGGTGG	0.333																																						dbGAP											2	Substitution - Missense(2)	breast(2)											113.0	97.0	103.0					7																	86547849		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.1502C>G	7.37:g.86547849G>C	ENSP00000413445:p.Ser501Cys		A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Growth_fac_rcpt	p.S501C	ENST00000450689.2	37	c.1502	CCDS47632.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.1|22.1	4.238642|4.238642	0.79800|0.79800	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000423294|ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314	.|T;T;T;T	.|0.55930	.|0.49;0.49;0.49;0.49	5.84|5.84	5.84|5.84	0.93424|0.93424	.|Growth factor, receptor (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.74989|0.74989	0.3789|0.3789	M|M	0.77103|0.77103	2.36|2.36	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.993;0.999;0.999	T|T	0.76274|0.76274	-0.3019|-0.3019	5|10	.|0.66056	.|D	.|0.02	.|.	19.1274|19.1274	0.93391|0.93391	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|501;261;334	.|A8MWY0;A8MWY0-2;B4DJV3	.|K132L_HUMAN;.;.	M|C	461|501;261;501;334	.|ENSP00000413445:S501C;ENSP00000297222:S261C;ENSP00000397377:S501C;ENSP00000402390:S334C	.|ENSP00000297222:S261C	I|S	-|-	3|2	3|0	KIAA1324L|KIAA1324L	86385785|86385785	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.778000|0.778000	0.44026|0.44026	9.062000|9.062000	0.93920|0.93920	2.775000|2.775000	0.95449|0.95449	0.655000|0.655000	0.94253|0.94253	ATC|TCT	KIAA1324L	-	superfamily_Growth_fac_rcpt	ENSG00000164659		0.333	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1324L	HGNC	protein_coding	OTTHUMT00000333372.3	679	0.00	0	G	NM_152748		86547849	86547849	-1	no_errors	ENST00000450689	ensembl	human	known	69_37n	missense	159	28.57	64	SNP	1.000	C
LAG3	3902	genome.wustl.edu	37	12	6882449	6882449	+	Silent	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:6882449C>T	ENST00000203629.2	+	2	483	c.150C>T	c.(148-150)ctC>ctT	p.L50L	LAG3_ENST00000441671.2_Silent_p.L50L	NM_002286.5	NP_002277.4	P18627	LAG3_HUMAN	lymphocyte-activation gene 3	50	Ig-like V-type.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell activation (GO:0050868)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|MHC class II protein binding (GO:0042289)|transmembrane signaling receptor activity (GO:0004888)	p.L50L(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						CAATCCCCCTCCAGGATCTCA	0.642																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											48.0	48.0	48.0					12																	6882449		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8561.1	12p13.3	2013-01-11			ENSG00000089692	ENSG00000089692		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6476	protein-coding gene	gene with protein product		153337					Standard	NM_002286		Approved	CD223	uc001qqt.4	P18627	OTTHUMG00000169197	ENST00000203629.2:c.150C>T	12.37:g.6882449C>T			A8K7T9|Q7Z643	Silent	SNP	smart_Ig_sub,pfscan_Ig-like	p.L50	ENST00000203629.2	37	c.150	CCDS8561.1	12																																																																																			LAG3	-	smart_Ig_sub	ENSG00000089692		0.642	LAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAG3	HGNC	protein_coding	OTTHUMT00000402846.1	264	0.00	0	C			6882449	6882449	+1	no_errors	ENST00000203629	ensembl	human	known	69_37n	silent	30	26.19	11	SNP	0.007	T
LARP1	23367	genome.wustl.edu	37	5	154185485	154185485	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr5:154185485G>T	ENST00000336314.4	+	15	2384	c.2360G>T	c.(2359-2361)tGt>tTt	p.C787F		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	864					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)	p.C787F(1)|p.C864F(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AGCTATGGCTGTACCCCTCAG	0.527																																						dbGAP											2	Substitution - Missense(2)	breast(2)											163.0	154.0	157.0					5																	154185485		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.2360G>T	5.37:g.154185485G>T	ENSP00000336721:p.Cys787Phe		O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,smart_DM15,pfscan_Lupus_La_RNA-bd	p.C787F	ENST00000336314.4	37	c.2360	CCDS4328.1	5	.	.	.	.	.	.	.	.	.	.	G	29.3	4.993257	0.93167	.	.	ENSG00000155506	ENST00000336314	T	0.24350	1.86	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.55242	0.1908	M	0.80616	2.505	0.80722	D	1	D;D	0.65815	0.982;0.995	P;D	0.66847	0.837;0.947	T	0.58482	-0.7629	10	0.72032	D	0.01	-13.0546	19.7429	0.96238	0.0:0.0:1.0:0.0	.	864;787	Q6PKG0;Q6PKG0-3	LARP1_HUMAN;.	F	787	ENSP00000336721:C787F	ENSP00000336721:C787F	C	+	2	0	LARP1	154165678	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	9.731000	0.98807	2.742000	0.94016	0.455000	0.32223	TGT	LARP1	-	NULL	ENSG00000155506		0.527	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP1	HGNC	protein_coding	OTTHUMT00000252509.1	374	0.27	1	G	NM_033551		154185485	154185485	+1	no_errors	ENST00000336314	ensembl	human	known	69_37n	missense	132	23.12	40	SNP	1.000	T
LDLR	3949	genome.wustl.edu	37	19	11218157	11218158	+	Missense_Mutation	DNP	CG	CG	AA	rs151207122	byFrequency	TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C|G	C|G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr19:11218157_11218158CG>AA	ENST00000558518.1	+	6	1094_1095	c.907_908CG>AA	c.(907-909)CGg>AAg	p.R303K	LDLR_ENST00000545707.1_Missense_Mutation_p.R176K|LDLR_ENST00000535915.1_Missense_Mutation_p.R262K|LDLR_ENST00000455727.2_Missense_Mutation_p.R135K|LDLR_ENST00000557933.1_Missense_Mutation_p.R303K|LDLR_ENST00000558013.1_Missense_Mutation_p.R303K	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	303	LDL-receptor class A 7. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.?(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	TAGAGACTGCCGGGACTGGTCA	0.564																																					GBM(18;201 575 7820 21545)	dbGAP											1	Unknown(1)	lung(1)	GRCh37	CM983994	LDLR	M	rs151207122																																			-	-	-	SO:0001583	missense	0			AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		Exception_encountered	19.37:g.11218157_11218158delinsAA	ENSP00000454071:p.Arg303Lys		B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Silent|Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.R303|p.R303Q	ENST00000558518.1	37	c.907|c.908	CCDS12254.1	19																																																																																			LDLR	-	pfam_LDrepeatLR_classA_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000130164		0.564	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDLR	HGNC	protein_coding	OTTHUMT00000415973.2	59|57	0.00	0	C|G			11218157|11218158	11218157|11218158	+1	no_errors	ENST00000558518	ensembl	human	known	69_37n	silent|missense	22	51.11|50.00	23|22	SNP	0.999|0.998	A
LEMD3	23592	genome.wustl.edu	37	12	65564185	65564185	+	Frame_Shift_Del	DEL	C	C	-	rs147082719		TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:65564185delC	ENST00000308330.2	+	1	835	c.809delC	c.(808-810)gccfs	p.A270fs	LEMD3_ENST00000541171.1_3'UTR	NM_001167614.1|NM_014319.4	NP_001161086.1|NP_055134.2	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	270					negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of cell cycle (GO:0051726)|skeletal muscle cell differentiation (GO:0035914)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	36			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		GACGACGTGGCCTCCAGCAGA	0.622																																						dbGAP											0													35.0	37.0	36.0					12																	65564185		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			AF263918	CCDS8972.1	12q14	2008-02-05			ENSG00000174106	ENSG00000174106			28887	protein-coding gene	gene with protein product		607844				10671519, 15489854	Standard	NM_014319		Approved	MAN1	uc001ssl.2	Q9Y2U8	OTTHUMG00000168840	ENST00000308330.2:c.809delC	12.37:g.65564185delC	ENSP00000308369:p.Ala270fs		Q9NT47|Q9NYA5	Frame_Shift_Del	DEL	pfam_Inner-Nucl-membr_MAN1,pfam_LEM,superfamily_LEM-like_dom,smart_LEM,pfscan_LEM	p.S271fs	ENST00000308330.2	37	c.809	CCDS8972.1	12																																																																																			LEMD3	-	NULL	ENSG00000174106		0.622	LEMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEMD3	HGNC	protein_coding	OTTHUMT00000401312.2	63	0.00	0	C			65564185	65564185	+1	no_errors	ENST00000308330	ensembl	human	known	69_37n	frame_shift_del	14	12.50	2	DEL	0.961	-
LIN54	132660	genome.wustl.edu	37	4	83849430	83849430	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr4:83849430T>C	ENST00000340417.3	-	13	2452	c.2075A>G	c.(2074-2076)gAa>gGa	p.E692G	LIN54_ENST00000395283.2_Missense_Mutation_p.E603G|LIN54_ENST00000510557.1_Missense_Mutation_p.E471G|LIN54_ENST00000442461.2_Missense_Mutation_p.E471G|LIN54_ENST00000505397.1_Missense_Mutation_p.E692G|LIN54_ENST00000506560.1_Missense_Mutation_p.E603G|LIN54_ENST00000446851.2_Missense_Mutation_p.E471G|LIN54_ENST00000395282.2_3'UTR|LIN54_ENST00000505905.1_5'Flank	NM_194282.2	NP_919258.2	Q6MZP7	LIN54_HUMAN	lin-54 DREAM MuvB core complex component	692					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)	p.E692G(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)	14		Hepatocellular(203;0.114)				TTCAGCTACTTCCTTAGTTAC	0.403																																						dbGAP											1	Substitution - Missense(1)	breast(1)											108.0	96.0	100.0					4																	83849430		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX537919	CCDS3599.1, CCDS47089.1, CCDS75157.1	4q21.22	2014-07-17	2014-07-17		ENSG00000189308	ENSG00000189308			25397	protein-coding gene	gene with protein product	"""CXC domain containing 1"""	613367	"""lin-54 homolog (C. elegans)"""			21498570	Standard	XM_005262749		Approved	MIP120, DKFZp686L1814, JC8.6, CXCDC1	uc003hnx.3	Q6MZP7	OTTHUMG00000130287	ENST00000340417.3:c.2075A>G	4.37:g.83849430T>C	ENSP00000341947:p.Glu692Gly		Q32M68|Q32M69|Q6N071|Q76B60	Missense_Mutation	SNP	pfam_TCR	p.E692G	ENST00000340417.3	37	c.2075	CCDS3599.1	4	.	.	.	.	.	.	.	.	.	.	T	29.4	5.002225	0.93227	.	.	ENSG00000189308	ENST00000340417;ENST00000395283;ENST00000442461;ENST00000446851;ENST00000510557;ENST00000506560;ENST00000505397	.	.	.	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.78413	0.4279	M	0.71206	2.165	0.80722	D	1	D;D;D	0.63046	0.992;0.986;0.992	D;P;P	0.69824	0.966;0.82;0.905	T	0.80412	-0.1393	9	0.72032	D	0.01	-23.0032	16.4696	0.84102	0.0:0.0:0.0:1.0	.	603;564;692	Q6MZP7-2;Q7Z3G2;Q6MZP7	.;.;LIN54_HUMAN	G	692;603;471;471;471;603;692	.	ENSP00000341947:E692G	E	-	2	0	LIN54	84068454	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.953000	0.87836	2.289000	0.77006	0.482000	0.46254	GAA	LIN54	-	NULL	ENSG00000189308		0.403	LIN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN54	HGNC	protein_coding	OTTHUMT00000252626.2	219	0.00	0	T	NM_194282		83849430	83849430	-1	no_errors	ENST00000340417	ensembl	human	known	69_37n	missense	72	23.96	23	SNP	1.000	C
MACF1	23499	genome.wustl.edu	37	1	39916733	39916733	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:39916733G>T	ENST00000372915.3	+	84	20052	c.19965G>T	c.(19963-19965)aaG>aaT	p.K6655N	MACF1_ENST00000539005.1_Missense_Mutation_p.K4567N|MACF1_ENST00000317713.7_Missense_Mutation_p.K4697N|MACF1_ENST00000545844.1_Missense_Mutation_p.K4697N|MACF1_ENST00000567887.1_Missense_Mutation_p.K6793N|MACF1_ENST00000289893.4_Missense_Mutation_p.K5199N|MACF1_ENST00000361689.2_Missense_Mutation_p.K4697N|MACF1_ENST00000564288.1_Missense_Mutation_p.K6756N			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6655					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.K4697N(1)|p.K5199N(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGCAGCACAAGTTGGAGGAAG	0.488																																						dbGAP											2	Substitution - Missense(2)	breast(2)											167.0	160.0	162.0					1																	39916733		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.19965G>T	1.37:g.39916733G>T	ENSP00000362006:p.Lys6655Asn		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.K4697N	ENST00000372915.3	37	c.14091		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.8|20.8	4.049189|4.049189	0.75846|0.75846	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.52057|.	0.68;0.68;0.68;0.68;0.68;0.68|.	6.16|6.16	0.103|0.103	0.14526|0.14526	.|.	0.000000|.	0.64402|.	D|.	0.000003|.	T|T	0.73575|0.73575	0.3604|0.3604	M|M	0.84585|0.84585	2.705|2.705	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.998;1.0|.	T|T	0.74172|0.74172	-0.3751|-0.3751	10|5	0.87932|.	D|.	0|.	.|.	11.0276|11.0276	0.47753|0.47753	0.4273:0.0:0.5727:0.0|0.4273:0.0:0.5727:0.0	.|.	6655;4697|.	Q9UPN3;F8W8Q1|.	MACF1_HUMAN;.|.	N|F	4697;6655;4697;4697;4567;5199|3701	ENSP00000439537:K4697N;ENSP00000362006:K6655N;ENSP00000354573:K4697N;ENSP00000313438:K4697N;ENSP00000444364:K4567N;ENSP00000289893:K5199N|.	ENSP00000289893:K5199N|.	K|V	+|+	3|1	2|0	MACF1|MACF1	39689320|39689320	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.994000|0.994000	0.84299|0.84299	2.034000|2.034000	0.41145|0.41145	0.198000|0.198000	0.20407|0.20407	-0.142000|-0.142000	0.14014|0.14014	AAG|GTT	MACF1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000127603		0.488	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	353	0.00	0	G	NM_033044		39916733	39916733	+1	no_errors	ENST00000317713	ensembl	human	known	69_37n	missense	73	44.27	58	SNP	1.000	T
LINGO4	339398	genome.wustl.edu	37	1	151773745	151773745	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:151773745C>T	ENST00000368820.3	-	2	2373	c.1436G>A	c.(1435-1437)aGa>aAa	p.R479K	RP11-98D18.17_ENST00000601909.1_lincRNA	NM_001004432.2	NP_001004432.1	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	479	Ig-like C2-type.					integral component of membrane (GO:0016021)		p.R479K(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			ATAGGCCCCTCTGTCCCGTAG	0.587																																						dbGAP											1	Substitution - Missense(1)	breast(1)											186.0	175.0	179.0					1																	151773745		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30855.1	1q21.3	2013-01-11	2007-02-01	2007-02-01	ENSG00000213171	ENSG00000213171		"""Immunoglobulin superfamily / I-set domain containing"""	31814	protein-coding gene	gene with protein product		609794	"""leucine rich repeat neuronal 6D"""	LRRN6D			Standard	NM_001004432		Approved		uc001ezf.1	Q6UY18	OTTHUMG00000013059	ENST00000368820.3:c.1436G>A	1.37:g.151773745C>T	ENSP00000357810:p.Arg479Lys			Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R479K	ENST00000368820.3	37	c.1436	CCDS30855.1	1	.	.	.	.	.	.	.	.	.	.	C	15.73	2.919153	0.52546	.	.	ENSG00000213171	ENST00000368820	T	0.27104	1.69	5.53	4.62	0.57501	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.124278	0.34046	N	0.004301	T	0.07143	0.0181	N	0.17723	0.515	0.28604	N	0.908991	B	0.21606	0.058	B	0.30401	0.115	T	0.16394	-1.0404	10	0.44086	T	0.13	.	7.5778	0.27946	0.0:0.7476:0.1664:0.0859	.	479	Q6UY18	LIGO4_HUMAN	K	479	ENSP00000357810:R479K	ENSP00000357810:R479K	R	-	2	0	LINGO4	150040369	0.402000	0.25311	0.751000	0.31187	0.988000	0.76386	1.609000	0.36858	1.567000	0.49668	0.650000	0.86243	AGA	LINGO4	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000213171		0.587	LINGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO4	HGNC	protein_coding	OTTHUMT00000036639.1	379	0.00	0	C	XM_291387		151773745	151773745	-1	no_errors	ENST00000368820	ensembl	human	known	69_37n	missense	119	32.00	56	SNP	0.895	T
MAEL	84944	genome.wustl.edu	37	1	166985513	166985513	+	Silent	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:166985513G>A	ENST00000367872.4	+	9	1144	c.900G>A	c.(898-900)aaG>aaA	p.K300K	MAEL_ENST00000491055.1_3'UTR|MAEL_ENST00000367870.2_Silent_p.K269K	NM_032858.1	NP_116247.1	Q96JY0	MAEL_HUMAN	maelstrom spermatogenic transposon silencer	300					cell differentiation (GO:0030154)|cell morphogenesis (GO:0000902)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|piRNA metabolic process (GO:0034587)|regulation of organ growth (GO:0046620)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	autosome (GO:0030849)|chromatin (GO:0000785)|chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|perinuclear region of cytoplasm (GO:0048471)|piP-body (GO:0071547)|XY body (GO:0001741)	DNA binding (GO:0003677)	p.K300K(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(12)|skin(4)	28						CTGTTTGCAAGAAGATTGCGT	0.378																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											152.0	150.0	151.0					1																	166985513		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027810, DQ076156	CCDS1257.1, CCDS65712.1, CCDS72975.1	1q24.1	2013-10-11	2012-12-18		ENSG00000143194	ENSG00000143194			25929	protein-coding gene	gene with protein product	"""cancer/testis antigen 128"", ""spermatogenesis associated 35"""	611368	"""maelstrom homolog (Drosophila)"""			19693694, 18694567	Standard	NM_001286378		Approved	FLJ14904, CT128, SPATA35	uc001gdy.1	Q96JY0	OTTHUMG00000034432	ENST00000367872.4:c.900G>A	1.37:g.166985513G>A			B4DY43|E9JVC3|Q49AP9|Q5VZP8|Q9UIW6	Silent	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,superfamily_CH-domain	p.K300	ENST00000367872.4	37	c.900	CCDS1257.1	1																																																																																			MAEL	-	NULL	ENSG00000143194		0.378	MAEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAEL	HGNC	protein_coding	OTTHUMT00000083239.1	373	0.00	0	G	NM_032858		166985513	166985513	+1	no_errors	ENST00000367872	ensembl	human	known	69_37n	silent	126	20.25	32	SNP	1.000	A
MAPK8	5599	genome.wustl.edu	37	10	49618209	49618209	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr10:49618209C>T	ENST00000374189.1	+	5	629	c.448C>T	c.(448-450)Cgg>Tgg	p.R150W	MAPK8_ENST00000374182.3_Missense_Mutation_p.R150W|MAPK8_ENST00000374174.1_Missense_Mutation_p.R150W|MAPK8_ENST00000360332.3_Missense_Mutation_p.R150W|MAPK8_ENST00000395611.3_Missense_Mutation_p.R150W			P45983	MK08_HUMAN	mitogen-activated protein kinase 8	150	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nitric oxide (GO:0071732)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|programmed necrotic cell death (GO:0097300)|regulation of histone deacetylation (GO:0031063)|regulation of protein localization (GO:0032880)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to cadmium ion (GO:0046686)|response to stress (GO:0006950)|response to UV (GO:0009411)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|JUN kinase activity (GO:0004705)|protein serine/threonine kinase activity (GO:0004674)	p.R150W(2)		breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	34		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		AATTATTCATCGGGTTAGTAG	0.363																																						dbGAP											2	Substitution - Missense(2)	breast(2)											167.0	149.0	155.0					10																	49618209		2203	4300	6503	-	-	-	SO:0001583	missense	0			L26318	CCDS7223.1, CCDS7224.1, CCDS7225.1, CCDS7226.1, CCDS60527.1	10q11	2011-06-09			ENSG00000107643	ENSG00000107643	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6881	protein-coding gene	gene with protein product	"""JUN N-terminal kinase"""	601158		PRKM8		8137421, 8654373	Standard	NM_002750		Approved	JNK, JNK1, SAPK1	uc001jgp.3	P45983	OTTHUMG00000018172	ENST00000374189.1:c.448C>T	10.37:g.49618209C>T	ENSP00000363304:p.Arg150Trp		B5BTZ5|B7ZLV4|D3DX88|D3DX92|Q15709|Q15712|Q15713|Q308M2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_JNK	p.R150W	ENST00000374189.1	37	c.448	CCDS7224.1	10	.	.	.	.	.	.	.	.	.	.	C	22.2	4.263965	0.80358	.	.	ENSG00000107643	ENST00000429041;ENST00000374189;ENST00000374182;ENST00000374179;ENST00000360332;ENST00000374176;ENST00000374174;ENST00000395611	D;D;D;D;D;D;D;D	0.90504	-2.68;-2.68;-2.68;-2.68;-2.68;-2.68;-2.68;-2.68	5.4	5.4	0.78164	Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97623	0.9221	H	0.99789	4.78	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;0.999	D	0.98102	1.0415	9	.	.	.	.	12.6677	0.56851	0.2738:0.7262:0.0:0.0	.	150;150;150;150;150	Q308M2;P45983-2;P45983;A1L4K2;P45983-3	.;.;MK08_HUMAN;.;.	W	67;150;150;150;150;150;150;150	ENSP00000393223:R67W;ENSP00000363304:R150W;ENSP00000363297:R150W;ENSP00000363294:R150W;ENSP00000353483:R150W;ENSP00000363291:R150W;ENSP00000363289:R150W;ENSP00000378974:R150W	.	R	+	1	2	MAPK8	49288215	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.379000	0.66196	2.695000	0.91970	0.650000	0.86243	CGG	MAPK8	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000107643		0.363	MAPK8-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAPK8	HGNC	protein_coding	OTTHUMT00000047931.1	990	0.20	2	C			49618209	49618209	+1	no_errors	ENST00000360332	ensembl	human	known	69_37n	missense	430	25.09	144	SNP	1.000	T
MBTPS2	51360	genome.wustl.edu	37	X	21871596	21871596	+	Silent	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chrX:21871596C>G	ENST00000379484.5	+	5	744	c.645C>G	c.(643-645)gtC>gtG	p.V215V	MBTPS2_ENST00000465888.1_3'UTR|MBTPS2_ENST00000365779.2_Silent_p.V215V|YY2_ENST00000429584.2_5'Flank	NM_015884.3	NP_056968.1	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase, site 2	215					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.V215V(1)		breast(2)|endometrium(3)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24						TATCGCCAGTCCAGCAGCTAA	0.343																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											165.0	159.0	161.0					X																	21871596		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF019612	CCDS14201.1	Xp22.12-p22.11	2014-02-03	2005-08-17		ENSG00000012174	ENSG00000012174			15455	protein-coding gene	gene with protein product		300294	"""membrane-bound transcription factor protease, site 2"", ""keratosis follicularis spinulosa decalvans"""	KFSD		9847074, 9659902, 20672378	Standard	NM_015884		Approved	S2P	uc004dae.3	O43462	OTTHUMG00000021237	ENST00000379484.5:c.645C>G	X.37:g.21871596C>G			Q9UM70|Q9UMD3	Silent	SNP	pfam_Peptidase_M50,superfamily_PDZ,prints_Pept_M50_SREBP	p.V215	ENST00000379484.5	37	c.645	CCDS14201.1	X																																																																																			MBTPS2	-	pfam_Peptidase_M50,superfamily_PDZ	ENSG00000012174		0.343	MBTPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTPS2	HGNC	protein_coding	OTTHUMT00000056026.1	527	0.00	0	C			21871596	21871596	+1	no_errors	ENST00000379484	ensembl	human	known	69_37n	silent	530	11.50	69	SNP	0.985	G
MDGA2	161357	genome.wustl.edu	37	14	47342770	47342770	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr14:47342770G>A	ENST00000399232.2	-	14	2775	c.2411C>T	c.(2410-2412)tCa>tTa	p.S804L	MDGA2_ENST00000357362.3_Missense_Mutation_p.S575L|MDGA2_ENST00000439988.3_Missense_Mutation_p.S873L|MDGA2_ENST00000399222.3_Missense_Mutation_p.S6L|MDGA2_ENST00000426342.1_Missense_Mutation_p.S575L	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	804	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.S575L(2)|p.S873L(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TCTGGGTCGTGATGTCTCAAT	0.373																																						dbGAP											3	Substitution - Missense(3)	breast(3)											124.0	120.0	121.0					14																	47342770		1849	4095	5944	-	-	-	SO:0001583	missense	0			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2411C>T	14.37:g.47342770G>A	ENSP00000382178:p.Ser804Leu		F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like	p.S873L	ENST00000399232.2	37	c.2618		14	.	.	.	.	.	.	.	.	.	.	G	29.5	5.011620	0.93346	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000399222;ENST00000357362	T;T;T;T;T	0.02787	4.16;4.16;4.16;4.16;4.16	5.19	5.19	0.71726	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.000000	0.47852	U	0.000203	T	0.18002	0.0432	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	0.992;1.0	D;D	0.97110	0.985;1.0	T	0.00201	-1.1926	10	0.87932	D	0	.	17.6371	0.88125	0.0:0.0:1.0:0.0	.	575;804	F6W3S7;Q7Z553	.;MDGA2_HUMAN	L	804;575;873;6;575	ENSP00000400011:S804L;ENSP00000405456:S575L;ENSP00000382178:S873L;ENSP00000382168:S6L;ENSP00000349925:S575L	ENSP00000349925:S575L	S	-	2	0	MDGA2	46412520	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	9.420000	0.97426	2.571000	0.86741	0.467000	0.42956	TCA	MDGA2	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl,smart_MAM_dom,pfscan_MAM_dom	ENSG00000139915		0.373	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	HGNC	protein_coding	OTTHUMT00000073352.5	361	0.00	0	G	NM_182830		47342770	47342770	-1	no_errors	ENST00000399232	ensembl	human	known	69_37n	missense	107	27.33	41	SNP	1.000	A
METTL13	51603	genome.wustl.edu	37	1	171765635	171765635	+	Silent	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:171765635C>T	ENST00000361735.3	+	8	2105	c.1839C>T	c.(1837-1839)ctC>ctT	p.L613L	METTL13_ENST00000466643.1_3'UTR|METTL13_ENST00000362019.3_Silent_p.L527L|METTL13_ENST00000367737.5_Silent_p.L457L|METTL13_ENST00000458517.1_Silent_p.L612L	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	613							methyltransferase activity (GO:0008168)	p.L613L(1)		breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						TTTTTATTCTCAACCTTGTGT	0.473																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											144.0	136.0	139.0					1																	171765635		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.1839C>T	1.37:g.171765635C>T			A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Silent	SNP	pfam_Methyltransf_11,pfam_Spermidine/spermine_synthase	p.L613	ENST00000361735.3	37	c.1839	CCDS1299.1	1																																																																																			METTL13	-	pfam_Spermidine/spermine_synthase	ENSG00000010165		0.473	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL13	HGNC	protein_coding	OTTHUMT00000084528.5	508	0.00	0	C	NM_014955		171765635	171765635	+1	no_errors	ENST00000361735	ensembl	human	known	69_37n	silent	163	32.79	81	SNP	0.988	T
MOS	4342	genome.wustl.edu	37	8	57025782	57025782	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr8:57025782C>G	ENST00000311923.1	-	1	759	c.760G>C	c.(760-762)Gag>Cag	p.E254Q		NM_005372.1	NP_005363.1	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene homolog	254	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|chromatin organization (GO:0006325)|establishment of meiotic spindle orientation (GO:0051296)|MAPK cascade (GO:0000165)|meiotic spindle organization (GO:0000212)|negative regulation of metaphase/anaphase transition of meiotic cell cycle (GO:1902103)|protein autophosphorylation (GO:0046777)|regulation of meiosis (GO:0040020)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)	p.E254Q(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(12)|ovary(1)|urinary_tract(2)	22			Epithelial(17;0.00117)|all cancers(17;0.00879)			GTCACGCCCTCTCCTTTCAGG	0.567																																					Esophageal Squamous(124;373 2870 4778)	dbGAP											1	Substitution - Missense(1)	breast(1)											58.0	64.0	62.0					8																	57025782		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6164.1	8q11	2012-10-02			ENSG00000172680	ENSG00000172680			7199	protein-coding gene	gene with protein product		190060				9552420	Standard	NM_005372		Approved		uc011leb.2	P00540	OTTHUMG00000164299	ENST00000311923.1:c.760G>C	8.37:g.57025782C>G	ENSP00000310722:p.Glu254Gln		Q3KPG9|Q3KPH0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E254Q	ENST00000311923.1	37	c.760	CCDS6164.1	8	.	.	.	.	.	.	.	.	.	.	C	18.82	3.705961	0.68615	.	.	ENSG00000172680	ENST00000311923	T	0.65364	-0.15	5.8	5.8	0.92144	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.64170	0.2574	N	0.04508	-0.205	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74372	-0.3687	10	0.87932	D	0	.	20.0537	0.97638	0.0:1.0:0.0:0.0	.	254	P00540	MOS_HUMAN	Q	254	ENSP00000310722:E254Q	ENSP00000310722:E254Q	E	-	1	0	MOS	57188336	1.000000	0.71417	0.996000	0.52242	0.193000	0.23685	7.336000	0.79245	2.758000	0.94735	0.561000	0.74099	GAG	MOS	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000172680		0.567	MOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOS	HGNC	protein_coding	OTTHUMT00000378174.1	53	0.00	0	C	NM_005372		57025782	57025782	-1	no_errors	ENST00000311923	ensembl	human	known	69_37n	missense	20	23.08	6	SNP	1.000	G
MPP6	51678	genome.wustl.edu	37	7	24681452	24681452	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr7:24681452G>A	ENST00000222644.5	+	3	485	c.235G>A	c.(235-237)Gaa>Aaa	p.E79K	MPP6_ENST00000396475.2_Missense_Mutation_p.E79K|MPP6_ENST00000409761.1_5'UTR			Q99547	MPH6_HUMAN	membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)	0					maturation of 5.8S rRNA (GO:0000460)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)	p.E79K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|skin(2)	20						AAATGTGGCAGAATTGGTTGG	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											137.0	136.0	136.0					7																	24681452		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF162130	CCDS5388.1	7p15	2007-08-01			ENSG00000105926	ENSG00000105926			18167	protein-coding gene	gene with protein product		606959				10753959, 11311936	Standard	NM_016447		Approved	PALS2, VAM-1, p55T	uc003swx.3	Q9NZW5	OTTHUMG00000023507	ENST00000222644.5:c.235G>A	7.37:g.24681452G>A	ENSP00000222644:p.Glu79Lys		B2RAF0	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_L27_C,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.E79K	ENST00000222644.5	37	c.235	CCDS5388.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.869625	0.97049	.	.	ENSG00000105926	ENST00000432190;ENST00000222644;ENST00000396475;ENST00000430180	T;T;T;T	0.32753	1.44;3.01;3.01;1.88	5.65	5.65	0.86999	L27, C-terminal (1);L27 (2);	0.105807	0.40554	N	0.001074	T	0.61974	0.2390	M	0.90650	3.135	0.80722	D	1	D	0.64830	0.994	P	0.59012	0.85	T	0.69453	-0.5141	10	0.87932	D	0	.	20.0781	0.97751	0.0:0.0:1.0:0.0	.	79	Q9NZW5	MPP6_HUMAN	K	79	ENSP00000395859:E79K;ENSP00000222644:E79K;ENSP00000379737:E79K;ENSP00000391020:E79K	ENSP00000222644:E79K	E	+	1	0	MPP6	24647977	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.813000	0.99286	2.817000	0.96982	0.563000	0.77884	GAA	MPP6	-	pfam_L27_C,smart_L27,pfscan_L27	ENSG00000105926		0.378	MPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP6	HGNC	protein_coding	OTTHUMT00000250272.4	442	0.23	1	G			24681452	24681452	+1	no_errors	ENST00000222644	ensembl	human	known	69_37n	missense	166	25.56	57	SNP	1.000	A
MRPL1	65008	genome.wustl.edu	37	4	78873708	78873708	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr4:78873708C>T	ENST00000315567.8	+	9	1254	c.925C>T	c.(925-927)Cca>Tca	p.P309S		NM_020236.3	NP_064621.3	Q9BYD6	RM01_HUMAN	mitochondrial ribosomal protein L1	309					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.P309S(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)	17						GAAGATTGATCCATTGTTGCC	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											142.0	136.0	138.0					4																	78873708		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB049474	CCDS3583.2	4q21.1	2012-09-13			ENSG00000169288	ENSG00000169288		"""Mitochondrial ribosomal proteins / large subunits"""	14275	protein-coding gene	gene with protein product		611821					Standard	NM_020236		Approved	BM022	uc003hku.2	Q9BYD6	OTTHUMG00000130200	ENST00000315567.8:c.925C>T	4.37:g.78873708C>T	ENSP00000315017:p.Pro309Ser		A6NG03|Q4W5B8|Q6IAG4|Q96BW3|Q9H793|Q9NRL5	Missense_Mutation	SNP	pfam_Ribosomal_L1,superfamily_Ribosomal_L1_SF,tigrfam_Ribosomal_L1_mit	p.P309S	ENST00000315567.8	37	c.925	CCDS3583.2	4	.	.	.	.	.	.	.	.	.	.	C	1.388	-0.581469	0.03854	.	.	ENSG00000169288	ENST00000315567;ENST00000538314	T	0.32515	1.45	6.16	3.49	0.39957	Ribosomal protein L1, superfamily (1);	0.582086	0.19199	N	0.120227	T	0.20088	0.0483	L	0.45137	1.4	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.35226	-0.9797	10	0.07175	T	0.84	-0.6014	6.5303	0.22324	0.1451:0.702:0.0:0.1528	.	309	Q9BYD6	RM01_HUMAN	S	309;287	ENSP00000315017:P309S	ENSP00000315017:P309S	P	+	1	0	MRPL1	79092732	0.018000	0.18449	0.003000	0.11579	0.005000	0.04900	1.781000	0.38644	0.460000	0.27045	-0.188000	0.12872	CCA	MRPL1	-	superfamily_Ribosomal_L1_SF	ENSG00000169288		0.343	MRPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL1	HGNC	protein_coding	OTTHUMT00000252518.3	242	0.00	0	C	NM_020236		78873708	78873708	+1	no_errors	ENST00000315567	ensembl	human	known	69_37n	missense	74	25.25	25	SNP	0.005	T
MRPS9	64965	genome.wustl.edu	37	2	105665628	105665628	+	Splice_Site	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr2:105665628G>C	ENST00000258455.3	+	2	245		c.e2-1			NM_182640.2	NP_872578.1	P82933	RT09_HUMAN	mitochondrial ribosomal protein S9						DNA damage response, detection of DNA damage (GO:0042769)|peptide biosynthetic process (GO:0043043)|translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.?(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18						TTTTCTGTTAGATATTAAGGC	0.289																																						dbGAP											1	Unknown(1)	breast(1)											43.0	44.0	44.0					2																	105665628		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS2065.1	2q12.1	2012-09-13			ENSG00000135972	ENSG00000135972		"""Mitochondrial ribosomal proteins / small subunits"""	14501	protein-coding gene	gene with protein product	"""28S ribosomal protein S9, mitochondrial"""	611975				11279123	Standard	NM_182640		Approved	RPMS9, MRP-S9, S9mt	uc002tcn.4	P82933	OTTHUMG00000130807	ENST00000258455.3:c.136-1G>C	2.37:g.105665628G>C			Q6PG40	Splice_Site	SNP	-	e2-1	ENST00000258455.3	37	c.136-1	CCDS2065.1	2	.	.	.	.	.	.	.	.	.	.	G	10.34	1.322760	0.23994	.	.	ENSG00000135972	ENST00000258455	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1823	0.98208	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MRPS9	105032060	1.000000	0.71417	0.839000	0.33178	0.008000	0.06430	5.494000	0.66905	2.771000	0.95319	0.650000	0.86243	.	MRPS9	-	-	ENSG00000135972		0.289	MRPS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS9	HGNC	protein_coding	OTTHUMT00000253352.1	318	0.00	0	G	NM_182640	Intron	105665628	105665628	+1	no_errors	ENST00000258455	ensembl	human	known	69_37n	splice_site	101	17.21	21	SNP	1.000	C
MTF2	22823	genome.wustl.edu	37	1	93599740	93599740	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:93599740C>G	ENST00000370298.4	+	14	1701	c.1412C>G	c.(1411-1413)tCc>tGc	p.S471C	MTF2_ENST00000370303.4_Missense_Mutation_p.S414C|MTF2_ENST00000540243.1_Missense_Mutation_p.S369C|MTF2_ENST00000545708.1_Missense_Mutation_p.S369C|MTF2_ENST00000471953.1_3'UTR	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2	471					chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.S471C(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		TCTAGCATTTCCAGGCATTAT	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											70.0	74.0	73.0					1																	93599740		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.1412C>G	1.37:g.93599740C>G	ENSP00000359321:p.Ser471Cys		A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.S471C	ENST00000370298.4	37	c.1412	CCDS742.1	1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.460987	0.63513	.	.	ENSG00000143033	ENST00000545708;ENST00000540243;ENST00000370298;ENST00000370303	T;T;T;T	0.37235	1.21;1.21;1.62;1.59	5.36	5.36	0.76844	.	0.054104	0.85682	D	0.000000	T	0.39253	0.1071	L	0.27053	0.805	0.80722	D	1	P;D;D	0.76494	0.661;0.966;0.999	B;P;D	0.64776	0.181;0.695;0.929	T	0.38090	-0.9677	10	0.66056	D	0.02	3.1088	19.0949	0.93246	0.0:1.0:0.0:0.0	.	414;471;369	B1AKT6;Q9Y483;B4DZG1	.;MTF2_HUMAN;.	C	369;369;471;414	ENSP00000444962:S369C;ENSP00000443295:S369C;ENSP00000359321:S471C;ENSP00000359326:S414C	ENSP00000359321:S471C	S	+	2	0	MTF2	93372328	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.382000	0.79729	2.520000	0.84964	0.655000	0.94253	TCC	MTF2	-	NULL	ENSG00000143033		0.348	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTF2	HGNC	protein_coding	OTTHUMT00000028075.3	392	0.00	0	C	NM_007358		93599740	93599740	+1	no_errors	ENST00000370298	ensembl	human	known	69_37n	missense	81	39.71	54	SNP	1.000	G
MYO9B	4650	genome.wustl.edu	37	19	17212831	17212831	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr19:17212831G>A	ENST00000594824.1	+	2	451	c.304G>A	c.(304-306)Gag>Aag	p.E102K	CTD-2528A14.5_ENST00000597045.1_RNA|MYO9B_ENST00000397274.2_Missense_Mutation_p.E102K|MYO9B_ENST00000595618.1_Missense_Mutation_p.E102K			Q13459	MYO9B_HUMAN	myosin IXB	102	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.E102K(2)		breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						GCACCCTCAGGAGGATGGCTA	0.647																																						dbGAP											2	Substitution - Missense(2)	breast(2)											34.0	37.0	36.0					19																	17212831		2036	4194	6230	-	-	-	SO:0001583	missense	0				CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.304G>A	19.37:g.17212831G>A	ENSP00000471367:p.Glu102Lys		O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.E102K	ENST00000594824.1	37	c.304		19	.	.	.	.	.	.	.	.	.	.	G	3.588	-0.084221	0.07097	.	.	ENSG00000099331	ENST00000397274	T	0.27557	1.66	5.39	3.03	0.35002	Ras-association (3);	0.491317	0.17025	N	0.189970	T	0.11793	0.0287	N	0.04880	-0.145	0.09310	N	0.999998	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.004;0.004;0.004	T	0.19386	-1.0307	10	0.20519	T	0.43	.	3.5578	0.07870	0.1439:0.0:0.3577:0.4984	.	102;102;108	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	K	102	ENSP00000380444:E102K	ENSP00000380444:E102K	E	+	1	0	MYO9B	17073831	1.000000	0.71417	0.066000	0.19879	0.740000	0.42216	2.258000	0.43249	1.190000	0.43042	0.655000	0.94253	GAG	MYO9B	-	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	ENSG00000099331		0.647	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	MYO9B	HGNC	protein_coding	OTTHUMT00000463236.1	57	0.00	0	G			17212831	17212831	+1	no_errors	ENST00000397274	ensembl	human	known	69_37n	missense	25	23.53	8	SNP	0.259	A
MYOM2	9172	genome.wustl.edu	37	8	2000312	2000312	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr8:2000312G>C	ENST00000262113.4	+	3	285	c.144G>C	c.(142-144)ttG>ttC	p.L48F	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	48					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.L48F(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		AGAAGTCCTTGAGTCAGCGGT	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											198.0	179.0	185.0					8																	2000312		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.144G>C	8.37:g.2000312G>C	ENSP00000262113:p.Leu48Phe		Q7Z3Y2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L48F	ENST00000262113.4	37	c.144	CCDS5957.1	8	.	.	.	.	.	.	.	.	.	.	G	1.061	-0.672884	0.03403	.	.	ENSG00000036448	ENST00000262113	T	0.50813	0.73	4.41	-4.29	0.03721	.	0.867030	0.09896	N	0.741698	T	0.23688	0.0573	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32851	-0.9891	10	0.08837	T	0.75	.	7.2144	0.25951	0.0:0.5406:0.1566:0.3028	.	48	P54296	MYOM2_HUMAN	F	48	ENSP00000262113:L48F	ENSP00000262113:L48F	L	+	3	2	MYOM2	1987719	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.729000	0.04920	-0.938000	0.03714	-0.976000	0.02587	TTG	MYOM2	-	NULL	ENSG00000036448		0.557	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	337	0.00	0	G	NM_003970		2000312	2000312	+1	no_errors	ENST00000262113	ensembl	human	known	69_37n	missense	121	18.79	28	SNP	0.000	C
NCKAP1L	3071	genome.wustl.edu	37	12	54914999	54914999	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:54914999G>A	ENST00000293373.6	+	18	1934	c.1855G>A	c.(1855-1857)Gag>Aag	p.E619K	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.E569K	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	619					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)	p.E619K(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						GATCTGTGCTGAGCAGCGAAA	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											132.0	119.0	124.0					12																	54914999		2203	4300	6503	-	-	-	SO:0001583	missense	0			AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.1855G>A	12.37:g.54914999G>A	ENSP00000293373:p.Glu619Lys		B4DUT5|Q52LW0	Missense_Mutation	SNP	pfam_Nck-associated_protein-1,superfamily_Nucl_hormone_rcpt_ligand-bd	p.E619K	ENST00000293373.6	37	c.1855	CCDS31813.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.507516	0.96386	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.38722	1.12;1.12	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.65196	0.2668	M	0.78049	2.395	0.58432	D	0.999999	D	0.69078	0.997	D	0.79108	0.992	T	0.64867	-0.6306	10	0.39692	T	0.17	-13.7836	16.4729	0.84119	0.0:0.0:1.0:0.0	.	619	P55160	NCKPL_HUMAN	K	619;569	ENSP00000293373:E619K;ENSP00000445596:E569K	ENSP00000293373:E619K	E	+	1	0	NCKAP1L	53201266	1.000000	0.71417	0.986000	0.45419	0.968000	0.65278	9.251000	0.95483	2.558000	0.86282	0.484000	0.47621	GAG	NCKAP1L	-	pfam_Nck-associated_protein-1	ENSG00000123338		0.547	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1L	HGNC	protein_coding	OTTHUMT00000406195.1	348	0.00	0	G	NM_005337		54914999	54914999	+1	no_errors	ENST00000293373	ensembl	human	known	69_37n	missense	162	31.36	74	SNP	1.000	A
NCOA6	23054	genome.wustl.edu	37	20	33345176	33345176	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr20:33345176G>C	ENST00000374796.2	-	8	3945	c.1375C>G	c.(1375-1377)Caa>Gaa	p.Q459E	NCOA6_ENST00000359003.2_Missense_Mutation_p.Q459E			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	459	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q459E(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						GGGTTATTTTGAGGTGGCCTT	0.552																																						dbGAP											1	Substitution - Missense(1)	breast(1)											106.0	111.0	109.0					20																	33345176		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.1375C>G	20.37:g.33345176G>C	ENSP00000363929:p.Gln459Glu		A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	NULL	p.Q459E	ENST00000374796.2	37	c.1375	CCDS13241.1	20	.	.	.	.	.	.	.	.	.	.	G	17.86	3.491535	0.64074	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.26067	1.76;1.76	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000004	T	0.40222	0.1108	L	0.29908	0.895	0.48762	D	0.999702	P;P	0.52842	0.954;0.956	D;D	0.65140	0.932;0.931	T	0.04017	-1.0984	10	0.36615	T	0.2	-4.1266	19.8745	0.96864	0.0:0.0:1.0:0.0	.	459;459	F6M2K2;Q14686	.;NCOA6_HUMAN	E	459	ENSP00000363929:Q459E;ENSP00000351894:Q459E	ENSP00000351894:Q459E	Q	-	1	0	NCOA6	32808837	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.778000	0.75043	2.704000	0.92352	0.467000	0.42956	CAA	NCOA6	-	NULL	ENSG00000198646		0.552	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2	312	0.00	0	G	NM_014071		33345176	33345176	-1	no_errors	ENST00000359003	ensembl	human	known	69_37n	missense	103	27.46	39	SNP	1.000	C
NLRC4	58484	genome.wustl.edu	37	2	32475388	32475388	+	Silent	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr2:32475388G>A	ENST00000404025.2	-	5	2033	c.1545C>T	c.(1543-1545)caC>caT	p.H515H	NLRC4_ENST00000342905.6_Intron|NLRC4_ENST00000402280.1_Silent_p.H515H|NLRC4_ENST00000360906.5_Silent_p.H515H			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	515					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)	p.H515H(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GAAGGCAGCCGTGTTGATACA	0.507																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											81.0	78.0	79.0					2																	32475388		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.1545C>T	2.37:g.32475388G>A			A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Silent	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_NACHT_NTPase,pfscan_CARD	p.H515	ENST00000404025.2	37	c.1545	CCDS33174.1	2																																																																																			NLRC4	-	NULL	ENSG00000091106		0.507	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	NLRC4	HGNC	protein_coding	OTTHUMT00000325222.2	283	0.00	0	G	NM_021209		32475388	32475388	-1	no_errors	ENST00000360906	ensembl	human	known	69_37n	silent	109	30.57	48	SNP	0.052	A
NUGGC	389643	genome.wustl.edu	37	8	27886887	27886887	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr8:27886887C>G	ENST00000413272.2	-	17	2192	c.2050G>C	c.(2050-2052)Gag>Cag	p.E684Q	NUGGC_ENST00000341513.6_Missense_Mutation_p.E684Q	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	684					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.E684Q(2)									TTCATCCGCTCACACGCTTTT	0.532																																						dbGAP											2	Substitution - Missense(2)	breast(2)											64.0	65.0	65.0					8																	27886887		2012	4182	6194	-	-	-	SO:0001583	missense	0			AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.2050G>C	8.37:g.27886887C>G	ENSP00000408697:p.Glu684Gln		Q6ZP73	Missense_Mutation	SNP	pfam_Dynamin_GTPase	p.E684Q	ENST00000413272.2	37	c.2050	CCDS47833.1	8	.	.	.	.	.	.	.	.	.	.	C	9.944	1.218349	0.22373	.	.	ENSG00000189233	ENST00000413272;ENST00000341513	T;T	0.14640	2.49;2.49	5.56	5.56	0.83823	.	0.259577	0.39146	N	0.001454	T	0.10551	0.0258	N	0.20986	0.625	0.36936	D	0.89215	B	0.23316	0.083	B	0.16722	0.016	T	0.20571	-1.0271	10	0.27082	T	0.32	-28.8061	15.0246	0.71659	0.0:1.0:0.0:0.0	.	684	Q68CJ6	SLIP_HUMAN	Q	684	ENSP00000408697:E684Q;ENSP00000345031:E684Q	ENSP00000345031:E684Q	E	-	1	0	C8orf80	27942806	0.999000	0.42202	0.939000	0.37840	0.163000	0.22366	1.994000	0.40757	2.608000	0.88229	0.655000	0.94253	GAG	NUGGC	-	NULL	ENSG00000189233		0.532	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUGGC	HGNC	protein_coding	OTTHUMT00000342494.1	82	0.00	0	C	NM_001010906		27886887	27886887	-1	no_errors	ENST00000341513	ensembl	human	known	69_37n	missense	31	22.50	9	SNP	0.999	G
OBSCN	84033	genome.wustl.edu	37	1	228491624	228491625	+	Intron	DEL	AC	AC	-			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:228491624_228491625delAC	ENST00000422127.1	+	44	11703				RP5-1139B12.4_ENST00000602778.1_RNA|OBSCN_ENST00000366709.4_Intron|OBSCN_ENST00000570156.2_Frame_Shift_Del_p.T4663fs|OBSCN_ENST00000284548.11_Intron|OBSCN_ENST00000359599.6_3'UTR|OBSCN_ENST00000366707.4_Frame_Shift_Del_p.T1353fs	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AACCTCAGCTACACTCACTGTC	0.545																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11660-2448AC>-	1.37:g.228491626_228491627delAC			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_DH-domain,pfam_Fibronectin_type3,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.L1354fs	ENST00000422127.1	37	c.4057_4058	CCDS58065.1	1																																																																																			OBSCN	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000154358		0.545	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		197	0.00	0	AC	NM_052843		228491624	228491625	+1	no_errors	ENST00000366707	ensembl	human	known	69_37n	frame_shift_del	74	34.75	41	DEL	0.004:0.000	-
OR4N2	390429	genome.wustl.edu	37	14	20296308	20296308	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr14:20296308A>G	ENST00000315947.1	+	1	701	c.701A>G	c.(700-702)aAc>aGc	p.N234S	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N234S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GAGGCAAAAAACAAGGCCATG	0.498																																						dbGAP											1	Substitution - Missense(1)	breast(1)											107.0	109.0	108.0					14																	20296308		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.701A>G	14.37:g.20296308A>G	ENSP00000319601:p.Asn234Ser		Q6IEY9|Q6IFA2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.N234S	ENST00000315947.1	37	c.701	CCDS32022.1	14	.	.	.	.	.	.	.	.	.	.	.	0.042	-1.279933	0.01398	.	.	ENSG00000176294	ENST00000315947	T	0.00039	8.85	4.52	-0.673	0.11373	GPCR, rhodopsin-like superfamily (1);	0.841254	0.10543	N	0.662428	T	0.00039	0.0001	N	0.00493	-1.44	0.09310	N	1	B	0.02656	0.0	B	0.11329	0.006	T	0.01218	-1.1415	10	0.22109	T	0.4	0.0112	4.8998	0.13769	0.5831:0.1603:0.2565:0.0	.	234	Q8NGD1	OR4N2_HUMAN	S	234	ENSP00000319601:N234S	ENSP00000319601:N234S	N	+	2	0	OR4N2	19366148	0.000000	0.05858	0.980000	0.43619	0.138000	0.21146	-1.399000	0.02506	0.083000	0.17047	0.477000	0.44152	AAC	OR4N2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176294		0.498	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N2	HGNC	protein_coding	OTTHUMT00000409821.2	672	0.00	0	A			20296308	20296308	+1	no_errors	ENST00000315947	ensembl	human	known	69_37n	missense	266	28.49	106	SNP	0.138	G
OR7D2	162998	genome.wustl.edu	37	19	9296715	9296715	+	Silent	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr19:9296715G>A	ENST00000344248.2	+	1	437	c.258G>A	c.(256-258)caG>caA	p.Q86Q		NM_175883.2	NP_787079.1	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D, member 2	86					regulation of transcription, DNA-templated (GO:0006355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q86Q(1)		breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	20						TGAACATCCAGACCGAGAACA	0.517																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											167.0	155.0	159.0					19																	9296715		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095468	CCDS32900.1	19p13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8378	protein-coding gene	gene with protein product							Standard	NM_175883		Approved	OR19-4, HTPCRH03, FLJ38149	uc002mkz.1	Q96RA2		ENST00000344248.2:c.258G>A	19.37:g.9296715G>A			Q6IFJ7|Q8N133	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.Q86	ENST00000344248.2	37	c.258	CCDS32900.1	19																																																																																			OR7D2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000188000		0.517	OR7D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7D2	HGNC	protein_coding	OTTHUMT00000449002.1	833	0.24	2	G			9296715	9296715	+1	no_errors	ENST00000344248	ensembl	human	known	69_37n	silent	389	24.42	126	SNP	0.000	A
OSM	5008	genome.wustl.edu	37	22	30662766	30662767	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr22:30662766_30662767delCT	ENST00000215781.2	-	1	62_63	c.22_23delAG	c.(22-24)aggfs	p.R8fs	OSM_ENST00000403463.1_Frame_Shift_Del_p.R8fs|OSM_ENST00000403389.1_5'Flank	NM_020530.4	NP_065391.1	P13725	ONCM_HUMAN	oncostatin M	8					behavioral response to pain (GO:0048266)|cell proliferation (GO:0008283)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hormone secretion (GO:0046888)|negative regulation of meiosis (GO:0045835)|peripheral nervous system development (GO:0007422)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of growth (GO:0040008)|response to heat (GO:0009408)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	extracellular space (GO:0005615)|oncostatin-M receptor complex (GO:0005900)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|oncostatin-M receptor binding (GO:0005147)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|skin(3)	11			Epithelial(10;0.206)			GAGCAGCGTCCTCTGTGTGAGC	0.703																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF129855	CCDS13873.1	22q12.2	2011-07-21			ENSG00000099985	ENSG00000099985			8506	protein-coding gene	gene with protein product		165095				1717982	Standard	NM_020530		Approved	MGC20461	uc003ahb.3	P13725	OTTHUMG00000150913	ENST00000215781.2:c.22_23delAG	22.37:g.30662768_30662769delCT	ENSP00000215781:p.Arg8fs		Q6FHP8|Q9UCP6	Frame_Shift_Del	DEL	pfam_Leukemia_IF/oncostatin,superfamily_4_helix_cytokine-like_core,smart_Leukemia_IF/oncostatin	p.R8fs	ENST00000215781.2	37	c.23_22	CCDS13873.1	22																																																																																			OSM	-	pfam_Leukemia_IF/oncostatin	ENSG00000099985		0.703	OSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSM	HGNC	protein_coding	OTTHUMT00000320512.1	12	0.00	0	CT	NM_020530		30662766	30662767	-1	no_errors	ENST00000215781	ensembl	human	known	69_37n	frame_shift_del	9	30.77	4	DEL	0.104:0.160	-
PARVB	29780	genome.wustl.edu	37	22	44514987	44514987	+	Silent	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr22:44514987C>T	ENST00000338758.7	+	4	406	c.343C>T	c.(343-345)Ctg>Ttg	p.L115L	PARVB_ENST00000406477.3_Silent_p.L148L|PARVB_ENST00000404989.1_Silent_p.L78L	NM_013327.4	NP_037459.2	Q9HBI1	PARVB_HUMAN	parvin, beta	115	CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell projection assembly (GO:0030031)|establishment or maintenance of cell polarity regulating cell shape (GO:0071963)|lamellipodium assembly (GO:0030032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)		p.L148L(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Ovarian(80;0.0246)|all_neural(38;0.0423)				GGAGGAAGACCTGTATGACGG	0.602																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											187.0	161.0	169.0					22																	44514987		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF151814	CCDS14056.1, CCDS46724.1, CCDS58808.1, CCDS74874.1	22q13.2-q13.33	2013-01-24			ENSG00000188677	ENSG00000188677		"""Parvins"""	14653	protein-coding gene	gene with protein product	"""affixin"""	608121				10810093, 11171322	Standard	NM_001003828		Approved	CGI-56	uc003ben.3	Q9HBI1	OTTHUMG00000150665	ENST00000338758.7:c.343C>T	22.37:g.44514987C>T			B0QYM8|B0QYN1|B2R9X6|Q5TGJ5|Q86X93|Q96PN1|Q9NSP7|Q9UGT3|Q9Y368|Q9Y3L6|Q9Y3L7	Silent	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.L148	ENST00000338758.7	37	c.442	CCDS14056.1	22																																																																																			PARVB	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000188677		0.602	PARVB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PARVB	HGNC	protein_coding	OTTHUMT00000319518.2	117	0.00	0	C	NM_001003828		44514987	44514987	+1	no_errors	ENST00000406477	ensembl	human	known	69_37n	silent	75	10.71	9	SNP	0.993	T
PCDHB4	56131	genome.wustl.edu	37	5	140503220	140503220	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr5:140503220G>A	ENST00000194152.1	+	1	1640	c.1640G>A	c.(1639-1641)cGc>cAc	p.R547H	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	547	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R547H(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGCTGGTGCGCGTGCTGGTG	0.701																																						dbGAP											1	Substitution - Missense(1)	breast(1)											39.0	44.0	42.0					5																	140503220		2201	4294	6495	-	-	-	SO:0001583	missense	0			AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1640G>A	5.37:g.140503220G>A	ENSP00000194152:p.Arg547His		Q4V761	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R547H	ENST00000194152.1	37	c.1640	CCDS4246.1	5	.	.	.	.	.	.	.	.	.	.	G	12.57	1.977255	0.34848	.	.	ENSG00000081818	ENST00000194152	T	0.01767	4.65	3.88	2.99	0.34606	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.01489	0.0048	N	0.17474	0.49	0.30563	N	0.764337	P	0.35821	0.523	B	0.37989	0.262	T	0.32877	-0.9890	9	0.59425	D	0.04	.	4.8721	0.13639	0.1687:0.0:0.639:0.1923	.	547	Q9Y5E5	PCDB4_HUMAN	H	547	ENSP00000194152:R547H	ENSP00000194152:R547H	R	+	2	0	PCDHB4	140483404	0.000000	0.05858	1.000000	0.80357	0.980000	0.70556	0.205000	0.17356	2.189000	0.69895	0.485000	0.47835	CGC	PCDHB4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000081818		0.701	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	HGNC	protein_coding	OTTHUMT00000251812.2	132	0.00	0	G	NM_018938		140503220	140503220	+1	no_errors	ENST00000194152	ensembl	human	known	69_37n	missense	47	17.54	10	SNP	0.696	A
PCDHB12	56124	genome.wustl.edu	37	5	140588724	140588724	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr5:140588724G>C	ENST00000239450.2	+	1	434	c.245G>C	c.(244-246)gGg>gCg	p.G82A	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	82	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.G82A(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACAAACACTGGGGATTTGCTC	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											71.0	79.0	77.0					5																	140588724		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.245G>C	5.37:g.140588724G>C	ENSP00000239450:p.Gly82Ala		B4DDU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G82A	ENST00000239450.2	37	c.245	CCDS4254.1	5	.	.	.	.	.	.	.	.	.	.	G	16.68	3.190647	0.58017	.	.	ENSG00000120328	ENST00000239450	T	0.39997	1.05	4.25	4.25	0.50352	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.70228	0.3200	H	0.99143	4.445	0.80722	D	1	B	0.27679	0.185	B	0.38296	0.27	T	0.79645	-0.1717	9	0.66056	D	0.02	.	16.6077	0.84835	0.0:0.0:1.0:0.0	.	82	Q9Y5F1	PCDBC_HUMAN	A	82	ENSP00000239450:G82A	ENSP00000239450:G82A	G	+	2	0	PCDHB12	140568908	1.000000	0.71417	0.375000	0.26029	0.364000	0.29643	5.669000	0.68081	2.076000	0.62316	0.561000	0.74099	GGG	PCDHB12	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000120328		0.517	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB12	HGNC	protein_coding	OTTHUMT00000251815.2	274	0.00	0	G	NM_018932		140588724	140588724	+1	no_errors	ENST00000239450	ensembl	human	known	69_37n	missense	95	17.39	20	SNP	1.000	C
PCDHGB6	56100	genome.wustl.edu	37	5	140789141	140789141	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr5:140789141G>A	ENST00000520790.1	+	1	1372	c.1372G>A	c.(1372-1374)Gtg>Atg	p.V458M	PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	458	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V458M(1)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGTCCTACGTGGTCCACGT	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											48.0	55.0	52.0					5																	140789141		2113	4225	6338	-	-	-	SO:0001583	missense	0			AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.1372G>A	5.37:g.140789141G>A	ENSP00000428603:p.Val458Met		Q9Y5C5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V458M	ENST00000520790.1	37	c.1372	CCDS54929.1	5	.	.	.	.	.	.	.	.	.	.	g	1.289	-0.608259	0.03717	.	.	ENSG00000253305	ENST00000520790	T	0.01804	4.63	5.35	-1.75	0.08031	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01835	0.0058	M	0.64260	1.97	0.09310	N	1	P;P	0.38582	0.638;0.585	B;B	0.32677	0.15;0.092	T	0.35599	-0.9782	9	0.48119	T	0.1	.	2.1179	0.03718	0.4421:0.252:0.1919:0.1141	.	458;458	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	M	458	ENSP00000428603:V458M	ENSP00000428603:V458M	V	+	1	0	PCDHGB6	140769325	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.765000	0.00783	-0.793000	0.04475	-0.257000	0.10917	GTG	PCDHGB6	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000253305		0.572	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB6	HGNC	protein_coding	OTTHUMT00000374746.1	89	0.00	0	G	NM_018926		140789141	140789141	+1	no_errors	ENST00000520790	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	0.000	A
PCDHGA10	56106	genome.wustl.edu	37	5	140795061	140795061	+	Silent	SNP	C	C	A	rs377609539		TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr5:140795061C>A	ENST00000398610.2	+	1	2319	c.2319C>A	c.(2317-2319)atC>atA	p.I773I	PCDHGA8_ENST00000398604.2_Intron|PCDHGB7_ENST00000398594.2_5'Flank|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	773					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I773I(1)		breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCACCTGATCTTCCCCCAGC	0.547																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											105.0	113.0	111.0					5																	140795061		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.2319C>A	5.37:g.140795061C>A			Q9Y5E0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I773	ENST00000398610.2	37	c.2319	CCDS47292.1	5																																																																																			PCDHGA10	-	NULL	ENSG00000253846		0.547	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA10	HGNC	protein_coding	OTTHUMT00000374747.1	184	0.00	0	C	NM_018913		140795061	140795061	+1	no_errors	ENST00000398610	ensembl	human	known	69_37n	silent	61	10.29	7	SNP	0.999	A
PDE3B	5140	genome.wustl.edu	37	11	14865386	14865386	+	Silent	SNP	A	A	G	rs536270843		TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr11:14865386A>G	ENST00000282096.4	+	12	2687	c.2334A>G	c.(2332-2334)agA>agG	p.R778R	PDE3B_ENST00000455098.2_Silent_p.R727R	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	778	Catalytic. {ECO:0000250}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)	p.R778R(1)		NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	CTGATGGTAGAATTAACCATG	0.368													A|||	1	0.000199681	0.0	0.0014	5008	,	,		18772	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	breast(1)											172.0	173.0	173.0					11																	14865386		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.2334A>G	11.37:g.14865386A>G			B7ZM37|O00639|Q14408|Q6SEI4	Silent	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.R778	ENST00000282096.4	37	c.2334	CCDS7817.1	11																																																																																			PDE3B	-	smart_HD/PDEase_dom	ENSG00000152270		0.368	PDE3B-001	KNOWN	basic|CCDS	protein_coding	PDE3B	HGNC	protein_coding	OTTHUMT00000386974.1	566	0.00	0	A	NM_000922		14865386	14865386	+1	no_errors	ENST00000282096	ensembl	human	known	69_37n	silent	192	16.09	37	SNP	0.158	G
PDE5A	8654	genome.wustl.edu	37	4	120432238	120432238	+	Silent	SNP	A	A	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr4:120432238A>G	ENST00000354960.3	-	15	2371	c.2052T>C	c.(2050-2052)caT>caC	p.H684H	PDE5A_ENST00000394439.1_Silent_p.H632H|RP11-33B1.1_ENST00000498873.1_RNA|PDE5A_ENST00000264805.5_Silent_p.H642H	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	684	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)	p.H684H(1)		breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	GGTCAAAATGATGGTGTTCCA	0.318																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											143.0	145.0	144.0					4																	120432238		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.2052T>C	4.37:g.120432238A>G			A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,prints_PDEase	p.I36T	ENST00000354960.3	37	c.107	CCDS3713.1	4	.	.	.	.	.	.	.	.	.	.	A	9.554	1.116792	0.20795	.	.	ENSG00000138735	ENST00000503412	.	.	.	5.42	-2.51	0.06365	.	.	.	.	.	T	0.65943	0.2740	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65413	-0.6174	4	.	.	.	.	15.1537	0.72723	0.4046:0.0:0.5954:0.0	.	.	.	.	T	36	.	.	I	-	2	0	PDE5A	120651686	1.000000	0.71417	0.983000	0.44433	0.995000	0.86356	0.698000	0.25571	-0.403000	0.07622	0.528000	0.53228	ATC	PDE5A	-	pfam_PDEase_catalytic_dom,prints_PDEase	ENSG00000138735		0.318	PDE5A-001	KNOWN	basic|CCDS	protein_coding	PDE5A	HGNC	protein_coding	OTTHUMT00000256529.1	586	0.00	0	A	NM_001083		120432238	120432238	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000503412	ensembl	human	putative	69_37n	missense	136	15.95	26	SNP	0.996	G
PIGT	51604	genome.wustl.edu	37	20	44045206	44045206	+	Silent	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr20:44045206G>A	ENST00000279036.6	+	2	317	c.237G>A	c.(235-237)aaG>aaA	p.K79K	PIGT_ENST00000535404.1_5'UTR|PIGT_ENST00000372689.5_Silent_p.K79K|PIGT_ENST00000341555.5_Intron|PIGT_ENST00000543458.2_Silent_p.K79K|PIGT_ENST00000279035.9_Intron|PIGT_ENST00000545755.1_Intron	NM_015937.5	NP_057021.2	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class T	79					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|post-translational protein modification (GO:0043687)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)	p.K79K(2)		breast(1)|endometrium(2)|kidney(5)|large_intestine(4)|lung(7)|pancreas(1)|skin(1)|stomach(1)	22		Myeloproliferative disorder(115;0.0122)				TGATCTCCAAGTATTCTCTAC	0.597																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											38.0	38.0	38.0					20																	44045206		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13353.1, CCDS54464.1, CCDS54465.1, CCDS54466.1	20q12-q13.12	2013-02-26	2006-06-28		ENSG00000124155	ENSG00000124155		"""Phosphatidylinositol glycan anchor biosynthesis"""	14938	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610272	"""phosphatidylinositol glycan, class T"""			15713669	Standard	NM_015937		Approved		uc002xoh.3	Q969N2	OTTHUMG00000032574	ENST00000279036.6:c.237G>A	20.37:g.44045206G>A			B2RND5|B7Z3N1|B7Z7I8|E1P622|G8JLF5|Q2NL69|Q7Z3N7|Q9BQY7|Q9BQY8|Q9UJG6|Q9Y2Z5	Silent	SNP	pfam_Gpi16	p.K79	ENST00000279036.6	37	c.237	CCDS13353.1	20																																																																																			PIGT	-	pfam_Gpi16	ENSG00000124155		0.597	PIGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGT	HGNC	protein_coding	OTTHUMT00000079434.2	81	0.00	0	G	NM_015937		44045206	44045206	+1	no_errors	ENST00000279036	ensembl	human	known	69_37n	silent	43	15.69	8	SNP	1.000	A
PIM2	11040	genome.wustl.edu	37	X	48775085	48775085	+	Silent	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chrX:48775085C>G	ENST00000376509.4	-	3	384	c.195G>C	c.(193-195)cgG>cgC	p.R65R	PIM2_ENST00000485431.1_5'Flank	NM_006875.3	NP_006866.2	Q9P1W9	PIM2_HUMAN	Pim-2 proto-oncogene, serine/threonine kinase	65	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic mitochondrial changes (GO:0008637)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|response to virus (GO:0009615)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R65R(1)		lung(3)|stomach(1)	4						GCACACGATTCCGGGGAATCA	0.567											OREG0019768	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - coding silent(1)	breast(1)											86.0	60.0	69.0					X																	48775085		2198	4298	6496	-	-	-	SO:0001819	synonymous_variant	0			U77735	CCDS14312.1	Xp11.23	2014-06-25	2014-06-25		ENSG00000102096	ENSG00000102096			8987	protein-coding gene	gene with protein product		300295	"""pim-2 oncogene"""			9804974	Standard	NM_006875		Approved		uc004dls.3	Q9P1W9	OTTHUMG00000024132	ENST00000376509.4:c.195G>C	X.37:g.48775085C>G		957	A8K4G6|Q99739	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R65	ENST00000376509.4	37	c.195	CCDS14312.1	X																																																																																			PIM2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000102096		0.567	PIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIM2	HGNC	protein_coding	OTTHUMT00000060805.1	38	0.00	0	C			48775085	48775085	-1	no_errors	ENST00000376509	ensembl	human	known	69_37n	silent	12	42.86	9	SNP	0.997	G
PIP4K2C	79837	genome.wustl.edu	37	12	57994184	57994184	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:57994184G>C	ENST00000354947.5	+	7	793	c.777G>C	c.(775-777)aaG>aaC	p.K259N	PIP4K2C_ENST00000422156.3_Missense_Mutation_p.K211N|PIP4K2C_ENST00000540759.2_Missense_Mutation_p.K259N|PIP4K2C_ENST00000550465.1_Missense_Mutation_p.K241N			Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, gamma	259	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|identical protein binding (GO:0042802)	p.K259N(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(13)|pancreas(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Melanoma(17;0.122)					AAGAGGAGAAGAAAATATTTC	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											94.0	90.0	91.0					12																	57994184		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK125526	CCDS8946.1, CCDS53808.1, CCDS55839.1	12q13.3	2014-09-04	2007-08-14	2007-08-14	ENSG00000166908	ENSG00000166908			23786	protein-coding gene	gene with protein product			"""phosphatidylinositol-4-phosphate 5-kinase, type II, gamma"""	PIP5K2C		9367159	Standard	NM_024779		Approved	FLJ22055	uc001sot.3	Q8TBX8	OTTHUMG00000170144	ENST00000354947.5:c.777G>C	12.37:g.57994184G>C	ENSP00000347032:p.Lys259Asn		B2RDL3|B4DM11|B4DY44|Q9H6N2	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.K259N	ENST00000354947.5	37	c.777	CCDS8946.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.52|19.52	3.843603|3.843603	0.71488|0.71488	.|.	.|.	ENSG00000166908|ENSG00000166908	ENST00000422156;ENST00000540759;ENST00000550465;ENST00000354947|ENST00000436866;ENST00000548264	T;T;T;T|.	0.34859|.	1.34;1.34;1.34;1.34|.	4.78|4.78	3.87|3.87	0.44632|0.44632	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78483|0.78483	0.4290|0.4290	M|M	0.87097|0.87097	2.86|2.86	0.52501|0.52501	D|D	0.999959|0.999959	P;P;P|.	0.52061|.	0.95;0.948;0.933|.	P;P;P|.	0.58391|.	0.775;0.752;0.838|.	T|T	0.82617|0.82617	-0.0369|-0.0369	10|6	0.54805|0.87932	T|D	0.06|0	-14.5717|-14.5717	12.9916|12.9916	0.58622|0.58622	0.0867:0.0:0.9133:0.0|0.0867:0.0:0.9133:0.0	.|.	211;241;259|.	B4DM11;B4DY44;Q8TBX8|.	.;.;PI42C_HUMAN|.	N|T	211;259;241;259|259;67	ENSP00000412035:K211N;ENSP00000439878:K259N;ENSP00000447390:K241N;ENSP00000347032:K259N|.	ENSP00000347032:K259N|ENSP00000388853:R259T	K|R	+|+	3|2	2|0	PIP4K2C|PIP4K2C	56280451|56280451	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	1.350000|1.350000	0.34010|0.34010	2.373000|2.373000	0.80994|0.80994	0.555000|0.555000	0.69702|0.69702	AAG|AGA	PIP4K2C	-	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	ENSG00000166908		0.408	PIP4K2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP4K2C	HGNC	protein_coding	OTTHUMT00000407644.1	268	0.00	0	G	NM_024779		57994184	57994184	+1	no_errors	ENST00000354947	ensembl	human	known	69_37n	missense	59	20.78	16	SNP	1.000	C
PLA2G12B	84647	genome.wustl.edu	37	10	74702434	74702434	+	Silent	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr10:74702434G>A	ENST00000373032.3	-	2	368	c.276C>T	c.(274-276)ttC>ttT	p.F92F		NM_032562.2	NP_115951.2	Q9BX93	PG12B_HUMAN	phospholipase A2, group XIIB	92					cholesterol homeostasis (GO:0042632)|lipid catabolic process (GO:0016042)|triglyceride homeostasis (GO:0070328)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)	p.F92F(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	9	Prostate(51;0.0198)					TGAGACCCAGGAAATAGGAGC	0.488																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											55.0	53.0	54.0					10																	74702434		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF349540	CCDS7319.1	10q22.1	2008-09-19	2004-01-13	2004-01-14	ENSG00000138308	ENSG00000138308	3.1.1.4		18555	protein-coding gene	gene with protein product		611653	"""phospholipase A2, group XIII"""	PLA2G13			Standard	NM_032562		Approved		uc001jtf.1	Q9BX93	OTTHUMG00000018446	ENST00000373032.3:c.276C>T	10.37:g.74702434G>A			B7ZL23|Q52LB2|Q96Q99	Silent	SNP	pfam_PLipase_A2_secretory_G12,superfamily_PLipase_A2	p.F92	ENST00000373032.3	37	c.276	CCDS7319.1	10																																																																																			PLA2G12B	-	pfam_PLipase_A2_secretory_G12,superfamily_PLipase_A2	ENSG00000138308		0.488	PLA2G12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G12B	HGNC	protein_coding	OTTHUMT00000048598.1	40	0.00	0	G	NM_032562		74702434	74702434	-1	no_errors	ENST00000373032	ensembl	human	known	69_37n	silent	16	30.43	7	SNP	1.000	A
PLA2G15	23659	genome.wustl.edu	37	16	68289854	68289855	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr16:68289854_68289855insG	ENST00000219345.5	+	5	771_772	c.688_689insG	c.(688-690)tggfs	p.W230fs	RP11-96D1.7_ENST00000569843.1_RNA|PLA2G15_ENST00000413021.2_Frame_Shift_Ins_p.W136fs|PLA2G15_ENST00000444212.2_Intron|PLA2G15_ENST00000566188.1_Frame_Shift_Ins_p.LG188fs|RP11-96D1.7_ENST00000563175.1_RNA	NM_012320.3	NP_036452.1	Q8NCC3	PAG15_HUMAN	phospholipase A2, group XV	230					ceramide metabolic process (GO:0006672)|fatty acid catabolic process (GO:0009062)|phosphatidylcholine metabolic process (GO:0046470)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)|O-acyltransferase activity (GO:0008374)|phospholipid binding (GO:0005543)			kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(3)|skin(1)	12						GGGTGCGCCCTGGGGGGGCGTG	0.629																																						dbGAP											0										11,4251		0,11,2120						5.6	1.0			28	14,8240		0,14,4113	no	frameshift	PLA2G15	NM_012320.3		0,25,6233	A1A1,A1R,RR		0.1696,0.2581,0.1997				25,12491				-	-	-	SO:0001589	frameshift_variant	0			AB017494	CCDS10864.1	16q22.1	2008-09-19	2008-09-19	2008-09-19	ENSG00000103066	ENSG00000103066			17163	protein-coding gene	gene with protein product		609362	"""lysophospholipase 3 (lysosomal phospholipase A2)"""	LYPLA3		10092508, 16973413	Standard	XM_005255886		Approved	LLPL, GXVPLA2	uc002evr.3	Q8NCC3	OTTHUMG00000137554	ENST00000219345.5:c.695dupG	16.37:g.68289861_68289861dupG	ENSP00000219345:p.Trp230fs		B3KMF3|B4DUD1|Q53GZ1|Q9NPQ6|Q9UG04|Q9Y2B3	Frame_Shift_Ins	INS	pfam_LACT/PDAT_acylTrfase	p.V233fs	ENST00000219345.5	37	c.688_689	CCDS10864.1	16																																																																																			PLA2G15	-	pfam_LACT/PDAT_acylTrfase	ENSG00000103066		0.629	PLA2G15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G15	HGNC	protein_coding	OTTHUMT00000268888.2	18	0.00	0	-	NM_012320		68289854	68289855	+1	no_errors	ENST00000219345	ensembl	human	known	69_37n	frame_shift_ins	3	40.00	2	INS	1.000:1.000	G
PLEKHG6	55200	genome.wustl.edu	37	12	6436478	6436478	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:6436478G>A	ENST00000396988.3	+	15	1959	c.1729G>A	c.(1729-1731)Gat>Aat	p.D577N	PLEKHG6_ENST00000449001.2_Missense_Mutation_p.D545N|PLEKHG6_ENST00000011684.7_Missense_Mutation_p.D577N|PLEKHG6_ENST00000304581.8_Missense_Mutation_p.D107N	NM_001144856.1	NP_001138328.1	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 6	577						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D577N(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(4)	23						CACAGATGAAGATGCTCCCCT	0.562											OREG0021622	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											151.0	141.0	145.0					12																	6436478		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001527	CCDS8541.1, CCDS44808.1	12p13.31	2013-01-11			ENSG00000008323	ENSG00000008323		"""Pleckstrin homology (PH) domain containing"""	25562	protein-coding gene	gene with protein product		611743					Standard	NM_018173		Approved	FLJ10665	uc001qnr.3	Q3KR16	OTTHUMG00000168266	ENST00000396988.3:c.1729G>A	12.37:g.6436478G>A	ENSP00000380185:p.Asp577Asn	634	Q3SWR1|Q8N1P1|Q8WYY1|Q9H8F4|Q9NVK9	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.D577N	ENST00000396988.3	37	c.1729	CCDS8541.1	12	.	.	.	.	.	.	.	.	.	.	G	13.43	2.234434	0.39498	.	.	ENSG00000008323	ENST00000011684;ENST00000396988;ENST00000449001;ENST00000304581	T;T;T	0.64803	-0.01;-0.01;-0.12	5.45	4.5	0.54988	.	0.102687	0.43110	D	0.000620	T	0.67933	0.2946	L	0.36672	1.1	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	T	0.57682	-0.7769	10	0.37606	T	0.19	-16.7463	11.3532	0.49600	0.0:0.183:0.817:0.0	.	545;577	Q3KR16-2;Q3KR16	.;PKHG6_HUMAN	N	577;577;545;107	ENSP00000011684:D577N;ENSP00000380185:D577N;ENSP00000393194:D545N	ENSP00000011684:D577N	D	+	1	0	PLEKHG6	6306739	1.000000	0.71417	0.491000	0.27477	0.018000	0.09664	2.887000	0.48586	2.547000	0.85894	0.655000	0.94253	GAT	PLEKHG6	-	NULL	ENSG00000008323		0.562	PLEKHG6-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PLEKHG6	HGNC	protein_coding	OTTHUMT00000399031.1	272	0.00	0	G	NM_018173		6436478	6436478	+1	no_errors	ENST00000011684	ensembl	human	known	69_37n	missense	47	18.97	11	SNP	0.283	A
PLK1	5347	genome.wustl.edu	37	16	23693394	23693394	+	Missense_Mutation	SNP	G	G	C	rs532172121		TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr16:23693394G>C	ENST00000300093.4	+	4	843	c.732G>C	c.(730-732)ttG>ttC	p.L244F		NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1	244	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.L244F(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		GGTATACCTTGTTAGTGGGCA	0.458																																					Colon(12;240 564 27038 33155)	dbGAP											1	Substitution - Missense(1)	breast(1)											157.0	142.0	147.0					16																	23693394		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984	ENST00000300093.4:c.732G>C	16.37:g.23693394G>C	ENSP00000300093:p.Leu244Phe		Q15153|Q99746	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_POLO_box_duplicated_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_cat_dom	p.L244F	ENST00000300093.4	37	c.732	CCDS10616.1	16	.	.	.	.	.	.	.	.	.	.	G	20.2	3.946237	0.73672	.	.	ENSG00000166851	ENST00000300093;ENST00000425844	T	0.34859	1.34	5.85	2.41	0.29592	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.58250	0.2109	M	0.81614	2.55	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.62148	-0.6915	10	0.87932	D	0	-15.9044	10.4601	0.44575	0.2514:0.0:0.7486:0.0	.	244	P53350	PLK1_HUMAN	F	244;147	ENSP00000300093:L244F	ENSP00000300093:L244F	L	+	3	2	PLK1	23600895	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.635000	0.37134	0.823000	0.34589	0.655000	0.94253	TTG	PLK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000166851		0.458	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK1	HGNC	protein_coding	OTTHUMT00000214057.2	213	0.00	0	G	NM_005030		23693394	23693394	+1	no_errors	ENST00000300093	ensembl	human	known	69_37n	missense	114	31.33	52	SNP	1.000	C
PPHLN1	51535	genome.wustl.edu	37	12	42781327	42781327	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:42781327C>A	ENST00000395568.2	+	7	722	c.638C>A	c.(637-639)tCt>tAt	p.S213Y	PPHLN1_ENST00000549190.1_Missense_Mutation_p.S231Y|PPHLN1_ENST00000358314.7_Missense_Mutation_p.S213Y|PPHLN1_ENST00000337898.6_Missense_Mutation_p.S158Y|PPHLN1_ENST00000432191.2_Missense_Mutation_p.S158Y|PPHLN1_ENST00000449194.2_Missense_Mutation_p.S194Y|PPHLN1_ENST00000256678.8_Missense_Mutation_p.S93Y|PPHLN1_ENST00000395580.3_Missense_Mutation_p.S220Y|PPHLN1_ENST00000552761.1_Missense_Mutation_p.S165Y|PPHLN1_ENST00000317560.9_Missense_Mutation_p.S146Y	NM_016488.6	NP_057572.5	Q8NEY8	PPHLN_HUMAN	periphilin 1	213	Ser-rich.				keratinization (GO:0031424)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S213Y(2)|p.S220Y(1)		breast(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	16	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		TCAGCAGTTTCTTCATCAAAG	0.313																																						dbGAP											3	Substitution - Missense(3)	breast(3)											74.0	77.0	76.0					12																	42781327		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY157850	CCDS8741.1, CCDS31777.1, CCDS41773.1, CCDS44860.1, CCDS44861.1, CCDS55817.1	12q12	2006-10-24				ENSG00000134283			19369	protein-coding gene	gene with protein product		608150					Standard	NM_016488		Approved		uc001rng.1	Q8NEY8		ENST00000395568.2:c.638C>A	12.37:g.42781327C>A	ENSP00000378935:p.Ser213Tyr		E9PAX8|Q86YT2|Q8IXN3|Q8TB09|Q96NB9|Q9NXL4|Q9P0P6|Q9P0R9	Missense_Mutation	SNP	NULL	p.S213Y	ENST00000395568.2	37	c.638	CCDS31777.1	12	.	.	.	.	.	.	.	.	.	.	C	16.93	3.258911	0.59321	.	.	ENSG00000134283	ENST00000549190;ENST00000395580;ENST00000337898;ENST00000358314;ENST00000395568;ENST00000256678;ENST00000449194;ENST00000552761;ENST00000317560;ENST00000432191	.	.	.	5.98	5.98	0.97165	.	0.799302	0.11760	N	0.532135	T	0.52092	0.1713	N	0.22421	0.69	0.30173	N	0.801122	B;P;P;B;B;P;P;B;B;B;B;B;B;B	0.49358	0.394;0.865;0.788;0.394;0.164;0.923;0.778;0.415;0.144;0.066;0.066;0.203;0.203;0.203	B;B;B;B;B;P;B;B;B;B;B;B;B;B	0.53593	0.413;0.422;0.242;0.154;0.11;0.73;0.422;0.154;0.1;0.203;0.252;0.299;0.361;0.299	T	0.54669	-0.8259	9	0.72032	D	0.01	3.3059	17.3688	0.87370	0.0:1.0:0.0:0.0	.	146;93;139;158;146;29;158;213;194;213;165;220;165;231	F8WF16;F8W6A0;B7Z695;B7Z8L1;B7Z615;Q8NEY8-7;Q8NEY8-3;Q8NEY8;E9PAX8;Q8NEY8-8;Q8NEY8-6;Q8NEY8-2;Q8NEY8-5;F8W0Q9	.;.;.;.;.;.;.;PPHLN_HUMAN;.;.;.;.;.;.	Y	231;220;158;213;213;93;194;165;146;158	.	ENSP00000256678:S93Y	S	+	2	0	PPHLN1	41067594	0.940000	0.31905	0.892000	0.35008	0.919000	0.55068	4.319000	0.59197	2.838000	0.97847	0.591000	0.81541	TCT	PPHLN1	-	NULL	ENSG00000134283		0.313	PPHLN1-010	KNOWN	basic|CCDS	protein_coding	PPHLN1	HGNC	protein_coding	OTTHUMT00000404047.1	347	0.00	0	C	NM_201515		42781327	42781327	+1	no_errors	ENST00000395568	ensembl	human	known	69_37n	missense	113	36.52	65	SNP	0.931	A
PPL	5493	genome.wustl.edu	37	16	4934651	4934651	+	Silent	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr16:4934651C>T	ENST00000345988.2	-	22	4094	c.4005G>A	c.(4003-4005)caG>caA	p.Q1335Q	PPL_ENST00000590782.2_Silent_p.Q1333Q	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	1335					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.Q1335Q(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						TCCGGGCGATCTGCTCTTCCT	0.602																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											173.0	182.0	179.0					16																	4934651		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.4005G>A	16.37:g.4934651C>T			O60314|O60454|Q14C98	Silent	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.Q1335	ENST00000345988.2	37	c.4005	CCDS10526.1	16																																																																																			PPL	-	NULL	ENSG00000118898		0.602	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPL	HGNC	protein_coding	OTTHUMT00000251715.1	655	0.15	1	C	NM_002705		4934651	4934651	-1	no_errors	ENST00000345988	ensembl	human	known	69_37n	silent	191	27.61	74	SNP	0.115	T
PPP1R9A	55607	genome.wustl.edu	37	7	94917854	94917854	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr7:94917854G>A	ENST00000433881.1	+	15	3440	c.2908G>A	c.(2908-2910)Gat>Aat	p.D970N	PPP1R9A_ENST00000456331.2_Intron|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.D1168N|PPP1R9A_ENST00000340694.4_Missense_Mutation_p.D970N|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.D1246N|PPP1R9A_ENST00000424654.1_Intron			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	970	Interacts with TGN38. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)		p.D1194N(1)|p.D1246N(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			TTAGATCCTTGATGATGGACA	0.423										HNSCC(28;0.073)																												dbGAP											2	Substitution - Missense(2)	breast(2)											138.0	115.0	122.0					7																	94917854		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.2908G>A	7.37:g.94917854G>A	ENSP00000398870:p.Asp970Asn		A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_PDZ,superfamily_PDZ,superfamily_SAM/pointed,superfamily_Smac_DIABLO-like,smart_PDZ,smart_SAM,pfscan_PDZ,pfscan_SAM	p.D1168N	ENST00000433881.1	37	c.3502	CCDS34683.1	7	.	.	.	.	.	.	.	.	.	.	G	33	5.270183	0.95429	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000433881;ENST00000289495	T;T;T;T	0.24350	1.86;2.17;2.17;2.11	5.61	5.61	0.85477	.	0.063541	0.64402	D	0.000009	T	0.48642	0.1511	L	0.52573	1.65	0.80722	D	1	P;D;D;D;P	0.89917	0.704;1.0;1.0;1.0;0.799	B;D;D;D;B	0.77004	0.122;0.987;0.989;0.984;0.272	T	0.38908	-0.9639	10	0.72032	D	0.01	.	20.0216	0.97506	0.0:0.0:1.0:0.0	.	962;1168;1246;1186;970	B7ZLX4;F8W7J9;E9PDX1;D6W5R0;Q9ULJ8	.;.;.;.;NEB1_HUMAN	N	1246;970;970;1168	ENSP00000405514:D1246N;ENSP00000344524:D970N;ENSP00000398870:D970N;ENSP00000289495:D1168N	ENSP00000289495:D1168N	D	+	1	0	PPP1R9A	94755790	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	9.476000	0.97823	2.826000	0.97356	0.655000	0.94253	GAT	PPP1R9A	-	NULL	ENSG00000158528		0.423	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R9A	HGNC	protein_coding	OTTHUMT00000340662.1	267	0.00	0	G	NM_001166160		94917854	94917854	+1	no_errors	ENST00000289495	ensembl	human	known	69_37n	missense	95	24.60	31	SNP	1.000	A
PRAMEF10	343071	genome.wustl.edu	37	1	12954599	12954599	+	Silent	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:12954599C>G	ENST00000235347.4	-	3	763	c.684G>C	c.(682-684)ctG>ctC	p.L228L		NM_001039361.3	NP_001034450.2	O60809	PRA10_HUMAN	PRAME family member 10	228					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.L228L(1)		NS(2)|breast(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TCATCTGGCTCAGGTAAGGGG	0.468																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											11.0	7.0	9.0					1																	12954599		1109	2684	3793	-	-	-	SO:0001819	synonymous_variant	0			AL049682	CCDS41255.1	1p36.21	2013-01-17			ENSG00000187545	ENSG00000187545		"""-"""	27997	protein-coding gene	gene with protein product							Standard	NM_001039361		Approved		uc001auo.3	O60809	OTTHUMG00000001981	ENST00000235347.4:c.684G>C	1.37:g.12954599C>G			Q2M1V2	Silent	SNP	NULL	p.L228	ENST00000235347.4	37	c.684	CCDS41255.1	1																																																																																			PRAMEF10	-	NULL	ENSG00000187545		0.468	PRAMEF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF10	HGNC	protein_coding	OTTHUMT00000005512.2	524	0.00	0	C	XM_496342		12954599	12954599	-1	no_errors	ENST00000235347	ensembl	human	known	69_37n	silent	268	17.03	55	SNP	0.019	G
PTPRD	5789	genome.wustl.edu	37	9	8449827	8449827	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr9:8449827C>G	ENST00000381196.4	-	31	4429	c.3886G>C	c.(3886-3888)Gag>Cag	p.E1296Q	PTPRD_ENST00000356435.5_Missense_Mutation_p.E1296Q|PTPRD_ENST00000397611.3_Missense_Mutation_p.E886Q|PTPRD_ENST00000537002.1_Missense_Mutation_p.E886Q|PTPRD_ENST00000358503.5_Missense_Mutation_p.E1274Q|PTPRD_ENST00000355233.5_Missense_Mutation_p.E890Q|PTPRD_ENST00000486161.1_Missense_Mutation_p.E889Q|PTPRD_ENST00000397606.3_Missense_Mutation_p.E875Q|PTPRD_ENST00000397617.3_Missense_Mutation_p.E875Q|PTPRD_ENST00000360074.4_Missense_Mutation_p.E1283Q|PTPRD_ENST00000540109.1_Missense_Mutation_p.E1296Q	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1296					heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.E1296Q(2)|p.E890Q(1)|p.E767Q(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GAGTCGGACTCTGCCCTCTTC	0.443										TSP Lung(15;0.13)																												dbGAP											4	Substitution - Missense(4)	breast(4)											251.0	237.0	242.0					9																	8449827		2203	4300	6503	-	-	-	SO:0001583	missense	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.3886G>C	9.37:g.8449827C>G	ENSP00000370593:p.Glu1296Gln		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt	p.E1296Q	ENST00000381196.4	37	c.3886	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	C	16.38	3.107379	0.56291	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.54866	0.62;0.62;0.66;0.71;0.75;0.91;0.64;0.55;0.62;0.76;0.91	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.65729	0.2719	L	0.41415	1.275	0.80722	D	1	D;D;D;D;P;D;B;P;B	0.61080	0.981;0.981;0.981;0.981;0.69;0.989;0.106;0.839;0.002	D;D;D;D;B;D;B;B;B	0.70487	0.932;0.932;0.932;0.932;0.32;0.969;0.021;0.372;0.01	T	0.60424	-0.7266	9	.	.	.	.	19.9455	0.97180	0.0:1.0:0.0:0.0	.	875;880;889;890;886;886;1283;1296;1296	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	Q	1296;1296;1283;1274;890;875;886;886;767;1296;889;875	ENSP00000370593:E1296Q;ENSP00000348812:E1296Q;ENSP00000353187:E1283Q;ENSP00000351293:E1274Q;ENSP00000347373:E890Q;ENSP00000380741:E875Q;ENSP00000380735:E886Q;ENSP00000440515:E886Q;ENSP00000438164:E1296Q;ENSP00000417093:E889Q;ENSP00000380731:E875Q	.	E	-	1	0	PTPRD	8439827	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.332000	0.79203	2.788000	0.95919	0.650000	0.86243	GAG	PTPRD	-	NULL	ENSG00000153707		0.443	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	525	0.00	0	C			8449827	8449827	-1	no_errors	ENST00000356435	ensembl	human	known	69_37n	missense	109	34.34	57	SNP	1.000	G
RBM33	155435	genome.wustl.edu	37	7	155473535	155473535	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr7:155473535A>G	ENST00000401878.3	+	5	698	c.500A>G	c.(499-501)gAg>gGg	p.E167G	RBM33_ENST00000287912.3_Missense_Mutation_p.E167G|RBM33_ENST00000392759.3_Missense_Mutation_p.E167G	NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	167	Glu-rich.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E167G(3)		breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		GAAGAGCCAGAGGAGGAGCAG	0.413																																						dbGAP											3	Substitution - Missense(3)	breast(3)											94.0	93.0	94.0					7																	155473535		1980	4165	6145	-	-	-	SO:0001583	missense	0			AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.500A>G	7.37:g.155473535A>G	ENSP00000384160:p.Glu167Gly		A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Missense_Mutation	SNP	smart_RRM_dom	p.E167G	ENST00000401878.3	37	c.500	CCDS5941.2	7	.	.	.	.	.	.	.	.	.	.	A	11.79	1.744310	0.30865	.	.	ENSG00000184863	ENST00000287912;ENST00000401878;ENST00000392759;ENST00000440108	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	5.35	4.22	0.49857	.	.	.	.	.	T	0.10252	0.0251	N	0.01705	-0.755	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.003;0.004	T	0.14727	-1.0462	9	0.33940	T	0.23	.	3.2574	0.06836	0.7374:0.0:0.2626:0.0	.	167;167	Q96EV2;Q96EV2-2	RBM33_HUMAN;.	G	167;167;167;58	ENSP00000287912:E167G;ENSP00000384160:E167G;ENSP00000376513:E167G;ENSP00000394987:E58G	ENSP00000287912:E167G	E	+	2	0	RBM33	155166296	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	2.881000	0.48538	2.029000	0.59856	0.460000	0.39030	GAG	RBM33	-	NULL	ENSG00000184863		0.413	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBM33	HGNC	protein_coding	OTTHUMT00000317225.3	240	0.00	0	A	NM_001008408		155473535	155473535	+1	no_errors	ENST00000401878	ensembl	human	known	69_37n	missense	79	20.20	20	SNP	1.000	G
RC3H2	54542	genome.wustl.edu	37	9	125618153	125618153	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr9:125618153G>C	ENST00000373670.1	-	13	3059	c.2459C>G	c.(2458-2460)tCa>tGa	p.S820*	RC3H2_ENST00000357244.2_Nonsense_Mutation_p.S820*|RC3H2_ENST00000423239.2_Nonsense_Mutation_p.S820*			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	820					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S820*(1)		breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						CACACTCTCTGAGAACTGGTT	0.328																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											64.0	60.0	62.0					9																	125618153		1805	4073	5878	-	-	-	SO:0001587	stop_gained	0			AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.2459C>G	9.37:g.125618153G>C	ENSP00000362774:p.Ser820*		Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Nonsense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_RING,smart_Znf_CCCH,pfscan_Znf_RING	p.S820*	ENST00000373670.1	37	c.2459	CCDS43874.1	9	.	.	.	.	.	.	.	.	.	.	G	41	8.776474	0.98950	.	.	ENSG00000056586	ENST00000373670;ENST00000357244;ENST00000373663;ENST00000423239	.	.	.	5.53	5.53	0.82687	.	0.132739	0.52532	D	0.000071	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-30.9663	16.6089	0.84838	0.0:0.0:1.0:0.0	.	.	.	.	X	820;820;691;820	.	ENSP00000349783:S820X	S	-	2	0	RC3H2	124657974	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	5.297000	0.65704	2.595000	0.87683	0.655000	0.94253	TCA	RC3H2	-	NULL	ENSG00000056586		0.328	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RC3H2	HGNC	protein_coding	OTTHUMT00000053966.1	172	0.00	0	G	NM_018835		125618153	125618153	-1	no_errors	ENST00000357244	ensembl	human	known	69_37n	nonsense	47	17.24	10	SNP	1.000	C
RIMS2	9699	genome.wustl.edu	37	8	105010426	105010426	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr8:105010426C>G	ENST00000436393.2	+	16	2633	c.2392C>G	c.(2392-2394)Cta>Gta	p.L798V	RIMS2_ENST00000406091.3_Intron|RIMS2_ENST00000262231.10_Intron|RIMS2_ENST00000507740.1_Missense_Mutation_p.L812V			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1082					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.L812V(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TTTTCTTACTCTACCTCGCTC	0.353										HNSCC(12;0.0054)																												dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	126.0	132.0					8																	105010426		1866	4103	5969	-	-	-	SO:0001583	missense	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2392C>G	8.37:g.105010426C>G	ENSP00000390665:p.Leu798Val		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.L798V	ENST00000436393.2	37	c.2392		8	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740734	0.69304	.	.	ENSG00000176406	ENST00000329869;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T	0.18338	2.33;2.22;2.7	4.81	4.81	0.61882	.	.	.	.	.	T	0.14184	0.0343	L	0.29908	0.895	0.80722	D	1	B;B	0.17852	0.024;0.015	B;B	0.18263	0.021;0.009	T	0.08452	-1.0721	9	0.18276	T	0.48	.	16.8103	0.85717	0.0:1.0:0.0:0.0	.	798;812	D6RA03;Q9UQ26-3	.;.	V	1035;812;812;798	ENSP00000423559:L812V;ENSP00000386228:L812V;ENSP00000390665:L798V	ENSP00000332184:L1035V	L	+	1	2	RIMS2	105079602	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.140000	0.58031	2.496000	0.84212	0.650000	0.86243	CTA	RIMS2	-	NULL	ENSG00000176406		0.353	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	964	0.10	1	C	NM_001100117		105010426	105010426	+1	no_errors	ENST00000436393	ensembl	human	novel	69_37n	missense	530	22.48	154	SNP	1.000	G
ROPN1	54763	genome.wustl.edu	37	3	123694377	123694377	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr3:123694377C>T	ENST00000184183.4	-	5	585	c.245G>A	c.(244-246)aGa>aAa	p.R82K	ROPN1_ENST00000405845.3_Missense_Mutation_p.R82K	NM_017578.2	NP_060048.2	Q9HAT0	ROP1A_HUMAN	rhophilin associated tail protein 1	82						cytoplasm (GO:0005737)|nucleus (GO:0005634)				lung(2)|ovary(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.148)		GATGATCAGTCTGCCAGCAAC	0.552																																						dbGAP											0													2.0	3.0	3.0					3																	123694377		1407	3120	4527	-	-	-	SO:0001583	missense	0			AF231410	CCDS3026.1	3q21.1	2011-01-20	2011-01-20			ENSG00000065371			17692	protein-coding gene	gene with protein product	"""cancer/testis antigen 91"""	611757	"""ropporin, rhophilin associated protein 1"""			10591629	Standard	NM_017578		Approved	ODF6, ropporin, ROPN1A, CT91	uc003eha.3	Q9HAT0		ENST00000184183.4:c.245G>A	3.37:g.123694377C>T	ENSP00000184183:p.Arg82Lys		D3DN99|Q9UF38	Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.R82K	ENST00000184183.4	37	c.245	CCDS3026.1	3	.	.	.	.	.	.	.	.	.	.	C	10.02	1.236826	0.22711	.	.	ENSG00000065371	ENST00000184183;ENST00000405845;ENST00000467907;ENST00000460743;ENST00000495336	T;T;T;T	0.28069	2.04;2.04;2.04;1.63	4.61	4.61	0.57282	.	0.069655	0.56097	D	0.000034	T	0.24509	0.0594	N	0.02539	-0.55	0.80722	D	1	D	0.56035	0.974	D	0.70487	0.969	T	0.08659	-1.0711	10	0.02654	T	1	-30.513	14.9935	0.71412	0.0:1.0:0.0:0.0	.	82	Q9HAT0	ROP1A_HUMAN	K	82	ENSP00000184183:R82K;ENSP00000385919:R82K;ENSP00000417067:R82K;ENSP00000420310:R82K	ENSP00000184183:R82K	R	-	2	0	ROPN1	125177067	0.998000	0.40836	1.000000	0.80357	0.762000	0.43233	2.683000	0.46943	2.614000	0.88457	0.644000	0.83932	AGA	ROPN1	-	NULL	ENSG00000065371		0.552	ROPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROPN1	HGNC	protein_coding	OTTHUMT00000356188.2	98	0.00	0	C	NM_017578		123694377	123694377	-1	no_errors	ENST00000184183	ensembl	human	known	69_37n	missense	24	41.46	17	SNP	1.000	T
RPTN	126638	genome.wustl.edu	37	1	152129240	152129240	+	Missense_Mutation	SNP	T	T	C	rs541429578		TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:152129240T>C	ENST00000316073.3	-	3	399	c.335A>G	c.(334-336)aAg>aGg	p.K112R		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	112	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.K112R(1)		breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TCCTGGGAACTTACAGTCTTG	0.522													T|||	1	0.000199681	0.0	0.0	5008	,	,		23641	0.0		0.0	False		,,,				2504	0.001					dbGAP											1	Substitution - Missense(1)	breast(1)											453.0	375.0	399.0					1																	152129240		1568	3582	5150	-	-	-	SO:0001583	missense	0			AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.335A>G	1.37:g.152129240T>C	ENSP00000317895:p.Lys112Arg		B7ZBZ3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.K112R	ENST00000316073.3	37	c.335	CCDS41397.1	1	.	.	.	.	.	.	.	.	.	.	T	9.964	1.223680	0.22457	.	.	ENSG00000215853	ENST00000316073	T	0.12465	2.68	4.69	-2.41	0.06562	.	.	.	.	.	T	0.02767	0.0083	L	0.56769	1.78	0.09310	N	1	B	0.33694	0.421	B	0.29785	0.107	T	0.43686	-0.9376	9	0.09338	T	0.73	-1.3076	5.9525	0.19255	0.0:0.1599:0.3821:0.458	.	112	Q6XPR3	RPTN_HUMAN	R	112	ENSP00000317895:K112R	ENSP00000317895:K112R	K	-	2	0	RPTN	150395864	0.000000	0.05858	0.000000	0.03702	0.109000	0.19521	-0.003000	0.12901	-0.609000	0.05724	0.443000	0.29094	AAG	RPTN	-	NULL	ENSG00000215853		0.522	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTN	HGNC	protein_coding	OTTHUMT00000333867.1	1214	0.08	1	T	XM_371312		152129240	152129240	-1	no_errors	ENST00000316073	ensembl	human	known	69_37n	missense	358	34.61	190	SNP	0.000	C
RRS1	23212	genome.wustl.edu	37	8	67342428	67342430	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	AGG	AGG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr8:67342428_67342430delAGG	ENST00000320270.2	+	1	1166_1168	c.1062_1064delAGG	c.(1060-1065)aaagga>aaa	p.G356del	RP11-346I3.4_ENST00000499642.1_lincRNA|ADHFE1_ENST00000396623.3_5'Flank|ADHFE1_ENST00000415254.1_5'Flank|ADHFE1_ENST00000379385.4_5'Flank	NM_015169.3	NP_055984.1	Q15050	RRS1_HUMAN	RRS1 ribosome biogenesis regulator homolog (S. cerevisiae)	356	Arg/Gly/Lys-rich.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic metaphase plate congression (GO:0007080)|ribosome biogenesis (GO:0042254)	condensed nuclear chromosome (GO:0000794)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(2)|lung(2)	4		Lung NSC(129;0.197)	Epithelial(68;0.0391)|all cancers(69;0.0898)|BRCA - Breast invasive adenocarcinoma(89;0.111)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			GCAAGAGAAAAGGAGGACAGCGC	0.542																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			BC001811	CCDS6189.1	8q13.1	2013-10-22			ENSG00000179041	ENSG00000179041			17083	protein-coding gene	gene with protein product						7788527, 10688653	Standard	NM_015169		Approved	KIAA0112	uc003xwa.3	Q15050	OTTHUMG00000164765	ENST00000320270.2:c.1062_1064delAGG	8.37:g.67342431_67342433delAGG	ENSP00000322396:p.Gly356del		Q9BUX8	In_Frame_Del	DEL	pfam_Ribosom_reg	p.G356in_frame_del	ENST00000320270.2	37	c.1062_1064	CCDS6189.1	8																																																																																			RRS1	-	NULL	ENSG00000179041		0.542	RRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRS1	HGNC	protein_coding	OTTHUMT00000380126.1	200	0.00	0	AGG	NM_015169		67342428	67342430	+1	no_errors	ENST00000320270	ensembl	human	known	69_37n	in_frame_del	73	17.05	15	DEL	0.999:0.998:0.996	-
SAMD4A	23034	genome.wustl.edu	37	14	55168944	55168944	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr14:55168944G>A	ENST00000554335.1	+	3	1024	c.361G>A	c.(361-363)Gag>Aag	p.E121K	SAMD4A_ENST00000555112.1_3'UTR|SAMD4A_ENST00000392067.3_Missense_Mutation_p.E121K|SAMD4A_ENST00000357634.3_Missense_Mutation_p.E120K|SAMD4A_ENST00000251091.5_Missense_Mutation_p.E121K			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	121					negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)	p.E120K(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						GCACATTGAGGAGAGCAGGCA	0.498																																						dbGAP											1	Substitution - Missense(1)	breast(1)											90.0	88.0	89.0					14																	55168944		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.361G>A	14.37:g.55168944G>A	ENSP00000452535:p.Glu121Lys		A8MPZ5|Q0VA96|Q6PEW4	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM	p.E121K	ENST00000554335.1	37	c.361	CCDS32084.2	14	.	.	.	.	.	.	.	.	.	.	G	29.6	5.020205	0.93462	.	.	ENSG00000020577	ENST00000554335;ENST00000392067;ENST00000305831;ENST00000251091;ENST00000357634	T;T;T;T	0.73681	-0.74;-0.74;-0.77;-0.74	6.17	5.23	0.72850	.	0.000000	0.85682	D	0.000000	D	0.84306	0.5443	M	0.63428	1.95	0.34254	D	0.679074	D;P;D	0.76494	0.999;0.782;0.999	D;B;D	0.73708	0.981;0.28;0.918	D	0.88151	0.2851	10	0.72032	D	0.01	-9.4279	17.0967	0.86637	0.0:0.1264:0.8736:0.0	.	20;121;121	Q9UPU9-2;Q9UPU9-3;Q9UPU9	.;.;SMAG1_HUMAN	K	121;121;121;120;120	ENSP00000452535:E121K;ENSP00000375919:E121K;ENSP00000251091:E120K;ENSP00000350261:E120K	ENSP00000306381:E121K	E	+	1	0	SAMD4A	54238694	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.934000	0.87649	2.941000	0.99782	0.655000	0.94253	GAG	SAMD4A	-	NULL	ENSG00000020577		0.498	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAMD4A	HGNC	protein_coding	OTTHUMT00000411186.1	209	0.00	0	G	NM_015589		55168944	55168944	+1	no_errors	ENST00000392067	ensembl	human	known	69_37n	missense	80	23.81	25	SNP	1.000	A
SAMHD1	25939	genome.wustl.edu	37	20	35555629	35555629	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr20:35555629C>G	ENST00000262878.4	-	6	851	c.652G>C	c.(652-654)Gat>Cat	p.D218H	SAMHD1_ENST00000373694.5_Missense_Mutation_p.D3H	NM_015474.3	NP_056289.2	Q9Y3Z3	SAMH1_HUMAN	SAM domain and HD domain 1	218	HD.				dATP catabolic process (GO:0046061)|defense response to virus (GO:0051607)|dGTP catabolic process (GO:0006203)|immune response (GO:0006955)|innate immune response (GO:0045087)|protein homotetramerization (GO:0051289)|regulation of innate immune response (GO:0045088)	intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dGTP binding (GO:0032567)|dGTPase activity (GO:0008832)|nucleic acid binding (GO:0003676)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.D218H(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	20		Myeloproliferative disorder(115;0.00878)				AATCGTCCATCAAACATGTGA	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											105.0	100.0	102.0					20																	35555629		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF228421	CCDS13288.1	20q11.23	2014-09-17			ENSG00000101347	ENSG00000101347		"""Sterile alpha motif (SAM) domain containing"""	15925	protein-coding gene	gene with protein product	"""HD domain containing 1"", ""monocyte protein 5"", ""Aicardi-Goutieres syndrome 5"""	606754				11064105, 11230166	Standard	NM_015474		Approved	SBBI88, Mg11, HDDC1, MOP-5, AGS5	uc002xgh.2	Q9Y3Z3	OTTHUMG00000032402	ENST00000262878.4:c.652G>C	20.37:g.35555629C>G	ENSP00000262878:p.Asp218His		B4E2A5|E1P5V2|Q5JXG8|Q8N491|Q9H004|Q9H005|Q9H3U9	Missense_Mutation	SNP	pfam_HD_domain,pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,smart_HD/PDEase_dom,pfscan_SAM	p.D218H	ENST00000262878.4	37	c.652	CCDS13288.1	20	.	.	.	.	.	.	.	.	.	.	C	31	5.098133	0.94197	.	.	ENSG00000101347	ENST00000262878;ENST00000373694	D;D	0.95949	-3.86;-3.07	5.64	5.64	0.86602	Metal-dependent phosphohydrolase, HD domain (1);Metal-dependent phosphohydrolase, HD subdomain (1);HD domain (1);	0.000000	0.85682	D	0.000000	D	0.98451	0.9484	M	0.93594	3.435	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99177	1.0866	10	0.87932	D	0	-30.8648	19.7154	0.96115	0.0:1.0:0.0:0.0	.	218	Q9Y3Z3	SAMH1_HUMAN	H	218;3	ENSP00000262878:D218H;ENSP00000362798:D3H	ENSP00000262878:D218H	D	-	1	0	SAMHD1	34989043	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.357000	0.79456	2.664000	0.90586	0.655000	0.94253	GAT	SAMHD1	-	pfam_HD_domain,smart_HD/PDEase_dom	ENSG00000101347		0.343	SAMHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMHD1	HGNC	protein_coding	OTTHUMT00000079062.2	535	0.37	2	C	NM_015474		35555629	35555629	-1	no_errors	ENST00000262878	ensembl	human	known	69_37n	missense	242	29.39	102	SNP	1.000	G
SERPINA12	145264	genome.wustl.edu	37	14	94962895	94962895	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr14:94962895C>T	ENST00000341228.2	-	4	1515	c.720G>A	c.(718-720)atG>atA	p.M240I	SERPINA12_ENST00000556881.1_Missense_Mutation_p.M240I	NM_173850.2	NP_776249.1	Q8IW75	SPA12_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12	240					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.M240I(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33				COAD - Colon adenocarcinoma(157;0.235)		TACGGAACATCATGGGCACCT	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											162.0	155.0	157.0					14																	94962895		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY177692	CCDS9926.1	14q32.13	2014-02-21	2005-08-18		ENSG00000165953	ENSG00000165953		"""Serine (or cysteine) peptidase inhibitors"""	18359	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12"""			24172014	Standard	NM_173850		Approved	OL-64, Vaspin	uc001ydj.3	Q8IW75	OTTHUMG00000171349	ENST00000341228.2:c.720G>A	14.37:g.94962895C>T	ENSP00000342109:p.Met240Ile			Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.M240I	ENST00000341228.2	37	c.720	CCDS9926.1	14	.	.	.	.	.	.	.	.	.	.	C	29.0	4.965076	0.92855	.	.	ENSG00000165953	ENST00000556881;ENST00000341228	D;D	0.88509	-2.39;-2.39	5.6	5.6	0.85130	Serpin domain (3);	0.000000	0.85682	D	0.000000	D	0.96337	0.8805	H	0.94847	3.59	0.58432	D	0.999999	D	0.89917	1.0	D	0.78314	0.991	D	0.97061	0.9771	10	0.87932	D	0	.	19.6138	0.95622	0.0:1.0:0.0:0.0	.	240	Q8IW75	SPA12_HUMAN	I	240	ENSP00000451738:M240I;ENSP00000342109:M240I	ENSP00000342109:M240I	M	-	3	0	SERPINA12	94032648	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.680000	0.74518	2.631000	0.89168	0.561000	0.74099	ATG	SERPINA12	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000165953		0.413	SERPINA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA12	HGNC	protein_coding	OTTHUMT00000413097.1	572	0.00	0	C	NM_173850		94962895	94962895	-1	no_errors	ENST00000341228	ensembl	human	known	69_37n	missense	172	53.89	201	SNP	1.000	T
SETX	23064	genome.wustl.edu	37	9	135201859	135201859	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr9:135201859T>G	ENST00000224140.5	-	10	5308	c.5126A>C	c.(5125-5127)aAa>aCa	p.K1709T	SETX_ENST00000372169.2_Missense_Mutation_p.K1709T|SETX_ENST00000393220.1_Missense_Mutation_p.K1709T	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1709					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.K1709T(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		CATTTCATATTTCCATTTTAA	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	68.0	68.0					9																	135201859		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.5126A>C	9.37:g.135201859T>G	ENSP00000224140:p.Lys1709Thr		A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	NULL	p.K1709T	ENST00000224140.5	37	c.5126	CCDS6947.1	9	.	.	.	.	.	.	.	.	.	.	T	11.37	1.619628	0.28801	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.87729	-2.21;-2.29;-1.91	5.52	4.38	0.52667	.	0.443696	0.22934	N	0.053866	T	0.80433	0.4622	L	0.50333	1.59	0.34438	D	0.699297	B;P;P	0.40431	0.141;0.595;0.717	B;B;B	0.37198	0.032;0.123;0.243	T	0.79674	-0.1705	10	0.23302	T	0.38	.	7.3782	0.26841	0.0:0.0781:0.1546:0.7673	.	1709;1709;1709	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	T	1709	ENSP00000224140:K1709T;ENSP00000361242:K1709T;ENSP00000376913:K1709T	ENSP00000224140:K1709T	K	-	2	0	SETX	134191680	0.996000	0.38824	0.772000	0.31596	0.992000	0.81027	2.706000	0.47135	0.930000	0.37217	0.482000	0.46254	AAA	SETX	-	NULL	ENSG00000107290		0.398	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	HGNC	protein_coding	OTTHUMT00000054774.3	471	0.00	0	T	NM_015046		135201859	135201859	-1	no_errors	ENST00000372169	ensembl	human	known	69_37n	missense	211	30.62	94	SNP	0.928	G
SEZ6L2	26470	genome.wustl.edu	37	16	29898983	29898983	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr16:29898983C>T	ENST00000308713.5	-	7	1722	c.1195G>A	c.(1195-1197)Gag>Aag	p.E399K	SEZ6L2_ENST00000346932.5_Missense_Mutation_p.E285K|SEZ6L2_ENST00000350527.3_Missense_Mutation_p.E329K|SEZ6L2_ENST00000562159.1_5'Flank|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.E355K	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	399	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.E399K(1)|p.E329K(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCATTGTCCTCATCCAGCGAG	0.622																																						dbGAP											2	Substitution - Missense(2)	breast(2)											101.0	91.0	94.0					16																	29898983		2197	4300	6497	-	-	-	SO:0001583	missense	0			AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1195G>A	16.37:g.29898983C>T	ENSP00000312550:p.Glu399Lys		B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_CUB,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.E399K	ENST00000308713.5	37	c.1195	CCDS10659.1	16	.	.	.	.	.	.	.	.	.	.	C	23.7	4.443517	0.83993	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	5.72	5.72	0.89469	CUB (4);	0.000000	0.56097	D	0.000035	T	0.58566	0.2131	L	0.46885	1.475	0.46701	D	0.999167	D;D;P;D;D;D	0.89917	1.0;0.979;0.728;0.988;0.979;0.988	D;P;B;P;P;P	0.74023	0.982;0.628;0.138;0.736;0.628;0.778	T	0.48725	-0.9010	10	0.15499	T	0.54	.	14.3416	0.66630	0.0:0.8515:0.1484:0.0	.	355;399;285;329;399;329	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	K	329;399;285;355	ENSP00000310206:E329K;ENSP00000312550:E399K;ENSP00000319215:E285K;ENSP00000439412:E355K	ENSP00000312550:E399K	E	-	1	0	SEZ6L2	29806484	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.825000	0.62708	2.720000	0.93068	0.555000	0.69702	GAG	SEZ6L2	-	superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000174938		0.622	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L2	HGNC	protein_coding	OTTHUMT00000255154.2	154	0.00	0	C	NM_012410		29898983	29898983	-1	no_errors	ENST00000308713	ensembl	human	known	69_37n	missense	59	15.71	11	SNP	1.000	T
SIDT1	54847	genome.wustl.edu	37	3	113302310	113302310	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr3:113302310G>C	ENST00000264852.4	+	7	1528	c.802G>C	c.(802-804)Gat>Cat	p.D268H	SIDT1_ENST00000393830.3_Missense_Mutation_p.D268H	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	268					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)	p.D268H(1)		breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						AAAGCCTGAAGATTATGCCTG	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											120.0	117.0	118.0					3																	113302310		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.802G>C	3.37:g.113302310G>C	ENSP00000264852:p.Asp268His		Q17RR4	Missense_Mutation	SNP	NULL	p.D268H	ENST00000264852.4	37	c.802	CCDS2974.1	3	.	.	.	.	.	.	.	.	.	.	G	23.1	4.379965	0.82682	.	.	ENSG00000072858	ENST00000264852;ENST00000393830	T;T	0.34275	1.37;1.37	5.41	5.41	0.78517	.	0.174005	0.40144	N	0.001169	T	0.67325	0.2881	M	0.86420	2.815	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.73445	-0.3980	10	0.87932	D	0	-13.7939	18.801	0.92016	0.0:0.0:1.0:0.0	.	268;268	Q9NXL6-2;Q9NXL6	.;SIDT1_HUMAN	H	268	ENSP00000264852:D268H;ENSP00000377416:D268H	ENSP00000264852:D268H	D	+	1	0	SIDT1	114785000	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.749000	0.74883	2.548000	0.85928	0.585000	0.79938	GAT	SIDT1	-	NULL	ENSG00000072858		0.448	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT1	HGNC	protein_coding	OTTHUMT00000317564.1	158	0.00	0	G	NM_017699		113302310	113302310	+1	no_errors	ENST00000393830	ensembl	human	known	69_37n	missense	35	23.91	11	SNP	1.000	C
SLAIN2	57606	genome.wustl.edu	37	4	48371964	48371964	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr4:48371964T>C	ENST00000264313.6	+	2	906	c.488T>C	c.(487-489)gTt>gCt	p.V163A	SLAIN2_ENST00000506375.1_3'UTR	NM_020846.1	NP_065897.1	Q9P270	SLAI2_HUMAN	SLAIN motif family, member 2	163					cytoplasmic microtubule organization (GO:0031122)|microtubule nucleation (GO:0007020)|positive regulation of microtubule polymerization (GO:0031116)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.V163A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)	13						AGTCCTGATGTTGAGTGTGCT	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											133.0	128.0	130.0					4																	48371964		1843	4085	5928	-	-	-	SO:0001583	missense	0			BC006139	CCDS47051.1	4p12	2008-02-05	2006-09-12	2006-09-12	ENSG00000109171	ENSG00000109171			29282	protein-coding gene	gene with protein product		610492	"""KIAA1458"""	KIAA1458		16546155	Standard	NM_020846		Approved	FLJ21611	uc003gya.4	Q9P270	OTTHUMG00000161701	ENST00000264313.6:c.488T>C	4.37:g.48371964T>C	ENSP00000264313:p.Val163Ala		A8K4P1|Q8N5R3	Missense_Mutation	SNP	NULL	p.V163A	ENST00000264313.6	37	c.488	CCDS47051.1	4	.	.	.	.	.	.	.	.	.	.	T	16.44	3.123437	0.56613	.	.	ENSG00000109171	ENST00000264313	.	.	.	5.85	4.68	0.58851	.	0.183995	0.47093	D	0.000250	T	0.31104	0.0786	N	0.12182	0.205	0.80722	D	1	B	0.33171	0.4	B	0.30855	0.121	T	0.18398	-1.0338	9	0.44086	T	0.13	-3.6179	8.6064	0.33775	0.0:0.1428:0.0:0.8572	.	163	Q9P270	SLAI2_HUMAN	A	163	.	ENSP00000264313:V163A	V	+	2	0	SLAIN2	48066721	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.967000	0.70403	2.234000	0.73211	0.460000	0.39030	GTT	SLAIN2	-	NULL	ENSG00000109171		0.358	SLAIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAIN2	HGNC	protein_coding	OTTHUMT00000365807.4	305	0.00	0	T	NM_020846		48371964	48371964	+1	no_errors	ENST00000264313	ensembl	human	known	69_37n	missense	57	43.00	43	SNP	1.000	C
SLC26A9	115019	genome.wustl.edu	37	1	205904876	205904876	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:205904876C>G	ENST00000367135.3	-	2	186	c.73G>C	c.(73-75)Gag>Cag	p.E25Q	SLC26A9_ENST00000340781.4_Missense_Mutation_p.E25Q|RP4-681L3.2_ENST00000421166.1_RNA|SLC26A9_ENST00000367134.2_Missense_Mutation_p.E25Q	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	25					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)	p.E25Q(2)		NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			TCCTTCTTCTCAAACTCATCG	0.547																																						dbGAP											2	Substitution - Missense(2)	breast(2)											213.0	188.0	196.0					1																	205904876		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.73G>C	1.37:g.205904876C>G	ENSP00000356103:p.Glu25Gln		A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.E25Q	ENST00000367135.3	37	c.73	CCDS30990.1	1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.337006	0.81801	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.93076	-3.16;-3.12;-3.16	5.21	5.21	0.72293	.	0.512684	0.17144	N	0.185333	D	0.95598	0.8569	M	0.62723	1.935	0.50632	D	0.999882	D;D	0.76494	0.998;0.999	P;D	0.64144	0.863;0.922	D	0.94006	0.7280	10	0.27785	T	0.31	.	18.3498	0.90335	0.0:1.0:0.0:0.0	.	25;25	Q7LBE3;B1AVM8	S26A9_HUMAN;.	Q	25	ENSP00000341682:E25Q;ENSP00000356103:E25Q;ENSP00000356102:E25Q	ENSP00000341682:E25Q	E	-	1	0	SLC26A9	204171499	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.839000	0.69395	2.448000	0.82819	0.655000	0.94253	GAG	SLC26A9	-	NULL	ENSG00000174502		0.547	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A9	HGNC	protein_coding	OTTHUMT00000087742.1	193	0.00	0	C	NM_052934		205904876	205904876	-1	no_errors	ENST00000340781	ensembl	human	known	69_37n	missense	60	37.50	36	SNP	1.000	G
SLC26A9	115019	genome.wustl.edu	37	1	205904946	205904946	+	Start_Codon_SNP	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:205904946C>T	ENST00000367135.3	-	2	116	c.3G>A	c.(1-3)atG>atA	p.M1I	SLC26A9_ENST00000340781.4_Start_Codon_SNP_p.M1I|RP4-681L3.2_ENST00000421166.1_RNA|SLC26A9_ENST00000367134.2_Start_Codon_SNP_p.M1I	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	1					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)	p.M1I(2)		NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			TGGGCTGGCTCATATCTGGGG	0.582																																						dbGAP											2	Substitution - Missense(2)	breast(2)											85.0	79.0	81.0					1																	205904946		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.3G>A	1.37:g.205904946C>T	ENSP00000356103:p.Met1Ile		A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.M1I	ENST00000367135.3	37	c.3	CCDS30990.1	1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402036	0.83120	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.93426	-3.22;-3.09;-3.22	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.96676	0.8915	.	.	.	0.80722	D	1	D;D	0.63880	0.993;0.969	D;D	0.70227	0.968;0.914	D	0.96813	0.9598	9	0.56958	D	0.05	.	18.3498	0.90335	0.0:1.0:0.0:0.0	.	1;1	Q7LBE3;B1AVM8	S26A9_HUMAN;.	I	1	ENSP00000341682:M1I;ENSP00000356103:M1I;ENSP00000356102:M1I	ENSP00000341682:M1I	M	-	3	0	SLC26A9	204171569	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.839000	0.69395	2.448000	0.82819	0.655000	0.94253	ATG	SLC26A9	-	NULL	ENSG00000174502		0.582	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A9	HGNC	protein_coding	OTTHUMT00000087742.1	129	0.00	0	C	NM_052934	Missense_Mutation	205904946	205904946	-1	no_errors	ENST00000340781	ensembl	human	known	69_37n	missense	28	44.00	22	SNP	1.000	T
SLC4A5	57835	genome.wustl.edu	37	2	74452135	74452135	+	3'UTR	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr2:74452135G>C	ENST00000451608.2	-	0	4305				SLC4A5_ENST00000423644.1_Intron|SLC4A5_ENST00000358683.4_Intron|SLC4A5_ENST00000377632.1_Intron|SLC4A5_ENST00000483195.1_Intron|SLC4A5_ENST00000377634.4_Intron|SLC4A5_ENST00000359484.4_Intron|SLC4A5_ENST00000346834.4_Intron|SLC4A5_ENST00000357822.5_Intron|SLC4A5_ENST00000394019.2_Intron																							GTGGTGGAGAGAGACTAAAGT	0.478																																						dbGAP											0													53.0	54.0	54.0					2																	74452135		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0																														ENST00000451608.2:c.*3730C>G	2.37:g.74452135G>C				Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.S934C	ENST00000451608.2	37	c.2801		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.168|8.168	0.791012|0.791012	0.16258|0.16258	.|.	.|.	ENSG00000188687|ENSG00000188687	ENST00000451608|ENST00000425249	.|T	.|0.68624	.|-0.34	3.53|3.53	0.435|0.435	0.16544|0.16544	.|.	.|.	.|.	.|.	.|.	T|T	0.50735|0.50735	0.1633|0.1633	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.39840|0.39840	-0.9594|-0.9594	5|8	0.21540|0.52906	T|T	0.41|0.07	.|.	5.7286|5.7286	0.18026|0.18026	0.1332:0.5133:0.3535:0.0|0.1332:0.5133:0.3535:0.0	.|.	.|934	.|E7EQT3	.|.	V|C	1048|934	.|ENSP00000405678:S934C	ENSP00000416453:L1048V|ENSP00000405678:S934C	L|S	-|-	1|2	0|0	SLC4A5|SLC4A5	74305643|74305643	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.002000|0.002000	0.02628|0.02628	-0.423000|-0.423000	0.07034|0.07034	-0.173000|-0.173000	0.10761|0.10761	-0.327000|-0.327000	0.08410|0.08410	CTC|TCT	SLC4A5	-	NULL	ENSG00000188687		0.478	RP11-287D1.3-002	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	SLC4A5	HGNC	protein_coding	OTTHUMT00000445907.1	189	0.00	0	G			74452135	74452135	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000425249	ensembl	human	novel	69_37n	missense	78	35.00	42	SNP	0.001	C
SMAD4	4089	genome.wustl.edu	37	18	48586275	48586275	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr18:48586275delC	ENST00000342988.3	+	8	1482	c.944delC	c.(943-945)tccfs	p.S315fs	SMAD4_ENST00000398417.2_Frame_Shift_Del_p.S315fs|SMAD4_ENST00000588745.1_Intron	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	315	SAD.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(3)|p.N316fs*20(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CCTCCCATTTCCAATCATCCT	0.343																																						dbGAP											40	Whole gene deletion(36)|Unknown(3)|Deletion - Frameshift(1)	pancreas(27)|breast(4)|stomach(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)											116.0	111.0	113.0					18																	48586275		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.944delC	18.37:g.48586275delC	ENSP00000341551:p.Ser315fs		A8K405	Frame_Shift_Del	DEL	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.N316fs	ENST00000342988.3	37	c.944	CCDS11950.1	18																																																																																			SMAD4	-	superfamily_SMAD_FHA_domain	ENSG00000141646		0.343	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD4	HGNC	protein_coding	OTTHUMT00000255993.3	324	0.00	0	C	NM_005359		48586275	48586275	+1	no_errors	ENST00000342988	ensembl	human	known	69_37n	frame_shift_del	88	32.35	44	DEL	1.000	-
SMC4	10051	genome.wustl.edu	37	3	160119723	160119723	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr3:160119723G>C	ENST00000357388.3	+	3	611	c.160G>C	c.(160-162)Gat>Cat	p.D54H	SMC4_ENST00000360111.2_Missense_Mutation_p.D54H|SMC4_ENST00000469762.1_Intron|SMC4_ENST00000344722.5_Missense_Mutation_p.D54H|IFT80_ENST00000496589.1_5'Flank|MIR16-2_ENST00000362117.1_RNA|IFT80_ENST00000326448.7_5'Flank|IFT80_ENST00000477495.1_5'Flank|MIR15B_ENST00000385045.1_RNA|RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000462787.1_Missense_Mutation_p.D54H	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	54					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)	p.D54H(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TGAGGAACTTGATAATAGAAG	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											104.0	117.0	113.0					3																	160119723		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.160G>C	3.37:g.160119723G>C	ENSP00000349961:p.Asp54His		A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_Chemotax_Me-accpt_rcpt_lig-bd,superfamily_Prefoldin,smart_SMC_hinge	p.D54H	ENST00000357388.3	37	c.160	CCDS3189.1	3	.	.	.	.	.	.	.	.	.	.	G	16.21	3.059942	0.55325	.	.	ENSG00000113810	ENST00000497311;ENST00000357388;ENST00000465903;ENST00000485645;ENST00000360111;ENST00000392788;ENST00000489573;ENST00000462787;ENST00000490207;ENST00000344722	T;T;T;T;T;T;T;T;T	0.74315	0.9;-0.83;0.9;0.9;-0.83;0.22;-0.83;0.9;-0.83	4.86	2.95	0.34219	.	0.170346	0.50627	D	0.000119	T	0.77032	0.4071	L	0.32530	0.975	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.76753	-0.2843	10	0.54805	T	0.06	-24.9108	10.0468	0.42192	0.0751:0.0:0.7883:0.1367	.	54;54	Q9NTJ3-2;Q9NTJ3	.;SMC4_HUMAN	H	54	ENSP00000418820:D54H;ENSP00000349961:D54H;ENSP00000419247:D54H;ENSP00000420644:D54H;ENSP00000353225:D54H;ENSP00000420121:D54H;ENSP00000420734:D54H;ENSP00000420817:D54H;ENSP00000341382:D54H	ENSP00000341382:D54H	D	+	1	0	SMC4	161602417	1.000000	0.71417	0.693000	0.30195	0.387000	0.30353	7.209000	0.77916	1.175000	0.42826	-0.218000	0.12543	GAT	SMC4	-	NULL	ENSG00000113810		0.448	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC4	HGNC	protein_coding	OTTHUMT00000352862.1	250	0.00	0	G			160119723	160119723	+1	no_errors	ENST00000344722	ensembl	human	known	69_37n	missense	48	38.46	30	SNP	0.990	C
SMC6	79677	genome.wustl.edu	37	2	17906553	17906556	+	Frame_Shift_Del	DEL	TTCT	TTCT	-			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	TTCT	TTCT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr2:17906553_17906556delTTCT	ENST00000448223.2	-	9	963_966	c.694_697delAGAA	c.(694-699)agaacafs	p.RT232fs	SMC6_ENST00000402989.1_Frame_Shift_Del_p.RT232fs|SMC6_ENST00000381272.4_Frame_Shift_Del_p.RT258fs|SMC6_ENST00000351948.4_Frame_Shift_Del_p.RT232fs	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	232					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)	p.R232G(1)		NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TGCTCCTTTGTTCTTTCTTTCGTT	0.299																																						dbGAP											1	Substitution - Missense(1)	lung(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.694_697delAGAA	2.37:g.17906557_17906560delTTCT	ENSP00000404092:p.Arg232fs		A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Frame_Shift_Del	DEL	NULL	p.R258fs	ENST00000448223.2	37	c.775_772	CCDS1690.1	2																																																																																			SMC6	-	NULL	ENSG00000163029		0.299	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC6	HGNC	protein_coding	OTTHUMT00000207359.1	109	0.00	0	TTCT	NM_024624		17906553	17906556	-1	no_errors	ENST00000381272	ensembl	human	known	69_37n	frame_shift_del	46	25.81	16	DEL	1.000:1.000:1.000:1.000	-
SMCR8	140775	genome.wustl.edu	37	17	18219650	18219650	+	Silent	SNP	T	T	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr17:18219650T>C	ENST00000406438.3	+	1	1027	c.547T>C	c.(547-549)Ttg>Ctg	p.L183L	TOP3A_ENST00000582230.1_5'Flank|TOP3A_ENST00000321105.5_5'Flank|TOP3A_ENST00000542570.1_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	183						nucleus (GO:0005634)		p.L183L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						TTCTGAGTGCTTGAAGACTGG	0.473																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											51.0	55.0	54.0					17																	18219650		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.547T>C	17.37:g.18219650T>C			A5PKZ5|Q3ZCN0|Q6PJL3	Silent	SNP	pfam_Folliculin	p.L183	ENST00000406438.3	37	c.547	CCDS11195.2	17																																																																																			SMCR8	-	pfam_Folliculin	ENSG00000176994		0.473	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR8	HGNC	protein_coding	OTTHUMT00000132065.2	120	0.00	0	T	NM_144775		18219650	18219650	+1	no_errors	ENST00000406438	ensembl	human	known	69_37n	silent	53	18.46	12	SNP	1.000	C
SNX33	257364	genome.wustl.edu	37	15	75949547	75949547	+	Silent	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr15:75949547C>T	ENST00000308527.5	+	2	2913	c.1716C>T	c.(1714-1716)gaC>gaT	p.D572D		NM_153271.1	NP_695003.1	Q8WV41	SNX33_HUMAN	sorting nexin 33	572	BAR.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|macropinocytosis (GO:0044351)|membrane tubulation (GO:0097320)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|negative regulation of endocytosis (GO:0045806)|negative regulation of protein localization to cell surface (GO:2000009)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein localization to cell surface (GO:2000010)|protein import (GO:0017038)	cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)	p.D572D(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	19						GCATGTATGACAACCTCTGAC	0.607																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											117.0	119.0	118.0					15																	75949547		2197	4294	6491	-	-	-	SO:0001819	synonymous_variant	0			AK091291	CCDS10283.1	15q23	2008-04-18	2008-03-25	2008-03-25	ENSG00000173548	ENSG00000173548			28468	protein-coding gene	gene with protein product			"""SH3 and PX domain containing 3"""	SH3PX3		16374509, 16782399, 18353773	Standard	NM_153271		Approved	MGC32065, SH3PXD3C, SNX30	uc002bau.3	Q8WV41	OTTHUMG00000142835	ENST00000308527.5:c.1716C>T	15.37:g.75949547C>T			B1NM17	Nonsense_Mutation	SNP	pfam_Sorting_nexin_WASP-bd-dom,pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.Q281*	ENST00000308527.5	37	c.841	CCDS10283.1	15																																																																																			SNX33	-	pfam_Sorting_nexin_WASP-bd-dom	ENSG00000173548		0.607	SNX33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX33	HGNC	protein_coding	OTTHUMT00000286471.1	140	0.00	0	C	NM_153271		75949547	75949547	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000569152	ensembl	human	novel	69_37n	nonsense	58	24.68	19	SNP	0.709	T
SPEF2	79925	genome.wustl.edu	37	5	35740104	35740104	+	Silent	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr5:35740104G>A	ENST00000356031.3	+	22	3301	c.3147G>A	c.(3145-3147)ctG>ctA	p.L1049L	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Silent_p.L1044L	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1049					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)		p.L1049L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCAGGCATCTGAGGGAAGACC	0.338																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											109.0	100.0	102.0					5																	35740104		1823	4084	5907	-	-	-	SO:0001819	synonymous_variant	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.3147G>A	5.37:g.35740104G>A			Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Silent	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC,superfamily_CH-domain,pfscan_CH-domain	p.L1049	ENST00000356031.3	37	c.3147	CCDS43309.1	5																																																																																			SPEF2	-	NULL	ENSG00000152582		0.338	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	572	0.00	0	G	NM_144722		35740104	35740104	+1	no_errors	ENST00000356031	ensembl	human	known	69_37n	silent	262	27.40	100	SNP	0.947	A
STK4	6789	genome.wustl.edu	37	20	43703693	43703693	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr20:43703693G>C	ENST00000372806.3	+	11	1435	c.1340G>C	c.(1339-1341)aGg>aCg	p.R447T	STK4_ENST00000499879.2_Missense_Mutation_p.R392T|STK4_ENST00000372801.1_3'UTR	NM_006282.2	NP_006273.1	Q13043	STK4_HUMAN	serine/threonine kinase 4	447	SARAH. {ECO:0000255|PROSITE- ProRule:PRU00310}.				apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|cell morphogenesis (GO:0000902)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|keratinocyte differentiation (GO:0030216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.R447T(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Myeloproliferative disorder(115;0.0122)				CTTCAGAAGAGGCTCTTGGCC	0.527																																					GBM(187;1039 2137 11798 21916 33213)	dbGAP											1	Substitution - Missense(1)	breast(1)											63.0	60.0	61.0					20																	43703693		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13341.1	20q11.2-q13.2	2014-09-17			ENSG00000101109	ENSG00000101109			11408	protein-coding gene	gene with protein product	"""mammalian sterile 20-like 1"", ""yeast Ste20-like"", ""kinase responsive to stress 2"""	604965				8816758, 9545236, 11517310	Standard	NM_006282		Approved	MST1, KRS2, YSK3	uc002xnb.3	Q13043	OTTHUMG00000033059	ENST00000372806.3:c.1340G>C	20.37:g.43703693G>C	ENSP00000361892:p.Arg447Thr		B2RCR8|Q15802|Q4G156|Q5H982|Q6PD60|Q9BR32|Q9NTZ4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_SARAH_domain,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_SARAH,pfscan_Prot_kinase_cat_dom	p.R447T	ENST00000372806.3	37	c.1340	CCDS13341.1	20	.	.	.	.	.	.	.	.	.	.	G	28.4	4.914665	0.92178	.	.	ENSG00000101109	ENST00000372806;ENST00000499879	T;T	0.74842	-0.88;-0.88	5.81	4.86	0.63082	SARAH domain (1);SARAH (1);	0.000000	0.85682	D	0.000000	D	0.83857	0.5345	M	0.80183	2.485	0.80722	D	1	D;P	0.55605	0.972;0.919	P;P	0.58721	0.844;0.71	D	0.85509	0.1196	10	0.62326	D	0.03	.	14.3079	0.66395	0.0708:0.0:0.9292:0.0	.	392;447	F5H5B4;Q13043	.;STK4_HUMAN	T	447;392	ENSP00000361892:R447T;ENSP00000443514:R392T	ENSP00000361892:R447T	R	+	2	0	STK4	43137107	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.367000	0.73099	2.746000	0.94184	0.655000	0.94253	AGG	STK4	-	pfam_SARAH_domain,pfscan_SARAH	ENSG00000101109		0.527	STK4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	STK4	HGNC	protein_coding	OTTHUMT00000080401.4	153	0.00	0	G	NM_006282		43703693	43703693	+1	no_errors	ENST00000372806	ensembl	human	known	69_37n	missense	103	14.05	17	SNP	1.000	C
SYBU	55638	genome.wustl.edu	37	8	110590147	110590147	+	Silent	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr8:110590147C>G	ENST00000422135.1	-	7	1349	c.834G>C	c.(832-834)gtG>gtC	p.V278V	SYBU_ENST00000529690.1_Silent_p.V148V|SYBU_ENST00000399066.3_Silent_p.V275V|SYBU_ENST00000433638.1_Silent_p.V278V|SYBU_ENST00000528331.1_Silent_p.V159V|SYBU_ENST00000419099.1_Silent_p.V277V|SYBU_ENST00000408889.3_Silent_p.V159V|SYBU_ENST00000533065.1_Silent_p.V159V|SYBU_ENST00000276646.9_Silent_p.V278V|SYBU_ENST00000440310.1_Silent_p.V278V|SYBU_ENST00000424158.2_Silent_p.V283V|SYBU_ENST00000532779.1_Silent_p.V210V|SYBU_ENST00000408908.2_Silent_p.V278V|SYBU_ENST00000527707.1_5'UTR|SYBU_ENST00000446070.2_Silent_p.V277V|SYBU_ENST00000533895.1_Silent_p.V277V|SYBU_ENST00000528647.1_Silent_p.V277V|SYBU_ENST00000533171.1_Silent_p.V278V|SYBU_ENST00000529175.1_Silent_p.V72V	NM_001099744.1	NP_001093214.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)	278	Sufficient for interaction with KIF5B.				regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|dense body (GO:0097433)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.V275V(1)		NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30						TGAGGTGTCTCACTGTCACCT	0.507																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											189.0	185.0	187.0					8																	110590147		2020	4195	6215	-	-	-	SO:0001819	synonymous_variant	0			AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642			26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568				17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743		Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000422135.1:c.834G>C	8.37:g.110590147C>G			A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	Silent	SNP	NULL	p.V278	ENST00000422135.1	37	c.834	CCDS47912.1	8																																																																																			SYBU	-	NULL	ENSG00000147642		0.507	SYBU-204	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYBU	HGNC	protein_coding	OTTHUMT00000385501.1	485	0.00	0	C	NM_017786		110590147	110590147	-1	no_errors	ENST00000276646	ensembl	human	known	69_37n	silent	402	10.22	46	SNP	1.000	G
SYNE2	23224	genome.wustl.edu	37	14	64488685	64488685	+	Silent	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr14:64488685C>T	ENST00000344113.4	+	37	5675	c.5463C>T	c.(5461-5463)gtC>gtT	p.V1821V	SYNE2_ENST00000358025.3_Silent_p.V1821V|SYNE2_ENST00000554584.1_Silent_p.V1821V|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	1821					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.V1821V(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ATGAAAGTGTCAGTGATTTAT	0.323																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											94.0	90.0	91.0					14																	64488685		1829	4090	5919	-	-	-	SO:0001819	synonymous_variant	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.5463C>T	14.37:g.64488685C>T			Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.V1821	ENST00000344113.4	37	c.5463	CCDS41963.1	14																																																																																			SYNE2	-	NULL	ENSG00000054654		0.323	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	248	0.00	0	C	NM_182914		64488685	64488685	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	silent	110	20.86	29	SNP	1.000	T
SYNE2	23224	genome.wustl.edu	37	14	64494451	64494451	+	Silent	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr14:64494451C>T	ENST00000344113.4	+	43	6866	c.6654C>T	c.(6652-6654)ttC>ttT	p.F2218F	SYNE2_ENST00000358025.3_Silent_p.F2218F|SYNE2_ENST00000554584.1_Silent_p.F2218F|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2218					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.F2218F(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ATCCCAGCTTCAGTGAAGAGC	0.388																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											67.0	64.0	64.0					14																	64494451		1833	4086	5919	-	-	-	SO:0001819	synonymous_variant	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.6654C>T	14.37:g.64494451C>T			Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.F2218	ENST00000344113.4	37	c.6654	CCDS41963.1	14																																																																																			SYNE2	-	NULL	ENSG00000054654		0.388	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	332	0.00	0	C	NM_182914		64494451	64494451	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	silent	109	22.70	32	SNP	1.000	T
SYNE2	23224	genome.wustl.edu	37	14	64497798	64497798	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr14:64497798C>A	ENST00000344113.4	+	45	7156	c.6944C>A	c.(6943-6945)tCc>tAc	p.S2315Y	SYNE2_ENST00000358025.3_Missense_Mutation_p.S2315Y|SYNE2_ENST00000554584.1_Missense_Mutation_p.S2315Y|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2315					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.S2315Y(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TTAGCAAAATCCGTCAAGCAA	0.338																																						dbGAP											1	Substitution - Missense(1)	breast(1)											104.0	103.0	103.0					14																	64497798		1809	4081	5890	-	-	-	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.6944C>A	14.37:g.64497798C>A	ENSP00000341781:p.Ser2315Tyr		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.S2315Y	ENST00000344113.4	37	c.6944	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	C	14.84	2.655601	0.47467	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.36520	1.25;1.25;1.25	5.23	5.23	0.72850	.	0.243064	0.29466	N	0.012080	T	0.45054	0.1323	L	0.29908	0.895	0.80722	D	1	D;D	0.61697	0.984;0.99	P;D	0.63192	0.819;0.912	T	0.14615	-1.0466	10	0.27082	T	0.32	.	16.3277	0.82994	0.0:1.0:0.0:0.0	.	2315;2315	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	Y	2315	ENSP00000350719:S2315Y;ENSP00000341781:S2315Y;ENSP00000452570:S2315Y	ENSP00000261678:S2315Y	S	+	2	0	SYNE2	63567551	1.000000	0.71417	0.999000	0.59377	0.936000	0.57629	4.533000	0.60615	2.590000	0.87494	0.561000	0.74099	TCC	SYNE2	-	smart_Spectrin/alpha-actinin	ENSG00000054654		0.338	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	292	0.00	0	C	NM_182914		64497798	64497798	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	missense	77	16.30	15	SNP	1.000	A
SYT2	127833	genome.wustl.edu	37	1	202571103	202571103	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:202571103C>G	ENST00000367267.1	-	6	908	c.716G>C	c.(715-717)gGa>gCa	p.G239A	RP11-569A11.1_ENST00000428573.1_RNA|SYT2_ENST00000367268.4_Missense_Mutation_p.G239A	NM_001136504.1	NP_001129976.1	Q8N9I0	SYT2_HUMAN	synaptotagmin II	239	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000250}.				neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)	p.G239A(1)		NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	29			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	CTTTACCTCTCCAATGATGTC	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											181.0	164.0	170.0					1																	202571103		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090672	CCDS1427.1	1q32.1	2013-01-21			ENSG00000143858	ENSG00000143858		"""Synaptotagmins"""	11510	protein-coding gene	gene with protein product		600104				7749232	Standard	NM_177402		Approved		uc010pqb.2	Q8N9I0	OTTHUMG00000041388	ENST00000367267.1:c.716G>C	1.37:g.202571103C>G	ENSP00000356236:p.Gly239Ala		Q496K5|Q8NBE5	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_membr_targeting	p.G239A	ENST00000367267.1	37	c.716	CCDS1427.1	1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.957511	0.92726	.	.	ENSG00000143858	ENST00000367268;ENST00000367267	T;T	0.70282	-0.47;-0.47	5.39	5.39	0.77823	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.000000	0.85682	D	0.000000	D	0.89044	0.6603	H	0.94462	3.54	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91922	0.5548	10	0.87932	D	0	.	18.7518	0.91819	0.0:1.0:0.0:0.0	.	239	Q8N9I0	SYT2_HUMAN	A	239	ENSP00000356237:G239A;ENSP00000356236:G239A	ENSP00000356236:G239A	G	-	2	0	SYT2	200837726	1.000000	0.71417	0.960000	0.40013	0.962000	0.63368	7.781000	0.85668	2.523000	0.85059	0.514000	0.50259	GGA	SYT2	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_Synaptotagmin,pfscan_C2_membr_targeting	ENSG00000143858		0.542	SYT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT2	HGNC	protein_coding	OTTHUMT00000099157.1	365	0.27	1	C	NM_177402		202571103	202571103	-1	no_errors	ENST00000367267	ensembl	human	known	69_37n	missense	129	29.51	54	SNP	1.000	G
TAS2R19	259294	genome.wustl.edu	37	12	11175145	11175145	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:11175145G>A	ENST00000390673.2	-	1	74	c.26C>T	c.(25-27)tCa>tTa	p.S9L	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176888.1	NP_795369.1	P59542	T2R19_HUMAN	taste receptor, type 2, member 19	9					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S9L(1)		breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						CAGAATTGATGAAATGATGAG	0.373																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	61.0	63.0					12																	11175145		2202	4299	6501	-	-	-	SO:0001583	missense	0			AX097730, AF494234	CCDS8640.1	12p13.2	2012-08-22			ENSG00000212124	ENSG00000212124		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19108	protein-coding gene	gene with protein product		613961	"""taste receptor, type 2, member 48"", ""taste receptor, type 2, member 23"""	TAS2R48, TAS2R23			Standard	NM_176888		Approved	T2R19, T2R23	uc010shj.2	P59542	OTTHUMG00000162687	ENST00000390673.2:c.26C>T	12.37:g.11175145G>A	ENSP00000375091:p.Ser9Leu		Q3MIJ4|Q645X8	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.S9L	ENST00000390673.2	37	c.26	CCDS8640.1	12	.	.	.	.	.	.	.	.	.	.	.	2.061	-0.415423	0.04766	.	.	ENSG00000212124	ENST00000390673	T	0.00637	6.05	2.45	-0.513	0.11962	.	1.638660	0.05009	U	0.470632	T	0.00328	0.0010	N	0.00864	-1.135	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.41627	-0.9498	10	0.27785	T	0.31	.	4.2575	0.10724	0.6892:0.0:0.1422:0.1686	.	9	P59542	T2R19_HUMAN	L	9	ENSP00000375091:S9L	ENSP00000375091:S9L	S	-	2	0	TAS2R19	11066412	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.206000	0.09398	-0.173000	0.10761	-3.044000	0.00070	TCA	TAS2R19	-	pfam_TAS2_rcpt	ENSG00000212124		0.373	TAS2R19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R19	HGNC	protein_coding	OTTHUMT00000370080.1	322	0.00	0	G	NM_176888		11175145	11175145	-1	no_errors	ENST00000390673	ensembl	human	known	69_37n	missense	104	29.05	43	SNP	0.000	A
TBP	6908	genome.wustl.edu	37	6	170871064	170871064	+	Silent	SNP	G	G	A	rs112748399		TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr6:170871064G>A	ENST00000392092.2	+	3	519	c.240G>A	c.(238-240)caG>caA	p.Q80Q	TBP_ENST00000540980.1_Silent_p.Q60Q|TBP_ENST00000230354.6_Silent_p.Q80Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	80	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcagcagcagcagcagc	0.577																																						dbGAP											0													11.0	17.0	15.0					6																	170871064		1936	3813	5749	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.240G>A	6.37:g.170871064G>A			B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q80	ENST00000392092.2	37	c.240	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.577	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	24	0.00	0	G	NM_003194		170871064	170871064	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	33	19.05	8	SNP	1.000	A
TMEM67	91147	genome.wustl.edu	37	8	94784835	94784835	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr8:94784835G>C	ENST00000453321.3	+	7	728	c.670G>C	c.(670-672)Gaa>Caa	p.E224Q	TMEM67_ENST00000409623.3_Missense_Mutation_p.E143Q|TMEM67_ENST00000425545.2_3'UTR	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	224					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)	p.E224Q(1)|p.E214Q(1)		breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			TTTAACTTCAGAATGGTTTGC	0.279																																						dbGAP											2	Substitution - Missense(2)	breast(2)											96.0	97.0	97.0					8																	94784835		2203	4297	6500	-	-	-	SO:0001583	missense	0			BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.670G>C	8.37:g.94784835G>C	ENSP00000389998:p.Glu224Gln		B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Missense_Mutation	SNP	pfam_Meckelin,superfamily_Growth_fac_rcpt	p.E224Q	ENST00000453321.3	37	c.670	CCDS6258.2	8	.	.	.	.	.	.	.	.	.	.	G	17.77	3.470320	0.63625	.	.	ENSG00000164953	ENST00000452276;ENST00000453321;ENST00000409623	D;D;D	0.97066	-4.23;-4.23;-4.23	5.67	5.67	0.87782	.	0.242391	0.41294	D	0.000908	D	0.96049	0.8713	L	0.44542	1.39	0.38423	D	0.946239	P;P	0.51147	0.942;0.89	P;P	0.47673	0.554;0.527	D	0.95461	0.8543	10	0.29301	T	0.29	-11.3475	19.7806	0.96414	0.0:0.0:1.0:0.0	.	224;143	Q5HYA8;G5E9H2	MKS3_HUMAN;.	Q	121;224;143	ENSP00000388671:E121Q;ENSP00000389998:E224Q;ENSP00000386966:E143Q	ENSP00000314488:E214Q	E	+	1	0	TMEM67	94854011	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	4.986000	0.63851	2.669000	0.90835	0.650000	0.86243	GAA	TMEM67	-	pfam_Meckelin	ENSG00000164953		0.279	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM67	HGNC	protein_coding	OTTHUMT00000329641.2	423	0.00	0	G	NM_153704		94784835	94784835	+1	no_errors	ENST00000453321	ensembl	human	known	69_37n	missense	196	19.18	47	SNP	1.000	C
TMEM87B	84910	genome.wustl.edu	37	2	112873718	112873718	+	Nonstop_Mutation	SNP	T	T	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr2:112873718T>C	ENST00000283206.4	+	19	2035	c.1666T>C	c.(1666-1668)Tga>Cga	p.*556R		NM_032824.2	NP_116213.1	Q96K49	TM87B_HUMAN	transmembrane protein 87B	0						integral component of membrane (GO:0016021)		p.*556R(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)	19						AAAGATAATGTGATTGGAACC	0.318																																						dbGAP											1	Nonstop extension(1)	breast(1)											64.0	67.0	66.0					2																	112873718		2202	4299	6501	-	-	-	SO:0001578	stop_lost	0			AC092645	CCDS33275.1	2q13	2008-02-05			ENSG00000153214	ENSG00000153214			25913	protein-coding gene	gene with protein product							Standard	NM_032824		Approved	FLJ14681	uc002thm.2	Q96K49	OTTHUMG00000153266	ENST00000283206.4:c.1666T>C	2.37:g.112873718T>C	ENSP00000283206:p.*556Argext*5		A8K2M9|Q1RLN2|Q53R54	Nonstop_Mutation	SNP	pfam_TM_rcpt_euk	p.*556R	ENST00000283206.4	37	c.1666	CCDS33275.1	2	.	.	.	.	.	.	.	.	.	.	T	19.39	3.819088	0.71028	.	.	ENSG00000153214	ENST00000283206	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5444	0.56190	0.0:0.0:0.0:1.0	.	.	.	.	R	556	.	.	X	+	1	0	TMEM87B	112590189	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.548000	0.53670	2.210000	0.71456	0.455000	0.32223	TGA	TMEM87B	-	NULL	ENSG00000153214		0.318	TMEM87B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM87B	HGNC	protein_coding	OTTHUMT00000330500.1	92	0.00	0	T	NM_032824		112873718	112873718	+1	no_errors	ENST00000283206	ensembl	human	known	69_37n	nonstop	19	29.63	8	SNP	1.000	C
TMPRSS11A	339967	genome.wustl.edu	37	4	68784731	68784731	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr4:68784731C>G	ENST00000334830.7	-	8	1667	c.921G>C	c.(919-921)ttG>ttC	p.L307F	UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11A_ENST00000508048.1_Missense_Mutation_p.L303F|TMPRSS11A_ENST00000396188.2_Missense_Mutation_p.L304F			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	307	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)	p.L307F(1)		breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						TGTGGACAGTCAAATTTGGTT	0.468																																					NSCLC(26;2 894 10941 14480 22546)	dbGAP											1	Substitution - Missense(1)	breast(1)											149.0	149.0	149.0					4																	68784731		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.921G>C	4.37:g.68784731C>G	ENSP00000334611:p.Leu307Phe		J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Missense_Mutation	SNP	pirsf_Pept_S1A_HAT/DESC1,pfam_Peptidase_S1_S6,pfam_SEA,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.L307F	ENST00000334830.7	37	c.921	CCDS3519.1	4	.	.	.	.	.	.	.	.	.	.	C	8.020	0.759491	0.15846	.	.	ENSG00000187054	ENST00000508048;ENST00000334830;ENST00000396188;ENST00000513536	D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42	5.36	-4.37	0.03633	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.635376	0.13948	N	0.351704	T	0.77798	0.4184	N	0.25094	0.71	0.09310	N	1	P;B	0.39157	0.662;0.106	B;B	0.42138	0.377;0.18	T	0.69796	-0.5048	10	0.66056	D	0.02	.	2.8565	0.05573	0.1191:0.3666:0.1226:0.3917	.	304;307	B5MDI9;Q6ZMR5	.;TM11A_HUMAN	F	303;307;304;271	ENSP00000426911:L303F;ENSP00000334611:L307F;ENSP00000379491:L304F;ENSP00000427621:L271F	ENSP00000334611:L307F	L	-	3	2	TMPRSS11A	68467326	0.000000	0.05858	0.003000	0.11579	0.177000	0.22998	-4.419000	0.00237	-0.931000	0.03746	-1.936000	0.00505	TTG	TMPRSS11A	-	pirsf_Pept_S1A_HAT/DESC1,pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000187054		0.468	TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS11A	HGNC	protein_coding	OTTHUMT00000251433.3	302	0.00	0	C	NM_182606		68784731	68784731	-1	no_errors	ENST00000334830	ensembl	human	known	69_37n	missense	136	19.88	34	SNP	0.006	G
TP53	7157	genome.wustl.edu	37	17	7578222	7578223	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr17:7578222_7578223delTC	ENST00000269305.4	-	6	815_816	c.626_627delGA	c.(625-627)agafs	p.R209fs	TP53_ENST00000445888.2_Frame_Shift_Del_p.R209fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.R209fs|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Frame_Shift_Del_p.R209fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.R209fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.R209fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	209	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> I (in sporadic cancers; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).|R -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R209fs*6(38)|p.0?(8)|p.R209K(7)|p.?(5)|p.R209T(3)|p.R77fs*6(2)|p.R209fs*35(2)|p.D207fs*6(2)|p.R209fs*38(2)|p.R116fs*6(2)|p.R77K(1)|p.R116K(1)|p.E204_N210delEYLDDRN(1)|p.R209fs*36(1)|p.D207_R213delDDRNTFR(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.N210fs*7(1)|p.R209S(1)|p.R209I(1)|p.R209_R213delRNTFR(1)|p.D207_V216del10(1)|p.R209fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAAAAGTGTTTCTGTCATCCAA	0.535		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	84	Deletion - Frameshift(51)|Substitution - Missense(14)|Whole gene deletion(8)|Deletion - In frame(5)|Unknown(5)|Insertion - Frameshift(1)	biliary_tract(11)|breast(9)|upper_aerodigestive_tract(8)|oesophagus(7)|large_intestine(6)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(5)|prostate(5)|lung(4)|bone(4)|stomach(3)|soft_tissue(3)|ovary(3)|pancreas(3)|salivary_gland(2)|skin(2)|cervix(1)|urinary_tract(1)|liver(1)|thyroid(1)	GRCh37	CD962734	TP53	D																																				-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.626_627delGA	17.37:g.7578222_7578223delTC	ENSP00000269305:p.Arg209fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R209fs	ENST00000269305.4	37	c.627_626	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.535	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	161	0.00	0	TC	NM_000546		7578222	7578223	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	66	35.29	36	DEL	0.000:0.000	-
TRDMT1	1787	genome.wustl.edu	37	10	17199723	17199723	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr10:17199723C>G	ENST00000377799.3	-	8	651	c.604G>C	c.(604-606)Gaa>Caa	p.E202Q	TRDMT1_ENST00000351358.4_Missense_Mutation_p.E156Q|TRDMT1_ENST00000488990.1_Missense_Mutation_p.E79Q|TRDMT1_ENST00000457442.2_Missense_Mutation_p.E121Q|TRDMT1_ENST00000412821.3_Missense_Mutation_p.E178Q|TRDMT1_ENST00000358282.7_3'UTR|TRDMT1_ENST00000452380.2_5'UTR|TRDMT1_ENST00000377766.5_3'UTR	NM_004412.5	NP_004403.1	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1	202	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|response to amphetamine (GO:0001975)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|tRNA methyltransferase activity (GO:0008175)	p.E202Q(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	18					Pentamidine(DB00738)	ATTTTATTTTCTACATCCATT	0.338																																						dbGAP											1	Substitution - Missense(1)	breast(1)											94.0	87.0	89.0					10																	17199723		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ223333	CCDS7114.1	10p15.1	2006-10-23	2006-10-23	2006-10-23	ENSG00000107614	ENSG00000107614	2.1.1.37		2977	protein-coding gene	gene with protein product		602478	"""DNA (cytosine-5-)-methyltransferase 2"""	DNMT2		9425235, 9763678, 16424344	Standard	NM_004412		Approved	RNMT1	uc001iop.3	O14717	OTTHUMG00000017745	ENST00000377799.3:c.604G>C	10.37:g.17199723C>G	ENSP00000367030:p.Glu202Gln		B0YJ02|B0YJ03|B0YJ07|B0YJ08|O43669|Q86WW6	Missense_Mutation	SNP	pfam_C5_MeTfrase,prints_C5_MeTfrase,tigrfam_C5_MeTfrase	p.E202Q	ENST00000377799.3	37	c.604	CCDS7114.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.85|11.85	1.762122|1.762122	0.31228|0.31228	.|.	.|.	ENSG00000107614|ENSG00000107614	ENST00000377799;ENST00000412821;ENST00000351358;ENST00000457442;ENST00000488990|ENST00000313936	D;D;D;D|.	0.83673|.	-1.75;-1.75;-1.75;-1.75|.	5.41|5.41	3.46|3.46	0.39613|0.39613	.|.	0.548680|.	0.20382|.	N|.	0.093427|.	T|T	0.25121|0.25121	0.0610|0.0610	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	0.999998|0.999998	B;B;B;B;B;B|.	0.23442|.	0.085;0.02;0.016;0.007;0.005;0.012|.	B;B;B;B;B;B|.	0.19391|.	0.025;0.018;0.013;0.007;0.004;0.011|.	T|T	0.19877|0.19877	-1.0292|-1.0292	10|5	0.18276|.	T|.	0.48|.	-10.2236|-10.2236	9.0698|9.0698	0.36486|0.36486	0.0:0.6435:0.2756:0.0809|0.0:0.6435:0.2756:0.0809	.|.	79;131;121;156;178;202|.	B7Z8H2;B7Z1Y7;E7EMI8;O14717-3;O14717-2;O14717|.	.;.;.;.;.;TRDMT_HUMAN|.	Q|T	202;178;156;121;79|135	ENSP00000367030:E202Q;ENSP00000409354:E178Q;ENSP00000324328:E156Q;ENSP00000412256:E121Q|.	ENSP00000324328:E156Q|.	E|R	-|-	1|2	0|0	TRDMT1|TRDMT1	17239729|17239729	0.050000|0.050000	0.20438|0.20438	0.304000|0.304000	0.25085|0.25085	0.386000|0.386000	0.30323|0.30323	2.086000|2.086000	0.41643|0.41643	0.688000|0.688000	0.31529|0.31529	0.650000|0.650000	0.86243|0.86243	GAA|AGA	TRDMT1	-	pfam_C5_MeTfrase,tigrfam_C5_MeTfrase	ENSG00000107614		0.338	TRDMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRDMT1	HGNC	protein_coding	OTTHUMT00000047024.3	201	0.00	0	C	NM_004412		17199723	17199723	-1	no_errors	ENST00000377799	ensembl	human	known	69_37n	missense	104	20.00	26	SNP	0.004	G
TRIM16	10626	genome.wustl.edu	37	17	15535029	15535029	+	Splice_Site	SNP	C	C	G			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr17:15535029C>G	ENST00000578237.1	-	10	1871		c.e10-1		TRIM16_ENST00000577886.1_Splice_Site|TRIM16_ENST00000416464.2_Splice_Site|RP11-385D13.1_ENST00000455584.2_Splice_Site|TRIM16_ENST00000579219.1_Intron|TRIM16_ENST00000336708.7_Splice_Site			O95361	TRI16_HUMAN	tripartite motif containing 16						histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription, DNA-templated (GO:0045893)|response to growth hormone (GO:0060416)|response to organophosphorus (GO:0046683)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|PML body (GO:0016605)	DNA binding (GO:0003677)|interleukin-1 binding (GO:0019966)|NACHT domain binding (GO:0032089)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	19				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		TCATACTCCTCTAGAAAATCA	0.502																																						dbGAP											1	Unknown(1)	breast(1)											98.0	84.0	89.0					17																	15535029		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF096870	CCDS11171.1	17p11.2	2011-04-20	2011-01-25		ENSG00000221926	ENSG00000221926		"""Tripartite motif containing / Tripartite motif containing"""	17241	protein-coding gene	gene with protein product	"""estrogen-responsive B box protein"""	609505	"""tripartite motif-containing 16"""			11331580	Standard	NM_006470		Approved	EBBP	uc002gor.1	O95361	OTTHUMG00000059067	ENST00000578237.1:c.1016-1G>C	17.37:g.15535029C>G			Q6IAL8|Q7Z6I2|Q96BE8|Q96J43	Splice_Site	SNP	-	e5-1	ENST00000578237.1	37	c.1016-1	CCDS11171.1	17	.	.	.	.	.	.	.	.	.	.	C	17.03	3.283535	0.59867	.	.	ENSG00000251537;ENSG00000221926;ENSG00000221926	ENST00000455584;ENST00000336708;ENST00000416464	.	.	.	4.39	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8305	0.70146	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRIM16;RP11-385D13.1	15475754	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.177000	0.65032	2.146000	0.66826	0.555000	0.69702	.	TRIM16	-	-	ENSG00000221926		0.502	TRIM16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM16	HGNC	protein_coding	OTTHUMT00000130700.2	121	0.00	0	C	NM_006470	Intron	15535029	15535029	-1	no_errors	ENST00000336708	ensembl	human	known	69_37n	splice_site	15	34.78	8	SNP	1.000	G
TRNT1	51095	genome.wustl.edu	37	3	3189137	3189137	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr3:3189137T>C	ENST00000251607.6	+	7	908	c.806T>C	c.(805-807)tTa>tCa	p.L269S	TRNT1_ENST00000280591.6_Missense_Mutation_p.L249S	NM_182916.2	NP_886552	Q96Q11	TRNT1_HUMAN	tRNA nucleotidyl transferase, CCA-adding, 1	269					protein targeting to mitochondrion (GO:0006626)|tRNA 3'-end processing (GO:0042780)|tRNA 3'-terminal CCA addition (GO:0001680)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP:3'-cytidine-cytidine-tRNA adenylyltransferase activity (GO:0052929)|CTP:3'-cytidine-tRNA cytidylyltransferase activity (GO:0052928)|CTP:tRNA cytidylyltransferase activity (GO:0052927)|tRNA adenylyltransferase activity (GO:0004810)|tRNA binding (GO:0000049)	p.L269S(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(2)|urinary_tract(1)	12				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)		CCTACAGGTTTACCTGCTAAT	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											63.0	65.0	64.0					3																	3189137		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151805	CCDS2561.2	3p25.1	2002-05-30			ENSG00000072756	ENSG00000072756	2.7.7.25		17341	protein-coding gene	gene with protein product		612907				10810093, 11504732	Standard	NM_182916		Approved	MtCCA, CGI-47, CCA1	uc003bpp.4	Q96Q11	OTTHUMG00000090259	ENST00000251607.6:c.806T>C	3.37:g.3189137T>C	ENSP00000251607:p.Leu269Ser		A8K2Z6|B7WP13|C9JKA2|Q8ND57|Q9BS97|Q9Y362	Missense_Mutation	SNP	pfam_PolA_pol_head_dom	p.L269S	ENST00000251607.6	37	c.806	CCDS2561.2	3	.	.	.	.	.	.	.	.	.	.	T	23.6	4.431331	0.83776	.	.	ENSG00000072756	ENST00000251607;ENST00000280591	T;T	0.55760	0.5;0.88	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000002	T	0.77864	0.4194	M	0.91768	3.24	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.77557	0.972;0.99	T	0.81722	-0.0803	10	0.46703	T	0.11	-8.4736	15.5464	0.76104	0.0:0.0:0.0:1.0	.	249;269	Q96Q11-2;Q96Q11	.;TRNT1_HUMAN	S	269;249	ENSP00000251607:L269S;ENSP00000280591:L249S	ENSP00000251607:L269S	L	+	2	0	TRNT1	3164137	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	7.372000	0.79612	2.155000	0.67459	0.533000	0.62120	TTA	TRNT1	-	NULL	ENSG00000072756		0.358	TRNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRNT1	HGNC	protein_coding	OTTHUMT00000337616.1	380	0.00	0	T			3189137	3189137	+1	no_errors	ENST00000251607	ensembl	human	known	69_37n	missense	180	19.20	43	SNP	0.984	C
TTI2	80185	genome.wustl.edu	37	8	33361052	33361052	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr8:33361052T>A	ENST00000431156.2	-	6	1772	c.1154A>T	c.(1153-1155)gAg>gTg	p.E385V	TTI2_ENST00000520636.1_Missense_Mutation_p.E354V|TTI2_ENST00000360742.5_Missense_Mutation_p.E385V|TTI2_ENST00000519356.1_5'UTR	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	385								p.E385V(1)									GATGACTCTCTCCAGCCTCTT	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											168.0	173.0	171.0					8																	33361052		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.1154A>T	8.37:g.33361052T>A	ENSP00000411169:p.Glu385Val		D3DSV7|Q96IM2|Q9H5N4	Missense_Mutation	SNP	pfam_DUF2454,superfamily_ARM-type_fold	p.E385V	ENST00000431156.2	37	c.1154	CCDS6090.1	8	.	.	.	.	.	.	.	.	.	.	T	11.02	1.516929	0.27123	.	.	ENSG00000129696	ENST00000360742;ENST00000431156;ENST00000522668;ENST00000520636	T;T;T	0.74947	-0.89;-0.89;-0.89	6.03	6.03	0.97812	.	0.060752	0.64402	D	0.000005	T	0.69575	0.3126	L	0.57536	1.79	0.80722	D	1	P;B	0.37061	0.58;0.437	B;B	0.38712	0.28;0.172	T	0.66093	-0.6009	10	0.18276	T	0.48	-15.9491	11.332	0.49482	0.1357:0.0:0.0:0.8643	.	385;354	Q6NXR4;E5RIH5	TTI2_HUMAN;.	V	385;385;374;354	ENSP00000353971:E385V;ENSP00000411169:E385V;ENSP00000428401:E354V	ENSP00000353971:E385V	E	-	2	0	C8orf41	33480594	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	3.712000	0.54875	2.302000	0.77476	0.533000	0.62120	GAG	TTI2	-	pfam_DUF2454,superfamily_ARM-type_fold	ENSG00000129696		0.448	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTI2	HGNC	protein_coding	OTTHUMT00000376555.1	405	0.00	0	T	NM_025115		33361052	33361052	-1	no_errors	ENST00000360742	ensembl	human	known	69_37n	missense	186	14.03	31	SNP	1.000	A
TTYH2	94015	genome.wustl.edu	37	17	72245191	72245191	+	Silent	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr17:72245191G>A	ENST00000269346.4	+	7	920	c.846G>A	c.(844-846)ctG>ctA	p.L282L	TTYH2_ENST00000441391.2_5'UTR|TTYH2_ENST00000529107.1_Silent_p.L261L|TTYH2_ENST00000534346.1_3'UTR	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	282						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)	p.L282L(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						CCTTCATCCTGAACGTCACGG	0.582																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											146.0	115.0	126.0					17																	72245191		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.846G>A	17.37:g.72245191G>A			B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Missense_Mutation	SNP	pfam_Tweety	p.E71K	ENST00000269346.4	37	c.211	CCDS32717.1	17																																																																																			TTYH2	-	pfam_Tweety	ENSG00000141540		0.582	TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TTYH2	HGNC	protein_coding	OTTHUMT00000387459.1	140	0.00	0	G			72245191	72245191	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000528128	ensembl	human	known	69_37n	missense	43	34.85	23	SNP	1.000	A
UNC119B	84747	genome.wustl.edu	37	12	121154503	121154503	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:121154503T>A	ENST00000344651.4	+	3	471	c.431T>A	c.(430-432)tTc>tAc	p.F144Y		NM_001080533.1	NP_001074002.1	A6NIH7	U119B_HUMAN	unc-119 homolog B (C. elegans)	144					cilium morphogenesis (GO:0060271)|lipoprotein transport (GO:0042953)	ciliary transition zone (GO:0035869)	lipid binding (GO:0008289)	p.F144Y(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CGCTATCAGTTCACACCGGCA	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											278.0	253.0	261.0					12																	121154503		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31914.1	12q24	2014-06-16	2001-11-28		ENSG00000175970	ENSG00000175970			16488	protein-coding gene	gene with protein product	"""POC7 centriolar protein homolog B (Chlamydomonas)"""		"""unc119 (C.elegans) homolog B"""				Standard	NM_001080533		Approved	MGC5139, POC7B	uc001tyz.4	A6NIH7	OTTHUMG00000169201	ENST00000344651.4:c.431T>A	12.37:g.121154503T>A	ENSP00000344942:p.Phe144Tyr			Missense_Mutation	SNP	pfam_GMP_PDE_delta,superfamily_Ig_E-set	p.F144Y	ENST00000344651.4	37	c.431	CCDS31914.1	12	.	.	.	.	.	.	.	.	.	.	T	36	5.813472	0.96975	.	.	ENSG00000175970	ENST00000344651;ENST00000537794	.	.	.	5.82	5.82	0.92795	Immunoglobulin E-set (1);	0.000000	0.85682	D	0.000000	D	0.87224	0.6124	H	0.95745	3.715	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.91009	0.4848	9	0.87932	D	0	-15.9391	16.1839	0.81934	0.0:0.0:0.0:1.0	.	144	A6NIH7	U119B_HUMAN	Y	144	.	ENSP00000344942:F144Y	F	+	2	0	UNC119B	119638886	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	8.036000	0.88901	2.222000	0.72286	0.533000	0.62120	TTC	UNC119B	-	pfam_GMP_PDE_delta,superfamily_Ig_E-set	ENSG00000175970		0.532	UNC119B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC119B	HGNC	protein_coding	OTTHUMT00000402857.1	215	0.00	0	T	NM_001080533		121154503	121154503	+1	no_errors	ENST00000344651	ensembl	human	known	69_37n	missense	45	22.95	14	SNP	1.000	A
UNC79	57578	genome.wustl.edu	37	14	94087993	94087993	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr14:94087993G>A	ENST00000393151.2	+	30	4414	c.4414G>A	c.(4414-4416)Gag>Aag	p.E1472K	UNC79_ENST00000553484.1_Missense_Mutation_p.E1494K|UNC79_ENST00000256339.4_Missense_Mutation_p.E1295K|UNC79_ENST00000555664.1_Missense_Mutation_p.E1472K			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1472					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E1494K(1)|p.E1295K(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TGAATATAGAGAGACGGGTGC	0.388																																						dbGAP											2	Substitution - Missense(2)	breast(2)											62.0	62.0	62.0					14																	94087993		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.4414G>A	14.37:g.94087993G>A	ENSP00000376858:p.Glu1472Lys		B5MDL6|Q6ZUT7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E1494K	ENST00000393151.2	37	c.4480		14	.	.	.	.	.	.	.	.	.	.	G	17.64	3.440633	0.63067	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.23147	1.95;1.92;1.95;1.95	5.98	5.98	0.97165	.	0.146062	0.64402	D	0.000014	T	0.23886	0.0578	L	0.27053	0.805	0.58432	D	0.99999	B	0.27656	0.184	B	0.26094	0.066	T	0.02526	-1.1146	10	0.52906	T	0.07	-6.9963	20.4561	0.99145	0.0:0.0:1.0:0.0	.	1494	C9JQL1	.	K	1295;1472;1494;1472;1494	ENSP00000256339:E1295K;ENSP00000450868:E1472K;ENSP00000451360:E1494K;ENSP00000376858:E1472K	ENSP00000256339:E1295K	E	+	1	0	KIAA1409	93157746	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.847000	0.97988	0.591000	0.81541	GAG	UNC79	-	superfamily_ARM-type_fold	ENSG00000133958		0.388	UNC79-006	KNOWN	basic	protein_coding	UNC79	HGNC	protein_coding	OTTHUMT00000412766.1	583	0.00	0	G	XM_028395		94087993	94087993	+1	no_errors	ENST00000553484	ensembl	human	known	69_37n	missense	147	50.34	149	SNP	1.000	A
UPF2	26019	genome.wustl.edu	37	10	12071466	12071466	+	Silent	SNP	T	T	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr10:12071466T>C	ENST00000356352.2	-	2	896	c.423A>G	c.(421-423)agA>agG	p.R141R	UPF2_ENST00000357604.5_Silent_p.R141R|UPF2_ENST00000397053.2_Silent_p.R141R			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	141					gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)	p.R141R(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				GAAGTTCCTTTCTTAAATGAT	0.368																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											93.0	105.0	101.0					10																	12071466		2189	4264	6453	-	-	-	SO:0001819	synonymous_variant	0			AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.423A>G	10.37:g.12071466T>C			A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Silent	SNP	pfam_MIF4G-like_typ-3,pfam_Up-fram_suppressor-2,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.R141	ENST00000356352.2	37	c.423	CCDS7086.1	10																																																																																			UPF2	-	NULL	ENSG00000151461		0.368	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UPF2	HGNC	protein_coding	OTTHUMT00000046783.1	516	0.00	0	T			12071466	12071466	-1	no_errors	ENST00000356352	ensembl	human	known	69_37n	silent	246	41.47	175	SNP	0.993	C
USP5	8078	genome.wustl.edu	37	12	6961446	6961446	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:6961446G>A	ENST00000229268.8	+	1	155	c.103G>A	c.(103-105)Gac>Aac	p.D35N	CDCA3_ENST00000535406.1_5'Flank|CDCA3_ENST00000538862.2_5'Flank|CDCA3_ENST00000229265.6_5'Flank|CDCA3_ENST00000540683.1_5'Flank|CDCA3_ENST00000422785.3_5'Flank|USP5_ENST00000389231.5_Missense_Mutation_p.D35N	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	35					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)	p.D35N(2)		breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						CTTCTCCTTCGACACGCCGGT	0.642																																						dbGAP											2	Substitution - Missense(2)	breast(2)											95.0	76.0	83.0					12																	6961446		2202	4300	6502	-	-	-	SO:0001583	missense	0			U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.103G>A	12.37:g.6961446G>A	ENSP00000229268:p.Asp35Asn		D3DUS7|D3DUS8|Q96J22	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_UBA/transl_elong_EF1B_N,pfam_Znf_UBP,superfamily_UBA-like,smart_Znf_UBP,smart_UBA/transl_elong_EF1B_N_euk,pirsf_Ubiquitinyl_hydrolase,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.D35N	ENST00000229268.8	37	c.103	CCDS41743.1	12	.	.	.	.	.	.	.	.	.	.	G	23.5	4.417988	0.83449	.	.	ENSG00000111667	ENST00000229268;ENST00000389231;ENST00000542087	T;T	0.26957	1.7;1.7	5.38	5.38	0.77491	.	0.224693	0.46145	D	0.000304	T	0.44307	0.1287	M	0.73319	2.225	0.47994	D	0.999565	P;D	0.69078	0.943;0.997	B;P	0.56343	0.124;0.796	T	0.30880	-0.9963	10	0.54805	T	0.06	.	14.8829	0.70547	0.0:0.1429:0.8571:0.0	.	35;35	P45974;P45974-2	UBP5_HUMAN;.	N	35	ENSP00000229268:D35N;ENSP00000373883:D35N	ENSP00000229268:D35N	D	+	1	0	USP5	6831707	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.690000	0.47001	2.813000	0.96785	0.655000	0.94253	GAC	USP5	-	pirsf_Ubiquitinyl_hydrolase	ENSG00000111667		0.642	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP5	HGNC	protein_coding	OTTHUMT00000402982.1	12	0.00	0	G			6961446	6961446	+1	no_errors	ENST00000229268	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	1.000	A
USP5	8078	genome.wustl.edu	37	12	6967614	6967614	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr12:6967614G>C	ENST00000229268.8	+	8	943	c.891G>C	c.(889-891)gaG>gaC	p.E297D	USP5_ENST00000389231.5_Missense_Mutation_p.E297D	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	297					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)	p.E297D(2)		breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						CTGAGTTGGAGATAGACATGA	0.522																																						dbGAP											2	Substitution - Missense(2)	breast(2)											117.0	93.0	101.0					12																	6967614		2203	4300	6503	-	-	-	SO:0001583	missense	0			U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.891G>C	12.37:g.6967614G>C	ENSP00000229268:p.Glu297Asp		D3DUS7|D3DUS8|Q96J22	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_UBA/transl_elong_EF1B_N,pfam_Znf_UBP,superfamily_UBA-like,smart_Znf_UBP,smart_UBA/transl_elong_EF1B_N_euk,pirsf_Ubiquitinyl_hydrolase,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.E297D	ENST00000229268.8	37	c.891	CCDS41743.1	12	.	.	.	.	.	.	.	.	.	.	G	16.26	3.072326	0.55646	.	.	ENSG00000111667	ENST00000229268;ENST00000389231	T;T	0.25749	1.78;1.78	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.40272	0.1110	M	0.78456	2.415	0.80722	D	1	B;P	0.46064	0.157;0.872	B;P	0.50934	0.031;0.654	T	0.27971	-1.0058	10	0.66056	D	0.02	-8.7613	9.6241	0.39739	0.1545:0.0:0.8455:0.0	.	297;297	P45974;P45974-2	UBP5_HUMAN;.	D	297	ENSP00000229268:E297D;ENSP00000373883:E297D	ENSP00000229268:E297D	E	+	3	2	USP5	6837875	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.195000	0.58400	2.884000	0.98904	0.655000	0.94253	GAG	USP5	-	pirsf_Ubiquitinyl_hydrolase	ENSG00000111667		0.522	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP5	HGNC	protein_coding	OTTHUMT00000402982.1	120	0.00	0	G			6967614	6967614	+1	no_errors	ENST00000229268	ensembl	human	known	69_37n	missense	49	25.76	17	SNP	1.000	C
UTP14C	9724	genome.wustl.edu	37	13	52604942	52604942	+	Missense_Mutation	SNP	A	A	C	rs530974224		TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr13:52604942A>C	ENST00000521776.2	+	2	2735	c.2002A>C	c.(2002-2004)Atc>Ctc	p.I668L		NM_021645.5	NP_067677.4	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)	668					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|rRNA processing (GO:0006364)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)		p.I668L(1)		breast(4)|cervix(1)|endometrium(1)|large_intestine(10)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	32		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)		AAATGTGATTATCAGTGAGAA	0.483																																						dbGAP											1	Substitution - Missense(1)	breast(1)											176.0	175.0	175.0					13																	52604942		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87455	CCDS31978.1	13q12.2-q13.3	2010-11-23	2004-06-15	2004-06-16	ENSG00000253797	ENSG00000253797			20321	protein-coding gene	gene with protein product		608969	"""KIAA0266"""	KIAA0266		9039502, 16354793	Standard	NM_021645		Approved	2700066J21Rik	uc021rjw.1	Q5TAP6	OTTHUMG00000164353	ENST00000521776.2:c.2002A>C	13.37:g.52604942A>C	ENSP00000428619:p.Ile668Leu		Q5FWG3|Q92555	Missense_Mutation	SNP	pfam_SSU_processome_Utp14	p.I668L	ENST00000521776.2	37	c.2002	CCDS31978.1	13	.	.	.	.	.	.	.	.	.	.	A	17.16	3.317477	0.60524	.	.	ENSG00000253797	ENST00000521776	T	0.37752	1.18	2.88	-0.137	0.13469	.	0.090894	0.64402	N	0.000001	T	0.51363	0.1670	M	0.92738	3.34	0.51012	D	0.999905	P	0.45474	0.859	P	0.51833	0.681	T	0.52193	-0.8608	9	.	.	.	-4.6413	4.2995	0.10918	0.6081:0.1979:0.0:0.1939	.	668	Q5TAP6	UT14C_HUMAN	L	668	ENSP00000428619:I668L	.	I	+	1	0	UTP14C	51502943	1.000000	0.71417	0.995000	0.50966	0.829000	0.46940	1.403000	0.34612	0.307000	0.22880	0.363000	0.22086	ATC	UTP14C	-	pfam_SSU_processome_Utp14	ENSG00000253797		0.483	UTP14C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP14C	HGNC	protein_coding	OTTHUMT00000045049.2	934	0.00	0	A	NM_021645		52604942	52604942	+1	no_errors	ENST00000521776	ensembl	human	known	69_37n	missense	305	33.98	158	SNP	1.000	C
WASF1	8936	genome.wustl.edu	37	6	110426631	110426631	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr6:110426631G>T	ENST00000392589.1	-	8	1528	c.692C>A	c.(691-693)cCa>cAa	p.P231Q	WASF1_ENST00000392586.1_Missense_Mutation_p.P231Q|WASF1_ENST00000392588.1_Missense_Mutation_p.P231Q|WASF1_ENST00000359451.2_Missense_Mutation_p.P231Q|WASF1_ENST00000392587.2_Missense_Mutation_p.P231Q	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	231					actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)	p.P231Q(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		ATGAGAGGCTGGGCCATTAGC	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	49.0	50.0					6																	110426631		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.692C>A	6.37:g.110426631G>T	ENSP00000376368:p.Pro231Gln		E1P5F2|Q5SZK7	Missense_Mutation	SNP	pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.P231Q	ENST00000392589.1	37	c.692	CCDS5080.1	6	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640698	0.67244	.	.	ENSG00000112290	ENST00000392586;ENST00000392587;ENST00000392589;ENST00000392588;ENST00000359451	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	5.49	5.49	0.81192	.	0.161399	0.56097	D	0.000026	T	0.22704	0.0548	L	0.27053	0.805	0.50813	D	0.999891	P	0.48911	0.917	B	0.42882	0.401	T	0.01711	-1.1290	10	0.22109	T	0.4	.	19.3767	0.94512	0.0:0.0:1.0:0.0	.	231	Q92558	WASF1_HUMAN	Q	231	ENSP00000376365:P231Q;ENSP00000376366:P231Q;ENSP00000376368:P231Q;ENSP00000376367:P231Q;ENSP00000352425:P231Q	ENSP00000352425:P231Q	P	-	2	0	WASF1	110533324	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.746000	0.74866	2.556000	0.86216	0.591000	0.81541	CCA	WASF1	-	NULL	ENSG00000112290		0.388	WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	WASF1	HGNC	protein_coding	OTTHUMT00000041784.3	378	0.26	1	G	NM_003931		110426631	110426631	-1	no_errors	ENST00000359451	ensembl	human	known	69_37n	missense	118	47.58	108	SNP	1.000	T
UTRN	7402	genome.wustl.edu	37	6	144835162	144835162	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr6:144835162G>C	ENST00000367545.3	+	35	5062	c.5062G>C	c.(5062-5064)Gaa>Caa	p.E1688Q		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1688	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.E1688Q(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TAAACAGGAAGAAATTGTGAA	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											148.0	152.0	151.0					6																	144835162		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.5062G>C	6.37:g.144835162G>C	ENSP00000356515:p.Glu1688Gln		Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.E1688Q	ENST00000367545.3	37	c.5062	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998717	0.54147	.	.	ENSG00000152818	ENST00000367545	T	0.49720	0.77	5.02	4.16	0.48862	.	0.000000	0.50627	D	0.000117	T	0.26882	0.0658	L	0.52364	1.645	0.80722	D	1	B	0.33022	0.394	B	0.37304	0.246	T	0.08432	-1.0722	10	0.14252	T	0.57	.	13.5536	0.61747	0.0757:0.0:0.9243:0.0	.	1688	P46939	UTRO_HUMAN	Q	1688	ENSP00000356515:E1688Q	ENSP00000356515:E1688Q	E	+	1	0	UTRN	144876855	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	5.916000	0.69981	1.256000	0.44068	0.591000	0.81541	GAA	UTRN	-	pfam_Spectrin_repeat,pirsf_Dystrophin/utrophin	ENSG00000152818		0.383	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	574	0.17	1	G			144835162	144835162	+1	no_errors	ENST00000367545	ensembl	human	known	69_37n	missense	266	17.34	56	SNP	1.000	C
WNK4	65266	genome.wustl.edu	37	17	40948199	40948200	+	Frame_Shift_Del	DEL	TA	TA	-	rs141257205		TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	TA	TA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr17:40948199_40948200delTA	ENST00000246914.5	+	17	3511_3512	c.3490_3491delTA	c.(3490-3492)tacfs	p.Y1164fs	CNTD1_ENST00000588408.1_5'Flank|CNTD1_ENST00000588527.1_5'Flank	NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	1164					chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		TGAAGATTTGTACAGCCGGCTG	0.584																																					Esophageal Squamous(6;201 374 4964 23855 42828)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.3490_3491delTA	17.37:g.40948199_40948200delTA	ENSP00000246914:p.Tyr1164fs		B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Y1164fs	ENST00000246914.5	37	c.3490_3491	CCDS11439.1	17																																																																																			WNK4	-	NULL	ENSG00000126562		0.584	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK4	HGNC	protein_coding	OTTHUMT00000452389.1	77	0.00	0	TA			40948199	40948200	+1	no_errors	ENST00000246914	ensembl	human	known	69_37n	frame_shift_del	26	12.12	4	DEL	1.000:1.000	-
WNT7A	7476	genome.wustl.edu	37	3	13860570	13860570	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr3:13860570C>A	ENST00000285018.4	-	4	1225	c.921G>T	c.(919-921)atG>atT	p.M307I		NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	307					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)	p.M307I(2)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						GCCCACAGCACATGAGGTCAC	0.647																																						dbGAP											2	Substitution - Missense(2)	lung(1)|breast(1)											62.0	55.0	58.0					3																	13860570		2203	4300	6503	-	-	-	SO:0001583	missense	0			D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.921G>T	3.37:g.13860570C>A	ENSP00000285018:p.Met307Ile		Q96H90|Q9Y560	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt7	p.M307I	ENST00000285018.4	37	c.921	CCDS2616.1	3	.	.	.	.	.	.	.	.	.	.	C	25.3	4.626254	0.87560	.	.	ENSG00000154764	ENST00000285018	T	0.76968	-1.06	4.18	4.18	0.49190	.	0.038032	0.85682	D	0.000000	D	0.84813	0.5555	M	0.80746	2.51	0.80722	D	1	P	0.42871	0.792	P	0.50537	0.643	D	0.88110	0.2825	10	0.87932	D	0	.	16.9039	0.86120	0.0:1.0:0.0:0.0	.	307	O00755	WNT7A_HUMAN	I	307	ENSP00000285018:M307I	ENSP00000285018:M307I	M	-	3	0	WNT7A	13835571	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.802000	0.85969	2.052000	0.61016	0.563000	0.77884	ATG	WNT7A	-	pfam_Wnt,smart_Wnt	ENSG00000154764		0.647	WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT7A	HGNC	protein_coding	OTTHUMT00000252031.2	44	0.00	0	C	NM_004625		13860570	13860570	-1	no_errors	ENST00000285018	ensembl	human	known	69_37n	missense	34	22.73	10	SNP	1.000	A
ZBTB6	10773	genome.wustl.edu	37	9	125673289	125673289	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr9:125673289G>A	ENST00000373659.3	-	2	1151	c.1063C>T	c.(1063-1065)Cag>Tag	p.Q355*		NM_006626.5	NP_006617.1	Q15916	ZBTB6_HUMAN	zinc finger and BTB domain containing 6	355					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q355*(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	11						ACAGTACACTGAAAGGGCCGT	0.438																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											94.0	89.0	91.0					9																	125673289		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X82018	CCDS6846.1	9q33.1-q33.3	2013-01-08	2006-04-10	2006-04-10	ENSG00000186130	ENSG00000186130		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16764	protein-coding gene	gene with protein product		605976	"""zinc finger protein 482"""	ZNF482		7958847	Standard	NM_006626		Approved	ZID	uc004bnh.4	Q15916	OTTHUMG00000020628	ENST00000373659.3:c.1063C>T	9.37:g.125673289G>A	ENSP00000362763:p.Gln355*		A8K8N6	Nonsense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.Q355*	ENST00000373659.3	37	c.1063	CCDS6846.1	9	.	.	.	.	.	.	.	.	.	.	G	34	5.312918	0.95655	.	.	ENSG00000186130	ENST00000373659	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	.	19.5705	0.95413	0.0:0.0:1.0:0.0	.	.	.	.	X	355	.	ENSP00000362763:Q355X	Q	-	1	0	ZBTB6	124713110	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.655000	0.61476	2.941000	0.99782	0.655000	0.94253	CAG	ZBTB6	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186130		0.438	ZBTB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB6	HGNC	protein_coding	OTTHUMT00000053962.1	220	0.00	0	G	NM_006626		125673289	125673289	-1	no_errors	ENST00000373659	ensembl	human	known	69_37n	nonsense	93	31.62	43	SNP	1.000	A
ZBTB6	10773	genome.wustl.edu	37	9	125673973	125673973	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr9:125673973G>C	ENST00000373659.3	-	2	467	c.379C>G	c.(379-381)Ctg>Gtg	p.L127V		NM_006626.5	NP_006617.1	Q15916	ZBTB6_HUMAN	zinc finger and BTB domain containing 6	127					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L127V(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	11						TCAATTTCCAGATACTTTGAC	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											74.0	74.0	74.0					9																	125673973		2203	4300	6503	-	-	-	SO:0001583	missense	0			X82018	CCDS6846.1	9q33.1-q33.3	2013-01-08	2006-04-10	2006-04-10	ENSG00000186130	ENSG00000186130		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16764	protein-coding gene	gene with protein product		605976	"""zinc finger protein 482"""	ZNF482		7958847	Standard	NM_006626		Approved	ZID	uc004bnh.4	Q15916	OTTHUMG00000020628	ENST00000373659.3:c.379C>G	9.37:g.125673973G>C	ENSP00000362763:p.Leu127Val		A8K8N6	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L127V	ENST00000373659.3	37	c.379	CCDS6846.1	9	.	.	.	.	.	.	.	.	.	.	G	11.43	1.636357	0.29068	.	.	ENSG00000186130	ENST00000373659	T	0.13307	2.6	5.96	0.382	0.16234	BTB/POZ-like (1);BTB/POZ fold (1);	0.247453	0.34002	N	0.004352	T	0.13798	0.0334	L	0.47190	1.495	0.31038	N	0.716701	P	0.44380	0.834	P	0.45406	0.479	T	0.14783	-1.0460	10	0.23302	T	0.38	.	10.9161	0.47137	0.5087:0.0:0.4913:0.0	.	127	Q15916	ZBTB6_HUMAN	V	127	ENSP00000362763:L127V	ENSP00000362763:L127V	L	-	1	2	ZBTB6	124713794	0.775000	0.28604	0.990000	0.47175	0.990000	0.78478	0.005000	0.13129	0.128000	0.18479	0.655000	0.94253	CTG	ZBTB6	-	superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000186130		0.363	ZBTB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB6	HGNC	protein_coding	OTTHUMT00000053962.1	525	0.00	0	G	NM_006626		125673973	125673973	-1	no_errors	ENST00000373659	ensembl	human	known	69_37n	missense	170	31.73	79	SNP	0.608	C
ZBTB6	10773	genome.wustl.edu	37	9	125674188	125674188	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr9:125674188G>C	ENST00000373659.3	-	2	252	c.164C>G	c.(163-165)tCc>tGc	p.S55C		NM_006626.5	NP_006617.1	Q15916	ZBTB6_HUMAN	zinc finger and BTB domain containing 6	55	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S55C(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	11						CATAAAAGTGGAGCAAGCAGC	0.373																																						dbGAP											1	Substitution - Missense(1)	breast(1)											113.0	119.0	117.0					9																	125674188		2203	4300	6503	-	-	-	SO:0001583	missense	0			X82018	CCDS6846.1	9q33.1-q33.3	2013-01-08	2006-04-10	2006-04-10	ENSG00000186130	ENSG00000186130		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16764	protein-coding gene	gene with protein product		605976	"""zinc finger protein 482"""	ZNF482		7958847	Standard	NM_006626		Approved	ZID	uc004bnh.4	Q15916	OTTHUMG00000020628	ENST00000373659.3:c.164C>G	9.37:g.125674188G>C	ENSP00000362763:p.Ser55Cys		A8K8N6	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S55C	ENST00000373659.3	37	c.164	CCDS6846.1	9	.	.	.	.	.	.	.	.	.	.	G	20.6	4.011026	0.75046	.	.	ENSG00000186130	ENST00000373659	D	0.85861	-2.04	6.17	6.17	0.99709	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.94036	0.8089	M	0.89353	3.025	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94044	0.7312	10	0.87932	D	0	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	55	Q15916	ZBTB6_HUMAN	C	55	ENSP00000362763:S55C	ENSP00000362763:S55C	S	-	2	0	ZBTB6	124714009	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	TCC	ZBTB6	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000186130		0.373	ZBTB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB6	HGNC	protein_coding	OTTHUMT00000053962.1	597	0.00	0	G	NM_006626		125674188	125674188	-1	no_errors	ENST00000373659	ensembl	human	known	69_37n	missense	191	26.54	69	SNP	1.000	C
ZBTB14	7541	genome.wustl.edu	37	18	5291339	5291339	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr18:5291339C>T	ENST00000357006.4	-	4	1206	c.868G>A	c.(868-870)Ggc>Agc	p.G290S	ZBTB14_ENST00000400143.3_Missense_Mutation_p.G290S	NM_001143823.2|NM_001243704.1	NP_001137295.1|NP_001230633.1	O43829	ZBT14_HUMAN	zinc finger and BTB domain containing 14	290					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G290S(1)									CTCAATCTGCCTTCATCAGAA	0.498																																						dbGAP											1	Substitution - Missense(1)	breast(1)											93.0	83.0	87.0					18																	5291339		2203	4300	6503	-	-	-	SO:0001583	missense	0			D89859	CCDS11837.1	18p11.31	2013-09-19	2013-01-08	2013-01-08	ENSG00000198081	ENSG00000198081		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12860	protein-coding gene	gene with protein product		602126	"""zinc finger protein 161 homolog (mouse)"", ""zinc finger protein 161"", ""ZFP161 zinc finger protein"""	ZFP161		9244432	Standard	NM_001243702		Approved	ZNF478	uc010dkp.3	O43829	OTTHUMG00000131563	ENST00000357006.4:c.868G>A	18.37:g.5291339C>T	ENSP00000349503:p.Gly290Ser		O00403|Q2TB80	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.G290S	ENST00000357006.4	37	c.868	CCDS11837.1	18	.	.	.	.	.	.	.	.	.	.	C	10.45	1.352903	0.24512	.	.	ENSG00000198081	ENST00000357006;ENST00000400143	T;T	0.25250	1.81;1.81	5.8	5.8	0.92144	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.414865	0.26824	N	0.022317	T	0.12518	0.0304	N	0.03608	-0.345	0.37397	D	0.912706	B	0.06786	0.001	B	0.04013	0.001	T	0.14420	-1.0473	10	0.02654	T	1	-20.6441	20.053	0.97634	0.0:1.0:0.0:0.0	.	290	O43829	ZF161_HUMAN	S	290	ENSP00000349503:G290S;ENSP00000383009:G290S	ENSP00000349503:G290S	G	-	1	0	ZFP161	5281339	1.000000	0.71417	0.984000	0.44739	0.989000	0.77384	4.685000	0.61693	2.733000	0.93635	0.650000	0.86243	GGC	ZFP161	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198081		0.498	ZBTB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP161	HGNC	protein_coding	OTTHUMT00000254425.1	194	0.00	0	C	NM_003409		5291339	5291339	-1	no_errors	ENST00000357006	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	1.000	T
ZIM3	114026	genome.wustl.edu	37	19	57647337	57647337	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr19:57647337G>C	ENST00000269834.1	-	5	753	c.368C>G	c.(367-369)tCt>tGt	p.S123C	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	123					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S123C(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TATTTTCTTAGATCCGTCACA	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											220.0	213.0	215.0					19																	57647337		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.368C>G	19.37:g.57647337G>C	ENSP00000269834:p.Ser123Cys		Q14CA6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S123C	ENST00000269834.1	37	c.368	CCDS33125.1	19	.	.	.	.	.	.	.	.	.	.	G	8.957	0.969564	0.18659	.	.	ENSG00000141946	ENST00000269834	T	0.04809	3.55	1.41	-0.888	0.10583	.	.	.	.	.	T	0.04318	0.0119	N	0.14661	0.345	0.09310	N	1	D	0.61697	0.99	P	0.61592	0.891	T	0.13872	-1.0493	9	0.02654	T	1	.	2.3831	0.04359	0.325:0.0:0.4153:0.2597	.	123	Q96PE6	ZIM3_HUMAN	C	123	ENSP00000269834:S123C	ENSP00000269834:S123C	S	-	2	0	ZIM3	62339149	0.000000	0.05858	0.005000	0.12908	0.110000	0.19582	-2.057000	0.01395	-0.351000	0.08249	0.313000	0.20887	TCT	ZIM3	-	NULL	ENSG00000141946		0.393	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIM3	HGNC	protein_coding	OTTHUMT00000465078.1	725	0.00	0	G			57647337	57647337	-1	no_errors	ENST00000269834	ensembl	human	known	69_37n	missense	375	22.38	109	SNP	0.000	C
ZNF33B	7582	genome.wustl.edu	37	10	43127865	43127865	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr10:43127865G>A	ENST00000359467.3	-	3	146	c.32C>T	c.(31-33)tCa>tTa	p.S11L	ZNF33B_ENST00000486187.1_RNA	NM_006955.1	NP_008886.1	Q06732	ZN33B_HUMAN	zinc finger protein 33B	11					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S11L(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(15)|skin(1)|stomach(1)	29						AAATGATACTGACCCCTGGAA	0.438																																					Melanoma(137;1247 1767 16772 25727 43810)	dbGAP											1	Substitution - Missense(1)	breast(1)											78.0	78.0	78.0					10																	43127865		2203	4300	6503	-	-	-	SO:0001583	missense	0			X68688, AJ491697	CCDS7198.1	10q11.2	2013-01-08	2005-03-18		ENSG00000196693	ENSG00000196693		"""Zinc fingers, C2H2-type"", ""-"""	13097	protein-coding gene	gene with protein product		194522	"""zinc finger protein 33b (KOX 31)"", ""zinc finger protein 11B"""	ZNF11B		2014798	Standard	NM_006955		Approved	KOX31, KOX2	uc001jaf.1	Q06732	OTTHUMG00000018014	ENST00000359467.3:c.32C>T	10.37:g.43127865G>A	ENSP00000352444:p.Ser11Leu		Q06731|Q32MA2|Q86XY8|Q8NDW3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S11L	ENST00000359467.3	37	c.32	CCDS7198.1	10	.	.	.	.	.	.	.	.	.	.	G	7.664	0.685632	0.14973	.	.	ENSG00000196693	ENST00000359467;ENST00000395836	T	0.00737	5.76	1.44	0.495	0.16890	Krueppel-associated box (1);	.	.	.	.	T	0.00384	0.0012	N	0.03029	-0.43	0.22127	N	0.999343	B;B	0.34103	0.437;0.295	B;B	0.32090	0.14;0.1	T	0.43294	-0.9400	8	.	.	.	.	3.8272	0.08859	0.2457:0.0:0.7543:0.0	.	11;11	Q3B799;Q06732	.;ZN33B_HUMAN	L	11	ENSP00000352444:S11L	.	S	-	2	0	ZNF33B	42447871	0.060000	0.20803	0.840000	0.33206	0.677000	0.39632	0.715000	0.25822	0.177000	0.19895	0.423000	0.28283	TCA	ZNF33B	-	superfamily_Krueppel-associated_box	ENSG00000196693		0.438	ZNF33B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF33B	HGNC	protein_coding		228	0.00	0	G	NM_006955		43127865	43127865	-1	no_errors	ENST00000359467	ensembl	human	known	69_37n	missense	93	33.09	46	SNP	0.902	A
ZNF737	100129842	genome.wustl.edu	37	19	20728199	20728199	+	Silent	SNP	A	A	C	rs527980349	byFrequency	TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr19:20728199A>C	ENST00000427401.4	-	4	904	c.810T>G	c.(808-810)tcT>tcG	p.S270S		NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	270					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S269S(1)		breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						TAGTAAGGTTAGAGGAGCGCT	0.418																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											41.0	40.0	40.0					19																	20728199		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.810T>G	19.37:g.20728199A>C			C9JHM3	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S270	ENST00000427401.4	37	c.810	CCDS54238.1	19																																																																																			ZNF737	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000237440		0.418	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF737	HGNC	protein_coding	OTTHUMT00000447844.2	345	0.00	0	A	NM_145289		20728199	20728199	-1	no_errors	ENST00000427401	ensembl	human	known	69_37n	silent	148	30.70	66	SNP	0.000	C
ZNF45	7596	genome.wustl.edu	37	19	44417544	44417544	+	Nonsense_Mutation	SNP	G	G	A	rs192974000	byFrequency	TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr19:44417544G>A	ENST00000269973.5	-	10	3134	c.2044C>T	c.(2044-2046)Cga>Tga	p.R682*	ZNF45_ENST00000589703.1_Nonsense_Mutation_p.R682*|RP11-15A1.2_ENST00000586247.1_RNA	NM_003425.3	NP_003416.1	Q02386	ZNF45_HUMAN	zinc finger protein 45	682					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R682*(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	17						ATATTTTATCGAGTTTTCCTG	0.378													G|||	2	0.000399361	0.0	0.0	5008	,	,		21901	0.002		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Nonsense(1)	breast(1)											54.0	54.0	54.0					19																	44417544		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M67509	CCDS12632.1	19q13.2	2013-01-08	2005-01-11			ENSG00000124459		"""Zinc fingers, C2H2-type"", ""-"""	13111	protein-coding gene	gene with protein product		194554	"""zinc finger protein 45 (a Kruppel-associated box (KRAB) domain polypeptide)"", ""zinc finger protein 13"""	ZNF13		9067431	Standard	NM_003425		Approved		uc002oxw.2	Q02386		ENST00000269973.5:c.2044C>T	19.37:g.44417544G>A	ENSP00000269973:p.Arg682*		P17016|P78472|Q9P1U9	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R682*	ENST00000269973.5	37	c.2044	CCDS12632.1	19	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	46	12.736259	0.99692	.	.	ENSG00000124459	ENST00000269973	.	.	.	3.65	1.43	0.22495	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.4189	0.21732	0.1025:0.0:0.7172:0.1803	.	.	.	.	X	682	.	ENSP00000269973:R682X	R	-	1	2	ZNF45	49109384	0.000000	0.05858	0.000000	0.03702	0.415000	0.31203	-0.267000	0.08619	0.511000	0.28236	-0.234000	0.12200	CGA	ZNF45	-	NULL	ENSG00000124459		0.378	ZNF45-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF45	HGNC	protein_coding	OTTHUMT00000459919.1	502	0.00	0	G	NM_003425		44417544	44417544	-1	no_errors	ENST00000269973	ensembl	human	known	69_37n	nonsense	274	11.90	37	SNP	0.001	A
ZNF350	59348	genome.wustl.edu	37	19	52468721	52468721	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr19:52468721G>A	ENST00000243644.4	-	5	1212	c.985C>T	c.(985-987)Cag>Tag	p.Q329*	HCCAT3_ENST00000595010.1_RNA|HCCAT3_ENST00000600253.1_RNA|ZNF350_ENST00000600703.1_5'Flank	NM_021632.3	NP_067645.3	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	329					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q329*(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		CACGTCTTCTGAATGAAGCCT	0.413																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											102.0	93.0	96.0					19																	52468721		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF295096	CCDS12845.1	19q13.41	2013-05-23			ENSG00000256683	ENSG00000256683		"""Zinc fingers, C2H2-type"", ""-"""	16656	protein-coding gene	gene with protein product		605422				11090615, 11161714	Standard	NM_021632		Approved	ZBRK1, ZFQR	uc002pyd.3	Q9GZX5	OTTHUMG00000182538	ENST00000243644.4:c.985C>T	19.37:g.52468721G>A	ENSP00000243644:p.Gln329*		Q96G73|Q9HAQ4	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q329*	ENST00000243644.4	37	c.985	CCDS12845.1	19	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308232	0.60305	.	.	ENSG00000256683	ENST00000243644	.	.	.	3.28	-0.761	0.11038	.	0.000000	0.34828	N	0.003658	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	2.4562	0.04530	0.1017:0.1568:0.4254:0.3161	.	.	.	.	X	329	.	ENSP00000243644:Q329X	Q	-	1	0	ZNF350	57160533	0.000000	0.05858	0.088000	0.20740	0.322000	0.28314	-0.161000	0.10026	0.105000	0.17753	0.491000	0.48974	CAG	ZNF350	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000256683		0.413	ZNF350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF350	HGNC	protein_coding	OTTHUMT00000462278.1	468	0.00	0	G	NM_021632		52468721	52468721	-1	no_errors	ENST00000243644	ensembl	human	known	69_37n	nonsense	144	26.53	52	SNP	0.000	A
ZNF772	400720	genome.wustl.edu	37	19	57985633	57985633	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr19:57985633G>T	ENST00000343280.4	-	5	739	c.479C>A	c.(478-480)gCt>gAt	p.A160D	ZNF772_ENST00000356584.3_Missense_Mutation_p.A119D|AC004076.9_ENST00000596831.1_Intron|ZNF772_ENST00000427512.2_Missense_Mutation_p.A48D|ZNF772_ENST00000425074.3_3'UTR|AC004076.9_ENST00000415705.3_Intron|ZNF772_ENST00000600175.1_Intron|ZNF772_ENST00000601768.1_Intron	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	160					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A160D(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		CTGGTGCTCAGCCAAGTGCAA	0.512																																					Melanoma(5;289 436 14293 15924 30817)	dbGAP											1	Substitution - Missense(1)	breast(1)											117.0	108.0	111.0					19																	57985633		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.479C>A	19.37:g.57985633G>T	ENSP00000341165:p.Ala160Asp		A6NJK9|B4DH56|B4DYS0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A160D	ENST00000343280.4	37	c.479	CCDS33133.1	19	.	.	.	.	.	.	.	.	.	.	G	14.92	2.678872	0.47886	.	.	ENSG00000197128	ENST00000343280;ENST00000427512;ENST00000319969;ENST00000356584	T;T;T	0.07444	3.19;3.19;3.19	3.99	2.91	0.33838	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08492	0.0211	N	0.21583	0.68	0.09310	N	0.999999	B;B;P	0.40970	0.386;0.267;0.734	B;B;P	0.44860	0.165;0.079;0.462	T	0.30149	-0.9988	9	0.38643	T	0.18	.	10.4861	0.44722	0.0:0.0:0.8045:0.1954	.	48;119;160	Q68DY9-2;A6NJK9;Q68DY9	.;.;ZN772_HUMAN	D	160;48;106;119	ENSP00000341165:A160D;ENSP00000395967:A48D;ENSP00000348992:A119D	ENSP00000321015:A106D	A	-	2	0	ZNF772	62677445	0.000000	0.05858	0.903000	0.35520	0.976000	0.68499	-0.778000	0.04664	0.863000	0.35553	0.491000	0.48974	GCT	ZNF772	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197128		0.512	ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF772	HGNC	protein_coding	OTTHUMT00000397447.1	279	0.00	0	G	NM_001024596		57985633	57985633	-1	no_errors	ENST00000343280	ensembl	human	known	69_37n	missense	72	31.43	33	SNP	0.001	T
ZP4	57829	genome.wustl.edu	37	1	238046042	238046042	+	Splice_Site	SNP	G	G	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr1:238046042G>A	ENST00000366570.4	-	11	1653	c.1495C>T	c.(1495-1497)Cgt>Tgt	p.R499C	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	499					acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)	p.R499C(1)		breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GGATACTTACGGAGCTTTTCT	0.403																																					NSCLC(166;160 2029 11600 18754 19936)	dbGAP											1	Substitution - Missense(1)	breast(1)											109.0	108.0	109.0					1																	238046042		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1495+1C>T	1.37:g.238046042G>A			B2RAE1	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_P_trefoil,superfamily_P_trefoil,smart_P_trefoil,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.R499C	ENST00000366570.4	37	c.1495	CCDS1615.1	1	.	.	.	.	.	.	.	.	.	.	G	17.03	3.284832	0.59867	.	.	ENSG00000116996	ENST00000366570	T	0.75154	-0.91	3.67	1.69	0.24217	.	1.195430	0.06357	N	0.710939	T	0.67543	0.2904	L	0.34521	1.04	0.09310	N	1	D	0.60160	0.987	P	0.46144	0.505	T	0.56300	-0.8002	9	.	.	.	-0.5794	8.4095	0.32636	0.0:0.0:0.5803:0.4197	.	499	Q12836	ZP4_HUMAN	C	499	ENSP00000355529:R499C	.	R	-	1	0	ZP4	236112665	0.000000	0.05858	0.000000	0.03702	0.743000	0.42351	-0.060000	0.11712	0.489000	0.27749	0.655000	0.94253	CGT	ZP4	-	NULL	ENSG00000116996		0.403	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZP4	HGNC	protein_coding	OTTHUMT00000095476.1	144	0.00	0	G		Missense_Mutation	238046042	238046042	-1	no_errors	ENST00000366570	ensembl	human	known	69_37n	missense	45	37.50	27	SNP	0.000	A
ZRANB3	84083	genome.wustl.edu	37	2	135988439	135988439	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr2:135988439C>A	ENST00000264159.6	-	13	1714	c.1598G>T	c.(1597-1599)aGa>aTa	p.R533I	ZRANB3_ENST00000401392.1_Missense_Mutation_p.R533I|ZRANB3_ENST00000536680.1_Missense_Mutation_p.R533I|ZRANB3_ENST00000412849.1_5'UTR	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	533					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)	p.R533I(1)		NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		CATCAACTGTCTTTTTTTAGG	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											75.0	70.0	72.0					2																	135988439		1823	4084	5907	-	-	-	SO:0001583	missense	0			AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.1598G>T	2.37:g.135988439C>A	ENSP00000264159:p.Arg533Ile		B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HNH,pfam_Znf_RanBP2,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Znf_RanBP2,smart_HNH_nuc,pfscan_Znf_RanBP2,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R533I	ENST00000264159.6	37	c.1598	CCDS46419.1	2	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461972	0.63513	.	.	ENSG00000121988	ENST00000401392;ENST00000264159;ENST00000536680	D;D;D	0.91068	-2.78;-2.78;-2.76	5.79	0.904	0.19302	.	0.472401	0.25076	N	0.033336	D	0.86548	0.5959	L	0.51422	1.61	0.09310	N	1	P;P	0.48089	0.846;0.905	B;P	0.46362	0.316;0.514	T	0.79037	-0.1967	10	0.87932	D	0	-0.8287	4.5178	0.11945	0.0:0.448:0.1605:0.3915	.	533;533	Q5FWF4;Q5FWF4-3	ZRAB3_HUMAN;.	I	533	ENSP00000383979:R533I;ENSP00000264159:R533I;ENSP00000441320:R533I	ENSP00000264159:R533I	R	-	2	0	ZRANB3	135704909	0.996000	0.38824	0.056000	0.19401	0.972000	0.66771	0.991000	0.29654	0.373000	0.24621	0.563000	0.77884	AGA	ZRANB3	-	NULL	ENSG00000121988		0.368	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB3	HGNC	protein_coding	OTTHUMT00000318254.1	321	0.00	0	C	NM_032143		135988439	135988439	-1	no_errors	ENST00000264159	ensembl	human	known	69_37n	missense	136	30.96	61	SNP	0.014	A
ZWINT	11130	genome.wustl.edu	37	10	58119265	58119265	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A094-01A-11W-A019-09	TCGA-A8-A094-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ab9bf7a6-688e-4388-9682-6b1616723fde	81550760-c58d-4ae7-90eb-9a436d664442	g.chr10:58119265G>T	ENST00000373944.3	-	5	490	c.452C>A	c.(451-453)gCa>gAa	p.A151E	ZWINT_ENST00000460654.1_5'UTR|ZWINT_ENST00000361148.6_Missense_Mutation_p.A151E|ZWINT_ENST00000318387.2_Missense_Mutation_p.A31E|ZWINT_ENST00000395405.1_Missense_Mutation_p.A151E			O95229	ZWINT_HUMAN	ZW10 interacting kinetochore protein	151	Interaction with NDC80 and ZW10.				establishment of localization in cell (GO:0051649)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|kinetochore (GO:0000776)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)	p.A151E(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)	20						GTTCTGGACTGCTCTGCGTTT	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											140.0	117.0	125.0					10																	58119265		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF067656	CCDS7249.1, CCDS31205.1	10q21-q22	2013-05-01	2013-05-01		ENSG00000122952	ENSG00000122952			13195	protein-coding gene	gene with protein product		609177	"""ZW10 interactor"""				Standard	XM_005269463		Approved	KNTC2AP	uc001jka.1	O95229	OTTHUMG00000018261	ENST00000373944.3:c.452C>A	10.37:g.58119265G>T	ENSP00000363055:p.Ala151Glu		A6NNV6|Q0D2I3|Q9BWD0	Missense_Mutation	SNP	NULL	p.A151E	ENST00000373944.3	37	c.452	CCDS7249.1	10	.	.	.	.	.	.	.	.	.	.	G	13.98	2.400355	0.42613	.	.	ENSG00000122952	ENST00000373944;ENST00000395405;ENST00000318387;ENST00000361148	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	4.31	-1.35	0.09114	.	1.726220	0.03331	N	0.193367	T	0.33614	0.0869	L	0.29908	0.895	0.09310	N	1	B;B	0.11235	0.004;0.004	B;B	0.09377	0.004;0.004	T	0.23190	-1.0195	10	0.54805	T	0.06	3.2149	3.0411	0.06139	0.305:0.0:0.3582:0.3369	.	151;151	A6NNV6;O95229	.;ZWINT_HUMAN	E	151;151;31;151	ENSP00000363055:A151E;ENSP00000378801:A151E;ENSP00000322850:A31E;ENSP00000354921:A151E	ENSP00000322850:A31E	A	-	2	0	ZWINT	57789271	0.002000	0.14202	0.023000	0.16930	0.524000	0.34500	-0.311000	0.08124	-0.204000	0.10235	0.650000	0.86243	GCA	ZWINT	-	NULL	ENSG00000122952		0.488	ZWINT-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZWINT	HGNC	protein_coding	OTTHUMT00000048132.1	236	0.00	0	G			58119265	58119265	-1	no_errors	ENST00000373944	ensembl	human	known	69_37n	missense	83	17.00	17	SNP	0.024	T
