#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
A2MP1	3	genome.wustl.edu	37	12	9413853	9413853	+	IGR	SNP	T	T	C	rs252031|rs386760161	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr12:9413853T>C								RP11-118B22.4 (3297 upstream) : SNORA75 (25415 downstream)																							GTTTCCTTGTTCAATGGATAA	0.313													T|||	3264	0.651757	0.5469	0.7075	5008	,	,		-128	0.624		0.66	False		,,,				2504	0.774					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															12.37:g.9413853T>C				RNA	SNP	-	NULL		37	NULL		12																																																																																			A2MP1	-	-	ENSG00000256069	0	0.313					A2MP1	HGNC			24	0.00	0	T			9413853	9413853	-1	no_errors	ENST00000544183	ensembl	human	known	69_37n	rna	30	14.29	5	SNP	0.001	C
AKR1CL1	340811	genome.wustl.edu	37	10	5199934	5199934	+	5'UTR	SNP	G	G	C	rs1781935	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr10:5199934G>C	ENST00000465430.1	-	0	130							Q5T2L2	AKCL1_HUMAN	aldo-keto reductase family 1, member C-like 1							cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	6						CCTGGGCTTCGACTGTGTTTC	0.572													G|||	3015	0.602037	0.5333	0.5476	5008	,	,		19246	0.8601		0.4095	False		,,,				2504	0.6656				Ovarian(129;1623 1737 25446 28757 47467)	dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					10p15.2	2014-05-06			ENSG00000196326	ENSG00000264006			23469	protein-coding gene	gene with protein product						15164054	Standard	NR_027916		Approved		uc009xhz.2	Q5T2L2	OTTHUMG00000184213	ENST00000465430.1:c.-1397C>G	10.37:g.5199934G>C			A6NF66|Q6ZN81	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.R78G	ENST00000465430.1	37	c.232		10	1291	0.5911172161172161	283	0.5752032520325203	197	0.5441988950276243	499	0.8723776223776224	312	0.41160949868073876	G	13.16	2.153403	0.38021	.	.	ENSG00000196326	ENST00000473890	T	0.24538	1.85	3.37	0.0254	0.14145	.	0.132697	0.32301	U	0.006286	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.06881	-1.0802	6	0.87932	D	0	.	3.1982	0.06640	0.2203:0.0:0.4227:0.357	rs1781935;rs17306169;rs56495102;rs60248121;rs1781935	.	.	.	G	78	ENSP00000417959:R78G	ENSP00000417959:R78G	R	-	1	2	AKR1CL1	5189934	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	0.130000	0.15850	-0.102000	0.12197	0.430000	0.28490	CGA	AKR1CL1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	ENSG00000196326		0.572	AKR1CL1-003	KNOWN	basic	processed_transcript	AKR1CL1	HGNC	protein_coding	OTTHUMT00000356488.1	28	0.00	0	G	NR_027916		5199934	5199934	-1	no_errors	ENST00000473890	ensembl	human	novel	69_37n	missense	60	13.04	9	SNP	0.000	C
DPH6	89978	genome.wustl.edu	37	15	35529406	35529406	+	Intron	SNP	C	C	T			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr15:35529406C>T	ENST00000560386.1	-	4	200				ANP32AP1_ENST00000560832.1_RNA			Q7L8W6	DPH6_HUMAN	diphthamine biosynthesis 6						peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)		ATP binding (GO:0005524)|diphthine-ammonia ligase activity (GO:0017178)										TAGCGTGTGCCGGGGGTGCTG	0.473																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS10043.1, CCDS45213.1	15q14	2013-06-19	2013-06-19	2013-05-02	ENSG00000134146	ENSG00000134146	6.3.1.14		30543	protein-coding gene	gene with protein product	"""diphthine--ammonia ligase"""		"""ATP binding domain 4"", ""DPH6 homolog (S. cerevisiae)"""	ATPBD4		23169644, 23468660	Standard	NM_080650		Approved	MGC14798		Q7L8W6	OTTHUMG00000129759	ENST00000560386.1:c.3239-16623G>A	15.37:g.35529406C>T			B3KWG1|Q96HJ6	RNA	SNP	-	NULL	ENST00000560386.1	37	NULL		15																																																																																			ANP32AP1	-	-	ENSG00000259516		0.473	DPH6-003	KNOWN	basic	processed_transcript	ANP32AP1	HGNC	protein_coding	OTTHUMT00000417824.1	9	0.00	0	C	NM_080650		35529406	35529406	+1	no_errors	ENST00000560832	ensembl	human	known	69_37n	rna	43	15.69	8	SNP	0.008	T
ASTN2	23245	genome.wustl.edu	37	9	119770383	119770383	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr9:119770383C>T	ENST00000313400.4	-	7	1679	c.1579G>A	c.(1579-1581)Gac>Aac	p.D527N	ASTN2_ENST00000361209.2_Missense_Mutation_p.D476N|ASTN2_ENST00000373996.3_Missense_Mutation_p.D527N|ASTN2_ENST00000361477.3_5'UTR			O75129	ASTN2_HUMAN	astrotactin 2	527	EGF-like 1.				negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)		p.D476N(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GTTTCTGGGTCGCAGAGCTGC	0.577																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											65.0	62.0	63.0					9																	119770383		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.1579G>A	9.37:g.119770383C>T	ENSP00000314038:p.Asp527Asn		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.D527N	ENST00000313400.4	37	c.1579		9	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434533	0.83776	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	T;T;T;T	0.16897	2.53;2.53;2.31;2.57	5.67	5.67	0.87782	.	0.059892	0.64402	D	0.000003	T	0.33118	0.0852	L	0.32530	0.975	0.54753	D	0.999985	D;D;D	0.89917	0.996;0.976;1.0	P;P;D	0.79784	0.842;0.51;0.993	T	0.01074	-1.1460	9	.	.	.	-31.0695	19.7848	0.96432	0.0:1.0:0.0:0.0	.	476;527;527	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	N	527;527;254;476	ENSP00000314038:D527N;ENSP00000363108:D527N;ENSP00000363098:D254N;ENSP00000354504:D476N	.	D	-	1	0	ASTN2	118810204	1.000000	0.71417	0.997000	0.53966	0.866000	0.49608	7.684000	0.84104	2.673000	0.90976	0.655000	0.94253	GAC	ASTN2	-	NULL	ENSG00000148219		0.577	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	HGNC	protein_coding		22	0.00	0	C	NM_014010		119770383	119770383	-1	no_errors	ENST00000313400	ensembl	human	known	69_37n	missense	50	20.63	13	SNP	1.000	T
CEP152	22995	genome.wustl.edu	37	15	49085545	49085545	+	Silent	SNP	G	G	A			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr15:49085545G>A	ENST00000380950.2	-	7	992	c.805C>T	c.(805-807)Ctg>Ttg	p.L269L	CEP152_ENST00000325747.5_Silent_p.L176L|CEP152_ENST00000399334.3_Silent_p.L269L	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	269					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TGGTGATTCAGATATCGAATT	0.333																																						dbGAP											0													165.0	155.0	158.0					15																	49085545		1856	4098	5954	-	-	-	SO:0001819	synonymous_variant	0			AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.805C>T	15.37:g.49085545G>A			E7ER66|Q17RV1|Q6NTA0	Silent	SNP	NULL	p.L269	ENST00000380950.2	37	c.805	CCDS58361.1	15																																																																																			CEP152	-	NULL	ENSG00000103995		0.333	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP152	HGNC	protein_coding	OTTHUMT00000417365.1	16	0.00	0	G	NM_014985		49085545	49085545	-1	no_errors	ENST00000380950	ensembl	human	known	69_37n	silent	56	22.22	16	SNP	1.000	A
DCUN1D4	23142	genome.wustl.edu	37	4	52780048	52780048	+	3'UTR	SNP	G	G	C	rs13531	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr4:52780048G>C	ENST00000334635.5	+	0	1357				DCUN1D4_ENST00000381441.3_3'UTR|DCUN1D4_ENST00000381437.4_3'UTR	NM_001040402.1	NP_001035492.1	Q92564	DCNL4_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 4							nucleus (GO:0005634)				endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	9			GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)			AAGGAAAAAGGTTCACCTAGA	0.289													C|||	2698	0.538738	0.8404	0.3055	5008	,	,		18121	0.62		0.2565	False		,,,				2504	0.5031					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			D87466	CCDS3487.2, CCDS33982.1, CCDS75123.1	4q11	2013-06-10	2013-06-10		ENSG00000109184	ENSG00000109184			28998	protein-coding gene	gene with protein product		612977	"""DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)"""			15988528	Standard	XM_005265731		Approved	KIAA0276	uc003gze.3	Q92564	OTTHUMG00000128700	ENST00000334635.5:c.*298G>C	4.37:g.52780048G>C			B4DH25|Q7Z3F3|Q7Z6B8	RNA	SNP	-	NULL	ENST00000334635.5	37	NULL	CCDS33982.1	4																																																																																			DCUN1D4	-	-	ENSG00000109184		0.289	DCUN1D4-001	KNOWN	basic|CCDS	protein_coding	DCUN1D4	HGNC	protein_coding	OTTHUMT00000250599.2	24	0.00	0	G	NM_015115		52780048	52780048	+1	no_errors	ENST00000508257	ensembl	human	known	69_37n	rna	38	13.33	6	SNP	1.000	C
DENND2D	79961	genome.wustl.edu	37	1	111730159	111730160	+	3'UTR	DNP	GC	GC	AA			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr1:111730159_111730160GC>AA	ENST00000357640.4	-	0	1712_1713				DENND2D_ENST00000369752.5_3'UTR|RP5-1180E21.5_ENST00000610049.1_RNA	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D						positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		TGCTGATCCTGCCACACTGGCA	0.455																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.1414_1414delinsAA	1.37:g.111730159_111730160delinsAA			Q5T5V6|Q9BSU0	RNA	SNP	-	NULL	ENST00000357640.4	37	NULL	CCDS831.1	1																																																																																			DENND2D	-	-	ENSG00000162777		0.455	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DENND2D	HGNC	protein_coding	OTTHUMT00000034456.1	35	0.00	0	G|C	NM_024901		111730159|111730160	111730159|111730160	-1	no_errors	ENST00000468692	ensembl	human	known	69_37n	rna	100	13.04|12.28	15|14	SNP	0.001|0.016	A
EGFLAM	133584	genome.wustl.edu	37	5	38370546	38370546	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr5:38370546G>T	ENST00000354891.3	+	6	1040	c.694G>T	c.(694-696)Gac>Tac	p.D232Y	EGFLAM_ENST00000322350.5_Missense_Mutation_p.D232Y	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	232	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)	p.D232N(2)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					CTGGCCCAGTGACATCATCCG	0.577																																					Colon(62;485 1295 3347 17454)	dbGAP											2	Substitution - Missense(2)	lung(2)											40.0	39.0	39.0					5																	38370546		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.694G>T	5.37:g.38370546G>T	ENSP00000346964:p.Asp232Tyr		A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Fibronectin_type3,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Laminin_G	p.D232Y	ENST00000354891.3	37	c.694	CCDS56363.1	5	.	.	.	.	.	.	.	.	.	.	G	10.59	1.393767	0.25205	.	.	ENSG00000164318	ENST00000354891;ENST00000322350	T;T	0.52754	0.65;0.65	5.82	-2.44	0.06502	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.640381	0.17696	N	0.165103	T	0.37517	0.1006	L	0.56340	1.77	0.09310	N	1	B;P	0.39737	0.331;0.685	B;B	0.39904	0.106;0.313	T	0.28933	-1.0028	10	0.72032	D	0.01	.	6.2637	0.20915	0.3492:0.2062:0.4447:0.0	.	232;232	Q63HQ2;Q63HQ2-2	EGFLA_HUMAN;.	Y	232	ENSP00000346964:D232Y;ENSP00000313084:D232Y	ENSP00000313084:D232Y	D	+	1	0	EGFLAM	38406303	0.001000	0.12720	0.000000	0.03702	0.704000	0.40688	0.604000	0.24164	-0.928000	0.03761	-0.254000	0.11334	GAC	EGFLAM	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000164318		0.577	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	HGNC	protein_coding	OTTHUMT00000367323.1	18	0.00	0	G	NM_152403		38370546	38370546	+1	no_errors	ENST00000354891	ensembl	human	known	69_37n	missense	35	22.22	10	SNP	0.003	T
FLG	2312	genome.wustl.edu	37	1	152280782	152280782	+	Missense_Mutation	SNP	A	A	G	rs2184953	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr1:152280782A>G	ENST00000368799.1	-	3	6615	c.6580T>C	c.(6580-6582)Tat>Cat	p.Y2194H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2194	Ser-rich.		Y -> H (in dbSNP:rs2184953).		establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCTTGTCATATGTTTTTCTG	0.547									Ichthyosis				-|||	2703	0.539736	0.7897	0.4683	5008	,	,		29126	0.6607		0.1759	False		,,,				2504	0.502					dbGAP											0													483.0	407.0	432.0					1																	152280782		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6580T>C	1.37:g.152280782A>G	ENSP00000357789:p.Tyr2194His		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.Y2194H	ENST00000368799.1	37	c.6580	CCDS30860.1	1	1006	0.4606227106227106	366	0.7439024390243902	142	0.39226519337016574	362	0.6328671328671329	136	0.17941952506596306	g	2.593	-0.294672	0.05568	.	.	ENSG00000143631	ENST00000368799	T	0.01665	4.7	2.99	-5.98	0.02220	.	.	.	.	.	T	0.00241	0.0007	N	0.02011	-0.69	0.80722	P	0.0	B	0.10296	0.003	B	0.04013	0.001	T	0.45673	-0.9245	8	0.45353	T	0.12	.	4.3415	0.11112	0.287:0.0:0.31:0.403	rs2184953;rs2184953	2194	P20930	FILA_HUMAN	H	2194	ENSP00000357789:Y2194H	ENSP00000357789:Y2194H	Y	-	1	0	FLG	150547406	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.749000	0.00793	-2.890000	0.00315	-2.627000	0.00155	TAT	FLG	-	NULL	ENSG00000143631		0.547	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	83	0.00	0	A	NM_002016		152280782	152280782	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	156	13.26	24	SNP	0.000	G
FAM89A	375061	genome.wustl.edu	37	1	231161773	231161773	+	Intron	SNP	C	C	T	rs12569337	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr1:231161773C>T	ENST00000366654.4	-	2	326				FAM89A_ENST00000494111.1_5'UTR	NM_198552.2	NP_940954.1	Q96GI7	FA89A_HUMAN	family with sequence similarity 89, member A											endometrium(1)|upper_aerodigestive_tract(1)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				atcttggctccgccactcacc	0.443													C|||	800	0.159744	0.2322	0.072	5008	,	,		12883	0.119		0.1213	False		,,,				2504	0.2055					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC009447	CCDS1590.1	1q42.2	2008-02-05	2005-09-13	2005-09-13	ENSG00000182118	ENSG00000182118			25057	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 153"""	C1orf153		12477932	Standard	NM_198552		Approved	MGC15887	uc001hui.2	Q96GI7	OTTHUMG00000037960	ENST00000366654.4:c.292-5901G>A	1.37:g.231161773C>T				RNA	SNP	-	NULL	ENST00000366654.4	37	NULL	CCDS1590.1	1																																																																																			FAM89A	-	-	ENSG00000182118		0.443	FAM89A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM89A	HGNC	protein_coding	OTTHUMT00000092652.1	9	0.00	0	C	NM_198552		231161773	231161773	-1	no_errors	ENST00000494111	ensembl	human	known	69_37n	rna	18	50.00	18	SNP	0.000	T
GPC2	221914	genome.wustl.edu	37	7	99767587	99767587	+	3'UTR	SNP	A	A	G	rs1918353	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr7:99767587A>G	ENST00000292377.2	-	0	2173				GAL3ST4_ENST00000360039.4_5'Flank|GAL3ST4_ENST00000411994.1_5'Flank|GPC2_ENST00000471050.1_5'UTR|GAL3ST4_ENST00000426974.2_5'Flank|GAL3ST4_ENST00000423751.1_5'Flank|GAL3ST4_ENST00000413800.1_5'Flank|GAL3ST4_ENST00000482469.1_5'Flank	NM_152742.1	NP_689955.1	Q8N158	GPC2_HUMAN	glypican 2						carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuron differentiation (GO:0030182)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	anchored component of membrane (GO:0031225)|endoplasmic reticulum (GO:0005783)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(3)	18	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TTAGAGGGCTAGAGACTATAC	0.483													G|||	3004	0.59984	0.5015	0.6671	5008	,	,		13897	0.7093		0.5656	False		,,,				2504	0.6074					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BX375153	CCDS5689.1	7q22.1	2007-02-16	2007-02-15		ENSG00000213420	ENSG00000213420		"""Proteoglycans / Cell Surface : Glypicans"""	4450	protein-coding gene	gene with protein product	"""glypican proteoglycan 2, cerebroglycan proteoglycan"""		"""glypican 2 (cerebroglycan)"""			8294498	Standard	NM_152742		Approved	cerebroglycan, FLJ38962, DKFZp547M109	uc003utv.3	Q8N158	OTTHUMG00000154894	ENST00000292377.2:c.*266T>C	7.37:g.99767587A>G			A4D2A7	RNA	SNP	-	NULL	ENST00000292377.2	37	NULL	CCDS5689.1	7																																																																																			GPC2	-	-	ENSG00000213420		0.483	GPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC2	HGNC	protein_coding	OTTHUMT00000337556.1	16	0.00	0	A	NM_152742		99767587	99767587	-1	no_errors	ENST00000471050	ensembl	human	known	69_37n	rna	27	28.95	11	SNP	0.000	G
HERC2P4	100289574	genome.wustl.edu	37	16	32192670	32192670	+	IGR	SNP	C	C	T	rs368052707	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr16:32192670C>T								HERC2P4 (9782 upstream) : RP11-17M15.1 (6983 downstream)																							TGGTGCCTGGCGTTCCGTGAA	0.537													c|||	4	0.000798722	0.0	0.0	5008	,	,		27770	0.0		0.001	False		,,,				2504	0.0031					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															16.37:g.32192670C>T				RNA	SNP	-	NULL		37	NULL		16	.	.	.	.	.	.	.	.	.	.	.	2.342	-0.350891	0.05173	.	.	ENSG00000230267	ENST00000433784	.	.	.	2.88	-2.32	0.06745	.	.	.	.	.	T	0.28200	0.0696	.	.	.	.	.	.	.	.	.	.	.	.	T	0.35276	-0.9795	4	0.37606	T	0.19	.	2.6861	0.05108	0.3841:0.2883:0.0:0.3276	.	.	.	.	T	12	.	ENSP00000402538:A12T	A	-	1	0	AC133485.1	32100171	0.952000	0.32445	0.978000	0.43139	0.098000	0.18820	0.084000	0.14891	-0.074000	0.12820	0.194000	0.17425	GCC	HERC2P4	-	-	ENSG00000230267	0	0.537					HERC2P4	HGNC			46	0.00	0	C			32192670	32192670	-1	no_errors	ENST00000568097	ensembl	human	known	69_37n	rna	91	15.74	17	SNP	0.939	T
HOXA5	3202	genome.wustl.edu	37	7	27181431	27181431	+	3'UTR	SNP	C	C	T			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr7:27181431C>T	ENST00000222726.3	-	0	896				HOXA-AS3_ENST00000518848.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000521197.1_RNA|HOXA5_ENST00000520854.1_5'UTR|HOXA3_ENST00000521401.1_5'Flank	NM_019102.3	NP_061975.2	P20719	HXA5_HUMAN	homeobox A5						anterior/posterior pattern specification (GO:0009952)|bronchiole development (GO:0060435)|cell migration (GO:0016477)|cell-cell signaling involved in mammary gland development (GO:0060764)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|intestinal epithelial cell maturation (GO:0060574)|lung alveolus development (GO:0048286)|lung goblet cell differentiation (GO:0060480)|lung-associated mesenchyme development (GO:0060484)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal-epithelial cell signaling (GO:0060638)|multicellular organism growth (GO:0035264)|negative regulation of angiogenesis (GO:0016525)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of apoptotic process (GO:0043065)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|respiratory system process (GO:0003016)|thyroid gland development (GO:0030878)|trachea cartilage morphogenesis (GO:0060535)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(12)|skin(1)	16						TAATACTGCTCAGTACTTTAA	0.488																																					Colon(119;75 2200 7557 42868)	dbGAP											0													79.0	78.0	78.0					7																	27181431		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS5406.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106004	ENSG00000106004		"""Homeoboxes / ANTP class : HOXL subclass"""	5106	protein-coding gene	gene with protein product		142952	"""homeo box A5"""	HOX1C, HOX1		1973146, 1358459	Standard	NM_019102		Approved		uc003syn.2	P20719	OTTHUMG00000023214	ENST00000222726.3:c.*23G>A	7.37:g.27181431C>T			A4D179|O43367|Q96CY6	RNA	SNP	-	NULL	ENST00000222726.3	37	NULL	CCDS5406.1	7																																																																																			HOXA5	-	-	ENSG00000106004		0.488	HOXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA5	HGNC	protein_coding	OTTHUMT00000358705.1	19	0.00	0	C			27181431	27181431	-1	no_errors	ENST00000520854	ensembl	human	putative	69_37n	rna	28	30.00	12	SNP	1.000	T
LHX9	56956	genome.wustl.edu	37	1	197898292	197898292	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr1:197898292C>G	ENST00000367387.4	+	5	1522	c.1097C>G	c.(1096-1098)aCc>aGc	p.T366S	LHX9_ENST00000337020.2_Intron|LHX9_ENST00000367390.3_Missense_Mutation_p.T357S|LHX9_ENST00000367391.1_Intron|LHX9_ENST00000561173.1_Intron	NM_020204.2	NP_064589.2	Q9NQ69	LHX9_HUMAN	LIM homeobox 9	366					cell proliferation (GO:0008283)|female gonad development (GO:0008585)|gonad morphogenesis (GO:0035262)|male gonad development (GO:0008584)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			endometrium(8)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|skin(1)|stomach(1)	35						ACAGACCTGACCAATCCCACT	0.542																																						dbGAP											0													85.0	86.0	86.0					1																	197898292		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ277915	CCDS1393.1, CCDS30962.1	1q31.1	2011-06-20			ENSG00000143355	ENSG00000143355		"""Homeoboxes / LIM class"""	14222	protein-coding gene	gene with protein product		606066					Standard	NM_020204		Approved		uc001guk.1	Q9NQ69	OTTHUMG00000035656	ENST00000367387.4:c.1097C>G	1.37:g.197898292C>G	ENSP00000356357:p.Thr366Ser		Q5VUE2|Q5VUE3|Q5VUE6|Q86UH2|Q9BYU6|Q9NQ70	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeodomain,pfscan_Znf_LIM,pfscan_Homeodomain	p.T366S	ENST00000367387.4	37	c.1097	CCDS1393.1	1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.286612	0.59867	.	.	ENSG00000143355	ENST00000367390;ENST00000367387	D;D	0.88431	-2.37;-2.38	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.82403	0.5029	N	0.19112	0.55	0.58432	D	0.999994	P;P	0.38195	0.488;0.622	B;B	0.38296	0.23;0.27	T	0.79424	-0.1809	10	0.10636	T	0.68	.	20.1295	0.97995	0.0:1.0:0.0:0.0	.	366;357	Q9NQ69;Q9NQ69-2	LHX9_HUMAN;.	S	357;366	ENSP00000356360:T357S;ENSP00000356357:T366S	ENSP00000356357:T366S	T	+	2	0	LHX9	196164915	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.708000	0.68377	2.758000	0.94735	0.591000	0.81541	ACC	LHX9	-	NULL	ENSG00000143355		0.542	LHX9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LHX9	HGNC	protein_coding	OTTHUMT00000086547.2	17	0.00	0	C	NM_020204		197898292	197898292	+1	no_errors	ENST00000367387	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	1.000	G
LRRC63	220416	genome.wustl.edu	37	13	46801970	46801970	+	Missense_Mutation	SNP	A	A	G	rs7338697	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr13:46801970A>G	ENST00000595396.1	+	2	409	c.409A>G	c.(409-411)Atg>Gtg	p.M137V	LRRC63_ENST00000446175.1_Missense_Mutation_p.M137V			Q05C16	LRC63_HUMAN	leucine rich repeat containing 63	137			M -> V (in dbSNP:rs7338697).							lung(1)|ovary(1)	2						GTTTAAAACTATGAAAGATGT	0.313													A|||	1174	0.234425	0.4425	0.1988	5008	,	,		20074	0.2073		0.0905	False		,,,				2504	0.1544					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS61325.1	13q14.12	2014-02-12			ENSG00000173988	ENSG00000173988			34296	protein-coding gene	gene with protein product							Standard	NM_001282460		Approved	RP11-139H14.4	uc001vbc.3	Q05C16	OTTHUMG00000016866	ENST00000595396.1:c.409A>G	13.37:g.46801970A>G	ENSP00000469337:p.Met137Val		Q5TBN0	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.M137V	ENST00000595396.1	37	c.409		13	481	0.22023809523809523	230	0.46747967479674796	70	0.19337016574585636	111	0.19405594405594406	70	0.09234828496042216	A	0.182	-1.060865	0.01950	.	.	ENSG00000173988	ENST00000378805;ENST00000446175	T;T	0.01178	5.22;5.26	5.15	-2.33	0.06724	.	2.696310	0.01001	N	0.003661	T	0.00012	0.0000	N	0.12182	0.205	0.80722	P	0.0	B	0.10296	0.003	B	0.06405	0.002	T	0.39078	-0.9631	9	0.37606	T	0.19	-0.0014	0.4431	0.00489	0.2671:0.1365:0.1863:0.41	rs7338697;rs17068957;rs61308874;rs7338697	137	Q05C16	LRC63_HUMAN	V	137	ENSP00000368082:M137V;ENSP00000408828:M137V	ENSP00000368082:M137V	M	+	1	0	LRRC63	45699971	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.526000	0.02229	-0.198000	0.10333	-0.435000	0.05868	ATG	LRRC63	-	NULL	ENSG00000173988		0.313	LRRC63-002	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	LRRC63	HGNC	protein_coding	OTTHUMT00000463266.1	13	0.00	0	A	XM_001718341		46801970	46801970	+1	no_errors	ENST00000446175	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	0.000	G
MAP3K1	4214	genome.wustl.edu	37	5	56161269	56161271	+	In_Frame_Del	DEL	TTA	TTA	-			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	TTA	TTA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr5:56161269_56161271delTTA	ENST00000399503.3	+	5	1138_1140	c.1138_1140delTTA	c.(1138-1140)ttadel	p.L380del		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	380					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GAGAAAAACTTTAAAGAATTTTG	0.335																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.1138_1140delTTA	5.37:g.56161269_56161271delTTA	ENSP00000382423:p.Leu380del			In_Frame_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.L380in_frame_del	ENST00000399503.3	37	c.1138_1140	CCDS43318.1	5																																																																																			MAP3K1	-	NULL	ENSG00000095015		0.335	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	23	0.00	0	TTA	XM_042066		56161269	56161271	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	in_frame_del	51	16.13	10	DEL	0.988:0.999:0.997	-
TARID	100507308	genome.wustl.edu	37	6	134142606	134142606	+	RNA	SNP	A	A	G	rs62424063	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr6:134142606A>G	ENST00000607033.1	-	0	454				RP3-323P13.2_ENST00000419627.1_RNA|RP4-662A9.2_ENST00000456347.1_lincRNA|RP3-323P13.2_ENST00000606544.1_RNA|RP3-323P13.2_ENST00000607573.1_RNA																							caacccaggcaccttccaggt	0.438													A|||	653	0.130391	0.0272	0.0893	5008	,	,		16732	0.2202		0.1372	False		,,,				2504	0.1994					dbGAP											0																																										-	-	-			0																															6.37:g.134142606A>G				RNA	SNP	-	NULL	ENST00000607033.1	37	NULL		6																																																																																			RP4-662A9.2	-	-	ENSG00000223586		0.438	RP3-323P13.2-002	KNOWN	basic	antisense	MGC34034	Clone_based_vega_gene	antisense	OTTHUMT00000470371.1	18	0.00	0	A			134142606	134142606	+1	no_errors	ENST00000456347	ensembl	human	known	69_37n	rna	22	18.52	5	SNP	0.000	G
RAE1	8480	genome.wustl.edu	37	20	55934083	55934083	+	Intron	SNP	T	T	C	rs78026223	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr20:55934083T>C	ENST00000395841.2	+	4	708				RAE1_ENST00000371242.2_Intron|MTRNR2L3_ENST00000543500.1_Missense_Mutation_p.R5G|RAE1_ENST00000527947.1_Intron|RAE1_ENST00000395840.2_Intron	NM_003610.3	NP_003601.1	P78406	RAE1L_HUMAN	ribonucleic acid export 1						carbohydrate metabolic process (GO:0005975)|cellular response to organic cyclic compound (GO:0071407)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|nuclear pore (GO:0005643)|nucleolus (GO:0005730)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|RNA binding (GO:0003723)			breast(1)|endometrium(5)|large_intestine(4)|lung(6)|prostate(3)|skin(2)	21	Lung NSC(12;0.00263)|all_lung(29;0.00828)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;3.7e-14)|Epithelial(14;1.07e-09)|all cancers(14;1.11e-08)			CAGCTGAACCTTCGTGTGGCC	0.413													C|||	164	0.0327476	0.0847	0.0144	5008	,	,		20390	0.001		0.0219	False		,,,				2504	0.0194					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U84720	CCDS13458.1	20q13.31	2013-08-28	2013-08-28		ENSG00000101146	ENSG00000101146		"""WD repeat domain containing"""	9828	protein-coding gene	gene with protein product		603343	"""RAE1 (RNA export 1, S.pombe) homolog"", ""RAE1 RNA export 1 homolog (S. pombe)"""			9370289, 9256445	Standard	XM_005260582		Approved	Mnrp41	uc002xyi.3	P78406	OTTHUMG00000032819	ENST00000395841.2:c.288+2489T>C	20.37:g.55934083T>C			A8K882|O15306|Q3SYL7|Q5TCH8|Q6V708|Q9H100|Q9NQM6	Missense_Mutation	SNP	NULL	p.R5G	ENST00000395841.2	37	c.13	CCDS13458.1	20	61	0.027930402930402932	38	0.07723577235772358	6	0.016574585635359115	0	0.0	17	0.022427440633245383	C	6.150	0.395868	0.11638	.	.	ENSG00000256222	ENST00000543500	.	.	.	0.418	0.418	0.16429	.	.	.	.	.	T	0.02267	0.0070	.	.	.	0.21020	N	0.99981	.	.	.	.	.	.	T	0.13442	-1.0509	5	0.87932	D	0	.	3.8528	0.08962	0.0:0.4161:0.0:0.5839	.	.	.	.	G	5	.	ENSP00000443339:R5G	R	-	1	2	MTRNR2L3	55367490	1.000000	0.71417	0.112000	0.21494	0.100000	0.18952	1.481000	0.35476	-0.348000	0.08286	-0.348000	0.07805	AGG	MTRNR2L3	-	NULL	ENSG00000256222		0.413	RAE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTRNR2L3	HGNC	protein_coding	OTTHUMT00000079842.2	22	0.00	0	T			55934083	55934083	-1	no_errors	ENST00000543500	ensembl	human	known	69_37n	missense	30	14.29	5	SNP	1.000	C
MUC4	4585	genome.wustl.edu	37	3	195511390	195511390	+	Missense_Mutation	SNP	T	T	G	rs75692609	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr3:195511390T>G	ENST00000463781.3	-	2	7520	c.7061A>C	c.(7060-7062)cAt>cCt	p.H2354P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H2354P|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H2354P(2)|p.H2354L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACATGAAGAGGGGT	0.582													.|||	288	0.057508	0.1505	0.0216	5008	,	,		22743	0.004		0.0288	False		,,,				2504	0.0419					dbGAP											3	Substitution - Missense(3)	stomach(2)|endometrium(1)											18.0	15.0	16.0					3																	195511390		675	1569	2244	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7061A>C	3.37:g.195511390T>G	ENSP00000417498:p.His2354Pro		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.H2354P	ENST00000463781.3	37	c.7061	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	t	2.704	-0.270348	0.05716	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.28666	1.61;1.6	.	.	.	.	.	.	.	.	T	0.08935	0.0221	N	0.02539	-0.55	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.28267	-1.0049	7	.	.	.	.	5.2163	0.15344	0.0:0.0:0.5975:0.4024	.	2354	E7ESK3	.	P	2354	ENSP00000417498:H2354P;ENSP00000420243:H2354P	.	H	-	2	0	MUC4	196995785	0.004000	0.15560	0.001000	0.08648	0.045000	0.14185	-2.399000	0.01050	-2.179000	0.00767	-2.418000	0.00219	CAT	MUC4	-	NULL	ENSG00000145113		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	48	0.00	0	T	NM_018406		195511390	195511390	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	76	12.64	11	SNP	0.001	G
MUC4	4585	genome.wustl.edu	37	3	195513779	195513779	+	Missense_Mutation	SNP	C	C	T	rs3103959		TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr3:195513779C>T	ENST00000463781.3	-	2	5131	c.4672G>A	c.(4672-4674)Gct>Act	p.A1558T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A1558T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAGCGTCGGTGACA	0.577																																						dbGAP											0													13.0	10.0	11.0					3																	195513779		683	1561	2244	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4672G>A	3.37:g.195513779C>T	ENSP00000417498:p.Ala1558Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.A1558T	ENST00000463781.3	37	c.4672	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	7.475	0.647427	0.14516	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32272	1.46;1.46	0.844	0.844	0.18943	.	.	.	.	.	T	0.12561	0.0305	N	0.19112	0.55	0.09310	N	1	P	0.52463	0.953	B	0.32149	0.141	T	0.16424	-1.0403	8	.	.	.	.	5.0592	0.14548	0.0:0.6209:0.379:0.0	.	1558	E7ESK3	.	T	1558	ENSP00000417498:A1558T;ENSP00000420243:A1558T	.	A	-	1	0	MUC4	196998174	0.000000	0.05858	0.011000	0.14972	0.011000	0.07611	-5.191000	0.00143	0.088000	0.17205	0.089000	0.15464	GCT	MUC4	-	NULL	ENSG00000145113		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	48	0.00	0	C	NM_018406		195513779	195513779	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	47	11.11	6	SNP	0.004	T
NPAS2	4862	genome.wustl.edu	37	2	101437561	101437561	+	Intron	SNP	G	G	A	rs6542989	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr2:101437561G>A	ENST00000335681.5	+	1	263				NPAS2_ENST00000542504.1_Missense_Mutation_p.E25K|AC092168.2_ENST00000430586.1_RNA	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2						cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGACCTTTCTGAAGAGCTGGG	0.572													A|||	2081	0.415535	0.6936	0.2968	5008	,	,		15318	0.5169		0.1779	False		,,,				2504	0.2638					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.-23+685G>A	2.37:g.101437561G>A			Q4ZFV9|Q53SQ3|Q86V96|Q99629	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_HLH_DNA-bd,tigrfam_PAS	p.E25K	ENST00000335681.5	37	c.73	CCDS2048.1	2	873	0.39972527472527475	349	0.709349593495935	102	0.281767955801105	294	0.513986013986014	128	0.16886543535620052	A	17.89	3.500184	0.64298	.	.	ENSG00000170485	ENST00000542504	T	0.05649	3.41	4.53	-3.89	0.04193	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.30534	-0.9975	7	0.02654	T	1	.	7.3833	0.26868	0.4177:0.1318:0.4506:0.0	rs6542989	25	F5H027	.	K	25	ENSP00000438428:E25K	ENSP00000438428:E25K	E	+	1	0	NPAS2	100803993	0.000000	0.05858	0.000000	0.03702	0.594000	0.36715	-1.971000	0.01503	-1.504000	0.01810	-1.677000	0.00738	GAA	NPAS2	-	NULL	ENSG00000170485		0.572	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NPAS2	HGNC	protein_coding	OTTHUMT00000253168.3	31	0.00	0	G			101437561	101437561	+1	no_errors	ENST00000542504	ensembl	human	known	69_37n	missense	54	11.29	7	SNP	0.000	A
NTN3	4917	genome.wustl.edu	37	16	2522060	2522060	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr16:2522060G>C	ENST00000293973.1	+	1	561	c.358G>C	c.(358-360)Gtg>Ctg	p.V120L		NM_006181.2	NP_006172.1	O00634	NET3_HUMAN	netrin 3	120	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(2)|lung(3)|prostate(1)	7						GCTGGTCTTCGTGAGCCTGCG	0.682																																						dbGAP											0													26.0	30.0	29.0					16																	2522060		2197	4298	6495	-	-	-	SO:0001583	missense	0			U86759	CCDS10469.1	16p13.3	2013-03-01	2008-10-29	2008-10-29	ENSG00000162068	ENSG00000162068		"""Netrins"""	8030	protein-coding gene	gene with protein product	"""Netrin-3"""	602349	"""netrin 2 (chicken)-like"", ""netrin 2-like (chicken)"""	NTN2L		9143507, 10366627	Standard	NM_006181		Approved		uc002cqj.3	O00634	OTTHUMG00000128867	ENST00000293973.1:c.358G>C	16.37:g.2522060G>C	ENSP00000293973:p.Val120Leu			Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,smart_Laminin_N,smart_EGF_laminin,smart_Netrin_module_non-TIMP,pfscan_EGF_laminin,pfscan_Laminin_N,pfscan_Netrin_domain	p.V120L	ENST00000293973.1	37	c.358	CCDS10469.1	16	.	.	.	.	.	.	.	.	.	.	G	16.88	3.244605	0.59103	.	.	ENSG00000162068	ENST00000293973	T	0.75477	-0.94	3.97	3.0	0.34707	Laminin, N-terminal (3);	0.000000	0.64402	D	0.000004	T	0.79936	0.4532	M	0.62154	1.92	0.58432	D	0.999999	D	0.63046	0.992	D	0.64506	0.926	T	0.75786	-0.3195	10	0.23891	T	0.37	.	10.3482	0.43918	0.0989:0.0:0.9011:0.0	.	120	O00634	NET3_HUMAN	L	120	ENSP00000293973:V120L	ENSP00000293973:V120L	V	+	1	0	NTN3	2462061	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.542000	0.60677	0.885000	0.36088	0.462000	0.41574	GTG	NTN3	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N	ENSG00000162068		0.682	NTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTN3	HGNC	protein_coding	OTTHUMT00000250812.1	24	0.00	0	G	NM_006181		2522060	2522060	+1	no_errors	ENST00000293973	ensembl	human	known	69_37n	missense	40	14.58	7	SNP	1.000	C
NUP155	9631	genome.wustl.edu	37	5	37350364	37350364	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr5:37350364C>T	ENST00000231498.3	-	7	930	c.727G>A	c.(727-729)Gaa>Aaa	p.E243K	NUP155_ENST00000513532.1_Missense_Mutation_p.E243K|NUP155_ENST00000381843.2_Missense_Mutation_p.E184K	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	243					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CACCCTGCTTCAGCCTTAAAG	0.343																																						dbGAP											0													101.0	103.0	102.0					5																	37350364		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.727G>A	5.37:g.37350364C>T	ENSP00000231498:p.Glu243Lys		Q9UBE9|Q9UFL5	Missense_Mutation	SNP	pfam_Nucleoporin_Nup133/Nup155_C,pfam_Nucleoporin_Nup133/Nup155_N,superfamily_WD40_repeat_dom	p.E243K	ENST00000231498.3	37	c.727	CCDS3921.1	5	.	.	.	.	.	.	.	.	.	.	C	19.58	3.854606	0.71719	.	.	ENSG00000113569	ENST00000231498;ENST00000381843;ENST00000434056;ENST00000513532	T;T;T	0.44083	0.93;0.93;0.93	5.42	4.55	0.56014	Nucleoporin, Nup133/Nup155-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.50051	0.1593	L	0.59436	1.845	0.80722	D	1	B;P	0.42908	0.019;0.793	B;P	0.49953	0.074;0.627	T	0.43245	-0.9403	10	0.30078	T	0.28	-3.7354	14.2898	0.66270	0.0:0.928:0.0:0.072	.	243;243	E9PF10;O75694	.;NU155_HUMAN	K	243;184;205;243	ENSP00000231498:E243K;ENSP00000371265:E184K;ENSP00000422019:E243K	ENSP00000231498:E243K	E	-	1	0	NUP155	37386121	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.203000	0.77864	1.293000	0.44690	0.563000	0.77884	GAA	NUP155	-	pfam_Nucleoporin_Nup133/Nup155_N,superfamily_WD40_repeat_dom	ENSG00000113569		0.343	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP155	HGNC	protein_coding	OTTHUMT00000207593.2	16	0.00	0	C	NM_153485, NM_004298		37350364	37350364	-1	no_errors	ENST00000231498	ensembl	human	known	69_37n	missense	87	30.71	39	SNP	1.000	T
TENM4	26011	genome.wustl.edu	37	11	78381280	78381280	+	Missense_Mutation	SNP	G	G	T	rs370873891		TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr11:78381280G>T	ENST00000278550.7	-	32	6572	c.6110C>A	c.(6109-6111)aCg>aAg	p.T2037K		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2037					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CATGCCTGCCGTCTCGTCATA	0.547																																						dbGAP											0													78.0	86.0	84.0					11																	78381280		2104	4197	6301	-	-	-	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.6110C>A	11.37:g.78381280G>T	ENSP00000278550:p.Thr2037Lys		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.T2037K	ENST00000278550.7	37	c.6110	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	G	13.23	2.174339	0.38413	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.89415	-2.51;0.93	4.78	3.86	0.44501	.	0.374826	0.29572	N	0.011761	D	0.85630	0.5741	M	0.63843	1.955	0.36999	D	0.895186	P	0.36010	0.532	B	0.29524	0.103	D	0.86390	0.1735	9	.	.	.	.	15.6114	0.76721	0.0:0.1376:0.8624:0.0	.	2037	Q6N022	TEN4_HUMAN	K	2037;501	ENSP00000278550:T2037K;ENSP00000431711:T501K	.	T	-	2	0	ODZ4	78058928	1.000000	0.71417	0.703000	0.30354	0.967000	0.64934	5.163000	0.64948	1.341000	0.45600	0.655000	0.94253	ACG	ODZ4	-	NULL	ENSG00000149256		0.547	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ4	HGNC	protein_coding	OTTHUMT00000391406.2	28	0.00	0	G			78381280	78381280	-1	no_errors	ENST00000278550	ensembl	human	known	69_37n	missense	47	18.97	11	SNP	0.976	T
PLA2G6	8398	genome.wustl.edu	37	22	38543453	38543453	+	Intron	SNP	T	T	C	rs2284060	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr22:38543453T>C	ENST00000332509.3	-	3	393				PLA2G6_ENST00000447598.2_Intron|PLA2G6_ENST00000417303.2_Intron|PLA2G6_ENST00000436218.1_Intron|PLA2G6_ENST00000435484.1_Intron|PLA2G6_ENST00000402064.1_Intron|PLA2G6_ENST00000335539.3_Intron	NM_003560.2	NP_003551.2	O60733	PLPL9_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)						cardiolipin acyl-chain remodeling (GO:0035965)|cardiolipin biosynthetic process (GO:0032049)|cell death (GO:0008219)|chemotaxis (GO:0006935)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of exocytosis (GO:0045921)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of vasodilation (GO:0045909)|regulation of store-operated calcium channel activity (GO:1901339)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|urinary bladder smooth muscle contraction (GO:0014832)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipase A2 activity (GO:0004623)			breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				Quinacrine(DB01103)	GAGAGTGCGTTGATTAACAGT	0.483													C|||	2104	0.420128	0.3631	0.4323	5008	,	,		18818	0.3413		0.4245	False		,,,				2504	0.5654					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	3.1.1.4	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604				9417066, 16799181, 19029121	Standard	NM_001199562		Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.210-1793A>G	22.37:g.38543453T>C			A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	RNA	SNP	-	NULL	ENST00000332509.3	37	NULL	CCDS13967.1	22																																																																																			PLA2G6	-	-	ENSG00000184381		0.483	PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G6	HGNC	protein_coding	OTTHUMT00000321860.1	28	0.00	0	T	NM_001004426		38543453	38543453	-1	no_errors	ENST00000420435	ensembl	human	known	69_37n	rna	63	12.50	9	SNP	0.000	C
RAET1K	646024	genome.wustl.edu	37	6	150326267	150326267	+	RNA	SNP	A	A	G	rs2275092	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr6:150326267A>G	ENST00000533735.1	-	0	13					NR_024045.1				retinoic acid early transcript 1K pseudogene																		AGCACAGAAGAAACGCGGGGC	0.677													.|||	2836	0.566294	0.7466	0.6124	5008	,	,		12030	0.4901		0.4125	False		,,,				2504	0.5266					dbGAP											0																																										-	-	-			0			AF425244		6q25.1	2012-01-10			ENSG00000218358	ENSG00000218358			16797	pseudogene	pseudogene						11827464	Standard	NR_024045		Approved		uc003qnq.3		OTTHUMG00000015815		6.37:g.150326267A>G				RNA	SNP	-	NULL	ENST00000533735.1	37	NULL		6																																																																																			RAET1K	-	-	ENSG00000218358		0.677	RAET1K-002	KNOWN	basic	processed_transcript	RAET1K	HGNC	pseudogene	OTTHUMT00000390882.1	38	0.00	0	A			150326267	150326267	-1	no_errors	ENST00000533735	ensembl	human	known	69_37n	rna	36	10.00	4	SNP	0.000	G
RBMXL3	139804	genome.wustl.edu	37	X	114427149	114427149	+	Missense_Mutation	SNP	A	A	G	rs6643947		TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chrX:114427149A>G	ENST00000424776.3	+	1	3187	c.3145A>G	c.(3145-3147)Agg>Ggg	p.R1049G	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	1049	Gly-rich.			R -> G (in Ref. 1; BAG63332). {ECO:0000305}.			nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CAGGGTGCCCAGGGGCGGAGG	0.612													A|||	259	0.0686093	0.0113	0.0591	3775	,	,		11631	0.0774		0.0755	False		,,,				2504	0.0501					dbGAP											0													11.0	11.0	11.0					X																	114427149		692	1585	2277	-	-	-	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.3145A>G	X.37:g.114427149A>G	ENSP00000417451:p.Arg1049Gly		B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R1049G	ENST00000424776.3	37	c.3145	CCDS55478.1	X	133	0.08016877637130802	6	0.012244897959183673	10	0.028409090909090908	32	0.06037735849056604	44	0.06043956043956044	A	8.749	0.920736	0.17982	.	.	ENSG00000175718	ENST00000424776	T	0.12255	2.7	0.733	-1.24	0.09435	.	.	.	.	.	T	0.02156	0.0067	L	0.59436	1.845	0.53005	P	3.500000000000725E-5	P	0.51653	0.947	P	0.55965	0.788	T	0.11494	-1.0585	8	0.87932	D	0	.	4.5168	0.11939	0.6705:0.3295:0.0:0.0	rs6643947;rs58851782	1049	Q8N7X1	RMXL3_HUMAN	G	1049	ENSP00000417451:R1049G	ENSP00000417451:R1049G	R	+	1	2	RBMXL3	114333405	1.000000	0.71417	0.004000	0.12327	0.019000	0.09904	2.151000	0.42263	-0.413000	0.07507	0.235000	0.17854	AGG	RBMXL3	-	NULL	ENSG00000175718		0.612	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	16	0.00	0	A	NM_001145346		114427149	114427149	+1	no_errors	ENST00000424776	ensembl	human	known	69_37n	missense	9	55.00	11	SNP	0.987	G
RRP12	23223	genome.wustl.edu	37	10	99118293	99118293	+	Splice_Site	SNP	C	C	T			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr10:99118293C>T	ENST00000370992.4	-	33	3903		c.e33+1		RRP12_ENST00000315563.6_Splice_Site|RRP12_ENST00000414986.1_Splice_Site|RRP12_ENST00000479481.1_Splice_Site|RRP12_ENST00000536831.1_Splice_Site	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)							integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		CAGCGTCATACCTGCGGTTGA	0.547																																						dbGAP											0													204.0	210.0	208.0					10																	99118293		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.3791+1G>A	10.37:g.99118293C>T			B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Splice_Site	SNP	-	e33+1	ENST00000370992.4	37	c.3791+1	CCDS7457.1	10	.	.	.	.	.	.	.	.	.	.	C	18.45	3.626758	0.66901	.	.	ENSG00000052749	ENST00000370992;ENST00000315563;ENST00000414986;ENST00000536831	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9055	0.97006	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RRP12	99108283	1.000000	0.71417	0.999000	0.59377	0.496000	0.33645	7.222000	0.78025	2.711000	0.92665	0.561000	0.74099	.	RRP12	-	-	ENSG00000052749		0.547	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RRP12	HGNC	protein_coding	OTTHUMT00000049699.4	11	0.00	0	C	NM_015179	Intron	99118293	99118293	-1	no_errors	ENST00000370992	ensembl	human	known	69_37n	splice_site	19	20.83	5	SNP	1.000	T
SLC43A3	29015	genome.wustl.edu	37	11	57177569	57177569	+	Silent	SNP	G	G	A			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr11:57177569G>A	ENST00000395123.2	-	12	1390	c.1086C>T	c.(1084-1086)ctC>ctT	p.L362L	SLC43A3_ENST00000352187.1_Silent_p.L362L|SLC43A3_ENST00000533524.1_Silent_p.L375L|SLC43A3_ENST00000395124.1_Silent_p.L362L|RP11-872D17.8_ENST00000529411.1_Silent_p.L6L|SLC43A3_ENST00000529554.1_Silent_p.L362L	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	362					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						CCGTCGAGCAGAGGGCCACCG	0.597																																						dbGAP											0													63.0	46.0	52.0					11																	57177569		2200	4296	6496	-	-	-	SO:0001819	synonymous_variant	0			AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.1086C>T	11.37:g.57177569G>A			B4DNR8|E7EQD2|Q9NSS4	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.L362	ENST00000395123.2	37	c.1086	CCDS7956.1	11																																																																																			SLC43A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000134802		0.597	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC43A3	HGNC	protein_coding	OTTHUMT00000393057.1	13	0.00	0	G	NM_017611		57177569	57177569	-1	no_errors	ENST00000352187	ensembl	human	known	69_37n	silent	14	30.00	6	SNP	0.953	A
SOCS2	8835	genome.wustl.edu	37	12	93968720	93968720	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr12:93968720G>T	ENST00000340600.2	+	3	960	c.362G>T	c.(361-363)aGt>aTt	p.S121I	SOCS2_ENST00000549122.1_Missense_Mutation_p.S121I|SOCS2_ENST00000536696.2_Missense_Mutation_p.S121I|SOCS2_ENST00000551556.1_Missense_Mutation_p.S121I|SOCS2_ENST00000548537.1_3'UTR|SOCS2_ENST00000549206.1_Missense_Mutation_p.S121I	NM_001270468.1|NM_001270469.1|NM_001270471.1|NM_003877.4	NP_001257397.1|NP_001257398.1|NP_001257400.1|NP_003868.1	O14508	SOCS2_HUMAN	suppressor of cytokine signaling 2	121	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cellular response to hormone stimulus (GO:0032870)|growth hormone receptor signaling pathway (GO:0060396)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of signal transduction (GO:0009967)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of signal transduction (GO:0009966)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	growth hormone receptor binding (GO:0005131)|insulin-like growth factor receptor binding (GO:0005159)|JAK pathway signal transduction adaptor activity (GO:0008269)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)	14						CAATTTGACAGTGTGGTTCAT	0.438																																						dbGAP											0													87.0	82.0	84.0					12																	93968720		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF037989	CCDS9047.1	12q	2013-02-14			ENSG00000120833	ENSG00000120833		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19382	protein-coding gene	gene with protein product	"""STAT-induced STAT inhibitor-2"""	605117				9344848, 9266833	Standard	NM_003877		Approved	STATI2, SSI2, SOCS-2, SSI-2, CIS2, Cish2	uc031qjc.1	O14508		ENST00000340600.2:c.362G>T	12.37:g.93968720G>T	ENSP00000339428:p.Ser121Ile		A8K3D1|O14542|O95102|Q9UKS5	Missense_Mutation	SNP	pfam_SOCS_C,pfam_SH2,smart_SH2,smart_SOCS_C,prints_SH2,pfscan_SOCS_C,pfscan_SH2	p.S121I	ENST00000340600.2	37	c.362	CCDS9047.1	12	.	.	.	.	.	.	.	.	.	.	G	21.7	4.188534	0.78789	.	.	ENSG00000120833	ENST00000340600;ENST00000549206;ENST00000536696;ENST00000539385;ENST00000548091;ENST00000549122;ENST00000549887;ENST00000551556	T;T;T;T;T;T;T	0.38560	1.13;1.13;1.13;1.13;1.13;1.13;1.13	5.84	5.84	0.93424	SH2 motif (5);	0.000000	0.85682	D	0.000000	T	0.75503	0.3858	M	0.93150	3.385	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.80874	-0.1187	10	0.66056	D	0.02	-2.0415	20.1346	0.98019	0.0:0.0:1.0:0.0	.	121	O14508	SOCS2_HUMAN	I	121;121;121;69;121;121;121;121	ENSP00000339428:S121I;ENSP00000448815:S121I;ENSP00000442898:S121I;ENSP00000447902:S121I;ENSP00000447161:S121I;ENSP00000448611:S121I;ENSP00000449227:S121I	ENSP00000339428:S121I	S	+	2	0	SOCS2	92492851	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.508000	0.73721	2.765000	0.95021	0.655000	0.94253	AGT	SOCS2	-	pfam_SH2,smart_SH2,prints_SH2,pfscan_SH2	ENSG00000120833		0.438	SOCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS2	HGNC	protein_coding	OTTHUMT00000407731.2	9	0.00	0	G			93968720	93968720	+1	no_errors	ENST00000340600	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	1.000	T
SPIN2A	54466	genome.wustl.edu	37	X	57162385	57162385	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chrX:57162385A>G	ENST00000374908.1	-	1	1045	c.646T>C	c.(646-648)Tat>Cat	p.Y216H	SPIN2A_ENST00000374906.3_Missense_Mutation_p.Y216H			Q99865	SPI2A_HUMAN	spindlin family, member 2A	216					cell cycle (GO:0007049)|gamete generation (GO:0007276)|regulation of cell cycle (GO:0051726)	nucleus (GO:0005634)				breast(1)|kidney(1)|ovary(1)	3						TCTTTGGTATATTCCACATGC	0.463																																						dbGAP											0													59.0	50.0	53.0					X																	57162385		2203	4290	6493	-	-	-	SO:0001583	missense	0			Y09858	CCDS35312.1	Xp11.1	2008-02-05	2006-12-05	2006-12-05	ENSG00000147059	ENSG00000147059			20694	protein-coding gene	gene with protein product		300621	"""spindlin family, member 2"""	SPIN2		9271673	Standard	NM_019003		Approved	DXF34	uc004dvb.3	Q99865	OTTHUMG00000022705	ENST00000374908.1:c.646T>C	X.37:g.57162385A>G	ENSP00000364043:p.Tyr216His		O75650|Q6IPW2|Q9UJJ0	Missense_Mutation	SNP	pfam_Spin_Ssty	p.Y216H	ENST00000374908.1	37	c.646	CCDS35312.1	X	.	.	.	.	.	.	.	.	.	.	.	14.51	2.557041	0.45590	.	.	ENSG00000147059	ENST00000374908;ENST00000374906	T;T	0.31510	1.49;1.49	2.89	2.89	0.33648	.	0.000000	0.64402	D	0.000003	T	0.43233	0.1238	L	0.46157	1.445	0.41956	D	0.990686	D	0.61697	0.99	D	0.80764	0.994	T	0.30238	-0.9985	10	0.51188	T	0.08	-10.7838	8.6446	0.33998	1.0:0.0:0.0:0.0	.	216	Q99865	SPI2A_HUMAN	H	216	ENSP00000364043:Y216H;ENSP00000364041:Y216H	ENSP00000364041:Y216H	Y	-	1	0	SPIN2A	57179110	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	7.388000	0.79795	1.384000	0.46424	0.345000	0.21793	TAT	SPIN2A	-	pfam_Spin_Ssty	ENSG00000147059		0.463	SPIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIN2A	HGNC	protein_coding	OTTHUMT00000058915.1	30	0.00	0	A	NM_019003		57162385	57162385	-1	no_errors	ENST00000374906	ensembl	human	known	69_37n	missense	51	17.74	11	SNP	1.000	G
TNS3	64759	genome.wustl.edu	37	7	47481602	47481602	+	5'UTR	SNP	G	G	A	rs11763044	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr7:47481602G>A	ENST00000398879.1	-	0	343				TNS3_ENST00000458317.2_5'UTR|TNS3_ENST00000311160.9_5'UTR|TNS3_ENST00000442536.2_5'UTR|TNS3_ENST00000355730.3_5'UTR			Q68CZ2	TENS3_HUMAN	tensin 3						cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						GACACTCACCGCAGAGGTTTA	0.483													G|||	1750	0.349441	0.0318	0.5346	5008	,	,		20508	0.4266		0.4712	False		,,,				2504	0.4427					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.-24C>T	7.37:g.47481602G>A			B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Tyr_Pase_cat,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.R96W	ENST00000398879.1	37	c.286	CCDS5506.2	7	763	0.34935897435897434	22	0.044715447154471545	171	0.4723756906077348	224	0.3916083916083916	346	0.45646437994722955	G	10.86	1.470374	0.26423	.	.	ENSG00000136205	ENST00000538633;ENST00000457718;ENST00000450444;ENST00000434451	D;D;D	0.95622	-3.23;-3.76;-3.5	4.09	-8.19	0.01049	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.29713	P	0.839272	.	.	.	.	.	.	T	0.45101	-0.9284	5	0.72032	D	0.01	.	6.582	0.22600	0.0985:0.0869:0.6469:0.1678	rs11763044;rs17544219;rs11763044	.	.	.	W	103;96;82;109	ENSP00000414358:R96W;ENSP00000396914:R82W;ENSP00000407464:R109W	ENSP00000407464:R109W	R	-	1	2	TNS3	47448127	0.004000	0.15560	0.005000	0.12908	0.002000	0.02628	-0.623000	0.05546	-1.610000	0.01583	-2.274000	0.00274	CGG	TNS3	-	NULL	ENSG00000136205		0.483	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS3	HGNC	protein_coding	OTTHUMT00000157253.1	8	0.00	0	G	NM_022748		47481602	47481602	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000457718	ensembl	human	putative	69_37n	missense	16	48.39	15	SNP	0.001	A
TPTE2P1	646405	genome.wustl.edu	37	13	25541467	25541467	+	RNA	SNP	C	C	T	rs2483380	byFrequency	TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr13:25541467C>T	ENST00000429698.1	-	0	282							Q5T6R2	TPT2L_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 1																		GTCCTACCAGCGATGTTTCAG	0.328													N|||	2069	0.413139	0.3911	0.304	5008	,	,		17090	0.3442		0.4076	False		,,,				2504	0.5971					dbGAP											0																																										-	-	-			0					13q12.12-q12.13	2012-10-03			ENSG00000253771	ENSG00000253771			35196	pseudogene	pseudogene							Standard	NR_026730		Approved		uc010tdh.2	Q5T6R2	OTTHUMG00000016596		13.37:g.25541467C>T			B3KST4|B4DMH9	RNA	SNP	-	NULL	ENST00000429698.1	37	NULL		13																																																																																			TPTE2P1	-	-	ENSG00000253771		0.328	TPTE2P1-003	KNOWN	basic	processed_transcript	TPTE2P1	HGNC	pseudogene	OTTHUMT00000044206.1	19	0.00	0	C			25541467	25541467	-1	no_errors	ENST00000381871	ensembl	human	known	69_37n	rna	43	15.69	8	SNP	0.009	T
TRIM62	55223	genome.wustl.edu	37	1	33623922	33623922	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr1:33623922delG	ENST00000291416.5	-	4	1042	c.809delC	c.(808-810)ccgfs	p.P270fs	TRIM62_ENST00000485148.1_5'Flank|TRIM62_ENST00000543586.1_Frame_Shift_Del_p.P149fs	NM_018207.2	NP_060677.2	Q9BVG3	TRI62_HUMAN	tripartite motif containing 62	270					innate immune response (GO:0045087)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral entry into host cell (GO:0046596)|regulation of viral release from host cell (GO:1902186)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0393)				CTTGGAGGTCGGGAAGTCTTC	0.552																																						dbGAP											0													205.0	192.0	197.0					1																	33623922		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC007999	CCDS376.1	1p35.1	2013-10-11	2011-01-25		ENSG00000116525	ENSG00000116525		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	25574	protein-coding gene	gene with protein product	"""ductal epithelium-associated RING Chromosome 1"""		"""tripartite motif-containing 62"""			19536326	Standard	NM_018207		Approved	FLJ10759, DEAR1	uc001bxb.3	Q9BVG3	OTTHUMG00000004132	ENST00000291416.5:c.809delC	1.37:g.33623922delG	ENSP00000291416:p.Pro270fs		B3KVH5|B4DTE4|D3DPR1|Q9NVG0	Frame_Shift_Del	DEL	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.P270fs	ENST00000291416.5	37	c.809	CCDS376.1	1																																																																																			TRIM62	-	NULL	ENSG00000116525		0.552	TRIM62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM62	HGNC	protein_coding	OTTHUMT00000011890.1	44	0.00	0	G	NM_018207		33623922	33623922	-1	no_errors	ENST00000291416	ensembl	human	known	69_37n	frame_shift_del	50	13.79	8	DEL	0.999	-
ZNF710	374655	genome.wustl.edu	37	15	90611206	90611206	+	Silent	SNP	G	G	A			TCGA-AC-A2FE-01A-11D-A19Y-09	TCGA-AC-A2FE-11B-22D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f97dcfdf-eed2-4844-8547-162917143704	a2826b46-da0f-4e0d-9f06-bfae025386a6	g.chr15:90611206G>A	ENST00000268154.4	+	2	1088	c.837G>A	c.(835-837)caG>caA	p.Q279Q		NM_198526.2	NP_940928.2	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	279					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(1)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	19	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			TCAACGTGCAGATTGACGACT	0.622																																						dbGAP											0													57.0	66.0	63.0					15																	90611206		2200	4297	6497	-	-	-	SO:0001819	synonymous_variant	0			AK094712	CCDS10358.1	15q26.1	2013-01-08			ENSG00000140548	ENSG00000140548		"""Zinc fingers, C2H2-type"""	25352	protein-coding gene	gene with protein product							Standard	XM_005254905		Approved	DKFZp547K1113, FLJ37393, FLJ00306	uc002bov.2	Q8N1W2	OTTHUMG00000149812	ENST00000268154.4:c.837G>A	15.37:g.90611206G>A			A0AVS3|Q6ZMK9|Q8NDU0	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q279	ENST00000268154.4	37	c.837	CCDS10358.1	15																																																																																			ZNF710	-	NULL	ENSG00000140548		0.622	ZNF710-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF710	HGNC	protein_coding	OTTHUMT00000313423.1	20	0.00	0	G	NM_198526		90611206	90611206	+1	no_errors	ENST00000268154	ensembl	human	known	69_37n	silent	34	19.05	8	SNP	1.000	A
