#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTA1	58	genome.wustl.edu	37	1	229568794	229568794	+	Silent	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:229568794G>A	ENST00000366684.3	-	2	171	c.69C>T	c.(67-69)ttC>ttT	p.F23F	ACTA1_ENST00000366683.2_Silent_p.F23F	NM_001100.3	NP_001091.1	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	23					cell growth (GO:0016049)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to extracellular stimulus (GO:0009991)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to steroid hormone (GO:0048545)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle thin filament assembly (GO:0030240)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|striated muscle thin filament (GO:0005865)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|myosin binding (GO:0017022)|structural constituent of cytoskeleton (GO:0005200)	p.F23F(1)		endometrium(4)|large_intestine(4)|lung(18)|prostate(1)|urinary_tract(1)	28	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)				CATCCCCGGCGAAGCCGGCTT	0.682																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											46.0	49.0	48.0					1																	229568794		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J00068	CCDS1578.1	1q42.13	2014-09-17			ENSG00000143632	ENSG00000143632			129	protein-coding gene	gene with protein product	"""nemaline myopathy type 3"""	102610		ACTA		10072583, 6865942	Standard	NM_001100		Approved	NEM3	uc001htm.3	P68133	OTTHUMG00000038006	ENST00000366684.3:c.69C>T	1.37:g.229568794G>A			P02568|P99020|Q5T8M9	Silent	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.F23	ENST00000366684.3	37	c.69	CCDS1578.1	1																																																																																			ACTA1	-	pfam_Actin-like,smart_Actin-like	ENSG00000143632		0.682	ACTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA1	HGNC	protein_coding	OTTHUMT00000092781.1	15	0.00	0	G	NM_001100		229568794	229568794	-1	no_errors	ENST00000366684	ensembl	human	known	69_37n	silent	16	60.00	24	SNP	0.952	A
AKAP17A	8227	genome.wustl.edu	37	X	1712627	1712627	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chrX:1712627C>G	ENST00000313871.3	+	2	468	c.272C>G	c.(271-273)tCt>tGt	p.S91C	AKAP17A_ENST00000381261.3_Missense_Mutation_p.S91C	NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	91	PKA-RI and PKA-RII subunit binding domain.				B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						CTGGTCAAGTCTTTTCTGGCC	0.587																																						dbGAP											0													190.0	193.0	192.0					X																	1712627		2203	4296	6499	-	-	-	SO:0001583	missense	0			L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.272C>G	X.37:g.1712627C>G	ENSP00000324827:p.Ser91Cys		Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Missense_Mutation	SNP	NULL	p.S91C	ENST00000313871.3	37	c.272	CCDS14116.1	X	.	.	.	.	.	.	.	.	.	.	c	8.609	0.888631	0.17540	.	.	ENSG00000197976	ENST00000313871;ENST00000381261	T;T	0.30981	1.51;1.51	2.17	2.17	0.27698	.	0.384998	0.24810	U	0.035418	T	0.41305	0.1153	.	.	.	0.09310	N	0.999996	D;D	0.61697	0.976;0.99	P;P	0.54460	0.722;0.753	T	0.28235	-1.0050	9	0.54805	T	0.06	-10.2415	12.7152	0.57111	0.0:1.0:0.0:0.0	.	91;91	Q02040-3;Q02040	.;AK17A_HUMAN	C	91	ENSP00000324827:S91C;ENSP00000370660:S91C	ENSP00000324827:S91C	S	+	2	0	AKAP17A	1672627	0.998000	0.40836	0.001000	0.08648	0.335000	0.28730	1.759000	0.38420	0.877000	0.35895	0.100000	0.15512	TCT	AKAP17A	-	NULL	ENSG00000197976		0.587	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP17A	HGNC	protein_coding	OTTHUMT00000055609.2	33	0.00	0	C	NM_005088		1712627	1712627	+1	no_errors	ENST00000313871	ensembl	human	known	69_37n	missense	12	42.86	9	SNP	0.747	G
ANKRD19P	138649	genome.wustl.edu	37	9	95600000	95600000	+	RNA	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr9:95600000G>C	ENST00000473204.1	+	0	2081							Q9H560	ANR19_HUMAN	ankyrin repeat domain 19, pseudogene							extracellular vesicular exosome (GO:0070062)											GGAATCGGCGGACGCGGGACA	0.418																																						dbGAP											0																																										-	-	-			0			BC038951		9q22.32	2011-04-27	2011-04-27	2011-04-27	ENSG00000187984	ENSG00000187984			22567	pseudogene	pseudogene			"""ankyrin repeat domain 19"", ""ankyrin repeat domain 19 pseudogene"""	ANKRD19			Standard	NR_026868		Approved	FLJ36178	uc011lua.1	Q9H560	OTTHUMG00000020237		9.37:g.95600000G>C			A8K853|Q17RD3	RNA	SNP	-	NULL	ENST00000473204.1	37	NULL		9																																																																																			ANKRD19P	-	-	ENSG00000187984		0.418	ANKRD19P-004	KNOWN	basic	processed_transcript	ANKRD19P	HGNC	pseudogene	OTTHUMT00000053116.3	27	0.00	0	G	NR_026868		95600000	95600000	+1	no_errors	ENST00000464387	ensembl	human	known	69_37n	rna	19	20.83	5	SNP	0.019	C
ANKRD31	256006	genome.wustl.edu	37	5	74489201	74489201	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr5:74489201C>A	ENST00000274361.3	-	8	1424	c.1233G>T	c.(1231-1233)aaG>aaT	p.K411N	ANKRD31_ENST00000506364.2_Missense_Mutation_p.K411N	NM_001164443.1	NP_001157915.1	Q8N7Z5	ANR31_HUMAN	ankyrin repeat domain 31	411										endometrium(1)|kidney(4)	5						TTGGTAAAATCTTTTCTGGCA	0.373																																						dbGAP											0													176.0	143.0	153.0					5																	74489201		692	1591	2283	-	-	-	SO:0001583	missense	0			AK097510	CCDS47233.1	5q13.3	2013-01-10			ENSG00000145700	ENSG00000145700		"""Ankyrin repeat domain containing"""	26853	protein-coding gene	gene with protein product							Standard	NM_001164443		Approved	FLJ40191	uc003kdo.2	Q8N7Z5	OTTHUMG00000162649	ENST00000274361.3:c.1233G>T	5.37:g.74489201C>A	ENSP00000274361:p.Lys411Asn			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.K411N	ENST00000274361.3	37	c.1233		5	.	.	.	.	.	.	.	.	.	.	C	12.60	1.987075	0.35036	.	.	ENSG00000145700	ENST00000274361;ENST00000506364	T;T	0.63096	-0.02;0.41	5.74	1.65	0.23941	.	1.059460	0.07431	N	0.895634	T	0.43389	0.1245	N	0.19112	0.55	0.09310	N	1	B	0.17465	0.022	B	0.15052	0.012	T	0.24941	-1.0146	10	0.25106	T	0.35	.	5.0991	0.14749	0.0:0.4833:0.3222:0.1944	.	411	Q8N7Z5	ANR31_HUMAN	N	411	ENSP00000274361:K411N;ENSP00000427262:K411N	ENSP00000274361:K411N	K	-	3	2	ANKRD31	74524957	0.002000	0.14202	0.010000	0.14722	0.887000	0.51463	-0.038000	0.12144	0.001000	0.14605	0.650000	0.86243	AAG	ANKRD31	-	NULL	ENSG00000145700		0.373	ANKRD31-201	KNOWN	basic|appris_principal	protein_coding	ANKRD31	HGNC	protein_coding		84	0.00	0	C	NM_001164443		74489201	74489201	-1	no_errors	ENST00000274361	ensembl	human	known	69_37n	missense	40	20.00	10	SNP	0.025	A
APOBR	55911	genome.wustl.edu	37	16	28507452	28507452	+	Missense_Mutation	SNP	G	G	T	rs370148393		TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr16:28507452G>T	ENST00000431282.1	+	3	1073	c.1063G>T	c.(1063-1065)Ggg>Tgg	p.G355W	CLN3_ENST00000567160.1_5'Flank|APOBR_ENST00000328423.5_Missense_Mutation_p.G355W|CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000564831.1_Missense_Mutation_p.G364W			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	355	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						GGAGGAGGCCGGGACAGCCTC	0.672																																						dbGAP											0													14.0	17.0	16.0					16																	28507452		1944	4097	6041	-	-	-	SO:0001583	missense	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1063G>T	16.37:g.28507452G>T	ENSP00000416094:p.Gly355Trp		H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	NULL	p.G364W	ENST00000431282.1	37	c.1090		16	.	.	.	.	.	.	.	.	.	.	G	11.71	1.718826	0.30503	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.60548	0.18;0.18	3.86	-2.49	0.06403	.	.	.	.	.	T	0.33059	0.0850	N	0.19112	0.55	0.09310	N	1	B	0.33777	0.425	B	0.27715	0.082	T	0.13980	-1.0489	9	0.72032	D	0.01	.	3.7884	0.08710	0.5999:0.0:0.2159:0.1841	.	355	Q9NS13	.	W	355	ENSP00000327669:G355W;ENSP00000416094:G355W	ENSP00000327669:G355W	G	+	1	0	APOBR	28414953	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.825000	0.04433	-0.783000	0.04534	-0.487000	0.04747	GGG	APOBR	-	NULL	ENSG00000184730		0.672	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	HGNC	protein_coding		20	0.00	0	G	NM_182804		28507452	28507452	+1	no_errors	ENST00000564831	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	0.000	T
ARHGAP29	9411	genome.wustl.edu	37	1	94652094	94652094	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:94652094C>T	ENST00000260526.6	-	16	1923	c.1741G>A	c.(1741-1743)Gat>Aat	p.D581N	ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	581					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TCATCTAGATCATCTGCAGAG	0.413																																						dbGAP											0													200.0	194.0	196.0					1																	94652094		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.1741G>A	1.37:g.94652094C>T	ENSP00000260526:p.Asp581Asn		O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Rho_GTPase_activation_prot,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.D581N	ENST00000260526.6	37	c.1741	CCDS748.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.735478	0.96865	.	.	ENSG00000137962	ENST00000260526	T	0.28895	1.59	6.08	6.08	0.98989	.	0.000000	0.39909	N	0.001238	T	0.51210	0.1661	M	0.67700	2.07	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.986	T	0.44922	-0.9296	10	0.59425	D	0.04	-28.716	20.6634	0.99662	0.0:1.0:0.0:0.0	.	581;581	F8VWZ8;Q52LW3	.;RHG29_HUMAN	N	581	ENSP00000260526:D581N	ENSP00000260526:D581N	D	-	1	0	ARHGAP29	94424682	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.170000	0.77587	2.894000	0.99253	0.655000	0.94253	GAT	ARHGAP29	-	NULL	ENSG00000137962		0.413	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP29	HGNC	protein_coding	OTTHUMT00000029376.2	73	0.00	0	C	NM_004815		94652094	94652094	-1	no_errors	ENST00000260526	ensembl	human	known	69_37n	missense	48	20.00	12	SNP	1.000	T
EFCC1	79825	genome.wustl.edu	37	3	128755858	128755858	+	Silent	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr3:128755858G>C	ENST00000480450.1	+	6	1488	c.1488G>C	c.(1486-1488)ctG>ctC	p.L496L	EFCC1_ENST00000436022.2_Silent_p.L59L			Q9HA90	EFCC1_HUMAN	EF-hand and coiled-coil domain containing 1	496							calcium ion binding (GO:0005509)										ATGAGCACCTGAGGCTGGAGC	0.627																																						dbGAP											0													64.0	66.0	65.0					3																	128755858		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022119	CCDS3054.1, CCDS3054.2	3q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000114654	ENSG00000114654		"""EF-hand domain containing"""	25692	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 73"", ""coiled-coil domain containing 48"""	C3orf73, CCDC48			Standard	NM_024768		Approved	FLJ12057	uc011bkt.2	Q9HA90	OTTHUMG00000158996	ENST00000480450.1:c.1488G>C	3.37:g.128755858G>C			A8MYE2	Silent	SNP	NULL	p.L59	ENST00000480450.1	37	c.177	CCDS3054.2	3																																																																																			CCDC48	-	NULL	ENSG00000114654		0.627	EFCC1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CCDC48	HGNC	protein_coding	OTTHUMT00000352832.1	34	0.00	0	G	NM_024768		128755858	128755858	+1	no_errors	ENST00000436022	ensembl	human	known	69_37n	silent	13	27.78	5	SNP	1.000	C
CD9	928	genome.wustl.edu	37	12	6344725	6344725	+	Silent	SNP	C	C	G	rs80271009	byFrequency	TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr12:6344725C>G	ENST00000382518.1	+	7	967	c.531C>G	c.(529-531)acC>acG	p.T177T	CD9_ENST00000009180.4_Silent_p.T177T|CD9_ENST00000382515.2_Silent_p.T108T|CD9_ENST00000481267.1_3'UTR|Y_RNA_ENST00000365448.1_RNA			P21926	CD9_HUMAN	CD9 molecule	177					blood coagulation (GO:0007596)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|oligodendrocyte development (GO:0014003)|paranodal junction assembly (GO:0030913)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|response to water deprivation (GO:0009414)|single fertilization (GO:0007338)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|vesicle (GO:0031982)				endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	8						AAACCTTCACCGTGAAGGTAA	0.542																																						dbGAP											0													123.0	105.0	111.0					12																	6344725		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M38690	CCDS8540.1	12p13	2013-02-14	2006-03-28		ENSG00000010278	ENSG00000010278		"""CD molecules"", ""Tetraspanins"""	1709	protein-coding gene	gene with protein product	"""motility related protein-1"""	143030	"""CD9 antigen (p24)"""	MIC3		6198179	Standard	NM_001769		Approved	BA2, P24, TSPAN29, MRP-1	uc001qnq.2	P21926	OTTHUMG00000044400	ENST00000382518.1:c.531C>G	12.37:g.6344725C>G			D3DUQ9|Q5J7W6|Q96ES4	Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.T177	ENST00000382518.1	37	c.531	CCDS8540.1	12	.	.	.	.	.	.	.	.	.	.	C	4.495	0.091866	0.08632	.	.	ENSG00000010278	ENST00000425469	.	.	.	5.39	-10.8	0.00216	.	.	.	.	.	T	0.13670	0.0331	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10894	-1.0610	7	0.22109	T	0.4	.	3.0663	0.06215	0.1762:0.4518:0.2142:0.1578	.	227	B4DK09	.	G	177	.	ENSP00000388933:R177G	R	+	1	0	CD9	6214986	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.283000	0.00527	-1.414000	0.02025	-0.182000	0.12963	CGT	CD9	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000010278		0.542	CD9-004	NOVEL	basic|appris_principal|CCDS	protein_coding	CD9	HGNC	protein_coding	OTTHUMT00000103348.1	65	0.00	0	C			6344725	6344725	+1	no_errors	ENST00000009180	ensembl	human	known	69_37n	silent	24	35.14	13	SNP	0.000	G
CDH8	1006	genome.wustl.edu	37	16	62055264	62055264	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr16:62055264G>T	ENST00000577390.1	-	2	998	c.44C>A	c.(43-45)cCa>cAa	p.P15Q	CDH8_ENST00000584337.1_Missense_Mutation_p.P15Q|CDH8_ENST00000299345.6_Missense_Mutation_p.P15Q|CDH8_ENST00000577730.1_Missense_Mutation_p.P15Q	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	15					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		TATTATTAATGGAGTCCAGAG	0.413																																						dbGAP											0													67.0	69.0	68.0					16																	62055264		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.44C>A	16.37:g.62055264G>T	ENSP00000462701:p.Pro15Gln		B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P15Q	ENST00000577390.1	37	c.44	CCDS10802.1	16	.	.	.	.	.	.	.	.	.	.	G	22.3	4.269707	0.80469	.	.	ENSG00000150394	ENST00000299345	T	0.54675	0.56	6.17	5.22	0.72569	.	0.171574	0.52532	D	0.000061	T	0.48114	0.1482	L	0.51422	1.61	0.39963	D	0.97469	P	0.48911	0.917	B	0.41860	0.368	T	0.47837	-0.9086	10	0.21540	T	0.41	.	15.6271	0.76870	0.0653:0.0:0.9346:0.0	.	15	P55286	CADH8_HUMAN	Q	15	ENSP00000299345:P15Q	ENSP00000299345:P15Q	P	-	2	0	CDH8	60612765	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.148000	0.94652	1.632000	0.50472	-0.140000	0.14226	CCA	CDH8	-	NULL	ENSG00000150394		0.413	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH8	HGNC	protein_coding	OTTHUMT00000268754.3	40	0.00	0	G	NM_001796		62055264	62055264	-1	no_errors	ENST00000577390	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	T
CDK18	5129	genome.wustl.edu	37	1	205500482	205500482	+	Silent	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:205500482G>A	ENST00000360066.2	+	16	1702	c.1401G>A	c.(1399-1401)aaG>aaA	p.K467K	CDK18_ENST00000429964.2_Silent_p.K467K|CDK18_ENST00000509056.1_3'UTR|CDK18_ENST00000506784.1_Silent_p.K497K	NM_002596.3|NM_212502.2|NM_212503.2	NP_002587.2|NP_997667.1|NP_997668.1	Q07002	CDK18_HUMAN	cyclin-dependent kinase 18	465							ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|endometrium(2)|large_intestine(2)|lung(10)|stomach(2)|urinary_tract(1)	19						GACGAGGGAAGAACAGGCGGC	0.617																																					Pancreas(180;489 2072 28461 40831 44265)	dbGAP											0													86.0	73.0	78.0					1																	205500482		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X66362	CCDS1454.1, CCDS44300.1	1q31-q32	2011-11-08	2009-12-16	2009-12-16	ENSG00000117266	ENSG00000117266		"""Cyclin-dependent kinases"""	8751	protein-coding gene	gene with protein product		169190	"""PCTAIRE protein kinase 3"""	PCTK3		1437147, 19884882	Standard	NM_002596		Approved	PCTAIRE3	uc010pri.2	Q07002	OTTHUMG00000037203	ENST00000360066.2:c.1401G>A	1.37:g.205500482G>A			Q5VXQ2|Q6V3A2|Q6V3A3|Q96F90	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K497	ENST00000360066.2	37	c.1491	CCDS44300.1	1																																																																																			CDK18	-	NULL	ENSG00000117266		0.617	CDK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK18	HGNC	protein_coding	OTTHUMT00000090407.2	25	0.00	0	G	NM_002596		205500482	205500482	+1	no_errors	ENST00000506784	ensembl	human	known	69_37n	silent	36	10.00	4	SNP	1.000	A
CKAP5	9793	genome.wustl.edu	37	11	46772131	46772131	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr11:46772131C>T	ENST00000529230.1	-	41	5537	c.5491G>A	c.(5491-5493)Gat>Aat	p.D1831N	CKAP5_ENST00000312055.5_Missense_Mutation_p.D1771N|CKAP5_ENST00000354558.3_Missense_Mutation_p.D1771N|CKAP5_ENST00000415402.1_Missense_Mutation_p.D1838N|MIR5582_ENST00000579697.1_RNA			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	1831					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						GCTAAGAAATCATTCACTTTG	0.348																																					Ovarian(4;85 273 2202 4844 13323)	dbGAP											0													99.0	97.0	97.0					11																	46772131		2201	4299	6500	-	-	-	SO:0001583	missense	0				CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.5491G>A	11.37:g.46772131C>T	ENSP00000432768:p.Asp1831Asn		Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.D1838N	ENST00000529230.1	37	c.5512	CCDS31477.1	11	.	.	.	.	.	.	.	.	.	.	C	21.2	4.105931	0.77096	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558	T;T;T;T	0.48522	0.88;0.81;0.82;0.82	5.79	5.79	0.91817	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69187	0.3083	M	0.68952	2.095	0.80722	D	1	B;D;D	0.71674	0.277;0.998;0.997	B;D;D	0.81914	0.1;0.995;0.989	T	0.68224	-0.5465	10	0.54805	T	0.06	-7.5977	20.0993	0.97865	0.0:1.0:0.0:0.0	.	1838;1771;1831	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	N	1831;1838;1771;1771	ENSP00000432768:D1831N;ENSP00000395302:D1838N;ENSP00000310227:D1771N;ENSP00000346566:D1771N	ENSP00000310227:D1771N	D	-	1	0	CKAP5	46728707	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.520000	0.67080	2.758000	0.94735	0.549000	0.68633	GAT	CKAP5	-	superfamily_ARM-type_fold	ENSG00000175216		0.348	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP5	HGNC	protein_coding	OTTHUMT00000390679.1	129	0.00	0	C	NM_014756		46772131	46772131	-1	no_errors	ENST00000415402	ensembl	human	known	69_37n	missense	57	32.94	28	SNP	1.000	T
CLGN	1047	genome.wustl.edu	37	4	141321646	141321646	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr4:141321646C>T	ENST00000325617.5	-	7	999	c.559G>A	c.(559-561)Gaa>Aaa	p.E187K	CLGN_ENST00000414773.1_Missense_Mutation_p.E187K|CLGN_ENST00000537281.1_Missense_Mutation_p.E187K	NM_004362.2	NP_004353.1	O14967	CLGN_HUMAN	calmegin	187					binding of sperm to zona pellucida (GO:0007339)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(5)|ovary(2)|prostate(3)|skin(4)|urinary_tract(1)	25	all_hematologic(180;0.162)					TTATAATCTTCTCCACATTTA	0.338																																						dbGAP											0													87.0	91.0	90.0					4																	141321646		2203	4298	6501	-	-	-	SO:0001583	missense	0			D86322	CCDS3751.1	4q28.3-q31.1	2008-02-05			ENSG00000153132	ENSG00000153132			2060	protein-coding gene	gene with protein product		601858					Standard	NM_004362		Approved		uc003iii.3	O14967	OTTHUMG00000133414	ENST00000325617.5:c.559G>A	4.37:g.141321646C>T	ENSP00000326699:p.Glu187Lys		B3KS90|B4DXV8|D3DNY8	Missense_Mutation	SNP	pfam_Calret/calnex,superfamily_ConA-like_lec_gl,superfamily_Calreticulin/calnexin_P,prints_Calret/calnex	p.E187K	ENST00000325617.5	37	c.559	CCDS3751.1	4	.	.	.	.	.	.	.	.	.	.	C	32	5.126354	0.94429	.	.	ENSG00000153132	ENST00000325617;ENST00000414773;ENST00000537281;ENST00000545667	T;T;T	0.51817	0.69;0.69;0.69	5.36	5.36	0.76844	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.107759	0.64402	D	0.000001	T	0.57344	0.2047	L	0.48642	1.525	0.80722	D	1	D	0.52996	0.957	P	0.58873	0.847	T	0.44952	-0.9294	10	0.11485	T	0.65	-25.4922	19.4559	0.94889	0.0:1.0:0.0:0.0	.	187	O14967	CLGN_HUMAN	K	187;187;187;104	ENSP00000326699:E187K;ENSP00000392782:E187K;ENSP00000439381:E187K	ENSP00000326699:E187K	E	-	1	0	CLGN	141541096	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.776000	0.85560	2.669000	0.90835	0.591000	0.81541	GAA	CLGN	-	pfam_Calret/calnex,superfamily_ConA-like_lec_gl,prints_Calret/calnex	ENSG00000153132		0.338	CLGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLGN	HGNC	protein_coding	OTTHUMT00000257272.2	64	0.00	0	C	NM_004362		141321646	141321646	-1	no_errors	ENST00000325617	ensembl	human	known	69_37n	missense	36	30.77	16	SNP	1.000	T
CNDP1	84735	genome.wustl.edu	37	18	72234494	72234494	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr18:72234494C>G	ENST00000358821.3	+	6	810	c.582C>G	c.(580-582)atC>atG	p.I194M	CNDP1_ENST00000582365.1_Missense_Mutation_p.I151M|CNDP1_ENST00000585136.1_3'UTR	NM_032649.5	NP_116038	Q96KN2	CNDP1_HUMAN	carnosine dipeptidase 1 (metallopeptidase M20 family)	194						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		TCAAATTCATCATTGAGGGGA	0.433																																					Melanoma(32;1029 1042 25286 38395 44237)	dbGAP											0													94.0	104.0	101.0					18																	72234494		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12007.1	18q22.3	2014-07-14			ENSG00000150656	ENSG00000150656	3.4.13.20		20675	protein-coding gene	gene with protein product	"""carnosinase 1"", ""glutamate carboxypeptidase-like protein 2"""	609064				12473676	Standard	NM_032649		Approved	MGC10825, CN1, CPGL2, HsT2308	uc002llq.3	Q96KN2	OTTHUMG00000132852	ENST00000358821.3:c.582C>G	18.37:g.72234494C>G	ENSP00000351682:p.Ile194Met		Q14D40|Q17S05|Q2TBG0|Q6UWK2|Q9BT98	Missense_Mutation	SNP	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,pirsf_GSH_degradosome_DUG1	p.I194M	ENST00000358821.3	37	c.582	CCDS12007.1	18	.	.	.	.	.	.	.	.	.	.	C	14.68	2.606643	0.46527	.	.	ENSG00000150656	ENST00000358821	T	0.56103	0.48	5.31	2.49	0.30216	ArgE/DapE/ACY1/CPG2/YscS, conserved site (1);	0.599362	0.17957	N	0.156337	T	0.58793	0.2147	L	0.50919	1.6	0.09310	N	1	P	0.37864	0.61	P	0.55965	0.788	T	0.52472	-0.8571	10	0.59425	D	0.04	-8.5058	4.7377	0.12997	0.0:0.4168:0.2807:0.3025	.	194	Q96KN2	CNDP1_HUMAN	M	194	ENSP00000351682:I194M	ENSP00000351682:I194M	I	+	3	3	CNDP1	70385474	0.272000	0.24172	0.011000	0.14972	0.967000	0.64934	-0.185000	0.09684	0.210000	0.20664	0.585000	0.79938	ATC	CNDP1	-	pfam_Peptidase_M20,pirsf_GSH_degradosome_DUG1	ENSG00000150656		0.433	CNDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNDP1	HGNC	protein_coding	OTTHUMT00000256326.1	47	0.00	0	C	NM_032649		72234494	72234494	+1	no_errors	ENST00000358821	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	0.009	G
CSMD3	114788	genome.wustl.edu	37	8	113662562	113662562	+	Silent	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr8:113662562C>T	ENST00000297405.5	-	19	3265	c.3021G>A	c.(3019-3021)acG>acA	p.T1007T	CSMD3_ENST00000343508.3_Silent_p.T967T|CSMD3_ENST00000455883.2_Silent_p.T903T|CSMD3_ENST00000352409.3_Silent_p.T1007T	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1007						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AACAAGAATACGTGTTCACTG	0.398										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0													112.0	112.0	112.0					8																	113662562		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3021G>A	8.37:g.113662562C>T			Q96PZ3	Silent	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.T1007	ENST00000297405.5	37	c.3021	CCDS6315.1	8																																																																																			CSMD3	-	superfamily_Complement_control_module	ENSG00000164796		0.398	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	44	0.00	0	C	NM_052900		113662562	113662562	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	silent	26	35.00	14	SNP	0.249	T
CYFIP2	26999	genome.wustl.edu	37	5	156817670	156817670	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr5:156817670G>C	ENST00000521420.1	+	29	3601	c.3510G>C	c.(3508-3510)aaG>aaC	p.K1170N	CYFIP2_ENST00000435847.2_Missense_Mutation_p.K895N|CYFIP2_ENST00000377576.3_Missense_Mutation_p.K1196N|CYFIP2_ENST00000318218.6_Missense_Mutation_p.K1221N|CYFIP2_ENST00000541131.1_Missense_Mutation_p.K1121N|CYFIP2_ENST00000347377.6_Missense_Mutation_p.K1196N|CYFIP2_ENST00000522463.1_Missense_Mutation_p.K1000N|CYFIP2_ENST00000442283.2_3'UTR					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAATCATTAAGAATGTGGTGA	0.537																																						dbGAP											0													45.0	45.0	45.0					5																	156817670		2045	4199	6244	-	-	-	SO:0001583	missense	0			AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.3510G>C	5.37:g.156817670G>C	ENSP00000430904:p.Lys1170Asn			Missense_Mutation	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.K1221N	ENST00000521420.1	37	c.3663		5	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239759	0.58995	.	.	ENSG00000055163	ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T;T;T;T;T;T;T	0.26660	1.72;1.72;1.72;1.72;1.72;1.72;1.72	4.87	3.99	0.46301	.	0.000000	0.85682	D	0.000000	T	0.44095	0.1277	M	0.65320	2	0.80722	D	1	B;B;B;P;B;P	0.44521	0.138;0.256;0.238;0.837;0.081;0.807	B;B;B;P;B;D	0.65140	0.131;0.374;0.126;0.448;0.034;0.932	T	0.19160	-1.0314	10	0.31617	T	0.26	-38.1449	11.2084	0.48784	0.1684:0.0:0.8316:0.0	.	1060;1000;1170;1196;1196;1221	A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;.;CYFP2_HUMAN	N	1221;1000;1170;1196;1196;1121;895	ENSP00000325817:K1221N;ENSP00000428009:K1000N;ENSP00000430904:K1170N;ENSP00000313567:K1196N;ENSP00000366799:K1196N;ENSP00000444645:K1121N;ENSP00000403793:K895N	ENSP00000325817:K1221N	K	+	3	2	CYFIP2	156750248	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	1.447000	0.35101	1.337000	0.45525	0.655000	0.94253	AAG	CYFIP2	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000055163		0.537	CYFIP2-001	NOVEL	basic	protein_coding	CYFIP2	HGNC	protein_coding	OTTHUMT00000373710.1	26	0.00	0	G	NM_001037332		156817670	156817670	+1	no_errors	ENST00000318218	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	1.000	C
CYP7A1	1581	genome.wustl.edu	37	8	59404035	59404035	+	Silent	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr8:59404035C>T	ENST00000301645.3	-	6	1651	c.1514G>A	c.(1513-1515)tGa>tAa	p.*505*		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	0					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				GCCATGTATTCACAAATGCTT	0.438									Neonatal Giant Cell Hepatitis																													dbGAP											0													36.0	35.0	35.0					8																	59404035		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Neonatal Hemochromatosis	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.1514G>A	8.37:g.59404035C>T			P78454|Q3MIL8|Q7KZ19	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I	p.*505	ENST00000301645.3	37	c.1514	CCDS6171.1	8																																																																																			CYP7A1	-	NULL	ENSG00000167910		0.438	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP7A1	HGNC	protein_coding	OTTHUMT00000378190.1	40	0.00	0	C	NM_000780		59404035	59404035	-1	no_errors	ENST00000301645	ensembl	human	known	69_37n	silent	15	40.00	10	SNP	0.058	T
DEPDC7	91614	genome.wustl.edu	37	11	33054213	33054213	+	Splice_Site	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr11:33054213G>C	ENST00000241051.3	+	7	1229		c.e7-1		DEPDC7_ENST00000311388.3_Splice_Site	NM_001077242.1	NP_001070710.1	Q96QD5	DEPD7_HUMAN	DEP domain containing 7						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	17						TATTTTTATAGAGTGACAACC	0.249																																						dbGAP											0													28.0	27.0	27.0					11																	33054213		1778	4038	5816	-	-	-	SO:0001630	splice_region_variant	0				CCDS41632.1, CCDS41633.1	11p13	2006-03-24			ENSG00000121690	ENSG00000121690			29899	protein-coding gene	gene with protein product		612294				10568747	Standard	NM_001077242		Approved		uc001mub.3	Q96QD5	OTTHUMG00000166242	ENST00000241051.3:c.1138-1G>C	11.37:g.33054213G>C			G5E941|Q8N602|Q8NCU9|Q9UGK5	Splice_Site	SNP	-	e7-1	ENST00000241051.3	37	c.1138-1	CCDS41632.1	11	.	.	.	.	.	.	.	.	.	.	G	14.25	2.478613	0.44044	.	.	ENSG00000121690	ENST00000241051;ENST00000311388	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4646	0.94932	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DEPDC7	33010789	1.000000	0.71417	1.000000	0.80357	0.438000	0.31896	9.379000	0.97198	2.574000	0.86865	0.557000	0.71058	.	DEPDC7	-	-	ENSG00000121690		0.249	DEPDC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEPDC7	HGNC	protein_coding	OTTHUMT00000388655.1	50	0.00	0	G	NM_139160	Intron	33054213	33054213	+1	no_errors	ENST00000241051	ensembl	human	known	69_37n	splice_site	28	24.32	9	SNP	1.000	C
DHTKD1	55526	genome.wustl.edu	37	10	12126636	12126636	+	Silent	SNP	A	A	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr10:12126636A>G	ENST00000263035.4	+	3	470	c.408A>G	c.(406-408)caA>caG	p.Q136Q	DHTKD1_ENST00000465617.1_Intron	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	136					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			AAACCTCCCAACTTCAGAGCC	0.443																																						dbGAP											0													148.0	150.0	149.0					10																	12126636		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.408A>G	10.37:g.12126636A>G			Q68CU5|Q9BUM8|Q9HCE2	Silent	SNP	pfam_Transketolase-like_Pyr-bd,pfam_DH_E1,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.Q136	ENST00000263035.4	37	c.408	CCDS7087.1	10																																																																																			DHTKD1	-	pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000181192		0.443	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHTKD1	HGNC	protein_coding	OTTHUMT00000046777.1	60	0.00	0	A	NM_018706		12126636	12126636	+1	no_errors	ENST00000263035	ensembl	human	known	69_37n	silent	34	15.00	6	SNP	0.997	G
DMXL2	23312	genome.wustl.edu	37	15	51857358	51857358	+	Silent	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr15:51857358G>C	ENST00000251076.5	-	4	578	c.291C>G	c.(289-291)ctC>ctG	p.L97L	DMXL2_ENST00000560421.1_5'UTR|DMXL2_ENST00000449909.3_Silent_p.L97L|DMXL2_ENST00000543779.2_Silent_p.L97L	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	97						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		ACTGGCACTTGAGTTGCTGAA	0.303																																						dbGAP											0													27.0	27.0	27.0					15																	51857358		2195	4292	6487	-	-	-	SO:0001819	synonymous_variant	0			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.291C>G	15.37:g.51857358G>C			B2RTR3|B7ZMH3|F5GWF1|O94938	Silent	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L97	ENST00000251076.5	37	c.291	CCDS10141.1	15																																																																																			DMXL2	-	superfamily_WD40_repeat_dom	ENSG00000104093		0.303	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	HGNC	protein_coding	OTTHUMT00000254671.2	58	0.00	0	G	NM_015263		51857358	51857358	-1	no_errors	ENST00000543779	ensembl	human	known	69_37n	silent	26	21.21	7	SNP	1.000	C
DPP9	91039	genome.wustl.edu	37	19	4702043	4702043	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr19:4702043C>G	ENST00000598800.1	-	10	1426	c.921G>C	c.(919-921)agG>agC	p.R307S	DPP9_ENST00000262960.9_Missense_Mutation_p.R336S|DPP9_ENST00000594671.1_Missense_Mutation_p.R307S|DPP9_ENST00000597849.1_Missense_Mutation_p.R336S			Q86TI2	DPP9_HUMAN	dipeptidyl-peptidase 9	307						cytoplasm (GO:0005737)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|identical protein binding (GO:0042802)|serine-type peptidase activity (GO:0008236)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		ACTCACCTGTCCTGGGGTACC	0.622																																						dbGAP											0													93.0	100.0	98.0					19																	4702043		2009	4179	6188	-	-	-	SO:0001583	missense	0			AF452102	CCDS45928.1	19p13.3	2014-06-11	2006-01-12		ENSG00000142002	ENSG00000142002			18648	protein-coding gene	gene with protein product		608258	"""dipeptidylpeptidase 9"""				Standard	NM_139159		Approved		uc002mba.3	Q86TI2	OTTHUMG00000182040	ENST00000598800.1:c.921G>C	19.37:g.4702043C>G	ENSP00000469603:p.Arg307Ser		O75273|O75868|Q1ZZB8|Q6AI37|Q6UAL0|Q6ZMT2|Q6ZNJ5|Q8N2J7|Q8N3F5|Q8WXD8|Q96NT8|Q9BVR3	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_X-Pro-like_dom	p.R336S	ENST00000598800.1	37	c.1008		19	.	.	.	.	.	.	.	.	.	.	C	9.821	1.185771	0.21870	.	.	ENSG00000142002	ENST00000357909;ENST00000381797;ENST00000262960	T	0.30182	1.54	4.54	3.51	0.40186	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.186912	0.46758	N	0.000272	T	0.28632	0.0709	L	0.59912	1.85	0.80722	D	1	B;B	0.18166	0.026;0.006	B;B	0.26969	0.075;0.021	T	0.07578	-1.0765	10	0.35671	T	0.21	-37.2813	7.7007	0.28621	0.0:0.7473:0.1644:0.0883	.	307;336	Q86TI2;Q1ZZB8	DPP9_HUMAN;.	S	415;277;336	ENSP00000262960:R336S	ENSP00000262960:R336S	R	-	3	2	DPP9	4653043	1.000000	0.71417	1.000000	0.80357	0.032000	0.12392	0.730000	0.26043	1.144000	0.42321	-0.136000	0.14681	AGG	DPP9	-	pfam_Peptidase_S9B	ENSG00000142002		0.622	DPP9-026	NOVEL	basic	protein_coding	DPP9	HGNC	protein_coding	OTTHUMT00000459343.2	34	0.00	0	C			4702043	4702043	-1	no_errors	ENST00000262960	ensembl	human	known	69_37n	missense	12	42.86	9	SNP	1.000	G
ELK3	2004	genome.wustl.edu	37	12	96641458	96641458	+	Silent	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr12:96641458C>T	ENST00000228741.3	+	3	1274	c.948C>T	c.(946-948)ctC>ctT	p.L316L	ELK3_ENST00000552142.1_Intron	NM_005230.2	NP_005221.2	P41970	ELK3_HUMAN	ELK3, ETS-domain protein (SRF accessory protein 2)	316					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|wound healing (GO:0042060)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	purine-rich negative regulatory element binding (GO:0032422)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(5)|ovary(2)|prostate(1)|stomach(2)	20	all_cancers(2;0.00173)					CCATCGCCCTCAACAGCCCAG	0.597																																						dbGAP											0													36.0	33.0	34.0					12																	96641458		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC017371	CCDS9060.1	12q23	2006-12-30				ENSG00000111145			3325	protein-coding gene	gene with protein product		600247				7851904	Standard	NM_005230		Approved	ERP, NET, SAP2	uc001teo.1	P41970		ENST00000228741.3:c.948C>T	12.37:g.96641458C>T			B2R6S6|Q6FG57|Q6GU29|Q9UD17	Silent	SNP	pfam_Ets,smart_Ets,prints_Ets,pfscan_Ets	p.L316	ENST00000228741.3	37	c.948	CCDS9060.1	12																																																																																			ELK3	-	NULL	ENSG00000111145		0.597	ELK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELK3	HGNC	protein_coding	OTTHUMT00000408694.1	25	0.00	0	C	NM_005230		96641458	96641458	+1	no_errors	ENST00000228741	ensembl	human	known	69_37n	silent	13	40.91	9	SNP	1.000	T
ERN1	2081	genome.wustl.edu	37	17	62137877	62137878	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	AT	AT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr17:62137877_62137878delAT	ENST00000433197.3	-	11	1252_1253	c.1157_1158delAT	c.(1156-1158)catfs	p.H386fs		NM_001433.3	NP_001424.3			endoplasmic reticulum to nucleus signaling 1											central_nervous_system(4)|kidney(1)|lung(2)|ovary(1)|stomach(1)	9						CATTTTCCCGATGTTTGGGTAG	0.475																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF059198	CCDS45762.1	17q23	2011-08-12	2007-08-14			ENSG00000178607			3449	protein-coding gene	gene with protein product	"""inositol-requiring enzyme 1"""	604033	"""ER to nucleus signalling 1"""			9637683	Standard	NM_001433		Approved	IRE1, IRE1P	uc002jdz.2	O75460		ENST00000433197.3:c.1157_1158delAT	17.37:g.62137877_62137878delAT	ENSP00000401445:p.His386fs			Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_KEN_RNase_activator,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like,smart_PQQ_beta_propeller_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PUG-dom,pfscan_Prot_kinase_cat_dom	p.H386fs	ENST00000433197.3	37	c.1158_1157	CCDS45762.1	17																																																																																			ERN1	-	NULL	ENSG00000178607		0.475	ERN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERN1	HGNC	protein_coding	OTTHUMT00000443734.2	116	0.00	0	AT	NM_001433		62137877	62137878	-1	no_errors	ENST00000433197	ensembl	human	known	69_37n	frame_shift_del	55	21.05	16	DEL	0.109:0.220	-
EVC	2121	genome.wustl.edu	37	4	5803792	5803792	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr4:5803792G>C	ENST00000264956.6	+	16	2604	c.2420G>C	c.(2419-2421)aGa>aCa	p.R807T	EVC_ENST00000382674.2_Missense_Mutation_p.R807T	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	807					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				CACGAGGAGAGAAAACTGCAG	0.587																																						dbGAP											0													82.0	82.0	82.0					4																	5803792		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.2420G>C	4.37:g.5803792G>C	ENSP00000264956:p.Arg807Thr			Missense_Mutation	SNP	NULL	p.R807T	ENST00000264956.6	37	c.2420	CCDS3383.1	4	.	.	.	.	.	.	.	.	.	.	G	4.251	0.045576	0.08196	.	.	ENSG00000072840	ENST00000264956;ENST00000382674	T;T	0.53640	0.61;0.61	4.72	1.98	0.26296	.	0.451576	0.20678	N	0.087706	T	0.35278	0.0926	L	0.55481	1.735	0.09310	N	1	B	0.28636	0.218	B	0.31101	0.124	T	0.16335	-1.0406	10	0.18710	T	0.47	.	3.5796	0.07947	0.326:0.1928:0.4812:0.0	.	807	P57679	EVC_HUMAN	T	807	ENSP00000264956:R807T;ENSP00000372120:R807T	ENSP00000264956:R807T	R	+	2	0	EVC	5854693	0.155000	0.22806	0.028000	0.17463	0.104000	0.19210	0.456000	0.21859	0.404000	0.25506	0.561000	0.74099	AGA	EVC	-	NULL	ENSG00000072840		0.587	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVC	HGNC	protein_coding	OTTHUMT00000206859.1	37	0.00	0	G			5803792	5803792	+1	no_errors	ENST00000264956	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	0.014	C
FABP1	2168	genome.wustl.edu	37	2	88425757	88425757	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr2:88425757G>A	ENST00000295834.3	-	2	276	c.178C>T	c.(178-180)Caa>Taa	p.Q60*	FABP1_ENST00000495375.1_5'UTR|FABP1_ENST00000393750.3_Nonsense_Mutation_p.Q60*	NM_001443.2	NP_001434.1	P07148	FABPL_HUMAN	fatty acid binding protein 1, liver	60					cellular lipid metabolic process (GO:0044255)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|intestinal absorption (GO:0050892)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of hydrolase activity (GO:0051345)|small molecule metabolic process (GO:0044281)	apical cortex (GO:0045179)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|peroxisomal matrix (GO:0005782)	antioxidant activity (GO:0016209)|bile acid binding (GO:0032052)|chromatin binding (GO:0003682)|drug binding (GO:0008144)|fatty acid binding (GO:0005504)|long-chain fatty acid transporter activity (GO:0005324)|phospholipid binding (GO:0005543)	p.Q60E(1)		kidney(1)|large_intestine(1)|lung(2)|prostate(1)|stomach(1)	6						AATTCGTTTTGGATCACTTTG	0.517																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											326.0	276.0	293.0					2																	88425757		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M10617	CCDS2001.1	2p11	2013-03-01			ENSG00000163586	ENSG00000163586		"""Fatty acid binding protein family"""	3555	protein-coding gene	gene with protein product		134650				3012800, 17698986	Standard	NM_001443		Approved	L-FABP	uc002sst.2	P07148	OTTHUMG00000130312	ENST00000295834.3:c.178C>T	2.37:g.88425757G>A	ENSP00000295834:p.Gln60*			Nonsense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.Q60*	ENST00000295834.3	37	c.178	CCDS2001.1	2	.	.	.	.	.	.	.	.	.	.	G	11.18	1.563416	0.27915	.	.	ENSG00000163586	ENST00000295834;ENST00000393750	.	.	.	5.81	1.67	0.24075	.	1.295960	0.04477	N	0.377066	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	9.3455	0.38107	0.0:0.1466:0.4296:0.4238	.	.	.	.	X	60	.	ENSP00000295834:Q60X	Q	-	1	0	FABP1	88206872	0.000000	0.05858	0.141000	0.22245	0.028000	0.11728	-0.544000	0.06077	0.321000	0.23259	-0.269000	0.10298	CAA	FABP1	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like	ENSG00000163586		0.517	FABP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FABP1	HGNC	protein_coding	OTTHUMT00000252660.1	73	0.00	0	G	NM_001443		88425757	88425757	-1	no_errors	ENST00000295834	ensembl	human	known	69_37n	nonsense	47	24.19	15	SNP	0.000	A
SUPT20H	55578	genome.wustl.edu	37	13	37618235	37618235	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr13:37618235C>T	ENST00000350612.6	-	7	596	c.376G>A	c.(376-378)Gat>Aat	p.D126N	SUPT20H_ENST00000542180.1_Missense_Mutation_p.D114N|SUPT20H_ENST00000464744.1_Missense_Mutation_p.D127N|SUPT20H_ENST00000470359.2_5'UTR|SUPT20H_ENST00000356185.3_Missense_Mutation_p.D127N|SUPT20H_ENST00000475892.1_Missense_Mutation_p.D126N|SUPT20H_ENST00000360252.4_Missense_Mutation_p.D127N	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	126					autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										TCTAGGAGATCAACCAAAATA	0.294																																						dbGAP											0													73.0	76.0	75.0					13																	37618235		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.376G>A	13.37:g.37618235C>T	ENSP00000218894:p.Asp126Asn		E7ER46|Q71RF3|Q9Y6A6	Missense_Mutation	SNP	pfam_Spt20	p.D126N	ENST00000350612.6	37	c.376	CCDS31959.1	13	.	.	.	.	.	.	.	.	.	.	C	33	5.253909	0.95336	.	.	ENSG00000102710	ENST00000360252;ENST00000475892;ENST00000350612;ENST00000356185;ENST00000536874;ENST00000464744;ENST00000542180;ENST00000497318	T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.60830	0.2299	L	0.50333	1.59	0.80722	D	1	P;P;P;P;P;D	0.60160	0.932;0.932;0.927;0.937;0.839;0.987	P;P;P;P;P;D	0.67382	0.597;0.768;0.759;0.734;0.624;0.951	T	0.60393	-0.7272	10	0.66056	D	0.02	-22.1031	19.8604	0.96781	0.0:1.0:0.0:0.0	.	114;126;126;127;127;126	B4E2D5;B3KNI1;E7ER46;A8K8L1;Q8NEM7-2;Q8NEM7	.;.;.;.;.;FA48A_HUMAN	N	127;126;126;127;126;127;114;127	ENSP00000353388:D127N;ENSP00000417510:D126N;ENSP00000218894:D126N;ENSP00000348512:D127N;ENSP00000419754:D127N;ENSP00000439000:D114N;ENSP00000420170:D127N	ENSP00000218894:D126N	D	-	1	0	FAM48A	36516235	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.433000	0.80362	2.699000	0.92147	0.650000	0.86243	GAT	FAM48A	-	pfam_Spt20	ENSG00000102710		0.294	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM48A	HGNC	protein_coding	OTTHUMT00000354766.1	86	0.00	0	C	NM_017569		37618235	37618235	-1	no_errors	ENST00000350612	ensembl	human	known	69_37n	missense	52	27.78	20	SNP	1.000	T
FAM81A	145773	genome.wustl.edu	37	15	59808952	59808952	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr15:59808952G>C	ENST00000288228.5	+	8	1082	c.895G>C	c.(895-897)Gaa>Caa	p.E299Q		NM_152450.2	NP_689663.2	Q8TBF8	FA81A_HUMAN	family with sequence similarity 81, member A	299										endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10						AACAAGGCAAGAAGAGGAGAA	0.453																																						dbGAP											0													109.0	105.0	106.0					15																	59808952		1959	4149	6108	-	-	-	SO:0001583	missense	0				CCDS45269.1	15q22.2	2012-10-02			ENSG00000157470	ENSG00000157470			28379	protein-coding gene	gene with protein product							Standard	NM_152450		Approved	MGC26690	uc002agc.2	Q8TBF8	OTTHUMG00000171915	ENST00000288228.5:c.895G>C	15.37:g.59808952G>C	ENSP00000288228:p.Glu299Gln			Missense_Mutation	SNP	superfamily_Ferritin/RR-like	p.E299Q	ENST00000288228.5	37	c.895	CCDS45269.1	15	.	.	.	.	.	.	.	.	.	.	G	3.122	-0.180329	0.06380	.	.	ENSG00000157470	ENST00000288228	T	0.73469	-0.75	5.39	5.39	0.77823	.	0.569160	0.17760	N	0.162935	T	0.53270	0.1786	N	0.08118	0	0.09310	N	1	B	0.19817	0.039	B	0.25759	0.063	T	0.35251	-0.9796	10	0.14656	T	0.56	-19.4075	10.5876	0.45292	0.0883:0.0:0.9117:0.0	.	299	Q8TBF8	FA81A_HUMAN	Q	299	ENSP00000288228:E299Q	ENSP00000288228:E299Q	E	+	1	0	FAM81A	57596244	0.678000	0.27586	0.607000	0.28956	0.361000	0.29550	2.546000	0.45778	2.679000	0.91253	0.650000	0.86243	GAA	FAM81A	-	NULL	ENSG00000157470		0.453	FAM81A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM81A	HGNC	protein_coding	OTTHUMT00000415876.1	45	0.00	0	G	NM_152450		59808952	59808952	+1	no_errors	ENST00000288228	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	0.103	C
FARP2	9855	genome.wustl.edu	37	2	242402844	242402844	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr2:242402844G>A	ENST00000264042.3	+	16	1942	c.1772G>A	c.(1771-1773)aGa>aAa	p.R591K	FARP2_ENST00000373287.4_Missense_Mutation_p.R591K|FARP2_ENST00000545004.1_Missense_Mutation_p.R591K	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	591	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		GAGTTCCACAGAGGCTTCCTG	0.592																																						dbGAP											0													106.0	87.0	94.0					2																	242402844		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.1772G>A	2.37:g.242402844G>A	ENSP00000264042:p.Arg591Lys		B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_FERM-adjacent,superfamily_DH-domain,superfamily_FERM_central,smart_Band_41_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_FERM_domain,pfscan_Pleckstrin_homology,pfscan_DH-domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.R591K	ENST00000264042.3	37	c.1772	CCDS33424.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.19|14.19	2.461738|2.461738	0.43736|0.43736	.|.	.|.	ENSG00000006607|ENSG00000006607	ENST00000422951|ENST00000264042;ENST00000545004;ENST00000373287	.|T;T;T	.|0.61742	.|0.08;0.08;0.08	5.25|5.25	5.25|5.25	0.73442|0.73442	.|Dbl homology (DH) domain (5);	.|0.064413	.|0.64402	.|D	.|0.000013	T|T	0.42040|0.42040	0.1185|0.1185	N|N	0.14661|0.14661	0.345|0.345	0.42188|0.42188	D|D	0.991715|0.991715	.|P;B;D	.|0.56746	.|0.925;0.112;0.977	.|B;B;P	.|0.45538	.|0.435;0.029;0.484	T|T	0.28459|0.28459	-1.0043|-1.0043	5|10	.|0.23302	.|T	.|0.38	.|.	12.2269|12.2269	0.54465|0.54465	0.0784:0.0:0.9216:0.0|0.0784:0.0:0.9216:0.0	.|.	.|591;591;591	.|O94887-2;F5GZ84;O94887	.|.;.;FARP2_HUMAN	K|K	32|591	.|ENSP00000264042:R591K;ENSP00000443876:R591K;ENSP00000362384:R591K	.|ENSP00000264042:R591K	E|R	+|+	1|2	0|0	FARP2|FARP2	242051517|242051517	0.999000|0.999000	0.42202|0.42202	0.990000|0.990000	0.47175|0.47175	0.998000|0.998000	0.95712|0.95712	4.258000|4.258000	0.58822|0.58822	2.434000|2.434000	0.82447|0.82447	0.655000|0.655000	0.94253|0.94253	GAG|AGA	FARP2	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000006607		0.592	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP2	HGNC	protein_coding	OTTHUMT00000323153.1	27	0.00	0	G			242402844	242402844	+1	no_errors	ENST00000264042	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	1.000	A
FLG2	388698	genome.wustl.edu	37	1	152327368	152327368	+	Missense_Mutation	SNP	C	C	G	rs571867232		TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:152327368C>G	ENST00000388718.5	-	3	2966	c.2894G>C	c.(2893-2895)gGa>gCa	p.G965A	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	965	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAGCCTGATCCATGTTGGCC	0.488																																						dbGAP											0													271.0	272.0	272.0					1																	152327368		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2894G>C	1.37:g.152327368C>G	ENSP00000373370:p.Gly965Ala		Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.G965A	ENST00000388718.5	37	c.2894	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.272834	0.23221	.	.	ENSG00000143520	ENST00000388718	T	0.53423	0.62	4.54	3.62	0.41486	.	.	.	.	.	T	0.44180	0.1281	M	0.76328	2.33	0.09310	N	1	D	0.56968	0.978	P	0.55508	0.777	T	0.25398	-1.0133	9	0.29301	T	0.29	.	10.5087	0.44849	0.0:0.8037:0.1963:0.0	.	965	Q5D862	FILA2_HUMAN	A	965	ENSP00000373370:G965A	ENSP00000373370:G965A	G	-	2	0	FLG2	150593992	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.030000	0.12308	1.122000	0.41944	-0.165000	0.13383	GGA	FLG2	-	NULL	ENSG00000143520		0.488	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	119	0.00	0	C	NM_001014342		152327368	152327368	-1	no_errors	ENST00000388718	ensembl	human	known	69_37n	missense	75	42.75	56	SNP	0.005	G
GIPC2	54810	genome.wustl.edu	37	1	78546505	78546505	+	Silent	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:78546505C>T	ENST00000370759.3	+	2	580	c.387C>T	c.(385-387)ctC>ctT	p.L129L	GIPC2_ENST00000476882.1_3'UTR	NM_017655.4	NP_060125.4	Q8TF65	GIPC2_HUMAN	GIPC PDZ domain containing family, member 2	129	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)	20						CACTTGGTCTCACCATTACAG	0.333																																						dbGAP											0													94.0	95.0	95.0					1																	78546505		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AB073737	CCDS685.1	1p31.1	2010-05-28			ENSG00000137960	ENSG00000137960			18177	protein-coding gene	gene with protein product	"""semaphorin cytoplasmic domain associated protein 2"""					11836570	Standard	NM_017655		Approved	FLJ20075, SEMCAP-2	uc001dik.3	Q8TF65	OTTHUMG00000041145	ENST00000370759.3:c.387C>T	1.37:g.78546505C>T			Q8IYD3|Q9NXS7	Silent	SNP	pfam_PDZ,superfamily_PDZ,superfamily_Ig_E-set,smart_PDZ,pirsf_UCP038083_PDZ,pfscan_PDZ	p.L129	ENST00000370759.3	37	c.387	CCDS685.1	1																																																																																			GIPC2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_UCP038083_PDZ,pfscan_PDZ	ENSG00000137960		0.333	GIPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIPC2	HGNC	protein_coding	OTTHUMT00000098629.1	56	0.00	0	C	NM_017655		78546505	78546505	+1	no_errors	ENST00000370759	ensembl	human	known	69_37n	silent	37	26.00	13	SNP	0.995	T
FLG2	388698	genome.wustl.edu	37	1	152327430	152327430	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:152327430C>G	ENST00000388718.5	-	3	2904	c.2832G>C	c.(2830-2832)caG>caC	p.Q944H	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	944	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATCCAAAAGTCTGTCCTGAAC	0.493																																						dbGAP											0													314.0	311.0	312.0					1																	152327430		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2832G>C	1.37:g.152327430C>G	ENSP00000373370:p.Gln944His		Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.Q944H	ENST00000388718.5	37	c.2832	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	C	9.446	1.089332	0.20390	.	.	ENSG00000143520	ENST00000388718	T	0.22539	1.95	4.28	-1.08	0.09936	.	.	.	.	.	T	0.03136	0.0092	N	0.25144	0.715	0.09310	N	1	B	0.31611	0.331	B	0.28709	0.093	T	0.39981	-0.9587	9	0.48119	T	0.1	.	0.858	0.01186	0.163:0.3856:0.1589:0.2925	.	944	Q5D862	FILA2_HUMAN	H	944	ENSP00000373370:Q944H	ENSP00000373370:Q944H	Q	-	3	2	FLG2	150594054	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.464000	0.06688	-0.420000	0.07427	-0.140000	0.14226	CAG	FLG2	-	NULL	ENSG00000143520		0.493	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	125	0.00	0	C	NM_001014342		152327430	152327430	-1	no_errors	ENST00000388718	ensembl	human	known	69_37n	missense	70	38.05	43	SNP	0.010	G
GJD2	57369	genome.wustl.edu	37	15	35045503	35045503	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr15:35045503C>A	ENST00000290374.4	-	2	618	c.142G>T	c.(142-144)Gat>Tat	p.D48Y	RP11-814P5.1_ENST00000558707.1_RNA|RP11-814P5.1_ENST00000503496.1_RNA	NM_020660.2	NP_065711.1	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	48					action potential (GO:0001508)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	19		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		GTCTGCTCATCATCGTACACC	0.567																																						dbGAP											0													95.0	85.0	88.0					15																	35045503		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB037509	CCDS10040.1	15q13.1	2008-02-04	2007-11-06	2007-11-06	ENSG00000159248	ENSG00000159248		"""Ion channels / Gap junction proteins (connexins)"""	19154	protein-coding gene	gene with protein product	"""connexin 36"""	607058	"""gap junction protein, alpha 9, 36kDa"""	GJA9		10462698	Standard	NM_020660		Approved	CX36	uc001zis.2	Q9UKL4	OTTHUMG00000129674	ENST00000290374.4:c.142G>T	15.37:g.35045503C>A	ENSP00000290374:p.Asp48Tyr		Q2M241|Q9P2R0	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin36	p.D48Y	ENST00000290374.4	37	c.142	CCDS10040.1	15	.	.	.	.	.	.	.	.	.	.	C	19.46	3.832406	0.71258	.	.	ENSG00000159248	ENST00000290374	D	0.99578	-6.21	5.1	5.1	0.69264	Connexin, N-terminal (2);	0.098445	0.44285	D	0.000473	D	0.99718	0.9891	M	0.92077	3.27	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.97520	1.0072	10	0.87932	D	0	.	18.6917	0.91585	0.0:1.0:0.0:0.0	.	48	Q9UKL4	CXD2_HUMAN	Y	48	ENSP00000290374:D48Y	ENSP00000290374:D48Y	D	-	1	0	GJD2	32832795	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.652000	0.90054	0.561000	0.74099	GAT	GJD2	-	pfam_Connexin_N,smart_Connexin_N	ENSG00000159248		0.567	GJD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJD2	HGNC	protein_coding	OTTHUMT00000251875.2	32	0.00	0	C			35045503	35045503	-1	no_errors	ENST00000290374	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	1.000	A
GNL2	29889	genome.wustl.edu	37	1	38061433	38061433	+	5'UTR	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:38061433G>A	ENST00000373062.3	-	0	89					NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)						GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				TCTTGGCGACGAGACCGGGAC	0.612																																						dbGAP											0													114.0	89.0	98.0					1																	38061433		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.-10C>T	1.37:g.38061433G>A			Q9BWN7	RNA	SNP	-	NULL	ENST00000373062.3	37	NULL	CCDS421.1	1																																																																																			GNL2	-	-	ENSG00000134697		0.612	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL2	HGNC	protein_coding	OTTHUMT00000012478.1	29	0.00	0	G	NM_013285		38061433	38061433	-1	no_errors	ENST00000488496	ensembl	human	known	69_37n	rna	23	30.30	10	SNP	0.000	A
GPR112	139378	genome.wustl.edu	37	X	135475730	135475730	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chrX:135475730G>C	ENST00000394143.1	+	18	8362	c.8071G>C	c.(8071-8073)Gag>Cag	p.E2691Q	GPR112_ENST00000412101.1_Missense_Mutation_p.E2486Q|GPR112_ENST00000370652.1_Missense_Mutation_p.E2691Q|GPR112_ENST00000394141.1_Missense_Mutation_p.E2486Q|GPR112_ENST00000287534.4_Missense_Mutation_p.E2444Q	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2691	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TTGGGATTTTGAGAATAATAG	0.368																																						dbGAP											0													176.0	152.0	161.0					X																	135475730		2202	4298	6500	-	-	-	SO:0001583	missense	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.8071G>C	X.37:g.135475730G>C	ENSP00000377699:p.Glu2691Gln		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.E2691Q	ENST00000394143.1	37	c.8071	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	G	11.23	1.577851	0.28180	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.29917	1.59;1.59;1.55;1.73;1.55	5.57	5.57	0.84162	GPS domain (3);	.	.	.	.	T	0.29684	0.0741	L	0.39085	1.19	0.18873	N	0.999989	P;B	0.41265	0.744;0.219	B;P	0.46885	0.271;0.53	T	0.22765	-1.0207	9	0.41790	T	0.15	.	5.5598	0.17137	0.1693:0.1663:0.6643:0.0	.	2486;2691	Q8IZF6-3;Q8IZF6	.;GP112_HUMAN	Q	2691;2691;2486;2444;2486	ENSP00000377699:E2691Q;ENSP00000359686:E2691Q;ENSP00000416526:E2486Q;ENSP00000287534:E2444Q;ENSP00000377697:E2486Q	ENSP00000287534:E2444Q	E	+	1	0	GPR112	135303396	0.098000	0.21812	0.893000	0.35052	0.870000	0.49936	0.295000	0.19065	2.337000	0.79520	0.600000	0.82982	GAG	GPR112	-	pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom	ENSG00000156920		0.368	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	153	0.00	0	G			135475730	135475730	+1	no_errors	ENST00000370652	ensembl	human	known	69_37n	missense	84	22.94	25	SNP	0.505	C
GRAMD1C	54762	genome.wustl.edu	37	3	113623050	113623050	+	Silent	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr3:113623050C>T	ENST00000358160.4	+	8	1212	c.720C>T	c.(718-720)atC>atT	p.I240I	GRAMD1C_ENST00000452134.2_5'UTR|GRAMD1C_ENST00000472026.1_Silent_p.I73I|GRAMD1C_ENST00000479212.1_3'UTR|GRAMD1C_ENST00000440446.2_Silent_p.I35I	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	240						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						CCAAGTCAATCAGTTTTACCA	0.348																																						dbGAP											0													87.0	93.0	91.0					3																	113623050		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.720C>T	3.37:g.113623050C>T			A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Silent	SNP	pfam_GRAM,smart_GRAM	p.I240	ENST00000358160.4	37	c.720	CCDS33826.1	3																																																																																			GRAMD1C	-	NULL	ENSG00000178075		0.348	GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD1C	HGNC	protein_coding	OTTHUMT00000354733.1	67	0.00	0	C	NM_017577		113623050	113623050	+1	no_errors	ENST00000358160	ensembl	human	known	69_37n	silent	31	27.91	12	SNP	1.000	T
HSPA5	3309	genome.wustl.edu	37	9	128003098	128003098	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr9:128003098C>T	ENST00000324460.6	-	2	414	c.211G>A	c.(211-213)Gaa>Aaa	p.E71K	RP11-65N13.8_ENST00000468244.1_RNA	NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	71					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	CGTTCCCCTTCAGGAGTGAAG	0.602										Prostate(1;0.17)																												dbGAP											0													88.0	84.0	86.0					9																	128003098		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.211G>A	9.37:g.128003098C>T	ENSP00000324173:p.Glu71Lys		B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.E71K	ENST00000324460.6	37	c.211	CCDS6863.1	9	.	.	.	.	.	.	.	.	.	.	C	26.6	4.751263	0.89753	.	.	ENSG00000044574	ENST00000324460;ENST00000401067	T	0.03951	3.75	5.71	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.05181	0.0138	N	0.25426	0.745	0.80722	D	1	B	0.11235	0.004	B	0.12156	0.007	T	0.31081	-0.9956	10	0.87932	D	0	-14.5435	13.7153	0.62693	0.0:0.9261:0.0:0.0739	.	71	P11021	GRP78_HUMAN	K	71	ENSP00000324173:E71K	ENSP00000324173:E71K	E	-	1	0	HSPA5	127042919	1.000000	0.71417	0.887000	0.34795	0.988000	0.76386	7.818000	0.86416	1.405000	0.46838	0.655000	0.94253	GAA	HSPA5	-	pfam_Hsp_70_fam	ENSG00000044574		0.602	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA5	HGNC	protein_coding	OTTHUMT00000054062.1	21	0.00	0	C			128003098	128003098	-1	no_errors	ENST00000324460	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	0.999	T
HTT	3064	genome.wustl.edu	37	4	3216854	3216854	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr4:3216854G>A	ENST00000355072.5	+	51	7115	c.6970G>A	c.(6970-6972)Gag>Aag	p.E2324K		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2324					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GCAGCCTGGAGAGCAGCTTCT	0.433																																						dbGAP											0													96.0	96.0	96.0					4																	3216854		1941	4142	6083	-	-	-	SO:0001583	missense	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.6970G>A	4.37:g.3216854G>A	ENSP00000347184:p.Glu2324Lys		Q9UQB7	Missense_Mutation	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.E2324K	ENST00000355072.5	37	c.6970	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	G	16.86	3.238926	0.58995	.	.	ENSG00000197386	ENST00000355072	T	0.05199	3.48	5.4	5.4	0.78164	.	0.103433	0.64402	D	0.000004	T	0.04907	0.0132	N	0.24115	0.695	0.27535	N	0.950985	B	0.10296	0.003	B	0.09377	0.004	T	0.31696	-0.9934	10	0.25106	T	0.35	.	10.7129	0.45995	0.117:0.0:0.883:0.0	.	2324	P42858	HD_HUMAN	K	2324	ENSP00000347184:E2324K	ENSP00000347184:E2324K	E	+	1	0	HTT	3186652	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.608000	0.54109	2.687000	0.91594	0.655000	0.94253	GAG	HTT	-	NULL	ENSG00000197386		0.433	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	73	0.00	0	G	NM_002111		3216854	3216854	+1	no_errors	ENST00000355072	ensembl	human	known	69_37n	missense	25	32.43	12	SNP	1.000	A
SPIDR	23514	genome.wustl.edu	37	8	48309073	48309073	+	Silent	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr8:48309073G>A	ENST00000297423.4	+	6	1047	c.663G>A	c.(661-663)gaG>gaA	p.E221E	SPIDR_ENST00000541342.1_Silent_p.E151E|SPIDR_ENST00000518074.1_Silent_p.E161E|SPIDR_ENST00000521214.1_3'UTR	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	221	Necessary for interaction with RAD51.				cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											AGATTATGGAGAGACTGATAG	0.413																																						dbGAP											0													139.0	134.0	136.0					8																	48309073		1886	4122	6008	-	-	-	SO:0001819	synonymous_variant	0			AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.663G>A	8.37:g.48309073G>A			B4DFV2|B4E0Y6|Q96BI5	Silent	SNP	NULL	p.E221	ENST00000297423.4	37	c.663	CCDS43737.1	8																																																																																			KIAA0146	-	NULL	ENSG00000164808		0.413	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0146	HGNC	protein_coding	OTTHUMT00000377611.1	44	0.00	0	G	NM_001080394		48309073	48309073	+1	no_errors	ENST00000297423	ensembl	human	known	69_37n	silent	22	18.52	5	SNP	0.005	A
KNTC1	9735	genome.wustl.edu	37	12	123014620	123014620	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr12:123014620G>T	ENST00000333479.7	+	2	187	c.10G>T	c.(10-12)Gat>Tat	p.D4Y	KNTC1_ENST00000450485.2_Missense_Mutation_p.D4Y	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	4					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		CATGTGGAATGATATTGAGCT	0.393																																						dbGAP											0													101.0	101.0	101.0					12																	123014620		1889	4118	6007	-	-	-	SO:0001583	missense	0				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.10G>T	12.37:g.123014620G>T	ENSP00000328236:p.Asp4Tyr		A7E2C4|B3KSG2	Missense_Mutation	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.D4Y	ENST00000333479.7	37	c.10	CCDS45002.1	12	.	.	.	.	.	.	.	.	.	.	G	16.20	3.055139	0.55325	.	.	ENSG00000184445	ENST00000450485;ENST00000333479	T;T	0.41065	1.01;1.01	5.36	4.46	0.54185	.	0.121584	0.53938	D	0.000059	T	0.39306	0.1073	L	0.27053	0.805	0.80722	D	1	D;P	0.57257	0.979;0.911	P;P	0.52710	0.707;0.647	T	0.17228	-1.0376	10	0.44086	T	0.13	-12.0832	9.6422	0.39846	0.0783:0.1427:0.779:0.0	.	4;4	E7ES84;P50748	.;KNTC1_HUMAN	Y	4	ENSP00000397992:D4Y;ENSP00000328236:D4Y	ENSP00000328236:D4Y	D	+	1	0	KNTC1	121580573	1.000000	0.71417	1.000000	0.80357	0.317000	0.28152	2.715000	0.47210	1.220000	0.43490	0.591000	0.81541	GAT	KNTC1	-	NULL	ENSG00000184445		0.393	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	55	0.00	0	G			123014620	123014620	+1	no_errors	ENST00000333479	ensembl	human	known	69_37n	missense	26	29.73	11	SNP	1.000	T
LDHA	3939	genome.wustl.edu	37	11	18428760	18428760	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr11:18428760G>A	ENST00000422447.3	+	8	1204	c.931G>A	c.(931-933)Gag>Aag	p.E311K	LDHA_ENST00000227157.4_3'UTR|LDHA_ENST00000430553.2_Missense_Mutation_p.E253K|AC084117.3_ENST00000496975.2_RNA|LDHA_ENST00000379412.5_Missense_Mutation_p.E311K|LDHA_ENST00000396222.2_Intron|LDHA_ENST00000542179.1_Missense_Mutation_p.E311K|LDHA_ENST00000540430.1_Missense_Mutation_p.E340K	NM_001135239.1|NM_005566.3	NP_001128711.1|NP_005557.1	P00338	LDHA_HUMAN	lactate dehydrogenase A	311					cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|cellular response to extracellular stimulus (GO:0031668)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	L-lactate dehydrogenase activity (GO:0004459)			central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(4)	12						TCTGACTTCTGAGGAAGAGGC	0.428																																						dbGAP											0													78.0	75.0	76.0					11																	18428760		2199	4293	6492	-	-	-	SO:0001583	missense	0			X02152	CCDS7839.1, CCDS44549.1, CCDS53609.1, CCDS53610.1, CCDS53611.1	11p15.1	2012-10-02			ENSG00000134333	ENSG00000134333	1.1.1.27		6535	protein-coding gene	gene with protein product		150000				3000353	Standard	NM_005566		Approved		uc010rdd.2	P00338	OTTHUMG00000167721	ENST00000422447.3:c.931G>A	11.37:g.18428760G>A	ENSP00000395337:p.Glu311Lys		B4DKQ2|B7Z5E3|D3DQY3|F8W819|Q53G53|Q6IBM7|Q6ZNV1|Q9UDE8|Q9UDE9	Missense_Mutation	SNP	pfam_Lactate/malate_DH_N,pfam_Lactate/malate_DH_C,superfamily_Lactate_DH/Glyco_Ohase_4_C,pirsf_L-lactate/malate_DH,prints_L-lactate/malate_DH,tigrfam_L-lactate_DH	p.E340K	ENST00000422447.3	37	c.1018	CCDS7839.1	11	.	.	.	.	.	.	.	.	.	.	G	18.58	3.654846	0.67472	.	.	ENSG00000134333	ENST00000422447;ENST00000430553;ENST00000541620;ENST00000445376;ENST00000540430;ENST00000379412;ENST00000542179	T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22	4.87	4.87	0.63330	Lactate/malate dehydrogenase, C-terminal (1);Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (2);	0.190359	0.44902	D	0.000406	T	0.65678	0.2714	L	0.58810	1.83	0.54753	D	0.999988	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.17722	0.007;0.017;0.015;0.019	T	0.62732	-0.6792	10	0.40728	T	0.16	-0.1876	18.4314	0.90627	0.0:0.0:1.0:0.0	.	340;253;284;311	B7Z5E3;B4DKQ2;B4DJI1;P00338	.;.;.;LDHA_HUMAN	K	311;253;283;284;340;311;311	ENSP00000395337:E311K;ENSP00000406172:E253K;ENSP00000445175:E340K;ENSP00000368722:E311K;ENSP00000445331:E311K	ENSP00000368722:E311K	E	+	1	0	LDHA	18385336	1.000000	0.71417	0.392000	0.26245	0.978000	0.69477	7.711000	0.84669	2.427000	0.82271	0.449000	0.29647	GAG	LDHA	-	pfam_Lactate/malate_DH_C,superfamily_Lactate_DH/Glyco_Ohase_4_C,pirsf_L-lactate/malate_DH,tigrfam_L-lactate_DH	ENSG00000134333		0.428	LDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDHA	HGNC	protein_coding	OTTHUMT00000258172.2	52	0.00	0	G	NM_005566		18428760	18428760	+1	no_errors	ENST00000540430	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	0.992	A
LDLRAD1	388633	genome.wustl.edu	37	1	54476002	54476002	+	Missense_Mutation	SNP	C	C	A	rs147345740		TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:54476002C>A	ENST00000371360.1	-	5	439	c.422G>T	c.(421-423)tGt>tTt	p.C141F	LDLRAD1_ENST00000545928.1_Missense_Mutation_p.C98F|LDLRAD1_ENST00000420619.1_Missense_Mutation_p.C102F|LDLRAD1_ENST00000371362.3_Missense_Mutation_p.C52F	NM_001010978.2	NP_001010978.2	Q5T700	LRAD1_HUMAN	low density lipoprotein receptor class A domain containing 1	141	LDL-receptor class A 2; atypical. {ECO:0000255|PROSITE-ProRule:PRU00124}.					integral component of membrane (GO:0016021)				large_intestine(3)|prostate(1)|skin(3)	7						AGTGCCATCACATTTTTGGTC	0.602																																						dbGAP											0													76.0	73.0	74.0					1																	54476002		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30725.1, CCDS60145.1, CCDS60146.1, CCDS60147.1	1p32.3	2008-02-05	2005-10-07		ENSG00000203985	ENSG00000203985			32069	protein-coding gene	gene with protein product			"""low density lipoprotein receptor A domain containing 1"""				Standard	NM_001010978		Approved		uc001cwm.2	Q5T700	OTTHUMG00000008433	ENST00000371360.1:c.422G>T	1.37:g.54476002C>A	ENSP00000360411:p.Cys141Phe		A0PJY0|B7ZME3|Q5T6Z9	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	p.C141F	ENST00000371360.1	37	c.422	CCDS30725.1	1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.673422	0.67928	.	.	ENSG00000203985	ENST00000371362;ENST00000371360;ENST00000545928;ENST00000420619	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	4.88	4.88	0.63580	.	0.000000	0.64402	D	0.000010	D	0.82527	0.5056	M	0.66939	2.045	0.51482	D	0.999927	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84202	0.0451	10	0.87932	D	0	-12.8332	15.9048	0.79419	0.0:1.0:0.0:0.0	.	98;141	B7ZME3;Q5T700	.;LRAD1_HUMAN	F	52;141;98;102	ENSP00000360413:C52F;ENSP00000360411:C141F;ENSP00000445871:C98F;ENSP00000411017:C102F	ENSP00000360411:C141F	C	-	2	0	LDLRAD1	54248590	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	4.846000	0.62860	2.679000	0.91253	0.655000	0.94253	TGT	LDLRAD1	-	superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt	ENSG00000203985		0.602	LDLRAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDLRAD1	HGNC	protein_coding	OTTHUMT00000023243.1	47	0.00	0	C	NM_001010978		54476002	54476002	-1	no_errors	ENST00000371360	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	1.000	A
LRRC18	474354	genome.wustl.edu	37	10	50121646	50121646	+	Silent	SNP	C	C	T	rs376105556		TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr10:50121646C>T	ENST00000374160.3	-	1	631	c.555G>A	c.(553-555)tcG>tcA	p.S185S	WDFY4_ENST00000325239.5_Intron|WDFY4_ENST00000413659.2_Intron|RP11-523O18.7_ENST00000430438.1_RNA|LRRC18_ENST00000298124.3_Silent_p.S185S	NM_001006939.3	NP_001006940.3	Q8N456	LRC18_HUMAN	leucine rich repeat containing 18	185						cytoplasm (GO:0005737)				NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						TGAATATTTCCGACTCACCTG	0.502																																						dbGAP											0													111.0	110.0	110.0					10																	50121646		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY358137	CCDS31197.1	10q11.23	2011-02-10			ENSG00000165383	ENSG00000165383			23199	protein-coding gene	gene with protein product							Standard	NM_001006939		Approved	UNQ933, MGC34773, UNQ9338, VKGE9338	uc001jhd.3	Q8N456	OTTHUMG00000018182	ENST00000374160.3:c.555G>A	10.37:g.50121646C>T			Q6UY02	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S185	ENST00000374160.3	37	c.555	CCDS31197.1	10																																																																																			LRRC18	-	NULL	ENSG00000165383		0.502	LRRC18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC18	HGNC	protein_coding	OTTHUMT00000047964.1	91	0.00	0	C	NM_001006939		50121646	50121646	-1	no_errors	ENST00000374160	ensembl	human	known	69_37n	silent	49	25.76	17	SNP	0.000	T
MAG	4099	genome.wustl.edu	37	19	35786323	35786323	+	Silent	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr19:35786323C>T	ENST00000392213.3	+	3	171	c.12C>T	c.(10-12)ctC>ctT	p.L4L	MAG_ENST00000361922.4_Silent_p.L4L|MAG_ENST00000537831.2_Intron|MAG_ENST00000597035.1_Silent_p.L4L	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	4					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TGATATTCCTCACGGCACTGC	0.552																																						dbGAP											0													249.0	246.0	247.0					19																	35786323		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.12C>T	19.37:g.35786323C>T			B7Z2E5|F5GYC0|Q567S4	Silent	SNP	pfam_Ig_I-set,pfam_CD80_C2-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L4	ENST00000392213.3	37	c.12	CCDS12455.1	19																																																																																			MAG	-	NULL	ENSG00000105695		0.552	MAG-001	KNOWN	basic|CCDS	protein_coding	MAG	HGNC	protein_coding	OTTHUMT00000466071.1	62	0.00	0	C	NM_080600		35786323	35786323	+1	no_errors	ENST00000392213	ensembl	human	known	69_37n	silent	37	19.57	9	SNP	0.998	T
MAP3K5	4217	genome.wustl.edu	37	6	136990511	136990511	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr6:136990511C>T	ENST00000359015.4	-	8	1636	c.1276G>A	c.(1276-1278)Gag>Aag	p.E426K		NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	426					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		AGTGTTGGCTCAGATTCAAAT	0.393																																						dbGAP											0													120.0	123.0	122.0					6																	136990511		2203	4300	6503	-	-	-	SO:0001583	missense	0			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.1276G>A	6.37:g.136990511C>T	ENSP00000351908:p.Glu426Lys		A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E426K	ENST00000359015.4	37	c.1276	CCDS5179.1	6	.	.	.	.	.	.	.	.	.	.	C	35	5.511000	0.96386	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	T	0.10099	2.91	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.25975	0.0633	M	0.61703	1.905	0.80722	D	1	D;D;D	0.76494	0.995;0.999;0.999	D;D;D	0.83275	0.968;0.996;0.995	T	0.00860	-1.1537	10	0.72032	D	0.01	.	19.7105	0.96095	0.0:1.0:0.0:0.0	.	506;271;426	Q59GL6;B4DF67;Q99683	.;.;M3K5_HUMAN	K	426;506	ENSP00000351908:E426K	ENSP00000351908:E426K	E	-	1	0	MAP3K5	137032204	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.705000	0.68355	2.672000	0.90937	0.655000	0.94253	GAG	MAP3K5	-	NULL	ENSG00000197442		0.393	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K5	HGNC	protein_coding	OTTHUMT00000042383.1	91	0.00	0	C			136990511	136990511	-1	no_errors	ENST00000359015	ensembl	human	known	69_37n	missense	43	20.37	11	SNP	1.000	T
MARS	4141	genome.wustl.edu	37	12	57884133	57884133	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr12:57884133G>A	ENST00000262027.5	+	6	768	c.634G>A	c.(634-636)Gag>Aag	p.E212K	MARS_ENST00000447721.2_3'UTR|ARHGAP9_ENST00000550288.1_5'Flank|MARS_ENST00000315473.5_5'UTR|ARHGAP9_ENST00000393797.2_5'Flank	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	212					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	CAGCCCCGCTGAGGGAAGGGC	0.602																																						dbGAP											0													76.0	86.0	83.0					12																	57884133		2203	4300	6503	-	-	-	SO:0001583	missense	0			X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.634G>A	12.37:g.57884133G>A	ENSP00000262027:p.Glu212Lys		B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	pfam_Methionyl/Leucyl_tRNA_Synth,pfam_WHEP-TRS,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Glutathione-S-Trfase_C-like,superfamily_S15_NS1_RNA-bd,superfamily_Thioredoxin-like_fold,pfscan_WHEP-TRS,prints_Met-tRNA_synth,tigrfam_Met-tRNA_synth	p.E212K	ENST00000262027.5	37	c.634	CCDS8942.1	12	.	.	.	.	.	.	.	.	.	.	G	3.423	-0.117666	0.06838	.	.	ENSG00000166986	ENST00000262027	T	0.29917	1.55	4.43	1.28	0.21552	.	0.589450	0.17929	N	0.157231	T	0.16557	0.0398	L	0.29908	0.895	0.22552	N	0.998991	B;B	0.20887	0.049;0.002	B;B	0.19666	0.026;0.005	T	0.29701	-1.0003	10	0.07990	T	0.79	-8.3283	6.8164	0.23833	0.0:0.2734:0.3908:0.3358	.	85;212	B4E0E9;P56192	.;SYMC_HUMAN	K	212	ENSP00000262027:E212K	ENSP00000262027:E212K	E	+	1	0	MARS	56170400	0.369000	0.25039	0.560000	0.28344	0.013000	0.08279	0.537000	0.23144	0.581000	0.29539	0.514000	0.50259	GAG	MARS	-	NULL	ENSG00000166986		0.602	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MARS	HGNC	protein_coding	OTTHUMT00000407014.1	35	0.00	0	G	NM_004990		57884133	57884133	+1	no_errors	ENST00000262027	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.232	A
H3F3B	3021	genome.wustl.edu	37	17	73780650	73780650	+	Intron	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr17:73780650G>A	ENST00000586607.1	-	1	111				MIR4738_ENST00000579134.1_RNA|UNK_ENST00000589666.1_5'Flank|UNK_ENST00000293218.3_5'Flank			P84243	H33_HUMAN	H3 histone, family 3B (H3.3B)						blood coagulation (GO:0007596)|brain development (GO:0007420)|DNA replication-independent nucleosome assembly (GO:0006336)|positive regulation of cell growth (GO:0030307)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nuclear nucleosome (GO:0000788)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			large_intestine(1)|lung(4)|ovary(2)|skin(1)	8	all_cancers(13;1.5e-07)		all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCTTCCCTATGAAACTGAAAA	0.542																																						dbGAP											0													19.0	21.0	21.0					17																	73780650		1733	3805	5538	-	-	-	SO:0001627	intron_variant	0			Z48950	CCDS11729.1	17q25.1	2011-06-01			ENSG00000132475	ENSG00000132475		"""Histones / Replication-independent"""	4765	protein-coding gene	gene with protein product		601058				8586426	Standard	NM_005324		Approved	H3.3B	uc002jpl.3	P84243		ENST00000586607.1:c.9+806C>T	17.37:g.73780650G>A			P06351|P33155|Q5VV55|Q5VV56|Q66I33|Q9V3W4	RNA	SNP	-	NULL	ENST00000586607.1	37	NULL	CCDS11729.1	17																																																																																			MIR4738	-	-	ENSG00000263565		0.542	H3F3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MIR4738	HGNC	protein_coding	OTTHUMT00000448507.1	22	0.00	0	G	NM_005324		73780650	73780650	-1	no_errors	ENST00000579134	ensembl	human	known	69_37n	rna	14	22.22	4	SNP	0.000	A
MKL2	57496	genome.wustl.edu	37	16	14234535	14234535	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr16:14234535G>C	ENST00000574045.1	+	3	227	c.72G>C	c.(70-72)caG>caC	p.Q24H	MKL2_ENST00000318282.5_Missense_Mutation_p.Q24H|MKL2_ENST00000575537.1_3'UTR|MKL2_ENST00000571589.1_Missense_Mutation_p.Q24H			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	0					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.Q24_A27del(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CAAGTCCTCAGAGTGAAGCTG	0.512																																						dbGAP											1	Deletion - In frame(1)	ovary(1)											148.0	123.0	131.0					16																	14234535		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000574045.1:c.72G>C	16.37:g.14234535G>C	ENSP00000459205:p.Gln24His		A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_DNA-bd,smart_RPEL_repeat,smart_SAP_DNA-bd,pfscan_RPEL_repeat,pfscan_SAP_DNA-bd	p.Q24H	ENST00000574045.1	37	c.72	CCDS32391.1	16	.	.	.	.	.	.	.	.	.	.	G	13.42	2.231372	0.39399	.	.	ENSG00000186260	ENST00000318282	.	.	.	5.15	-5.93	0.02254	.	.	.	.	.	T	0.41604	0.1166	L	0.32530	0.975	0.80722	D	1	B;B	0.11235	0.002;0.004	B;B	0.11329	0.003;0.006	T	0.03473	-1.1033	8	0.45353	T	0.12	.	12.4786	0.55829	0.2534:0.1098:0.6367:0.0	.	24;24	B4DGT8;Q9ULH7-4	.;.	H	24	.	ENSP00000339086:Q24H	Q	+	3	2	MKL2	14142036	0.847000	0.29606	0.937000	0.37676	0.976000	0.68499	-0.229000	0.09098	-1.114000	0.02977	-0.808000	0.03180	CAG	MKL2	-	NULL	ENSG00000186260		0.512	MKL2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MKL2	HGNC	protein_coding	OTTHUMT00000436622.1	63	0.00	0	G	NM_014048		14234535	14234535	+1	no_errors	ENST00000318282	ensembl	human	known	69_37n	missense	43	18.87	10	SNP	0.671	C
MYO3A	53904	genome.wustl.edu	37	10	26359066	26359066	+	Silent	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr10:26359066G>A	ENST00000265944.5	+	13	1363	c.1197G>A	c.(1195-1197)aaG>aaA	p.K399K	MYO3A_ENST00000543632.1_Silent_p.K399K	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	399	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TTGGATCAAAGAGAACTGCCA	0.318																																						dbGAP											0													68.0	68.0	68.0					10																	26359066		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.1197G>A	10.37:g.26359066G>A			Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_cat_dom,prints_Myosin_head_motor_dom	p.K399	ENST00000265944.5	37	c.1197	CCDS7148.1	10																																																																																			MYO3A	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000095777		0.318	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO3A	HGNC	protein_coding	OTTHUMT00000047259.1	53	0.00	0	G	NM_017433		26359066	26359066	+1	no_errors	ENST00000265944	ensembl	human	known	69_37n	silent	29	21.62	8	SNP	0.998	A
NICN1	84276	genome.wustl.edu	37	3	49462495	49462495	+	Intron	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr3:49462495G>A	ENST00000273598.3	-	5	582				NICN1-AS1_ENST00000424915.1_RNA|NICN1_ENST00000436744.2_Intron|AMT_ENST00000546031.1_5'Flank|AMT_ENST00000538581.1_5'Flank|AMT_ENST00000273588.3_5'Flank|AMT_ENST00000476226.1_5'Flank|NICN1_ENST00000422593.1_5'UTR|AMT_ENST00000395338.2_5'Flank|AMT_ENST00000458307.2_5'Flank	NM_032316.3	NP_115692.1	Q9BSH3	NICN1_HUMAN	nicolin 1							microtubule (GO:0005874)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(193;4.52e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCCTGCTCCAGAAGGAGGGGT	0.627																																						dbGAP											0													34.0	32.0	33.0					3																	49462495		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AJ299740	CCDS2798.1	3p21.31	2008-07-18			ENSG00000145029	ENSG00000145029			18317	protein-coding gene	gene with protein product		611516				12392556	Standard	NM_032316		Approved	MGC12936	uc003cwz.1	Q9BSH3	OTTHUMG00000156848	ENST00000273598.3:c.496-9C>T	3.37:g.49462495G>A			Q8IZQ2	RNA	SNP	-	NULL	ENST00000273598.3	37	NULL	CCDS2798.1	3																																																																																			NICN1	-	-	ENSG00000145029		0.627	NICN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NICN1	HGNC	protein_coding	OTTHUMT00000346224.3	31	0.00	0	G	NM_032316		49462495	49462495	-1	no_errors	ENST00000422593	ensembl	human	known	69_37n	rna	16	33.33	8	SNP	0.992	A
NSD1	64324	genome.wustl.edu	37	5	176666775	176666775	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr5:176666775G>A	ENST00000439151.2	+	8	4256	c.4211G>A	c.(4210-4212)cGt>cAt	p.R1404H	NSD1_ENST00000354179.4_Missense_Mutation_p.R1135H|NSD1_ENST00000361032.4_Missense_Mutation_p.R1301H|NSD1_ENST00000347982.4_Missense_Mutation_p.R1135H	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1404					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GAAAGTAAACGTCAAAGAAAA	0.328			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																												dbGAP		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0													66.0	67.0	67.0					5																	176666775		2203	4298	6501	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.4211G>A	5.37:g.176666775G>A	ENSP00000395929:p.Arg1404His		Q96PD8|Q96RN7	Missense_Mutation	SNP	pfam_PWWP,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.R1404H	ENST00000439151.2	37	c.4211	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793075	0.90453	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.96554	-4.0;-4.02;-4.0;-4.05	6.16	6.16	0.99307	.	0.000000	0.64402	D	0.000017	D	0.96880	0.8981	L	0.32530	0.975	0.42742	D	0.993744	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.996	D	0.97442	1.0022	10	0.87932	D	0	.	17.7766	0.88510	0.0:0.0:1.0:0.0	.	1135;1301;1404	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	H	1135;1404;1135;1301	ENSP00000346111:R1135H;ENSP00000395929:R1404H;ENSP00000343209:R1135H;ENSP00000354310:R1301H	ENSP00000343209:R1135H	R	+	2	0	NSD1	176599381	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	5.924000	0.70054	2.937000	0.99478	0.650000	0.86243	CGT	NSD1	-	NULL	ENSG00000165671		0.328	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2	44	0.00	0	G	NM_172349		176666775	176666775	+1	no_errors	ENST00000439151	ensembl	human	known	69_37n	missense	25	24.24	8	SNP	1.000	A
NUFIP1	26747	genome.wustl.edu	37	13	45554075	45554075	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr13:45554075C>G	ENST00000379161.4	-	4	653	c.607G>C	c.(607-609)Gat>Cat	p.D203H	RP11-321C24.1_ENST00000437748.2_lincRNA	NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	203					box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		AAAGAGCAATCTAATTCAGGG	0.294																																						dbGAP											0													57.0	59.0	59.0					13																	45554075		2203	4293	6496	-	-	-	SO:0001583	missense	0			AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.607G>C	13.37:g.45554075C>G	ENSP00000368459:p.Asp203His		Q8WVM5|Q96SG1	Missense_Mutation	SNP	pfam_NUFIP1_cons_dom,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D203H	ENST00000379161.4	37	c.607	CCDS9393.1	13	.	.	.	.	.	.	.	.	.	.	C	18.20	3.572044	0.65765	.	.	ENSG00000083635	ENST00000379161	T	0.54866	0.55	5.45	5.45	0.79879	Zinc finger, C2H2-like (1);	0.113631	0.64402	D	0.000016	T	0.67429	0.2892	L	0.57536	1.79	0.43930	D	0.996588	D	0.89917	1.0	D	0.68192	0.956	T	0.67098	-0.5756	10	0.48119	T	0.1	.	14.8001	0.69909	0.0:1.0:0.0:0.0	.	203	Q9UHK0	NUFP1_HUMAN	H	203	ENSP00000368459:D203H	ENSP00000368459:D203H	D	-	1	0	NUFIP1	44452075	0.999000	0.42202	0.986000	0.45419	0.951000	0.60555	5.041000	0.64196	2.547000	0.85894	0.655000	0.94253	GAT	NUFIP1	-	smart_Znf_C2H2-like	ENSG00000083635		0.294	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUFIP1	HGNC	protein_coding	OTTHUMT00000044755.2	42	0.00	0	C	NM_012345		45554075	45554075	-1	no_errors	ENST00000379161	ensembl	human	known	69_37n	missense	34	19.05	8	SNP	0.993	G
TENM1	10178	genome.wustl.edu	37	X	123518123	123518123	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chrX:123518123C>A	ENST00000371130.3	-	29	6700	c.6637G>T	c.(6637-6639)Gat>Tat	p.D2213Y	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.D2220Y	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2213					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CCATCTTCATCCATTTTATAC	0.443																																						dbGAP											0													71.0	67.0	69.0					X																	123518123		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.6637G>T	X.37:g.123518123C>A	ENSP00000360171:p.Asp2213Tyr		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.D2220Y	ENST00000371130.3	37	c.6658	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	19.26	3.792880	0.70452	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.91180	-2.8;-2.75	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.96676	0.8915	M	0.92833	3.35	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.997	D	0.97365	0.9972	10	0.87932	D	0	.	18.9778	0.92745	0.0:1.0:0.0:0.0	.	2219;2220;2213	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	Y	2213;2220	ENSP00000360171:D2213Y;ENSP00000403954:D2220Y	ENSP00000360171:D2213Y	D	-	1	0	ODZ1	123345804	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	2.430000	0.82344	0.544000	0.68410	GAT	ODZ1	-	NULL	ENSG00000009694		0.443	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	44	0.00	0	C	NM_014253		123518123	123518123	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	1.000	A
OR10H1	26539	genome.wustl.edu	37	19	15918842	15918842	+	Silent	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr19:15918842C>T	ENST00000334920.2	-	1	94	c.6G>A	c.(4-6)caG>caA	p.Q2Q		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						GATTGGCTCTCTGCATGGAGG	0.542																																						dbGAP											0													102.0	104.0	103.0					19																	15918842		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.6G>A	19.37:g.15918842C>T			Q6IFQ2|Q96R59	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.Q2	ENST00000334920.2	37	c.6	CCDS12335.1	19																																																																																			OR10H1	-	NULL	ENSG00000186723		0.542	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H1	HGNC	protein_coding	OTTHUMT00000460364.1	34	0.00	0	C			15918842	15918842	-1	no_errors	ENST00000334920	ensembl	human	known	69_37n	silent	20	36.36	12	SNP	0.001	T
OR10J1	26476	genome.wustl.edu	37	1	159410259	159410259	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:159410259G>C	ENST00000423932.3	+	1	748	c.711G>C	c.(709-711)aaG>aaC	p.K237N	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	237					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					CAATCCTCAAGATTGCTTCAG	0.458																																						dbGAP											0													205.0	194.0	197.0					1																	159410259		2203	4300	6503	-	-	-	SO:0001583	missense	0			X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.711G>C	1.37:g.159410259G>C	ENSP00000399078:p.Lys237Asn		Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.K237N	ENST00000423932.3	37	c.711	CCDS1185.1	1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.494995	0.26774	.	.	ENSG00000196184	ENST00000423932	T	0.00183	8.6	4.29	0.0947	0.14482	GPCR, rhodopsin-like superfamily (1);	0.159875	0.29239	N	0.012721	T	0.00073	0.0002	M	0.75085	2.285	0.09310	N	1	B	0.20550	0.046	B	0.33750	0.169	T	0.47724	-0.9095	10	0.66056	D	0.02	.	3.2708	0.06882	0.3795:0.0:0.4421:0.1784	.	237	P30954	O10J1_HUMAN	N	237	ENSP00000399078:K237N	ENSP00000399078:K237N	K	+	3	2	OR10J1	157676883	0.000000	0.05858	0.179000	0.23059	0.950000	0.60333	-0.452000	0.06787	0.142000	0.18901	0.555000	0.69702	AAG	OR10J1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196184		0.458	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J1	HGNC	protein_coding	OTTHUMT00000059020.1	86	0.00	0	G	NM_012351		159410259	159410259	+1	no_errors	ENST00000423932	ensembl	human	known	69_37n	missense	84	18.45	19	SNP	0.028	C
OR4D11	219986	genome.wustl.edu	37	11	59271954	59271954	+	Silent	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr11:59271954G>A	ENST00000313253.1	+	1	906	c.906G>A	c.(904-906)aaG>aaA	p.K302K		NM_001004706.1	NP_001004706.1	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D, member 11	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29						GAAGACTGAAGAGAAGACTCG	0.532																																						dbGAP											0													58.0	55.0	56.0					11																	59271954		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			AB065810	CCDS31563.1	11q12.1	2012-08-09		2004-03-10	ENSG00000176200	ENSG00000176200		"""GPCR / Class A : Olfactory receptors"""	15174	protein-coding gene	gene with protein product				OR4D11P			Standard	NM_001004706		Approved		uc001noa.1	Q8NGI4	OTTHUMG00000167342	ENST00000313253.1:c.906G>A	11.37:g.59271954G>A				Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.K302	ENST00000313253.1	37	c.906	CCDS31563.1	11																																																																																			OR4D11	-	NULL	ENSG00000176200		0.532	OR4D11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D11	HGNC	protein_coding	OTTHUMT00000394236.1	70	0.00	0	G	NM_001004706		59271954	59271954	+1	no_errors	ENST00000313253	ensembl	human	known	69_37n	silent	23	37.84	14	SNP	0.000	A
PBRM1	55193	genome.wustl.edu	37	3	52643679	52643679	+	Silent	SNP	A	A	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr3:52643679A>G	ENST00000296302.7	-	16	2218	c.2217T>C	c.(2215-2217)aaT>aaC	p.N739N	PBRM1_ENST00000409057.1_Silent_p.N739N|PBRM1_ENST00000409767.1_Silent_p.N754N|PBRM1_ENST00000410007.1_Silent_p.N739N|PBRM1_ENST00000356770.4_Silent_p.N707N|PBRM1_ENST00000409114.3_Silent_p.N754N|PBRM1_ENST00000394830.3_Silent_p.N739N|PBRM1_ENST00000337303.4_Silent_p.N739N			Q86U86	PB1_HUMAN	polybromo 1	739	Bromo 5. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.Y738_P741>*(2)|p.E740fs*19(2)|p.Y706_P709>*(1)|p.E708fs*19(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ACTCCGGCTCATTGTATGTAC	0.423			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																	dbGAP		Rec	yes		3	3p21	55193	polybromo 1		E	6	Complex - deletion inframe(3)|Insertion - Frameshift(3)	kidney(6)											135.0	131.0	132.0					3																	52643679		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2217T>C	3.37:g.52643679A>G			A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Silent	SNP	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_superfamily,superfamily_Bromodomain,superfamily_HMG_superfamily,smart_Bromodomain,smart_BAH_dom,smart_HMG_superfamily,pfscan_BAH_dom,pfscan_HMG_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.N739	ENST00000296302.7	37	c.2217		3																																																																																			PBRM1	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain	ENSG00000163939		0.423	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	HGNC	protein_coding	OTTHUMT00000327232.1	66	0.00	0	A	NM_018165		52643679	52643679	-1	no_errors	ENST00000296302	ensembl	human	known	69_37n	silent	35	18.60	8	SNP	1.000	G
PCDH15	65217	genome.wustl.edu	37	10	55568927	55568927	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr10:55568927G>A	ENST00000395445.1	-	36	5277	c.4883C>T	c.(4882-4884)tCa>tTa	p.S1628L	PCDH15_ENST00000395442.1_Missense_Mutation_p.S493L|PCDH15_ENST00000395440.1_Missense_Mutation_p.S562L|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000395438.1_3'UTR|PCDH15_ENST00000409834.1_3'UTR|PCDH15_ENST00000395446.1_Missense_Mutation_p.S824L|PCDH15_ENST00000373965.2_Intron	NM_001142769.1	NP_001136241.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GGGTGTCTCTGACTCAGATTC	0.458										HNSCC(58;0.16)																												dbGAP											0													130.0	109.0	115.0					10																	55568927		1568	3582	5150	-	-	-	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000395445.1:c.4883C>T	10.37:g.55568927G>A	ENSP00000378832:p.Ser1628Leu		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S1628L	ENST00000395445.1	37	c.4883		10	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639171	0.67244	.	.	ENSG00000150275	ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440	T;T;T;D	0.97256	2.12;2.47;2.47;-4.31	5.68	5.68	0.88126	.	.	.	.	.	D	0.92642	0.7662	N	0.14661	0.345	0.80722	D	1	P;P	0.39060	0.657;0.657	B;B	0.37650	0.255;0.255	D	0.91849	0.5490	9	0.17369	T	0.5	.	17.5603	0.87905	0.0:0.0:1.0:0.0	.	1626;1628	C6ZEF5;A2A3E2	.;.	L	1628;824;493;562	ENSP00000378832:S1628L;ENSP00000378833:S824L;ENSP00000378829:S493L;ENSP00000378827:S562L	ENSP00000378827:S562L	S	-	2	0	PCDH15	55238933	0.993000	0.37304	0.996000	0.52242	0.924000	0.55760	5.619000	0.67729	2.673000	0.90976	0.655000	0.94253	TCA	PCDH15	-	NULL	ENSG00000150275		0.458	PCDH15-007	NOVEL	not_organism_supported|basic	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000291335.1	92	0.00	0	G	NM_033056		55568927	55568927	-1	no_errors	ENST00000395445	ensembl	human	novel	69_37n	missense	41	39.71	27	SNP	1.000	A
PCDHGA1	56114	genome.wustl.edu	37	5	140710703	140710703	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr5:140710703G>C	ENST00000517417.1	+	1	452	c.452G>C	c.(451-453)aGa>aCa	p.R151T	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.R151T|AC005618.6_ENST00000606901.1_lincRNA	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	151	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGGTACCAGAGTCTCATTG	0.428																																						dbGAP											0													107.0	114.0	112.0					5																	140710703		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.452G>C	5.37:g.140710703G>C	ENSP00000431083:p.Arg151Thr		Q2M273|Q9Y5D6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R151T	ENST00000517417.1	37	c.452	CCDS54922.1	5	.	.	.	.	.	.	.	.	.	.	G	10.17	1.276132	0.23307	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.51574	0.7;0.7	4.2	2.4	0.29515	Cadherin (3);Cadherin-like (1);	0.129274	0.34531	N	0.003896	T	0.50034	0.1592	M	0.76727	2.345	0.09310	N	1	P;P	0.40909	0.577;0.732	P;B	0.45343	0.477;0.314	T	0.47787	-0.9090	10	0.87932	D	0	.	6.877	0.24153	0.3548:0.0:0.6452:0.0	.	151;151	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	T	151	ENSP00000431083:R151T;ENSP00000367345:R151T	ENSP00000367345:R151T	R	+	2	0	PCDHGA1	140690887	0.312000	0.24545	1.000000	0.80357	0.409000	0.31022	3.128000	0.50492	1.127000	0.42034	0.655000	0.94253	AGA	PCDHGA1	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000204956		0.428	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHGA1	HGNC	protein_coding	OTTHUMT00000374737.1	20	0.00	0	G	NM_018912		140710703	140710703	+1	no_errors	ENST00000517417	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	0.015	C
PCF11	51585	genome.wustl.edu	37	11	82876651	82876651	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr11:82876651C>G	ENST00000298281.4	+	5	1164	c.712C>G	c.(712-714)Ctt>Gtt	p.L238V		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	238					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						GGCAGTTTCTCTTAGTGTTCA	0.378																																						dbGAP											0													49.0	47.0	48.0					11																	82876651		1875	4105	5980	-	-	-	SO:0001583	missense	0			AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.712C>G	11.37:g.82876651C>G	ENSP00000298281:p.Leu238Val		A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	p.L238V	ENST00000298281.4	37	c.712	CCDS44689.1	11	.	.	.	.	.	.	.	.	.	.	C	14.90	2.672842	0.47781	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.47177	1.86;0.88;0.85	5.69	4.76	0.60689	.	0.000000	0.48767	D	0.000167	T	0.63343	0.2503	M	0.62723	1.935	0.35173	D	0.771734	D;D	0.69078	0.996;0.997	P;D	0.72625	0.754;0.978	T	0.72520	-0.4268	9	.	.	.	-10.0855	12.1773	0.54192	0.0:0.918:0.0:0.082	.	238;238	E9PQ01;O94913	.;PCF11_HUMAN	V	238	ENSP00000298281:L238V;ENSP00000434540:L238V;ENSP00000431567:L238V	.	L	+	1	0	PCF11	82554299	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.952000	0.49097	1.334000	0.45468	0.655000	0.94253	CTT	PCF11	-	NULL	ENSG00000165494		0.378	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCF11	HGNC	protein_coding	OTTHUMT00000392548.2	37	0.00	0	C	NM_015885		82876651	82876651	+1	no_errors	ENST00000298281	ensembl	human	known	69_37n	missense	16	42.86	12	SNP	1.000	G
PCSK6	5046	genome.wustl.edu	37	15	101971661	101971661	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr15:101971661C>T	ENST00000348070.1	-	5	517	c.518G>A	c.(517-519)gGc>gAc	p.G173D	PCSK6_ENST00000331826.7_Missense_Mutation_p.G8D|PCSK6_ENST00000358417.3_Missense_Mutation_p.G173D|PCSK6_ENST00000561177.1_5'UTR|PCSK6_ENST00000398181.2_Missense_Mutation_p.G173D|PCSK6_ENST00000344273.2_Missense_Mutation_p.G173D	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	174					determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GTTCTTGTCGCCACAATGCTG	0.557																																						dbGAP											0													56.0	56.0	56.0					15																	101971661		2117	4240	6357	-	-	-	SO:0001583	missense	0				CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.518G>A	15.37:g.101971661C>T	ENSP00000305056:p.Gly173Asp		Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,pfam_PLAC,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EGF-like,prints_Peptidase_S8_subtilisin-rel,pfscan_PLAC	p.G173D	ENST00000348070.1	37	c.518		15	.	.	.	.	.	.	.	.	.	.	C	13.05	2.121273	0.37436	.	.	ENSG00000140479	ENST00000348070;ENST00000358417;ENST00000398185;ENST00000344273;ENST00000398181;ENST00000331826	T;T;T;T;T	0.74947	0.97;0.97;0.97;0.97;-0.89	5.67	2.75	0.32379	Peptidase S8/S53, subtilisin/kexin/sedolisin (2);	0.461467	0.26380	N	0.024704	T	0.50257	0.1605	N	0.15975	0.35	0.09310	N	1	P;B;B;B;B;B;B;B;B	0.43477	0.808;0.001;0.007;0.003;0.002;0.002;0.003;0.065;0.034	B;B;B;B;B;B;B;B;B	0.32864	0.154;0.001;0.009;0.017;0.008;0.008;0.003;0.02;0.01	T	0.46884	-0.9159	10	0.66056	D	0.02	-11.4258	8.2074	0.31463	0.0:0.7223:0.1339:0.1437	.	174;79;173;174;173;173;174;174;173	P29122;Q59H04;E7EUC8;P29122-4;E7EWH5;E7EQ62;P29122-8;P29122-7;E7EM82	PCSK6_HUMAN;.;.;.;.;.;.;.;.	D	173;173;78;173;173;8	ENSP00000305056:G173D;ENSP00000351193:G173D;ENSP00000344410:G173D;ENSP00000381243:G173D;ENSP00000332052:G8D	ENSP00000332052:G8D	G	-	2	0	PCSK6	99789184	0.015000	0.18098	0.007000	0.13788	0.953000	0.61014	1.412000	0.34714	0.334000	0.23590	-0.136000	0.14681	GGC	PCSK6	-	superfamily_Peptidase_S8/S53	ENSG00000140479		0.557	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	PCSK6	HGNC	protein_coding		33	0.00	0	C	NM_002570		101971661	101971661	-1	no_errors	ENST00000348070	ensembl	human	known	69_37n	missense	20	45.95	17	SNP	0.068	T
PDE4DIP	9659	genome.wustl.edu	37	1	144918872	144918872	+	Silent	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:144918872G>A	ENST00000369354.3	-	10	1503	c.1314C>T	c.(1312-1314)caC>caT	p.H438H	PDE4DIP_ENST00000369359.4_Silent_p.H575H|PDE4DIP_ENST00000369349.3_Silent_p.H438H|PDE4DIP_ENST00000369356.4_Silent_p.H438H|PDE4DIP_ENST00000313382.9_Silent_p.H504H|PDE4DIP_ENST00000529945.1_Silent_p.H601H|PDE4DIP_ENST00000479408.2_Silent_p.H225H|PDE4DIP_ENST00000530740.1_Silent_p.H575H|PDE4DIP_ENST00000369351.3_Silent_p.H438H|PDE4DIP_ENST00000313431.9_Silent_p.H601H			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	438					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TATGGTTTAGGTGCTGGATGT	0.408			T	PDGFRB	MPD																																	dbGAP		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													470.0	498.0	488.0					1																	144918872		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.1314C>T	1.37:g.144918872G>A			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.H438	ENST00000369354.3	37	c.1314	CCDS30824.1	1																																																																																			PDE4DIP	-	NULL	ENSG00000178104		0.408	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	213	0.00	0	G	NM_022359		144918872	144918872	-1	no_errors	ENST00000369356	ensembl	human	known	69_37n	silent	163	10.93	20	SNP	0.121	A
PDLIM4	8572	genome.wustl.edu	37	5	131598453	131598453	+	Splice_Site	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr5:131598453G>C	ENST00000253754.3	+	2	309	c.245G>C	c.(244-246)aGg>aCg	p.R82T	PDLIM4_ENST00000379018.3_Splice_Site_p.R82T|P4HA2_ENST00000471826.1_Intron	NM_001131027.1|NM_003687.3	NP_001124499.1|NP_003678.2	P50479	PDLI4_HUMAN	PDZ and LIM domain 4	82	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.						zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|urinary_tract(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCTGTGAGCAGGTATGCACAG	0.587																																						dbGAP											0													82.0	57.0	65.0					5																	131598453		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF153882	CCDS4152.1, CCDS47261.1	5q31.1	2008-02-05			ENSG00000131435	ENSG00000131435			16501	protein-coding gene	gene with protein product		603422				9573374	Standard	NM_001131027		Approved	RIL	uc003kwn.3	P50479	OTTHUMG00000059645	ENST00000253754.3:c.245+1G>C	5.37:g.131598453G>C			B2R8U1|Q53Y39|Q96AT8|Q9BTW8|Q9Y292	Missense_Mutation	SNP	pfam_PDZ,pfam_Znf_LIM,superfamily_PDZ,smart_PDZ,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.R82T	ENST00000253754.3	37	c.245	CCDS4152.1	5	.	.	.	.	.	.	.	.	.	.	G	27.3	4.814637	0.90790	.	.	ENSG00000131435	ENST00000253754;ENST00000379018;ENST00000418373	T;T;T	0.65916	0.2;0.2;-0.18	5.55	5.55	0.83447	PDZ/DHR/GLGF (3);	0.101193	0.64402	D	0.000004	D	0.88001	0.6320	H	0.98951	4.38	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	D;D;P	0.83275	0.968;0.996;0.696	D	0.92619	0.6106	10	0.87932	D	0	-17.4154	16.9926	0.86358	0.0:0.0:1.0:0.0	.	82;23;82	P50479-2;C9J542;P50479	.;.;PDLI4_HUMAN	T	82;82;23	ENSP00000253754:R82T;ENSP00000368303:R82T;ENSP00000411753:R23T	ENSP00000253754:R82T	R	+	2	0	PDLIM4	131626352	1.000000	0.71417	1.000000	0.80357	0.746000	0.42486	8.736000	0.91554	2.608000	0.88229	0.609000	0.83330	AGG	PDLIM4	-	superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000131435		0.587	PDLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDLIM4	HGNC	protein_coding	OTTHUMT00000132644.2	32	0.00	0	G	NM_003687	Missense_Mutation	131598453	131598453	+1	no_errors	ENST00000253754	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	1.000	C
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	68	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	25	52.83	28	SNP	1.000	A
PJA2	9867	genome.wustl.edu	37	5	108714508	108714508	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr5:108714508C>T	ENST00000361189.2	-	4	919	c.680G>A	c.(679-681)aGa>aAa	p.R227K	PJA2_ENST00000511624.1_5'Flank|PJA2_ENST00000361557.3_Missense_Mutation_p.R227K	NM_014819.4	NP_055634.3	O43164	PJA2_HUMAN	praja ring finger 2, E3 ubiquitin protein ligase	227					long-term memory (GO:0007616)|protein ubiquitination (GO:0016567)|regulation of protein kinase A signaling (GO:0010738)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		AAACTCATCTCTTACTTCACA	0.408																																						dbGAP											0													117.0	114.0	115.0					5																	108714508		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB007898	CCDS4099.1	5q22.1	2013-01-09	2012-02-23	2003-06-05	ENSG00000198961	ENSG00000198961		"""RING-type (C3HC4) zinc fingers"""	17481	protein-coding gene	gene with protein product			"""ring finger protein 131"", ""praja ring finger 2"""	RNF131			Standard	NM_014819		Approved	KIAA0438, Neurodap1	uc003kos.4	O43164	OTTHUMG00000128750	ENST00000361189.2:c.680G>A	5.37:g.108714508C>T	ENSP00000354775:p.Arg227Lys		A8K6U4|D3DSZ5|Q68D49|Q8N1G5	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.R227K	ENST00000361189.2	37	c.680	CCDS4099.1	5	.	.	.	.	.	.	.	.	.	.	C	6.040	0.375795	0.11409	.	.	ENSG00000198961	ENST00000361189;ENST00000361557	T;T	0.05025	3.51;3.51	5.98	0.897	0.19258	.	0.599126	0.18263	N	0.146567	T	0.03651	0.0104	N	0.22421	0.69	0.09310	N	1	B	0.18013	0.025	B	0.12837	0.008	T	0.45160	-0.9280	10	0.20046	T	0.44	-2.8651	5.4311	0.16454	0.0:0.5018:0.1313:0.3669	.	227	O43164	PJA2_HUMAN	K	227	ENSP00000354775:R227K;ENSP00000355284:R227K	ENSP00000354775:R227K	R	-	2	0	PJA2	108742407	0.000000	0.05858	0.023000	0.16930	0.695000	0.40330	-0.245000	0.08890	0.084000	0.17077	-0.355000	0.07637	AGA	PJA2	-	NULL	ENSG00000198961		0.408	PJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PJA2	HGNC	protein_coding	OTTHUMT00000250663.1	58	0.00	0	C	NM_014819		108714508	108714508	-1	no_errors	ENST00000361189	ensembl	human	known	69_37n	missense	45	13.46	7	SNP	0.122	T
PSG8	440533	genome.wustl.edu	37	19	43268108	43268108	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr19:43268108C>G	ENST00000306511.4	-	2	487	c.390G>C	c.(388-390)gaG>gaC	p.E130D	PSG8_ENST00000406636.3_Intron|PSG8_ENST00000404209.4_Missense_Mutation_p.E130D|PSG8_ENST00000401467.2_Missense_Mutation_p.E130D	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	130	Ig-like V-type.					extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				CTCCTCTATTCTCATCACCTC	0.468																																						dbGAP											0													349.0	333.0	339.0					19																	43268108		2203	4299	6502	-	-	-	SO:0001583	missense	0			M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.390G>C	19.37:g.43268108C>G	ENSP00000305005:p.Glu130Asp		A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E130D	ENST00000306511.4	37	c.390	CCDS33037.1	19	.	.	.	.	.	.	.	.	.	.	c	0.010	-1.780207	0.00634	.	.	ENSG00000124467	ENST00000404209;ENST00000292109;ENST00000401467;ENST00000407488;ENST00000306511	T;T;T	0.20598	2.06;3.16;2.06	1.35	-2.7	0.06004	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.16514	0.0397	L	0.49126	1.545	0.09310	N	1	B;B;B;B;B	0.17465	0.001;0.02;0.022;0.001;0.002	B;B;B;B;B	0.34824	0.004;0.19;0.116;0.009;0.016	T	0.45220	-0.9276	9	0.15952	T	0.53	.	0.6635	0.00846	0.1642:0.2516:0.2913:0.293	.	130;130;130;130;130	B5MCQ0;Q9UQ74;E7ENH0;Q9UQ74-3;A5PKV3	.;PSG8_HUMAN;.;.;.	D	130;5;130;130;130	ENSP00000385869:E130D;ENSP00000386090:E130D;ENSP00000305005:E130D	ENSP00000292109:E5D	E	-	3	2	PSG8	47959948	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.089000	0.03376	-2.959000	0.00290	0.184000	0.17185	GAG	PSG8	-	smart_Ig_sub	ENSG00000124467		0.468	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG8	HGNC	protein_coding	OTTHUMT00000464526.1	193	0.00	0	C			43268108	43268108	-1	no_errors	ENST00000306511	ensembl	human	known	69_37n	missense	121	18.79	28	SNP	0.000	G
RBL1	5933	genome.wustl.edu	37	20	35684594	35684594	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr20:35684594G>C	ENST00000373664.3	-	10	1384	c.1318C>G	c.(1318-1320)Caa>Gaa	p.Q440E	RBL1_ENST00000344359.3_Missense_Mutation_p.Q440E	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1	440	Domain A.|Pocket; binds T and E1A.				chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				GTATAGTGTTGACAGAAAGTC	0.363																																						dbGAP											0													168.0	140.0	149.0					20																	35684594		2203	4300	6503	-	-	-	SO:0001583	missense	0			L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.1318C>G	20.37:g.35684594G>C	ENSP00000362768:p.Gln440Glu		A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Missense_Mutation	SNP	pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,pfam_Rb_C,superfamily_Cyclin-like,smart_Cyclin-like	p.Q440E	ENST00000373664.3	37	c.1318	CCDS13289.1	20	.	.	.	.	.	.	.	.	.	.	G	12.23	1.874663	0.33069	.	.	ENSG00000080839	ENST00000373664;ENST00000344359	D;D	0.86865	-2.18;-2.18	4.64	4.64	0.57946	Retinoblastoma-associated protein, A-box (1);Cyclin-like (2);	0.346172	0.31347	N	0.007813	T	0.74619	0.3740	N	0.20881	0.62	0.32598	N	0.526335	B;B	0.12013	0.004;0.005	B;B	0.16289	0.004;0.015	T	0.65990	-0.6034	10	0.02654	T	1	-9.0287	11.4392	0.50086	0.0864:0.0:0.9136:0.0	.	440;440	P28749-2;P28749	.;RBL1_HUMAN	E	440	ENSP00000362768:Q440E;ENSP00000343646:Q440E	ENSP00000343646:Q440E	Q	-	1	0	RBL1	35118008	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	2.692000	0.47018	2.423000	0.82170	0.650000	0.86243	CAA	RBL1	-	pfam_RB_A,superfamily_Cyclin-like	ENSG00000080839		0.363	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBL1	HGNC	protein_coding	OTTHUMT00000079067.2	102	0.00	0	G	NM_002895		35684594	35684594	-1	no_errors	ENST00000373664	ensembl	human	known	69_37n	missense	58	37.63	35	SNP	0.998	C
RFFL	117584	genome.wustl.edu	37	17	33353466	33353466	+	Missense_Mutation	SNP	G	G	A	rs546308606		TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr17:33353466G>A	ENST00000315249.7	-	2	329	c.107C>T	c.(106-108)tCc>tTc	p.S36F	RFFL_ENST00000413582.2_Missense_Mutation_p.S36F|RAD51L3-RFFL_ENST00000593039.1_Intron|RFFL_ENST00000394597.2_Missense_Mutation_p.S36F|RFFL_ENST00000584655.1_Missense_Mutation_p.S36F|RFFL_ENST00000415395.2_Missense_Mutation_p.S36F|RFFL_ENST00000378516.2_Missense_Mutation_p.S36F|RFFL_ENST00000447669.2_Missense_Mutation_p.S36F|RFFL_ENST00000268850.7_Missense_Mutation_p.S36F					ring finger and FYVE-like domain containing E3 ubiquitin protein ligase											kidney(1)|large_intestine(2)|lung(3)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		GGAAGGGAAGGAGCTGTACCC	0.597																																						dbGAP											0													87.0	65.0	72.0					17																	33353466		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF434816	CCDS11286.1	17q12	2012-02-23	2012-02-23		ENSG00000092871	ENSG00000092871		"""RING-type (C3HC4) zinc fingers"""	24821	protein-coding gene	gene with protein product		609735	"""ring finger and FYVE-like domain containing"""			15229288	Standard	NR_037713		Approved	rififylin, fring, RNF189, RNF34L	uc002hin.1	Q8WZ73	OTTHUMG00000132933	ENST00000315249.7:c.107C>T	17.37:g.33353466G>A	ENSP00000326170:p.Ser36Phe			Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,smart_Znf_RING,pfscan_Znf_RING	p.S36F	ENST00000315249.7	37	c.107	CCDS11286.1	17	.	.	.	.	.	.	.	.	.	.	G	19.02	3.745919	0.69418	.	.	ENSG00000092871	ENST00000315249;ENST00000394597;ENST00000378516;ENST00000268850;ENST00000413582;ENST00000415395;ENST00000414419;ENST00000447669	T;T;T;T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15	5.21	3.18	0.36537	Zinc finger, FYVE/PHD-type (1);	0.113755	0.56097	D	0.000024	T	0.81356	0.4805	L	0.39898	1.24	0.44908	D	0.997926	D;D;D;D	0.76494	0.999;0.998;0.995;0.999	D;D;P;D	0.83275	0.996;0.935;0.901;0.996	T	0.80915	-0.1169	10	0.48119	T	0.1	-20.2855	11.2819	0.49199	0.1497:0.0:0.8503:0.0	.	36;36;36;36	C9JN73;Q8WZ73-3;Q8WZ73;Q8WZ73-2	.;.;RFFL_HUMAN;.	F	36	ENSP00000326170:S36F;ENSP00000378096:S36F;ENSP00000367777:S36F;ENSP00000268850:S36F;ENSP00000408513:S36F;ENSP00000412322:S36F;ENSP00000395090:S36F;ENSP00000389832:S36F	ENSP00000268850:S36F	S	-	2	0	RFFL	30377579	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.802000	0.55553	1.437000	0.47472	0.650000	0.86243	TCC	RFFL	-	superfamily_Znf_FYVE_PHD	ENSG00000092871		0.597	RFFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFFL	HGNC	protein_coding	OTTHUMT00000256460.2	37	0.00	0	G	NM_057178		33353466	33353466	-1	no_errors	ENST00000315249	ensembl	human	known	69_37n	missense	18	30.77	8	SNP	1.000	A
RGPD3	653489	genome.wustl.edu	37	2	107049424	107049424	+	Silent	SNP	C	C	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr2:107049424C>A	ENST00000409886.3	-	17	2523	c.2436G>T	c.(2434-2436)ctG>ctT	p.L812L	RGPD3_ENST00000304514.7_Silent_p.L812L	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	812					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						GAATCATTTTCAGTAAAGAAT	0.348																																						dbGAP											0													3.0	3.0	3.0					2																	107049424		521	1257	1778	-	-	-	SO:0001819	synonymous_variant	0				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2436G>T	2.37:g.107049424C>A			B8ZZM4	Silent	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.L812	ENST00000409886.3	37	c.2436	CCDS46379.1	2																																																																																			RGPD3	-	NULL	ENSG00000153165		0.348	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	130	0.00	0	C	XM_929931		107049424	107049424	-1	no_errors	ENST00000304514	ensembl	human	known	69_37n	silent	74	25.25	25	SNP	1.000	A
RND1	27289	genome.wustl.edu	37	12	49251830	49251830	+	Silent	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr12:49251830G>A	ENST00000309739.5	-	5	778	c.648C>T	c.(646-648)ctC>ctT	p.L216L		NM_014470.3	NP_055285.1	Q92730	RND1_HUMAN	Rho family GTPase 1	216					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|GTP catabolic process (GO:0006184)|negative regulation of cell adhesion (GO:0007162)|neuron remodeling (GO:0016322)|small GTPase mediated signal transduction (GO:0007264)	adherens junction (GO:0005912)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(2)|skin(1)|urinary_tract(1)	10						TAGAAGAGATGAGTTCAGAGC	0.542																																						dbGAP											0													130.0	123.0	125.0					12																	49251830		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y07923	CCDS8771.1	12q12	2008-01-23				ENSG00000172602			18314	protein-coding gene	gene with protein product	"""ras homolog gene family, member S"""	609038				9531558	Standard	NM_014470		Approved	Rho6, ARHS, RHOS	uc001rsn.3	Q92730	OTTHUMG00000170400	ENST00000309739.5:c.648C>T	12.37:g.49251830G>A			A8K9P7	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L216	ENST00000309739.5	37	c.648	CCDS8771.1	12																																																																																			RND1	-	NULL	ENSG00000172602		0.542	RND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RND1	HGNC	protein_coding	OTTHUMT00000408915.1	85	0.00	0	G	NM_014470		49251830	49251830	-1	no_errors	ENST00000309739	ensembl	human	known	69_37n	silent	34	37.04	20	SNP	1.000	A
RPL10	6134	genome.wustl.edu	37	X	153628244	153628244	+	Missense_Mutation	SNP	C	C	G	rs138325578	byFrequency	TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chrX:153628244C>G	ENST00000369817.2	+	6	867	c.291C>G	c.(289-291)atC>atG	p.I97M	RPL10_ENST00000406022.2_Missense_Mutation_p.I46M|SNORA70_ENST00000384436.1_RNA|RPL10_ENST00000424325.2_Missense_Mutation_p.I97M			P27635	RL10_HUMAN	ribosomal protein L10	97					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCCACGTCATCCGCATCAACA	0.507																																						dbGAP											0													57.0	52.0	54.0					X																	153628244		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB007170	CCDS14746.1, CCDS76059.1	Xq28	2011-04-06			ENSG00000147403	ENSG00000147403		"""L ribosomal proteins"""	10298	protein-coding gene	gene with protein product		312173				9582194	Standard	NM_006013		Approved	NOV, QM, DXS648E, DXS648, FLJ23544, L10	uc004fkm.2	P27635	OTTHUMG00000033189	ENST00000369817.2:c.291C>G	X.37:g.153628244C>G	ENSP00000358832:p.Ile97Met		A3KQT0|D3DWW6|Q16470|Q2HXT7|Q53FH7|Q6FGN8|Q8TDA5	Missense_Mutation	SNP	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	p.I97M	ENST00000369817.2	37	c.291	CCDS14746.1	X	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671630	0.67928	.	.	ENSG00000147403	ENST00000369817;ENST00000424325;ENST00000436473;ENST00000344746;ENST00000458500;ENST00000406022;ENST00000451365;ENST00000427682;ENST00000449494;ENST00000428169	T;T;T;T	0.74632	-0.85;-0.85;-0.85;-0.86	4.88	3.11	0.35812	Ribosomal protein L10e/L16 (2);	0.169386	0.41294	U	0.000909	D	0.87838	0.6278	H	0.94808	3.585	0.58432	D	0.999994	D;P;D	0.57899	0.978;0.48;0.981	D;P;D	0.73708	0.946;0.706;0.981	D	0.86510	0.1809	10	0.62326	D	0.03	-30.7641	8.5387	0.33379	0.0:0.8039:0.0:0.1961	.	46;97;97	F8W7C6;A6QRI9;P27635	.;.;RL10_HUMAN	M	97;97;97;97;97;46;80;7;7;7	ENSP00000358832:I97M;ENSP00000413436:I97M;ENSP00000341730:I97M;ENSP00000385621:I46M	ENSP00000341730:I97M	I	+	3	3	RPL10	153281438	1.000000	0.71417	0.999000	0.59377	0.849000	0.48306	4.393000	0.59665	0.332000	0.23536	0.513000	0.50165	ATC	RPL10	-	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	ENSG00000147403		0.507	RPL10-008	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL10	HGNC	protein_coding	OTTHUMT00000127774.5	52	0.00	0	C	NM_006013		153628244	153628244	+1	no_errors	ENST00000344746	ensembl	human	known	69_37n	missense	43	18.87	10	SNP	1.000	G
RPL22P19	644022	genome.wustl.edu	37	12	125420366	125420367	+	RNA	INS	-	-	T	rs568536373|rs111807895	byFrequency	TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr12:125420366_125420367insT	ENST00000480427.1	-	0	74_75									ribosomal protein L22 pseudogene 19																		AACCTGCTTCCTTTTTTTTAGC	0.45																																						dbGAP											0																																										-	-	-			0					12q24.31	2009-03-11				ENSG00000241129			36567	pseudogene	pseudogene						19123937	Standard	NG_010946		Approved						12.37:g.125420374_125420374dupT				RNA	INS	-	NULL	ENST00000480427.1	37	NULL		12																																																																																			RPL22P19	-	-	ENSG00000241129		0.450	RPL22P19-002	KNOWN	basic	processed_transcript	RPL22P19	HGNC	pseudogene	OTTHUMT00000351190.1	9	0.00	0	-	NG_010946		125420366	125420367	-1	no_errors	ENST00000480427	ensembl	human	known	69_37n	rna	5	37.50	3	INS	1.000:1.000	T
SENP6	26054	genome.wustl.edu	37	6	76380360	76380360	+	Missense_Mutation	SNP	C	C	T	rs550031341	byFrequency	TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr6:76380360C>T	ENST00000447266.2	+	11	1794	c.1316C>T	c.(1315-1317)tCc>tTc	p.S439F	SENP6_ENST00000370014.3_Missense_Mutation_p.S439F|SENP6_ENST00000327284.8_Missense_Mutation_p.S432F|SENP6_ENST00000370010.2_Missense_Mutation_p.S432F|SENP6_ENST00000541192.1_Missense_Mutation_p.S35F	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	439					protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				TGCCAAAGTTCCTTTGACAGT	0.383													C|||	5	0.000998403	0.0	0.0	5008	,	,		13527	0.0		0.0	False		,,,				2504	0.0051					dbGAP											0													100.0	89.0	93.0					6																	76380360		1822	4082	5904	-	-	-	SO:0001583	missense	0				CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.1316C>T	6.37:g.76380360C>T	ENSP00000402527:p.Ser439Phe		A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.S439F	ENST00000447266.2	37	c.1316	CCDS47454.1	6	.	.	.	.	.	.	.	.	.	.	C	12.42	1.932241	0.34096	.	.	ENSG00000112701	ENST00000370010;ENST00000370014;ENST00000538088;ENST00000327284;ENST00000447266;ENST00000424947;ENST00000541192	T;T;T;T;T;T	0.33216	2.64;2.63;1.42;2.64;1.42;1.43	5.27	3.27	0.37495	.	1.208880	0.05488	N	0.556045	T	0.19446	0.0467	L	0.44542	1.39	0.24340	N	0.994967	P;P;P	0.47409	0.895;0.832;0.797	P;P;P	0.50860	0.652;0.45;0.57	T	0.20806	-1.0264	10	0.14252	T	0.57	3.3036	11.8088	0.52171	0.1443:0.732:0.1237:0.0	.	432;439;432	Q9GZR1-2;Q9GZR1;F8W6D9	.;SENP6_HUMAN;.	F	432;439;288;432;439;329;35	ENSP00000359027:S432F;ENSP00000359031:S439F;ENSP00000321820:S432F;ENSP00000402527:S439F;ENSP00000391426:S329F;ENSP00000441715:S35F	ENSP00000321820:S432F	S	+	2	0	SENP6	76437080	0.989000	0.36119	0.780000	0.31762	0.557000	0.35523	1.647000	0.37260	1.208000	0.43306	0.655000	0.94253	TCC	SENP6	-	NULL	ENSG00000112701		0.383	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP6	HGNC	protein_coding	OTTHUMT00000041272.2	79	0.00	0	C	NM_015571		76380360	76380360	+1	no_errors	ENST00000370014	ensembl	human	known	69_37n	missense	42	26.32	15	SNP	0.830	T
SETBP1	26040	genome.wustl.edu	37	18	42281646	42281646	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr18:42281646G>A	ENST00000282030.5	+	2	631	c.335G>A	c.(334-336)cGg>cAg	p.R112Q	SETBP1_ENST00000426838.4_Missense_Mutation_p.R112Q	NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	112						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		ACCACAAAGCGGGCTAAGAAA	0.473									Schinzel-Giedion syndrome																													dbGAP											0													80.0	85.0	83.0					18																	42281646		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.335G>A	18.37:g.42281646G>A	ENSP00000282030:p.Arg112Gln		A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	smart_AT_hook_DNA-bd_motif	p.R112Q	ENST00000282030.5	37	c.335	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	G	34	5.292303	0.95546	.	.	ENSG00000152217	ENST00000426838;ENST00000282030;ENST00000552979	D	0.86230	-2.09	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.92691	0.7677	L	0.59436	1.845	0.43246	D	0.995162	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.92902	0.6340	10	0.87932	D	0	.	19.7784	0.96405	0.0:0.0:1.0:0.0	.	112;112	Q9Y6X0;Q9Y6X0-2	SETBP_HUMAN;.	Q	112	ENSP00000282030:R112Q	ENSP00000282030:R112Q	R	+	2	0	SETBP1	40535644	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.771000	0.98977	2.658000	0.90341	0.591000	0.81541	CGG	SETBP1	-	NULL	ENSG00000152217		0.473	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4	35	0.00	0	G	NM_001130110		42281646	42281646	+1	no_errors	ENST00000282030	ensembl	human	known	69_37n	missense	23	28.12	9	SNP	1.000	A
SF3B1	23451	genome.wustl.edu	37	2	198267493	198267493	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr2:198267493C>G	ENST00000335508.6	-	14	1955	c.1864G>C	c.(1864-1866)Gag>Cag	p.E622Q	SF3B1_ENST00000462613.1_5'Flank|SNORA4_ENST00000365564.1_RNA	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	622					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CGGACATACTCATCCATGTTA	0.418			Mis		myelodysplastic syndrome																																	dbGAP		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	0													90.0	86.0	88.0					2																	198267493		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1864G>C	2.37:g.198267493C>G	ENSP00000335321:p.Glu622Gln		E9PCH3	Missense_Mutation	SNP	pfam_SF3b_su1,superfamily_ARM-type_fold	p.E622Q	ENST00000335508.6	37	c.1864	CCDS33356.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.226422	0.95173	.	.	ENSG00000115524	ENST00000335508	T	0.67171	-0.25	5.82	5.82	0.92795	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88097	0.6345	H	0.95539	3.685	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.90807	0.4698	10	0.87932	D	0	.	20.0991	0.97865	0.0:1.0:0.0:0.0	.	622	O75533	SF3B1_HUMAN	Q	622	ENSP00000335321:E622Q	ENSP00000335321:E622Q	E	-	1	0	SF3B1	197975738	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.728000	0.84847	2.752000	0.94435	0.655000	0.94253	GAG	SF3B1	-	superfamily_ARM-type_fold	ENSG00000115524		0.418	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	HGNC	protein_coding	OTTHUMT00000335245.2	47	0.00	0	C			198267493	198267493	-1	no_errors	ENST00000335508	ensembl	human	known	69_37n	missense	29	34.09	15	SNP	1.000	G
SH3PXD2A	9644	genome.wustl.edu	37	10	105372651	105372651	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr10:105372651G>C	ENST00000369774.4	-	12	1493	c.1217C>G	c.(1216-1218)tCt>tGt	p.S406C	SH3PXD2A_ENST00000538130.1_Missense_Mutation_p.S241C|RP11-416N2.4_ENST00000609691.1_RNA|SH3PXD2A_ENST00000427662.2_Missense_Mutation_p.S268C|SH3PXD2A_ENST00000355946.2_Missense_Mutation_p.S378C|SH3PXD2A_ENST00000315994.6_5'UTR|SH3PXD2A_ENST00000540321.1_Missense_Mutation_p.S273C			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	406					superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		CACAGCTGGAGAGCCCTGGGC	0.602																																						dbGAP											0													35.0	33.0	34.0					10																	105372651		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.1217C>G	10.37:g.105372651G>C	ENSP00000358789:p.Ser406Cys		D3DR98|O43302|Q5TCZ2|Q5TDQ8	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Phox,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.S406C	ENST00000369774.4	37	c.1217		10	.	.	.	.	.	.	.	.	.	.	G	27.7	4.859013	0.91433	.	.	ENSG00000107957	ENST00000427662;ENST00000369774;ENST00000355946;ENST00000315994;ENST00000536035;ENST00000540321;ENST00000538130	T;T;T;T;T	0.56444	0.46;0.46;0.46;0.46;0.46	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.71204	0.3312	M	0.61703	1.905	0.80722	D	1	D;D;D;B;D	0.89917	0.999;0.999;1.0;0.409;1.0	D;D;D;B;D	0.76575	0.964;0.962;0.976;0.23;0.988	T	0.66654	-0.5869	10	0.35671	T	0.21	-13.7544	19.9983	0.97395	0.0:0.0:1.0:0.0	.	406;255;268;251;378	Q5TCZ1;B7Z9L8;F8WCK5;B7Z3B0;Q5TCZ1-3	SPD2A_HUMAN;.;.;.;.	C	268;406;378;213;321;273;241	ENSP00000392664:S268C;ENSP00000358789:S406C;ENSP00000348215:S378C;ENSP00000443663:S273C;ENSP00000441514:S241C	ENSP00000318135:S213C	S	-	2	0	SH3PXD2A	105362641	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	8.006000	0.88564	2.724000	0.93272	0.561000	0.74099	TCT	SH3PXD2A	-	NULL	ENSG00000107957		0.602	SH3PXD2A-001	KNOWN	basic	protein_coding	SH3PXD2A	HGNC	protein_coding	OTTHUMT00000050178.1	25	0.00	0	G	NM_014631		105372651	105372651	-1	no_errors	ENST00000369774	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	1.000	C
SLC16A14	151473	genome.wustl.edu	37	2	230910840	230910840	+	Silent	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr2:230910840G>A	ENST00000295190.4	-	4	1460	c.1002C>T	c.(1000-1002)ttC>ttT	p.F334F		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	334						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		GGAGGTGAATGAAGGGGATGA	0.403																																						dbGAP											0													66.0	65.0	65.0					2																	230910840		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.1002C>T	2.37:g.230910840G>A			A8KA08|Q53R92|Q96NI7	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.F334	ENST00000295190.4	37	c.1002	CCDS2473.1	2																																																																																			SLC16A14	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000163053		0.403	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A14	HGNC	protein_coding	OTTHUMT00000256918.2	49	0.00	0	G	NM_152527		230910840	230910840	-1	no_errors	ENST00000295190	ensembl	human	known	69_37n	silent	26	21.21	7	SNP	1.000	A
SLCO4C1	353189	genome.wustl.edu	37	5	101631645	101631645	+	Silent	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr5:101631645G>A	ENST00000310954.6	-	1	608	c.322C>T	c.(322-324)Ctg>Ttg	p.L108L		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1									p.L108L(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		TAGTGAAGCAGAAAGCCTCCA	0.627																																						dbGAP											1	Substitution - coding silent(1)	urinary_tract(1)											61.0	60.0	60.0					5																	101631645		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.322C>T	5.37:g.101631645G>A				Silent	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.L108	ENST00000310954.6	37	c.322	CCDS34205.1	5																																																																																			SLCO4C1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000173930		0.627	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO4C1	HGNC	protein_coding	OTTHUMT00000370332.1	38	0.00	0	G	NM_180991		101631645	101631645	-1	no_errors	ENST00000310954	ensembl	human	known	69_37n	silent	19	17.39	4	SNP	0.432	A
SMPD1	6609	genome.wustl.edu	37	11	6412070	6412070	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr11:6412070G>C	ENST00000342245.4	+	1	410	c.242G>C	c.(241-243)cGa>cCa	p.R81P	SMPD1_ENST00000527275.1_Missense_Mutation_p.R81P|SMPD1_ENST00000356761.2_Missense_Mutation_p.R81P|SMPD1_ENST00000533196.1_Intron|SMPD1_ENST00000299397.3_Missense_Mutation_p.R81P	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	79					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	CCCCGGCTCCGAGATGTCTTT	0.602																																						dbGAP											0													56.0	59.0	58.0					11																	6412070		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.242G>C	11.37:g.6412070G>C	ENSP00000340409:p.Arg81Pro		A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Missense_Mutation	SNP	pirsf_Sphingomy_PDE,pfam_Metallo_PEstase_dom,superfamily_Saposin-like,smart_SaposinB,pfscan_SaposinB	p.R81P	ENST00000342245.4	37	c.242	CCDS44531.1	11	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686258	0.47991	.	.	ENSG00000166311	ENST00000299397;ENST00000356761;ENST00000342245;ENST00000527275	T;T;T;T	0.10477	2.87;2.87;2.88;2.88	5.27	2.23	0.28157	.	0.439077	0.19162	N	0.121172	T	0.09686	0.0238	L	0.29908	0.895	0.09310	N	1	P;P;P	0.36660	0.564;0.465;0.564	B;B;B	0.42851	0.169;0.4;0.169	T	0.22977	-1.0201	10	0.37606	T	0.19	-30.5647	6.859	0.24056	0.3602:0.0:0.6398:0.0	.	81;81;79	E9PKS3;G3XAB5;P17405	.;.;ASM_HUMAN	P	81	ENSP00000299397:R81P;ENSP00000349203:R81P;ENSP00000340409:R81P;ENSP00000435350:R81P	ENSP00000299397:R81P	R	+	2	0	SMPD1	6368646	0.000000	0.05858	0.103000	0.21229	0.204000	0.24138	0.226000	0.17776	0.143000	0.18926	0.563000	0.77884	CGA	SMPD1	-	pirsf_Sphingomy_PDE	ENSG00000166311		0.602	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMPD1	HGNC	protein_coding	OTTHUMT00000384205.1	29	0.00	0	G	NM_000543		6412070	6412070	+1	no_errors	ENST00000342245	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	0.223	C
STEAP1	26872	genome.wustl.edu	37	7	89790576	89790576	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr7:89790576C>G	ENST00000297205.2	+	3	742	c.542C>G	c.(541-543)tCt>tGt	p.S181C	STEAP2-AS1_ENST00000478318.2_RNA	NM_012449.2	NP_036581.1	Q9UHE8	STEA1_HUMAN	six transmembrane epithelial antigen of the prostate 1	181	Ferric oxidoreductase.				ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|transmembrane transport (GO:0055085)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	channel activity (GO:0015267)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	14	all_hematologic(106;0.112)					TATAGTCTGTCTTACCCAATG	0.383																																						dbGAP											0													98.0	82.0	88.0					7																	89790576		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF186249	CCDS5614.1	7q21	2011-08-31	2005-02-21	2005-02-24	ENSG00000164647	ENSG00000164647		"""Serine peptidases / Serine peptidases"""	11378	protein-coding gene	gene with protein product		604415	"""six transmembrane epithelial antigen of the prostate"""	STEAP			Standard	NM_012449		Approved	PRSS24	uc003ujx.3	Q9UHE8	OTTHUMG00000023006	ENST00000297205.2:c.542C>G	7.37:g.89790576C>G	ENSP00000297205:p.Ser181Cys		A4D1E0|O95034	Missense_Mutation	SNP	pfam_Fe3_Rdtase_TM_dom	p.S181C	ENST00000297205.2	37	c.542	CCDS5614.1	7	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.757565	0.00657	.	.	ENSG00000164647	ENST00000297205	D	0.91068	-2.78	5.15	4.25	0.50352	Flavoprotein transmembrane component (1);	0.268300	0.32120	N	0.006554	T	0.75481	0.3855	N	0.02751	-0.505	0.32316	N	0.563061	B;B	0.18166	0.026;0.026	B;B	0.18561	0.022;0.022	T	0.67845	-0.5565	10	0.02654	T	1	-3.9812	14.7336	0.69399	0.0:0.6574:0.3426:0.0	.	181;181	B4E221;Q9UHE8	.;STEA1_HUMAN	C	181	ENSP00000297205:S181C	ENSP00000297205:S181C	S	+	2	0	STEAP1	89628512	1.000000	0.71417	0.212000	0.23672	0.347000	0.29111	3.201000	0.51059	1.359000	0.45940	0.561000	0.74099	TCT	STEAP1	-	pfam_Fe3_Rdtase_TM_dom	ENSG00000164647		0.383	STEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP1	HGNC	protein_coding	OTTHUMT00000059327.3	68	0.00	0	C	NM_012449		89790576	89790576	+1	no_errors	ENST00000297205	ensembl	human	known	69_37n	missense	54	22.86	16	SNP	0.997	G
STXBP3	6814	genome.wustl.edu	37	1	109338874	109338874	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:109338874G>C	ENST00000370008.3	+	14	1179	c.1129G>C	c.(1129-1131)Gat>Cat	p.D377H		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	377					blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		ACTTGGAACTGATGCAGAAGG	0.333																																						dbGAP											0													64.0	64.0	64.0					1																	109338874		2203	4300	6503	-	-	-	SO:0001583	missense	0			D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.1129G>C	1.37:g.109338874G>C	ENSP00000359025:p.Asp377His		A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.D377H	ENST00000370008.3	37	c.1129	CCDS790.1	1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.988963	0.74589	.	.	ENSG00000116266	ENST00000370008	D	0.84070	-1.8	5.84	4.92	0.64577	.	0.000000	0.85682	D	0.000000	D	0.90693	0.7080	M	0.86573	2.825	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.92740	0.6207	10	0.87932	D	0	-14.0265	16.2801	0.82672	0.0:0.0:0.8663:0.1337	.	377	O00186	STXB3_HUMAN	H	377	ENSP00000359025:D377H	ENSP00000359025:D377H	D	+	1	0	STXBP3	109140397	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.716000	0.91420	1.438000	0.47492	0.591000	0.81541	GAT	STXBP3	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000116266		0.333	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP3	HGNC	protein_coding	OTTHUMT00000030591.1	34	0.00	0	G	NM_007269		109338874	109338874	+1	no_errors	ENST00000370008	ensembl	human	known	69_37n	missense	27	27.03	10	SNP	1.000	C
SWAP70	23075	genome.wustl.edu	37	11	9750971	9750973	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	AAG	AAG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr11:9750971_9750973delAAG	ENST00000318950.6	+	6	974_976	c.871_873delAAG	c.(871-873)aagdel	p.K294del	SWAP70_ENST00000447399.2_In_Frame_Del_p.K236del	NM_015055.2	NP_055870.2	Q9UH65	SWP70_HUMAN	SWAP switching B-cell complex 70kDa subunit	294	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.|Poly-Lys.				isotype switching (GO:0045190)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	11				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		TGCTTCAGATAAGAAGAAGAAAC	0.33																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB014540	CCDS31426.1, CCDS73257.1	11p15	2013-01-10			ENSG00000133789	ENSG00000133789		"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	17070	protein-coding gene	gene with protein product		604762				9734811, 10681448	Standard	XM_005252829		Approved	KIAA0640, SWAP-70	uc001mhw.3	Q9UH65	OTTHUMG00000165865	ENST00000318950.6:c.871_873delAAG	11.37:g.9750977_9750979delAAG	ENSP00000315630:p.Lys294del		D3DQV1|O75135|Q7LCY6|Q9P061|Q9P0Z8	In_Frame_Del	DEL	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_EF_HAND_2,pfscan_Pleckstrin_homology	p.K294in_frame_del	ENST00000318950.6	37	c.871_873	CCDS31426.1	11																																																																																			SWAP70	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000133789		0.330	SWAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SWAP70	HGNC	protein_coding	OTTHUMT00000386766.2	83	0.00	0	AAG	NM_015055		9750971	9750973	+1	no_errors	ENST00000318950	ensembl	human	known	69_37n	in_frame_del	45	21.05	12	DEL	1.000:1.000:1.000	-
SYNE2	23224	genome.wustl.edu	37	14	64520304	64520304	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr14:64520304G>A	ENST00000344113.4	+	48	9885	c.9673G>A	c.(9673-9675)Gat>Aat	p.D3225N	SYNE2_ENST00000357395.3_De_novo_Start_OutOfFrame|SYNE2_ENST00000554584.1_Missense_Mutation_p.D3258N|SYNE2_ENST00000358025.3_Missense_Mutation_p.D3225N	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3225					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGAAGCGAGTGATGTGGAGAC	0.383																																						dbGAP											0													81.0	80.0	80.0					14																	64520304		1942	4133	6075	-	-	-	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.9673G>A	14.37:g.64520304G>A	ENSP00000341781:p.Asp3225Asn		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.D3225N	ENST00000344113.4	37	c.9673	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	13.55	2.271279	0.40194	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.35048	1.33;1.33;1.33	5.52	3.64	0.41730	.	0.712434	0.12869	N	0.432425	T	0.23766	0.0575	L	0.27053	0.805	0.19300	N	0.999975	P;P	0.38504	0.501;0.634	B;B	0.36186	0.109;0.219	T	0.09574	-1.0668	10	0.46703	T	0.11	.	6.631	0.22857	0.1482:0.1551:0.6966:0.0	.	3225;3225	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	N	3225;3225;3258;3258	ENSP00000350719:D3225N;ENSP00000341781:D3225N;ENSP00000452570:D3258N	ENSP00000261678:D3258N	D	+	1	0	SYNE2	63590057	0.160000	0.22878	0.005000	0.12908	0.138000	0.21146	1.821000	0.39041	1.292000	0.44672	0.563000	0.77884	GAT	SYNE2	-	NULL	ENSG00000054654		0.383	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	52	0.00	0	G	NM_182914		64520304	64520304	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	missense	33	23.26	10	SNP	0.001	A
SYT4	6860	genome.wustl.edu	37	18	40850187	40850189	+	3'UTR	DEL	CAA	CAA	-			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	CAA	CAA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr18:40850187_40850189delCAA	ENST00000255224.3	-	0	1763_1765				SYT4_ENST00000586678.1_5'UTR|SYT4_ENST00000590752.1_3'UTR	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV						exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						CCATTTCTAGCAACAACAACAAC	0.3																																					NSCLC(85;81 1419 2855 22820 35912)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.*119TTG>-	18.37:g.40850196_40850198delCAA			B4DEU3|Q9P2K4	RNA	DEL	-	NULL	ENST00000255224.3	37	NULL	CCDS11922.1	18																																																																																			SYT4	-	-	ENSG00000132872		0.300	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT4	HGNC	protein_coding	OTTHUMT00000255851.2	8	0.00	0	CAA	NM_020783		40850187	40850189	-1	no_errors	ENST00000585604	ensembl	human	known	69_37n	rna	8	20.00	2	DEL	0.380:0.367:0.351	-
TBX22	50945	genome.wustl.edu	37	X	79278589	79278589	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chrX:79278589C>T	ENST00000373294.5	+	2	234	c.206C>T	c.(205-207)tCt>tTt	p.S69F	TBX22_ENST00000373291.1_5'UTR|TBX22_ENST00000442340.1_5'UTR|TBX22_ENST00000373296.3_Missense_Mutation_p.S69F	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	69					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						CCCTCAACATCTGCTTCCTCT	0.522																																						dbGAP											0													64.0	56.0	59.0					X																	79278589		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.206C>T	X.37:g.79278589C>T	ENSP00000362390:p.Ser69Phe		Q5JZ06|Q96LC0|Q9HBF1	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,prints_TF_T-box,pfscan_TF_T-box	p.S69F	ENST00000373294.5	37	c.206	CCDS14445.1	X	.	.	.	.	.	.	.	.	.	.	C	11.67	1.707508	0.30322	.	.	ENSG00000122145	ENST00000373296;ENST00000373294	D;D	0.87809	-2.3;-2.3	3.82	2.92	0.33932	.	1.816480	0.02405	N	0.081016	T	0.78130	0.4235	N	0.08118	0	0.45567	D	0.998514	B	0.33379	0.41	B	0.32465	0.146	T	0.61456	-0.7059	10	0.52906	T	0.07	.	9.6344	0.39798	0.0:0.7908:0.2092:0.0	.	69	Q9Y458	TBX22_HUMAN	F	69	ENSP00000362393:S69F;ENSP00000362390:S69F	ENSP00000362390:S69F	S	+	2	0	TBX22	79165245	0.004000	0.15560	0.047000	0.18901	0.028000	0.11728	1.871000	0.39539	0.719000	0.32188	0.513000	0.50165	TCT	TBX22	-	NULL	ENSG00000122145		0.522	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX22	HGNC	protein_coding	OTTHUMT00000057334.1	38	0.00	0	C	NM_016954		79278589	79278589	+1	no_errors	ENST00000373294	ensembl	human	known	69_37n	missense	23	41.03	16	SNP	0.029	T
TCEA3	6920	genome.wustl.edu	37	1	23743835	23743835	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:23743835G>T	ENST00000450454.2	-	4	393	c.287C>A	c.(286-288)gCa>gAa	p.A96E	TCEA3_ENST00000461794.1_Missense_Mutation_p.A59E|TCEA3_ENST00000374601.3_Missense_Mutation_p.A96E	NM_003196.1	NP_003187.1	O75764	TCEA3_HUMAN	transcription elongation factor A (SII), 3	96					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;4.16e-05)|all_lung(284;6.68e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.0054)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.6e-25)|Colorectal(126;8.32e-08)|COAD - Colon adenocarcinoma(152;4.29e-06)|GBM - Glioblastoma multiforme(114;9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00424)|STAD - Stomach adenocarcinoma(196;0.0145)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0963)|LUSC - Lung squamous cell carcinoma(448;0.198)		cttcttctttgccttttctct	0.478																																						dbGAP											0													153.0	146.0	148.0					1																	23743835		1850	4101	5951	-	-	-	SO:0001583	missense	0			AJ223473	CCDS44086.1	1p36.11	2011-01-25			ENSG00000204219	ENSG00000204219			11615	protein-coding gene	gene with protein product		604128				9790746	Standard	NM_003196		Approved	TFIIS.H	uc021oig.1	O75764	OTTHUMG00000003233	ENST00000450454.2:c.287C>A	1.37:g.23743835G>T	ENSP00000406293:p.Ala96Glu		A8K2K7|Q5DR83	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_Znf_TFIIS,pfam_TFIIS_N,superfamily_TFIIS_cen_dom,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,smart_TFS2M,smart_Znf_TFIIS,pirsf_TF_IIS-rel,pfscan_Znf_TFIIS,tigrfam_TFSII	p.A96E	ENST00000450454.2	37	c.287	CCDS44086.1	1	.	.	.	.	.	.	.	.	.	.	G	10.21	1.288695	0.23478	.	.	ENSG00000204219	ENST00000450454;ENST00000374601	.	.	.	4.8	2.77	0.32553	Transcription factor IIS, N-terminal (1);	1.101550	0.06703	N	0.771792	T	0.22589	0.0545	N	0.14661	0.345	0.21915	N	0.999473	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.20806	-1.0264	9	0.05620	T	0.96	-6.5086	7.3225	0.26536	0.0:0.2083:0.6071:0.1847	.	96;96	A8K2K7;O75764	.;TCEA3_HUMAN	E	96	.	ENSP00000363729:A96E	A	-	2	0	TCEA3	23616422	0.997000	0.39634	0.998000	0.56505	0.681000	0.39784	1.126000	0.31344	1.373000	0.46208	-0.211000	0.12701	GCA	TCEA3	-	superfamily_TFIIS_N,pirsf_TF_IIS-rel,tigrfam_TFSII	ENSG00000204219		0.478	TCEA3-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	TCEA3	HGNC	protein_coding	OTTHUMT00000008911.2	147	0.00	0	G	NM_003196		23743835	23743835	-1	no_errors	ENST00000450454	ensembl	human	known	69_37n	missense	92	21.37	25	SNP	0.995	T
TCEA3	6920	genome.wustl.edu	37	1	23743844	23743844	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:23743844C>G	ENST00000450454.2	-	4	384	c.278G>C	c.(277-279)aGa>aCa	p.R93T	TCEA3_ENST00000461794.1_Missense_Mutation_p.R56T|TCEA3_ENST00000374601.3_Missense_Mutation_p.R93T	NM_003196.1	NP_003187.1	O75764	TCEA3_HUMAN	transcription elongation factor A (SII), 3	93					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;4.16e-05)|all_lung(284;6.68e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.0054)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.6e-25)|Colorectal(126;8.32e-08)|COAD - Colon adenocarcinoma(152;4.29e-06)|GBM - Glioblastoma multiforme(114;9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00424)|STAD - Stomach adenocarcinoma(196;0.0145)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0963)|LUSC - Lung squamous cell carcinoma(448;0.198)		tgccttttctctttcctctcc	0.493																																						dbGAP											0													132.0	127.0	128.0					1																	23743844		1852	4099	5951	-	-	-	SO:0001583	missense	0			AJ223473	CCDS44086.1	1p36.11	2011-01-25			ENSG00000204219	ENSG00000204219			11615	protein-coding gene	gene with protein product		604128				9790746	Standard	NM_003196		Approved	TFIIS.H	uc021oig.1	O75764	OTTHUMG00000003233	ENST00000450454.2:c.278G>C	1.37:g.23743844C>G	ENSP00000406293:p.Arg93Thr		A8K2K7|Q5DR83	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_Znf_TFIIS,pfam_TFIIS_N,superfamily_TFIIS_cen_dom,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,smart_TFS2M,smart_Znf_TFIIS,pirsf_TF_IIS-rel,pfscan_Znf_TFIIS,tigrfam_TFSII	p.R93T	ENST00000450454.2	37	c.278	CCDS44086.1	1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.153563	0.38021	.	.	ENSG00000204219	ENST00000450454;ENST00000374601	.	.	.	5.02	4.11	0.48088	Transcription factor IIS, N-terminal (2);	1.130320	0.06353	N	0.710257	T	0.25531	0.0621	L	0.27053	0.805	0.23156	N	0.998202	P;P	0.34462	0.454;0.454	B;B	0.24974	0.057;0.057	T	0.13818	-1.0495	9	0.37606	T	0.19	-0.0863	9.3186	0.37950	0.0:0.9035:0.0:0.0965	.	93;93	A8K2K7;O75764	.;TCEA3_HUMAN	T	93	.	ENSP00000363729:R93T	R	-	2	0	TCEA3	23616431	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	1.835000	0.39181	1.493000	0.48517	0.655000	0.94253	AGA	TCEA3	-	superfamily_TFIIS_N,pirsf_TF_IIS-rel,tigrfam_TFSII	ENSG00000204219		0.493	TCEA3-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	TCEA3	HGNC	protein_coding	OTTHUMT00000008911.2	129	0.00	0	C	NM_003196		23743844	23743844	-1	no_errors	ENST00000450454	ensembl	human	known	69_37n	missense	85	19.81	21	SNP	1.000	G
TJP3	27134	genome.wustl.edu	37	19	3743985	3743985	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr19:3743985C>G	ENST00000541714.2	+	15	2354	c.1892C>G	c.(1891-1893)gCt>gGt	p.A631G	TJP3_ENST00000589378.1_Missense_Mutation_p.A640G|TJP3_ENST00000262968.9_Missense_Mutation_p.A664G|TJP3_ENST00000587686.1_Missense_Mutation_p.A650G|TJP3_ENST00000539908.2_Missense_Mutation_p.A595G|TJP3_ENST00000382008.3_Missense_Mutation_p.A645G	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	631	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCGACATTGCTATGCAGAAG	0.507																																						dbGAP											0													118.0	108.0	112.0					19																	3743985		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.1892C>G	19.37:g.3743985C>G	ENSP00000439278:p.Ala631Gly		A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Missense_Mutation	SNP	pfam_PDZ,pfam_SH3_2,pfam_Guanylate_kin,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin,prints_ZonOcculS3,prints_ZonOcculdens	p.A664G	ENST00000541714.2	37	c.1991	CCDS32873.2	19	.	.	.	.	.	.	.	.	.	.	C	20.4	3.977510	0.74360	.	.	ENSG00000105289	ENST00000541714;ENST00000539908;ENST00000382008;ENST00000262968	T;T;T;T	0.09817	2.94;3.12;2.95;3.05	4.68	4.68	0.58851	Guanylate kinase/L-type calcium channel (1);	0.056165	0.64402	D	0.000001	T	0.36908	0.0984	M	0.86268	2.805	0.80722	D	1	D;D;D;D	0.76494	0.999;0.997;0.997;0.999	D;D;D;D	0.72982	0.972;0.979;0.937;0.979	T	0.38520	-0.9657	10	0.87932	D	0	.	15.1061	0.72322	0.0:1.0:0.0:0.0	.	650;664;645;631	O95049-3;O95049-2;O95049;F5H2X0	.;.;ZO3_HUMAN;.	G	631;595;645;664	ENSP00000439278:A631G;ENSP00000439991:A595G;ENSP00000371438:A645G;ENSP00000262968:A664G	ENSP00000262968:A664G	A	+	2	0	TJP3	3694985	1.000000	0.71417	0.464000	0.27143	0.841000	0.47740	4.765000	0.62271	2.143000	0.66587	0.655000	0.94253	GCT	TJP3	-	smart_Guanylate_kin/L-typ_Ca_channel	ENSG00000105289		0.507	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP3	HGNC	protein_coding	OTTHUMT00000453434.1	82	0.00	0	C			3743985	3743985	+1	no_errors	ENST00000262968	ensembl	human	known	69_37n	missense	39	25.00	13	SNP	0.982	G
TMEM55A	55529	genome.wustl.edu	37	8	92021021	92021021	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr8:92021021C>T	ENST00000285419.3	-	5	803	c.489G>A	c.(487-489)tgG>tgA	p.W163*		NM_018710.2	NP_061180.1	Q8N4L2	TM55A_HUMAN	transmembrane protein 55A	163						endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)	p.W163*(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	13			BRCA - Breast invasive adenocarcinoma(11;0.033)			TCAGTTCCATCCACTGTAAAA	0.333																																						dbGAP											1	Substitution - Nonsense(1)	upper_aerodigestive_tract(1)											96.0	100.0	99.0					8																	92021021		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC033892	CCDS6252.1	8q21.3	2005-08-09			ENSG00000155099	ENSG00000155099			25452	protein-coding gene	gene with protein product		609864				12477932	Standard	NM_018710		Approved	DKFZp762O076	uc003yes.3	Q8N4L2	OTTHUMG00000164019	ENST00000285419.3:c.489G>A	8.37:g.92021021C>T	ENSP00000285419:p.Trp163*		B2R9H4|Q68CU2	Nonsense_Mutation	SNP	pfam_Transmembrane_protein_55A/B	p.W163*	ENST00000285419.3	37	c.489	CCDS6252.1	8	.	.	.	.	.	.	.	.	.	.	C	39	7.619202	0.98393	.	.	ENSG00000155099	ENST00000285419;ENST00000520014	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-24.3642	19.9115	0.97026	0.0:1.0:0.0:0.0	.	.	.	.	X	163;169	.	ENSP00000285419:W163X	W	-	3	0	TMEM55A	92090197	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.672000	0.74477	2.804000	0.96469	0.650000	0.86243	TGG	TMEM55A	-	pfam_Transmembrane_protein_55A/B	ENSG00000155099		0.333	TMEM55A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM55A	HGNC	protein_coding	OTTHUMT00000376778.1	116	0.00	0	C	NM_018710		92021021	92021021	-1	no_errors	ENST00000285419	ensembl	human	known	69_37n	nonsense	53	15.87	10	SNP	1.000	T
TMOD4	29765	genome.wustl.edu	37	1	151147306	151147306	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:151147306C>A	ENST00000416280.2	-	2	145	c.46G>T	c.(46-48)Gaa>Taa	p.E16*	TMOD4_ENST00000601585.1_5'Flank|VPS72_ENST00000496809.1_5'Flank			Q9NZQ9	TMOD4_HUMAN	tropomodulin 4 (muscle)	0					muscle contraction (GO:0006936)	striated muscle thin filament (GO:0005865)	tropomyosin binding (GO:0005523)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)	7	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			ATCTCATCTTCATCTATGTCT	0.552																																						dbGAP											0													122.0	107.0	112.0					1																	151147306		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF177173	CCDS988.1	1q12	2008-05-23			ENSG00000163157	ENSG00000163157			11874	protein-coding gene	gene with protein product	"""actin-capping protein"""	605834				10662549, 10497209	Standard	NM_013353		Approved	Sk-Tmod	uc001exc.4	Q9NZQ9	OTTHUMG00000012350	ENST00000416280.2:c.46G>T	1.37:g.151147306C>A	ENSP00000414180:p.Glu16*		B7Z6N9|Q5JR83|Q8WVL3|Q9UKH2	Nonsense_Mutation	SNP	pfam_Tropomodulin	p.E16*	ENST00000416280.2	37	c.46		1	.	.	.	.	.	.	.	.	.	.	.	35	5.441662	0.96187	.	.	ENSG00000163157	ENST00000295314;ENST00000416280;ENST00000441701	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-15.6068	18.949	0.92635	0.0:1.0:0.0:0.0	.	.	.	.	X	16	.	ENSP00000295314:E16X	E	-	1	0	TMOD4	149413930	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.591000	0.82666	2.771000	0.95319	0.561000	0.74099	GAA	TMOD4	-	pfam_Tropomodulin	ENSG00000163157		0.552	TMOD4-201	KNOWN	basic	protein_coding	TMOD4	HGNC	protein_coding		47	0.00	0	C			151147306	151147306	-1	no_errors	ENST00000295314	ensembl	human	known	69_37n	nonsense	25	50.98	26	SNP	1.000	A
TP53BP1	7158	genome.wustl.edu	37	15	43701882	43701882	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr15:43701882C>G	ENST00000263801.3	-	25	5600	c.5348G>C	c.(5347-5349)gGa>gCa	p.G1783A	TP53BP1_ENST00000450115.2_Missense_Mutation_p.G1786A|TP53BP1_ENST00000382044.4_Missense_Mutation_p.G1788A|TP53BP1_ENST00000382039.3_Missense_Mutation_p.G1738A	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1783	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		ATAGCCAGCTCCTGCTCGAAG	0.368								Other conserved DNA damage response genes																														dbGAP											0													52.0	49.0	50.0					15																	43701882		2201	4298	6499	-	-	-	SO:0001583	missense	0			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.5348G>C	15.37:g.43701882C>G	ENSP00000263801:p.Gly1783Ala		F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	pfam_53-BP1_Tudor,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.G1788A	ENST00000263801.3	37	c.5363	CCDS10096.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.5|22.5	4.295974|4.295974	0.81025|0.81025	.|.	.|.	ENSG00000067369|ENSG00000067369	ENST00000434595|ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115	.|D;D;D;D	.|0.86097	.|-2.07;-2.07;-2.07;-2.07	5.67|5.67	5.67|5.67	0.87782|0.87782	.|BRCT (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91307|0.91307	0.7259|0.7259	L|L	0.57536|0.57536	1.79|1.79	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;0.998;1.0	.|D;D;D	.|0.91635	.|0.998;0.979;0.999	D|D	0.90875|0.90875	0.4749|0.4749	5|10	.|0.56958	.|D	.|0.05	-19.2209|-19.2209	19.1191|19.1191	0.93355|0.93355	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1783;1788;1786	.|Q12888;Q12888-2;F8VY86	.|TP53B_HUMAN;.;.	Q|A	108|1783;1788;1738;1786	.|ENSP00000263801:G1783A;ENSP00000371475:G1788A;ENSP00000371470:G1738A;ENSP00000393497:G1786A	.|ENSP00000263801:G1783A	E|G	-|-	1|2	0|0	TP53BP1|TP53BP1	41489174|41489174	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	6.692000|6.692000	0.74578|0.74578	2.837000|2.837000	0.97791|0.97791	0.655000|0.655000	0.94253|0.94253	GAG|GGA	TP53BP1	-	superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	ENSG00000067369		0.368	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TP53BP1	HGNC	protein_coding	OTTHUMT00000132897.3	61	0.00	0	C			43701882	43701882	-1	no_errors	ENST00000382044	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	1.000	G
TRIM65	201292	genome.wustl.edu	37	17	73888451	73888451	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr17:73888451C>T	ENST00000269383.3	-	3	706	c.641G>A	c.(640-642)cGa>cAa	p.R214Q		NM_001256124.1|NM_173547.3	NP_001243053.1|NP_775818.2	Q6PJ69	TRI65_HUMAN	tripartite motif containing 65	214						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTCCTCGTCTCGAGCCTGTGC	0.637																																						dbGAP											0													26.0	30.0	29.0					17																	73888451		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006138	CCDS11732.1	17q25.1	2013-01-09	2011-01-25		ENSG00000141569	ENSG00000141569		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	27316	protein-coding gene	gene with protein product			"""tripartite motif-containing 65"""			12477932	Standard	NM_173547		Approved		uc002jpx.4	Q6PJ69	OTTHUMG00000132127	ENST00000269383.3:c.641G>A	17.37:g.73888451C>T	ENSP00000269383:p.Arg214Gln		Q4G0F0|Q6DKJ6|Q9BRP6	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R214Q	ENST00000269383.3	37	c.641	CCDS11732.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.812|4.812	0.150984|0.150984	0.09185|0.09185	.|.	.|.	ENSG00000141569|ENSG00000141569	ENST00000543309|ENST00000269383	.|T	.|0.55930	.|0.49	4.23|4.23	-8.46|-8.46	0.00942|0.00942	.|.	.|1.526110	.|0.04232	.|N	.|0.335340	T|T	0.27765|0.27765	0.0683|0.0683	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B	.|0.17852	.|0.024	.|B	.|0.09377	.|0.004	T|T	0.33317|0.33317	-0.9873|-0.9873	5|10	.|0.18710	.|T	.|0.47	.|.	10.5333|10.5333	0.44990|0.44990	0.2148:0.1089:0.0:0.6763|0.2148:0.1089:0.0:0.6763	.|.	.|214	.|Q6PJ69	.|TRI65_HUMAN	K|Q	88|214	.|ENSP00000269383:R214Q	.|ENSP00000269383:R214Q	E|R	-|-	1|2	0|0	TRIM65|TRIM65	71400046|71400046	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-4.252000|-4.252000	0.00266|0.00266	-3.869000|-3.869000	0.00097|0.00097	-0.448000|-0.448000	0.05591|0.05591	GAG|CGA	TRIM65	-	NULL	ENSG00000141569		0.637	TRIM65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM65	HGNC	protein_coding	OTTHUMT00000255170.2	13	0.00	0	C	NM_173547		73888451	73888451	-1	no_errors	ENST00000269383	ensembl	human	known	69_37n	missense	9	30.77	4	SNP	0.000	T
TRPV6	55503	genome.wustl.edu	37	7	142573303	142573303	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr7:142573303C>T	ENST00000359396.3	-	8	1285	c.1040G>A	c.(1039-1041)tGc>tAc	p.C347Y	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	347					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					GCGGTAGATGCAGCACATGGT	0.572																																						dbGAP											0													137.0	136.0	136.0					7																	142573303		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.1040G>A	7.37:g.142573303C>T	ENSP00000352358:p.Cys347Tyr		A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV5/TRPV6_channel,prints_TRPV6_channel,prints_Ankyrin_rpt,tigrfam_TRP_channel	p.C347Y	ENST00000359396.3	37	c.1040	CCDS5874.1	7	.	.	.	.	.	.	.	.	.	.	C	22.2	4.251866	0.80135	.	.	ENSG00000165125	ENST00000359396;ENST00000311470	D	0.85955	-2.05	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.93294	0.7863	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.93070	0.6482	10	0.36615	T	0.2	-20.6288	16.8604	0.86016	0.0:1.0:0.0:0.0	.	347	Q9H1D0	TRPV6_HUMAN	Y	347;179	ENSP00000352358:C347Y	ENSP00000310825:C179Y	C	-	2	0	TRPV6	142283425	1.000000	0.71417	0.984000	0.44739	0.810000	0.45777	7.299000	0.78831	2.458000	0.83093	0.655000	0.94253	TGC	TRPV6	-	prints_TRPV5/TRPV6_channel,tigrfam_TRP_channel	ENSG00000165125		0.572	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV6	HGNC	protein_coding	OTTHUMT00000347662.1	54	0.00	0	C	NM_014274		142573303	142573303	-1	no_errors	ENST00000359396	ensembl	human	known	69_37n	missense	29	30.95	13	SNP	1.000	T
TSC2	7249	genome.wustl.edu	37	16	2126577	2126577	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr16:2126577G>A	ENST00000219476.3	+	25	3458	c.2828G>A	c.(2827-2829)aGa>aAa	p.R943K	TSC2_ENST00000439673.2_Missense_Mutation_p.R906K|TSC2_ENST00000382538.6_Missense_Mutation_p.R894K|TSC2_ENST00000568454.1_Missense_Mutation_p.R954K|TSC2_ENST00000401874.2_Missense_Mutation_p.R943K|TSC2_ENST00000350773.4_Missense_Mutation_p.R943K|TSC2_ENST00000353929.4_Missense_Mutation_p.R943K	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	943					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CTCAACGAGAGACCCAAGAGG	0.622			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																													dbGAP	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0													79.0	76.0	77.0					16																	2126577		2198	4300	6498	-	-	-	SO:0001583	missense	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.2828G>A	16.37:g.2126577G>A	ENSP00000219476:p.Arg943Lys		A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	pfam_Tuberin-type_domain,pfam_Tuberin_N,pfam_Rap_GAP,superfamily_ARM-type_fold,prints_Tuberin,pfscan_Rap_GAP	p.R943K	ENST00000219476.3	37	c.2828	CCDS10458.1	16	.	.	.	.	.	.	.	.	.	.	G	20.3	3.966887	0.74131	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D;D	0.90069	-2.61;-2.48;-2.41;-2.5;-2.45;-2.56	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	D	0.93585	0.7952	M	0.65498	2.005	0.58432	D	0.999999	D;D;D;D;D;P	0.61080	0.979;0.989;0.976;0.988;0.989;0.932	D;D;D;D;D;P	0.79108	0.983;0.986;0.92;0.992;0.923;0.867	D	0.93615	0.6942	10	0.48119	T	0.1	-28.2204	17.6786	0.88236	0.0:0.0:1.0:0.0	.	894;906;943;943;943;943	B4DIL8;P49815-6;P49815-4;P49815-3;P49815-5;P49815	.;.;.;.;.;TSC2_HUMAN	K	943;943;943;906;894;943	ENSP00000219476:R943K;ENSP00000384468:R943K;ENSP00000248099:R943K;ENSP00000399232:R906K;ENSP00000371978:R894K;ENSP00000344383:R943K	ENSP00000219476:R943K	R	+	2	0	TSC2	2066578	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	9.142000	0.94618	2.163000	0.67991	0.561000	0.74099	AGA	TSC2	-	NULL	ENSG00000103197		0.622	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSC2	HGNC	protein_coding	OTTHUMT00000250657.2	30	0.00	0	G	NM_000548		2126577	2126577	+1	no_errors	ENST00000219476	ensembl	human	known	69_37n	missense	21	38.24	13	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179435608	179435608	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr2:179435608C>G	ENST00000591111.1	-	276	70552	c.70328G>C	c.(70327-70329)cGa>cCa	p.R23443P	TTN_ENST00000342992.6_Missense_Mutation_p.R22516P|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R16211P|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R16144P|TTN_ENST00000460472.2_Missense_Mutation_p.R16019P|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R25084P|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23443	Fibronectin type-III 70. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R16211Q(1)|p.R16144Q(1)|p.R22514Q(1)|p.R16019Q(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCGGCATTTCGGGCTATAAC	0.428																																						dbGAP											4	Substitution - Missense(4)	central_nervous_system(4)											149.0	134.0	139.0					2																	179435608		1882	4120	6002	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.70328G>C	2.37:g.179435608C>G	ENSP00000465570:p.Arg23443Pro		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.R22516P	ENST00000591111.1	37	c.67547		2	.	.	.	.	.	.	.	.	.	.	C	5.772	0.326888	0.10900	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	5.63	4.74	0.60224	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77205	0.4096	M	0.85859	2.78	0.54753	D	0.999989	D;D;D;D	0.64830	0.994;0.994;0.994;0.988	P;P;P;P	0.62014	0.897;0.897;0.897;0.811	T	0.82575	-0.0389	9	0.87932	D	0	.	17.1002	0.86647	0.0:0.8734:0.1266:0.0	.	16019;16144;16211;23443	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	P	22516;16019;16211;16144;16017	ENSP00000343764:R22516P;ENSP00000434586:R16019P;ENSP00000340554:R16211P;ENSP00000352154:R16144P	ENSP00000340554:R16211P	R	-	2	0	TTN	179143854	1.000000	0.71417	1.000000	0.80357	0.092000	0.18411	3.992000	0.56980	1.483000	0.48342	0.650000	0.86243	CGA	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.428	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	68	0.00	0	C	NM_133378		179435608	179435608	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	63	32.98	31	SNP	1.000	G
TYW1	55253	genome.wustl.edu	37	7	66463173	66463173	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr7:66463173C>G	ENST00000359626.5	+	2	290	c.126C>G	c.(124-126)atC>atG	p.I42M	SBDS_ENST00000246868.2_5'Flank|TYW1_ENST00000491969.1_3'UTR	NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	42					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				AGATTGTCATCAAGACGCAGG	0.318																																						dbGAP											0													155.0	151.0	152.0					7																	66463173		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.126C>G	7.37:g.66463173C>G	ENSP00000352645:p.Ile42Met		Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Missense_Mutation	SNP	pfam_rSAM,pfam_Flavodoxin/NO_synth,pfam_tRNA_wybutosine-synth,pfscan_Flavodoxin/NO_synth,prints_Flavdoxin	p.I42M	ENST00000359626.5	37	c.126	CCDS5538.1	7	.	.	.	.	.	.	.	.	.	.	C	11.81	1.750535	0.31046	.	.	ENSG00000198874	ENST00000359626;ENST00000442959	T	0.18338	2.22	4.08	2.24	0.28232	.	1.023590	0.07843	U	0.963398	T	0.16471	0.0396	L	0.58669	1.825	0.24938	N	0.991873	B	0.10296	0.003	B	0.06405	0.002	T	0.35549	-0.9784	10	0.44086	T	0.13	.	2.623	0.04922	0.192:0.5167:0.1865:0.1049	.	42	Q9NV66	TYW1_HUMAN	M	42	ENSP00000352645:I42M	ENSP00000352645:I42M	I	+	3	3	TYW1	66100608	0.254000	0.23992	0.997000	0.53966	0.776000	0.43924	0.431000	0.21444	0.372000	0.24591	-0.175000	0.13238	ATC	TYW1	-	NULL	ENSG00000198874		0.318	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYW1	HGNC	protein_coding	OTTHUMT00000251932.2	125	0.00	0	C	NM_018264		66463173	66463173	+1	no_errors	ENST00000359626	ensembl	human	known	69_37n	missense	69	26.60	25	SNP	0.995	G
UBR4	23352	genome.wustl.edu	37	1	19408173	19408173	+	Intron	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:19408173G>A	ENST00000375254.3	-	103	15036				UBR4_ENST00000375226.2_Intron|UBR4_ENST00000375267.2_Intron|UBR4_ENST00000375224.1_Intron|UBR4_ENST00000375225.3_Missense_Mutation_p.S43L|UBR4_ENST00000543981.1_Intron|UBR4_ENST00000375217.2_Intron|AL137127.1_ENST00000582644.1_RNA|UBR4_ENST00000429347.2_Intron	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GACATTTGCTGAACGCTTGGA	0.517																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.15009-106C>T	1.37:g.19408173G>A			A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	NULL	p.S43L	ENST00000375254.3	37	c.128	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	G	10.33	1.320375	0.23994	.	.	ENSG00000127481	ENST00000375225	T	0.52526	0.66	4.53	1.53	0.23141	.	.	.	.	.	T	0.31857	0.0810	.	.	.	0.18873	N	0.999986	.	.	.	.	.	.	T	0.21724	-1.0237	5	.	.	.	.	3.1433	0.06463	0.0979:0.1755:0.5453:0.1814	.	.	.	.	L	43	ENSP00000364373:S43L	.	S	-	2	0	UBR4	19280760	0.013000	0.17824	0.001000	0.08648	0.039000	0.13416	1.038000	0.30254	0.223000	0.20920	0.563000	0.77884	TCA	UBR4	-	NULL	ENSG00000127481		0.517	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	22	0.00	0	G	NM_020765		19408173	19408173	-1	no_errors	ENST00000375225	ensembl	human	known	69_37n	missense	15	34.78	8	SNP	0.003	A
WBSCR16	81554	genome.wustl.edu	37	7	74486513	74486513	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr7:74486513C>T	ENST00000329959.4	-	2	450	c.395G>A	c.(394-396)tGg>tAg	p.W132*	WBSCR16_ENST00000543840.1_Nonsense_Mutation_p.W132*|WBSCR16_ENST00000503250.2_Nonsense_Mutation_p.W132*	NM_030798.3	NP_110425.2	Q96I51	WBS16_HUMAN	Williams-Beuren syndrome chromosome region 16	132							poly(A) RNA binding (GO:0044822)			kidney(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						TCCCATCCCCCAGACTTTCGT	0.483																																						dbGAP											0													115.0	111.0	112.0					7																	74486513		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF410455	CCDS5577.1, CCDS64683.1, CCDS64684.1	7q11.23	2008-08-14			ENSG00000174374	ENSG00000274523			14948	protein-coding gene	gene with protein product						12073013	Standard	NM_030798		Approved		uc003ubr.3	Q96I51	OTTHUMG00000130373	ENST00000329959.4:c.395G>A	7.37:g.74486513C>T	ENSP00000333799:p.Trp132*		D3DXK0|F5GX55|F5H6C7|Q548B1|Q8IW88|Q8N572|Q9H0G7	Nonsense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.W132*	ENST00000329959.4	37	c.395	CCDS5577.1	7	.	.	.	.	.	.	.	.	.	.	C	38	6.865574	0.97897	.	.	ENSG00000174374	ENST00000503250;ENST00000329959;ENST00000543840;ENST00000455375	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-16.8078	17.8185	0.88643	0.0:1.0:0.0:0.0	.	.	.	.	X	132;132;132;59	.	ENSP00000333799:W132X	W	-	2	0	WBSCR16	74124449	1.000000	0.71417	0.998000	0.56505	0.867000	0.49689	7.014000	0.76380	2.553000	0.86117	0.561000	0.74099	TGG	WBSCR16	-	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens	ENSG00000174374		0.483	WBSCR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR16	HGNC	protein_coding	OTTHUMT00000252740.1	51	0.00	0	C	NM_030798		74486513	74486513	-1	no_errors	ENST00000329959	ensembl	human	known	69_37n	nonsense	44	27.87	17	SNP	1.000	T
WRN	7486	genome.wustl.edu	37	8	30969302	30969302	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr8:30969302C>G	ENST00000298139.5	+	19	2509	c.2260C>G	c.(2260-2262)Ctt>Gtt	p.L754V		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	754	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		GCAGCCATTTCTTGTCAAAAC	0.328			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	dbGAP	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	0													58.0	59.0	58.0					8																	30969302		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.2260C>G	8.37:g.30969302C>G	ENSP00000298139:p.Leu754Val		A1KYY9	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,pfam_Helicase_C,pfam_RQC_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/RNaseD_C,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_Helicase/RNaseD_C,pfscan_Helicase/RNaseD_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.L754V	ENST00000298139.5	37	c.2260	CCDS6082.1	8	.	.	.	.	.	.	.	.	.	.	C	15.10	2.733975	0.48939	.	.	ENSG00000165392	ENST00000298139	T	0.06687	3.27	5.15	5.15	0.70609	Helicase, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.20536	0.0494	L	0.55990	1.75	0.46927	D	0.999251	P;P	0.52316	0.952;0.941	P;P	0.55615	0.78;0.77	T	0.00257	-1.1872	10	0.42905	T	0.14	-17.8272	18.2419	0.89970	0.0:1.0:0.0:0.0	.	164;754	Q59F09;Q14191	.;WRN_HUMAN	V	754	ENSP00000298139:L754V	ENSP00000298139:L754V	L	+	1	0	WRN	31088844	1.000000	0.71417	0.997000	0.53966	0.494000	0.33585	6.196000	0.72094	2.394000	0.81467	0.557000	0.71058	CTT	WRN	-	pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000165392		0.328	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	HGNC	protein_coding	OTTHUMT00000376248.1	46	0.00	0	C			30969302	30969302	+1	no_errors	ENST00000298139	ensembl	human	known	69_37n	missense	17	45.16	14	SNP	1.000	G
ZBTB40	9923	genome.wustl.edu	37	1	22835712	22835712	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr1:22835712G>A	ENST00000375647.4	+	9	2026	c.1819G>A	c.(1819-1821)Gag>Aag	p.E607K	ZBTB40_ENST00000374651.4_Missense_Mutation_p.E495K|ZBTB40_ENST00000404138.1_Missense_Mutation_p.E607K	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	607					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		GCACCTGGCAGAGACTGTGAA	0.463																																						dbGAP											0													103.0	109.0	107.0					1																	22835712		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.1819G>A	1.37:g.22835712G>A	ENSP00000364798:p.Glu607Lys		O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E607K	ENST00000375647.4	37	c.1819	CCDS224.1	1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203397	0.58234	.	.	ENSG00000184677	ENST00000404138;ENST00000375647;ENST00000374651	D;D;D	0.82344	-1.6;-1.6;-1.6	5.95	4.04	0.47022	.	0.238515	0.29431	N	0.012164	T	0.71298	0.3323	L	0.32530	0.975	0.32657	N	0.518663	P;B	0.35575	0.51;0.376	B;B	0.29598	0.104;0.048	T	0.75900	-0.3154	10	0.87932	D	0	-13.3784	8.8368	0.35117	0.0789:0.1503:0.7707:0.0	.	495;607	F8WAI8;Q9NUA8	.;ZBT40_HUMAN	K	607;607;495	ENSP00000384527:E607K;ENSP00000364798:E607K;ENSP00000363782:E495K	ENSP00000363782:E495K	E	+	1	0	ZBTB40	22708299	0.931000	0.31567	0.137000	0.22149	0.846000	0.48090	1.792000	0.38754	0.809000	0.34255	0.655000	0.94253	GAG	ZBTB40	-	NULL	ENSG00000184677		0.463	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB40	HGNC	protein_coding	OTTHUMT00000008094.1	40	0.00	0	G	NM_014870		22835712	22835712	+1	no_errors	ENST00000375647	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	0.563	A
ZMYM2	7750	genome.wustl.edu	37	13	20600816	20600817	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr13:20600816_20600817delAG	ENST00000382874.2	+	9	1839_1840	c.1649_1650delAG	c.(1648-1650)cagfs	p.Q550fs	ZMYM2_ENST00000382871.2_Frame_Shift_Del_p.Q550fs|ZMYM2_ENST00000382869.3_Frame_Shift_Del_p.Q550fs|ZMYM2_ENST00000382883.3_Frame_Shift_Del_p.Q32fs	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	550					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		GATATGACTCAGTGTATAGGTC	0.322																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.1649_1650delAG	13.37:g.20600816_20600817delAG	ENSP00000372327:p.Gln550fs		A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Frame_Shift_Del	DEL	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH	p.Q550fs	ENST00000382874.2	37	c.1649_1650	CCDS45016.1	13																																																																																			ZMYM2	-	pfam_Znf_MYM	ENSG00000121741		0.322	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM2	HGNC	protein_coding	OTTHUMT00000044051.2	59	0.00	0	AG	NM_003453		20600816	20600817	+1	no_errors	ENST00000382869	ensembl	human	known	69_37n	frame_shift_del	27	23.08	9	DEL	1.000:1.000	-
ZNF558	148156	genome.wustl.edu	37	19	8923821	8923821	+	Silent	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr19:8923821G>A	ENST00000601372.1	-	8	1036	c.325C>T	c.(325-327)Cta>Tta	p.L109L	ZNF558_ENST00000301475.1_Silent_p.L109L|ZNF558_ENST00000444186.2_Silent_p.L38L			Q96NG5	ZN558_HUMAN	zinc finger protein 558	109	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	15						GTGCTTGGTAGAATTCCTCTT	0.458																																						dbGAP											0													200.0	160.0	174.0					19																	8923821		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055494	CCDS12208.1	19p13.2	2013-09-20			ENSG00000167785	ENSG00000167785		"""Zinc fingers, C2H2-type"", ""-"""	26422	protein-coding gene	gene with protein product							Standard	NM_144693		Approved	FLJ30932	uc002mkn.1	Q96NG5	OTTHUMG00000182196	ENST00000601372.1:c.325C>T	19.37:g.8923821G>A			A8K5F0|B7Z798	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L109	ENST00000601372.1	37	c.325	CCDS12208.1	19																																																																																			ZNF558	-	pfscan_Krueppel-associated_box	ENSG00000167785		0.458	ZNF558-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF558	HGNC	protein_coding	OTTHUMT00000459955.2	122	0.00	0	G	NM_144693		8923821	8923821	-1	no_errors	ENST00000301475	ensembl	human	known	69_37n	silent	95	21.49	26	SNP	0.504	A
ZNF155	7711	genome.wustl.edu	37	19	44500381	44500381	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr19:44500381C>G	ENST00000270014.2	+	5	500	c.372C>G	c.(370-372)ttC>ttG	p.F124L	ZNF155_ENST00000590615.1_Missense_Mutation_p.F124L|RP11-15A1.7_ENST00000586860.1_RNA|RP11-15A1.7_ENST00000589021.1_RNA|ZNF155_ENST00000407951.2_Missense_Mutation_p.F135L	NM_001260487.1|NM_198089.2	NP_001247416|NP_932355	Q12901	ZN155_HUMAN	zinc finger protein 155	124					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	15		Prostate(69;0.0352)				ACTCTCAGTTCTTTGAAAATG	0.458																																					NSCLC(61;554 1277 20909 42067 42312)	dbGAP											0													81.0	80.0	81.0					19																	44500381		2203	4300	6503	-	-	-	SO:0001583	missense	0			U09852	CCDS12634.1, CCDS58668.1	19q13.2-q13.32	2013-01-08	2006-08-22			ENSG00000204920		"""Zinc fingers, C2H2-type"", ""-"""	12940	protein-coding gene	gene with protein product		604086	"""zinc finger protein 155 (pHZ-96)"""			7557990	Standard	NM_001260486		Approved	pHZ-96	uc010xwt.2	Q12901		ENST00000270014.2:c.372C>G	19.37:g.44500381C>G	ENSP00000270014:p.Phe124Leu		A2BDE6|B2RB63|B4DM95|J3KQ08|Q6AZZ8|Q9UIE1|Q9UK14	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F124L	ENST00000270014.2	37	c.372	CCDS12634.1	19	.	.	.	.	.	.	.	.	.	.	C	3.983	-0.005983	0.07773	.	.	ENSG00000204920	ENST00000407951;ENST00000270014	T;T	0.04970	3.54;3.52	1.64	0.519	0.17035	.	.	.	.	.	T	0.02494	0.0076	N	0.08118	0	0.09310	N	1	B;B	0.13594	0.008;0.004	B;B	0.16289	0.015;0.007	T	0.48234	-0.9053	9	0.09843	T	0.71	.	2.9515	0.05864	0.0:0.5101:0.3007:0.1892	.	135;124	B4DM95;Q12901	.;ZN155_HUMAN	L	135;124	ENSP00000385163:F135L;ENSP00000270014:F124L	ENSP00000270014:F124L	F	+	3	2	ZNF155	49192221	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	-0.588000	0.05774	0.226000	0.20979	0.457000	0.33378	TTC	ZNF155	-	NULL	ENSG00000204920		0.458	ZNF155-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF155	HGNC	protein_coding	OTTHUMT00000460074.1	47	0.00	0	C	NM_003445		44500381	44500381	+1	no_errors	ENST00000270014	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	0.003	G
ZNF592	9640	genome.wustl.edu	37	15	85325970	85325970	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr15:85325970delA	ENST00000560079.2	+	4	352	c.64delA	c.(64-66)accfs	p.T22fs	ZNF592_ENST00000299927.3_Frame_Shift_Del_p.T22fs	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	22					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CCCAGACCCCACCAGCCTTGA	0.517																																						dbGAP											0													134.0	127.0	130.0					15																	85325970		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.64delA	15.37:g.85325970delA	ENSP00000452877:p.Thr22fs		Q2M1T2|Q504Y9	Frame_Shift_Del	DEL	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T22fs	ENST00000560079.2	37	c.64	CCDS32317.1	15																																																																																			ZNF592	-	NULL	ENSG00000166716		0.517	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF592	HGNC	protein_coding	OTTHUMT00000418779.2	39	0.00	0	A	NM_014630		85325970	85325970	+1	no_errors	ENST00000299927	ensembl	human	known	69_37n	frame_shift_del	10	40.91	9	DEL	1.000	-
ZNF592	9640	genome.wustl.edu	37	15	85326050	85326050	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2B8-01A-11D-A17D-09	TCGA-AC-A2B8-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	006faa97-572b-4015-a803-e1c9fa4a1be2	ca7ebf6b-a461-462e-9dbd-323b5aeba931	g.chr15:85326050G>A	ENST00000560079.2	+	4	432	c.144G>A	c.(142-144)atG>atA	p.M48I	ZNF592_ENST00000299927.3_Missense_Mutation_p.M48I	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	48					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GCATATGTATGGATGAAAGTG	0.557																																						dbGAP											0													144.0	125.0	131.0					15																	85326050		2203	4299	6502	-	-	-	SO:0001583	missense	0			D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.144G>A	15.37:g.85326050G>A	ENSP00000452877:p.Met48Ile		Q2M1T2|Q504Y9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M48I	ENST00000560079.2	37	c.144	CCDS32317.1	15	.	.	.	.	.	.	.	.	.	.	G	3.371	-0.128460	0.06753	.	.	ENSG00000166716	ENST00000299927	T	0.00603	6.28	6.17	2.24	0.28232	.	0.336276	0.40728	N	0.001022	T	0.00552	0.0018	L	0.36672	1.1	0.38750	D	0.954097	B	0.06786	0.001	B	0.06405	0.002	T	0.63019	-0.6730	10	0.46703	T	0.11	-1.7657	7.2204	0.25983	0.1998:0.1234:0.6767:0.0	.	48	Q92610	ZN592_HUMAN	I	48	ENSP00000299927:M48I	ENSP00000299927:M48I	M	+	3	0	ZNF592	83127054	1.000000	0.71417	0.964000	0.40570	0.988000	0.76386	1.177000	0.31969	0.173000	0.19788	0.655000	0.94253	ATG	ZNF592	-	NULL	ENSG00000166716		0.557	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF592	HGNC	protein_coding	OTTHUMT00000418779.2	39	0.00	0	G	NM_014630		85326050	85326050	+1	no_errors	ENST00000299927	ensembl	human	known	69_37n	missense	12	60.00	18	SNP	1.000	A
