#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ANKRD22	118932	genome.wustl.edu	37	10	90591731	90591731	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr10:90591731A>C	ENST00000371930.4	-	2	284	c.74T>G	c.(73-75)gTg>gGg	p.V25G		NM_144590.2	NP_653191.2	Q5VYY1	ANR22_HUMAN	ankyrin repeat domain 22	25										NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(3)	10		Colorectal(252;0.0163)		Colorectal(12;6.29e-05)|COAD - Colon adenocarcinoma(12;7.69e-05)		GTCTTCTTTCACCCACCGCCA	0.488																																						dbGAP											0													245.0	239.0	241.0					10																	90591731		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC021671	CCDS7390.1	10q23.31	2013-09-20			ENSG00000152766	ENSG00000152766		"""Ankyrin repeat domain containing"""	28321	protein-coding gene	gene with protein product						12477932	Standard	NM_144590		Approved	MGC22805	uc001kfj.4	Q5VYY1	OTTHUMG00000018699	ENST00000371930.4:c.74T>G	10.37:g.90591731A>C	ENSP00000360998:p.Val25Gly		B2R9Y7|Q8WU06	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.V25G	ENST00000371930.4	37	c.74	CCDS7390.1	10	.	.	.	.	.	.	.	.	.	.	A	11.14	1.551453	0.27739	.	.	ENSG00000152766	ENST00000371930	T	0.55052	0.54	5.58	1.79	0.24919	Ankyrin repeat-containing domain (2);	0.381500	0.28718	N	0.014370	T	0.50274	0.1606	M	0.74881	2.28	0.09310	N	0.999992	B	0.23442	0.085	B	0.24974	0.057	T	0.51772	-0.8663	10	0.87932	D	0	-7.7884	8.882	0.35380	0.7682:0.0:0.2318:0.0	.	25	Q5VYY1	ANR22_HUMAN	G	25	ENSP00000360998:V25G	ENSP00000360998:V25G	V	-	2	0	ANKRD22	90581711	0.945000	0.32115	0.050000	0.19076	0.523000	0.34469	2.694000	0.47035	0.371000	0.24564	-0.441000	0.05720	GTG	ANKRD22	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000152766		0.488	ANKRD22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD22	HGNC	protein_coding	OTTHUMT00000049262.1	100	0.00	0	A	NM_144590		90591731	90591731	-1	no_errors	ENST00000371930	ensembl	human	known	69_37n	missense	34	45.16	28	SNP	0.023	C
ANKRD65	441869	genome.wustl.edu	37	1	1354515	1354515	+	Missense_Mutation	SNP	C	C	G	rs534554090|rs904589	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr1:1354515C>G	ENST00000537107.1	-	4	1302	c.1165G>C	c.(1165-1167)Gag>Cag	p.E389Q	ANKRD65_ENST00000520296.1_3'UTR|ANKRD65_ENST00000454272.1_5'UTR|RP4-758J18.7_ENST00000428932.1_RNA|ANKRD65_ENST00000427211.1_3'UTR	NM_001145210.2	NP_001138682.1	E5RJM6	ANR65_HUMAN	ankyrin repeat domain 65	389										breast(1)	1						CACTCCTTCTCCCCCCCTCCA	0.687													G|||	1617	0.322883	0.8222	0.1945	5008	,	,		16520	0.1131		0.0964	False		,,,				2504	0.1881					dbGAP											0													2.0	3.0	3.0					1																	1354515		507	1316	1823	-	-	-	SO:0001583	missense	0				CCDS55558.1, CCDS57962.1, CCDS57963.1	1p36.33	2013-01-10			ENSG00000235098	ENSG00000235098		"""Ankyrin repeat domain containing"""	42950	protein-coding gene	gene with protein product							Standard	NM_001243535		Approved		uc010nyo.2	E5RJM6	OTTHUMG00000002911	ENST00000537107.1:c.1165G>C	1.37:g.1354515C>G	ENSP00000445688:p.Glu389Gln		J3KR93	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E389Q	ENST00000537107.1	37	c.1165	CCDS55558.1	1	622	0.2847985347985348	404	0.8211382113821138	79	0.21823204419889503	67	0.11713286713286714	72	0.09498680738786279	G	0.243	-1.012516	0.02095	.	.	ENSG00000235098	ENST00000537107	T	0.68624	-0.34	1.28	0.254	0.15557	.	.	.	.	.	T	0.00012	0.0000	N	0.24115	0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.38520	-0.9657	8	0.10902	T	0.67	.	6.8436	0.23977	0.0:0.5817:0.4183:0.0	rs904589;rs3766168	389	E5RJM6	ANR65_HUMAN	Q	389	ENSP00000445688:E389Q	ENSP00000445688:E389Q	E	-	1	0	RP4-758J18.6	1344378	0.004000	0.15560	0.001000	0.08648	0.007000	0.05969	-0.137000	0.10389	-0.272000	0.09259	-0.497000	0.04613	GAG	ANKRD65	-	NULL	ENSG00000235098		0.687	ANKRD65-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD65	HGNC	protein_coding		44	0.00	0	C			1354515	1354515	-1	no_errors	ENST00000537107	ensembl	human	known	69_37n	missense	39	11.36	5	SNP	0.027	G
APOC1P1	342	genome.wustl.edu	37	19	45430280	45430280	+	RNA	SNP	C	C	G	rs5112	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr19:45430280C>G	ENST00000574565.1	+	0	71					NR_028412.1				apolipoprotein C-I pseudogene 1																		TTCTGTCGATCGTCTTGGAAG	0.607													g|||	2892	0.577476	0.5635	0.5375	5008	,	,		19124	0.6756		0.5577	False		,,,				2504	0.544					dbGAP											0																																										-	-	-			0			M20903		19q13.32	2014-03-18			ENSG00000214855	ENSG00000214855			608	pseudogene	pseudogene							Standard	NR_028412		Approved		uc021uvm.1		OTTHUMG00000177534		19.37:g.45430280C>G				RNA	SNP	-	NULL	ENST00000574565.1	37	NULL		19																																																																																			APOC1P1	-	-	ENSG00000214855		0.607	APOC1P1-003	KNOWN	basic	processed_transcript	APOC1P1	HGNC	pseudogene	OTTHUMT00000437392.1	83	0.00	0	C			45430280	45430280	+1	no_errors	ENST00000507983	ensembl	human	known	69_37n	rna	49	12.50	7	SNP	0.001	G
ATRX	546	genome.wustl.edu	37	X	76762869	76762869	+	3'UTR	SNP	T	T	C			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chrX:76762869T>C	ENST00000373344.5	-	0	8653				ATRX_ENST00000395603.3_3'UTR|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked						ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						CATTTTGATGTTGTTTATAAA	0.368			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																															dbGAP		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.*960A>G	X.37:g.76762869T>C			D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	RNA	SNP	-	NULL	ENST00000373344.5	37	NULL	CCDS14434.1	X																																																																																			ATRX	-	-	ENSG00000085224		0.368	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	50	0.00	0	T	NM_000489		76762869	76762869	-1	no_errors	ENST00000480283	ensembl	human	known	69_37n	rna	41	16.33	8	SNP	0.848	C
ATP11C	286410	genome.wustl.edu	37	X	138864799	138864799	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chrX:138864799A>G	ENST00000327569.3	-	18	1966	c.1868T>C	c.(1867-1869)aTg>aCg	p.M623T	ATP11C_ENST00000460773.1_5'UTR|ATP11C_ENST00000361648.2_Missense_Mutation_p.M623T|ATP11C_ENST00000370543.1_Missense_Mutation_p.M623T|ATP11C_ENST00000359686.2_Missense_Mutation_p.M623T|ATP11C_ENST00000370557.1_Missense_Mutation_p.M620T	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	623					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					TTGTAAGGCCATTTTTGCCTC	0.373																																						dbGAP											0													112.0	93.0	99.0					X																	138864799		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.1868T>C	X.37:g.138864799A>G	ENSP00000332756:p.Met623Thr		Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.M623T	ENST00000327569.3	37	c.1868	CCDS14668.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.655|9.655	1.142536|1.142536	0.21205|0.21205	.|.	.|.	ENSG00000101974|ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686|ENST00000422228	T;T;T;T;T|.	0.80738|.	-1.41;-1.41;-1.41;-1.41;-1.41|.	5.68|5.68	5.68|5.68	0.88126|0.88126	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);|.	0.104165|.	0.64402|.	D|.	0.000003|.	T|T	0.33469|0.33469	0.0864|0.0864	N|N	0.03154|0.03154	-0.405|-0.405	0.50813|0.50813	D|D	0.99989|0.99989	B;B|.	0.24317|.	0.101;0.066|.	B;B|.	0.29176|.	0.096;0.099|.	T|T	0.31420|0.31420	-0.9944|-0.9944	10|5	0.02654|.	T|.	1|.	.|.	14.0104|14.0104	0.64493|0.64493	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	623;623|.	Q8NB49-3;Q8NB49|.	.;AT11C_HUMAN|.	T|R	620;623;623;623;623|175	ENSP00000359588:M620T;ENSP00000355165:M623T;ENSP00000332756:M623T;ENSP00000359574:M623T;ENSP00000352715:M623T|.	ENSP00000332756:M623T|.	M|W	-|-	2|1	0|0	ATP11C|ATP11C	138692465|138692465	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	6.883000|6.883000	0.75595|0.75595	1.906000|1.906000	0.55180|0.55180	0.481000|0.481000	0.45027|0.45027	ATG|TGG	ATP11C	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000101974		0.373	ATP11C-008	KNOWN	basic|CCDS	protein_coding	ATP11C	HGNC	protein_coding	OTTHUMT00000354945.1	123	0.00	0	A	NM_173694		138864799	138864799	-1	no_errors	ENST00000327569	ensembl	human	known	69_37n	missense	66	33.33	33	SNP	1.000	G
BCR	613	genome.wustl.edu	37	22	23652503	23652503	+	Intron	SNP	T	T	C	rs201201470	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr22:23652503T>C	ENST00000305877.8	+	18	3823				BCR_ENST00000359540.3_Intron|BCR_ENST00000436990.2_3'UTR	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region						actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.?(1)	BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CCCTTCTCCCTACTGTAGATC	0.532			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""								C|||	1567	0.312899	0.2784	0.2305	5008	,	,		15891	0.621		0.2227	False		,,,				2504	0.1933					dbGAP		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	1	Unknown(1)	stomach(1)											47.0	46.0	46.0					22																	23652503		1653	3598	5251	-	-	-	SO:0001627	intron_variant	0				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.3073-8T>C	22.37:g.23652503T>C			P78501|Q12842|Q4LE80|Q6NZI3	RNA	SNP	-	NULL	ENST00000305877.8	37	NULL	CCDS13806.1	22																																																																																			BCR	-	-	ENSG00000186716		0.532	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	65	0.00	0	T	NM_004327		23652503	23652503	+1	no_errors	ENST00000419722	ensembl	human	known	69_37n	rna	10	41.18	7	SNP	0.000	C
KNOP1	400506	genome.wustl.edu	37	16	19725476	19725476	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr16:19725476C>A	ENST00000219837.7	-	2	960	c.882G>T	c.(880-882)agG>agT	p.R294S	IQCK_ENST00000320394.6_5'Flank|AC002550.5_ENST00000565916.1_RNA|KNOP1_ENST00000568230.1_5'Flank	NM_001012991.2	NP_001013009.2	Q1ED39	KNOP1_HUMAN	lysine-rich nucleolar protein 1	294	Lys-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										CACTCTCTTTCCTCTTCTTCT	0.493																																						dbGAP											0													147.0	168.0	161.0					16																	19725476		2098	4244	6342	-	-	-	SO:0001583	missense	0			BC047010	CCDS42127.1	16p12.3	2013-03-12	2013-03-12	2013-03-12	ENSG00000103550	ENSG00000103550			34404	protein-coding gene	gene with protein product	"""family with sequence similarity 191, member A"", ""testis-specific gene 118"""		"""chromosome 16 open reading frame 88"""	C16orf88			Standard	NM_001012991		Approved	101F10.1, FAM191A, TSG118	uc002dgq.3	Q1ED39		ENST00000219837.7:c.882G>T	16.37:g.19725476C>A	ENSP00000219837:p.Arg294Ser		O43328|Q5FWF3	Nonsense_Mutation	SNP	NULL	p.E142*	ENST00000219837.7	37	c.424	CCDS42127.1	16	.	.	.	.	.	.	.	.	.	.	C	2.878	-0.232504	0.05983	.	.	ENSG00000103550	ENST00000219837	T	0.26957	1.7	4.26	2.23	0.28157	.	1.326250	0.05596	N	0.575573	T	0.14787	0.0357	N	0.17082	0.46	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.30909	-0.9962	9	.	.	.	-11.0867	3.4069	0.07344	0.1737:0.5616:0.1687:0.096	.	294	Q1ED39	CP088_HUMAN	S	294	ENSP00000219837:R294S	.	R	-	3	2	C16orf88	19632977	0.006000	0.16342	0.016000	0.15963	0.076000	0.17211	0.395000	0.20850	0.506000	0.28125	-0.150000	0.13652	AGG	C16orf88	-	NULL	ENSG00000103550		0.493	KNOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf88	HGNC	protein_coding	OTTHUMT00000435993.2	92	0.00	0	C	NM_001012991		19725476	19725476	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000567367	ensembl	human	novel	69_37n	nonsense	58	21.62	16	SNP	0.007	A
KNOP1	400506	genome.wustl.edu	37	16	19725691	19725691	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr16:19725691C>G	ENST00000219837.7	-	2	745	c.667G>C	c.(667-669)Gat>Cat	p.D223H	IQCK_ENST00000320394.6_5'Flank|AC002550.5_ENST00000565916.1_RNA|KNOP1_ENST00000568230.1_5'Flank	NM_001012991.2	NP_001013009.2	Q1ED39	KNOP1_HUMAN	lysine-rich nucleolar protein 1	223	Lys-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										GGGAGGGCATCTCCCTCCTGG	0.532																																						dbGAP											0													63.0	71.0	68.0					16																	19725691		2186	4298	6484	-	-	-	SO:0001583	missense	0			BC047010	CCDS42127.1	16p12.3	2013-03-12	2013-03-12	2013-03-12	ENSG00000103550	ENSG00000103550			34404	protein-coding gene	gene with protein product	"""family with sequence similarity 191, member A"", ""testis-specific gene 118"""		"""chromosome 16 open reading frame 88"""	C16orf88			Standard	NM_001012991		Approved	101F10.1, FAM191A, TSG118	uc002dgq.3	Q1ED39		ENST00000219837.7:c.667G>C	16.37:g.19725691C>G	ENSP00000219837:p.Asp223His		O43328|Q5FWF3	Missense_Mutation	SNP	NULL	p.D223H	ENST00000219837.7	37	c.667	CCDS42127.1	16	.	.	.	.	.	.	.	.	.	.	C	16.75	3.209774	0.58343	.	.	ENSG00000103550	ENST00000219837	T	0.45276	0.9	4.71	4.71	0.59529	.	3.058100	0.00931	N	0.002710	T	0.55909	0.1950	L	0.29908	0.895	0.80722	D	1	D	0.62365	0.991	P	0.61132	0.884	T	0.40136	-0.9579	9	.	.	.	-15.415	15.5314	0.75964	0.0:1.0:0.0:0.0	.	223	Q1ED39	CP088_HUMAN	H	223	ENSP00000219837:D223H	.	D	-	1	0	C16orf88	19633192	0.435000	0.25577	0.854000	0.33618	0.360000	0.29518	3.586000	0.53950	2.590000	0.87494	0.561000	0.74099	GAT	C16orf88	-	NULL	ENSG00000103550		0.532	KNOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf88	HGNC	protein_coding	OTTHUMT00000435993.2	95	0.00	0	C	NM_001012991		19725691	19725691	-1	no_errors	ENST00000219837	ensembl	human	known	69_37n	missense	76	26.21	27	SNP	0.949	G
C19orf68	374920	genome.wustl.edu	37	19	48685877	48685877	+	Silent	SNP	G	G	A	rs16981771	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr19:48685877G>A	ENST00000328759.7	+	3	473	c.441G>A	c.(439-441)ccG>ccA	p.P147P	ZNF114_ENST00000597695.1_Intron|CARD8_ENST00000600800.1_5'UTR			Q86XI8	CS068_HUMAN	chromosome 19 open reading frame 68	147					hematopoietic progenitor cell differentiation (GO:0002244)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)											CCTGCCTGCCGGTGCGCACCA	0.692													g|||	904	0.180511	0.3525	0.1657	5008	,	,		12950	0.1329		0.1064	False		,,,				2504	0.0838					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BC043386	CCDS74411.1	19q13.32	2008-08-06			ENSG00000185453	ENSG00000185453			34495	protein-coding gene	gene with protein product						12477932	Standard	NM_199341		Approved	LOC374920	uc002pic.3	Q86XI8		ENST00000328759.7:c.441G>A	19.37:g.48685877G>A				Silent	SNP	NULL	p.P147	ENST00000328759.7	37	c.441		19																																																																																			C19orf68	-	NULL	ENSG00000185453		0.692	C19orf68-001	KNOWN	non_canonical_other|basic|appris_principal	protein_coding	C19orf68	HGNC	protein_coding	OTTHUMT00000465598.1	53	0.00	0	G	XM_001713770		48685877	48685877	+1	no_errors	ENST00000328759	ensembl	human	known	69_37n	silent	36	10.00	4	SNP	0.003	A
C5orf27	202299	genome.wustl.edu	37	5	95194571	95194571	+	Silent	SNP	T	T	C	rs13168014	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr5:95194571T>C	ENST00000436592.1	+	4	786	c.138T>C	c.(136-138)ctT>ctC	p.L46L	C5orf27_ENST00000357880.3_Silent_p.L46L|AC008592.5_ENST00000503091.1_RNA					chromosome 5 open reading frame 27																		CGCAGCCACTTCAGGCTGCTG	0.592											OREG0016708	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	3012	0.601438	0.3918	0.5548	5008	,	,		19916	0.9425		0.5427	False		,,,				2504	0.6268					dbGAP											0													54.0	45.0	48.0					5																	95194571		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AY168789		5q15	2014-04-16			ENSG00000236882	ENSG00000236882			24687	other	unknown							Standard	NR_026936		Approved	FLJ38821, FIS	uc003klp.3	Q52M75	OTTHUMG00000122084	ENST00000436592.1:c.138T>C	5.37:g.95194571T>C		1311		Silent	SNP	NULL	p.L46	ENST00000436592.1	37	c.138		5																																																																																			C5orf27	-	NULL	ENSG00000236882		0.592	C5orf27-001	KNOWN	basic|appris_principal	protein_coding	C5orf27	HGNC	protein_coding	OTTHUMT00000242845.3	45	0.00	0	T	NM_175616		95194571	95194571	+1	no_errors	ENST00000357880	ensembl	human	known	69_37n	silent	30	11.76	4	SNP	0.000	C
C6orf183	389422	genome.wustl.edu	37	6	109519623	109519623	+	RNA	SNP	C	C	T	rs380774	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr6:109519623C>T	ENST00000417143.3	+	0	773							Q5T699	CF183_HUMAN	chromosome 6 open reading frame 183																		GTCGCTGAAGCTGGTCAGAAA	0.463													T|||	2484	0.496006	0.8109	0.2853	5008	,	,		18760	0.4563		0.4384	False		,,,				2504	0.32					dbGAP											0																																										-	-	-			0					6q21	2013-11-06	2012-02-07	2012-02-07	ENSG00000243587	ENSG00000243587			21562	other	unknown							Standard			Approved	bA487F23.3		Q5T699	OTTHUMG00000015337		6.37:g.109519623C>T				RNA	SNP	-	NULL	ENST00000417143.3	37	NULL		6																																																																																			C6orf183	-	-	ENSG00000243587		0.463	C6orf183-001	KNOWN	mRNA_end_NF|cds_end_NF|basic	polymorphic_pseudogene	C6orf183	HGNC	polymorphic_pseudogene	OTTHUMT00000041736.4	64	0.00	0	C			109519623	109519623	+1	no_errors	ENST00000417143	ensembl	human	known	69_37n	rna	44	12.00	6	SNP	0.000	T
CELSR2	1952	genome.wustl.edu	37	1	109812436	109812436	+	Silent	SNP	G	G	T			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr1:109812436G>T	ENST00000271332.3	+	22	7162	c.7101G>T	c.(7099-7101)cgG>cgT	p.R2367R		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2367	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		ACGTTTCTCGGCGGGAGGTCG	0.662																																					NSCLC(158;1285 2011 34800 34852 42084)	dbGAP											0													89.0	94.0	92.0					1																	109812436		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7101G>T	1.37:g.109812436G>T			Q5T2Y7|Q92566	Silent	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.R2367	ENST00000271332.3	37	c.7101	CCDS796.1	1																																																																																			CELSR2	-	smart_GPS_dom,pfscan_GPS_dom	ENSG00000143126		0.662	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	34	0.00	0	G	NM_001408		109812436	109812436	+1	no_errors	ENST00000271332	ensembl	human	known	69_37n	silent	15	21.05	4	SNP	0.997	T
CEP85L	387119	genome.wustl.edu	37	6	118803030	118803030	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr6:118803030C>A	ENST00000368491.3	-	8	2278	c.1657G>T	c.(1657-1659)Gaa>Taa	p.E553*	CEP85L_ENST00000368488.5_Nonsense_Mutation_p.E556*	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	553						centrosome (GO:0005813)|cytoplasm (GO:0005737)											TTGATCTCTTCAAGTTTTTTT	0.318																																						dbGAP											0													87.0	73.0	77.0					6																	118803030		1793	4058	5851	-	-	-	SO:0001587	stop_gained	0			AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.1657G>T	6.37:g.118803030C>A	ENSP00000357477:p.Glu553*		A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Nonsense_Mutation	SNP	NULL	p.E556*	ENST00000368491.3	37	c.1666	CCDS43498.1	6	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447623	0.63178	.	.	ENSG00000111860	ENST00000368491;ENST00000368488;ENST00000434604	.	.	.	5.24	4.36	0.52297	.	0.475270	0.23110	N	0.051811	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-13.4435	9.7087	0.40231	0.0:0.8423:0.0:0.1577	.	.	.	.	X	553;556;556	.	ENSP00000357474:E556X	E	-	1	0	C6orf204	118909723	1.000000	0.71417	0.996000	0.52242	0.504000	0.33889	3.391000	0.52530	2.599000	0.87857	0.561000	0.74099	GAA	CEP85L	-	NULL	ENSG00000111860		0.318	CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP85L	HGNC	protein_coding	OTTHUMT00000041996.2	45	0.00	0	C	NM_001042475		118803030	118803030	-1	no_errors	ENST00000368488	ensembl	human	known	69_37n	nonsense	29	30.95	13	SNP	0.996	A
CNTN2	6900	genome.wustl.edu	37	1	205034993	205034993	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr1:205034993C>T	ENST00000331830.4	+	14	2056	c.1772C>T	c.(1771-1773)aCg>aTg	p.T591M		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	591	Ig-like C2-type 6.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			ATGGCCCAGACGGTGGTGGAC	0.627																																					Melanoma(183;2548 2817 37099 41192)	dbGAP											0													91.0	81.0	85.0					1																	205034993		2203	4300	6503	-	-	-	SO:0001583	missense	0			X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.1772C>T	1.37:g.205034993C>T	ENSP00000330633:p.Thr591Met		P78432|Q5T054	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.T591M	ENST00000331830.4	37	c.1772	CCDS1449.1	1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.938198	0.92526	.	.	ENSG00000184144	ENST00000331830	T	0.67345	-0.26	5.75	4.8	0.61643	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000039	D	0.85418	0.5692	M	0.91768	3.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.89117	0.3500	10	0.87932	D	0	.	16.0602	0.80834	0.0:0.8653:0.1347:0.0	.	591;482	Q02246;Q68DA2	CNTN2_HUMAN;.	M	591	ENSP00000330633:T591M	ENSP00000330633:T591M	T	+	2	0	CNTN2	203301616	1.000000	0.71417	0.969000	0.41365	0.996000	0.88848	7.318000	0.79029	1.367000	0.46095	0.591000	0.81541	ACG	CNTN2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000184144		0.627	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN2	HGNC	protein_coding	OTTHUMT00000090080.3	36	0.00	0	C	NM_005076		205034993	205034993	+1	no_errors	ENST00000331830	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	1.000	T
CPQ	10404	genome.wustl.edu	37	8	97847337	97847337	+	Silent	SNP	G	G	T	rs141249137	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr8:97847337G>T	ENST00000220763.5	+	3	780	c.570G>T	c.(568-570)ggG>ggT	p.G190G		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	190					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										GAACGCAGGGGGCGGTGGAAG	0.493																																						dbGAP											0													100.0	99.0	100.0					8																	97847337		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.570G>T	8.37:g.97847337G>T			B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Silent	SNP	pfam_Peptidase_M28,pfam_Peptidase_M20	p.G190	ENST00000220763.5	37	c.570	CCDS6273.1	8																																																																																			CPQ	-	NULL	ENSG00000104324		0.493	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPQ	HGNC	protein_coding	OTTHUMT00000379757.2	59	0.00	0	G	NM_016134		97847337	97847337	+1	no_errors	ENST00000220763	ensembl	human	known	69_37n	silent	109	14.17	18	SNP	0.095	T
CROCCP2	84809	genome.wustl.edu	37	1	16956889	16956892	+	lincRNA	DEL	CAGA	CAGA	-	rs539867279	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	CAGA	CAGA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr1:16956889_16956892delCAGA	ENST00000412962.1	-	0	294							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CCCGGGATGCCAGACAAACTCCCA	0.627														26	0.00519169	0.0023	0.0014	5008	,	,		57676	0.001		0.0169	False		,,,				2504	0.0041					dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16956889_16956892delCAGA			Q8NF65|Q96FR5|Q9BRE8	RNA	DEL	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.627	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	16	0.00	0	CAGA	NR_026752.1		16956889	16956892	-1	no_errors	ENST00000362058	ensembl	human	known	69_37n	rna	9	30.77	4	DEL	0.064:0.065:0.068:0.074	-
DNM1P46	196968	genome.wustl.edu	37	15	100332712	100332712	+	RNA	SNP	T	T	G			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr15:100332712T>G	ENST00000341853.1	-	0	1479				AC090825.1_ENST00000408584.1_RNA|RN7SL484P_ENST00000462651.2_RNA	NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										TCTGCAggggtgggggtgggc	0.617																																						dbGAP											0													63.0	68.0	66.0					15																	100332712		876	1991	2867	-	-	-			0			AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100332712T>G			Q3ZCN3	RNA	SNP	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			DNM1P46	-	-	ENSG00000182397		0.617	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	HGNC	pseudogene	OTTHUMT00000313543.1	148	0.67	1	T	NR_003260		100332712	100332712	-1	no_errors	ENST00000341853	ensembl	human	known	69_37n	rna	49	30.56	22	SNP	0.017	G
EEF1DP3	196549	genome.wustl.edu	37	13	32527529	32527529	+	RNA	SNP	A	A	G	rs916756	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr13:32527529A>G	ENST00000428783.1	+	0	1229							Q658K8	EF1DL_HUMAN	eukaryotic translation elongation factor 1 delta pseudogene 3								translation elongation factor activity (GO:0003746)										GCCCGCGTGCATGAGGCCCTG	0.443													G|||	2060	0.411342	0.6286	0.1614	5008	,	,		13494	0.5427		0.2048	False		,,,				2504	0.3722					dbGAP											0																																										-	-	-			0					13q13.1	2012-10-23			ENSG00000229715	ENSG00000229715			30486	pseudogene	pseudogene						12477932	Standard	NR_027062		Approved		uc001utu.3	Q658K8	OTTHUMG00000016691		13.37:g.32527529A>G			Q08AR3	RNA	SNP	-	NULL	ENST00000428783.1	37	NULL		13																																																																																			EEF1DP3	-	-	ENSG00000229715		0.443	EEF1DP3-001	KNOWN	basic	processed_transcript	EEF1DP3	HGNC	pseudogene	OTTHUMT00000044400.2	20	0.00	0	A	NR_027062		32527529	32527529	+1	no_errors	ENST00000428783	ensembl	human	known	69_37n	rna	13	23.53	4	SNP	0.009	G
EPB41L4A	64097	genome.wustl.edu	37	5	111481696	111481696	+	Splice_Site	SNP	C	C	T	rs17134155	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr5:111481696C>T	ENST00000507810.1	-	13	994		c.e13-1					Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		tctggacaccctgttaaagaa	0.448													T|||	1202	0.240016	0.5461	0.1254	5008	,	,		17623	0.0575		0.1779	False		,,,				2504	0.1595					dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000507810.1:c.1559-1G>A	5.37:g.111481696C>T			A4FUI6	Splice_Site	SNP	-	NULL	ENST00000507810.1	37	c.NULL		5																																																																																			EPB41L4A	-	-	ENSG00000129595		0.448	EPB41L4A-007	KNOWN	basic	processed_transcript	EPB41L4A	HGNC	protein_coding	OTTHUMT00000370975.1	55	0.00	0	C		Intron	111481696	111481696	-1	no_errors	ENST00000507810	ensembl	human	known	69_37n	splice_site	52	10.34	6	SNP	0.000	T
FAM86B2	653333	genome.wustl.edu	37	8	12286609	12286609	+	Silent	SNP	T	T	C	rs564181697	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr8:12286609T>C	ENST00000262365.4	-	5	356	c.357A>G	c.(355-357)tcA>tcG	p.S119S	FAM86B2_ENST00000393715.3_5'UTR|FAM86B2_ENST00000309608.5_Silent_p.S85S|FAM86B2_ENST00000351291.4_Silent_p.S85S	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	119										endometrium(1)|kidney(2)	3						AGAGTGTGACTGAGCCTCCTG	0.572													t|||	611	0.122005	0.112	0.1182	5008	,	,		19018	0.0794		0.162	False		,,,				2504	0.1411					dbGAP											0													1.0	1.0	1.0					8																	12286609		18	72	90	-	-	-	SO:0001819	synonymous_variant	0				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.357A>G	8.37:g.12286609T>C				Silent	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.S119	ENST00000262365.4	37	c.357	CCDS59092.1	8																																																																																			FAM86B2	-	NULL	ENSG00000145002		0.572	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86B2	HGNC	protein_coding		8	0.00	0	T	XM_928336		12286609	12286609	-1	no_errors	ENST00000262365	ensembl	human	known	69_37n	silent	16	40.74	11	SNP	0.506	C
FASN	2194	genome.wustl.edu	37	17	80037356	80037358	+	In_Frame_Del	DEL	GTA	GTA	-			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	GTA	GTA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr17:80037356_80037358delGTA	ENST00000306749.2	-	42	7491_7493	c.7273_7275delTAC	c.(7273-7275)tacdel	p.Y2425del	FASN_ENST00000579758.1_5'UTR	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2425	Thioesterase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	CACGCAGCTTGTAGTAGAAGGAC	0.65																																					Colon(59;314 1043 11189 28578 32273)	dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.7273_7275delTAC	17.37:g.80037359_80037361delGTA	ENSP00000304592:p.Tyr2425del		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	In_Frame_Del	DEL	pfam_Acyl_transferase,pfam_Ketoacyl_synth_N,pfam_Thioesterase,pfam_PKS_KR,pfam_DH_sc/Rdtase_SDR,pfam_Ketoacyl_synth_C,pfam_ADH_C,pfam_Acyl_carrier_prot-like,pfam_Methyltransf_12,pfam_Methyltransf_11,superfamily_Thiolase-like,superfamily_Acyl_Trfase/lysoPLipase,superfamily_GroES-like,superfamily_Acyl_carrier_prot-like,superfamily_Malonyl_transacylase_ACP-bd,smart_PKS_Beta-ketoAc_synthase_dom,smart_PKS_acyl_transferase,smart_PKS_dehydratase,smart_PKS_ER,smart_PKS/FAS_KR,smart_PKS_PP-bd,pfscan_Acyl_carrier_prot-like	p.Y2425in_frame_del	ENST00000306749.2	37	c.7275_7273	CCDS11801.1	17																																																																																			FASN	-	pfam_Thioesterase	ENSG00000169710		0.650	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASN	HGNC	protein_coding	OTTHUMT00000442369.1	48	0.00	0	GTA	NM_004104		80037356	80037358	-1	no_errors	ENST00000306749	ensembl	human	known	69_37n	in_frame_del	58	11.94	8	DEL	1.000:1.000:0.992	-
FOXA1	3169	genome.wustl.edu	37	14	38061225	38061225	+	Missense_Mutation	SNP	T	T	A			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr14:38061225T>A	ENST00000250448.2	-	2	825	c.764A>T	c.(763-765)gAg>gTg	p.E255V	FOXA1_ENST00000545425.2_5'UTR|FOXA1_ENST00000540786.1_Missense_Mutation_p.E222V	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	255					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		GCAGCCGTTCTCGAACATGTT	0.687																																						dbGAP											0													23.0	23.0	23.0					14																	38061225		2203	4300	6503	-	-	-	SO:0001583	missense	0			U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.764A>T	14.37:g.38061225T>A	ENSP00000250448:p.Glu255Val		B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.E255V	ENST00000250448.2	37	c.764	CCDS9665.1	14	.	.	.	.	.	.	.	.	.	.	T	24.1	4.489108	0.84962	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	D;D	0.95690	-3.78;-3.78	3.92	3.92	0.45320	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	D	0.000000	D	0.97068	0.9042	M	0.74467	2.265	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.97332	0.9951	10	0.87932	D	0	.	11.8486	0.52399	0.0:0.0:0.0:1.0	.	255	P55317	FOXA1_HUMAN	V	255;222	ENSP00000250448:E255V;ENSP00000440178:E222V	ENSP00000250448:E255V	E	-	2	0	FOXA1	37130976	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.697000	0.84279	1.648000	0.50643	0.329000	0.21502	GAG	FOXA1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000129514		0.687	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	HGNC	protein_coding	OTTHUMT00000276735.1	43	0.00	0	T			38061225	38061225	-1	no_errors	ENST00000250448	ensembl	human	known	69_37n	missense	13	71.74	33	SNP	1.000	A
FSIP2	401024	genome.wustl.edu	37	2	186627943	186627943	+	Missense_Mutation	SNP	T	T	C	rs17228441	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr2:186627943T>C	ENST00000424728.1	+	12	1274	c.1274T>C	c.(1273-1275)aTt>aCt	p.I425T	FSIP2_ENST00000546113.1_3'UTR|FSIP2_ENST00000343098.5_Missense_Mutation_p.I514T			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	425										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GGTTCAATTATTTCAGCGCAG	0.353													T|||	2706	0.540335	0.5582	0.4928	5008	,	,		17696	0.4702		0.5089	False		,,,				2504	0.6544					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.1274T>C	2.37:g.186627943T>C	ENSP00000401306:p.Ile425Thr		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.I514T	ENST00000424728.1	37	c.1541		2	1107	0.5068681318681318	275	0.5589430894308943	185	0.511049723756906	268	0.46853146853146854	379	0.5	T	11.18	1.562444	0.27915	.	.	ENSG00000188738	ENST00000343098;ENST00000424728;ENST00000326147	T;T	0.57273	0.41;0.42	3.18	3.18	0.36537	.	1.289890	0.05751	N	0.603170	T	0.00012	0.0000	L	0.29908	0.895	0.80722	P	0.0	P	0.42518	0.782	B	0.37144	0.242	T	0.42464	-0.9450	9	0.59425	D	0.04	.	8.15	0.31134	0.0:0.0:0.0:1.0	rs17228441	425	Q5CZC0	FSIP2_HUMAN	T	514;425;425	ENSP00000344403:I514T;ENSP00000401306:I425T	ENSP00000321903:I425T	I	+	2	0	FSIP2	186336188	0.013000	0.17824	0.116000	0.21606	0.027000	0.11550	0.187000	0.16998	1.711000	0.51337	0.477000	0.44152	ATT	FSIP2	-	NULL	ENSG00000188738		0.353	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	29	0.00	0	T	NM_173651		186627943	186627943	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	missense	14	17.65	3	SNP	0.149	C
GAB2	9846	genome.wustl.edu	37	11	77937657	77937657	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr11:77937657C>G	ENST00000361507.4	-	4	1146	c.1061G>C	c.(1060-1062)cGc>cCc	p.R354P	GAB2_ENST00000526030.1_5'Flank|GAB2_ENST00000340149.2_Missense_Mutation_p.R316P	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	354					cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)		INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			CTTGGGGGGGCGGGGTGGGGG	0.582																																						dbGAP											0													46.0	52.0	50.0					11																	77937657		2200	4292	6492	-	-	-	SO:0001583	missense	0			AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.1061G>C	11.37:g.77937657C>G	ENSP00000354952:p.Arg354Pro		A2RRM2|A6NEW9|A7MD36|O60317	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R354P	ENST00000361507.4	37	c.1061	CCDS8259.1	11	.	.	.	.	.	.	.	.	.	.	C	19.04	3.749568	0.69533	.	.	ENSG00000033327	ENST00000340149;ENST00000361507	T;T	0.33865	1.39;1.39	5.21	5.21	0.72293	.	0.000000	0.85682	U	0.000000	T	0.63803	0.2542	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.61237	-0.7103	10	0.25106	T	0.35	-15.5922	19.1199	0.93358	0.0:1.0:0.0:0.0	.	354	Q9UQC2	GAB2_HUMAN	P	316;354	ENSP00000343959:R316P;ENSP00000354952:R354P	ENSP00000343959:R316P	R	-	2	0	GAB2	77615305	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.403000	0.79983	2.598000	0.87819	0.561000	0.74099	CGC	GAB2	-	NULL	ENSG00000033327		0.582	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAB2	HGNC	protein_coding	OTTHUMT00000391085.1	76	0.00	0	C	NM_080491		77937657	77937657	-1	no_errors	ENST00000361507	ensembl	human	known	69_37n	missense	29	42.31	22	SNP	1.000	G
GAB2	9846	genome.wustl.edu	37	11	77937662	77937662	+	Silent	SNP	T	T	G			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr11:77937662T>G	ENST00000361507.4	-	4	1141	c.1056A>C	c.(1054-1056)ccA>ccC	p.P352P	GAB2_ENST00000526030.1_5'Flank|GAB2_ENST00000340149.2_Silent_p.P314P	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	352					cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)		INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			GGGGGCGGGGTGGGGGAGCTA	0.582																																						dbGAP											0													44.0	51.0	49.0					11																	77937662		2200	4292	6492	-	-	-	SO:0001819	synonymous_variant	0			AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.1056A>C	11.37:g.77937662T>G			A2RRM2|A6NEW9|A7MD36|O60317	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P352	ENST00000361507.4	37	c.1056	CCDS8259.1	11																																																																																			GAB2	-	NULL	ENSG00000033327		0.582	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAB2	HGNC	protein_coding	OTTHUMT00000391085.1	76	0.00	0	T	NM_080491		77937662	77937662	-1	no_errors	ENST00000361507	ensembl	human	known	69_37n	silent	33	39.29	22	SNP	0.999	G
GAL3ST1	9514	genome.wustl.edu	37	22	30951295	30951295	+	Missense_Mutation	SNP	T	T	G			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr22:30951295T>G	ENST00000402321.1	-	3	1234	c.917A>C	c.(916-918)cAc>cCc	p.H306P	GAL3ST1_ENST00000338911.5_Missense_Mutation_p.H306P|GAL3ST1_ENST00000406955.1_Missense_Mutation_p.H306P|GAL3ST1_ENST00000401975.1_Missense_Mutation_p.H306P|GAL3ST1_ENST00000402369.1_Missense_Mutation_p.H306P|GAL3ST1_ENST00000443111.2_Missense_Mutation_p.H306P|GAL3ST1_ENST00000406361.1_Missense_Mutation_p.H306P			Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	306					galactosylceramide biosynthetic process (GO:0006682)|glycosphingolipid metabolic process (GO:0006687)|myelination (GO:0042552)|protein N-linked glycosylation (GO:0006487)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid metabolic process (GO:0006665)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21						GCGGTAGAGGTGGGAGTCCAG	0.701																																						dbGAP											0													18.0	23.0	21.0					22																	30951295		2198	4292	6490	-	-	-	SO:0001583	missense	0			D88667	CCDS13879.1	22q12.2	2007-04-02			ENSG00000128242	ENSG00000128242		"""Sulfotransferases, membrane-bound"""	24240	protein-coding gene	gene with protein product	"""cerebroside (3' phosphoadenylylsulfate:galactosylceramide 3') sulfotransferase"""	602300				9847074, 9030544	Standard	NM_004861		Approved	CST	uc003aii.1	Q99999	OTTHUMG00000151200	ENST00000402321.1:c.917A>C	22.37:g.30951295T>G	ENSP00000385735:p.His306Pro		Q96C63	Missense_Mutation	SNP	pfam_Gal-3-0_sulfotransfrase	p.H306P	ENST00000402321.1	37	c.917	CCDS13879.1	22	.	.	.	.	.	.	.	.	.	.	T	11.38	1.621434	0.28889	.	.	ENSG00000128242	ENST00000406955;ENST00000402321;ENST00000402369;ENST00000401975;ENST00000338911;ENST00000406361;ENST00000443111	T;T;T;T;T;T;T	0.14640	2.49;2.49;2.49;2.49;2.49;2.49;2.49	5.55	-2.15	0.07102	.	0.377651	0.30455	N	0.009593	T	0.06234	0.0161	N	0.17082	0.46	0.40178	D	0.977252	B	0.09022	0.002	B	0.04013	0.001	T	0.28933	-1.0028	10	0.31617	T	0.26	-12.3476	6.7124	0.23284	0.5427:0.2902:0.0:0.1671	.	306	Q99999	G3ST1_HUMAN	P	306	ENSP00000385825:H306P;ENSP00000385735:H306P;ENSP00000384122:H306P;ENSP00000384388:H306P;ENSP00000343234:H306P;ENSP00000385207:H306P;ENSP00000402587:H306P	ENSP00000343234:H306P	H	-	2	0	GAL3ST1	29281295	0.987000	0.35691	0.949000	0.38748	0.765000	0.43378	0.315000	0.19451	-0.005000	0.14395	-1.643000	0.00768	CAC	GAL3ST1	-	pfam_Gal-3-0_sulfotransfrase	ENSG00000128242		0.701	GAL3ST1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GAL3ST1	HGNC	protein_coding	OTTHUMT00000321745.1	78	0.00	0	T	NM_004861		30951295	30951295	-1	no_errors	ENST00000338911	ensembl	human	known	69_37n	missense	20	35.48	11	SNP	0.539	G
GNAS	2778	genome.wustl.edu	37	20	57431261	57431262	+	3'UTR	DEL	AC	AC	-			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr20:57431261_57431262delAC	ENST00000371099.2	+	0	2724_2725				GNAS_ENST00000371100.4_Intron|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000464624.2_Intron|GNAS_ENST00000371102.4_Intron|GNAS_ENST00000371098.2_Intron			P63092	GNAS2_HUMAN	GNAS complex locus						activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GAAAAACCAGACACACAGGTAT	0.53			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	dbGAP		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371099.2:c.*559AC>-	20.37:g.57431265_57431266delAC			A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	RNA	DEL	-	NULL	ENST00000371099.2	37	NULL		20																																																																																			GNAS	-	-	ENSG00000087460		0.530	GNAS-058	PUTATIVE	basic	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000267995.2	60	0.00	0	AC	NM_000516		57431261	57431262	+1	no_errors	ENST00000481768	ensembl	human	known	69_37n	rna	41	16.33	8	DEL	0.999:0.995	-
HHATL	57467	genome.wustl.edu	37	3	42739737	42739737	+	Missense_Mutation	SNP	T	T	G			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr3:42739737T>G	ENST00000441594.1	-	6	851	c.590A>C	c.(589-591)cAc>cCc	p.H197P	HHATL_ENST00000310417.5_Missense_Mutation_p.H197P	NM_020707.3	NP_065758.3	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like	197					negative regulation of N-terminal protein palmitoylation (GO:0060262)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(3)	19				KIRC - Kidney renal clear cell carcinoma(284;0.215)		GCGGTCAGGGTGGGCACAGCT	0.527																																						dbGAP											0													139.0	127.0	131.0					3																	42739737		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB042554	CCDS2704.1	3p22	2009-10-06	2007-02-06	2007-02-06	ENSG00000010282	ENSG00000010282			13242	protein-coding gene	gene with protein product	"""membrane bound O-acyltransferase domain containing 3"""	608116	"""chromosome 3 open reading frame 3"", ""GUP1, glycerol uptake/transporter homolog (yeast)"""	C3orf3, GUP1		11374908	Standard	NM_020707		Approved	KIAA1173, OACT3, MSTP002, MBOAT3	uc003clx.3	Q9HCP6	OTTHUMG00000133043	ENST00000441594.1:c.590A>C	3.37:g.42739737T>G	ENSP00000405423:p.His197Pro		Q8TBG3|Q9ULP7	Missense_Mutation	SNP	pfam_MBOAT_fam	p.H197P	ENST00000441594.1	37	c.590	CCDS2704.1	3	.	.	.	.	.	.	.	.	.	.	t	11.90	1.776124	0.31411	.	.	ENSG00000010282	ENST00000310417;ENST00000441594;ENST00000341477;ENST00000457462;ENST00000416756;ENST00000455195	D;D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09;-2.09	5.07	-1.3	0.09259	.	0.302120	0.39759	N	0.001272	T	0.71195	0.3311	N	0.11560	0.145	0.19300	N	0.999978	B	0.02656	0.0	B	0.04013	0.001	T	0.58200	-0.7678	10	0.30854	T	0.27	-13.9708	11.443	0.50107	0.0:0.5904:0.0:0.4096	.	197	Q9HCP6	HHATL_HUMAN	P	197;197;106;132;197;197	ENSP00000310621:H197P;ENSP00000405423:H197P;ENSP00000403787:H132P;ENSP00000395779:H197P;ENSP00000415351:H197P	ENSP00000310621:H197P	H	-	2	0	HHATL	42714741	0.985000	0.35326	0.985000	0.45067	0.963000	0.63663	0.214000	0.17541	-0.112000	0.11979	0.454000	0.30748	CAC	HHATL	-	pfam_MBOAT_fam	ENSG00000010282		0.527	HHATL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HHATL	HGNC	protein_coding	OTTHUMT00000343627.1	42	0.00	0	T	NM_020707		42739737	42739737	-1	no_errors	ENST00000310417	ensembl	human	known	69_37n	missense	17	43.33	13	SNP	0.214	G
HOOK1	51361	genome.wustl.edu	37	1	60334000	60334000	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr1:60334000G>T	ENST00000371208.3	+	20	2181	c.1924G>T	c.(1924-1926)Gag>Tag	p.E642*	HOOK1_ENST00000395561.2_Nonsense_Mutation_p.E600*|HOOK1_ENST00000465876.1_3'UTR	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	642					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					GGCAGAGAAAGAGAGAAGAAT	0.303																																						dbGAP											0													56.0	65.0	62.0					1																	60334000		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1924G>T	1.37:g.60334000G>T	ENSP00000360252:p.Glu642*		A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Nonsense_Mutation	SNP	pfam_HOOK,superfamily_Prefoldin	p.E642*	ENST00000371208.3	37	c.1924	CCDS612.1	1	.	.	.	.	.	.	.	.	.	.	G	42	9.443635	0.99172	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	.	.	.	5.99	5.99	0.97316	.	0.241908	0.47093	D	0.000248	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	.	.	.	X	642;600	.	ENSP00000360252:E642X	E	+	1	0	HOOK1	60106588	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	8.837000	0.92110	2.840000	0.97914	0.655000	0.94253	GAG	HOOK1	-	pfam_HOOK	ENSG00000134709		0.303	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK1	HGNC	protein_coding	OTTHUMT00000024934.1	56	0.00	0	G	NM_015888		60334000	60334000	+1	no_errors	ENST00000371208	ensembl	human	known	69_37n	nonsense	27	10.00	3	SNP	1.000	T
IL32	9235	genome.wustl.edu	37	16	3131810	3131810	+	lincRNA	SNP	T	T	C	rs148052546	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr16:3131810T>C	ENST00000571404.1	-	0	210																		p.V172V(1)									GGCACGGGGTTCTGGCCTGGG	0.592													T|||	2501	0.499401	0.2564	0.5058	5008	,	,		14657	0.5417		0.6183	False		,,,				2504	0.6575					dbGAP											1	Substitution - coding silent(1)	central_nervous_system(1)																																								-	-	-			0																															16.37:g.3131810T>C				Silent	SNP	NULL	p.V172	ENST00000571404.1	37	c.516		16																																																																																			IL32	-	NULL	ENSG00000008517		0.592	RP11-473M20.9-002	KNOWN	basic	lincRNA	IL32	HGNC	lincRNA	OTTHUMT00000437122.1	29	0.00	0	T			3131810	3131810	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000525377	ensembl	human	putative	69_37n	silent	29	19.44	7	SNP	0.000	C
KDM1B	221656	genome.wustl.edu	37	6	18188091	18188091	+	Silent	SNP	T	T	C	rs429158	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr6:18188091T>C	ENST00000388870.2	+	9	883	c.642T>C	c.(640-642)agT>agC	p.S214S	KDM1B_ENST00000397244.1_Intron|KDM1B_ENST00000546309.2_Intron|KDM1B_ENST00000297792.5_Intron			Q8NB78	KDM1B_HUMAN	lysine (K)-specific demethylase 1B	214					DNA methylation involved in gamete generation (GO:0043046)|histone H3-K4 demethylation (GO:0034720)|multicellular organismal development (GO:0007275)|regulation of DNA methylation (GO:0044030)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-monomethyl-K4 specific) (GO:0034649)|oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|large_intestine(6)|lung(8)|skin(3)|upper_aerodigestive_tract(1)	25						TGAAAGACAGTGTGGCAGCGC	0.562													t|||	1931	0.385583	0.646	0.2911	5008	,	,		16026	0.2173		0.2167	False		,,,				2504	0.4479					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK125318	CCDS34343.1	6p22.3	2011-07-01	2009-09-29	2009-09-29	ENSG00000165097	ENSG00000165097		"""Chromatin-modifying enzymes / K-demethylases"""	21577	protein-coding gene	gene with protein product		613081	"""amine oxidase, flavin containing 1"", ""chromosome 6 open reading frame 193"", ""amine oxidase (flavin containing) domain 1"""	C6orf193, AOF1		19407342, 19727073	Standard	NM_153042		Approved	FLJ34109, FLJ33898, dJ298J15.2, bA204B7.3, FLJ43328, LSD2	uc003ncn.1	Q8NB78	OTTHUMG00000014316	ENST00000388870.2:c.642T>C	6.37:g.18188091T>C			A2A2C5|A2A2C6|Q5TGV3|Q6AI15|Q6ZUU4|Q8N258|Q96EL7	Missense_Mutation	SNP	pfam_Amino_oxidase,pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_SWIRM,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_mOase_FAD-bd,pfam_CHP00275_HI0933-like,pfam_FAD_bind_dom,superfamily_Homeodomain-like,pfscan_SWIRM	p.V31A	ENST00000388870.2	37	c.92		6	710	0.3250915750915751	323	0.6565040650406504	114	0.3149171270718232	115	0.20104895104895104	158	0.20844327176781002	t	10.99	1.506411	0.26949	.	.	ENSG00000165097	ENST00000449850	.	.	.	5.97	-0.67	0.11384	.	.	.	.	.	T	0.33818	0.0876	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.22591	-1.0212	3	.	.	.	-9.0764	12.0561	0.53536	0.0:0.42:0.0:0.58	rs429158;rs61558942	.	.	.	A	31	.	.	V	+	2	0	KDM1B	18296070	0.255000	0.24002	0.979000	0.43373	0.987000	0.75469	-0.385000	0.07379	-0.470000	0.06901	-0.783000	0.03347	GTG	KDM1B	-	NULL	ENSG00000165097		0.562	KDM1B-201	KNOWN	basic|appris_principal	protein_coding	KDM1B	HGNC	protein_coding		46	0.00	0	T	NM_153042		18188091	18188091	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000449850	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.978	C
IMPG1	3617	genome.wustl.edu	37	6	76731925	76731925	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr6:76731925C>T	ENST00000369950.3	-	6	763	c.574G>A	c.(574-576)Gtc>Atc	p.V192I	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				CCAAGTGAGACGTTGGCAACA	0.378																																					Pancreas(37;839 1141 2599 26037)	dbGAP											0													135.0	121.0	125.0					6																	76731925		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.574G>A	6.37:g.76731925C>T	ENSP00000358966:p.Val192Ile			Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.V192I	ENST00000369950.3	37	c.574	CCDS4985.1	6	.	.	.	.	.	.	.	.	.	.	C	1.321	-0.599445	0.03744	.	.	ENSG00000112706	ENST00000369950	T	0.20881	2.04	5.01	1.23	0.21249	.	1.399850	0.04735	N	0.421791	T	0.02380	0.0073	N	0.03608	-0.345	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.39396	-0.9616	10	0.20046	T	0.44	.	5.4366	0.16484	0.1823:0.5747:0.0:0.243	.	192	Q17R60	IMPG1_HUMAN	I	192	ENSP00000358966:V192I	ENSP00000358966:V192I	V	-	1	0	IMPG1	76788645	0.002000	0.14202	0.072000	0.20136	0.015000	0.08874	0.043000	0.13971	0.304000	0.22809	0.650000	0.86243	GTC	IMPG1	-	NULL	ENSG00000112706		0.378	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG1	HGNC	protein_coding	OTTHUMT00000041288.1	56	0.00	0	C	NM_001563		76731925	76731925	-1	no_errors	ENST00000369950	ensembl	human	known	69_37n	missense	45	21.05	12	SNP	0.007	T
LILRB1	10859	genome.wustl.edu	37	19	55147987	55147988	+	Missense_Mutation	DNP	GA	GA	CC	rs202204734|rs41308744	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G|A	G|A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr19:55147987_55147988GA>CC	ENST00000396331.1	+	15	2047_2048	c.1690_1691GA>CC	c.(1690-1692)GAg>CCg	p.E564P	LILRB1_ENST00000396327.3_Missense_Mutation_p.E565P|LILRB1_ENST00000396315.1_Missense_Mutation_p.E566P|LILRB1_ENST00000418536.2_Missense_Mutation_p.E548P|LILRB1_ENST00000396321.2_Missense_Mutation_p.E564P|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000434867.2_Missense_Mutation_p.E564P|LILRB1_ENST00000396317.1_Missense_Mutation_p.E548P|LILRB1_ENST00000324602.7_Missense_Mutation_p.E566P|AC009892.10_ENST00000456337.1_Intron|LILRB1_ENST00000427581.2_Missense_Mutation_p.E615P|LILRB1_ENST00000448689.1_3'UTR|LILRB1_ENST00000396332.4_Missense_Mutation_p.E565P	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	564					cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)	p.E564>?(2)|p.E564Q(2)|p.E564K(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		GACGTATGCCGAGGTGAAACAC	0.579										HNSCC(37;0.09)																												dbGAP											5	Substitution - Missense(3)|Complex(2)	NS(2)|prostate(2)|skin(1)																																								-	-	-	SO:0001583	missense	0			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		Exception_encountered	19.37:g.55147987_55147988delinsCC	ENSP00000379622:p.Glu564Pro		A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E566Q|p.E566A	ENST00000396331.1	37	c.1696|c.1697	CCDS42617.1	19																																																																																			LILRB1	-	NULL	ENSG00000104972		0.579	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB1	HGNC	protein_coding	OTTHUMT00000140796.4	71|74	0.00	0	G|A			55147987|55147988	55147987|55147988	+1	no_errors	ENST00000324602	ensembl	human	known	69_37n	missense	151|153	17.03|16.85	31	SNP	0.004|0.001	C
KIR3DL1	3811	genome.wustl.edu	37	19	55324635	55324635	+	Intron	SNP	T	T	C	rs649216	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr19:55324635T>C	ENST00000538269.1	+	2	61				KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000357494.4_Intron|KIR2DL4_ENST00000463062.1_3'UTR|KIR2DL4_ENST00000396293.1_Intron|KIR2DL4_ENST00000359085.4_Silent_p.F254F|KIR3DL1_ENST00000541392.1_Intron|KIR2DL4_ENST00000346587.4_Intron|KIR2DL4_ENST00000396284.2_Silent_p.F252F|KIR2DL4_ENST00000345540.5_Intron			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.F254F(2)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		TCATCCTCTTTACCATCCTTC	0.502													c|||	2958	0.590655	0.6528	0.5605	5008	,	,		6076	0.8056		0.4871	False		,,,				2504	0.4131					dbGAP											2	Substitution - coding silent(2)	prostate(2)											121.0	187.0	166.0					19																	55324635		1991	4152	6143	-	-	-	SO:0001627	intron_variant	0			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-4354T>C	19.37:g.55324635T>C			O43473|Q14946|Q16541	Silent	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.F252	ENST00000538269.1	37	c.756		19																																																																																			KIR2DL4	-	NULL	ENSG00000189013		0.502	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	KIR2DL4	HGNC	protein_coding		103	0.96	1	T	NM_013289		55324635	55324635	+1	no_errors	ENST00000396284	ensembl	human	known	69_37n	silent	13	27.78	5	SNP	0.000	C
LRBA	987	genome.wustl.edu	37	4	151186181	151186181	+	3'UTR	SNP	C	C	T			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr4:151186181C>T	ENST00000357115.3	-	0	9528				LRBA_ENST00000503716.1_5'UTR|LRBA_ENST00000535741.1_3'UTR|LRBA_ENST00000510413.1_3'UTR	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing							cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AAGAGCATTTCCATCATTTCG	0.388																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.*693G>A	4.37:g.151186181C>T			Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	RNA	SNP	-	NULL	ENST00000357115.3	37	NULL	CCDS3773.1	4																																																																																			LRBA	-	-	ENSG00000198589		0.388	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	HGNC	protein_coding	OTTHUMT00000364939.1	29	0.00	0	C			151186181	151186181	-1	no_errors	ENST00000503716	ensembl	human	known	69_37n	rna	20	31.03	9	SNP	0.002	T
LRRC73	221424	genome.wustl.edu	37	6	43474845	43474845	+	3'UTR	SNP	G	G	A	rs7774051	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr6:43474845G>A	ENST00000372441.1	-	0	1982					NM_001012974.1	NP_001012992.1	Q5JTD7	LRC73_HUMAN	leucine rich repeat containing 73																		CACACTGCCAGGAGCTGCCAG	0.607											OREG0017453	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	181	0.0361422	0.1316	0.0086	5008	,	,		16996	0.0		0.001	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS34456.1	6p21.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000204052	ENSG00000204052			21375	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 154"""	C6orf154			Standard	NM_001012974		Approved	dJ337H4.2	uc003ovk.2	Q5JTD7	OTTHUMG00000014737	ENST00000372441.1:c.*131C>T	6.37:g.43474845G>A		916		RNA	SNP	-	NULL	ENST00000372441.1	37	NULL	CCDS34456.1	6																																																																																			LRRC73	-	-	ENSG00000204052		0.607	LRRC73-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRRC73	HGNC	protein_coding	OTTHUMT00000040635.1	23	0.00	0	G	NM_001012974		43474845	43474845	-1	no_errors	ENST00000468319	ensembl	human	known	69_37n	rna	18	18.18	4	SNP	0.958	A
LRRD1	401387	genome.wustl.edu	37	7	91779971	91779971	+	Missense_Mutation	SNP	T	T	G	rs6465353	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr7:91779971T>G	ENST00000458448.1	-	4	2355	c.2155A>C	c.(2155-2157)Att>Ctt	p.I719L	LRRD1_ENST00000422722.1_5'UTR|LRRD1_ENST00000343318.5_Missense_Mutation_p.I70L|LRRD1_ENST00000454089.2_Missense_Mutation_p.I70L|LRRD1_ENST00000430130.2_Missense_Mutation_p.I719L|CTB-161K23.1_ENST00000453068.1_RNA			A4D1F6	LRRD1_HUMAN	leucine-rich repeats and death domain containing 1	719					signal transduction (GO:0007165)					breast(4)|endometrium(1)	5						AGTGAAAAAATATTGTAGATA	0.323													G|||	2086	0.416534	0.6717	0.3732	5008	,	,		15605	0.1885		0.3926	False		,,,				2504	0.362					dbGAP											0													97.0	79.0	84.0					7																	91779971		692	1591	2283	-	-	-	SO:0001583	missense	0			BC026112	CCDS55124.1	7q21.2	2011-05-23			ENSG00000240720	ENSG00000240720			34300	protein-coding gene	gene with protein product							Standard	NM_001161528		Approved	IMAGE:4798971	uc011khp.1	A4D1F6	OTTHUMG00000155861	ENST00000458448.1:c.2155A>C	7.37:g.91779971T>G	ENSP00000405987:p.Ile719Leu		B7ZMM9|Q49AT9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_DEATH-like,smart_Leu-rich_rpt_typical-subtyp,pfscan_Death	p.I719L	ENST00000458448.1	37	c.2155	CCDS55124.1	7	899	0.4116300366300366	342	0.6951219512195121	144	0.39779005524861877	114	0.1993006993006993	299	0.3944591029023747	G	5.515	0.279899	0.10458	.	.	ENSG00000240720	ENST00000343318;ENST00000458448;ENST00000430130;ENST00000454089	T;T;T;T	0.17054	2.62;2.3;2.3;2.62	5.61	5.61	0.85477	.	.	.	.	.	T	0.00012	0.0000	N	0.00068	-2.285	0.54753	P	1.799999999996249E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.42327	-0.9458	8	0.02654	T	1	.	15.7556	0.78021	0.0:0.0:0.8621:0.1379	rs6465353;rs59146464;rs6465353	719	A4D1F6	LRRD1_HUMAN	L	70;719;719;70	ENSP00000339642:I70L;ENSP00000405987:I719L;ENSP00000411568:I719L;ENSP00000392112:I70L	ENSP00000339642:I70L	I	-	1	0	LRRD1	91617907	1.000000	0.71417	0.510000	0.27712	0.523000	0.34469	4.909000	0.63314	1.386000	0.46466	-0.121000	0.15023	ATT	LRRD1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000240720		0.323	LRRD1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRD1	HGNC	protein_coding	OTTHUMT00000342027.2	43	0.00	0	T	NM_001045475		91779971	91779971	-1	no_errors	ENST00000430130	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	0.683	G
LYN	4067	genome.wustl.edu	37	8	56910950	56910950	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr8:56910950C>T	ENST00000519728.1	+	11	1392	c.1096C>T	c.(1096-1098)Cgg>Tgg	p.R366W	LYN_ENST00000420292.1_3'UTR|LYN_ENST00000520220.2_Missense_Mutation_p.R345W	NM_002350.3	NP_002341.1	P07948	LYN_HUMAN	LYN proto-oncogene, Src family tyrosine kinase	366	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to heat (GO:0034605)|cellular response to retinoic acid (GO:0071300)|cytokine secretion (GO:0050663)|dendritic cell differentiation (GO:0097028)|erythrocyte differentiation (GO:0030218)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|histamine secretion by mast cell (GO:0002553)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of immune response (GO:0050777)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell proliferation (GO:0070667)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|neuron projection development (GO:0031175)|oligodendrocyte development (GO:0014003)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oligodendrocyte progenitor proliferation (GO:0070447)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of stress-activated protein kinase signaling cascade (GO:0070304)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cytokine production (GO:0001817)|regulation of cytokine secretion (GO:0050707)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of erythrocyte differentiation (GO:0045646)|regulation of inflammatory response (GO:0050727)|regulation of mast cell activation (GO:0033003)|regulation of mast cell degranulation (GO:0043304)|regulation of monocyte chemotaxis (GO:0090025)|regulation of platelet aggregation (GO:0090330)|regulation of protein phosphorylation (GO:0001932)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to hormone (GO:0009725)|response to insulin (GO:0032868)|response to organic cyclic compound (GO:0014070)|response to sterol depletion (GO:0006991)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|T cell costimulation (GO:0031295)|tolerance induction to self antigen (GO:0002513)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integrin alpha2-beta1 complex (GO:0034666)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycosphingolipid binding (GO:0043208)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)		Bosutinib(DB06616)|Ponatinib(DB08901)	CTACATTCACCGGGACCTGCG	0.453																																						dbGAP											0													113.0	108.0	110.0					8																	56910950		2203	4300	6503	-	-	-	SO:0001583	missense	0			M16038	CCDS6162.1, CCDS47859.1	8q13	2014-06-25	2014-06-25		ENSG00000254087	ENSG00000254087		"""SH2 domain containing"""	6735	protein-coding gene	gene with protein product		165120	"""v-yes-1 Yamaguchi sarcoma viral related oncogene homolog"""			3561390	Standard	NM_002350		Approved	JTK8	uc003xsk.4	P07948	OTTHUMG00000044345	ENST00000519728.1:c.1096C>T	8.37:g.56910950C>T	ENSP00000428924:p.Arg366Trp		A0AVQ5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.R366W	ENST00000519728.1	37	c.1096	CCDS6162.1	8	.	.	.	.	.	.	.	.	.	.	C	19.33	3.806030	0.70682	.	.	ENSG00000254087	ENST00000519728;ENST00000520220	D;D	0.88818	-2.43;-2.43	5.52	1.44	0.22558	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97145	0.9067	H	0.99811	4.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97386	0.9986	10	0.87932	D	0	.	15.5332	0.75980	0.5248:0.4752:0.0:0.0	.	436;366	Q6NUK7;P07948	.;LYN_HUMAN	W	366;345	ENSP00000428924:R366W;ENSP00000428424:R345W	ENSP00000428924:R366W	R	+	1	2	LYN	57073504	0.994000	0.37717	0.711000	0.30485	0.946000	0.59487	0.579000	0.23788	-0.035000	0.13691	-0.274000	0.10170	CGG	LYN	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000254087		0.453	LYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LYN	HGNC	protein_coding	OTTHUMT00000378155.1	26	0.00	0	C	NM_002350		56910950	56910950	+1	no_errors	ENST00000519728	ensembl	human	known	69_37n	missense	45	27.42	17	SNP	0.998	T
MIIP	60672	genome.wustl.edu	37	1	12081870	12081870	+	Silent	SNP	G	G	T			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr1:12081870G>T	ENST00000235332.4	+	2	256	c.87G>T	c.(85-87)cgG>cgT	p.R29R	MIIP_ENST00000436478.2_Silent_p.R29R|Y_RNA_ENST00000365591.1_RNA	NM_021933.3	NP_068752.2	Q5JXC2	MIIP_HUMAN	migration and invasion inhibitory protein	29										autonomic_ganglia(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(1)	15						ATGCTGTGCGGCGGTCAGTGG	0.667																																						dbGAP											0													29.0	29.0	29.0					1																	12081870		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK022500	CCDS143.1	1p36.22	2009-07-09			ENSG00000116691	ENSG00000116691			25715	protein-coding gene	gene with protein product	"""invasion inhibitory protein 45"""	608772				15867349, 14617774	Standard	NM_021933		Approved	FLJ12438, IIp45	uc001ato.2	Q5JXC2	OTTHUMG00000002439	ENST00000235332.4:c.87G>T	1.37:g.12081870G>T			C0KL22|Q96HU6|Q9H839|Q9HA00	Silent	SNP	NULL	p.R29	ENST00000235332.4	37	c.87	CCDS143.1	1																																																																																			MIIP	-	NULL	ENSG00000116691		0.667	MIIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIIP	HGNC	protein_coding	OTTHUMT00000006941.1	32	0.00	0	G	NM_021933		12081870	12081870	+1	no_errors	ENST00000235332	ensembl	human	known	69_37n	silent	20	16.67	4	SNP	0.428	T
MON1B	22879	genome.wustl.edu	37	16	77228812	77228812	+	Silent	SNP	G	G	T			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr16:77228812G>T	ENST00000248248.3	+	4	1406	c.1056G>T	c.(1054-1056)ctG>ctT	p.L352L	MON1B_ENST00000320859.6_Intron|MON1B_ENST00000439557.2_Silent_p.L243L|MON1B_ENST00000545553.1_Silent_p.L206L	NM_014940.2	NP_055755.1	Q7L1V2	MON1B_HUMAN	MON1 secretory trafficking family member B	352										breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	17						GCCTGCTGCTGCTTGGCACCC	0.632																																						dbGAP											0													90.0	91.0	91.0					16																	77228812		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			BC024277	CCDS10925.1, CCDS67082.1, CCDS67083.1	16q23.1	2013-08-21	2013-08-21		ENSG00000103111	ENSG00000103111			25020	protein-coding gene	gene with protein product		608954	"""MON1 homolog B (yeast)"""			10048485	Standard	NM_014940		Approved	SAND2, HSRG1, KIAA0872	uc002fez.3	Q7L1V2	OTTHUMG00000137618	ENST00000248248.3:c.1056G>T	16.37:g.77228812G>T			B4DDZ0|O94949	Silent	SNP	pfam_Vacuolar_fusion_protein_MON1,prints_Vacuolar_fusion_protein_MON1	p.L352	ENST00000248248.3	37	c.1056	CCDS10925.1	16																																																																																			MON1B	-	pfam_Vacuolar_fusion_protein_MON1,prints_Vacuolar_fusion_protein_MON1	ENSG00000103111		0.632	MON1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON1B	HGNC	protein_coding	OTTHUMT00000269036.2	188	0.00	0	G	NM_014940		77228812	77228812	+1	no_errors	ENST00000248248	ensembl	human	known	69_37n	silent	55	32.93	27	SNP	1.000	T
MUC2	4583	genome.wustl.edu	37	11	1083135	1083135	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr11:1083135C>T	ENST00000441003.2	+	16	2062	c.2035C>T	c.(2035-2037)Cgc>Tgc	p.R679C	MUC2_ENST00000359061.5_Missense_Mutation_p.R679C	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	679					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GCAGACCTGCCGCTCCCTCTC	0.662																																						dbGAP											0													18.0	23.0	21.0					11																	1083135		2023	4168	6191	-	-	-	SO:0001583	missense	0			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.2035C>T	11.37:g.1083135C>T	ENSP00000415183:p.Arg679Cys		Q14878	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.R679C	ENST00000441003.2	37	c.2035		11	.	.	.	.	.	.	.	.	.	.	c	12.08	1.830133	0.32329	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;D	0.90900	-1.31;-2.75	4.47	3.56	0.40772	.	0.083314	0.43260	D	0.000592	D	0.95633	0.8580	M	0.89534	3.04	0.33265	D	0.560217	D	0.89917	1.0	D	0.87578	0.998	D	0.97612	1.0130	10	0.87932	D	0	.	12.4947	0.55921	0.0:0.9181:0.0:0.0819	.	679	E7EUV1	.	C	679	ENSP00000415183:R679C;ENSP00000351956:R679C	ENSP00000351956:R679C	R	+	1	0	MUC2	1073135	1.000000	0.71417	0.995000	0.50966	0.377000	0.30045	4.689000	0.61723	1.113000	0.41760	0.550000	0.68814	CGC	MUC2	-	superfamily_TIL_dom	ENSG00000198788		0.662	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	65	0.00	0	C	NM_002457		1083135	1083135	+1	no_errors	ENST00000441003	ensembl	human	known	69_37n	missense	59	14.49	10	SNP	1.000	T
MUC4	4585	genome.wustl.edu	37	3	195506189	195506189	+	Missense_Mutation	SNP	A	A	G	rs2432533	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr3:195506189A>G	ENST00000463781.3	-	2	12721	c.12262T>C	c.(12262-12264)Tca>Cca	p.S4088P	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S4088P|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGGATGCTGAGGAAGCATCG	0.577													.|||	235	0.0469249	0.093	0.0173	5008	,	,		11999	0.0079		0.0378	False		,,,				2504	0.0552					dbGAP											0													38.0	19.0	25.0					3																	195506189		559	1322	1881	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12262T>C	3.37:g.195506189A>G	ENSP00000417498:p.Ser4088Pro		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.S4088P	ENST00000463781.3	37	c.12262	CCDS54700.1	3	71	0.03250915750915751	44	0.08943089430894309	12	0.03314917127071823	1	0.0017482517482517483	14	0.018469656992084433	a	3.610	-0.079683	0.07141	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.42513	1.11;0.97	.	.	.	.	.	.	.	.	T	0.00666	0.0022	N	0.19112	0.55	0.80722	P	0.0	P	0.42993	0.797	B	0.34452	0.183	T	0.06552	-1.0820	6	.	.	.	.	2.7352	0.05238	0.6089:0.0:0.3911:0.0	.	3960	E7ESK3	.	P	4088	ENSP00000417498:S4088P;ENSP00000420243:S4088P	.	S	-	1	0	MUC4	196990968	0.000000	0.05858	0.009000	0.14445	0.030000	0.12068	-1.369000	0.02578	0.408000	0.25621	0.055000	0.15244	TCA	MUC4	-	NULL	ENSG00000145113		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	11	0.00	0	A	NM_018406		195506189	195506189	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	0.060	G
NLRP7	199713	genome.wustl.edu	37	19	55452900	55452900	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr19:55452900G>C	ENST00000590030.1	-	1	220	c.180C>G	c.(178-180)aaC>aaG	p.N60K	NLRP7_ENST00000340844.2_Missense_Mutation_p.N60K|NLRP7_ENST00000592784.1_Missense_Mutation_p.N60K|NLRP7_ENST00000448121.2_Missense_Mutation_p.N60K|NLRP7_ENST00000588756.1_Missense_Mutation_p.N60K|NLRP7_ENST00000328092.5_Missense_Mutation_p.N60K|NLRP7_ENST00000446217.1_Missense_Mutation_p.N88K			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	60	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.						ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		CTGAGGAGGTGTTGACCAGAA	0.473																																						dbGAP											0													131.0	125.0	127.0					19																	55452900		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.180C>G	19.37:g.55452900G>C	ENSP00000465520:p.Asn60Lys		E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.N88K	ENST00000590030.1	37	c.264	CCDS33109.1	19	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.387937	0.00202	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	1.51	0.363	0.16118	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.14614	0.0353	N	0.04508	-0.205	0.09310	N	1	B;B;B;B	0.18166	0.026;0.009;0.004;0.001	B;B;B;B	0.15870	0.014;0.014;0.008;0.003	T	0.30995	-0.9959	9	0.02654	T	1	.	4.788	0.13234	0.0:0.0:0.6359:0.3641	.	88;60;60;60	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	K	60;60;60;88;60	ENSP00000329568:N60K;ENSP00000409137:N60K;ENSP00000339491:N60K;ENSP00000414273:N88K	ENSP00000329568:N60K	N	-	3	2	NLRP7	60144712	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.110000	0.10824	0.163000	0.19507	0.462000	0.41574	AAC	NLRP7	-	pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN	ENSG00000167634		0.473	NLRP7-003	KNOWN	basic|CCDS	protein_coding	NLRP7	HGNC	protein_coding	OTTHUMT00000451396.1	76	0.00	0	G	NM_139176		55452900	55452900	-1	no_errors	ENST00000446217	ensembl	human	known	69_37n	missense	44	26.67	16	SNP	0.001	C
OLFM4	10562	genome.wustl.edu	37	13	53624487	53624487	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr13:53624487C>A	ENST00000219022.2	+	5	1192	c.1114C>A	c.(1114-1116)Cgc>Agc	p.R372S		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	372	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		CTATAATAACCGCTTTTCATA	0.423																																						dbGAP											0													220.0	217.0	218.0					13																	53624487		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.1114C>A	13.37:g.53624487C>A	ENSP00000219022:p.Arg372Ser		O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	pfam_Olfac-like,superfamily_Quinoprot_gluc/sorb_DH,smart_Olfac-like,pfscan_Olfac-like	p.R372S	ENST00000219022.2	37	c.1114	CCDS9440.1	13	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843890	0.71488	.	.	ENSG00000102837	ENST00000219022	D	0.88818	-2.43	5.92	5.92	0.95590	Olfactomedin-like (3);	0.199304	0.53938	D	0.000049	D	0.94847	0.8335	M	0.80982	2.52	0.45205	D	0.998212	D	0.69078	0.997	D	0.72338	0.977	D	0.94030	0.7300	10	0.51188	T	0.08	.	20.3172	0.98658	0.0:1.0:0.0:0.0	.	372	Q6UX06	OLFM4_HUMAN	S	372	ENSP00000219022:R372S	ENSP00000219022:R372S	R	+	1	0	OLFM4	52522488	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	2.762000	0.47597	2.801000	0.96364	0.650000	0.86243	CGC	OLFM4	-	pfam_Olfac-like,superfamily_Quinoprot_gluc/sorb_DH,smart_Olfac-like,pfscan_Olfac-like	ENSG00000102837		0.423	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM4	HGNC	protein_coding	OTTHUMT00000045112.2	59	0.00	0	C	NM_006418		53624487	53624487	+1	no_errors	ENST00000219022	ensembl	human	known	69_37n	missense	39	40.00	26	SNP	1.000	A
PSMD5	5711	genome.wustl.edu	37	9	123580275	123580275	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr9:123580275T>C	ENST00000210313.3	-	10	1498	c.1424A>G	c.(1423-1425)aAc>aGc	p.N475S	PSMD5_ENST00000604848.1_Intron|PSMD5_ENST00000373904.5_Missense_Mutation_p.N432S	NM_001270427.1|NM_005047.3	NP_001257356.1|NP_005038.1	Q16401	PSMD5_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 5	475					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome regulatory particle assembly (GO:0070682)|protein folding (GO:0006457)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)				endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|prostate(1)	10						ATAATTTGGGTTCCCAAAGAT	0.438																																						dbGAP											0													136.0	124.0	128.0					9																	123580275		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001065	CCDS6824.1, CCDS59143.1	9q34.11	2008-02-05			ENSG00000095261	ENSG00000095261		"""Proteasome (prosome, macropain) subunits"""	9563	protein-coding gene	gene with protein product		604452				7559544	Standard	NM_005047		Approved	S5B, KIAA0072	uc004bko.4	Q16401	OTTHUMG00000020573	ENST00000210313.3:c.1424A>G	9.37:g.123580275T>C	ENSP00000210313:p.Asn475Ser		B4DZM8|Q15045|Q4VXG8	Missense_Mutation	SNP	pfam_26S_Psome_nonATP_su5,superfamily_ARM-type_fold	p.N475S	ENST00000210313.3	37	c.1424	CCDS6824.1	9	.	.	.	.	.	.	.	.	.	.	T	12.28	1.891904	0.33442	.	.	ENSG00000095261	ENST00000210313;ENST00000373904	T;T	0.28666	1.6;1.6	5.96	5.96	0.96718	Armadillo-like helical (1);	0.126574	0.64402	D	0.000001	T	0.22399	0.0540	L	0.36672	1.1	0.39404	D	0.96663	B;B	0.31879	0.344;0.344	B;B	0.24541	0.054;0.054	T	0.07868	-1.0750	10	0.09590	T	0.72	.	15.6296	0.76893	0.0:0.0:0.0:1.0	.	432;475	B4DZM8;Q16401	.;PSMD5_HUMAN	S	475;432	ENSP00000210313:N475S;ENSP00000363011:N432S	ENSP00000210313:N475S	N	-	2	0	PSMD5	122620096	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.536000	0.60636	2.285000	0.76669	0.533000	0.62120	AAC	PSMD5	-	pfam_26S_Psome_nonATP_su5	ENSG00000095261		0.438	PSMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD5	HGNC	protein_coding	OTTHUMT00000053825.2	28	0.00	0	T	NM_005047		123580275	123580275	-1	no_errors	ENST00000210313	ensembl	human	known	69_37n	missense	23	23.33	7	SNP	1.000	C
PTPRB	5787	genome.wustl.edu	37	12	70949883	70949883	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr12:70949883G>A	ENST00000261266.5	-	17	4135	c.4106C>T	c.(4105-4107)aCg>aTg	p.T1369M	PTPRB_ENST00000538708.1_Missense_Mutation_p.T1279M|PTPRB_ENST00000334414.6_Missense_Mutation_p.T1587M|PTPRB_ENST00000550358.1_Missense_Mutation_p.T1499M|PTPRB_ENST00000451516.2_Missense_Mutation_p.T1279M|PTPRB_ENST00000550857.1_Missense_Mutation_p.T1279M	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1369	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GGCAATGGCCGTGGAGTTCTG	0.438																																						dbGAP											0													46.0	43.0	44.0					12																	70949883		1843	4089	5932	-	-	-	SO:0001583	missense	0			X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.4106C>T	12.37:g.70949883G>A	ENSP00000261266:p.Thr1369Met		B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.T1587M	ENST00000261266.5	37	c.4760	CCDS44944.1	12	.	.	.	.	.	.	.	.	.	.	G	22.9	4.346279	0.82022	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000538708;ENST00000550857;ENST00000261266	T;T;T;T;T;T	0.62105	0.05;0.05;0.05;0.05;0.05;0.05	5.59	5.59	0.84812	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.047126	0.85682	D	0.000000	T	0.70456	0.3226	N	0.24115	0.695	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.993;0.993;0.996;0.998;0.996	T	0.74109	-0.3771	10	0.72032	D	0.01	.	19.5832	0.95478	0.0:0.0:1.0:0.0	.	1279;1279;1587;1369;1499	P23467-2;F5H3G6;P23467-3;P23467;F8VU56	.;.;.;PTPRB_HUMAN;.	M	1587;1279;1499;1279;1279;1369	ENSP00000334928:T1587M;ENSP00000393028:T1279M;ENSP00000448058:T1499M;ENSP00000438927:T1279M;ENSP00000447302:T1279M;ENSP00000261266:T1369M	ENSP00000261266:T1369M	T	-	2	0	PTPRB	69236150	1.000000	0.71417	0.116000	0.21606	0.939000	0.58152	9.062000	0.93920	2.621000	0.88768	0.655000	0.94253	ACG	PTPRB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000127329		0.438	PTPRB-007	KNOWN	basic|CCDS	protein_coding	PTPRB	HGNC	protein_coding	OTTHUMT00000404439.1	42	0.00	0	G			70949883	70949883	-1	no_errors	ENST00000334414	ensembl	human	known	69_37n	missense	55	11.29	7	SNP	0.978	A
PTPRC	5788	genome.wustl.edu	37	1	198671524	198671524	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr1:198671524G>A	ENST00000367376.2	+	6	613	c.442G>A	c.(442-444)Gga>Aga	p.G148R	PTPRC_ENST00000442510.2_Missense_Mutation_p.G150R|PTPRC_ENST00000352140.3_Intron|PTPRC_ENST00000391970.3_3'UTR|PTPRC_ENST00000594404.1_Intron|PTPRC_ENST00000348564.6_Intron	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	148					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						AGATGTCCCAGGAGAGAGGAG	0.512																																						dbGAP											0													329.0	259.0	283.0					1																	198671524		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.442G>A	1.37:g.198671524G>A	ENSP00000356346:p.Gly148Arg		A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Leukocyte_common_ag,pfam_PTP_recept_N,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.G150R	ENST00000367376.2	37	c.448		1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807063	0.50421	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000271610;ENST00000442510;ENST00000367367	.	.	.	5.84	1.67	0.24075	.	1.024940	0.07788	N	0.954532	T	0.47985	0.1475	L	0.59436	1.845	0.09310	N	1	D;D;P	0.64830	0.986;0.994;0.933	P;P;P	0.60886	0.867;0.88;0.486	T	0.41233	-0.9520	9	0.07644	T	0.81	.	4.4457	0.11597	0.276:0.1786:0.5454:0.0	.	84;189;148	F5GXZ3;Q6Q1P2;P08575	.;.;PTPRC_HUMAN	R	150;84;189;148;82	.	ENSP00000271610:G189R	G	+	1	0	PTPRC	196938147	0.001000	0.12720	0.001000	0.08648	0.066000	0.16364	0.921000	0.28718	0.816000	0.34421	0.650000	0.86243	GGA	PTPRC	-	pirsf_Leukocyte_common_ag	ENSG00000081237		0.512	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	HGNC	protein_coding		37	0.00	0	G			198671524	198671524	+1	no_errors	ENST00000367376	ensembl	human	known	69_37n	missense	31	39.22	20	SNP	0.000	A
PXDNL	137902	genome.wustl.edu	37	8	52384839	52384839	+	Silent	SNP	C	C	T			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr8:52384839C>T	ENST00000356297.4	-	8	820	c.720G>A	c.(718-720)ccG>ccA	p.P240P	PXDNL_ENST00000543296.1_Silent_p.P240P	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	240	Ig-like C2-type 1.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.P240P(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CCACATCCTGCGGCTCAAAAG	0.423																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											124.0	116.0	118.0					8																	52384839		1851	4078	5929	-	-	-	SO:0001819	synonymous_variant	0				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.720G>A	8.37:g.52384839C>T			B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Silent	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like	p.P240	ENST00000356297.4	37	c.720	CCDS47855.1	8																																																																																			PXDNL	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000147485		0.423	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1	35	0.00	0	C	NM_144651		52384839	52384839	-1	no_errors	ENST00000356297	ensembl	human	known	69_37n	silent	36	30.77	16	SNP	0.130	T
RAET1K	646024	genome.wustl.edu	37	6	150322381	150322381	+	RNA	SNP	T	T	A	rs9384023	byFrequency	TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr6:150322381T>A	ENST00000533735.1	-	0	495					NR_024045.1				retinoic acid early transcript 1K pseudogene																		CTCCTCAACCTCTTGGGTGAC	0.473													.|||	1983	0.395966	0.3419	0.5576	5008	,	,		21234	0.2222		0.4692	False		,,,				2504	0.4581					dbGAP											0																																										-	-	-			0			AF425244		6q25.1	2012-01-10			ENSG00000218358	ENSG00000218358			16797	pseudogene	pseudogene						11827464	Standard	NR_024045		Approved		uc003qnq.3		OTTHUMG00000015815		6.37:g.150322381T>A				RNA	SNP	-	NULL	ENST00000533735.1	37	NULL		6																																																																																			RAET1K	-	-	ENSG00000218358		0.473	RAET1K-002	KNOWN	basic	processed_transcript	RAET1K	HGNC	pseudogene	OTTHUMT00000390882.1	25	0.00	0	T			150322381	150322381	-1	no_errors	ENST00000533735	ensembl	human	known	69_37n	rna	29	14.71	5	SNP	0.000	A
RNY5	6090	genome.wustl.edu	37	7	148638600	148638600	+	RNA	SNP	G	G	T			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr7:148638600G>T	ENST00000516501.1	+	0	21					NR_001571.2				RNA, Ro-associated Y5																		agtgttgtgggttattgttaa	0.408																																						dbGAP											0													186.0	166.0	172.0					7																	148638600		692	1591	2283	-	-	-			0			U64824		7q36	2013-05-03	2008-03-26		ENSG00000252310			"""Y RNAs (Ro-associated)"""	10248	non-coding RNA	RNA, Y		601824	"""RNA, Y5 small cytoplasmic (associated with Ro protein)"""			7520568	Standard	NR_001571		Approved		uc010slc.1				7.37:g.148638600G>T				RNA	SNP	-	NULL	ENST00000516501.1	37	NULL		7																																																																																			RNY5	-	-	ENSG00000252310		0.408	RNY5-201	KNOWN	basic	misc_RNA	RNY5	HGNC	misc_RNA		52	0.00	0	G	NR_001571		148638600	148638600	+1	no_errors	ENST00000516501	ensembl	human	known	69_37n	rna	30	37.50	18	SNP	1.000	T
RSL1D1	26156	genome.wustl.edu	37	16	11935601	11935601	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr16:11935601C>G	ENST00000571133.1	-	7	878	c.806G>C	c.(805-807)aGc>aCc	p.S269T	RSL1D1_ENST00000542106.1_Missense_Mutation_p.S49T	NM_015659.2	NP_056474.2	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1	269					osteoblast differentiation (GO:0001649)|regulation of apoptotic process (GO:0042981)|regulation of cellular senescence (GO:2000772)|regulation of protein localization (GO:0032880)	membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	15						ATCCCAATTGCTGACAAACGA	0.358																																						dbGAP											0													71.0	72.0	72.0					16																	11935601		2197	4300	6497	-	-	-	SO:0001583	missense	0			AY154473	CCDS10551.1	16p13.13	2011-08-12			ENSG00000171490	ENSG00000171490			24534	protein-coding gene	gene with protein product		615874				15334068, 9859858	Standard	NM_015659		Approved	PBK1, L12, DKFZP564M182, CSIG, UTP30	uc002dbp.1	O76021	OTTHUMG00000129824	ENST00000571133.1:c.806G>C	16.37:g.11935601C>G	ENSP00000460871:p.Ser269Thr		B4DJ58|D3DUG7|Q2M1T7|Q6PL22|Q8IWS7|Q8WUZ1|Q9HDA9|Q9Y3Z9	Missense_Mutation	SNP	pfam_Ribosomal_L1,superfamily_Ribosomal_L1_SF	p.S269T	ENST00000571133.1	37	c.806	CCDS10551.1	16	.	.	.	.	.	.	.	.	.	.	C	9.489	1.100208	0.20552	.	.	ENSG00000171490	ENST00000355674;ENST00000396503;ENST00000542106	T	0.45668	0.89	4.72	-1.5	0.08691	.	0.653827	0.15456	N	0.261387	T	0.28134	0.0694	L	0.45698	1.435	0.09310	N	0.999995	B;B	0.33379	0.41;0.41	B;B	0.29598	0.104;0.104	T	0.26573	-1.0099	10	0.12766	T	0.61	-8.2985	10.8962	0.47023	0.0:0.2381:0.6693:0.0925	.	269;269	Q32Q62;O76021	.;RL1D1_HUMAN	T	268;269;49	ENSP00000347897:S268T	ENSP00000347897:S268T	S	-	2	0	RSL1D1	11843102	0.167000	0.22975	0.170000	0.22879	0.115000	0.19883	0.287000	0.18920	0.109000	0.17891	-0.479000	0.04858	AGC	RSL1D1	-	NULL	ENSG00000171490		0.358	RSL1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSL1D1	HGNC	protein_coding	OTTHUMT00000252059.2	51	0.00	0	C	NM_015659		11935601	11935601	-1	no_errors	ENST00000571133	ensembl	human	known	69_37n	missense	14	60.00	21	SNP	0.022	G
SATL1	340562	genome.wustl.edu	37	X	84362457	84362457	+	Silent	SNP	C	C	A			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chrX:84362457C>A	ENST00000395409.3	-	1	1517	c.957G>T	c.(955-957)ctG>ctT	p.L319L	SATL1_ENST00000332921.5_Silent_p.L319L|SATL1_ENST00000509231.1_Silent_p.L506L			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	319	Gln-rich.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						CTGGTTGACTCAGGCCTGGTT	0.557																																						dbGAP											0													129.0	107.0	115.0					X																	84362457		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.957G>T	X.37:g.84362457C>A			A0AVK7|E9PB72|Q5H8V9	Silent	SNP	superfamily_Acyl_CoA_acyltransferase	p.L506	ENST00000395409.3	37	c.1518		X																																																																																			SATL1	-	NULL	ENSG00000184788		0.557	SATL1-202	KNOWN	basic|appris_principal	protein_coding	SATL1	HGNC	protein_coding		126	0.00	0	C	XM_291339		84362457	84362457	-1	no_errors	ENST00000509231	ensembl	human	known	69_37n	silent	99	10.00	11	SNP	0.000	A
SLC22A15	55356	genome.wustl.edu	37	1	116609287	116609287	+	Silent	SNP	G	G	T			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr1:116609287G>T	ENST00000369503.4	+	11	1642	c.1512G>T	c.(1510-1512)ctG>ctT	p.L504L		NM_018420.2	NP_060890.2	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15	504					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|urinary_tract(1)	17	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		ATCGCAGGCTGGGAGAAGAAG	0.453																																						dbGAP											0													40.0	38.0	38.0					1																	116609287		1839	4089	5928	-	-	-	SO:0001819	synonymous_variant	0			AY145501	CCDS44198.1	1p12	2013-05-22	2008-01-11		ENSG00000163393	ENSG00000163393		"""Solute carriers"""	20301	protein-coding gene	gene with protein product		608275	"""solute carrier family 22 (organic cation transporter), member 15"""			12372408	Standard	NM_018420		Approved	FLIPT1	uc001egb.4	Q8IZD6	OTTHUMG00000012008	ENST00000369503.4:c.1512G>T	1.37:g.116609287G>T			A8MUR3|Q6UXP5|Q8TAL9|Q9NSH5	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L504	ENST00000369503.4	37	c.1512	CCDS44198.1	1																																																																																			SLC22A15	-	NULL	ENSG00000163393		0.453	SLC22A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A15	HGNC	protein_coding	OTTHUMT00000033220.2	73	0.00	0	G	NM_018420		116609287	116609287	+1	no_errors	ENST00000369503	ensembl	human	known	69_37n	silent	8	77.14	27	SNP	1.000	T
SLC9A6	10479	genome.wustl.edu	37	X	135126844	135126844	+	Silent	SNP	G	G	A			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chrX:135126844G>A	ENST00000370698.3	+	16	2006	c.1971G>A	c.(1969-1971)ccG>ccA	p.P657P	SLC9A6_ENST00000370695.4_Silent_p.P689P|SLC9A6_ENST00000370701.1_Silent_p.P637P	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	657					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					CTGAACCCCCGCTAAATTTGT	0.423													G|||	1	0.000264901	0.0008	0.0	3775	,	,		13231	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													80.0	71.0	74.0					X																	135126844		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.1971G>A	X.37:g.135126844G>A			A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Silent	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.P689	ENST00000370698.3	37	c.2067	CCDS14654.1	X																																																																																			SLC9A6	-	NULL	ENSG00000198689		0.423	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	SLC9A6	HGNC	protein_coding	OTTHUMT00000058450.1	74	0.00	0	G	NM_006359		135126844	135126844	+1	no_errors	ENST00000370695	ensembl	human	known	69_37n	silent	53	34.57	28	SNP	0.000	A
SLCO1B7	338821	genome.wustl.edu	37	12	21201768	21201768	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr12:21201768delT	ENST00000421593.2	+	8	1117	c.1117delT	c.(1117-1119)ttafs	p.L373fs	LST3_ENST00000540229.1_Intron|SLCO1B7_ENST00000554957.1_Frame_Shift_Del_p.L420fs|LST3_ENST00000381541.3_Frame_Shift_Del_p.L420fs|SLCO1B3_ENST00000553473.1_Intron	NM_001009562.4	NP_001009562.3	G3V0H7	SO1B7_HUMAN	solute carrier organic anion transporter family, member 1B7 (non-functional)	373						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(25)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						AGTGCATCTCTTATCTCAAGT	0.333																																						dbGAP											0													73.0	78.0	76.0					12																	21201768		2125	4260	6385	-	-	-	SO:0001589	frameshift_variant	0			AF401642	CCDS44843.1	12p12.3	2013-05-22			ENSG00000205754	ENSG00000205754		"""Solute carriers"""	32934	protein-coding gene	gene with protein product							Standard	NM_001009562		Approved	LST3, SLC21A21		G3V0H7	OTTHUMG00000169045	ENST00000421593.2:c.1117delT	12.37:g.21201768delT	ENSP00000394168:p.Leu373fs		Q71QF0	Frame_Shift_Del	DEL	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.L420fs	ENST00000421593.2	37	c.1258	CCDS44843.1	12																																																																																			SLCO1B7	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000205754		0.333	SLCO1B7-001	KNOWN	basic|CCDS	protein_coding	SLCO1B7	HGNC	protein_coding	OTTHUMT00000402066.1	63	0.00	0	T	NM_001009562		21201768	21201768	+1	no_errors	ENST00000554957	ensembl	human	known	69_37n	frame_shift_del	14	12.50	2	DEL	0.000	-
SPTLC1	10558	genome.wustl.edu	37	9	94812324	94812324	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr9:94812324G>T	ENST00000262554.2	-	9	811	c.806C>A	c.(805-807)gCa>gAa	p.A269E		NM_006415.2	NP_006406.1	O15269	SPTC1_HUMAN	serine palmitoyltransferase, long chain base subunit 1	269					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)|SPOTS complex (GO:0035339)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14					L-Serine(DB00133)	GAAGATTCTTGCTTTGTATTT	0.333																																						dbGAP											0													125.0	121.0	122.0					9																	94812324		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y08685	CCDS6692.1, CCDS6693.1	9q22.31	2014-09-17	2003-12-02		ENSG00000090054	ENSG00000090054	2.3.1.50		11277	protein-coding gene	gene with protein product		605712	"""hereditary sensory neuropathy, type 1"""	HSN1		9363775	Standard	NM_006415		Approved	LCB1, SPTI, HSAN1, hLCB1	uc004arl.1	O15269	OTTHUMG00000021047	ENST00000262554.2:c.806C>A	9.37:g.94812324G>T	ENSP00000262554:p.Ala269Glu		A8K681|Q5VWB4|Q96IX6	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	p.A269E	ENST00000262554.2	37	c.806	CCDS6692.1	9	.	.	.	.	.	.	.	.	.	.	G	21.1	4.098919	0.76870	.	.	ENSG00000090054	ENST00000262554	D	0.96522	-4.04	4.66	4.66	0.58398	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.125544	0.52532	D	0.000067	D	0.96765	0.8944	M	0.81614	2.55	0.80722	D	1	B;B	0.28667	0.219;0.162	P;B	0.46885	0.53;0.393	D	0.95662	0.8716	10	0.66056	D	0.02	-19.542	5.5521	0.17095	0.2394:0.0:0.7606:0.0	.	269;269	Q6NUL7;O15269	.;SPTC1_HUMAN	E	269	ENSP00000262554:A269E	ENSP00000262554:A269E	A	-	2	0	SPTLC1	93852145	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.149000	0.77396	2.411000	0.81874	0.551000	0.68910	GCA	SPTLC1	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000090054		0.333	SPTLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTLC1	HGNC	protein_coding	OTTHUMT00000055553.1	33	0.00	0	G	NM_006415		94812324	94812324	-1	no_errors	ENST00000262554	ensembl	human	known	69_37n	missense	21	12.50	3	SNP	1.000	T
TMX3	54495	genome.wustl.edu	37	18	66354964	66354964	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr18:66354964delC	ENST00000299608.2	-	10	992	c.676delG	c.(676-678)gaafs	p.E226fs	TMX3_ENST00000566887.1_5'Flank	NM_019022.3	NP_061895.3	Q96JJ7	TMX3_HUMAN	thioredoxin-related transmembrane protein 3	226					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	17						TGAAACCTTTCCCTGTTGATC	0.348																																						dbGAP											0													165.0	149.0	154.0					18																	66354964		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BX647846	CCDS32840.1	18q22	2011-10-19	2009-02-23	2009-02-23		ENSG00000166479		"""Protein disulfide isomerases"""	24718	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 13"""		"""thioredoxin domain containing 10"""	TXNDC10		15623505	Standard	NM_019022		Approved	FLJ20793, KIAA1830, PDIA13	uc002lkf.3	Q96JJ7		ENST00000299608.2:c.676delG	18.37:g.66354964delC	ENSP00000299608:p.Glu226fs		B3KV75|Q52LT7|Q8N5J0|Q9NWJ9	Frame_Shift_Del	DEL	pfam_Thioredoxin_domain,pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Thioredoxin	p.E226fs	ENST00000299608.2	37	c.676	CCDS32840.1	18																																																																																			TMX3	-	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold	ENSG00000166479		0.348	TMX3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	TMX3	HGNC	protein_coding	OTTHUMT00000420155.1	40	0.00	0	C	NM_019022		66354964	66354964	-1	no_errors	ENST00000299608	ensembl	human	known	69_37n	frame_shift_del	9	18.18	2	DEL	1.000	-
TNFAIP1	7126	genome.wustl.edu	37	17	26671409	26671409	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr17:26671409G>A	ENST00000226225.2	+	7	1001	c.734G>A	c.(733-735)cGa>cAa	p.R245Q	TNFAIP1_ENST00000583213.1_3'UTR|TNFAIP1_ENST00000544907.2_Missense_Mutation_p.R141Q|POLDIP2_ENST00000003607.4_5'Flank	NM_021137.4	NP_066960.1	Q13829	BACD2_HUMAN	tumor necrosis factor, alpha-induced protein 1 (endothelial)	245					apoptotic process (GO:0006915)|cell migration (GO:0016477)|DNA replication (GO:0006260)|embryo development (GO:0009790)|immune response (GO:0006955)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of DNA replication (GO:0045740)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleolus (GO:0005730)	GTP-Rho binding (GO:0017049)			endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)	12	all_lung(13;0.000294)|Lung NSC(42;0.000964)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		CCAGAGGCCCGAATCTATGAG	0.587																																						dbGAP											0													53.0	47.0	49.0					17																	26671409		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11227.1	17q22-q23	2013-01-09			ENSG00000109079	ENSG00000109079		"""BTB/POZ domain containing"""	11894	protein-coding gene	gene with protein product		191161		EDP1		2406243, 2233719	Standard	NM_021137		Approved	B61, B12, MGC2317, BTBD34	uc002hay.3	Q13829	OTTHUMG00000132501	ENST00000226225.2:c.734G>A	17.37:g.26671409G>A	ENSP00000226225:p.Arg245Gln		B7Z6M4|Q5TZQ1	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.R245Q	ENST00000226225.2	37	c.734	CCDS11227.1	17	.	.	.	.	.	.	.	.	.	.	G	34	5.400273	0.96030	.	.	ENSG00000109079	ENST00000226225;ENST00000544907	T	0.58060	0.36	5.87	4.9	0.64082	.	0.123297	0.56097	D	0.000028	T	0.71710	0.3372	M	0.84326	2.69	0.80722	D	1	D	0.69078	0.997	P	0.61477	0.889	T	0.77629	-0.2516	10	0.87932	D	0	-5.4974	14.6287	0.68640	0.0698:0.0:0.9302:0.0	.	245	Q13829	BACD2_HUMAN	Q	245;141	ENSP00000226225:R245Q	ENSP00000226225:R245Q	R	+	2	0	TNFAIP1	23695536	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	9.483000	0.97937	1.626000	0.50381	0.655000	0.94253	CGA	TNFAIP1	-	NULL	ENSG00000109079		0.587	TNFAIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP1	HGNC	protein_coding	OTTHUMT00000255681.2	64	0.00	0	G	NM_021137		26671409	26671409	+1	no_errors	ENST00000226225	ensembl	human	known	69_37n	missense	50	34.21	26	SNP	1.000	A
TPRX1	284355	genome.wustl.edu	37	19	48305694	48305694	+	Missense_Mutation	SNP	A	A	G	rs200053895		TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr19:48305694A>G	ENST00000322175.3	-	2	729	c.574T>C	c.(574-576)Tca>Cca	p.S192P	TPRX1_ENST00000535759.1_Missense_Mutation_p.S289P|TPRX1_ENST00000543508.1_Missense_Mutation_p.S182P	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	192	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		atcgggcctgagattgggcct	0.672																																					Esophageal Squamous(123;175 2281 3051 32395)	dbGAP											0													14.0	12.0	13.0					19																	48305694		1711	3169	4880	-	-	-	SO:0001583	missense	0				CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.574T>C	19.37:g.48305694A>G	ENSP00000323455:p.Ser192Pro		A5D8Y3|B2RPL5	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.S289P	ENST00000322175.3	37	c.865	CCDS33066.1	19	.	.	.	.	.	.	.	.	.	.	a	0.005	-2.138250	0.00335	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	T;T;T	0.19250	2.16;2.16;2.16	0.401	-0.802	0.10889	.	.	.	.	.	T	0.05868	0.0153	N	0.03608	-0.345	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.28522	-1.0041	8	0.08599	T	0.76	.	.	.	.	.	192	Q8N7U7	TPRX1_HUMAN	P	192;289;182	ENSP00000323455:S192P;ENSP00000438832:S289P;ENSP00000438712:S182P	ENSP00000323455:S192P	S	-	1	0	TPRX1	52997506	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.647000	0.01997	-2.695000	0.00402	-2.747000	0.00125	TCA	TPRX1	-	NULL	ENSG00000178928		0.672	TPRX1-001	KNOWN	basic|CCDS	protein_coding	TPRX1	HGNC	protein_coding	OTTHUMT00000409868.1	147	0.00	0	A	NM_198479		48305694	48305694	-1	no_errors	ENST00000535759	ensembl	human	known	69_37n	missense	70	24.73	23	SNP	0.000	G
TTYH1	57348	genome.wustl.edu	37	19	54930683	54930683	+	Intron	SNP	T	T	C			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chr19:54930683T>C	ENST00000376530.3	+	2	408				TTYH1_ENST00000376531.3_Intron|TTYH1_ENST00000391739.3_Intron|TTYH1_ENST00000301194.4_Intron	NM_001201461.1|NM_020659.3	NP_001188390.1|NP_065710.1	Q9H313	TTYH1_HUMAN	tweety family member 1						cell-substrate adhesion (GO:0031589)|chloride transport (GO:0006821)|filopodium assembly (GO:0046847)|ion transmembrane transport (GO:0034220)|iron ion transmembrane transport (GO:0034755)|iron ion transport (GO:0006826)|mitotic nuclear division (GO:0007067)|regulation of anion transport (GO:0044070)|single organismal cell-cell adhesion (GO:0016337)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|filopodium membrane (GO:0031527)|filopodium tip (GO:0032433)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum membrane (GO:0030868)	calcium ion binding (GO:0005509)|iron ion transmembrane transporter activity (GO:0005381)|volume-sensitive chloride channel activity (GO:0072320)			endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		aaagtgaggctctggagagga	0.557																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF177909	CCDS12893.1, CCDS33106.1, CCDS56102.1	19q13.4	2013-09-02	2013-09-02		ENSG00000167614	ENSG00000167614			13476	protein-coding gene	gene with protein product		605784	"""tweety (Drosophila) homolog 1"", ""tweety homolog 1 (Drosophila)"""			10950931	Standard	NM_020659		Approved		uc002qfr.3	Q9H313	OTTHUMG00000065544	ENST00000376530.3:c.305+203T>C	19.37:g.54930683T>C			B0VJY3|B0VJY4|B0VJY5|B2VAL9|Q5U682|Q68A17|Q6L750|Q6ZTE5|Q8WUU2	RNA	SNP	-	NULL	ENST00000376530.3	37	NULL	CCDS12893.1	19																																																																																			TTYH1	-	-	ENSG00000167614		0.557	TTYH1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TTYH1	HGNC	protein_coding	OTTHUMT00000140498.1	37	0.00	0	T			54930683	54930683	+1	no_errors	ENST00000462769	ensembl	human	known	69_37n	rna	15	68.09	32	SNP	0.001	C
USP9X	8239	genome.wustl.edu	37	X	41073963	41073963	+	Splice_Site	SNP	G	G	A			TCGA-AC-A2FM-01A-11D-A19Y-09	TCGA-AC-A2FM-11B-32D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c5da0b13-36d4-450f-91ad-28aec80cd486	15e2debd-3063-47bd-89ba-db738a9c0b45	g.chrX:41073963G>A	ENST00000324545.8	+	34	5964		c.e34+1		USP9X_ENST00000378308.2_Splice_Site	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked						axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						CAATAAAAAGGTACGGGCTGT	0.308																																					Ovarian(172;1807 2695 35459 49286)	dbGAP											0													76.0	77.0	76.0					X																	41073963		2159	4278	6437	-	-	-	SO:0001630	splice_region_variant	0			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.5331+1G>A	X.37:g.41073963G>A			O75550|Q8WWT3|Q8WX12	Splice_Site	SNP	-	e33+1	ENST00000324545.8	37	c.5331+1	CCDS43930.1	X	.	.	.	.	.	.	.	.	.	.	G	21.7	4.180697	0.78677	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7493	0.91807	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	USP9X	40958907	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	9.476000	0.97823	2.373000	0.80994	0.594000	0.82650	.	USP9X	-	-	ENSG00000124486		0.308	USP9X-003	KNOWN	basic|CCDS	protein_coding	USP9X	HGNC	protein_coding	OTTHUMT00000056250.4	73	0.00	0	G	NM_004652	Intron	41073963	41073963	+1	no_errors	ENST00000324545	ensembl	human	known	69_37n	splice_site	47	34.72	25	SNP	1.000	A
