#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB8	11194	genome.wustl.edu	37	7	150734380	150734380	+	Intron	SNP	T	T	C	rs35900662	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr7:150734380T>C	ENST00000297504.6	+	10	1334				ABCB8_ENST00000542328.1_Intron|ABCB8_ENST00000356058.4_Intron|ABCB8_ENST00000498578.1_Intron|ABCB8_ENST00000358849.4_Intron|ABCB8_ENST00000477719.1_3'UTR|ABCB8_ENST00000477092.1_Missense_Mutation_p.F424L			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8						transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	ggctgtgacattccatgcatg	0.562													T|||	1511	0.301717	0.3306	0.2233	5008	,	,		15935	0.2798		0.2873	False		,,,				2504	0.3558					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.1268+644T>C	7.37:g.150734380T>C			A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	p.F424L	ENST00000297504.6	37	c.1270		7	634	0.2902930402930403	175	0.3556910569105691	81	0.22375690607734808	157	0.2744755244755245	221	0.29155672823219	T	5.269	0.235015	0.09969	.	.	ENSG00000197150	ENST00000477092	D	0.82433	-1.61	2.24	-4.48	0.03515	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.07520	-1.0768	7	0.12430	T	0.62	.	4.0549	0.09813	0.0:0.317:0.3993:0.2837	rs35900662;rs58328017	424	C9JTY4	.	L	424	ENSP00000419558:F424L	ENSP00000419558:F424L	F	+	1	0	ABCB8	150365313	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.131000	0.03238	-1.108000	0.03000	-0.366000	0.07423	TTC	ABCB8	-	NULL	ENSG00000197150		0.562	ABCB8-003	KNOWN	basic	protein_coding	ABCB8	HGNC	protein_coding	OTTHUMT00000351733.2	72	0.00	0	T	NM_007188		150734380	150734380	+1	no_errors	ENST00000477092	ensembl	human	novel	69_37n	missense	43	10.42	5	SNP	0.000	C
ACR	49	genome.wustl.edu	37	22	51183017	51183017	+	Intron	SNP	C	C	T	rs58651371	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr22:51183017C>T	ENST00000216139.5	+	5	751				AC002056.5_ENST00000532913.1_RNA|ACR_ENST00000527761.1_3'UTR	NM_001097.2	NP_001088.2	P10323	ACRO_HUMAN	acrosin						acrosome matrix dispersal (GO:0002077)|acrosome reaction (GO:0007340)|activation of adenylate cyclase activity (GO:0007190)|binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|response to steroid hormone (GO:0048545)|single fertilization (GO:0007338)	acrosomal matrix (GO:0043159)|extracellular region (GO:0005576)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|protein complex (GO:0043234)	amidase activity (GO:0004040)|copper ion binding (GO:0005507)|DNA binding (GO:0003677)|drug binding (GO:0008144)|fucose binding (GO:0042806)|mannose binding (GO:0005537)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	7		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;1.1e-06)|LUAD - Lung adenocarcinoma(64;0.247)		CAGAGCCTTCCGACCCCTCTG	0.552													T|||	2072	0.413738	0.4546	0.3732	5008	,	,		13923	0.4256		0.3072	False		,,,				2504	0.4847					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			CR456366	CCDS14101.1	22q13.33	2012-10-23	2012-10-23		ENSG00000100312	ENSG00000100312	3.4.21.10		126	protein-coding gene	gene with protein product	"""preproacrosin"", ""acrosin light and heavy chain prepropeptide"""	102480				2298447, 12398221	Standard	NM_001097		Approved		uc003bnh.4	P10323	OTTHUMG00000150155	ENST00000216139.5:c.712-64C>T	22.37:g.51183017C>T			Q6ICK2	RNA	SNP	-	NULL	ENST00000216139.5	37	NULL	CCDS14101.1	22																																																																																			ACR	-	-	ENSG00000100312		0.552	ACR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ACR	HGNC	protein_coding	OTTHUMT00000316605.2	48	0.00	0	C	NM_001097		51183017	51183017	+1	no_errors	ENST00000527761	ensembl	human	known	69_37n	rna	34	19.05	8	SNP	0.001	T
AFAP1	60312	genome.wustl.edu	37	4	7800754	7800754	+	Intron	SNP	C	C	T	rs62289276	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr4:7800754C>T	ENST00000360265.4	-	9	1501				AFAP1_ENST00000358461.2_Intron|AFAP1_ENST00000382543.3_Intron|AFAP1_ENST00000420658.1_Intron|AFAP1_ENST00000513842.1_5'UTR			Q8N556	AFAP1_HUMAN	actin filament associated protein 1							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(4)|stomach(2)	32						TTTTTTCCACCGCCATCCACC	0.443													C|||	558	0.111422	0.0098	0.1484	5008	,	,		20262	0.0615		0.3042	False		,,,				2504	0.0757					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB209676	CCDS3397.1, CCDS47010.1	4p16	2014-02-12	2007-02-07		ENSG00000196526	ENSG00000196526		"""Pleckstrin homology (PH) domain containing"""	24017	protein-coding gene	gene with protein product		608252				14755689, 11641786, 11607843	Standard	NM_198595		Approved	AFAP-110, AFAP	uc011bwk.1	Q8N556	OTTHUMG00000125515	ENST00000360265.4:c.1266+1414G>A	4.37:g.7800754C>T			A8K442|B4DMU2|E9PDT7|Q59EY5|Q9HBY1	RNA	SNP	-	NULL	ENST00000360265.4	37	NULL	CCDS3397.1	4																																																																																			AFAP1	-	-	ENSG00000196526		0.443	AFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFAP1	HGNC	protein_coding	OTTHUMT00000246842.2	65	0.00	0	C	NM_021638		7800754	7800754	-1	no_errors	ENST00000513842	ensembl	human	known	69_37n	rna	61	12.86	9	SNP	0.000	T
AFF2	2334	genome.wustl.edu	37	X	147800748	147800748	+	Intron	SNP	A	A	G	rs241084	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chrX:147800748A>G	ENST00000370460.2	+	3	1520				AFF2_ENST00000370458.1_Intron|AFF2_ENST00000342251.3_Intron|AFF2_ENST00000370457.5_Intron|AFF2_ENST00000286437.5_Missense_Mutation_p.K15R	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2						brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TCCTTCTTCAAGATGAAGGTA	0.428													G|||	1061	0.28106	0.5083	0.1354	3775	,	,		15761	0.0099		0.1819	False		,,,				2504	0.1043					dbGAP											0													230.0	168.0	187.0					X																	147800748		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1041+56459A>G	X.37:g.147800748A>G			A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.K15R	ENST00000370460.2	37	c.44	CCDS14684.1	X	463	0.27908378541289935	178	0.536144578313253	38	0.1165644171779141	3	0.005244755244755245	108	0.1588235294117647	G	0.132	-1.111962	0.01813	.	.	ENSG00000155966	ENST00000286437	T	0.72615	-0.67	2.32	-3.36	0.04913	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.33445	-0.9868	7	0.07644	T	0.81	.	4.1086	0.10049	0.4306:0.0:0.4006:0.1688	rs241084;rs59062443;rs241084	15	B4DXD5	.	R	15	ENSP00000286437:K15R	ENSP00000286437:K15R	K	+	2	0	AFF2	147608440	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.173000	0.09854	-1.689000	0.01434	-1.824000	0.00597	AAG	AFF2	-	NULL	ENSG00000155966		0.428	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	67	0.00	0	A	NM_002025		147800748	147800748	+1	no_errors	ENST00000286437	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	0.000	G
AKR1CL1	340811	genome.wustl.edu	37	10	5200861	5200861	+	IGR	SNP	C	C	A	rs2020172	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr10:5200861C>A	ENST00000334314.3	-	0	492				AKR1CL1_ENST00000465430.1_Intron			Q5T2L2	AKCL1_HUMAN	aldo-keto reductase family 1, member C-like 1							cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	6						CTTGGACTTGCAGAACTCCAG	0.448													C|||	864	0.172524	0.1732	0.183	5008	,	,		17338	0.0		0.3579	False		,,,				2504	0.1513				Ovarian(129;1623 1737 25446 28757 47467)	dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0					10p15.2	2014-05-06			ENSG00000196326	ENSG00000264006			23469	protein-coding gene	gene with protein product						15164054	Standard	NR_027916		Approved		uc009xhz.2	Q5T2L2	OTTHUMG00000184213		10.37:g.5200861C>A			A6NF66|Q6ZN81	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.C34F	ENST00000334314.3	37	c.101		10	440	0.20146520146520147	99	0.20121951219512196	81	0.22375690607734808	0	0.0	260	0.34300791556728233	C	19.60	3.858582	0.71834	.	.	ENSG00000196326	ENST00000473890	T	0.28454	1.61	3.73	3.73	0.42828	.	0.000000	0.64402	U	0.000012	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.31752	-0.9932	6	0.87932	D	0	.	13.7685	0.63010	0.0:1.0:0.0:0.0	rs2020172;rs2020172	.	.	.	F	34	ENSP00000417959:C34F	ENSP00000417959:C34F	C	-	2	0	AKR1CL1	5190861	1.000000	0.71417	0.989000	0.46669	0.951000	0.60555	3.694000	0.54742	2.014000	0.59158	0.484000	0.47621	TGC	AKR1CL1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	ENSG00000196326		0.448	AKR1CL1-201	KNOWN	basic|appris_candidate_longest	protein_coding	AKR1CL1	HGNC	protein_coding		55	0.00	0	C	NR_027916		5200861	5200861	-1	no_errors	ENST00000473890	ensembl	human	novel	69_37n	missense	32	13.51	5	SNP	1.000	A
AGAP9	642517	genome.wustl.edu	37	10	48235892	48235892	+	Missense_Mutation	SNP	C	C	T	rs200283865	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr10:48235892C>T	ENST00000453919.1	+	8	794	c.794C>T	c.(793-795)cCg>cTg	p.P265L	AGAP9_ENST00000456984.2_Missense_Mutation_p.P220L			Q5VTM2	AGAP9_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 9	265					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										TCCATTCCACCGACTCCCAGC	0.542																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS73125.1	10q11.22	2013-01-11	2008-09-22	2008-09-22	ENSG00000198035			"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23463	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 6"""	CTGLF6			Standard	NM_001190810		Approved	bA301J7.2, FLJ00312	uc009xnf.2	Q5VTM2	OTTHUMG00000018141	ENST00000453919.1:c.794C>T	10.37:g.48235892C>T	ENSP00000396454:p.Pro265Leu		D3YTF3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_ProtSyn_GTP-bd,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.P265L	ENST00000453919.1	37	c.794		10	.	.	.	.	.	.	.	.	.	.	c	7.936	0.741745	0.15642	.	.	ENSG00000198035	ENST00000453919;ENST00000354954;ENST00000456984	T;T	0.40756	1.02;1.02	.	.	.	.	0.149774	0.46145	D	0.000318	T	0.13927	0.0337	N	0.02011	-0.69	0.34979	P	0.24610299999999996	B	0.02656	0.0	B	0.01281	0.0	T	0.09292	-1.0681	8	0.30854	T	0.27	.	5.8178	0.18506	0.0:0.999:0.0:0.001	.	220	D3YTF3	.	L	265;245;220	ENSP00000396454:P265L;ENSP00000403270:P220L	ENSP00000347040:P245L	P	+	2	0	AGAP9	47855898	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	4.780000	0.62382	-0.000000	0.14550	0.000000	0.15137	CCG	AGAP9	-	NULL	ENSG00000198035		0.542	AGAP9-201	KNOWN	basic|appris_candidate_longest	protein_coding	AGAP9	HGNC	protein_coding		106	0.00	0	C	XM_001716810.2		48235892	48235892	+1	no_errors	ENST00000453919	ensembl	human	known	69_37n	missense	80	11.11	10	SNP	1.000	T
AGAP7P	653268	genome.wustl.edu	37	10	51465138	51465138	+	Missense_Mutation	SNP	C	C	T	rs201025969	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr10:51465138C>T	ENST00000374095.5	-	7	1443	c.1318G>A	c.(1318-1320)Gag>Aag	p.E440K		NM_001077685.1	NP_001071153.1	Q5VUJ5	AGAP7_HUMAN		440					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	11						GCCATGGCCTCGCTCTGGCTG	0.587													-|||	835	0.166733	0.0703	0.1254	5008	,	,		19289	0.249		0.1958	False		,,,				2504	0.2117					dbGAP											0													3.0	4.0	4.0					10																	51465138		1265	2873	4138	-	-	-	SO:0001583	missense	0																														ENST00000374095.5:c.1318G>A	10.37:g.51465138C>T	ENSP00000363208:p.Glu440Lys		A6NGH4	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.E440K	ENST00000374095.5	37	c.1318	CCDS41524.1	10	.	.	.	.	.	.	.	.	.	.	.	14.78	2.638591	0.47153	.	.	ENSG00000204169	ENST00000374095	T	0.54071	0.59	.	.	.	.	0.000000	0.85682	D	0.000000	T	0.52517	0.1739	M	0.69185	2.1	0.24464	P	0.99442969	D	0.56746	0.977	P	0.50270	0.636	T	0.60642	-0.7223	8	0.48119	T	0.1	.	5.9763	0.19382	0.0:0.9994:0.0:6.0E-4	.	440	Q5VUJ5	AGAP7_HUMAN	K	440	ENSP00000363208:E440K	ENSP00000363208:E440K	E	-	1	0	AGAP7	51135144	0.998000	0.40836	0.100000	0.21137	0.102000	0.19082	3.583000	0.53928	0.172000	0.19760	0.175000	0.17021	GAG	AGAP7	-	superfamily_ArfGAP	ENSG00000204169		0.587	AGAP7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	AGAP7	HGNC	protein_coding	OTTHUMT00000048033.1	79	0.00	0	C			51465138	51465138	-1	no_errors	ENST00000374095	ensembl	human	known	69_37n	missense	49	14.04	8	SNP	0.997	T
FAM86A	196483	genome.wustl.edu	37	16	5135380	5135380	+	3'UTR	SNP	A	A	G	rs6775	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr16:5135380A>G	ENST00000427587.4	-	0	1314				FAM86A_ENST00000458008.4_3'UTR|ALG1_ENST00000262374.5_3'UTR|ALG1_ENST00000592661.1_3'UTR|ALG1_ENST00000588623.1_3'UTR	NM_201400.2	NP_958802.1	Q96G04	FA86A_HUMAN	family with sequence similarity 86, member A							cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	12						AGAAAATGCTATTTTTGGAGC	0.448													A|||	2802	0.559505	0.5121	0.4251	5008	,	,		21990	0.621		0.5219	False		,,,				2504	0.6943					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC010084	CCDS10529.1, CCDS10530.1, CCDS73823.1	16p13.3	2012-11-07			ENSG00000118894	ENSG00000118894			32221	protein-coding gene	gene with protein product		615263					Standard	NM_201400		Approved	SB153, MGC19636	uc002cyo.2	Q96G04	OTTHUMG00000129527	ENST00000427587.4:c.*253T>C	16.37:g.5135380A>G			D3DUF0|Q96S85	RNA	SNP	-	NULL	ENST00000427587.4	37	NULL	CCDS10529.1	16																																																																																			ALG1	-	-	ENSG00000033011		0.448	FAM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG1	HGNC	protein_coding	OTTHUMT00000251713.1	24	0.00	0	A	NM_201400		5135380	5135380	+1	no_errors	ENST00000592661	ensembl	human	putative	69_37n	rna	40	16.67	8	SNP	0.000	G
AMFR	267	genome.wustl.edu	37	16	56395610	56395610	+	3'UTR	SNP	G	G	A	rs2550303	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr16:56395610G>A	ENST00000290649.5	-	0	3353					NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase						aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						CAATAATTGTGGATAATACTG	0.264													A|||	3503	0.699481	0.8994	0.5677	5008	,	,		13607	0.6081		0.5517	False		,,,				2504	0.7689				Pancreas(2;144 323 39528)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.*1211C>T	16.37:g.56395610G>A			P26442|Q8IZ70	RNA	SNP	-	NULL	ENST00000290649.5	37	NULL	CCDS10758.1	16																																																																																			AMFR	-	-	ENSG00000159461		0.264	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMFR	HGNC	protein_coding	OTTHUMT00000256978.2	52	0.00	0	G			56395610	56395610	-1	no_errors	ENST00000492830	ensembl	human	known	69_37n	rna	25	21.88	7	SNP	0.999	A
ANKRD36BP2	645784	genome.wustl.edu	37	2	89103904	89103904	+	RNA	SNP	C	C	T	rs1047685	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr2:89103904C>T	ENST00000393525.3	+	0	4378									ankyrin repeat domain 36B pseudogene 2																		CTTCAAGAAACACAGGATCAA	0.299													T|||	2291	0.457468	0.7148	0.4726	5008	,	,		16474	0.3571		0.4085	False		,,,				2504	0.2526					dbGAP											0																																										-	-	-			0					2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89103904C>T				RNA	SNP	-	NULL	ENST00000393525.3	37	NULL		2																																																																																			ANKRD36BP2	-	-	ENSG00000230006		0.299	ANKRD36BP2-003	KNOWN	basic	processed_transcript	ANKRD36BP2	HGNC	pseudogene	OTTHUMT00000323523.1	209	0.00	0	C			89103904	89103904	+1	no_errors	ENST00000393515	ensembl	human	known	69_37n	rna	112	15.15	20	SNP	0.001	T
ANKRD36B	57730	genome.wustl.edu	37	2	98165911	98165911	+	RNA	SNP	T	T	C	rs1839230|rs112877086	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr2:98165911T>C	ENST00000443455.1	-	0	1558							Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B																		ATCCTTTTTTTCTCTGGCTAT	0.308													.|||	980	0.195687	0.5703	0.1239	5008	,	,		38822	0.0069		0.1004	False		,,,				2504	0.0327					dbGAP											0													45.0	18.0	26.0					2																	98165911		1759	3782	5541	-	-	-			0			AK024934	CCDS74543.1	2q11.2	2013-01-11	2008-03-25	2008-03-25	ENSG00000196912	ENSG00000196912		"""Ankyrin repeat domain containing"""	29333	protein-coding gene	gene with protein product	"""melanoma-associated antigen"", ""CLL-associated antigen KW-1"""		"""KIAA1641"""	KIAA1641		10997877	Standard	NM_025190		Approved	FLJ21281	uc010yvc.1	Q8N2N9	OTTHUMG00000130547		2.37:g.98165911T>C			Q08AK5|Q6IPR0|Q6PI49|Q8IZM7|Q8TDH6|Q96N30|Q9H759	RNA	SNP	-	NULL	ENST00000443455.1	37	NULL		2																																																																																			ANKRD36B	-	-	ENSG00000196912		0.308	ANKRD36B-003	KNOWN	basic	processed_transcript	ANKRD36B	HGNC	pseudogene	OTTHUMT00000328967.2	124	0.80	1	T	NM_025190		98165911	98165911	-1	no_errors	ENST00000443455	ensembl	human	known	69_37n	rna	100	12.28	14	SNP	0.003	C
ANKRD62	342850	genome.wustl.edu	37	18	12096249	12096249	+	Missense_Mutation	SNP	G	G	T	rs1986751	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr18:12096249G>T	ENST00000587848.2	+	4	727	c.562G>T	c.(562-564)Gca>Tca	p.A188S	ANKRD62_ENST00000314074.8_Missense_Mutation_p.A174S|RNU6-324P_ENST00000363957.1_RNA			A6NC57	ANR62_HUMAN	ankyrin repeat domain 62	188			A -> S (in dbSNP:rs1986751).							breast(2)|haematopoietic_and_lymphoid_tissue(1)	3						GCAAATGGTGGCATTTTTGTT	0.303													G|||	2627	0.524561	0.5764	0.5677	5008	,	,		19392	0.2391		0.669	False		,,,				2504	0.5695					dbGAP											0																																										-	-	-	SO:0001583	missense	0			BX648696	CCDS67439.1	18p11.21	2014-01-21			ENSG00000181626	ENSG00000181626		"""Ankyrin repeat domain containing"""	35241	protein-coding gene	gene with protein product							Standard	XM_003959949		Approved	DKFZp779B1634	uc031rhk.1	A6NC57	OTTHUMG00000180673	ENST00000587848.2:c.562G>T	18.37:g.12096249G>T	ENSP00000467740:p.Ala188Ser			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A174S	ENST00000587848.2	37	c.520		18	1156	0.5293040293040293	295	0.5995934959349594	201	0.5552486187845304	150	0.26223776223776224	510	0.6728232189973615	G	5.576	0.291063	0.10567	.	.	ENSG00000181626	ENST00000314074	T	0.63580	-0.05	1.61	-0.402	0.12404	.	1.261860	0.06428	U	0.723579	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.45234	-0.9275	6	0.87932	D	0	.	6.5344	0.22344	0.3298:0.0:0.6702:0.0	rs1986751;rs52805682;rs60283830;rs1986751	.	.	.	S	174	ENSP00000326572:A174S	ENSP00000326572:A174S	A	+	1	0	ANKRD62	12086249	0.358000	0.24947	0.001000	0.08648	0.187000	0.23431	0.687000	0.25407	-0.569000	0.06030	-1.786000	0.00637	GCA	ANKRD62	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000181626		0.303	ANKRD62-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	ANKRD62	HGNC	protein_coding	OTTHUMT00000452521.2	46	0.00	0	G	XM_001715728		12096249	12096249	+1	no_errors	ENST00000314074	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	0.002	T
ANKUB1	389161	genome.wustl.edu	37	3	149479301	149479301	+	IGR	SNP	C	C	T	rs954714	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:149479301C>T	ENST00000383050.3	-	0	1732				ANKUB1_ENST00000446160.1_Silent_p.A535A			A6NFN9	ANKUB_HUMAN	ankyrin repeat and ubiquitin domain containing 1									p.A535A(1)		breast(1)|kidney(1)|lung(1)|skin(1)	4						AGTTTTCACACGCTGTCAGAC	0.408													T|||	2607	0.520567	0.6543	0.402	5008	,	,		18894	0.5139		0.4911	False		,,,				2504	0.4611					dbGAP											1	Substitution - coding silent(1)	kidney(1)											152.0	128.0	136.0					3																	149479301		692	1591	2283	-	-	-	SO:0001628	intergenic_variant	0			AK027233		3q25.1	2013-01-11	2011-05-10	2011-05-10	ENSG00000206199	ENSG00000206199		"""Ankyrin repeat domain containing"""	29642	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 16"""	C3orf16			Standard	NM_001144960		Approved		uc003exl.3	A6NFN9	OTTHUMG00000159615		3.37:g.149479301C>T			B4E2N8	Silent	SNP	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ubiquitin_supergroup	p.A535	ENST00000383050.3	37	c.1605		3																																																																																			ANKUB1	-	NULL	ENSG00000206199		0.408	ANKUB1-201	KNOWN	basic	protein_coding	ANKUB1	HGNC	protein_coding		57	0.00	0	C	NM_001144960		149479301	149479301	-1	no_errors	ENST00000446160	ensembl	human	known	69_37n	silent	41	14.58	7	SNP	0.000	T
ARHGAP12	94134	genome.wustl.edu	37	10	32095666	32095666	+	3'UTR	SNP	T	T	C	rs2799002	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr10:32095666T>C	ENST00000344936.2	-	0	3695				ARHGAP12_ENST00000375245.4_3'UTR|ARHGAP12_ENST00000396144.4_3'UTR|ARHGAP12_ENST00000375250.5_3'UTR|ARHGAP12_ENST00000492028.1_5'UTR|ARHGAP12_ENST00000311380.4_3'UTR	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12						morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				AATAACGGACTATTTCTGGAG	0.313													T|||	1169	0.233427	0.0545	0.2983	5008	,	,		18977	0.4127		0.2107	False		,,,				2504	0.2679					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.*920A>G	10.37:g.32095666T>C			B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	RNA	SNP	-	NULL	ENST00000344936.2	37	NULL	CCDS7170.1	10																																																																																			ARHGAP12	-	-	ENSG00000165322		0.313	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	ARHGAP12	HGNC	protein_coding	OTTHUMT00000047465.1	46	0.00	0	T			32095666	32095666	-1	no_errors	ENST00000492028	ensembl	human	known	69_37n	rna	23	17.86	5	SNP	0.003	C
ARPP21	10777	genome.wustl.edu	37	3	35779750	35779750	+	Intron	SNP	A	A	G	rs2012153	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:35779750A>G	ENST00000187397.4	+	16	2100				ARPP21_ENST00000417925.1_Silent_p.P529P|ARPP21_ENST00000458225.1_Silent_p.P529P|ARPP21_ENST00000444190.1_Silent_p.P509P|ARPP21_ENST00000337271.5_Silent_p.P509P	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa						cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						TGCAATATCCAGCAGTCTCTT	0.483													G|||	1797	0.358826	0.4675	0.304	5008	,	,		17834	0.1508		0.4533	False		,,,				2504	0.3681					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.1644+896A>G	3.37:g.35779750A>G			B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	NULL	p.S220G	ENST00000187397.4	37	c.658	CCDS2661.1	3																																																																																			ARPP21	-	NULL	ENSG00000172995		0.483	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPP21	HGNC	protein_coding	OTTHUMT00000253334.2	89	0.00	0	A	NM_198399		35779750	35779750	+1	no_start_codon	ENST00000457165	ensembl	human	known	69_37n	missense	61	13.89	10	SNP	0.693	G
ATP2A3	489	genome.wustl.edu	37	17	3828086	3828086	+	IGR	SNP	C	C	G	rs1043246	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:3828086C>G	ENST00000352011.3	-	0	3274				ATP2A3_ENST00000309890.7_3'UTR|ATP2A3_ENST00000397035.3_3'UTR|ATP2A3_ENST00000397041.3_3'UTR|ATP2A3_ENST00000397039.1_Missense_Mutation_p.G216R			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous						blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		ACCCTTCACCCGCCCGGGCCC	0.637													C|||	1032	0.20607	0.0068	0.2651	5008	,	,		15160	0.4702		0.1461	False		,,,				2504	0.2229				GBM(32;29 774 15719 37967)	dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0				CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084			17.37:g.3828086C>G			A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Missense_Mutation	SNP	pfam_ATPase_P-typ_cation-transptr_C	p.G216R	ENST00000352011.3	37	c.646	CCDS11041.1	17	400	0.18315018315018314	5	0.01016260162601626	73	0.20165745856353592	241	0.42132867132867136	81	0.10686015831134564	C	11.71	1.719493	0.30503	.	.	ENSG00000074370	ENST00000397039	T	0.65549	-0.16	3.84	2.85	0.33270	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.36784	P	0.11548999999999998	.	.	.	.	.	.	T	0.35943	-0.9768	5	0.87932	D	0	.	9.4742	0.38862	0.0:0.7843:0.2157:0.0	rs1043246;rs3169619;rs17846888	.	.	.	R	216	ENSP00000380232:G216R	ENSP00000380232:G216R	G	-	1	0	ATP2A3	3774835	0.001000	0.12720	0.116000	0.21606	0.354000	0.29330	-0.190000	0.09615	1.191000	0.43056	0.555000	0.69702	GGG	ATP2A3	-	NULL	ENSG00000074370		0.637	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	ATP2A3	HGNC	protein_coding	OTTHUMT00000438401.1	73	0.00	0	C	NM_174953		3828086	3828086	-1	no_errors	ENST00000397039	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	0.113	G
BANP	54971	genome.wustl.edu	37	16	88110422	88110422	+	3'UTR	SNP	C	C	G	rs7499959	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr16:88110422C>G	ENST00000393207.1	+	0	1936				BANP_ENST00000355163.5_3'UTR|BANP_ENST00000538234.1_3'UTR|BANP_ENST00000481948.1_3'UTR|BANP_ENST00000393208.2_3'UTR|BANP_ENST00000286122.7_3'UTR|RP11-863P13.5_ENST00000568267.1_lincRNA|BANP_ENST00000355022.4_3'UTR	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein						cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		AGCATCCTATCAACTGAAAGA	0.672													C|||	1056	0.210863	0.025	0.2406	5008	,	,		11528	0.2798		0.2962	False		,,,				2504	0.2822					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.*155C>G	16.37:g.88110422C>G			A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	RNA	SNP	-	NULL	ENST00000393207.1	37	NULL	CCDS54054.1	16																																																																																			BANP	-	-	ENSG00000172530		0.672	BANP-002	KNOWN	basic|CCDS	protein_coding	BANP	HGNC	protein_coding	OTTHUMT00000269166.1	16	0.00	0	C	NM_017869		88110422	88110422	+1	no_errors	ENST00000481948	ensembl	human	known	69_37n	rna	12	29.41	5	SNP	0.000	G
BRD3	8019	genome.wustl.edu	37	9	136898627	136898627	+	3'UTR	SNP	A	A	G	rs433402	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr9:136898627A>G	ENST00000303407.7	-	0	2451				LINC00094_ENST00000605164.1_RNA|LINC00094_ENST00000603928.1_RNA|BRD3_ENST00000473349.1_5'UTR	NM_007371.3	NP_031397.1	Q15059	BRD3_HUMAN	bromodomain containing 3						chromatin modification (GO:0016568)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)		BRD3/C15orf55(3)	kidney(1)|skin(1)|stomach(4)	6				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		ACCATGGAACAGAAGTAGTAA	0.458			T	C15orf55	lethal midline carcinoma of young people								A|||	1724	0.344249	0.084	0.2738	5008	,	,		21276	0.6458		0.2972	False		,,,				2504	0.4836					dbGAP		Dom	yes		9	9q34	8019	bromodomain containing 3		E	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS6980.1	9q34	2010-12-23	2002-01-14		ENSG00000169925	ENSG00000169925			1104	protein-coding gene	gene with protein product	"""RING3-like"""	601541	"""bromodomain-containing 3"""			7584044, 8781126	Standard	NM_007371		Approved	RING3L, ORFX, KIAA0043	uc004cew.3	Q15059	OTTHUMG00000021004	ENST00000303407.7:c.*85T>C	9.37:g.136898627A>G			B1APD9|Q4G5Y3|Q5T1R7|Q8N5M3|Q92645	RNA	SNP	-	NULL	ENST00000303407.7	37	NULL	CCDS6980.1	9																																																																																			BRD3	-	-	ENSG00000169925		0.458	BRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD3	HGNC	protein_coding	OTTHUMT00000055390.4	44	0.00	0	A	NM_007371		136898627	136898627	-1	no_errors	ENST00000473349	ensembl	human	known	69_37n	rna	21	19.23	5	SNP	0.001	G
BST1	683	genome.wustl.edu	37	4	15739416	15739416	+	IGR	SNP	G	G	C	rs3900588	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr4:15739416G>C								BST1 (5006 upstream) : CD38 (40484 downstream)																							ACAGGAAACTGTGGGAACCAT	0.493													G|||	480	0.0958466	0.1657	0.0778	5008	,	,		21958	0.0536		0.1282	False		,,,				2504	0.0245					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															4.37:g.15739416G>C				Missense_Mutation	SNP	pfam_ADP-ribosyl_cyclase	p.C94S		37	c.281		4	223	0.1021062271062271	70	0.14227642276422764	34	0.09392265193370165	22	0.038461538461538464	97	0.1279683377308707	G	0.561	-0.845345	0.02671	.	.	ENSG00000109743	ENST00000514989	.	.	.	2.68	0.933	0.19471	.	.	.	.	.	T	0.00241	0.0007	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.13176	-1.0519	3	.	.	.	.	4.9422	0.13971	0.2874:0.0:0.7126:0.0	rs3900588;rs3900588	.	.	.	S	94	.	.	C	+	2	0	BST1	15348514	0.001000	0.12720	0.001000	0.08648	0.014000	0.08584	0.724000	0.25954	0.219000	0.20840	-0.471000	0.05019	TGT	BST1	-	NULL	ENSG00000109743	0	0.493					BST1	HGNC			62	0.00	0	G			15739416	15739416	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000514989	ensembl	human	putative	69_37n	missense	48	11.11	6	SNP	0.001	C
ELMSAN1	91748	genome.wustl.edu	37	14	74196792	74196792	+	Intron	SNP	T	T	C	rs8019058	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr14:74196792T>C	ENST00000286523.5	-	4	2532				ELMSAN1_ENST00000394071.2_Intron	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										TTAGTCTGCCTACCACACCCA	0.493													C|||	3030	0.605032	0.649	0.4568	5008	,	,		16526	0.8313		0.3917	False		,,,				2504	0.637					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.1750-104A>G	14.37:g.74196792T>C			Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	NULL	p.R436G	ENST00000286523.5	37	c.1306	CCDS9819.1	14																																																																																			C14orf43	-	NULL	ENSG00000156030		0.493	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf43	HGNC	protein_coding	OTTHUMT00000317793.1	40	0.00	0	T	NM_194278		74196792	74196792	-1	no_start_codon	ENST00000451078	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	0.000	C
C16orf95	100506581	genome.wustl.edu	37	16	87350773	87350773	+	Missense_Mutation	SNP	C	C	A	rs3748393	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr16:87350773C>A	ENST00000253461.4	-	1	249	c.76G>T	c.(76-78)Gct>Tct	p.A26S	C16orf95_ENST00000567970.1_Missense_Mutation_p.A26S|RP11-178L8.4_ENST00000568879.1_Intron|snoU13_ENST00000459533.1_RNA|RP11-178L8.7_ENST00000602282.1_RNA	NM_001195125.1|NM_001256917.1	NP_001182054.1|NP_001243846.1	Q9H693	CP095_HUMAN	chromosome 16 open reading frame 95	26																	ccggcAGCAGCGCCTGAGGCT	0.692													C|||	2101	0.419529	0.236	0.4395	5008	,	,		13742	0.6339		0.334	False		,,,				2504	0.5204					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS54049.1, CCDS58491.1, CCDS73921.1	16q24.2	2012-10-10			ENSG00000260456	ENSG00000260456			40033	protein-coding gene	gene with protein product							Standard	NM_001195124		Approved		uc021tmh.1	Q9H693	OTTHUMG00000175680	ENST00000253461.4:c.76G>T	16.37:g.87350773C>A	ENSP00000253461:p.Ala26Ser			Missense_Mutation	SNP	NULL	p.A26S	ENST00000253461.4	37	c.76	CCDS54049.1	16	877	0.4015567765567766	109	0.22154471544715448	160	0.4419889502762431	350	0.6118881118881119	258	0.3403693931398417	C	13.48	2.250221	0.39797	.	.	ENSG00000131152	ENST00000253461	.	.	.	2.52	-3.2	0.05156	.	.	.	.	.	T	0.00012	0.0000	N	0.19112	0.55	0.22468	P	0.999073	B	0.33583	0.418	B	0.24155	0.051	T	0.42413	-0.9453	7	0.87932	D	0	.	3.1421	0.06460	0.1949:0.4119:0.0:0.3932	rs3748393;rs3748393	26	Q9H693	CP095_HUMAN	S	26	.	ENSP00000253461:A26S	A	-	1	0	C16orf95	85908274	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-1.225000	0.02956	-0.788000	0.04504	-0.291000	0.09656	GCT	C16orf95	-	NULL	ENSG00000260456		0.692	C16orf95-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	C16orf95	Clone_based_vega_gene	protein_coding	OTTHUMT00000430790.1	84	0.00	0	C	NM_001195124		87350773	87350773	-1	no_errors	ENST00000567970	ensembl	human	known	69_37n	missense	56	23.29	17	SNP	0.001	A
C1QTNF6	114904	genome.wustl.edu	37	22	37576362	37576362	+	3'UTR	SNP	G	G	A	rs8279	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr22:37576362G>A	ENST00000337843.2	-	0	2778				RP1-151B14.6_ENST00000419128.1_RNA|C1QTNF6_ENST00000397110.2_3'UTR|C1QTNF6_ENST00000470655.1_5'UTR	NM_031910.3	NP_114116.3	Q9BXI9	C1QT6_HUMAN	C1q and tumor necrosis factor related protein 6						protein heterotrimerization (GO:0070208)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(1)|large_intestine(2)|lung(6)|stomach(1)|upper_aerodigestive_tract(1)	11						CGGCTCCTCGGCTGTGAGCAC	0.652													G|||	340	0.0678914	0.0136	0.1167	5008	,	,		17049	0.0		0.2018	False		,,,				2504	0.0389					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF329842	CCDS13943.1	22q13.1	2014-02-21			ENSG00000133466	ENSG00000133466			14343	protein-coding gene	gene with protein product		614910				12975309	Standard	NM_031910		Approved	CTRP6, ZACRP6	uc003aqy.1	Q9BXI9	OTTHUMG00000150538	ENST00000337843.2:c.*1866C>T	22.37:g.37576362G>A			Q5H9G8|Q6ZRM7	RNA	SNP	-	NULL	ENST00000337843.2	37	NULL	CCDS13943.1	22																																																																																			C1QTNF6	-	-	ENSG00000133466		0.652	C1QTNF6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QTNF6	HGNC	protein_coding	OTTHUMT00000318807.1	54	0.00	0	G	NM_182486		37576362	37576362	-1	no_errors	ENST00000470655	ensembl	human	known	69_37n	rna	50	13.79	8	SNP	0.009	A
C1QTNF9B	387911	genome.wustl.edu	37	13	24471039	24471039	+	Silent	SNP	T	T	G	rs66990269	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr13:24471039T>G	ENST00000382140.2	-	3	147	c.87A>C	c.(85-87)ggA>ggC	p.G29G	C1QTNF9B-AS1_ENST00000417034.1_RNA|C1QTNF9B_ENST00000556521.1_5'UTR|C1QTNF9B_ENST00000382145.1_Silent_p.G29G|C1QTNF9B_ENST00000382137.3_Silent_p.G29G|C1QTNF9B_ENST00000382057.3_Silent_p.G29G			B2RNN3	C1T9B_HUMAN	C1q and tumor necrosis factor related protein 9B	29	Collagen-like 1.					collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|large_intestine(3)|lung(1)	6						TCCCAGGGATTCCAGGGTGCC	0.562																																						dbGAP											0													107.0	103.0	104.0					13																	24471039		2202	4280	6482	-	-	-	SO:0001819	synonymous_variant	0			BC110413	CCDS31947.1	13q12.12	2011-05-08			ENSG00000205863	ENSG00000205863			34072	protein-coding gene	gene with protein product		614148				17544811	Standard	NM_001007537		Approved	CTRP9B	uc010tcv.1	B2RNN3	OTTHUMG00000016570	ENST00000382140.2:c.87A>C	13.37:g.24471039T>G			A2A3T6|B9EH31|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	Silent	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.G29	ENST00000382140.2	37	c.87	CCDS31947.1	13																																																																																			C1QTNF9B	-	pfam_Collagen	ENSG00000205863		0.562	C1QTNF9B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	C1QTNF9B	HGNC	protein_coding	OTTHUMT00000044162.3	88	0.00	0	T	NM_001007537		24471039	24471039	-1	no_errors	ENST00000382137	ensembl	human	known	69_37n	silent	58	15.94	11	SNP	1.000	G
C1orf220	400798	genome.wustl.edu	37	1	178514165	178514165	+	Splice_Site	SNP	C	C	T	rs12141152	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:178514165C>T	ENST00000319387.2	+	1	108		c.e1+2		C1orf220_ENST00000367638.1_Splice_Site|C1orf220_ENST00000521244.1_Intron|C1ORF220_ENST00000367636.4_Intron			Q5T0J3	CA220_HUMAN	chromosome 1 open reading frame 220											lung(1)	1						GGGTTCCAGGCGAGATGAGAC	0.493													C|||	1414	0.282348	0.0575	0.2738	5008	,	,		17705	0.4345		0.3509	False		,,,				2504	0.365					dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0					1q25.2	2013-01-15			ENSG00000213057	ENSG00000213057			33805	protein-coding gene	gene with protein product							Standard	NR_033186		Approved	FLJ35530	uc001glx.1	Q5T0J3	OTTHUMG00000035078	ENST00000319387.2:c.108+2C>T	1.37:g.178514165C>T			B2RN72|Q8NAD3	Splice_Site	SNP	-	e1+2	ENST00000319387.2	37	c.108+2		1	654	0.29945054945054944	31	0.06300813008130081	108	0.2983425414364641	237	0.4143356643356643	278	0.36675461741424803	C	2.923	-0.222825	0.06061	.	.	ENSG00000213057	ENST00000367638;ENST00000319387	.	.	.	3.71	1.39	0.22231	.	.	.	.	.	.	.	.	.	.	.	0.51767	P	6.099999999997774E-5	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.9121	0.05740	0.2162:0.1195:0.0:0.6643	rs12141152	.	.	.	.	-1	.	.	.	+	.	.	C1orf220	176780788	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.067000	0.11579	0.287000	0.22375	-1.263000	0.01449	.	C1orf220	-	-	ENSG00000213057		0.493	C1orf220-201	KNOWN	basic|appris_principal	protein_coding	C1orf220	HGNC	protein_coding	OTTHUMT00000098176.1	25	0.00	0	C	NR_033186	Intron	178514165	178514165	+1	no_errors	ENST00000319387	ensembl	human	known	69_37n	splice_site	28	12.50	4	SNP	0.000	T
SSUH2	51066	genome.wustl.edu	37	3	8757377	8757377	+	5'UTR	SNP	A	A	G	rs62242588	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:8757377A>G	ENST00000478513.1	-	0	530							Q9Y2M2	SSUH2_HUMAN	ssu-2 homolog (C. elegans)							cytoplasm (GO:0005737)											GAGCCCGTGCATTCAACAAAG	0.448													A|||	350	0.0698882	0.031	0.1081	5008	,	,		22536	0.0		0.169	False		,,,				2504	0.0654					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AB024705	CCDS2568.1, CCDS58815.1	3p25.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000125046	ENSG00000125046			24809	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 32"""	C3orf32		20205943	Standard	NM_001256748		Approved	fls485, ssu-2	uc011atg.3	Q9Y2M2	OTTHUMG00000122075	ENST00000478513.1:c.-655T>C	3.37:g.8757377A>G			A6NFA9|B3KS84|B7Z6E3|F5H2S5|Q7Z7K4	RNA	SNP	-	NULL	ENST00000478513.1	37	NULL		3																																																																																			C3orf32	-	-	ENSG00000125046		0.448	SSUH2-016	KNOWN	basic	processed_transcript	C3orf32	HGNC	protein_coding	OTTHUMT00000338028.1	25	0.00	0	A	NM_015931		8757377	8757377	-1	no_errors	ENST00000478513	ensembl	human	known	69_37n	rna	21	22.22	6	SNP	0.000	G
GCSAM	257144	genome.wustl.edu	37	3	111849182	111849182	+	Intron	SNP	C	C	G	rs115303483	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:111849182C>G	ENST00000308910.4	-	2	283				C3orf52_ENST00000467942.2_3'UTR|GCSAM_ENST00000484193.1_Intron	NM_001190259.1|NM_001190260.1|NM_152785.4	NP_001177188.1|NP_001177189.1|NP_689998.1	Q8N6F7	GCSAM_HUMAN	germinal center-associated, signaling and motility						negative regulation of lymphocyte migration (GO:2000402)|regulation of B cell receptor signaling pathway (GO:0050855)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|myosin II binding (GO:0045159)|protein kinase binding (GO:0019901)										ATTGCAACTGCTACTGGTCTA	0.443													.|||	63	0.0125799	0.0477	0.0	5008	,	,		20478	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC030506	CCDS2964.1, CCDS54621.1, CCDS54622.1	3q13.13	2012-09-03	2012-08-23	2012-08-23	ENSG00000174500	ENSG00000174500			20253	protein-coding gene	gene with protein product	"""human germinal center-associated lymphoma"""	607792	"""germinal center expressed transcript 2"""	GCET2			Standard	NM_152785		Approved	MGC40441, HGAL	uc021xcl.1	Q8N6F7	OTTHUMG00000159231	ENST00000308910.4:c.98+109G>C	3.37:g.111849182C>G			C9JD17|C9JUG6	RNA	SNP	-	NULL	ENST00000308910.4	37	NULL	CCDS2964.1	3																																																																																			C3orf52	-	-	ENSG00000114529		0.443	GCSAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C3orf52	HGNC	protein_coding	OTTHUMT00000353967.2	37	0.00	0	C	NM_152785		111849182	111849182	+1	no_errors	ENST00000467942	ensembl	human	known	69_37n	rna	38	11.63	5	SNP	0.000	G
C5orf27	202299	genome.wustl.edu	37	5	95194571	95194571	+	Silent	SNP	T	T	C	rs13168014	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr5:95194571T>C	ENST00000436592.1	+	4	786	c.138T>C	c.(136-138)ctT>ctC	p.L46L	AC008592.5_ENST00000503091.1_RNA|C5orf27_ENST00000357880.3_Silent_p.L46L					chromosome 5 open reading frame 27																		CGCAGCCACTTCAGGCTGCTG	0.592											OREG0016708	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	3012	0.601438	0.3918	0.5548	5008	,	,		19916	0.9425		0.5427	False		,,,				2504	0.6268					dbGAP											0													54.0	45.0	48.0					5																	95194571		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AY168789		5q15	2014-04-16			ENSG00000236882	ENSG00000236882			24687	other	unknown							Standard	NR_026936		Approved	FLJ38821, FIS	uc003klp.3	Q52M75	OTTHUMG00000122084	ENST00000436592.1:c.138T>C	5.37:g.95194571T>C		1311		Silent	SNP	NULL	p.L46	ENST00000436592.1	37	c.138		5																																																																																			C5orf27	-	NULL	ENSG00000236882		0.592	C5orf27-001	KNOWN	basic|appris_principal	protein_coding	C5orf27	HGNC	protein_coding	OTTHUMT00000242845.3	43	0.00	0	T	NM_175616		95194571	95194571	+1	no_errors	ENST00000357880	ensembl	human	known	69_37n	silent	27	12.90	4	SNP	0.000	C
FAM167A	83648	genome.wustl.edu	37	8	11296049	11296049	+	Intron	SNP	T	T	A	rs3021518	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr8:11296049T>A	ENST00000528897.1	-	2	1001				FAM167A_ENST00000284486.4_Intron|C8orf12_ENST00000533578.1_Nonstop_Mutation_p.*105K|C8orf12_ENST00000284481.3_Nonstop_Mutation_p.*105K|FAM167A_ENST00000531564.1_Intron|FAM167A_ENST00000534308.1_Intron			Q96KS9	F167A_HUMAN	family with sequence similarity 167, member A											breast(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)	9						GGTCTTTCAATAATGtctttc	0.343													T|||	397	0.0792732	0.034	0.1124	5008	,	,		18991	0.0		0.2107	False		,,,				2504	0.0634					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS5981.1	8p23-p22	2010-08-27	2008-06-11	2008-06-11	ENSG00000154319	ENSG00000154319			15549	protein-coding gene	gene with protein product		610085	"""chromosome 8 open reading frame 13"""	C8orf13			Standard	NM_053279		Approved		uc003wtw.2	Q96KS9	OTTHUMG00000129361	ENST00000528897.1:c.381+5490A>T	8.37:g.11296049T>A			A8K3T9|Q3SXY1|Q3SXY3|Q8N3M3|Q9NSR0	Nonstop_Mutation	SNP	NULL	p.*105K	ENST00000528897.1	37	c.313	CCDS5981.1	8	233	0.10668498168498168	18	0.036585365853658534	48	0.13259668508287292	0	0.0	167	0.22031662269129287	T	0.513	-0.865649	0.02590	.	.	ENSG00000184608	ENST00000284481;ENST00000533578	.	.	.	2.37	-3.45	0.04781	.	.	.	.	.	.	.	.	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.3326	0.04239	0.4068:0.278:0.0:0.3152	rs3021518;rs52828677;rs3021518	.	.	.	K	105	.	.	X	+	1	0	C8orf12	11333459	0.001000	0.12720	0.000000	0.03702	0.027000	0.11550	0.398000	0.20899	-0.868000	0.04058	-0.250000	0.11733	TAA	C8orf12	-	NULL	ENSG00000184608		0.343	FAM167A-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	C8orf12	HGNC	protein_coding	OTTHUMT00000383901.1	110	0.00	0	T			11296049	11296049	+1	no_errors	ENST00000284481	ensembl	human	known	69_37n	nonstop	69	11.54	9	SNP	0.000	A
GATA4	2626	genome.wustl.edu	37	8	11619397	11619397	+	IGR	SNP	G	G	A	rs36018280	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr8:11619397G>A	ENST00000335135.4	+	0	3414				C8orf49_ENST00000525043.2_Missense_Mutation_p.V159I	NM_002052.3	NP_002043.2	P43694	GATA4_HUMAN	GATA binding protein 4						atrial septum morphogenesis (GO:0060413)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac ventricle morphogenesis (GO:0003208)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to glucose stimulus (GO:0071333)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion development (GO:0003197)|endoderm development (GO:0007492)|endoderm formation (GO:0001706)|epithelial cell fate commitment (GO:0072148)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|lung lobe formation (GO:0060464)|male gonad development (GO:0008584)|negative regulation of autophagy (GO:0010507)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to mechanical stimulus (GO:0009612)|seminiferous tubule development (GO:0072520)|Sertoli cell differentiation (GO:0060008)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(10)	13	all_epithelial(15;0.0839)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)		ACAAGTATGCGTCATGCCTGC	0.502													G|||	588	0.117412	0.0408	0.1499	5008	,	,		19804	0.002		0.2326	False		,,,				2504	0.1984					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AK097060	CCDS5983.1	8p23.1-p22	2013-01-25	2001-11-28		ENSG00000136574	ENSG00000136574		"""GATA zinc finger domain containing"""	4173	protein-coding gene	gene with protein product		600576	"""GATA-binding protein 4"""			7665171	Standard	NM_002052		Approved		uc003wuc.2	P43694	OTTHUMG00000090800		8.37:g.11619397G>A			B7ZKX0|B7ZKZ4|Q3MJ45|Q5IFM8	Missense_Mutation	SNP	NULL	p.V159I	ENST00000335135.4	37	c.475	CCDS5983.1	8	274	0.12545787545787546	22	0.044715447154471545	60	0.16574585635359115	0	0.0	192	0.2532981530343008	G	1.250	-0.618886	0.03663	.	.	ENSG00000255394	ENST00000525043	T	0.22336	1.96	1.91	-3.83	0.04269	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.06786	0.001	B	0.08055	0.003	T	0.45293	-0.9271	7	0.16420	T	0.52	.	4.5307	0.12004	0.2376:0.4337:0.3287:0.0	rs36018280	159	E9PQH1	.	I	159	ENSP00000436777:V159I	ENSP00000436777:V159I	V	+	1	0	C8orf49	11656806	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.186000	0.16978	-1.231000	0.02557	0.313000	0.20887	GTC	C8orf49	-	NULL	ENSG00000255394		0.502	GATA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C8orf49	HGNC	protein_coding	OTTHUMT00000207587.2	78	0.00	0	G	NM_002052		11619397	11619397	+1	no_errors	ENST00000525043	ensembl	human	known	69_37n	missense	47	24.19	15	SNP	0.000	A
C9orf66	157983	genome.wustl.edu	37	9	214604	214604	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr9:214604G>T	ENST00000382387.2	-	1	1289	c.793C>A	c.(793-795)Cat>Aat	p.H265N	DOCK8_ENST00000432829.2_5'Flank|DOCK8_ENST00000453981.1_5'Flank	NM_152569.2	NP_689782.2	Q5T8R8	CI066_HUMAN	chromosome 9 open reading frame 66	265										central_nervous_system(1)|cervix(1)|kidney(1)|skin(1)	4	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		TCGGGCAGATGGAGCTTCCGG	0.697																																						dbGAP											0													24.0	25.0	25.0					9																	214604		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055720	CCDS6439.1	9p24.3	2008-02-05			ENSG00000183784	ENSG00000183784			26436	protein-coding gene	gene with protein product							Standard	NM_152569		Approved	FLJ31158	uc003zge.4	Q5T8R8	OTTHUMG00000021017	ENST00000382387.2:c.793C>A	9.37:g.214604G>T	ENSP00000371824:p.His265Asn		Q96NB0	Missense_Mutation	SNP	NULL	p.H265N	ENST00000382387.2	37	c.793	CCDS6439.1	9	.	.	.	.	.	.	.	.	.	.	.	9.046	0.990785	0.18966	.	.	ENSG00000183784	ENST00000382387	T	0.26373	1.74	3.7	3.7	0.42460	.	.	.	.	.	T	0.16896	0.0406	N	0.08118	0	0.24151	N	0.995697	D	0.54047	0.964	P	0.45099	0.469	T	0.08126	-1.0737	9	0.87932	D	0	.	11.6595	0.51339	0.0:0.0:1.0:0.0	.	265	Q5T8R8	CI066_HUMAN	N	265	ENSP00000371824:H265N	ENSP00000371824:H265N	H	-	1	0	C9orf66	204604	0.987000	0.35691	0.997000	0.53966	0.139000	0.21198	0.924000	0.28777	1.994000	0.58287	0.484000	0.47621	CAT	C9orf66	-	NULL	ENSG00000183784		0.697	C9orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf66	HGNC	protein_coding	OTTHUMT00000055436.1	32	0.00	0	G	NM_152569		214604	214604	-1	no_errors	ENST00000382387	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.997	T
CASZ1	54897	genome.wustl.edu	37	1	10697392	10697392	+	3'UTR	SNP	C	C	T	rs72641442	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:10697392C>T	ENST00000377022.3	-	0	7204				RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1						multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GAATCAGGTACGCTCCGTGCG	0.547													C|||	266	0.053115	0.0151	0.0576	5008	,	,		15900	0.0704		0.1044	False		,,,				2504	0.0307					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.*1607G>A	1.37:g.10697392C>T			Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	RNA	SNP	-	NULL	ENST00000377022.3	37	NULL	CCDS41246.1	1																																																																																			CASZ1	-	-	ENSG00000130940		0.547	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	95	0.00	0	C	NM_017766		10697392	10697392	-1	no_errors	ENST00000478524	ensembl	human	known	69_37n	rna	70	11.39	9	SNP	0.000	T
CBWD1	55871	genome.wustl.edu	37	9	166248	166248	+	Intron	SNP	G	G	A	rs202194999	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr9:166248G>A	ENST00000356521.4	-	5	519				CBWD1_ENST00000377400.4_Intron|CBWD1_ENST00000382447.4_Intron|CBWD1_ENST00000377447.3_Intron|CBWD1_ENST00000314367.10_Intron|CBWD1_ENST00000431099.2_Intron	NM_018491.3	NP_060961.3	Q9BRT8	CBWD1_HUMAN	COBW domain containing 1								ATP binding (GO:0005524)			kidney(1)|lung(2)|ovary(1)|skin(1)	5	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		AGAGAGCAGAGCCTAAAAGCC	0.453													g|||	1251	0.2498	0.1793	0.268	5008	,	,		21000	0.3899		0.1481	False		,,,				2504	0.2924					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY343911	CCDS6438.1, CCDS47947.1, CCDS47948.1	9p24.3	2008-02-05			ENSG00000172785	ENSG00000172785			17134	protein-coding gene	gene with protein product		611078				15233989, 12421752	Standard	NM_018491		Approved		uc003zga.4	Q9BRT8	OTTHUMG00000019425	ENST00000356521.4:c.431-2211C>T	9.37:g.166248G>A			A2RU55|A8K3N3|B0AZR4|Q49AJ1|Q5VVK2|Q6VBU6|Q7Z5Z0|Q7Z652|Q9BY38|Q9NYD0	RNA	SNP	-	NULL	ENST00000356521.4	37	NULL	CCDS6438.1	9																																																																																			CBWD1	-	-	ENSG00000172785		0.453	CBWD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	CBWD1	HGNC	protein_coding	OTTHUMT00000051463.1	46	0.00	0	G	NM_018491		166248	166248	-1	no_errors	ENST00000487575	ensembl	human	known	69_37n	rna	45	13.46	7	SNP	0.025	A
CCDC17	149483	genome.wustl.edu	37	1	46086329	46086329	+	Intron	SNP	C	C	T	rs11590549	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:46086329C>T	ENST00000528266.1	-	12	1858				CCDC17_ENST00000421127.2_Intron|CCDC17_ENST00000464739.1_5'Flank|CCDC17_ENST00000343901.2_Intron|CCDC17_ENST00000445048.2_Intron			Q96LX7	CCD17_HUMAN	coiled-coil domain containing 17											kidney(1)|large_intestine(1)|lung(1)|ovary(2)	5	Acute lymphoblastic leukemia(166;0.155)					aaaggctggccgttaGCCATA	0.502													T|||	921	0.183906	0.3094	0.147	5008	,	,		18961	0.0377		0.2455	False		,,,				2504	0.1278					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS44131.1, CCDS44131.2, CCDS53314.1	1p34.1	2014-02-12			ENSG00000159588	ENSG00000159588			26574	protein-coding gene	gene with protein product							Standard	NM_001190182		Approved	FLJ33084	uc010olt.2	Q96LX7	OTTHUMG00000007822	ENST00000528266.1:c.1710+65G>A	1.37:g.46086329C>T			A1A4Y7|B4DNX7|B4E1Q5|C9J8L2|Q0P683|Q5T629	Silent	SNP	NULL	p.T560	ENST00000528266.1	37	c.1680	CCDS44131.2	1																																																																																			CCDC17	-	NULL	ENSG00000159588		0.502	CCDC17-008	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CCDC17	HGNC	protein_coding	OTTHUMT00000386833.1	32	0.00	0	C	NM_152500		46086329	46086329	-1	no_errors	ENST00000479529	ensembl	human	known	69_37n	silent	21	16.00	4	SNP	0.000	T
CCDC40	55036	genome.wustl.edu	37	17	78061979	78061979	+	Intron	SNP	A	A	C	rs12942049	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:78061979A>C	ENST00000397545.4	+	16	2738				CCDC40_ENST00000374877.3_Intron|CCDC40_ENST00000573903.1_3'UTR	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40						axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			AAGACCATGTAGGAGGCCAGG	0.473													A|||	1550	0.309505	0.1157	0.3761	5008	,	,		18105	0.2222		0.4602	False		,,,				2504	0.4591					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.2711+78A>C	17.37:g.78061979A>C			A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	RNA	SNP	-	NULL	ENST00000397545.4	37	NULL	CCDS42395.1	17																																																																																			CCDC40	-	-	ENSG00000141519		0.473	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC40	HGNC	protein_coding	OTTHUMT00000256005.2	14	0.00	0	A	XM_371082		78061979	78061979	+1	no_errors	ENST00000573903	ensembl	human	known	69_37n	rna	14	33.33	7	SNP	0.000	C
CCDC40	55036	genome.wustl.edu	37	17	78064015	78064015	+	Intron	SNP	G	G	C	rs4889953|rs375858249	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:78064015G>C	ENST00000397545.4	+	17	2859				CCDC40_ENST00000374877.3_Missense_Mutation_p.K970N|CCDC40_ENST00000573903.1_Intron	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40						axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.K970N(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			cgtgcacgaagaacacgggac	0.607													C|||	3368	0.672524	0.7095	0.5389	5008	,	,		13699	0.6052		0.6968	False		,,,				2504	0.7618					dbGAP											1	Substitution - Missense(1)	pancreas(1)																																								-	-	-	SO:0001627	intron_variant	0			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.2832+332G>C	17.37:g.78064015G>C			A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	pfam_E3_ubiquit_lig_BRE1	p.K970N	ENST00000397545.4	37	c.2910	CCDS42395.1	17	1314	0.6016483516483516	336	0.6829268292682927	169	0.46685082872928174	339	0.5926573426573427	470	0.6200527704485488	C	1.785	-0.481066	0.04383	.	.	ENSG00000141519	ENST00000374877	T	0.47869	0.83	.	.	.	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.43540	-0.9385	3	0.17369	T	0.5	.	.	.	.	rs4889953	.	.	.	N	970	ENSP00000364011:K970N	ENSP00000364011:K970N	K	+	3	2	CCDC40	75678610	0.003000	0.15002	0.003000	0.11579	0.003000	0.03518	-2.000000	0.01466	-1.966000	0.01009	-1.954000	0.00483	AAG	CCDC40	-	NULL	ENSG00000141519		0.607	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC40	HGNC	protein_coding	OTTHUMT00000256005.2	41	0.00	0	G	XM_371082		78064015	78064015	+1	no_errors	ENST00000374877	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.003	C
CCDC57	284001	genome.wustl.edu	37	17	80115447	80115447	+	Intron	SNP	G	G	A	rs8080625	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:80115447G>A	ENST00000389641.4	-	14	2278				CCDC57_ENST00000392343.3_3'UTR|CCDC57_ENST00000327026.3_5'UTR|CCDC57_ENST00000392347.1_Intron|RP11-1376P16.2_ENST00000579979.1_RNA|RP11-1376P16.1_ENST00000582774.1_RNA			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			GGAAGAAGGCGGAGGAATGGG	0.652													G|||	2932	0.585463	0.4614	0.6268	5008	,	,		18172	0.8641		0.4831	False		,,,				2504	0.5419					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.2241+176C>T	17.37:g.80115447G>A			A6NP51|A8MQC7|Q8IWG2|Q8TER3	RNA	SNP	-	NULL	ENST00000389641.4	37	NULL		17																																																																																			CCDC57	-	-	ENSG00000176155		0.652	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC57	HGNC	protein_coding	OTTHUMT00000277182.3	21	0.00	0	G	NM_198082		80115447	80115447	-1	no_errors	ENST00000327026	ensembl	human	known	69_37n	rna	27	22.86	8	SNP	0.000	A
CCNYL2	414194	genome.wustl.edu	37	10	42905431	42905431	+	RNA	SNP	A	A	T	rs3004228	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr10:42905431A>T	ENST00000483242.3	-	0	1495					NR_103829.1		Q5T2Q4	CCYL2_HUMAN	cyclin Y-like 2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					breast(2)|endometrium(1)|lung(3)|ovary(1)	7						TTTCTTCTTTAGAAAATACCA	0.373													N|||	4320	0.86262	0.9244	0.8761	5008	,	,		18166	0.8433		0.825	False		,,,				2504	0.8282					dbGAP											0																																										-	-	-			0			BC039000		10q11.21	2007-02-09	2007-02-09	2007-02-09	ENSG00000182632	ENSG00000182632			23495	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 21"""	C10orf21			Standard	NR_103829		Approved	bA178A10.2		Q5T2Q4	OTTHUMG00000018009		10.37:g.42905431A>T				RNA	SNP	-	NULL	ENST00000483242.3	37	NULL		10																																																																																			CCNYL2	-	-	ENSG00000182632		0.373	CCNYL2-002	KNOWN	basic	processed_transcript	CCNYL2	HGNC	pseudogene	OTTHUMT00000047670.5	37	0.00	0	A	XM_936368		42905431	42905431	-1	no_errors	ENST00000472090	ensembl	human	known	69_37n	rna	41	16.00	8	SNP	0.000	T
CCNYL2	414194	genome.wustl.edu	37	10	42920884	42920884	+	RNA	SNP	C	C	T	rs2489720	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr10:42920884C>T	ENST00000483242.3	-	0	836					NR_103829.1		Q5T2Q4	CCYL2_HUMAN	cyclin Y-like 2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					breast(2)|endometrium(1)|lung(3)|ovary(1)	7						AACCTCTTTTCGCTGAAAGAA	0.383													c|||	1766	0.352636	0.292	0.304	5008	,	,		17782	0.2629		0.3787	False		,,,				2504	0.5348					dbGAP											0																																										-	-	-			0			BC039000		10q11.21	2007-02-09	2007-02-09	2007-02-09	ENSG00000182632	ENSG00000182632			23495	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 21"""	C10orf21			Standard	NR_103829		Approved	bA178A10.2		Q5T2Q4	OTTHUMG00000018009		10.37:g.42920884C>T				Missense_Mutation	SNP	pfam_Cyclin_PHO80-like,pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_Y	p.R176Q	ENST00000483242.3	37	c.527		10	715|715	0.3273809523809524|0.3273809523809524	144|144	0.2926829268292683|0.2926829268292683	113|113	0.31215469613259667|0.31215469613259667	173|173	0.30244755244755245|0.30244755244755245	285|285	0.3759894459102902|0.3759894459102902	.|.	0.988|0.988	-0.695012|-0.695012	0.03303|0.03303	.|.	.|.	ENSG00000182632|ENSG00000182632	ENST00000431603|ENST00000426433	.|.	.|.	.|.	2.03|2.03	0.1|0.1	0.14510|0.14510	.|.	.|0.198010	.|0.41001	.|N	.|0.000961	T|T	0.00012|0.00012	0.0000|0.0000	.|.	.|.	.|.	0.25820|0.25820	P|P	0.9842976|0.9842976	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.43861|0.43861	-0.9365|-0.9365	3|5	.|0.23302	.|T	.|0.38	.|.	4.4205|4.4205	0.11477|0.11477	0.0:0.6391:0.0:0.3609|0.0:0.6391:0.0:0.3609	rs2489720;rs17153991;rs56511297;rs2489720|rs2489720;rs17153991;rs56511297;rs2489720	.|.	.|.	.|.	K|Q	102|176	.|.	.|ENSP00000395902:R176Q	E|R	-|-	1|2	0|0	CCNYL2|CCNYL2	42240890|42240890	1.000000|1.000000	0.71417|0.71417	0.815000|0.815000	0.32552|0.32552	0.034000|0.034000	0.12701|0.12701	1.451000|1.451000	0.35145|0.35145	0.026000|0.026000	0.15269|0.15269	-0.708000|-0.708000	0.03648|0.03648	GAA|CGA	CCNYL2	-	pirsf_Cyclin_Y	ENSG00000182632		0.383	CCNYL2-002	KNOWN	basic	processed_transcript	CCNYL2	HGNC	pseudogene	OTTHUMT00000047670.5	72	0.00	0	C	XM_936368		42920884	42920884	-1	no_errors	ENST00000426433	ensembl	human	known	69_37n	missense	44	10.20	5	SNP	0.986	T
CD53	963	genome.wustl.edu	37	1	111415841	111415841	+	5'UTR	SNP	G	G	A	rs1494324	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:111415841G>A	ENST00000271324.5	+	0	66				CD53_ENST00000429072.2_5'UTR	NM_000560.3|NM_001040033.1	NP_000551.1|NP_001035122.1	P19397	CD53_HUMAN	CD53 molecule						positive regulation of myoblast fusion (GO:1901741)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)	17		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)		AAATTCTGCCGAAAGGACTGA	0.463													T|||	1279	0.255391	0.0711	0.2954	5008	,	,		20005	0.3323		0.2734	False		,,,				2504	0.3783					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			BC040693	CCDS829.1	1p13	2013-02-14	2006-03-28		ENSG00000143119	ENSG00000143119		"""CD molecules"", ""Tetraspanins"""	1686	protein-coding gene	gene with protein product		151525	"""CD53 antigen"""	MOX44		8319976	Standard	XM_006711053		Approved	TSPAN25	uc001dzw.3	P19397	OTTHUMG00000048020	ENST00000271324.5:c.-47G>A	1.37:g.111415841G>A			B2R905|Q5U0D6	RNA	SNP	-	NULL	ENST00000271324.5	37	NULL	CCDS829.1	1																																																																																			CD53	-	-	ENSG00000143119		0.463	CD53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD53	HGNC	protein_coding	OTTHUMT00000032931.1	124	0.00	0	G	NM_000560		111415841	111415841	+1	no_errors	ENST00000468160	ensembl	human	known	69_37n	rna	109	11.38	14	SNP	0.024	A
CDC27	996	genome.wustl.edu	37	17	45214685	45214685	+	Silent	SNP	T	T	C	rs11570543	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:45214685T>C	ENST00000066544.3	-	14	1839	c.1746A>G	c.(1744-1746)gaA>gaG	p.E582E	CDC27_ENST00000531206.1_Silent_p.E588E|CDC27_ENST00000446365.2_Silent_p.E521E|CDC27_ENST00000527547.1_Silent_p.E581E	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	582					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						CAATATCATGTTCCCGTTGCA	0.363													T|||	292	0.0583067	0.1127	0.0576	5008	,	,		19515	0.0089		0.0636	False		,,,				2504	0.0307					dbGAP											0													55.0	58.0	57.0					17																	45214685		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1746A>G	17.37:g.45214685T>C			G3V1C4|Q16349|Q96F35	Silent	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E588	ENST00000066544.3	37	c.1764	CCDS11509.1	17																																																																																			CDC27	-	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000004897		0.363	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	HGNC	protein_coding	OTTHUMT00000389742.2	29	0.00	0	T			45214685	45214685	-1	no_errors	ENST00000531206	ensembl	human	known	69_37n	silent	20	13.04	3	SNP	1.000	C
CDC27	996	genome.wustl.edu	37	17	45234725	45234725	+	Silent	SNP	T	T	C			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:45234725T>C	ENST00000066544.3	-	6	594	c.501A>G	c.(499-501)acA>acG	p.T167T	CDC27_ENST00000531206.1_Silent_p.T167T|CDC27_ENST00000446365.2_Silent_p.T106T|CDC27_ENST00000528748.1_5'UTR|CDC27_ENST00000527547.1_Silent_p.T167T	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	167					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.T167T(7)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGAATTTAAATGTTTGGTCAG	0.368																																						dbGAP											7	Substitution - coding silent(7)	large_intestine(4)|prostate(3)											74.0	74.0	74.0					17																	45234725		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.501A>G	17.37:g.45234725T>C			G3V1C4|Q16349|Q96F35	Silent	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.T167	ENST00000066544.3	37	c.501	CCDS11509.1	17																																																																																			CDC27	-	NULL	ENSG00000004897		0.368	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	HGNC	protein_coding	OTTHUMT00000389742.2	43	0.00	0	T			45234725	45234725	-1	no_errors	ENST00000531206	ensembl	human	known	69_37n	silent	32	27.27	12	SNP	0.999	C
CES1P1	51716	genome.wustl.edu	37	16	55806311	55806311	+	RNA	SNP	G	G	T	rs28538364	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr16:55806311G>T	ENST00000571348.1	+	0	613					NR_003276.2		Q9UKY3	CES1P_HUMAN	carboxylesterase 1 pseudogene 1						anatomical structure morphogenesis (GO:0009653)|metabolic process (GO:0008152)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)										CGGGGAACTGGGGTCACCTGG	0.577													.|||	2133	0.425919	0.2927	0.5908	5008	,	,		14336	0.25		0.6948	False		,,,				2504	0.3937					dbGAP											0																																										-	-	-			0			AF106005		16q12.2	2013-07-10	2010-10-12	2010-10-12	ENSG00000228695	ENSG00000228695			18546	pseudogene	pseudogene			"""carboxylesterase 4-like"", ""carboxylesterase 4, pseudogene"""	CES4		10452915, 20931200	Standard	NR_003276		Approved	PCE-3, CESR, CES1A3	uc010cce.3	Q9UKY3	OTTHUMG00000154668		16.37:g.55806311G>T			A2RRL8|B9ZVS2	RNA	SNP	-	NULL	ENST00000571348.1	37	NULL		16																																																																																			CES1P1	-	-	ENSG00000228695		0.577	CES1P1-003	KNOWN	basic	processed_transcript	CES1P1	HGNC	pseudogene	OTTHUMT00000440035.1	28	0.00	0	G	NR_003276		55806311	55806311	+1	no_errors	ENST00000571348	ensembl	human	known	69_37n	rna	2	75.00	6	SNP	1.000	T
CDH1	999	genome.wustl.edu	37	16	68842647	68842647	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr16:68842647C>T	ENST00000261769.5	+	5	774	c.583C>T	c.(583-585)Caa>Taa	p.Q195*	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Nonsense_Mutation_p.Q195*	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	195	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(2)|p.Q195K(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CATCACTGGCCAAGGAGCTGA	0.423			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	3	Unknown(2)|Substitution - Missense(1)	breast(3)											62.0	60.0	61.0					16																	68842647		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.583C>T	16.37:g.68842647C>T	ENSP00000261769:p.Gln195*		A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q195*	ENST00000261769.5	37	c.583	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	C	15.70	2.912197	0.52439	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	5.78	4.82	0.62117	.	0.277844	0.25701	N	0.028874	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	11.8395	0.52346	0.1272:0.7262:0.1466:0.0	.	.	.	.	X	195	.	ENSP00000261769:Q195X	Q	+	1	0	CDH1	67400148	0.847000	0.29606	1.000000	0.80357	0.832000	0.47134	2.320000	0.43797	1.572000	0.49736	0.655000	0.94253	CAA	CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000039068		0.423	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	24	0.00	0	C	NM_004360		68842647	68842647	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	14	48.15	13	SNP	1.000	T
CHST10	9486	genome.wustl.edu	37	2	101031561	101031561	+	5'UTR	SNP	G	G	T	rs3828193	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr2:101031561G>T	ENST00000264249.3	-	0	295				CHST10_ENST00000409701.1_5'UTR|CHST10_ENST00000485085.1_5'UTR|CHST10_ENST00000542617.1_Missense_Mutation_p.N18K	NM_004854.4	NP_004845.1	O43529	CHSTA_HUMAN	carbohydrate sulfotransferase 10						carbohydrate biosynthetic process (GO:0016051)|cell adhesion (GO:0007155)|learning (GO:0007612)|long-term memory (GO:0007616)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	HNK-1 sulfotransferase activity (GO:0016232)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)	16						GAGGTTCTTGGTTCCTCTTGT	0.383													G|||	1817	0.362819	0.0333	0.4496	5008	,	,		17694	0.6845		0.4881	False		,,,				2504	0.2863					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			BC010441	CCDS2047.1	2q11.2	2008-02-05			ENSG00000115526	ENSG00000115526		"""Sulfotransferases, membrane-bound"""	19650	protein-coding gene	gene with protein product		606376				12080076	Standard	NM_004854		Approved	HNK-1ST	uc002tam.3	O43529	OTTHUMG00000130669	ENST00000264249.3:c.-91C>A	2.37:g.101031561G>T			Q53T18	Missense_Mutation	SNP	pfam_Sulfotransferase	p.N18K	ENST00000264249.3	37	c.54	CCDS2047.1	2	927	0.42445054945054944	16	0.032520325203252036	155	0.4281767955801105	388	0.6783216783216783	368	0.48548812664907653	G	14.80	2.644646	0.47258	.	.	ENSG00000115526	ENST00000542617;ENST00000448989	T;T	0.70516	-0.49;0.78	4.21	1.42	0.22433	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.44559	-0.9320	5	0.27785	T	0.31	.	4.3517	0.11158	0.2051:0.1875:0.6074:0.0	rs3828193;rs17646791;rs56593647;rs58983336;rs3828193	.	.	.	K	18	ENSP00000438869:N18K;ENSP00000387977:N18K	ENSP00000387977:N18K	N	-	3	2	CHST10	100397993	0.117000	0.22190	0.011000	0.14972	0.979000	0.70002	1.396000	0.34531	0.314000	0.23086	0.561000	0.74099	AAC	CHST10	-	NULL	ENSG00000115526		0.383	CHST10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST10	HGNC	protein_coding	OTTHUMT00000253162.1	83	0.00	0	G	NM_004854		101031561	101031561	-1	no_errors	ENST00000542617	ensembl	human	known	69_37n	missense	49	18.03	11	SNP	0.014	T
CHTF18	63922	genome.wustl.edu	37	16	840014	840014	+	Intron	SNP	A	A	C	rs4984926	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr16:840014A>C	ENST00000262315.9	+	5	669				CHTF18_ENST00000491530.1_Intron|CHTF18_ENST00000317063.6_Intron|RPUSD1_ENST00000565809.1_5'Flank|RPUSD1_ENST00000007264.2_5'Flank|CHTF18_ENST00000455171.2_Intron|RPUSD1_ENST00000567114.1_5'Flank|RPUSD1_ENST00000561734.1_5'Flank	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)						cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				CAGCTGACCCATCTGGATGGC	0.597													a|||	729	0.145567	0.0424	0.1167	5008	,	,		18334	0.245		0.1501	False		,,,				2504	0.1984					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.607-163A>C	16.37:g.840014A>C			B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Silent	SNP	NULL	p.P75	ENST00000262315.9	37	c.225	CCDS45371.1	16																																																																																			CHTF18	-	NULL	ENSG00000127586		0.597	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHTF18	HGNC	protein_coding	OTTHUMT00000109061.3	43	0.00	0	A	NM_022092		840014	840014	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000426047	ensembl	human	novel	69_37n	silent	36	10.00	4	SNP	0.000	C
CIDEA	1149	genome.wustl.edu	37	18	12254761	12254761	+	Intron	SNP	A	A	C	rs139733533	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr18:12254761A>C	ENST00000320477.9	+	1	103				CIDEA_ENST00000521296.1_3'UTR	NM_001279.3	NP_001270.1	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a						apoptotic process (GO:0006915)|cell death (GO:0008219)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of sequestering of triglyceride (GO:0010890)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|response to stilbenoid (GO:0035634)|temperature homeostasis (GO:0001659)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|mitochondrial envelope (GO:0005740)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)	13						CCGCTGCTGCAGTCGCGGGCG	0.662																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF041378	CCDS11856.1	18p11.21	2008-08-01			ENSG00000176194	ENSG00000176194			1976	protein-coding gene	gene with protein product		604440				9564035, 18509062	Standard	NM_001279		Approved	CIDE-A	uc002kqt.4	O60543	OTTHUMG00000131691	ENST00000320477.9:c.38+341A>C	18.37:g.12254761A>C			B0YIY7|Q6UPR7	Missense_Mutation	SNP	NULL	p.S127R	ENST00000320477.9	37	c.379	CCDS11856.1	18																																																																																			CIDEA	-	NULL	ENSG00000176194		0.662	CIDEA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CIDEA	HGNC	protein_coding	OTTHUMT00000254599.2	35	0.00	0	A	NM_001279		12254761	12254761	+1	no_errors	ENST00000522713	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	0.000	C
CLCN7	1186	genome.wustl.edu	37	16	1499025	1499025	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr16:1499025C>A	ENST00000382745.4	-	19	2344	c.1739G>T	c.(1738-1740)gGc>gTc	p.G580V	CLCN7_ENST00000448525.1_Missense_Mutation_p.G556V|CLCN7_ENST00000262318.8_Missense_Mutation_p.G556V|LA16c-390E6.4_ENST00000563610.1_RNA|LA16c-390E6.5_ENST00000566287.1_RNA	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	580					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				GATGGGGAAGCCGTAGGTCAC	0.622																																						dbGAP											0													87.0	70.0	75.0					16																	1499025		2197	4299	6496	-	-	-	SO:0001583	missense	0			Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.1739G>T	16.37:g.1499025C>A	ENSP00000372193:p.Gly580Val		A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-7	p.G580V	ENST00000382745.4	37	c.1739	CCDS32361.1	16	.	.	.	.	.	.	.	.	.	.	C	20.7	4.040183	0.75732	.	.	ENSG00000103249	ENST00000448525;ENST00000262318;ENST00000382745;ENST00000428756	D;D;D	0.94232	-3.2;-3.38;-3.2	5.27	5.27	0.74061	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.93180	0.7828	N	0.25380	0.74	0.80722	D	1	P;D;D	0.76494	0.774;0.999;0.999	P;D;D	0.73708	0.627;0.981;0.976	D	0.89787	0.3965	10	0.08837	T	0.75	-37.6392	17.4426	0.87569	0.0:1.0:0.0:0.0	.	556;580;29	E9PDB9;P51798;B3KUD9	.;CLCN7_HUMAN;.	V	556;533;580;522	ENSP00000410907:G556V;ENSP00000262318:G533V;ENSP00000372193:G580V	ENSP00000262318:G533V	G	-	2	0	CLCN7	1439026	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	7.650000	0.83521	2.451000	0.82905	0.561000	0.74099	GGC	CLCN7	-	pfam_Cl-channel_volt-gated,superfamily_Cl-channel_core,prints_Cl-channel_volt-gated	ENSG00000103249		0.622	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN7	HGNC	protein_coding	OTTHUMT00000103598.2	49	0.00	0	C	NM_001287		1499025	1499025	-1	no_errors	ENST00000382745	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	1.000	A
CLDN12	9069	genome.wustl.edu	37	7	90099368	90099368	+	3'UTR	SNP	A	A	G	rs17864033	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr7:90099368A>G	ENST00000478752.1	+	0	400				CTB-13L3.1_ENST00000480135.1_RNA			P56749	CLD12_HUMAN	claudin 12						calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			breast(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)	15						TGTTGGTGGGAAGACATTTTA	0.378													A|||	1385	0.276558	0.0976	0.3271	5008	,	,		18490	0.6171		0.2058	False		,,,				2504	0.2045					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AJ250713	CCDS5618.1	7q21	2008-07-18			ENSG00000157224	ENSG00000157224		"""Claudins"""	2034	protein-coding gene	gene with protein product		611232					Standard	NM_001185072		Approved		uc003ukr.3	P56749	OTTHUMG00000156612	ENST00000478752.1:c.*397A>G	7.37:g.90099368A>G			D6W5Q4|Q7LDZ0	RNA	SNP	-	NULL	ENST00000478752.1	37	NULL		7																																																																																			CLDN12	-	-	ENSG00000157224		0.378	CLDN12-009	PUTATIVE	basic	processed_transcript	CLDN12	HGNC	protein_coding	OTTHUMT00000140209.1	22	0.00	0	A	NM_012129		90099368	90099368	+1	no_errors	ENST00000478752	ensembl	human	putative	69_37n	rna	20	28.57	8	SNP	0.012	G
CLRN1	7401	genome.wustl.edu	37	3	150690566	150690566	+	5'UTR	SNP	T	T	C	rs3796240	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:150690566T>C	ENST00000327047.1	-	0	220				CLRN1-AS1_ENST00000476886.1_RNA|CLRN1_ENST00000328863.4_5'Flank|CLRN1-AS1_ENST00000465576.1_RNA|RP11-166N6.2_ENST00000469268.1_RNA	NM_174878.2	NP_777367.1	P58418	CLRN1_HUMAN	clarin 1						actin filament organization (GO:0007015)|auditory receptor cell stereocilium organization (GO:0060088)|cell motility (GO:0048870)|equilibrioception (GO:0050957)|photoreceptor cell maintenance (GO:0045494)|positive regulation of lamellipodium assembly (GO:0010592)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			AGGGACTGCCTCTTTGACTGC	0.463													C|||	2350	0.469249	0.3313	0.5793	5008	,	,		21639	0.4365		0.5318	False		,,,				2504	0.547					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF388366	CCDS3153.1, CCDS35492.1, CCDS56285.1	3q25.1	2014-09-17	2006-11-23	2006-11-23	ENSG00000163646	ENSG00000163646			12605	protein-coding gene	gene with protein product		606397	"""Usher syndrome 3A"""	USH3, USH3A, RP61		7711740, 8975700	Standard	NM_052995		Approved		uc021xfr.1	P58418	OTTHUMG00000140368	ENST00000327047.1:c.-71A>G	3.37:g.150690566T>C			D3DNJ3|E1ACU9|Q8N6A9	RNA	SNP	-	NULL	ENST00000327047.1	37	NULL	CCDS3153.1	3																																																																																			CLRN1-AS1	-	-	ENSG00000239265		0.463	CLRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLRN1-AS1	HGNC	protein_coding	OTTHUMT00000277060.1	21	0.00	0	T			150690566	150690566	+1	no_errors	ENST00000465576	ensembl	human	known	69_37n	rna	7	30.00	3	SNP	0.001	C
CLSTN3	9746	genome.wustl.edu	37	12	7310620	7310620	+	Silent	SNP	C	C	T	rs142864552		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr12:7310620C>T	ENST00000266546.6	+	18	3264	c.2814C>T	c.(2812-2814)gcC>gcT	p.A938A	CLSTN3_ENST00000331148.5_3'UTR|CLSTN3_ENST00000537408.1_Silent_p.A950A	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	938					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						CGGAGGTGGCCGATTCCCCCA	0.637													C|||	7	0.00139776	0.0	0.0	5008	,	,		13657	0.005		0.002	False		,,,				2504	0.0					dbGAP											0													73.0	57.0	62.0					12																	7310620		2126	4162	6288	-	-	-	SO:0001819	synonymous_variant	0			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.2814C>T	12.37:g.7310620C>T			D3DUT6|O94831|Q2T9J5|Q5UE57	Silent	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A938	ENST00000266546.6	37	c.2814	CCDS8575.1	12																																																																																			CLSTN3	-	NULL	ENSG00000139182		0.637	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN3	HGNC	protein_coding	OTTHUMT00000398560.2	26	0.00	0	C	NM_014718		7310620	7310620	+1	no_errors	ENST00000266546	ensembl	human	known	69_37n	silent	25	13.79	4	SNP	0.109	T
CLSTN3	9746	genome.wustl.edu	37	12	7310623	7310623	+	Silent	SNP	T	T	C	rs146046597		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr12:7310623T>C	ENST00000266546.6	+	18	3267	c.2817T>C	c.(2815-2817)gaT>gaC	p.D939D	CLSTN3_ENST00000331148.5_3'UTR|CLSTN3_ENST00000537408.1_Silent_p.D951D	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	939					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						AGGTGGCCGATTCCCCCAGCA	0.632													T|||	7	0.00139776	0.0	0.0	5008	,	,		13005	0.005		0.002	False		,,,				2504	0.0					dbGAP											0													73.0	57.0	62.0					12																	7310623		2135	4172	6307	-	-	-	SO:0001819	synonymous_variant	0			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.2817T>C	12.37:g.7310623T>C			D3DUT6|O94831|Q2T9J5|Q5UE57	Silent	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D939	ENST00000266546.6	37	c.2817	CCDS8575.1	12																																																																																			CLSTN3	-	NULL	ENSG00000139182		0.632	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN3	HGNC	protein_coding	OTTHUMT00000398560.2	26	0.00	0	T	NM_014718		7310623	7310623	+1	no_errors	ENST00000266546	ensembl	human	known	69_37n	silent	25	13.79	4	SNP	1.000	C
CNTN6	27255	genome.wustl.edu	37	3	1134445	1134445	+	5'UTR	SNP	C	C	A	rs6807118	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:1134445C>A	ENST00000446702.2	+	0	186				CNTN6_ENST00000350110.2_5'UTR|CNTN6_ENST00000539053.1_5'UTR			Q9UQ52	CNTN6_HUMAN	contactin 6						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		CAGCTGCTCTCAGCTCTCTCT	0.423													C|||	949	0.189497	0.5817	0.072	5008	,	,		17900	0.004		0.0586	False		,,,				2504	0.0685					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.-442C>A	3.37:g.1134445C>A			Q2KHM2	Nonsense_Mutation	SNP	NULL	p.S9*	ENST00000446702.2	37	c.26	CCDS2557.1	3																																																																																			CNTN6	-	NULL	ENSG00000134115		0.423	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	28	0.00	0	C	NM_014461		1134445	1134445	+1	no_errors	ENST00000397479	ensembl	human	known	69_37n	nonsense	27	15.62	5	SNP	0.046	A
CNTNAP3B	728577	genome.wustl.edu	37	9	43822686	43822686	+	Missense_Mutation	SNP	C	C	A	rs62555055		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr9:43822686C>A	ENST00000377564.3	+	8	1633	c.1240C>A	c.(1240-1242)Cgt>Agt	p.R414S		NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	414	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.			R -> S (in Ref. 1; BAB70782). {ECO:0000305}.	cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						CGAACTTCAACGTGGTTCAGG	0.502																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.1240C>A	9.37:g.43822686C>A	ENSP00000366787:p.Arg414Ser		B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.R414S	ENST00000377564.3	37	c.1240	CCDS55312.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.827|8.827	0.939072|0.939072	0.18281|0.18281	.|.	.|.	ENSG00000154529|ENSG00000154529	ENST00000377561|ENST00000377564;ENST00000341990;ENST00000403166	.|T	.|0.77877	.|-1.13	2.83|2.83	1.91|1.91	0.25777|0.25777	.|.	.|.	.|.	.|.	.|.	T|T	0.57051|0.57051	0.2027|0.2027	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	P|P	0.0|0.0	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.55036|0.55036	-0.8203|-0.8203	4|6	.|0.07990	.|T	.|0.79	.|.	8.6249|8.6249	0.33883|0.33883	0.0:0.8775:0.0:0.1225|0.0:0.8775:0.0:0.1225	.|.	.|.	.|.	.|.	K|S	462|414	.|ENSP00000366787:R414S	.|ENSP00000340890:R414S	N|R	+|+	3|1	2|0	CNTNAP3B|CNTNAP3B	43762682|43762682	0.004000|0.004000	0.15560|0.15560	0.004000|0.004000	0.12327|0.12327	0.319000|0.319000	0.28217|0.28217	1.982000|1.982000	0.40638|0.40638	0.514000|0.514000	0.28300|0.28300	0.423000|0.423000	0.28283|0.28283	AAC|CGT	CNTNAP3B	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000154529		0.502	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	HGNC	protein_coding	OTTHUMT00000036930.3	97	0.00	0	C			43822686	43822686	+1	no_errors	ENST00000377564	ensembl	human	known	69_37n	missense	85	14.14	14	SNP	0.003	A
CNTNAP3B	728577	genome.wustl.edu	37	9	43822704	43822704	+	Missense_Mutation	SNP	G	G	A	rs62555056		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr9:43822704G>A	ENST00000377564.3	+	8	1651	c.1258G>A	c.(1258-1260)Gtc>Atc	p.V420I		NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	420	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.			V -> I (in Ref. 1; BAB70782). {ECO:0000305}.	cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						AGGGAGTTTCGTCCTCTTTCT	0.478																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.1258G>A	9.37:g.43822704G>A	ENSP00000366787:p.Val420Ile		B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.V420I	ENST00000377564.3	37	c.1258	CCDS55312.1	9	.	.	.	.	.	.	.	.	.	.	G	6.568	0.473072	0.12461	.	.	ENSG00000154529	ENST00000377564;ENST00000341990;ENST00000403166	T	0.77620	-1.11	2.66	-5.32	0.02722	.	.	.	.	.	T	0.64091	0.2567	L	0.29908	0.895	0.80722	P	0.0	.	.	.	.	.	.	T	0.57883	-0.7734	6	0.22109	T	0.4	.	9.5395	0.39242	0.1327:0.5788:0.2884:0.0	.	.	.	.	I	420	ENSP00000366787:V420I	ENSP00000340890:V420I	V	+	1	0	CNTNAP3B	43762700	0.001000	0.12720	0.004000	0.12327	0.327000	0.28475	-1.620000	0.02046	-1.150000	0.02840	-0.717000	0.03617	GTC	CNTNAP3B	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000154529		0.478	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	HGNC	protein_coding	OTTHUMT00000036930.3	81	0.00	0	G			43822704	43822704	+1	no_errors	ENST00000377564	ensembl	human	known	69_37n	missense	57	18.57	13	SNP	0.009	A
CROCCP3	114819	genome.wustl.edu	37	1	16812082	16812082	+	RNA	SNP	A	A	G	rs2418644	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:16812082A>G	ENST00000263511.4	-	0	1469					NR_023386.1		Q8IVE0	CROL2_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 3						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CAAGCTTCTCAGTGAGGTCCG	0.612													.|||	1123	0.224241	0.1339	0.3876	5008	,	,		18228	0.0188		0.3012	False		,,,				2504	0.363					dbGAP											0																																										-	-	-			0			AB067509		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000080947	ENSG00000080947			29405	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 2"""	CROCCL2		11572484	Standard	NR_023386		Approved	KIAA1922	uc001ayt.2	Q8IVE0	OTTHUMG00000037885		1.37:g.16812082A>G			Q96PW6	RNA	SNP	-	NULL	ENST00000263511.4	37	NULL		1																																																																																			CROCCP3	-	-	ENSG00000080947		0.612	CROCCP3-002	KNOWN	basic	processed_transcript	CROCCP3	HGNC	pseudogene	OTTHUMT00000458172.1	68	0.00	0	A	XM_057040		16812082	16812082	-1	no_errors	ENST00000263511	ensembl	human	known	69_37n	rna	51	10.53	6	SNP	0.066	G
CROCCP3	114819	genome.wustl.edu	37	1	16817677	16817677	+	RNA	SNP	T	T	C	rs157248	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:16817677T>C	ENST00000263511.4	-	0	852					NR_023386.1		Q8IVE0	CROL2_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 3						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											TGGGTGGCCCTGACCTTGCCC	0.652													.|||	2509	0.500998	0.1203	0.4308	5008	,	,		12969	0.9018		0.5537	False		,,,				2504	0.5982					dbGAP											0																																										-	-	-			0			AB067509		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000080947	ENSG00000080947			29405	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 2"""	CROCCL2		11572484	Standard	NR_023386		Approved	KIAA1922	uc001ayt.2	Q8IVE0	OTTHUMG00000037885		1.37:g.16817677T>C			Q96PW6	RNA	SNP	-	NULL	ENST00000263511.4	37	NULL		1																																																																																			CROCCP3	-	-	ENSG00000080947		0.652	CROCCP3-002	KNOWN	basic	processed_transcript	CROCCP3	HGNC	pseudogene	OTTHUMT00000458172.1	69	0.00	0	T	XM_057040		16817677	16817677	-1	no_errors	ENST00000590118	ensembl	human	known	69_37n	rna	38	13.64	6	SNP	0.990	C
DCDC1	341019	genome.wustl.edu	37	11	31263112	31263112	+	Missense_Mutation	SNP	A	A	G	rs2616812	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr11:31263112A>G	ENST00000597505.1	-	7	1105	c.1106T>C	c.(1105-1107)cTa>cCa	p.L369P				P59894	DCDC1_HUMAN	doublecortin domain containing 1	234					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					GACCCAAAGTAGTCCTCGCAA	0.438													G|||	3827	0.764177	0.857	0.6945	5008	,	,		16091	0.9484		0.5736	False		,,,				2504	0.6943					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.1106T>C	11.37:g.31263112A>G	ENSP00000472625:p.Leu369Pro		A6PVL6|B7WNX6|Q6ZU04	RNA	SNP	-	NULL	ENST00000597505.1	37	NULL		11																																																																																			DCDC1	-	-	ENSG00000188682		0.438	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000463167.1	50	0.00	0	A	NM_181807		31263112	31263112	-1	no_errors	ENST00000534722	ensembl	human	known	69_37n	rna	27	18.18	6	SNP	0.998	G
DDR2	4921	genome.wustl.edu	37	1	162746135	162746135	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:162746135G>A	ENST00000367922.3	+	17	2696	c.2258G>A	c.(2257-2259)tGg>tAg	p.W753*	RN7SL861P_ENST00000473793.2_RNA|DDR2_ENST00000367921.3_Nonsense_Mutation_p.W753*	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	753	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	CCTATCCGCTGGATGTCTTGG	0.493																																					NSCLC(161;314 2006 8283 19651 23192)	dbGAP											0													97.0	91.0	93.0					1																	162746135		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.2258G>A	1.37:g.162746135G>A	ENSP00000356899:p.Trp753*		Q7Z730	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.W753*	ENST00000367922.3	37	c.2258	CCDS1241.1	1	.	.	.	.	.	.	.	.	.	.	G	42	9.618749	0.99221	.	.	ENSG00000162733	ENST00000367922;ENST00000367921	.	.	.	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.6139	0.88063	0.0:0.0:1.0:0.0	.	.	.	.	X	753	.	ENSP00000356898:W753X	W	+	2	0	DDR2	161012759	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.662000	0.98603	2.541000	0.85698	0.637000	0.83480	TGG	DDR2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000162733		0.493	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDR2	HGNC	protein_coding	OTTHUMT00000083213.2	55	0.00	0	G	NM_006182		162746135	162746135	+1	no_errors	ENST00000367921	ensembl	human	known	69_37n	nonsense	51	25.00	17	SNP	1.000	A
DEPDC5	9681	genome.wustl.edu	37	22	32241185	32241185	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr22:32241185C>T	ENST00000382112.3	+	29	3026	c.2956C>T	c.(2956-2958)Cgc>Tgc	p.R986C	DEPDC5_ENST00000535622.1_Missense_Mutation_p.R917C|DEPDC5_ENST00000382111.2_Missense_Mutation_p.R995C|DEPDC5_ENST00000400246.1_Missense_Mutation_p.R995C|DEPDC5_ENST00000382105.2_Missense_Mutation_p.R917C|DEPDC5_ENST00000400248.2_Missense_Mutation_p.R986C|DEPDC5_ENST00000266091.3_Missense_Mutation_p.R995C|DEPDC5_ENST00000400249.2_Missense_Mutation_p.R986C	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	995					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						GGGCTTGAATCGCATTCGCAG	0.627																																						dbGAP											0													56.0	62.0	60.0					22																	32241185		2134	4243	6377	-	-	-	SO:0001583	missense	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.2956C>T	22.37:g.32241185C>T	ENSP00000371546:p.Arg986Cys		A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	pfam_DUF3608,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.R995C	ENST00000382112.3	37	c.2983	CCDS46692.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.3|23.3	4.400157|4.400157	0.83120|0.83120	.|.	.|.	ENSG00000100150|ENSG00000100150	ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248|ENST00000433147	T;T;T;T;T;T;T;T|.	0.43688|.	1.0;1.44;1.44;1.39;0.94;1.43;1.39;1.44|.	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	0.063133|.	0.64402|.	D|.	0.000004|.	T|T	0.57403|0.57403	0.2051|0.2051	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;P;D;P;P;P|.	0.91635|.	0.999;0.88;0.951;0.878;0.88;0.828|.	T|T	0.52540|0.52540	-0.8562|-0.8562	10|5	0.45353|.	T|.	0.12|.	.|.	17.9339|17.9339	0.89007|0.89007	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	316;995;917;995;986;986|.	B4DSS1;B9EGN9;B4DH93;O75140-4;A8MPX9;O75140|.	.;.;.;.;.;DEPD5_HUMAN|.	C|L	917;995;986;917;995;917;986;995;986|392	ENSP00000440210:R917C;ENSP00000266091:R995C;ENSP00000383108:R986C;ENSP00000383105:R995C;ENSP00000371539:R917C;ENSP00000371546:R986C;ENSP00000371545:R995C;ENSP00000383107:R986C|.	ENSP00000266091:R995C|.	R|S	+|+	1|2	0|0	DEPDC5|DEPDC5	30571185|30571185	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.859000|0.859000	0.49053|0.49053	3.378000|3.378000	0.52432|0.52432	2.487000|2.487000	0.83934|0.83934	0.558000|0.558000	0.71614|0.71614	CGC|TCG	DEPDC5	-	NULL	ENSG00000100150		0.627	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1	85	0.00	0	C	NM_014662		32241185	32241185	+1	no_errors	ENST00000266091	ensembl	human	known	69_37n	missense	57	26.92	21	SNP	1.000	T
DIP2A	23181	genome.wustl.edu	37	21	47983680	47983680	+	Intron	SNP	G	G	A	rs762254	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr21:47983680G>A	ENST00000417564.2	+	35	4110				DIP2A_ENST00000400274.1_Intron|DIP2A_ENST00000479654.1_3'UTR|DIP2A_ENST00000318711.7_Intron			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)						multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		CTGCAGGCCAGCTTCTGAGGG	0.428													A|||	555	0.110823	0.239	0.072	5008	,	,		19615	0.003		0.0885	False		,,,				2504	0.0992					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.4090-91G>A	21.37:g.47983680G>A			A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	RNA	SNP	-	NULL	ENST00000417564.2	37	NULL	CCDS46655.1	21																																																																																			DIP2A	-	-	ENSG00000160305		0.428	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1	41	0.00	0	G	NM_015151		47983680	47983680	+1	no_errors	ENST00000479654	ensembl	human	putative	69_37n	rna	32	11.11	4	SNP	0.000	A
GNAO1	2775	genome.wustl.edu	37	16	56227965	56227965	+	Intron	SNP	T	T	G	rs59779556	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr16:56227965T>G	ENST00000262493.6	+	2	1007				GNAO1_ENST00000262494.7_Intron|RP11-461O7.1_ENST00000501259.1_lincRNA|CTD-2050B12.2_ENST00000567381.1_RNA|GNAO1_ENST00000569295.1_Intron	NM_020988.2	NP_066268.1	P09471	GNAO_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|dopamine receptor signaling pathway (GO:0007212)|forebrain development (GO:0030900)|locomotory behavior (GO:0007626)|muscle contraction (GO:0006936)|negative regulation of calcium ion transport (GO:0051926)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|regulation of heart contraction (GO:0008016)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to morphine (GO:0043278)	heterotrimeric G-protein complex (GO:0005834)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	corticotropin-releasing hormone receptor 1 binding (GO:0051430)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|mu-type opioid receptor binding (GO:0031852)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)	17		all_neural(199;0.159)				AAATCTTGGATGTGTAACAGG	0.468													T|||	2246	0.448482	0.413	0.4827	5008	,	,		17705	0.5744		0.4523	False		,,,				2504	0.3384					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS10756.1, CCDS10757.1	16q13	2008-08-01			ENSG00000087258	ENSG00000087258			4389	protein-coding gene	gene with protein product		139311				1899283, 11395521	Standard	NM_020988		Approved	G-ALPHA-o	uc002eit.4	P09471	OTTHUMG00000133241	ENST00000262493.6:c.161+1437T>G	16.37:g.56227965T>G			P29777|Q8TD72|Q9UMV4	RNA	SNP	-	NULL	ENST00000262493.6	37	NULL	CCDS10756.1	16																																																																																			CTD-2050B12.2	-	-	ENSG00000261439		0.468	GNAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKFZP434H168	Clone_based_vega_gene	protein_coding	OTTHUMT00000256981.2	66	0.00	0	T	NM_020988		56227965	56227965	-1	no_errors	ENST00000567381	ensembl	human	known	69_37n	rna	17	26.09	6	SNP	1.000	G
UPK3B	80761	genome.wustl.edu	37	7	76610346	76610346	+	Intron	SNP	C	C	T	rs71552449	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr7:76610346C>T	ENST00000419923.2	+	6	1408				DTX2P1-UPK3BP1-PMS2P11_ENST00000584900.1_RNA|UPK3B_ENST00000443097.2_Intron			Q9BT76	UPK3B_HUMAN	uroplakin 3B						negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				GCATACCCCGCCCCCCAGCAC	0.662													c|||	2219	0.443091	0.6725	0.366	5008	,	,		11077	0.2619		0.4742	False		,,,				2504	0.3425					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000419923.2:c.961-37795C>T	7.37:g.76610346C>T			A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	RNA	SNP	-	NULL	ENST00000419923.2	37	NULL	CCDS5588.1	7																																																																																			DTX2P1-UPK3BP1-PMS2P11	-	-	ENSG00000265479		0.662	UPK3B-201	KNOWN	basic|CCDS	protein_coding	DTX2P1-UPK3BP1-PMS2P11	HGNC	protein_coding		44	0.00	0	C	NM_030570		76610346	76610346	+1	no_errors	ENST00000584900	ensembl	human	known	69_37n	rna	65	17.72	14	SNP	0.268	T
ECRP	643332	genome.wustl.edu	37	14	21388431	21388431	+	lincRNA	SNP	A	A	T	rs61977374	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr14:21388431A>T	ENST00000555642.1	-	0	344				RP11-219E7.4_ENST00000553534.1_lincRNA|RP11-84C10.2_ENST00000258817.2_lincRNA																							TGCCTTGTGAAGCCTGCAATA	0.473													-|||	70	0.0139776	0.0038	0.0173	5008	,	,		20175	0.0		0.0497	False		,,,				2504	0.0031					dbGAP											0																																										-	-	-			0																															14.37:g.21388431A>T				RNA	SNP	-	NULL	ENST00000555642.1	37	NULL		14																																																																																			RP11-84C10.2	-	-	ENSG00000136315		0.473	RP11-84C10.3-001	KNOWN	basic	lincRNA	ECRP	Clone_based_vega_gene	lincRNA	OTTHUMT00000411340.1	53	0.00	0	A			21388431	21388431	+1	no_errors	ENST00000555624	ensembl	human	known	69_37n	rna	36	10.00	4	SNP	0.000	T
ELP5	23587	genome.wustl.edu	37	17	7158203	7158203	+	Intron	SNP	T	T	G	rs402514	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:7158203T>G	ENST00000396628.2	+	4	674				ELP5_ENST00000574255.1_Nonstop_Mutation_p.*180E|CTDNEP1_ENST00000573600.1_5'Flank|ELP5_ENST00000574993.1_Intron|CTDNEP1_ENST00000318988.6_5'Flank|CTDNEP1_ENST00000572043.1_5'Flank|RP1-4G17.5_ENST00000577138.1_Intron|ELP5_ENST00000354429.2_Intron|ELP5_ENST00000356683.2_Intron|ELP5_ENST00000573657.1_Nonstop_Mutation_p.*180E|ELP5_ENST00000396627.2_Intron	NM_203414.1	NP_981959.1	Q8TE02	ELP5_HUMAN	elongator acetyltransferase complex subunit 5						chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Elongator holoenzyme complex (GO:0033588)|nucleus (GO:0005634)											TACCCTAGAATAAACATCTGG	0.413													G|||	3519	0.702676	0.8964	0.5937	5008	,	,		17334	0.6498		0.6352	False		,,,				2504	0.6421					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC002762	CCDS11094.1, CCDS11095.1	17p13.1	2012-08-14	2012-08-08	2012-08-08	ENSG00000170291	ENSG00000170291		"""Elongator acetyltransferase complex subunits"""	30617	protein-coding gene	gene with protein product	"""dermal papilla derived protein 6"", ""S-phase 2 protein"""	615019	"""chromosome 17 open reading frame 81"""	C17orf81		22854966	Standard	NM_203415		Approved	DERP6	uc002gfi.1	Q8TE02	OTTHUMG00000177974	ENST00000396628.2:c.457+81T>G	17.37:g.7158203T>G			A8K1M5|D3DTN9|Q659B6|Q7Z2T4|Q8TDR9|Q9BUB2|Q9Y2Q4	Nonstop_Mutation	SNP	pfam_Histone_acetylation_protein_2	p.*180E	ENST00000396628.2	37	c.538	CCDS11094.1	17																																																																																			ELP5	-	NULL	ENSG00000170291		0.413	ELP5-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ELP5	HGNC	protein_coding	OTTHUMT00000440111.1	19	0.00	0	T	NM_015362		7158203	7158203	+1	no_errors	ENST00000573657	ensembl	human	known	69_37n	nonstop	22	21.43	6	SNP	0.000	G
PDXDC2P	283970	genome.wustl.edu	37	16	70010458	70010458	+	RNA	SNP	G	G	A	rs3206834	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr16:70010458G>A	ENST00000531894.1	-	0	3925				RP11-419C5.2_ENST00000525562.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)										GAGGGTGGAAGGGGAATAAGA	0.512													g|||	1754	0.35024	0.0809	0.5187	5008	,	,		5105	0.2609		0.6292	False		,,,				2504	0.3998					dbGAP											0																																										-	-	-			0					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70010458G>A			A8K9Z5	Missense_Mutation	SNP	pfam_NPIP	p.L274F	ENST00000531894.1	37	c.820		16	1018	0.4661172161172161	104	0.21138211382113822	208	0.574585635359116	267	0.46678321678321677	439	0.579155672823219	.	8.557	0.876801	0.17395	.	.	ENSG00000226232	ENST00000532298	T	0.62105	0.05	.	.	.	.	.	.	.	.	T	0.00012	0.0000	.	.	.	.	.	.	.	.	.	.	.	.	T	0.48139	-0.9061	3	0.87932	D	0	.	.	.	.	rs3206834;rs3206834	.	.	.	F	274	ENSP00000448651:L274F	ENSP00000448651:L274F	L	-	1	0	RP11-419C5.2	68567959	0.006000	0.16342	0.013000	0.15412	0.013000	0.08279	0.150000	0.16263	0.107000	0.17824	0.109000	0.15622	CTT	RP11-419C5.2	-	pfam_NPIP	ENSG00000226232		0.512	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226232	Clone_based_vega_gene	processed_transcript	OTTHUMT00000395258.1	32	0.00	0	G			70010458	70010458	-1	no_errors	ENST00000532298	ensembl	human	novel	69_37n	missense	20	28.57	8	SNP	0.014	A
EPHA4	2043	genome.wustl.edu	37	2	222282765	222282765	+	3'UTR	SNP	C	C	T	rs3177117	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr2:222282765C>T	ENST00000281821.2	-	0	6329				EPHA4_ENST00000469354.1_5'UTR	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4						adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TTGTATACGGCAACTACTTTA	0.269													C|||	2158	0.430911	0.6036	0.3919	5008	,	,		17891	0.2222		0.4245	False		,,,				2504	0.4468					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.*3327G>A	2.37:g.222282765C>T			A8K2P1|B2R601|B7Z6Q8|Q2M380	RNA	SNP	-	NULL	ENST00000281821.2	37	NULL	CCDS2447.1	2																																																																																			EPHA4	-	-	ENSG00000116106		0.269	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	HGNC	protein_coding	OTTHUMT00000256836.3	36	0.00	0	C			222282765	222282765	-1	no_errors	ENST00000469354	ensembl	human	putative	69_37n	rna	31	20.51	8	SNP	1.000	T
SMIM11	54065	genome.wustl.edu	37	21	35774487	35774487	+	3'UTR	SNP	G	G	A	rs9980218	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr21:35774487G>A	ENST00000399299.1	+	0	445				AP000322.54_ENST00000410005.1_5'Flank|SMIM11_ENST00000481710.1_3'UTR			P58511	SIM11_HUMAN	small integral membrane protein 11							integral component of membrane (GO:0016021)											TTGAATGGAGGAGGATTTTTT	0.388													G|||	581	0.116014	0.323	0.0418	5008	,	,		16213	0.0109		0.0318	False		,,,				2504	0.0838					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC015596	CCDS33550.1	21q22.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000205670	ENSG00000205670			1293	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 51"", ""family with sequence similarity 165, member B"""	C21orf51, FAM165B			Standard	NM_058182		Approved		uc002ytu.4	P58511	OTTHUMG00000086193	ENST00000399299.1:c.*93G>A	21.37:g.35774487G>A				RNA	SNP	-	NULL	ENST00000399299.1	37	NULL		21																																																																																			FAM165B	-	-	ENSG00000205670		0.388	SMIM11-002	PUTATIVE	basic|exp_conf	protein_coding	FAM165B	HGNC	protein_coding	OTTHUMT00000194076.1	26	0.00	0	G	NM_058182		35774487	35774487	+1	no_errors	ENST00000481710	ensembl	human	known	69_37n	rna	32	13.51	5	SNP	0.001	A
FAM205A	259308	genome.wustl.edu	37	9	34723935	34723935	+	Missense_Mutation	SNP	C	C	T	rs2297134	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr9:34723935C>T	ENST00000378788.3	-	4	3341	c.3302G>A	c.(3301-3303)cGt>cAt	p.R1101H		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	1101				R -> H (in Ref. 1; BAC86357). {ECO:0000305}.		integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						ATGAAAGCTACGGCTCCATCG	0.592													C|||	2012	0.401757	0.0666	0.4006	5008	,	,		19132	0.6181		0.4851	False		,,,				2504	0.547					dbGAP											0													26.0	23.0	24.0					9																	34723935		692	1590	2282	-	-	-	SO:0001583	missense	0				CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.3302G>A	9.37:g.34723935C>T	ENSP00000417711:p.Arg1101His		A8MVW7	Missense_Mutation	SNP	NULL	p.R1101H	ENST00000378788.3	37	c.3302	CCDS55305.1	9	909	0.41620879120879123	45	0.09146341463414634	150	0.4143646408839779	334	0.583916083916084	380	0.5013192612137203	C	3.371	-0.128490	0.06753	.	.	ENSG00000205108	ENST00000378788	T	0.22539	1.95	4.13	-4.91	0.03085	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.45323	-0.9269	8	0.17369	T	0.5	.	5.6327	0.17520	0.0:0.4064:0.3212:0.2724	rs2297134;rs2297134	1101	Q6ZU69	F205A_HUMAN	H	1101	ENSP00000417711:R1101H	ENSP00000417711:R1101H	R	-	2	0	RP11-195F19.10	34713935	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-1.033000	0.03571	-0.710000	0.05001	-0.300000	0.09419	CGT	FAM205A	-	NULL	ENSG00000205108		0.592	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM205A	HGNC	protein_coding	OTTHUMT00000001150.2	63	0.00	0	C	NM_001141917		34723935	34723935	-1	no_errors	ENST00000378788	ensembl	human	novel	69_37n	missense	48	12.73	7	SNP	0.000	T
FAM207A	85395	genome.wustl.edu	37	21	46396611	46396611	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr21:46396611C>T	ENST00000291634.6	+	6	634	c.586C>T	c.(586-588)Cgg>Tgg	p.R196W	FAM207A_ENST00000479127.1_3'UTR|FAM207A_ENST00000397826.3_Missense_Mutation_p.R181W	NM_058190.2	NP_478070.1	Q9NSI2	F207A_HUMAN	family with sequence similarity 207, member A	196																	AGAAAGGACCCGGTTTCAGGA	0.642																																						dbGAP											0													16.0	16.0	16.0					21																	46396611		2177	4275	6452	-	-	-	SO:0001583	missense	0				CCDS13718.1	21q22.3	2011-08-15	2011-08-15	2011-08-15	ENSG00000160256	ENSG00000160256			15811	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 70"""	C21orf70			Standard	NM_058190		Approved	PRED56	uc002zgl.3	Q9NSI2	OTTHUMG00000090293	ENST00000291634.6:c.586C>T	21.37:g.46396611C>T	ENSP00000291634:p.Arg196Trp			Missense_Mutation	SNP	NULL	p.R196W	ENST00000291634.6	37	c.586	CCDS13718.1	21	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669931	0.67814	.	.	ENSG00000160256	ENST00000291634;ENST00000397826	T;T	0.57595	0.39;0.39	4.35	4.35	0.52113	.	0.203520	0.41823	D	0.000813	T	0.71178	0.3309	M	0.77616	2.38	0.46222	D	0.99893	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.75144	-0.3421	10	0.87932	D	0	-36.9995	12.5739	0.56354	0.0:1.0:0.0:0.0	.	181;196	Q9NSI2-2;Q9NSI2	.;F207A_HUMAN	W	196;181	ENSP00000291634:R196W;ENSP00000380926:R181W	ENSP00000291634:R196W	R	+	1	2	C21orf70	45221039	0.933000	0.31639	0.890000	0.34922	0.726000	0.41606	1.177000	0.31969	2.403000	0.81681	0.555000	0.69702	CGG	FAM207A	-	NULL	ENSG00000160256		0.642	FAM207A-002	KNOWN	basic|CCDS	protein_coding	FAM207A	HGNC	protein_coding	OTTHUMT00000206639.1	68	0.00	0	C	NM_058190		46396611	46396611	+1	no_errors	ENST00000291634	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	0.887	T
FAM210B	116151	genome.wustl.edu	37	20	54940298	54940298	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr20:54940298A>G	ENST00000371384.3	+	2	433	c.342A>G	c.(340-342)atA>atG	p.I114M		NM_080821.2	NP_543011.2	Q96KR6	F210B_HUMAN	family with sequence similarity 210, member B	114	DUF1279.					integral component of membrane (GO:0016021)		p.I114M(1)									CCTTGGGCATATTTTACATGG	0.333																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											138.0	137.0	137.0					20																	54940298		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL121914	CCDS13450.1	20q13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000124098	ENSG00000124098			16102	protein-coding gene	gene with protein product	"""hypothetical protein LOC116151"""		"""chromosome 20 open reading frame 108"""	C20orf108		11780052	Standard	NM_080821		Approved	dJ1167H4.1, DKFZP434A1114	uc002xxc.3	Q96KR6	OTTHUMG00000032793	ENST00000371384.3:c.342A>G	20.37:g.54940298A>G	ENSP00000360437:p.Ile114Met		B2RBQ9|E1P5Y7|Q8WVN2|Q9BYL6|Q9H418	Missense_Mutation	SNP	pfam_DUF1279	p.I114M	ENST00000371384.3	37	c.342	CCDS13450.1	20	.	.	.	.	.	.	.	.	.	.	A	12.07	1.827309	0.32329	.	.	ENSG00000124098	ENST00000371384	T	0.33865	1.39	5.36	-5.11	0.02901	Domain of unknown function DUF1279 (1);	0.279243	0.41823	N	0.000818	T	0.24774	0.0601	L	0.46741	1.465	0.37935	D	0.932133	B	0.30526	0.283	B	0.31191	0.125	T	0.03673	-1.1014	10	0.27082	T	0.32	-2.3136	11.0263	0.47746	0.1678:0.5565:0.2757:0.0	.	114	Q96KR6	CT108_HUMAN	M	114	ENSP00000360437:I114M	ENSP00000360437:I114M	I	+	3	3	C20orf108	54373705	0.023000	0.18921	0.067000	0.19924	0.979000	0.70002	-0.990000	0.03732	-1.446000	0.01945	0.477000	0.44152	ATA	FAM210B	-	pfam_DUF1279	ENSG00000124098		0.333	FAM210B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM210B	HGNC	protein_coding	OTTHUMT00000079800.2	31	0.00	0	A	NM_080821		54940298	54940298	+1	no_errors	ENST00000371384	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.754	G
SPATA31A3	727830	genome.wustl.edu	37	9	40705798	40705798	+	Missense_Mutation	SNP	C	C	A	rs11261518	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr9:40705798C>A	ENST00000356699.5	+	4	3484	c.3455C>A	c.(3454-3456)cCa>cAa	p.P1152Q	RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	1152				P -> Q (in Ref. 2; CAB45741). {ECO:0000305}.	cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CAGCTACTGCCATCAAAGAAA	0.438													C|||	1155	0.230631	0.0877	0.2536	5008	,	,		12729	0.3323		0.171	False		,,,				2504	0.364					dbGAP											0													11.0	10.0	10.0					9																	40705798		1428	2882	4310	-	-	-	SO:0001583	missense	0					9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.3455C>A	9.37:g.40705798C>A	ENSP00000349132:p.Pro1152Gln			Missense_Mutation	SNP	NULL	p.P1152Q	ENST00000356699.5	37	c.3455	CCDS47969.1	9	.	.	.	.	.	.	.	.	.	.	C	9.467	1.094545	0.20471	.	.	ENSG00000147926	ENST00000356699	T	0.06687	3.27	2.22	-3.42	0.04825	.	0.407546	0.18263	N	0.146555	T	0.11623	0.0283	M	0.67397	2.05	0.80722	P	0.0	P	0.51653	0.947	P	0.52514	0.701	T	0.06499	-1.0823	9	0.38643	T	0.18	0.6779	3.3683	0.07211	0.1864:0.4279:0.0:0.3857	.	1152	Q5VYP0	F75A3_HUMAN	Q	1152	ENSP00000349132:P1152Q	ENSP00000349132:P1152Q	P	+	2	0	FAM75A3	40695798	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.207000	0.09384	-0.967000	0.03582	-0.506000	0.04501	CCA	FAM75A3	-	NULL	ENSG00000147926		0.438	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75A3	HGNC	protein_coding	OTTHUMT00000036919.1	36	0.00	0	C	NM_001083124		40705798	40705798	+1	no_errors	ENST00000356699	ensembl	human	known	69_37n	missense	52	10.34	6	SNP	0.000	A
SPATA31A6	389730	genome.wustl.edu	37	9	43626820	43626820	+	Missense_Mutation	SNP	G	G	C	rs138779714	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr9:43626820G>C	ENST00000332857.6	-	4	1895	c.1867C>G	c.(1867-1869)Cgg>Ggg	p.R623G	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	623					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GATTCGTCCCGAAGCTGCATC	0.542													G|||	1620	0.323482	0.0764	0.5303	5008	,	,		10590	0.2411		0.4334	False		,,,				2504	0.4826					dbGAP											0													2.0	2.0	2.0					9																	43626820		38	330	368	-	-	-	SO:0001583	missense	0				CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.1867C>G	9.37:g.43626820G>C	ENSP00000329825:p.Arg623Gly			Missense_Mutation	SNP	NULL	p.R623G	ENST00000332857.6	37	c.1867	CCDS47973.1	9	524	0.23992673992673993	19	0.03861788617886179	149	0.4116022099447514	95	0.1660839160839161	261	0.34432717678100266	G	6.183	0.401995	0.11696	.	.	ENSG00000185775	ENST00000332857	T	0.06687	3.27	2.97	2.06	0.26882	.	0.721119	0.12036	N	0.505462	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.08055	0.003	T	0.45629	-0.9248	9	0.52906	T	0.07	-2.4748	6.1646	0.20384	0.1491:0.0:0.8509:0.0	.	623	Q5VVP1	F75A6_HUMAN	G	623	ENSP00000329825:R623G	ENSP00000329825:R623G	R	-	1	2	FAM75A6	43566816	0.028000	0.19301	0.001000	0.08648	0.001000	0.01503	0.853000	0.27777	0.610000	0.30035	-0.559000	0.04183	CGG	FAM75A6	-	NULL	ENSG00000185775		0.542	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75A6	HGNC	protein_coding	OTTHUMT00000036987.1	79	0.00	0	G	NM_001145196		43626820	43626820	-1	no_errors	ENST00000332857	ensembl	human	known	69_37n	missense	57	13.64	9	SNP	0.003	C
FAM86B2	653333	genome.wustl.edu	37	8	12285132	12285132	+	Intron	SNP	C	C	G	rs201597864	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr8:12285132C>G	ENST00000262365.4	-	7	892				FAM86B2_ENST00000309608.5_Intron|FAM86B2_ENST00000393715.3_Missense_Mutation_p.C81S|FAM86B2_ENST00000351291.4_Intron	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2									p.C81S(4)		endometrium(1)|kidney(2)	3						ACAGCTCGGGCACCATGTAGG	0.622													c|||	1566	0.3127	0.4448	0.2277	5008	,	,		8710	0.3423		0.2853	False		,,,				2504	0.1922					dbGAP											4	Substitution - Missense(4)	kidney(2)|endometrium(2)																																								-	-	-	SO:0001627	intron_variant	0				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.892+33G>C	8.37:g.12285132C>G				Missense_Mutation	SNP	NULL	p.C81S	ENST00000262365.4	37	c.242	CCDS59092.1	8	.	.	.	.	.	.	.	.	.	.	g	0.012	-1.667406	0.00765	.	.	ENSG00000145002	ENST00000393715	T	0.30182	1.54	0.634	-0.466	0.12153	.	.	.	.	.	T	0.10551	0.0258	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.32214	-0.9915	4	0.08837	T	0.75	.	.	.	.	.	.	.	.	S	81	ENSP00000377318:C81S	ENSP00000377318:C81S	C	-	2	0	FAM86B2	12329503	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.600000	0.05693	-1.610000	0.01583	-1.920000	0.00515	TGC	FAM86B2	-	NULL	ENSG00000145002		0.622	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86B2	HGNC	protein_coding		44	0.00	0	C	XM_928336		12285132	12285132	-1	no_errors	ENST00000393715	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	0.001	G
FAM86B2	653333	genome.wustl.edu	37	8	12287957	12287957	+	Missense_Mutation	SNP	C	C	T	rs148629503		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr8:12287957C>T	ENST00000262365.4	-	4	243	c.244G>A	c.(244-246)Gag>Aag	p.E82K	FAM86B2_ENST00000309608.5_Intron|FAM86B2_ENST00000393715.3_Intron|FAM86B2_ENST00000351291.4_Intron	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	82										endometrium(1)|kidney(2)	3						TGGACAGCCTCGTGCTGGGGG	0.537																																						dbGAP											0													13.0	16.0	15.0					8																	12287957		689	1588	2277	-	-	-	SO:0001583	missense	0				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.244G>A	8.37:g.12287957C>T	ENSP00000262365:p.Glu82Lys			Missense_Mutation	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.E82K	ENST00000262365.4	37	c.244	CCDS59092.1	8	.	.	.	.	.	.	.	.	.	.	-	13.25	2.180194	0.38511	.	.	ENSG00000145002	ENST00000262365	T	0.25414	1.8	1.16	1.16	0.20824	.	.	.	.	.	T	0.24661	0.0598	M	0.80982	2.52	0.80722	D	1	P	0.46395	0.877	B	0.36766	0.232	T	0.20940	-1.0260	9	0.72032	D	0.01	.	5.7399	0.18087	0.0:1.0:0.0:0.0	.	82	P0C5J1	F86B2_HUMAN	K	82	ENSP00000262365:E82K	ENSP00000262365:E82K	E	-	1	0	FAM86B2	12332328	0.994000	0.37717	0.994000	0.49952	0.123000	0.20343	2.765000	0.47621	0.945000	0.37605	0.162000	0.16502	GAG	FAM86B2	-	NULL	ENSG00000145002		0.537	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86B2	HGNC	protein_coding		184	0.54	1	C	XM_928336		12287957	12287957	-1	no_errors	ENST00000262365	ensembl	human	known	69_37n	missense	85	10.42	10	SNP	1.000	T
FAM86EP	348926	genome.wustl.edu	37	4	3943928	3943928	+	RNA	SNP	C	C	T	rs34752642	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr4:3943928C>T	ENST00000313946.8	-	0	2403									family with sequence similarity 86, member E, pseudogene																		CGGGGAAGTTCCCAGAAAGCG	0.587													.|||	4170	0.832668	0.9463	0.8372	5008	,	,		18794	0.8353		0.7694	False		,,,				2504	0.7382					dbGAP											0																																										-	-	-			0					4p16.3	2011-07-01			ENSG00000251669	ENSG00000251669			28017	pseudogene	pseudogene						12477932	Standard	NR_024253		Approved		uc011bvu.2		OTTHUMG00000159867		4.37:g.3943928C>T				RNA	SNP	-	NULL	ENST00000313946.8	37	NULL		4																																																																																			FAM86EP	-	-	ENSG00000251669		0.587	FAM86EP-002	KNOWN	basic	processed_transcript	FAM86EP	HGNC	pseudogene	OTTHUMT00000357822.1	15	0.00	0	C			3943928	3943928	-1	no_errors	ENST00000313946	ensembl	human	known	69_37n	rna	17	29.17	7	SNP	0.000	T
FAM86EP	348926	genome.wustl.edu	37	4	3944888	3944888	+	RNA	SNP	T	T	C	rs6845024	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr4:3944888T>C	ENST00000313946.8	-	0	1443									family with sequence similarity 86, member E, pseudogene																		TGGAAATTAATATTCTCCAAA	0.433													.|||	1979	0.395168	0.4448	0.6239	5008	,	,		18754	0.2262		0.4742	False		,,,				2504	0.2587					dbGAP											0																																										-	-	-			0					4p16.3	2011-07-01			ENSG00000251669	ENSG00000251669			28017	pseudogene	pseudogene						12477932	Standard	NR_024253		Approved		uc011bvu.2		OTTHUMG00000159867		4.37:g.3944888T>C				RNA	SNP	-	NULL	ENST00000313946.8	37	NULL		4																																																																																			FAM86EP	-	-	ENSG00000251669		0.433	FAM86EP-002	KNOWN	basic	processed_transcript	FAM86EP	HGNC	pseudogene	OTTHUMT00000357822.1	76	0.00	0	T			3944888	3944888	-1	no_errors	ENST00000313946	ensembl	human	known	69_37n	rna	63	13.51	10	SNP	0.289	C
FAM86EP	348926	genome.wustl.edu	37	4	3957091	3957091	+	RNA	SNP	C	C	T	rs12186334	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr4:3957091C>T	ENST00000313946.8	-	0	51				AC226119.5_ENST00000281228.8_RNA					family with sequence similarity 86, member E, pseudogene																		CGCCAGGAAGCGGCGCTCGAA	0.751													.|||	3028	0.604633	0.7292	0.598	5008	,	,		10319	0.6577		0.497	False		,,,				2504	0.4969					dbGAP											0																																										-	-	-			0					4p16.3	2011-07-01			ENSG00000251669	ENSG00000251669			28017	pseudogene	pseudogene						12477932	Standard	NR_024253		Approved		uc011bvu.2		OTTHUMG00000159867		4.37:g.3957091C>T				RNA	SNP	-	NULL	ENST00000313946.8	37	NULL		4																																																																																			FAM86EP	-	-	ENSG00000251669		0.751	FAM86EP-002	KNOWN	basic	processed_transcript	FAM86EP	HGNC	pseudogene	OTTHUMT00000357822.1	33	0.00	0	C			3957091	3957091	-1	no_errors	ENST00000313946	ensembl	human	known	69_37n	rna	20	20.00	5	SNP	0.998	T
FBXL2	25827	genome.wustl.edu	37	3	33414628	33414628	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:33414628A>G	ENST00000484457.1	+	6	426	c.335A>G	c.(334-336)aAt>aGt	p.N112S	FBXL2_ENST00000283627.6_3'UTR|FBXL2_ENST00000446237.3_5'UTR|FBXL2_ENST00000538892.1_Missense_Mutation_p.N112S|FBXL2_ENST00000538181.1_Missense_Mutation_p.N28S|FBXL2_ENST00000507198.1_Missense_Mutation_p.N112S|FBXL2_ENST00000542085.1_5'UTR	NM_012157.3	NP_036289.3			F-box and leucine-rich repeat protein 2											endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|urinary_tract(1)	15						TTGAACCTCAATGGATGCACA	0.418																																						dbGAP											0													142.0	140.0	140.0					3																	33414628		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF174589	CCDS2658.1, CCDS54560.1	3p22.3	2011-06-09			ENSG00000153558	ENSG00000153558		"""F-boxes / Leucine-rich repeats"""	13598	protein-coding gene	gene with protein product		605652				10508920, 10531035	Standard	NM_012157		Approved	FBL2, FBL3	uc003cfp.3	Q9UKC9	OTTHUMG00000130745	ENST00000484457.1:c.335A>G	3.37:g.33414628A>G	ENSP00000417601:p.Asn112Ser			Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom_cyclin-like	p.N112S	ENST00000484457.1	37	c.335	CCDS2658.1	3	.	.	.	.	.	.	.	.	.	.	A	7.545	0.661500	0.14645	.	.	ENSG00000153558	ENST00000484457;ENST00000538892;ENST00000538181;ENST00000507198	T;T;T;T	0.20332	4.34;4.37;2.08;4.37	5.04	5.04	0.67666	.	0.045565	0.85682	N	0.000000	T	0.08714	0.0216	N	0.02960	-0.455	0.80722	D	1	B;B	0.17268	0.021;0.002	B;B	0.23716	0.048;0.007	T	0.12915	-1.0529	10	0.02654	T	1	.	14.1117	0.65126	1.0:0.0:0.0:0.0	.	28;112	B4E1B8;Q9UKC9	.;FBXL2_HUMAN	S	112;112;28;112	ENSP00000417601:N112S;ENSP00000441228:N112S;ENSP00000440794:N28S;ENSP00000426163:N112S	ENSP00000408895:N112S	N	+	2	0	FBXL2	33389632	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.228000	0.95250	2.212000	0.71576	0.529000	0.55759	AAT	FBXL2	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000153558		0.418	FBXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL2	HGNC	protein_coding	OTTHUMT00000253245.2	59	0.00	0	A	NM_012157		33414628	33414628	+1	no_errors	ENST00000484457	ensembl	human	known	69_37n	missense	34	22.73	10	SNP	1.000	G
FAM86HP	729375	genome.wustl.edu	37	3	129821650	129821650	+	RNA	SNP	G	G	A	rs56088005	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:129821650G>A	ENST00000500074.2	-	0	495									family with sequence similarity 86, member H, pseudogene																		GGTTGCGGACGGTAAAGGCCA	0.667													g|||	1508	0.301118	0.1861	0.3775	5008	,	,		15451	0.249		0.4344	False		,,,				2504	0.319					dbGAP											0																																										-	-	-			0					3q22.1	2011-07-01			ENSG00000253540	ENSG00000253540			42359	pseudogene	pseudogene							Standard	NR_024252		Approved		uc011ble.1		OTTHUMG00000159796		3.37:g.129821650G>A				RNA	SNP	-	NULL	ENST00000500074.2	37	NULL		3																																																																																			FAM86HP	-	-	ENSG00000253540		0.667	FAM86HP-002	PUTATIVE	basic	processed_transcript	FAM86HP	HGNC	pseudogene	OTTHUMT00000358348.1	123	0.81	1	G			129821650	129821650	-1	no_errors	ENST00000500074	ensembl	human	putative	69_37n	rna	108	11.48	14	SNP	0.945	A
FCGBP	8857	genome.wustl.edu	37	19	40392585	40392585	+	Missense_Mutation	SNP	T	T	G	rs79253448|rs2542321	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr19:40392585T>G	ENST00000221347.6	-	16	7926	c.7919A>C	c.(7918-7920)gAg>gCg	p.E2640A		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2640	VWFD 6. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GATACAGCCCTCGCTCCCCGG	0.672													T|||	1633	0.326078	0.4002	0.2968	5008	,	,		24738	0.2917		0.3559	False		,,,				2504	0.2515					dbGAP											0													55.0	60.0	58.0					19																	40392585		2192	4300	6492	-	-	-	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.7919A>C	19.37:g.40392585T>G	ENSP00000221347:p.Glu2640Ala		O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.E2640A	ENST00000221347.6	37	c.7919	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	T	0.014	-1.603974	0.00849	.	.	ENSG00000090920	ENST00000221347	T	0.19938	2.11	1.95	-1.62	0.08372	von Willebrand factor, type D domain (1);	1.431730	0.05309	U	0.524414	T	0.15825	0.0381	L	0.35249	1.045	0.80722	P	0.0	B	0.21520	0.057	B	0.26864	0.074	T	0.38802	-0.9644	9	0.17832	T	0.49	.	7.8608	0.29509	0.0:0.5271:0.0:0.4729	.	2640	Q9Y6R7	FCGBP_HUMAN	A	2640	ENSP00000221347:E2640A	ENSP00000221347:E2640A	E	-	2	0	FCGBP	45084425	0.255000	0.24002	0.000000	0.03702	0.046000	0.14306	-0.115000	0.10741	-0.552000	0.06167	0.248000	0.18094	GAG	FCGBP	-	NULL	ENSG00000090920		0.672	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	93	0.00	0	T	NM_003890		40392585	40392585	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	missense	101	12.17	14	SNP	0.000	G
FHAD1	114827	genome.wustl.edu	37	1	15616139	15616139	+	Missense_Mutation	SNP	G	G	A	rs486557	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:15616139G>A	ENST00000375998.4	+	3	545	c.545G>A	c.(544-546)cGc>cAc	p.R182H	FHAD1_ENST00000375999.3_Missense_Mutation_p.R182H|FHAD1_ENST00000358897.4_Missense_Mutation_p.R182H|FHAD1_ENST00000417793.1_Missense_Mutation_p.R182H			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	182										skin(1)|stomach(1)	2						GACGACGCCCGCAAGCCACCC	0.612													G|||	1042	0.208067	0.2073	0.2089	5008	,	,		16676	0.0417		0.326	False		,,,				2504	0.2587					dbGAP											0													28.0	36.0	34.0					1																	15616139		692	1591	2283	-	-	-	SO:0001583	missense	0			AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.545G>A	1.37:g.15616139G>A	ENSP00000365166:p.Arg182His		Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.R182H	ENST00000375998.4	37	c.545		1	473	0.21657509157509158	110	0.22357723577235772	100	0.27624309392265195	22	0.038461538461538464	241	0.3179419525065963	G	5.490	0.275364	0.10403	.	.	ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998	T;T;T;T	0.46819	0.88;0.87;0.86;0.88	3.77	-7.54	0.01332	.	1.620530	0.04279	N	0.343560	T	0.00012	0.0000	N	0.02539	-0.55	0.50313	P	1.36000000000025E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.17228	-1.0376	9	0.36615	T	0.2	-1.7323	12.0544	0.53527	0.1394:0.6827:0.178:0.0	rs486557;rs3765352;rs52797627;rs60426766;rs486557	182	B1AJZ9	FHAD1_HUMAN	H	182	ENSP00000351770:R182H;ENSP00000407615:R182H;ENSP00000365167:R182H;ENSP00000365166:R182H	ENSP00000351770:R182H	R	+	2	0	FHAD1	15488726	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.847000	0.04331	-1.849000	0.01171	-1.154000	0.01816	CGC	FHAD1	-	NULL	ENSG00000142621		0.612	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	FHAD1	HGNC	protein_coding	OTTHUMT00000393400.2	62	0.00	0	G	NM_052929		15616139	15616139	+1	no_errors	ENST00000375999	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.000	A
FKBP1A	2280	genome.wustl.edu	37	20	1350508	1350508	+	3'UTR	SNP	A	A	G	rs11712	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr20:1350508A>G	ENST00000400137.4	-	0	735				FKBP1A_ENST00000460490.1_5'UTR|FKBP1A_ENST00000381724.3_3'UTR|SDCBP2-AS1_ENST00000609285.1_RNA|SDCBP2-AS1_ENST00000609470.1_RNA|SDCBP2-AS1_ENST00000446423.1_RNA	NM_000801.4	NP_000792.1	P62942	FKB1A_HUMAN	FK506 binding protein 1A, 12kDa						'de novo' protein folding (GO:0006458)|amyloid fibril formation (GO:1990000)|calcium ion transmembrane transport (GO:0070588)|chaperone-mediated protein folding (GO:0061077)|extracellular fibril organization (GO:0043206)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)|protein peptidyl-prolyl isomerization (GO:0000413)|protein refolding (GO:0042026)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of amyloid precursor protein catabolic process (GO:1902991)|regulation of immune response (GO:0050776)|regulation of protein localization (GO:0032880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|SMAD protein complex assembly (GO:0007183)|T cell activation (GO:0042110)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|terminal cisterna (GO:0014802)|Z disc (GO:0030018)	activin binding (GO:0048185)|FK506 binding (GO:0005528)|ion channel binding (GO:0044325)|macrolide binding (GO:0005527)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|type I transforming growth factor beta receptor binding (GO:0034713)			central_nervous_system(1)|lung(1)|upper_aerodigestive_tract(1)	3					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)	AATAAAATGAATAACTTGAGG	0.373													A|||	2908	0.580671	0.4418	0.5533	5008	,	,		16642	0.8433		0.4891	False		,,,				2504	0.6115					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			M92423	CCDS13014.1, CCDS74688.1	20p13	2013-03-20	2002-08-29		ENSG00000088832	ENSG00000088832			3711	protein-coding gene	gene with protein product	"""calstabin 1"""	186945	"""FK506-binding protein 1A (12kD)"""	FKBP1		1930186	Standard	NM_000801		Approved	FKBP-12, FKBP12, PKC12, PPIASE, FKBP12C	uc002wey.3	P62942	OTTHUMG00000031666	ENST00000400137.4:c.*245T>C	20.37:g.1350508A>G			D3DVW6|P20071|Q4VC47|Q6FGD9|Q6LEU3|Q9H103|Q9H566	RNA	SNP	-	NULL	ENST00000400137.4	37	NULL	CCDS13014.1	20																																																																																			FKBP1A	-	-	ENSG00000088832		0.373	FKBP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP1A	HGNC	protein_coding	OTTHUMT00000077534.2	29	0.00	0	A			1350508	1350508	-1	no_errors	ENST00000460490	ensembl	human	known	69_37n	rna	32	15.79	6	SNP	0.886	G
FLJ37453	729614	genome.wustl.edu	37	1	16162092	16162092	+	RNA	SNP	G	G	C	rs4661664	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:16162092G>C	ENST00000317122.1	-	0	1349				RP11-169K16.9_ENST00000535249.1_RNA	NR_024279.1																						CGGGGGCTGAGCAGTGGCAGA	0.632													G|||	722	0.144169	0.3676	0.0994	5008	,	,		12249	0.0089		0.0934	False		,,,				2504	0.0654					dbGAP											0																																										-	-	-			0																															1.37:g.16162092G>C				RNA	SNP	-	NULL	ENST00000317122.1	37	NULL		1																																																																																			RP11-169K16.9	-	-	ENSG00000179743		0.632	RP11-169K16.9-001	KNOWN	basic	antisense	FLJ37453	Clone_based_vega_gene	antisense	OTTHUMT00000025992.1	94	0.00	0	G			16162092	16162092	-1	no_errors	ENST00000317122	ensembl	human	known	69_37n	rna	64	12.33	9	SNP	0.006	C
FLJ46906	441172	genome.wustl.edu	37	6	139017815	139017815	+	RNA	SNP	A	A	G	rs550769421|rs9399249	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr6:139017815A>G	ENST00000432673.1	+	0	307				RP11-390P2.4_ENST00000447494.1_RNA|RP11-390P2.4_ENST00000428044.1_RNA|RP11-390P2.4_ENST00000458733.1_RNA																							GCTAGCaggcaagagaggggt	0.577													G|||	3759	0.750599	0.8328	0.6556	5008	,	,		17400	0.9206		0.503	False		,,,				2504	0.7863					dbGAP											0																																										-	-	-			0																															6.37:g.139017815A>G				RNA	SNP	-	NULL	ENST00000432673.1	37	NULL		6																																																																																			RP11-390P2.4	-	-	ENSG00000225177		0.577	RP11-390P2.4-001	KNOWN	basic	antisense	FLJ46906	Clone_based_vega_gene	antisense	OTTHUMT00000042434.1	49	0.00	0	A			139017815	139017815	+1	no_errors	ENST00000428044	ensembl	human	known	69_37n	rna	24	20.00	6	SNP	0.000	G
FLNC	2318	genome.wustl.edu	37	7	128485100	128485100	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr7:128485100C>A	ENST00000325888.8	+	21	3842	c.3581C>A	c.(3580-3582)tCg>tAg	p.S1194*	FLNC_ENST00000346177.6_Nonsense_Mutation_p.S1194*	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1194					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)	p.S1194L(1)		biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GAGATCCTGTCGGATGCCGGG	0.632																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											46.0	54.0	51.0					7																	128485100		2195	4285	6480	-	-	-	SO:0001587	stop_gained	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.3581C>A	7.37:g.128485100C>A	ENSP00000327145:p.Ser1194*		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Nonsense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.S1194*	ENST00000325888.8	37	c.3581	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	C	42	9.763202	0.99257	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.5273	0.95212	0.0:1.0:0.0:0.0	.	.	.	.	X	1194	.	ENSP00000327145:S1194X	S	+	2	0	FLNC	128272336	1.000000	0.71417	0.854000	0.33618	0.310000	0.27922	7.818000	0.86416	2.615000	0.88500	0.555000	0.69702	TCG	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.632	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	25	0.00	0	C			128485100	128485100	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	nonsense	23	42.50	17	SNP	0.999	A
FOLH1B	219595	genome.wustl.edu	37	11	89392653	89392653	+	RNA	SNP	A	A	G	rs10765230	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr11:89392653A>G	ENST00000532352.1	+	0	528							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						TGATATTACCAAATCTGGAAC	0.348													G|||	1038	0.207268	0.1346	0.2277	5008	,	,		17248	0.0873		0.3648	False		,,,				2504	0.2526					dbGAP											0																																										-	-	-			0			AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89392653A>G				RNA	SNP	-	NULL	ENST00000532352.1	37	NULL		11																																																																																			FOLH1B	-	-	ENSG00000134612		0.348	FOLH1B-004	KNOWN	basic	processed_transcript	FOLH1B	HGNC	pseudogene	OTTHUMT00000395421.1	15	0.00	0	A	NM_153696		89392653	89392653	+1	no_errors	ENST00000525540	ensembl	human	known	69_37n	rna	15	25.00	5	SNP	0.000	G
FTCD	10841	genome.wustl.edu	37	21	47556809	47556809	+	3'UTR	SNP	C	C	T	rs1047209	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr21:47556809C>T	ENST00000397746.3	-	0	1761				FTCD_ENST00000397743.1_3'UTR|FTCD_ENST00000359679.2_Intron|FTCD_ENST00000355384.2_Intron|FTCD_ENST00000498355.2_Intron|FTCD_ENST00000397748.1_Intron|FTCD_ENST00000291670.5_Intron	NM_206965.1	NP_996848.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase						cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	GGGCCCCACACGAACAAGCTG	0.687													C|||	794	0.158546	0.0726	0.1167	5008	,	,		17978	0.3244		0.1322	False		,,,				2504	0.1605					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000397746.3:c.*92G>A	21.37:g.47556809C>T			B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	Missense_Mutation	SNP	pfam_Cyclodeamin/CycHdrlase,superfamily_Cyclodeamin/CycHdrlase	p.R107H	ENST00000397746.3	37	c.320	CCDS13731.1	21	368	0.1684981684981685	30	0.06097560975609756	33	0.09116022099447514	207	0.3618881118881119	98	0.12928759894459102	C	1.234	-0.623272	0.03636	.	.	ENSG00000160282	ENST00000446405	.	.	.	2.0	-4.0	0.04057	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.17349	-1.0372	3	.	.	.	.	2.2328	0.04001	0.1566:0.3588:0.3501:0.1346	rs1047209;rs3187239	.	.	.	H	107	.	.	R	-	2	0	FTCD	46381237	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.112000	0.00599	-3.736000	0.00113	-2.605000	0.00161	CGT	FTCD	-	NULL	ENSG00000160282		0.687	FTCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTCD	HGNC	protein_coding	OTTHUMT00000206959.1	46	0.00	0	C	NM_006657		47556809	47556809	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000446405	ensembl	human	putative	69_37n	missense	33	15.38	6	SNP	0.000	T
GABRP	2568	genome.wustl.edu	37	5	170232723	170232723	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr5:170232723G>A	ENST00000518525.1	+	8	1009	c.545G>A	c.(544-546)gGc>gAc	p.G182D	GABRP_ENST00000265294.4_Missense_Mutation_p.G182D|GABRP_ENST00000519385.1_Missense_Mutation_p.G182D|GABRP_ENST00000519598.1_Missense_Mutation_p.G182D			O00591	GBRP_HUMAN	gamma-aminobutyric acid (GABA) A receptor, pi	182					signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(4)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	29	Renal(175;0.000159)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TTGCCAGGGGGCTATGATGGA	0.502																																						dbGAP											0													69.0	64.0	66.0					5																	170232723		2203	4300	6503	-	-	-	SO:0001583	missense	0			U95367	CCDS4375.1, CCDS75368.1	5q35.1	2012-06-22			ENSG00000094755	ENSG00000094755		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4089	protein-coding gene	gene with protein product	"""GABA(A) receptor, pi"""	602729				9182563	Standard	NM_014211		Approved		uc003mau.3	O00591	OTTHUMG00000130443	ENST00000518525.1:c.545G>A	5.37:g.170232723G>A	ENSP00000430100:p.Gly182Asp		A8KA36|D3DQL2|Q32MJ1	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAp_rcpt,prints_GABAA_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.G182D	ENST00000518525.1	37	c.545	CCDS4375.1	5	.	.	.	.	.	.	.	.	.	.	G	22.2	4.253999	0.80135	.	.	ENSG00000094755	ENST00000522868;ENST00000518525;ENST00000539175;ENST00000265294;ENST00000519385;ENST00000519598	T;T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29;-1.29	5.27	5.27	0.74061	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.92586	0.7645	M	0.93507	3.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.94360	0.7587	10	0.87932	D	0	.	18.5085	0.90907	0.0:0.0:1.0:0.0	.	182;182	E7EWG0;O00591	.;GBRP_HUMAN	D	182;182;80;182;182;182	ENSP00000430188:G182D;ENSP00000430100:G182D;ENSP00000265294:G182D;ENSP00000430727:G182D;ENSP00000430772:G182D	ENSP00000265294:G182D	G	+	2	0	GABRP	170165301	1.000000	0.71417	0.988000	0.46212	0.380000	0.30137	9.684000	0.98659	2.465000	0.83290	0.655000	0.94253	GGC	GABRP	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000094755		0.502	GABRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRP	HGNC	protein_coding	OTTHUMT00000252834.3	72	0.00	0	G	NM_014211		170232723	170232723	+1	no_errors	ENST00000265294	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	A
GLP2R	9340	genome.wustl.edu	37	17	9769199	9769199	+	Intron	SNP	T	T	C	rs756223	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:9769199T>C	ENST00000262441.5	+	9	1569				GLP2R_ENST00000574745.1_Intron	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)			endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	gagcattccctttggtcacaa	0.418													C|||	1713	0.342053	0.612	0.2896	5008	,	,		21802	0.2927		0.1233	False		,,,				2504	0.2904					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.1056+3792T>C	17.37:g.9769199T>C			Q4VAT3	Silent	SNP	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.P221	ENST00000262441.5	37	c.663	CCDS11150.1	17	640	0.29304029304029305	303	0.6158536585365854	90	0.24861878453038674	162	0.28321678321678323	85	0.11213720316622691	C	6.595	0.478230	0.12521	.	.	ENSG00000065325	ENST00000304773	.	.	.	2.02	-4.02	0.04034	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.38178	-0.9673	4	0.66056	D	0.02	.	4.5335	0.12017	0.1706:0.2265:0.0:0.603	rs756223	.	.	.	L	344	.	ENSP00000303605:F344L	F	+	1	0	GLP2R	9709924	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-1.805000	0.01737	-1.716000	0.01387	-0.166000	0.13349	TTT	GLP2R	-	NULL	ENSG00000065325		0.418	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLP2R	HGNC	protein_coding	OTTHUMT00000252601.4	67	0.00	0	T			9769199	9769199	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000458005	ensembl	human	putative	69_37n	silent	32	15.79	6	SNP	0.000	C
GPR153	387509	genome.wustl.edu	37	1	6313938	6313938	+	Missense_Mutation	SNP	C	C	T	rs12735670	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:6313938C>T	ENST00000377893.2	-	3	885	c.626G>A	c.(625-627)cGc>cAc	p.R209H		NM_207370.2	NP_997253.2	Q6NV75	GP153_HUMAN	G protein-coupled receptor 153	209			R -> H (in dbSNP:rs12735670). {ECO:0000269|PubMed:12679517, ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|liver(1)|lung(7)|skin(1)	14	Ovarian(185;0.0634)	all_cancers(23;8.07e-33)|all_epithelial(116;4.45e-18)|all_lung(118;1.09e-06)|all_neural(13;3.68e-06)|Lung NSC(185;1.52e-05)|all_hematologic(16;2.39e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.91e-37)|GBM - Glioblastoma multiforme(13;4.87e-29)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;1.33e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.246)		GAAGGCGCGGCGGTCGGCCTG	0.701													C|||	3501	0.699081	0.702	0.7939	5008	,	,		17470	0.6131		0.7117	False		,,,				2504	0.7035					dbGAP											0													31.0	33.0	32.0					1																	6313938		2199	4295	6494	-	-	-	SO:0001583	missense	0			AY255529	CCDS64.1	1p36.31	2012-08-21			ENSG00000158292	ENSG00000158292		"""GPCR / Class A : Orphans"""	23618	protein-coding gene	gene with protein product		614269				12679517	Standard	NM_207370		Approved	PGR1	uc001amp.2	Q6NV75	OTTHUMG00000001272	ENST00000377893.2:c.626G>A	1.37:g.6313938C>T	ENSP00000367125:p.Arg209His		Q5TGR5|Q6AHW8|Q86SP8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_GPCR_153,prints_GPCR_153/162	p.R209H	ENST00000377893.2	37	c.626	CCDS64.1	1	1502	0.6877289377289377	339	0.6890243902439024	279	0.7707182320441989	338	0.5909090909090909	546	0.7203166226912929	C	5.326	0.245509	0.10077	.	.	ENSG00000158292	ENST00000377893	T	0.42513	0.97	4.9	2.03	0.26663	GPCR, rhodopsin-like superfamily (1);	0.292679	0.37095	N	0.002257	T	0.00012	0.0000	N	0.14661	0.345	0.32111	P	0.589358	B	0.15141	0.012	B	0.14578	0.011	T	0.26916	-1.0089	9	0.20046	T	0.44	-31.5101	7.4677	0.27330	0.0:0.5669:0.0:0.4331	rs12735670;rs58824924	209	Q6NV75	GP153_HUMAN	H	209	ENSP00000367125:R209H	ENSP00000367125:R209H	R	-	2	0	GPR153	6236525	0.995000	0.38212	0.331000	0.25455	0.025000	0.11179	0.366000	0.20365	0.147000	0.19030	-0.448000	0.05591	CGC	GPR153	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_GPCR_153	ENSG00000158292		0.701	GPR153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR153	HGNC	protein_coding	OTTHUMT00000003717.2	58	0.00	0	C			6313938	6313938	-1	no_errors	ENST00000377893	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.988	T
GUSBP11	91316	genome.wustl.edu	37	22	24001975	24001975	+	RNA	SNP	A	A	T	rs5751704	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr22:24001975A>T	ENST00000455485.1	-	0	3360				KB-1572G7.2_ENST00000421064.1_RNA|AP000347.2_ENST00000417194.1_RNA			Q6P575	BGP11_HUMAN	glucuronidase, beta pseudogene 11						carbohydrate metabolic process (GO:0005975)		hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)										TCTTACAATCAAAGTGTCCAG	0.433													A|||	2635	0.526158	0.3782	0.6023	5008	,	,		21064	0.6081		0.503	False		,,,				2504	0.6115					dbGAP											0																																										-	-	-			0					22q11.23	2011-06-09			ENSG00000228315	ENSG00000228315			42325	pseudogene	pseudogene							Standard	NR_024448		Approved		uc011aiz.2	Q6P575	OTTHUMG00000150709		22.37:g.24001975A>T				RNA	SNP	-	NULL	ENST00000455485.1	37	NULL		22																																																																																			GUSBP11	-	-	ENSG00000228315		0.433	GUSBP11-005	KNOWN	basic|readthrough_transcript	processed_transcript	GUSBP11	HGNC	processed_transcript	OTTHUMT00000319697.1	117	0.85	1	A			24001975	24001975	-1	no_errors	ENST00000417194	ensembl	human	known	69_37n	rna	72	11.11	9	SNP	0.438	T
HDHD1	8226	genome.wustl.edu	37	X	6975752	6975752	+	Intron	SNP	G	G	T	rs5978220	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chrX:6975752G>T	ENST00000381077.5	-	4	587				HDHD1_ENST00000412827.2_Intron|HDHD1_ENST00000424830.2_Intron|HDHD1_ENST00000540122.1_Missense_Mutation_p.T208N	NM_001178136.1|NM_012080.4	NP_001171607.1|NP_036212.3	Q08623	HDHD1_HUMAN	haloacid dehalogenase-like hydrolase domain containing 1						nucleotide metabolic process (GO:0009117)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)			breast(2)|large_intestine(1)|lung(3)	6						GTGCGGTCAGGTGTCATCAGA	0.567													G|||	1308	0.34649	0.3434	0.17	3775	,	,		13241	0.2381		0.2266	False		,,,				2504	0.274					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M86934	CCDS48075.1, CCDS48076.1, CCDS55366.1, CCDS55367.1	Xp22.32	2010-07-21	2010-07-21	2010-07-21	ENSG00000130021	ENSG00000130021			16818	protein-coding gene	gene with protein product		306480	"""family with sequence similarity 16, member A, X-linked"", ""haloacid dehalogenase-like hydrolase domain containing 1A"""	FAM16AX, HDHD1A		1734713, 1284467	Standard	NM_012080		Approved	DXF68S1E, GS1	uc011mhm.1	Q08623	OTTHUMG00000021101	ENST00000381077.5:c.511-7239C>A	X.37:g.6975752G>T			B2R7X6|B4DV93|B7Z6Q3|E9PAV8|F5GWZ2|Q53F84|Q96EB8	Missense_Mutation	SNP	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom	p.T208N	ENST00000381077.5	37	c.623	CCDS48075.1	X	557	0.3357444243520193	118	0.30569948186528495	48	0.1568627450980392	91	0.18571428571428572	118	0.18553459119496854	G	2.593	-0.294797	0.05568	.	.	ENSG00000130021	ENST00000540122	T	0.33438	1.41	1.15	1.15	0.20763	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	P	0.38800	0.648	B	0.31290	0.127	T	0.44937	-0.9295	6	.	.	.	.	5.3176	0.15864	0.0:0.0:1.0:0.0	rs5978220;rs58857365;rs5978220	208	Q08623-3	.	N	208	ENSP00000441208:T208N	.	T	-	2	0	HDHD1	6985752	0.003000	0.15002	0.001000	0.08648	0.005000	0.04900	1.306000	0.33505	0.865000	0.35603	0.429000	0.28392	ACC	HDHD1	-	NULL	ENSG00000130021		0.567	HDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDHD1	HGNC	protein_coding	OTTHUMT00000055683.2	53	0.00	0	G	NM_012080		6975752	6975752	-1	no_errors	ENST00000540122	ensembl	human	known	69_37n	missense	44	13.73	7	SNP	0.001	T
HEATR6	63897	genome.wustl.edu	37	17	58136860	58136860	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:58136860T>C	ENST00000184956.6	-	11	1662	c.1646A>G	c.(1645-1647)aAt>aGt	p.N549S	HEATR6_ENST00000585976.1_Missense_Mutation_p.N549S	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	549							poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			ATAAGGTGCATTTGATACTAA	0.363																																						dbGAP											0													113.0	105.0	107.0					17																	58136860		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.1646A>G	17.37:g.58136860T>C	ENSP00000184956:p.Asn549Ser		B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.N549S	ENST00000184956.6	37	c.1646	CCDS11623.1	17	.	.	.	.	.	.	.	.	.	.	T	23.7	4.449855	0.84101	.	.	ENSG00000068097	ENST00000184956;ENST00000393017	T	0.63096	-0.02	5.81	5.81	0.92471	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75613	0.3873	L	0.60455	1.87	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.73827	-0.3860	10	0.36615	T	0.2	-21.2444	15.7122	0.77641	0.0:0.0:0.0:1.0	.	396;549	E7ESB9;Q6AI08	.;HEAT6_HUMAN	S	549;396	ENSP00000184956:N549S	ENSP00000184956:N549S	N	-	2	0	HEATR6	55491642	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.531000	0.81973	2.367000	0.80283	0.529000	0.55759	AAT	HEATR6	-	superfamily_ARM-type_fold	ENSG00000068097		0.363	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR6	HGNC	protein_coding	OTTHUMT00000449165.1	38	0.00	0	T	NM_022070		58136860	58136860	-1	no_errors	ENST00000184956	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	1.000	C
MROH2A	339766	genome.wustl.edu	37	2	234703136	234703136	+	Missense_Mutation	SNP	T	T	C	rs6431634	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr2:234703136T>C	ENST00000389758.3	+	8	1116	c.950T>C	c.(949-951)gTg>gCg	p.V317A				A6NES4	MRO2A_HUMAN	maestro heat-like repeat family member 2A	347																	AGTCTGGAGGTGCTCTTCGTC	0.632													C|||	3207	0.640375	0.7277	0.6556	5008	,	,		17678	0.6925		0.5656	False		,,,				2504	0.5348					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS74674.1	2q37.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000185038	ENSG00000185038		"""maestro heat-like repeat containing"""	27936	protein-coding gene	gene with protein product			"""HEAT repeat containing 7B1"""	HEATR7B1		12477932	Standard	NM_001287395		Approved			A6NES4	OTTHUMG00000059037	ENST00000389758.3:c.950T>C	2.37:g.234703136T>C	ENSP00000374408:p.Val317Ala			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.V317A	ENST00000389758.3	37	c.950		2	1420	0.6501831501831502	342	0.6951219512195121	229	0.6325966850828729	412	0.7202797202797203	437	0.5765171503957783	C	0.225	-1.025280	0.02061	.	.	ENSG00000185038	ENST00000389758	T	0.04317	3.65	5.32	5.32	0.75619	.	0.222820	0.22908	N	0.054168	T	0.00012	0.0000	.	.	.	0.49051	P	2.5200000000003E-4	.	.	.	.	.	.	T	0.01345	-1.1379	6	0.06757	T	0.87	.	10.501	0.44806	0.0:0.9096:0.0:0.0904	rs6431634;rs52799814;rs56522011;rs58363724;rs6431634	.	.	.	A	317	ENSP00000374408:V317A	ENSP00000374408:V317A	V	+	2	0	HEATR7B1	234367875	0.963000	0.33076	0.867000	0.34043	0.006000	0.05464	2.250000	0.43178	1.396000	0.46663	-0.215000	0.12644	GTG	HEATR7B1	-	superfamily_ARM-type_fold	ENSG00000185038		0.632	MROH2A-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	HEATR7B1	HGNC	protein_coding	OTTHUMT00000130646.6	33	0.00	0	T	XM_291007		234703136	234703136	+1	no_errors	ENST00000389758	ensembl	human	novel	69_37n	missense	30	11.76	4	SNP	0.948	C
MROH2A	339766	genome.wustl.edu	37	2	234704318	234704318	+	Missense_Mutation	SNP	A	A	G	rs2361503	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr2:234704318A>G	ENST00000389758.3	+	9	1152	c.986A>G	c.(985-987)gAa>gGa	p.E329G				A6NES4	MRO2A_HUMAN	maestro heat-like repeat family member 2A	359																	CAGATCCTGGAACTGTCAGTC	0.552													A|||	3269	0.652756	0.7791	0.6599	5008	,	,		21529	0.6796		0.5666	False		,,,				2504	0.5378					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS74674.1	2q37.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000185038	ENSG00000185038		"""maestro heat-like repeat containing"""	27936	protein-coding gene	gene with protein product			"""HEAT repeat containing 7B1"""	HEATR7B1		12477932	Standard	NM_001287395		Approved			A6NES4	OTTHUMG00000059037	ENST00000389758.3:c.986A>G	2.37:g.234704318A>G	ENSP00000374408:p.Glu329Gly			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E329G	ENST00000389758.3	37	c.986		2	1435	0.657051282051282	366	0.7439024390243902	233	0.643646408839779	401	0.701048951048951	435	0.5738786279683378	A	17.23	3.337455	0.60963	.	.	ENSG00000185038	ENST00000389758	T	0.09073	3.02	5.55	5.55	0.83447	.	0.000000	0.36591	N	0.002512	T	0.00012	0.0000	.	.	.	0.31217	P	0.6979770000000001	.	.	.	.	.	.	T	0.01858	-1.1259	6	0.49607	T	0.09	.	12.0769	0.53649	1.0:0.0:0.0:0.0	rs2361503;rs52811924;rs61429609;rs2361503	.	.	.	G	329	ENSP00000374408:E329G	ENSP00000374408:E329G	E	+	2	0	HEATR7B1	234369057	0.996000	0.38824	0.916000	0.36221	0.568000	0.35870	4.463000	0.60128	2.118000	0.64928	0.402000	0.26972	GAA	HEATR7B1	-	superfamily_ARM-type_fold	ENSG00000185038		0.552	MROH2A-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	HEATR7B1	HGNC	protein_coding	OTTHUMT00000130646.6	76	0.00	0	A	XM_291007		234704318	234704318	+1	no_errors	ENST00000389758	ensembl	human	novel	69_37n	missense	40	21.57	11	SNP	0.964	G
HES3	390992	genome.wustl.edu	37	1	6304439	6304439	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:6304439G>A	ENST00000377898.3	+	2	79	c.14G>A	c.(13-15)cGc>cAc	p.R5H		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	5	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		GAGAAAAAGCGCCGGGCACGC	0.622																																						dbGAP											0													48.0	55.0	52.0					1																	6304439		1961	4127	6088	-	-	-	SO:0001583	missense	0				CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.14G>A	1.37:g.6304439G>A	ENSP00000367130:p.Arg5His		Q5TGS0	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.R5H	ENST00000377898.3	37	c.14	CCDS41238.1	1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.602383	0.87157	.	.	ENSG00000173673	ENST00000377898	D	0.99722	-6.53	4.51	4.51	0.55191	Helix-loop-helix DNA-binding (5);	0.000000	0.56097	D	0.000035	D	0.99764	0.9904	H	0.94264	3.515	0.46279	D	0.998966	D	0.89917	1.0	D	0.91635	0.999	D	0.97108	0.9802	10	0.87932	D	0	14.3639	13.1525	0.59498	0.0:0.0:1.0:0.0	.	5	Q5TGS1	HES3_HUMAN	H	5	ENSP00000367130:R5H	ENSP00000367130:R5H	R	+	2	0	HES3	6227026	1.000000	0.71417	0.906000	0.35671	0.683000	0.39861	7.875000	0.87205	2.248000	0.74166	0.456000	0.33151	CGC	HES3	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000173673		0.622	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HES3	HGNC	protein_coding	OTTHUMT00000003716.3	26	0.00	0	G	NM_001024598		6304439	6304439	+1	no_errors	ENST00000377898	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	0.999	A
HLA-C	3107	genome.wustl.edu	37	6	31239577	31239577	+	Missense_Mutation	SNP	A	A	C	rs707911	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr6:31239577A>C	ENST00000376228.5	-	2	156	c.142T>G	c.(142-144)Tca>Gca	p.S48A	HLA-C_ENST00000383329.3_Missense_Mutation_p.S48A	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	48	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						TAGCCCACTGAGATGAAGCGG	0.721													N|||	3173	0.633586	0.705	0.6671	5008	,	,		12339	0.6161		0.5934	False		,,,				2504	0.5726					dbGAP											0													31.0	30.0	30.0					6																	31239577		1510	2704	4214	-	-	-	SO:0001583	missense	0			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.142T>G	6.37:g.31239577A>C	ENSP00000365402:p.Ser48Ala		O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.S85A	ENST00000376228.5	37	c.253	CCDS34393.1	6	1346|1346	0.6163003663003663|0.6163003663003663	334|334	0.6788617886178862|0.6788617886178862	245|245	0.6767955801104972|0.6767955801104972	334|334	0.583916083916084|0.583916083916084	433|433	0.5712401055408971|0.5712401055408971	N|N	4.403|4.403	0.074476|0.074476	0.08485|0.08485	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000415537|ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	.|T;T	.|0.00007	.|9.65;9.65	2.81|2.81	-5.62|-5.62	0.02481|0.02481	.|MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.|2.443560	.|0.02916	.|N	.|0.137302	T|T	0.00012|0.00012	0.0000|0.0000	.|.	.|.	.|.	0.80722|0.80722	P|P	0.0|0.0	.|B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0	.|B;B;B;B	.|0.10450	.|0.005;0.005;0.003;0.003	T|T	0.30031|0.30031	-0.9992|-0.9992	3|8	.|0.02654	.|T	.|1	.|.	1.0385|1.0385	0.01554|0.01554	0.4374:0.1213:0.2186:0.2227|0.4374:0.1213:0.2186:0.2227	rs707911;rs1050433;rs1050511;rs2308547;rs3175990;rs3179176;rs3190746;rs3200117;rs11547357;rs12721928;rs16893469|rs707911;rs1050433;rs1050511;rs2308547;rs3175990;rs3179176;rs3190746;rs3200117;rs11547357;rs12721928;rs16893469	.|48;48;48;48	.|A2AEA4;A6H578;A2AEA2;P10321	.|.;.;.;1C07_HUMAN	R|A	47|48;48;48;85	.|ENSP00000365402:S48A;ENSP00000372819:S48A	.|ENSP00000365402:S48A	L|S	-|-	2|1	0|0	HLA-C|HLA-C	31347556|31347556	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-10.610000|-10.610000	0.00006|0.00006	-3.265000|-3.265000	0.00201|0.00201	-4.734000|-4.734000	0.00003|0.00003	CTC|TCA	HLA-C	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000204525		0.721	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-C	HGNC	protein_coding	OTTHUMT00000076281.3	71	0.00	0	A	NM_002117		31239577	31239577	-1	no_errors	ENST00000539307	ensembl	human	known	69_37n	missense	67	10.67	8	SNP	0.000	C
HLA-DRB1	3123	genome.wustl.edu	37	6	32557478	32557478	+	Silent	SNP	C	C	A	rs9270301	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr6:32557478C>A	ENST00000360004.5	-	1	147	c.42G>T	c.(40-42)gcG>gcT	p.A14A		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	14					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						TCACTGTCAGCGCTGTCATGC	0.592										Multiple Myeloma(14;0.17)			c|||	1823	0.364018	0.3722	0.3559	5008	,	,		26176	0.4137		0.335	False		,,,				2504	0.3374					dbGAP											0													86.0	106.0	99.0					6																	32557478		1511	2709	4220	-	-	-	SO:0001819	synonymous_variant	0			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.42G>T	6.37:g.32557478C>A			P01914|Q9MYF5	Silent	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.A14	ENST00000360004.5	37	c.42	CCDS47409.1	6																																																																																			HLA-DRB1	-	superfamily_MHC_I/II-like_Ag-recog	ENSG00000196126		0.592	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DRB1	HGNC	protein_coding	OTTHUMT00000076393.3	162	0.61	1	C	NM_002124		32557478	32557478	-1	no_errors	ENST00000360004	ensembl	human	known	69_37n	silent	100	10.62	12	SNP	0.002	A
HSPA14	51182	genome.wustl.edu	37	10	14893133	14893133	+	Intron	SNP	G	G	A	rs118075029	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr10:14893133G>A	ENST00000378372.3	+	7	706					NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14						'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)			breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						AGTAGCTTTTGTATAAAATCT	0.274													G|||	68	0.0135783	0.0	0.0	5008	,	,		13237	0.0655		0.001	False		,,,				2504	0.001					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.468-85G>A	10.37:g.14893133G>A			A8K8F8|B0YIY9|Q9P0X2|Q9UI07	RNA	SNP	-	NULL	ENST00000378372.3	37	NULL	CCDS7103.1	10																																																																																			HSPA14	-	-	ENSG00000187522		0.274	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA14	HGNC	protein_coding	OTTHUMT00000046910.1	22	0.00	0	G	NM_016299		14893133	14893133	+1	no_errors	ENST00000470430	ensembl	human	known	69_37n	rna	17	19.05	4	SNP	0.000	A
IGHV5-51	28388	genome.wustl.edu	37	14	107034822	107034822	+	RNA	SNP	C	C	G	rs199503234	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr14:107034822C>G	ENST00000390626.2	-	0	316									immunoglobulin heavy variable 5-51																		AGATGGTGACCTGGCCTTGGA	0.597																																						dbGAP											0													114.0	126.0	122.0					14																	107034822		2125	4249	6374	-	-	-			0			M99686		14q32.33	2012-02-08			ENSG00000211966	ENSG00000211966		"""Immunoglobulins / IGH locus"""	5659	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151960		14.37:g.107034822C>G				Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.Q86H	ENST00000390626.2	37	c.258		14																																																																																			IGHV5-51	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211966		0.597	IGHV5-51-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV5-51	HGNC	IG_V_gene	OTTHUMT00000324606.1	59	0.00	0	C	NG_001019		107034822	107034822	-1	no_stop_codon	ENST00000390626	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	0.000	G
ITGAL	3683	genome.wustl.edu	37	16	30485393	30485393	+	Intron	SNP	G	G	C	rs11574938	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr16:30485393G>C	ENST00000356798.6	+	2	241				ITGAL_ENST00000358164.5_Intron|ITGAL_ENST00000433423.2_Intron|ITGAL_ENST00000454514.2_Intron|Y_RNA_ENST00000410769.1_RNA	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)						activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	CGCCCTGGAGGGGAAGCGCAG	0.667													G|||	2978	0.594649	0.1399	0.7017	5008	,	,		13391	0.9722		0.5586	False		,,,				2504	0.7812				NSCLC(110;1462 1641 3311 33990 49495)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.62-124G>C	16.37:g.30485393G>C			O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	NULL	p.G57R	ENST00000356798.6	37	c.169	CCDS32433.1	16																																																																																			ITGAL	-	NULL	ENSG00000005844		0.667	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAL	HGNC	protein_coding	OTTHUMT00000434508.2	18	0.00	0	G			30485393	30485393	+1	no_errors	ENST00000562652	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	0.001	C
KDM2B	84678	genome.wustl.edu	37	12	121947738	121947738	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr12:121947738C>T	ENST00000377071.4	-	11	1351	c.1279G>A	c.(1279-1281)Gag>Aag	p.E427K	KDM2B_ENST00000542973.1_5'Flank|KDM2B_ENST00000377069.4_Missense_Mutation_p.E396K|KDM2B_ENST00000538046.2_Missense_Mutation_p.E337K|KDM2B_ENST00000536437.1_Missense_Mutation_p.E310K	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	427	Glu-rich.				embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						TCGCcctcctcgtccttctcc	0.647																																						dbGAP											0													42.0	50.0	47.0					12																	121947738		2061	4176	6237	-	-	-	SO:0001583	missense	0			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.1279G>A	12.37:g.121947738C>T	ENSP00000366271:p.Glu427Lys		A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.E427K	ENST00000377071.4	37	c.1279	CCDS41850.1	12	.	.	.	.	.	.	.	.	.	.	C	6.323	0.427628	0.11987	.	.	ENSG00000089094	ENST00000397480;ENST00000377069;ENST00000377071;ENST00000536437;ENST00000397478;ENST00000261824;ENST00000446152	T;T;T;T	0.42900	2.55;1.96;0.96;0.96	4.34	3.44	0.39384	.	0.430138	0.20230	N	0.096514	T	0.31949	0.0813	L	0.45581	1.43	0.34364	D	0.69129	B;B;B;B	0.18310	0.027;0.002;0.002;0.002	B;B;B;B	0.09377	0.004;0.001;0.001;0.001	T	0.36383	-0.9750	10	0.36615	T	0.2	-25.3402	7.4912	0.27462	0.0:0.8854:0.0:0.1146	.	427;310;427;396	E7EML5;Q1RLM7;Q8NHM5;A8MRS1	.;.;KDM2B_HUMAN;.	K	427;396;427;310;427;427;390	ENSP00000366269:E396K;ENSP00000366271:E427K;ENSP00000445196:E310K;ENSP00000398279:E390K	ENSP00000261824:E427K	E	-	1	0	KDM2B	120432121	0.302000	0.24454	0.920000	0.36463	0.185000	0.23345	0.432000	0.21461	2.429000	0.82318	0.655000	0.94253	GAG	KDM2B	-	NULL	ENSG00000089094		0.647	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KDM2B	HGNC	protein_coding	OTTHUMT00000402132.2	52	0.00	0	C	NM_032590		121947738	121947738	-1	no_errors	ENST00000377071	ensembl	human	known	69_37n	missense	37	24.49	12	SNP	0.876	T
KIAA1217	56243	genome.wustl.edu	37	10	24810808	24810808	+	Silent	SNP	T	T	C			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr10:24810808T>C	ENST00000376454.3	+	12	2436	c.2406T>C	c.(2404-2406)agT>agC	p.S802S	KIAA1217_ENST00000376452.3_Silent_p.S767S|KIAA1217_ENST00000430453.2_Intron|KIAA1217_ENST00000396446.1_Silent_p.S485S|KIAA1217_ENST00000376462.1_Silent_p.S722S|KIAA1217_ENST00000307544.6_Silent_p.S485S|KIAA1217_ENST00000376451.2_Silent_p.S485S|KIAA1217_ENST00000458595.1_Silent_p.S767S|KIAA1217_ENST00000396445.1_Silent_p.S485S	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	802					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						AGCTGGACAGTCTCCTGAAGC	0.602																																						dbGAP											0													67.0	63.0	65.0					10																	24810808		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.2406T>C	10.37:g.24810808T>C			A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Silent	SNP	pfam_AIP3_C	p.S802	ENST00000376454.3	37	c.2406	CCDS31165.1	10																																																																																			KIAA1217	-	NULL	ENSG00000120549		0.602	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	HGNC	protein_coding	OTTHUMT00000047223.2	46	0.00	0	T	NM_019590		24810808	24810808	+1	no_errors	ENST00000376454	ensembl	human	known	69_37n	silent	21	27.59	8	SNP	0.890	C
Unknown	0	genome.wustl.edu	37	GL000209.1	89698	89698	+	IGR	SNP	G	G	A			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chrGL000209.1:89698G>A								None (None upstream) : None (None downstream)																							CACATGCTTCGGCTCTCTCCA	0.582																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															GL000209.1.37:g.89698G>A				Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.G195S		37	c.583		GL000209.1																																																																																			KIR2DL2	-	smart_Ig_sub	ENSG00000215764	0	0.582					KIR2DL2	HGNC			40	0.00	0	G			89698	89698	+1	no_errors	ENST00000391731	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	NULL	A
KRT16P3	644945	genome.wustl.edu	37	17	20406406	20406406	+	RNA	SNP	C	C	T	rs148301399	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:20406406C>T	ENST00000580113.1	-	0	660									keratin 16 pseudogene 3																		CGTGGTTCTTCCTCAGGTAGG	0.627													c|||	157	0.0313498	0.0015	0.0519	5008	,	,		22050	0.0		0.0905	False		,,,				2504	0.0286					dbGAP											0																																										-	-	-			0			BC110641		17p11.2	2014-06-12			ENSG00000214822	ENSG00000214822			37808	pseudogene	pseudogene			"""cytokeratin, Smith Magenis syndrome chromosome region"""	KERSMCR			Standard	NR_029393		Approved	MGC102966	uc002gxb.3		OTTHUMG00000130724		17.37:g.20406406C>T				RNA	SNP	-	NULL	ENST00000580113.1	37	NULL		17																																																																																			KRT16P3	-	-	ENSG00000214822		0.627	KRT16P3-004	KNOWN	basic	processed_transcript	KRT16P3	HGNC	pseudogene	OTTHUMT00000443764.1	49	0.00	0	C	NR_029393		20406406	20406406	-1	no_errors	ENST00000580113	ensembl	human	known	69_37n	rna	22	12.00	3	SNP	1.000	T
KRTAP4-11	653240	genome.wustl.edu	37	17	39274069	39274069	+	Missense_Mutation	SNP	G	G	C	rs349771	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:39274069G>C	ENST00000391413.2	-	1	537	c.499C>G	c.(499-501)Cga>Gga	p.R167G		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	167				R -> G (in Ref. 1; CAC27583 and 3; AAI26132/AAI30563). {ECO:0000305}.		keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGGAGACTCGGCCACAGACT	0.662													g|||	2320	0.463259	0.4365	0.487	5008	,	,		17612	0.252		0.661	False		,,,				2504	0.4969					dbGAP											0													35.0	39.0	38.0					17																	39274069		692	1590	2282	-	-	-	SO:0001583	missense	0			AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.499C>G	17.37:g.39274069G>C	ENSP00000375232:p.Arg167Gly		A0AUY2	Missense_Mutation	SNP	pfam_Keratin-assoc	p.R167G	ENST00000391413.2	37	c.499	CCDS45675.1	17	994	0.4551282051282051	207	0.42073170731707316	186	0.5138121546961326	136	0.23776223776223776	465	0.6134564643799473	.	12.44	1.937647	0.34189	.	.	ENSG00000212721	ENST00000391413	T	0.00622	6.16	3.95	2.95	0.34219	.	.	.	.	.	T	0.00012	0.0000	L	0.36672	1.1	0.44643	P	0.0023760000000000447	B	0.29646	0.253	B	0.28305	0.088	T	0.00202	-1.1925	8	0.51188	T	0.08	.	11.1465	0.48434	0.0:0.0:0.8133:0.1867	rs349771;rs62066327	167	Q9BYQ6	KR411_HUMAN	G	167	ENSP00000375232:R167G	ENSP00000375232:R167G	R	-	1	2	KRTAP4-11	36527595	0.116000	0.22171	0.948000	0.38648	0.879000	0.50718	2.143000	0.42187	0.934000	0.37316	0.609000	0.83330	CGA	KRTAP4-11	-	NULL	ENSG00000212721		0.662	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-11	HGNC	protein_coding	OTTHUMT00000257690.1	75	0.00	0	G			39274069	39274069	-1	no_errors	ENST00000391413	ensembl	human	known	69_37n	missense	66	18.52	15	SNP	0.822	C
LINC00052	145978	genome.wustl.edu	37	15	88121373	88121375	+	lincRNA	DEL	AGA	AGA	-			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	AGA	AGA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr15:88121373_88121375delAGA	ENST00000560153.1	+	0	242_244				RP11-648K4.2_ENST00000560439.1_lincRNA	NR_026869.1		Q96N35	TMM83_HUMAN	long intergenic non-protein coding RNA 52							integral component of membrane (GO:0016021)											CTGCAATCCCAGAAGATTTTTTG	0.384																																						dbGAP											0																																										-	-	-			0			AK056023		15q25.3	2012-10-12	2011-08-10	2011-08-10		ENSG00000259527		"""Long non-coding RNAs"""	26455	non-coding RNA	RNA, long non-coding			"""transmembrane protein 83"", ""non-protein coding RNA 52"""	TMEM83, NCRNA00052			Standard	NR_026869		Approved	FLJ31461	uc002bmc.1	Q96N35			15.37:g.88121376_88121378delAGA				RNA	DEL	-	NULL	ENST00000560153.1	37	NULL		15																																																																																			LINC00052	-	-	ENSG00000259527		0.384	LINC00052-002	KNOWN	basic	lincRNA	LINC00052	HGNC	lincRNA	OTTHUMT00000416151.1	42	0.00	0	AGA	XR_017978		88121373	88121375	+1	no_errors	ENST00000560153	ensembl	human	known	69_37n	rna	27	25.00	9	DEL	0.000:0.000:0.000	-
LINC00265	349114	genome.wustl.edu	37	7	39831736	39831736	+	lincRNA	SNP	T	T	C	rs6462949	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr7:39831736T>C	ENST00000340510.4	+	0	2094					NR_026999.1				long intergenic non-protein coding RNA 265																		GTCCTCAAGTTGGCCTCCCCA	0.692													N|||	2514	0.501997	0.6566	0.5951	5008	,	,		14946	0.4177		0.4881	False		,,,				2504	0.3282					dbGAP											0																																										-	-	-			0					7p14.1	2012-10-12	2011-08-11	2011-08-11	ENSG00000188185	ENSG00000188185		"""Long non-coding RNAs"""	28019	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 265-1"""		"""non-protein coding RNA 265"""	NCRNA00265		12477932	Standard	NR_026999		Approved	NCRNA00265-1	uc003thf.3		OTTHUMG00000155273		7.37:g.39831736T>C				RNA	SNP	-	NULL	ENST00000340510.4	37	NULL		7																																																																																			LINC00265	-	-	ENSG00000188185		0.692	LINC00265-001	KNOWN	basic	lincRNA	LINC00265	HGNC	lincRNA	OTTHUMT00000339278.1	43	0.00	0	T	NR_026999		39831736	39831736	+1	no_errors	ENST00000340510	ensembl	human	known	69_37n	rna	33	10.81	4	SNP	0.002	C
LINC00452	643365	genome.wustl.edu	37	13	114622597	114622597	+	lincRNA	SNP	A	A	G	rs112630268|rs9604529	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr13:114622597A>G	ENST00000609661.1	+	0	801									long intergenic non-protein coding RNA 452																		GCACCTGGAAACTCCAAAGAG	0.557													G|||	1067	0.213059	0.4425	0.2104	5008	,	,		15235	0.0466		0.175	False		,,,				2504	0.1155					dbGAP											0																																										-	-	-			0					13q34	2014-04-09			ENSG00000229373	ENSG00000229373		"""Long non-coding RNAs"""	42800	other	unknown			"""long intergenic non-protein coding RNA 453"""	LINC00453			Standard	NM_001278674		Approved				OTTHUMG00000017394		13.37:g.114622597A>G				RNA	SNP	-	NULL	ENST00000609661.1	37	NULL		13																																																																																			LINC00452	-	-	ENSG00000229373		0.557	LINC00452-003	KNOWN	basic	lincRNA	LINC00452	HGNC	lincRNA	OTTHUMT00000473163.1	49	0.00	0	A			114622597	114622597	+1	no_errors	ENST00000426859	ensembl	human	known	69_37n	rna	52	21.21	14	SNP	0.000	G
LINC00661	126536	genome.wustl.edu	37	19	16136405	16136405	+	RNA	SNP	C	C	T	rs4808423	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr19:16136405C>T	ENST00000549354.2	+	0	1475					NR_026828.1				long intergenic non-protein coding RNA 661																		GCCCTGAAACCCGGCCCTGCC	0.577											OREG0025325	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	3626	0.724042	0.5598	0.7003	5008	,	,		18268	0.8562		0.7217	False		,,,				2504	0.8292					dbGAP											0																																										-	-	-			0			AI184190, CR749400		19p13.12	2012-10-12			ENSG00000205396	ENSG00000205396		"""Long non-coding RNAs"""	27002	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_026828		Approved		uc002nbw.2		OTTHUMG00000169715		19.37:g.16136405C>T		708		RNA	SNP	-	NULL	ENST00000549354.2	37	NULL		19																																																																																			LINC00661	-	-	ENSG00000205396		0.577	LINC00661-001	KNOWN	basic	lincRNA	LINC00661	HGNC	processed_transcript	OTTHUMT00000405577.4	28	0.00	0	C	NR_026828		16136405	16136405	+1	no_errors	ENST00000379899	ensembl	human	known	69_37n	rna	44	12.00	6	SNP	0.081	T
LINC00661	126536	genome.wustl.edu	37	19	16137086	16137086	+	RNA	SNP	C	C	T	rs2365157|rs371932455	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr19:16137086C>T	ENST00000549354.2	+	0	2156					NR_026828.1				long intergenic non-protein coding RNA 661																		CCAGAGGCTTCGAGGCCCTGC	0.672													C|||	3609	0.720647	0.5605	0.6888	5008	,	,		15790	0.8562		0.7137	False		,,,				2504	0.8272					dbGAP											0																																										-	-	-			0			AI184190, CR749400		19p13.12	2012-10-12			ENSG00000205396	ENSG00000205396		"""Long non-coding RNAs"""	27002	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_026828		Approved		uc002nbw.2		OTTHUMG00000169715		19.37:g.16137086C>T				RNA	SNP	-	NULL	ENST00000549354.2	37	NULL		19																																																																																			LINC00661	-	-	ENSG00000205396		0.672	LINC00661-001	KNOWN	basic	lincRNA	LINC00661	HGNC	processed_transcript	OTTHUMT00000405577.4	31	0.00	0	C	NR_026828		16137086	16137086	+1	no_errors	ENST00000379899	ensembl	human	known	69_37n	rna	26	18.75	6	SNP	0.836	T
LINC00665	100506930	genome.wustl.edu	37	19	36806475	36806475	+	lincRNA	SNP	A	A	T	rs55676133		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr19:36806475A>T	ENST00000586340.1	+	0	4610																											ATTGTACTTCAGGTAAAAGTA	0.383																																						dbGAP											0																																										-	-	-			0																															19.37:g.36806475A>T				RNA	SNP	-	NULL	ENST00000586340.1	37	NULL		19																																																																																			LINC00665	-	-	ENSG00000232677		0.383	CTD-3162L10.1-005	KNOWN	basic	lincRNA	LINC00665	HGNC	lincRNA	OTTHUMT00000451982.1	31	0.00	0	A			36806475	36806475	-1	no_errors	ENST00000590657	ensembl	human	known	69_37n	rna	33	10.81	4	SNP	0.039	T
LRRC27	80313	genome.wustl.edu	37	10	134180353	134180353	+	Intron	SNP	C	C	T	rs45626936	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr10:134180353C>T	ENST00000368614.3	+	10	1521				LRRC27_ENST00000392638.2_Intron|LRRC27_ENST00000368610.3_Intron|LRRC27_ENST00000368612.1_Intron|LRRC27_ENST00000432555.2_Missense_Mutation_p.R347W|LRRC27_ENST00000368613.4_Intron|LRRC27_ENST00000475747.1_Intron	NM_030626.2	NP_085129.1	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27											breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	18		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		CTCCTAGAGCCGGAGATGGGA	0.602													C|||	352	0.0702875	0.028	0.1124	5008	,	,		18633	0.0		0.1889	False		,,,				2504	0.0481					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB051461	CCDS31316.1, CCDS44496.1	10q26.3	2013-09-20			ENSG00000148814	ENSG00000148814			29346	protein-coding gene	gene with protein product						11214970	Standard	NM_030626		Approved	KIAA1674	uc010quw.1	Q9C0I9	OTTHUMG00000019284	ENST00000368614.3:c.1416+1299C>T	10.37:g.134180353C>T			A6NE72|A6NJB4|A6NKD3|D3DRH0|Q5SZH6|Q5SZH8|Q5SZH9|Q86XT5|Q8N7C8|Q8NA21	Missense_Mutation	SNP	NULL	p.R347W	ENST00000368614.3	37	c.1039	CCDS31316.1	10	217	0.09935897435897435	17	0.034552845528455285	55	0.15193370165745856	0	0.0	145	0.19129287598944592	C	7.545	0.661533	0.14645	.	.	ENSG00000148814	ENST00000432555	T	0.48836	0.8	1.29	1.29	0.21616	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.09100	-1.0690	7	0.72032	D	0.01	.	5.9843	0.19426	0.0:1.0:0.0:0.0	rs45626936	347	B4DW88	.	W	347	ENSP00000407949:R347W	ENSP00000407949:R347W	R	+	1	2	LRRC27	134030343	0.001000	0.12720	0.003000	0.11579	0.009000	0.06853	0.140000	0.16056	1.027000	0.39758	0.511000	0.50034	CGG	LRRC27	-	NULL	ENSG00000148814		0.602	LRRC27-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC27	HGNC	protein_coding	OTTHUMT00000051058.2	37	0.00	0	C	XM_290462		134180353	134180353	+1	no_errors	ENST00000432555	ensembl	human	known	69_37n	missense	27	18.18	6	SNP	0.003	T
LRRC37A	9884	genome.wustl.edu	37	17	44374710	44374710	+	Silent	SNP	A	A	G	rs62073222	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:44374710A>G	ENST00000320254.5	+	1	2214	c.2211A>G	c.(2209-2211)ccA>ccG	p.P737P	LRRC37A_ENST00000393465.3_Silent_p.P737P|ARL17B_ENST00000570618.1_Intron|LRRC37A_ENST00000496930.1_Intron	NM_014834.4	NP_055649.4	A6NMS7	L37A1_HUMAN	leucine rich repeat containing 37A	737						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|pancreas(6)|prostate(1)|skin(1)	11		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		AGGTTAAACCATCTCCAACCA	0.517													.|||	3389	0.676717	0.3147	0.7046	5008	,	,		21665	0.8909		0.6789	False		,,,				2504	0.9233					dbGAP											0													1.0	1.0	1.0					17																	44374710		79	123	202	-	-	-	SO:0001819	synonymous_variant	0			BC040501	CCDS11504.2	17q21.31	2014-04-01			ENSG00000176681	ENSG00000176681			29069	protein-coding gene	gene with protein product						9628581, 15533724	Standard	NM_014834		Approved	KIAA0563	uc031rbr.1	A6NMS7	OTTHUMG00000149841	ENST00000320254.5:c.2211A>G	17.37:g.44374710A>G			Q68DY2|Q8IWC7	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.P737	ENST00000320254.5	37	c.2211	CCDS11504.2	17																																																																																			LRRC37A	-	NULL	ENSG00000176681		0.517	LRRC37A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC37A	HGNC	protein_coding	OTTHUMT00000313519.3	95	0.00	0	A	NM_014834		44374710	44374710	+1	no_errors	ENST00000320254	ensembl	human	known	69_37n	silent	40	29.82	17	SNP	0.000	G
LRRC37A3	374819	genome.wustl.edu	37	17	62892271	62892271	+	Missense_Mutation	SNP	A	A	T	rs62071406		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:62892271A>T	ENST00000584306.1	-	3	1635	c.1105T>A	c.(1105-1107)Tct>Act	p.S369T	RP11-927P21.1_ENST00000584959.1_RNA|RP11-927P21.1_ENST00000584131.1_RNA|LRRC37A3_ENST00000319651.5_Missense_Mutation_p.S369T|LRRC37A3_ENST00000339474.5_Intron|RP11-927P21.1_ENST00000577938.1_RNA|LRRC37A3_ENST00000577487.1_5'Flank|LRRC37A3_ENST00000400877.3_Intron	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	369						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TCCCTAGAAGACTCAGAAGGC	0.537																																						dbGAP											0													25.0	32.0	30.0					17																	62892271		1973	4078	6051	-	-	-	SO:0001583	missense	0			AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.1105T>A	17.37:g.62892271A>T	ENSP00000464535:p.Ser369Thr		Q49A01|Q49A80|Q8NB33	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S369T	ENST00000584306.1	37	c.1105	CCDS32708.1	17	.	.	.	.	.	.	.	.	.	.	.	3.342	-0.134342	0.06711	.	.	ENSG00000176809	ENST00000319651	T	0.58506	0.33	2.69	-3.39	0.04868	.	.	.	.	.	T	0.43010	0.1228	L	0.31294	0.92	0.09310	N	1	P	0.52061	0.95	P	0.46718	0.525	T	0.36890	-0.9729	9	0.56958	D	0.05	.	3.9507	0.09368	0.5048:0.1903:0.3049:0.0	.	369	O60309	L37A3_HUMAN	T	369	ENSP00000325713:S369T	ENSP00000325713:S369T	S	-	1	0	LRRC37A3	60322733	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-1.093000	0.03362	-0.631000	0.05560	0.234000	0.17832	TCT	LRRC37A3	-	NULL	ENSG00000176809		0.537	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37A3	HGNC	protein_coding	OTTHUMT00000445377.1	106	0.00	0	A	NM_199340		62892271	62892271	-1	no_errors	ENST00000319651	ensembl	human	known	69_37n	missense	92	17.12	19	SNP	0.000	T
LRRD1	401387	genome.wustl.edu	37	7	91779971	91779971	+	Missense_Mutation	SNP	T	T	G	rs6465353	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr7:91779971T>G	ENST00000458448.1	-	4	2355	c.2155A>C	c.(2155-2157)Att>Ctt	p.I719L	LRRD1_ENST00000422722.1_5'UTR|LRRD1_ENST00000430130.2_Missense_Mutation_p.I719L|CTB-161K23.1_ENST00000453068.1_RNA|LRRD1_ENST00000343318.5_Missense_Mutation_p.I70L|LRRD1_ENST00000454089.2_Missense_Mutation_p.I70L			A4D1F6	LRRD1_HUMAN	leucine-rich repeats and death domain containing 1	719					signal transduction (GO:0007165)					breast(4)|endometrium(1)	5						AGTGAAAAAATATTGTAGATA	0.323													G|||	2086	0.416534	0.6717	0.3732	5008	,	,		15605	0.1885		0.3926	False		,,,				2504	0.362					dbGAP											0													97.0	79.0	84.0					7																	91779971		692	1591	2283	-	-	-	SO:0001583	missense	0			BC026112	CCDS55124.1	7q21.2	2011-05-23			ENSG00000240720	ENSG00000240720			34300	protein-coding gene	gene with protein product							Standard	NM_001161528		Approved	IMAGE:4798971	uc011khp.1	A4D1F6	OTTHUMG00000155861	ENST00000458448.1:c.2155A>C	7.37:g.91779971T>G	ENSP00000405987:p.Ile719Leu		B7ZMM9|Q49AT9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_DEATH-like,smart_Leu-rich_rpt_typical-subtyp,pfscan_Death	p.I719L	ENST00000458448.1	37	c.2155	CCDS55124.1	7	899	0.4116300366300366	342	0.6951219512195121	144	0.39779005524861877	114	0.1993006993006993	299	0.3944591029023747	G	5.515	0.279899	0.10458	.	.	ENSG00000240720	ENST00000343318;ENST00000458448;ENST00000430130;ENST00000454089	T;T;T;T	0.17054	2.62;2.3;2.3;2.62	5.61	5.61	0.85477	.	.	.	.	.	T	0.00012	0.0000	N	0.00068	-2.285	0.54753	P	1.799999999996249E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.42327	-0.9458	8	0.02654	T	1	.	15.7556	0.78021	0.0:0.0:0.8621:0.1379	rs6465353;rs59146464;rs6465353	719	A4D1F6	LRRD1_HUMAN	L	70;719;719;70	ENSP00000339642:I70L;ENSP00000405987:I719L;ENSP00000411568:I719L;ENSP00000392112:I70L	ENSP00000339642:I70L	I	-	1	0	LRRD1	91617907	1.000000	0.71417	0.510000	0.27712	0.523000	0.34469	4.909000	0.63314	1.386000	0.46466	-0.121000	0.15023	ATT	LRRD1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000240720		0.323	LRRD1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRD1	HGNC	protein_coding	OTTHUMT00000342027.2	29	0.00	0	T	NM_001045475		91779971	91779971	-1	no_errors	ENST00000430130	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	0.683	G
MAP2K5	5607	genome.wustl.edu	37	15	67951150	67951150	+	Intron	SNP	G	G	T	rs12438118	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr15:67951150G>T	ENST00000178640.5	+	12	1425				MAP2K5_ENST00000395476.2_Intron|MAP2K5_ENST00000354498.5_Intron|MAP2K5_ENST00000340972.4_Intron|MAP2K5_ENST00000560591.1_3'UTR	NM_145160.2	NP_660143.1	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5						activation of MAPK activity (GO:0000187)|cellular response to growth factor stimulus (GO:0071363)|cellular response to laminar fluid shear stress (GO:0071499)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|skin(1)	16						ACGCTTATGTGCTCCAACCTG	0.398													G|||	1630	0.325479	0.1581	0.4524	5008	,	,		17900	0.506		0.2416	False		,,,				2504	0.362					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U25265	CCDS10224.1, CCDS42051.1, CCDS55970.1	15q22.31	2011-06-09			ENSG00000137764	ENSG00000137764		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6845	protein-coding gene	gene with protein product		602520		PRKMK5		7759517	Standard	NM_002757		Approved	MEK5, MAPKK5, HsT17454	uc002aqu.3	Q13163	OTTHUMG00000133264	ENST00000178640.5:c.798+198G>T	15.37:g.67951150G>T			B4DE43|Q92961|Q92962	RNA	SNP	-	NULL	ENST00000178640.5	37	NULL	CCDS10224.1	15																																																																																			MAP2K5	-	-	ENSG00000137764		0.398	MAP2K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K5	HGNC	protein_coding	OTTHUMT00000257041.1	82	0.00	0	G	NM_145162		67951150	67951150	+1	no_errors	ENST00000560591	ensembl	human	known	69_37n	rna	57	10.94	7	SNP	0.000	T
MED15	51586	genome.wustl.edu	37	22	20862646	20862646	+	Intron	SNP	T	T	G	rs5750324	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr22:20862646T>G	ENST00000263205.7	+	1	137				MED15_ENST00000542773.1_Intron|MED15_ENST00000292733.7_Intron|MED15_ENST00000406969.1_Intron|MED15_ENST00000382974.2_Intron|MED15_ENST00000541476.1_5'UTR|MED15_ENST00000425759.2_Intron	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15						gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			TCAGAGGAACTCTAGCCCCTC	0.547													T|||	2266	0.452476	0.1967	0.6585	5008	,	,		16646	0.4573		0.5795	False		,,,				2504	0.5164					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.68+613T>G	22.37:g.20862646T>G			D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Silent	SNP	NULL	p.T29	ENST00000263205.7	37	c.87	CCDS33602.1	22																																																																																			MED15	-	NULL	ENSG00000099917		0.547	MED15-004	KNOWN	basic|CCDS	protein_coding	MED15	HGNC	protein_coding	OTTHUMT00000320177.2	53	0.00	0	T	NM_015889		20862646	20862646	+1	no_errors	ENST00000441501	ensembl	human	known	69_37n	silent	47	16.07	9	SNP	0.002	G
MEG3	55384	genome.wustl.edu	37	14	101300843	101300843	+	RNA	SNP	G	G	A	rs77658190	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr14:101300843G>A	ENST00000554041.1	-	0	214																											GAGGGGTCTCGTTGCTCCCTT	0.527													g|||	939	0.1875	0.0643	0.0893	5008	,	,		18511	0.4266		0.1004	False		,,,				2504	0.2669					dbGAP											0																																										-	-	-			0																															14.37:g.101300843G>A				RNA	SNP	-	NULL	ENST00000554041.1	37	NULL		14																																																																																			MEG3	-	-	ENSG00000214548		0.527	RP11-123M6.2-001	KNOWN	basic	antisense	MEG3	HGNC	antisense	OTTHUMT00000414687.1	44	0.00	0	G			101300843	101300843	+1	no_errors	ENST00000398461	ensembl	human	known	69_37n	rna	40	11.11	5	SNP	0.000	A
METTL15	196074	genome.wustl.edu	37	11	28134974	28134974	+	Missense_Mutation	SNP	C	C	A	rs60970073	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr11:28134974C>A	ENST00000407364.3	+	3	445	c.93C>A	c.(91-93)aaC>aaA	p.N31K	METTL15_ENST00000403099.1_Missense_Mutation_p.N31K|METTL15_ENST00000379199.2_Missense_Mutation_p.N31K|METTL15_ENST00000406787.3_Missense_Mutation_p.N31K|METTL15_ENST00000303459.6_Missense_Mutation_p.N31K|METTL15_ENST00000342303.5_Missense_Mutation_p.N31K			A6NJ78	MET15_HUMAN	methyltransferase like 15	31			N -> K (in dbSNP:rs2883478). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.				methyltransferase activity (GO:0008168)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	14						TCTGGCCAAACAGAATACATA	0.383													A|||	3025	0.604034	0.764	0.3905	5008	,	,		13842	0.756		0.4364	False		,,,				2504	0.5552					dbGAP											0													26.0	40.0	35.0					11																	28134974		2141	4280	6421	-	-	-	SO:0001583	missense	0			AL832668	CCDS31450.1, CCDS44559.1, CCDS73269.1	11p14.1	2011-03-02	2011-03-02	2011-03-02	ENSG00000169519	ENSG00000169519			26606	protein-coding gene	gene with protein product			"""methyltransferase 5 domain containing 1"""	METT5D1		12477932	Standard	NM_152636		Approved	FLJ33979	uc001msh.2	A6NJ78	OTTHUMG00000150448	ENST00000407364.3:c.93C>A	11.37:g.28134974C>A	ENSP00000384369:p.Asn31Lys		A8MRS5|B7WNU2|Q3MHD3|Q8N601|Q8NBA7	Missense_Mutation	SNP	pfam_SAM-dep_MeTrfase_MraW,superfamily_SAM-dep_MeTrfase_MraW_recog,tigrfam_SAM-dep_MeTrfase_MraW	p.N31K	ENST00000407364.3	37	c.93	CCDS44559.1	11	1152	0.5274725274725275	329	0.6686991869918699	131	0.36187845303867405	401	0.701048951048951	291	0.3839050131926121	A	0.003	-2.405788	0.00193	.	.	ENSG00000169519	ENST00000406787;ENST00000342303;ENST00000403099;ENST00000407364;ENST00000379199;ENST00000303459	T;T;T;T;T;T	0.36699	1.65;1.69;1.26;2.1;1.24;1.69	5.68	-3.88	0.04205	.	0.448998	0.23920	N	0.043252	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.29058	-1.0024	8	0.02654	T	1	.	7.6202	0.28181	0.3776:0.301:0.3214:0.0	rs60970073;rs61888969	31;31;31	A6NJ78;A6NJ78-2;A6NJ78-4	MET15_HUMAN;.;.	K	31	ENSP00000385507:N31K;ENSP00000342259:N31K;ENSP00000385860:N31K;ENSP00000384369:N31K;ENSP00000368497:N31K;ENSP00000307251:N31K	ENSP00000307251:N31K	N	+	3	2	METTL15	28091550	0.340000	0.24792	0.011000	0.14972	0.058000	0.15608	0.395000	0.20850	-1.457000	0.01919	-2.677000	0.00143	AAC	METTL15	-	NULL	ENSG00000169519		0.383	METTL15-003	NOVEL	basic|appris_principal|CCDS	protein_coding	METTL15	HGNC	protein_coding	OTTHUMT00000318135.2	40	0.00	0	C	NM_152636		28134974	28134974	+1	no_errors	ENST00000303459	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	0.010	A
PRKD2	25865	genome.wustl.edu	37	19	47212593	47212593	+	Intron	SNP	A	A	G	rs10423365	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr19:47212593A>G	ENST00000291281.4	-	3	737				PRKD2_ENST00000600194.1_Intron|PRKD2_ENST00000433867.1_Intron|PRKD2_ENST00000595515.1_Intron|PRKD2_ENST00000601806.1_Intron|MIR320E_ENST00000390179.3_RNA			Q9BZL6	KPCD2_HUMAN	protein kinase D2						angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		AAGAACTGGGAAGAGAAGGCC	0.468													A|||	2308	0.460863	0.3918	0.5778	5008	,	,		18148	0.2599		0.5368	False		,,,				2504	0.6002					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.511+1570T>C	19.37:g.47212593A>G			Q8TB08|Q9P0T6|Q9Y3X8	RNA	SNP	-	NULL	ENST00000291281.4	37	NULL	CCDS12689.1	19																																																																																			MIR320E	-	-	ENSG00000211513		0.468	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR320E	HGNC	protein_coding	OTTHUMT00000466591.1	31	0.00	0	A	NM_016457		47212593	47212593	-1	no_errors	ENST00000390179	ensembl	human	known	69_37n	rna	28	17.65	6	SNP	0.509	G
MIR3689A	100500846	genome.wustl.edu	37	9	137742124	137742124	+	RNA	SNP	G	G	A	rs62571442	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr9:137742124G>A	ENST00000578854.1	-	0	0				AL603650.4_ENST00000583817.1_RNA|MIR3689C_ENST00000581239.1_RNA|AL603650.2_ENST00000581079.1_RNA|MIR3689D2_ENST00000580187.1_RNA|MIR3689B_ENST00000581772.1_RNA|MIR3689E_ENST00000582479.1_RNA|AL603650.3_ENST00000582742.1_RNA|AL603650.1_ENST00000583957.1_RNA|MIR3689F_ENST00000579617.1_RNA|MIR3689D1_ENST00000579706.1_RNA	NR_037460.1				microRNA 3689a																		GGATCACACCGCTCAGGAAGA	0.592													T|||	1579	0.315296	0.1089	0.4251	5008	,	,		22744	0.2202		0.5577	False		,,,				2504	0.365					dbGAP											0																																										-	-	-			0					9	2011-09-12				ENSG00000265872		"""ncRNAs / Micro RNAs"""	38904	non-coding RNA	RNA, micro							Standard	NR_037460		Approved	hsa-mir-3689a	uc022bpb.1				9.37:g.137742124G>A				RNA	SNP	-	NULL	ENST00000578854.1	37	NULL		9																																																																																			MIR3689D2	-	-	ENSG00000264136		0.592	MIR3689A-201	KNOWN	basic	miRNA	MIR3689D2	HGNC	miRNA		44	0.00	0	G	NR_037460		137742124	137742124	-1	no_errors	ENST00000580187	ensembl	human	known	69_37n	rna	42	10.42	5	SNP	0.000	A
MIR508	574513	genome.wustl.edu	37	X	146318448	146318448	+	RNA	SNP	C	C	T			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chrX:146318448C>T	ENST00000384857.1	-	0	97					NR_030235.1				microRNA 508																		ATATGCGTTACGTGATGTGTA	0.517													C|||	1	0.000264901	0.0	0.0	3775	,	,		14213	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													94.0	71.0	78.0					X																	146318448		1568	3582	5150	-	-	-			0					Xq27.3	2011-09-12		2008-12-18	ENSG00000207589	ENSG00000207589		"""ncRNAs / Micro RNAs"""	32145	non-coding RNA	RNA, micro		300874		MIRN508			Standard	NR_030235		Approved	hsa-mir-508	uc022cfw.1				X.37:g.146318448C>T				RNA	SNP	-	NULL	ENST00000384857.1	37	NULL		X																																																																																			MIR508	-	-	ENSG00000207589		0.517	MIR508-201	KNOWN	basic	miRNA	MIR508	HGNC	miRNA		61	0.00	0	C	NR_030235		146318448	146318448	-1	no_errors	ENST00000384857	ensembl	human	known	69_37n	rna	28	24.32	9	SNP	0.000	T
MPC1	51660	genome.wustl.edu	37	6	166778679	166778679	+	3'UTR	SNP	T	T	G	rs3728	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr6:166778679T>G	ENST00000360961.6	-	0	689				MPC1_ENST00000487218.1_5'UTR|MPC1_ENST00000341756.6_3'UTR	NM_001270879.1|NM_016098.3	NP_001257808.1|NP_057182.1	Q9Y5U8	MPC1_HUMAN	mitochondrial pyruvate carrier 1						cellular metabolic process (GO:0044237)|mitochondrial pyruvate transport (GO:0006850)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	pyruvate transmembrane transporter activity (GO:0050833)										TCATCAGAAATTATTAAATTA	0.279													T|||	2230	0.445288	0.1157	0.451	5008	,	,		17759	0.6389		0.4354	False		,,,				2504	0.6973					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF125101	CCDS5293.1, CCDS75547.1	6q27	2012-08-01	2012-07-30	2012-07-30	ENSG00000060762	ENSG00000060762			21606	protein-coding gene	gene with protein product		614738	"""brain protein 44-like"""	BRP44L		22628558	Standard	NM_016098		Approved	dJ68L15.3, CGI-129	uc031sra.1	Q9Y5U8	OTTHUMG00000015999	ENST00000360961.6:c.*238A>C	6.37:g.166778679T>G			B2R5I7|Q5TI66|Q9HB67|Q9UQN4	RNA	SNP	-	NULL	ENST00000360961.6	37	NULL	CCDS5293.1	6																																																																																			MPC1	-	-	ENSG00000060762		0.279	MPC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MPC1	HGNC	protein_coding	OTTHUMT00000043052.1	29	0.00	0	T	NM_016098		166778679	166778679	-1	no_errors	ENST00000487218	ensembl	human	known	69_37n	rna	33	15.38	6	SNP	0.000	G
MT1A	4489	genome.wustl.edu	37	16	56670226	56670226	+	5'Flank	SNP	C	C	A	rs4094215	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr16:56670226C>A	ENST00000290705.8	+	0	0				MT1JP_ENST00000564564.1_RNA	NM_005946.2	NP_005937.2	P04731	MT1A_HUMAN	metallothionein 1A						cellular response to cadmium ion (GO:0071276)|cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(1)	3					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TTCCTCTGTCCTGAGTGGGAA	0.567													.|||	2307	0.460663	0.2315	0.6081	5008	,	,		20267	0.4534		0.6282	False		,,,				2504	0.501					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			BC029475	CCDS32454.1	16q13	2012-10-02	2007-03-02			ENSG00000205362		"""Metallothioneins"""	7393	protein-coding gene	gene with protein product		156350	"""metallothionein 1S"""	MT1, MT1S		6089206, 6327055	Standard	NM_005946		Approved		uc002ejq.3	P04731			16.37:g.56670226C>A	Exception_encountered		Q86YX5	RNA	SNP	-	NULL	ENST00000290705.8	37	NULL	CCDS32454.1	16																																																																																			MT1JP	-	-	ENSG00000255986		0.567	MT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MT1JP	HGNC	protein_coding	OTTHUMT00000434324.1	44	0.00	0	C	NM_005946		56670226	56670226	+1	no_errors	ENST00000564564	ensembl	human	known	69_37n	rna	13	18.75	3	SNP	0.000	A
MUC19	283463	genome.wustl.edu	37	12	40832126	40832126	+	Silent	SNP	C	C	T	rs10878584	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr12:40832126C>T	ENST00000454784.4	+	21	2398	c.1665C>T	c.(1663-1665)aaC>aaT	p.N555N	RP11-115F18.1_ENST00000552757.1_RNA			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	555					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						GTTACATAAACGACGAGGTCA	0.398													T|||	2595	0.518171	0.3601	0.5648	5008	,	,		19939	0.4742		0.5447	False		,,,				2504	0.7168					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.1665C>T	12.37:g.40832126C>T			Q8NA85	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_VWC_out,smart_Unchr_dom_Cys-rich	p.N784	ENST00000454784.4	37	c.2352		12																																																																																			MUC19	-	NULL	ENSG00000205592		0.398	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	67	0.00	0	C	XM_003403524		40832126	40832126	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000425730	ensembl	human	novel	69_37n	silent	37	17.78	8	SNP	0.012	T
MUC19	283463	genome.wustl.edu	37	12	40832161	40832161	+	Missense_Mutation	SNP	T	T	C	rs11176635	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr12:40832161T>C	ENST00000454784.4	+	21	2433	c.1700T>C	c.(1699-1701)aTt>aCt	p.I567T	RP11-115F18.1_ENST00000552757.1_RNA			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	567			I -> T (in dbSNP:rs11176635).		cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						CTCATCCATATTGATGACAAT	0.368													T|||	2596	0.518371	0.3601	0.5663	5008	,	,		20982	0.4742		0.5447	False		,,,				2504	0.7168					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.1700T>C	12.37:g.40832161T>C	ENSP00000476404:p.Ile567Thr		Q8NA85	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_VWC_out,smart_Unchr_dom_Cys-rich	p.I796T	ENST00000454784.4	37	c.2387		12	1086	0.49725274725274726	198	0.4024390243902439	215	0.5939226519337016	247	0.4318181818181818	426	0.5620052770448549	T	10.71	1.426663	0.25726	.	.	ENSG00000205592	ENST00000425730	.	.	.	5.19	5.19	0.71726	.	.	.	.	.	T	0.00012	0.0000	L	0.33792	1.035	0.09310	P	1.0	.	.	.	.	.	.	T	0.44832	-0.9302	5	0.13853	T	0.58	.	9.7103	0.40240	0.1548:0.0:0.0:0.8451	rs11176635;rs17445001;rs17492362;rs52814276;rs11176635	.	.	.	T	796	.	ENSP00000395253:I796T	I	+	2	0	MUC19	39118428	1.000000	0.71417	0.957000	0.39632	0.873000	0.50193	2.127000	0.42035	2.098000	0.63641	0.528000	0.53228	ATT	MUC19	-	NULL	ENSG00000205592		0.368	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	56	0.00	0	T	XM_003403524		40832161	40832161	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000425730	ensembl	human	novel	69_37n	missense	33	13.16	5	SNP	0.917	C
MUC19	283463	genome.wustl.edu	37	12	40835734	40835734	+	Missense_Mutation	SNP	C	C	G	rs7966110	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr12:40835734C>G	ENST00000454784.4	+	25	2815	c.2082C>G	c.(2080-2082)atC>atG	p.I694M	RP11-115F18.1_ENST00000552757.1_RNA			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	694	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.		I -> M (in dbSNP:rs7966110).		cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						TCTGCCACATCTATGGGGAAG	0.368													C|||	2596	0.518371	0.3601	0.5663	5008	,	,		16912	0.4742		0.5447	False		,,,				2504	0.7168					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.2082C>G	12.37:g.40835734C>G	ENSP00000476404:p.Ile694Met		Q8NA85	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_VWC_out,smart_Unchr_dom_Cys-rich	p.I923M	ENST00000454784.4	37	c.2769		12	1086	0.49725274725274726	198	0.4024390243902439	215	0.5939226519337016	247	0.4318181818181818	426	0.5620052770448549	C	15.04	2.715889	0.48622	.	.	ENSG00000205592	ENST00000425730	.	.	.	4.95	3.09	0.35607	.	.	.	.	.	T	0.00012	0.0000	L	0.58101	1.795	0.09310	P	0.999999999999998	.	.	.	.	.	.	T	0.49234	-0.8961	5	0.72032	D	0.01	.	8.9957	0.36050	0.0:0.7499:0.0:0.2501	rs7966110;rs17445043;rs52818908;rs7966110	.	.	.	M	923	.	ENSP00000395253:I923M	I	+	3	3	MUC19	39122001	0.303000	0.24463	1.000000	0.80357	0.976000	0.68499	-0.406000	0.07187	1.210000	0.43336	-0.439000	0.05793	ATC	MUC19	-	pfam_VWF_type-D,smart_VWC_out,smart_VWF_type-D	ENSG00000205592		0.368	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	101	0.98	1	C	XM_003403524		40835734	40835734	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000425730	ensembl	human	novel	69_37n	missense	53	15.87	10	SNP	1.000	G
MUC4	4585	genome.wustl.edu	37	3	195512343	195512343	+	Silent	SNP	G	G	A	rs113457754		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:195512343G>A	ENST00000463781.3	-	2	6567	c.6108C>T	c.(6106-6108)acC>acT	p.T2036T	MUC4_ENST00000475231.1_Silent_p.T2036T|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T2036T(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTATCGGTGACAGGAA	0.567																																						dbGAP											2	Substitution - coding silent(2)	stomach(2)											29.0	25.0	26.0					3																	195512343		688	1575	2263	-	-	-	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6108C>T	3.37:g.195512343G>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.T2036	ENST00000463781.3	37	c.6108	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	106	0.93	1	G	NM_018406		195512343	195512343	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	silent	112	10.40	13	SNP	0.000	A
MYL5	4636	genome.wustl.edu	37	4	672525	672525	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr4:672525G>A	ENST00000400159.2	+	2	187	c.82G>A	c.(82-84)Gag>Aag	p.E28K	MYL5_ENST00000505477.1_5'UTR|MYL5_ENST00000511290.1_5'UTR|MYL5_ENST00000506838.1_5'UTR	NM_002477.1	NP_002468.1	Q02045	MYL5_HUMAN	myosin, light chain 5, regulatory	28					regulation of muscle contraction (GO:0006937)	muscle myosin complex (GO:0005859)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			endometrium(1)|kidney(1)|lung(1)	3						CTCCAACTTTGAGCAGACTCA	0.607																																						dbGAP											0													41.0	53.0	49.0					4																	672525		1956	4178	6134	-	-	-	SO:0001583	missense	0				CCDS43197.1	4p16	2013-01-10	2006-09-29		ENSG00000215375	ENSG00000215375		"""Myosins / Light chain"", ""EF-hand domain containing"""	7586	protein-coding gene	gene with protein product		160782	"""myosin, light polypeptide 5, regulatory"""			1284596	Standard	NM_002477		Approved		uc003gav.3	Q02045	OTTHUMG00000159971	ENST00000400159.2:c.82G>A	4.37:g.672525G>A	ENSP00000383023:p.Glu28Lys		Q8IXL8	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.E28K	ENST00000400159.2	37	c.82	CCDS43197.1	4	.	.	.	.	.	.	.	.	.	.	G	17.70	3.455149	0.63401	.	.	ENSG00000215375	ENST00000400159;ENST00000507804	T;T	0.78481	-1.18;-1.18	4.15	2.28	0.28536	EF-hand-like domain (1);	0.000000	0.31347	U	0.007820	T	0.73345	0.3575	L	0.58810	1.83	0.27952	N	0.937125	P	0.43826	0.818	B	0.41135	0.348	T	0.68232	-0.5463	10	0.87932	D	0	.	11.7833	0.52028	0.0:0.3419:0.6581:0.0	.	28	Q02045	MYL5_HUMAN	K	28;33	ENSP00000383023:E28K;ENSP00000427317:E33K	ENSP00000383023:E28K	E	+	1	0	MYL5	662525	1.000000	0.71417	0.713000	0.30519	0.988000	0.76386	5.750000	0.68712	0.265000	0.21872	0.591000	0.81541	GAG	MYL5	-	NULL	ENSG00000215375		0.607	MYL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYL5	HGNC	protein_coding	OTTHUMT00000358570.2	69	0.00	0	G	NM_002477		672525	672525	+1	no_errors	ENST00000400159	ensembl	human	known	69_37n	missense	38	28.30	15	SNP	1.000	A
MYOM3	127294	genome.wustl.edu	37	1	24392671	24392671	+	Intron	SNP	T	T	C	rs6699525	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:24392671T>C	ENST00000374434.3	-	29	3586				MYOM3_ENST00000330966.7_Intron|RP11-293P20.4_ENST00000429191.1_RNA|MYOM3_ENST00000329601.7_Intron|RP11-293P20.2_ENST00000439239.2_RNA|MYOM3_ENST00000338909.5_Missense_Mutation_p.R10G	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3							M band (GO:0031430)	protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		gatccctgccttactctattt	0.463													C|||	1383	0.276158	0.4713	0.1599	5008	,	,		20973	0.1964		0.1421	False		,,,				2504	0.3149					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.3424-180A>G	1.37:g.24392671T>C			A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R10G	ENST00000374434.3	37	c.28	CCDS41281.1	1	465	0.2129120879120879	192	0.3902439024390244	61	0.1685082872928177	109	0.19055944055944055	103	0.1358839050131926	C	0.013	-1.645440	0.00792	.	.	ENSG00000142661	ENST00000338909;ENST00000374442	T	0.56444	0.46	3.14	-0.964	0.10326	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36792	-0.9733	7	0.72032	D	0.01	.	9.5106	0.39074	0.0:0.3941:0.0:0.6059	rs6699525;rs52809325;rs60201490;rs6699525	10	Q5VTT5-3	.	G	10	ENSP00000342689:R10G	ENSP00000342689:R10G	R	-	1	2	MYOM3	24265258	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.076000	0.11412	-0.511000	0.06514	-0.726000	0.03593	AGG	MYOM3	-	NULL	ENSG00000142661		0.463	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYOM3	HGNC	protein_coding	OTTHUMT00000008272.2	92	0.00	0	T	NM_152372		24392671	24392671	-1	no_errors	ENST00000338909	ensembl	human	known	69_37n	missense	82	12.77	12	SNP	0.000	C
NBPF22P	285622	genome.wustl.edu	37	5	85583507	85583507	+	RNA	SNP	T	T	G	rs71580744	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr5:85583507T>G	ENST00000590707.1	+	0	773					NR_003719.2				neuroblastoma breakpoint family, member 22, pseudogene																		AGCCAGGAGCTGCCAGAGGTG	0.532													t|||	2797	0.558506	0.5303	0.451	5008	,	,		20955	0.8185		0.5	False		,,,				2504	0.4652					dbGAP											0																																										-	-	-			0			BC050328		5q14.3	2013-01-17	2011-04-15		ENSG00000205449	ENSG00000205449		"""neuroblastoma breakpoint family"""	28731	pseudogene	pseudogene						16079250	Standard	NR_003719		Approved	MGC48637	uc003kiq.3		OTTHUMG00000162585		5.37:g.85583507T>G				RNA	SNP	-	NULL	ENST00000590707.1	37	NULL		5																																																																																			NBPF22P	-	-	ENSG00000205449		0.532	NBPF22P-004	KNOWN	basic	processed_transcript	NBPF22P	HGNC	pseudogene	OTTHUMT00000453100.1	140	0.71	1	T	XM_208333		85583507	85583507	+1	no_errors	ENST00000590707	ensembl	human	known	69_37n	rna	91	11.54	12	SNP	0.001	G
NBPF22P	285622	genome.wustl.edu	37	5	85583642	85583642	+	RNA	SNP	C	C	T	rs71641946	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr5:85583642C>T	ENST00000590707.1	+	0	908					NR_003719.2				neuroblastoma breakpoint family, member 22, pseudogene																		GATCAGCTTGCCTGCTCTGCT	0.512													c|||	848	0.169329	0.0113	0.2176	5008	,	,		22586	0.2401		0.2644	False		,,,				2504	0.1779					dbGAP											0																																										-	-	-			0			BC050328		5q14.3	2013-01-17	2011-04-15		ENSG00000205449	ENSG00000205449		"""neuroblastoma breakpoint family"""	28731	pseudogene	pseudogene						16079250	Standard	NR_003719		Approved	MGC48637	uc003kiq.3		OTTHUMG00000162585		5.37:g.85583642C>T				RNA	SNP	-	NULL	ENST00000590707.1	37	NULL		5																																																																																			NBPF22P	-	-	ENSG00000205449		0.512	NBPF22P-004	KNOWN	basic	processed_transcript	NBPF22P	HGNC	pseudogene	OTTHUMT00000453100.1	133	0.00	0	C	XM_208333		85583642	85583642	+1	no_errors	ENST00000590707	ensembl	human	known	69_37n	rna	96	10.28	11	SNP	0.000	T
NMT1	4836	genome.wustl.edu	37	17	43183108	43183108	+	3'UTR	SNP	G	G	A	rs1053739	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:43183108G>A	ENST00000592782.1	+	0	1723				NMT1_ENST00000258960.2_3'UTR			P30419	NMT1_HUMAN	N-myristoyltransferase 1						apoptotic process (GO:0006915)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	8		Prostate(33;0.155)				GAGAATCCCTGGCAAAGGGAG	0.527													G|||	1554	0.310304	0.0719	0.2695	5008	,	,		13463	0.5278		0.3857	False		,,,				2504	0.3599					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS11494.1	17q21.31	2012-10-02			ENSG00000136448	ENSG00000136448			7857	protein-coding gene	gene with protein product	"""alternative, short form NMT-S"", ""myristoyl-CoA:protein N-myristoyltransferase"", ""long form, NMT-L"""	160993				1570339	Standard	NM_021079		Approved	NMT	uc002ihz.3	P30419	OTTHUMG00000180003	ENST00000592782.1:c.*101G>A	17.37:g.43183108G>A			A8K7C1|Q9UE09	RNA	SNP	-	NULL	ENST00000592782.1	37	NULL	CCDS11494.1	17																																																																																			NMT1	-	-	ENSG00000136448		0.527	NMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMT1	HGNC	protein_coding	OTTHUMT00000449239.1	43	0.00	0	G	NM_021079		43183108	43183108	+1	no_errors	ENST00000587120	ensembl	human	known	69_37n	rna	31	11.43	4	SNP	0.998	A
NOTCH4	4855	genome.wustl.edu	37	6	32188297	32188297	+	Silent	SNP	G	G	C	rs423023	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr6:32188297G>C	ENST00000375023.3	-	6	1182	c.1044C>G	c.(1042-1044)ggC>ggG	p.G348G		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	348	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						AGCTTGTGCCGCCCCAGCCAC	0.612													C|||	1604	0.320288	0.2413	0.3372	5008	,	,		17939	0.2976		0.3996	False		,,,				2504	0.3569					dbGAP											0													107.0	106.0	106.0					6																	32188297		1511	2709	4220	-	-	-	SO:0001819	synonymous_variant	0				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1044C>G	6.37:g.32188297G>C			B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	pfam_EGF-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_4,prints_Notch_dom	p.G348	ENST00000375023.3	37	c.1044	CCDS34420.1	6																																																																																			NOTCH4	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_Notch,pfscan_EG-like_dom	ENSG00000204301		0.612	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2	54	0.00	0	G			32188297	32188297	-1	no_errors	ENST00000375023	ensembl	human	known	69_37n	silent	35	12.20	5	SNP	0.470	C
NRP1	8829	genome.wustl.edu	37	10	33483561	33483561	+	Intron	SNP	T	T	A	rs2474726	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr10:33483561T>A	ENST00000265371.4	-	14	2450				NRP1_ENST00000395995.1_Intron|NRP1_ENST00000374875.1_Intron|NRP1_ENST00000374867.2_Intron			O14786	NRP1_HUMAN	neuropilin 1						angiogenesis (GO:0001525)|angiogenesis involved in coronary vascular morphogenesis (GO:0060978)|artery morphogenesis (GO:0048844)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|dendrite development (GO:0016358)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell chemotaxis (GO:0035767)|endothelial tip cell fate specification (GO:0097102)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|patterning of blood vessels (GO:0001569)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of cytokine activity (GO:0060301)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of smooth muscle cell migration (GO:0014911)|protein localization to early endosome (GO:1902946)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of vesicle-mediated transport (GO:0060627)|renal artery morphogenesis (GO:0061441)|response to wounding (GO:0009611)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal ganglion cell axon guidance (GO:0031290)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|VEGF-activated neuropilin signaling pathway (GO:0038190)|VEGF-activated neuropilin signaling pathway involved in axon guidance (GO:1902378)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neurofilament (GO:0005883)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|semaphorin receptor complex (GO:0002116)|sorting endosome (GO:0097443)	coreceptor activity (GO:0015026)|cytokine binding (GO:0019955)|growth factor binding (GO:0019838)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|semaphorin receptor activity (GO:0017154)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	48					Palifermin(DB00039)|Pegaptanib(DB04895)	CCGCTCTAAGTTTTTGTATTT	0.373													T|||	1648	0.329073	0.2027	0.196	5008	,	,		19390	0.6399		0.2445	False		,,,				2504	0.3609				Melanoma(104;886 1489 44640 45944 51153)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF016050	CCDS7177.1, CCDS31179.1, CCDS31180.1	10p12	2006-02-23			ENSG00000099250	ENSG00000099250		"""CD molecules"""	8004	protein-coding gene	gene with protein product		602069				9529250, 9331348	Standard	NM_003873		Approved	NRP, VEGF165R, CD304	uc001iwx.4	O14786	OTTHUMG00000019343	ENST00000265371.4:c.1925-2215A>T	10.37:g.33483561T>A			B0LPG9|O60461|Q5T7F1|Q5T7F2|Q5T7F3|Q86T59|Q96I90|Q96IH5	RNA	SNP	-	NULL	ENST00000265371.4	37	NULL	CCDS7177.1	10																																																																																			NRP1	-	-	ENSG00000099250		0.373	NRP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NRP1	HGNC	protein_coding	OTTHUMT00000051203.2	67	0.00	0	T			33483561	33483561	-1	no_errors	ENST00000466932	ensembl	human	known	69_37n	rna	41	10.64	5	SNP	0.000	A
NSUN4	387338	genome.wustl.edu	37	1	46808224	46808224	+	Intron	SNP	A	A	C	rs56909107	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:46808224A>C	ENST00000474844.1	+	1	743				NSUN4_ENST00000536062.1_Intron|NSUN4_ENST00000537428.1_Intron|NSUN4_ENST00000498008.1_3'UTR	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4						rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)			endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					CTGGGAGGCAACTGGGAACTC	0.582													A|||	660	0.131789	0.1331	0.147	5008	,	,		16658	0.0179		0.2724	False		,,,				2504	0.092					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	ENST00000474844.1:c.93+1633A>C	1.37:g.46808224A>C			A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	RNA	SNP	-	NULL	ENST00000474844.1	37	NULL	CCDS534.1	1																																																																																			NSUN4	-	-	ENSG00000117481		0.582	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN4	HGNC	protein_coding	OTTHUMT00000021427.1	51	0.00	0	A	NM_199044		46808224	46808224	+1	no_errors	ENST00000498008	ensembl	human	known	69_37n	rna	48	11.11	6	SNP	0.021	C
NSUN4	387338	genome.wustl.edu	37	1	46827728	46827728	+	3'UTR	SNP	A	A	C	rs1053627	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:46827728A>C	ENST00000474844.1	+	0	2015				NSUN4_ENST00000537428.1_3'UTR|NSUN4_ENST00000498008.1_3'UTR	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4						rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)			endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					TCACTCATTAACCCCTACCCC	0.483													C|||	661	0.131989	0.1339	0.147	5008	,	,		20653	0.0179		0.2724	False		,,,				2504	0.092					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	ENST00000474844.1:c.*210A>C	1.37:g.46827728A>C			A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	RNA	SNP	-	NULL	ENST00000474844.1	37	NULL	CCDS534.1	1																																																																																			NSUN4	-	-	ENSG00000117481		0.483	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN4	HGNC	protein_coding	OTTHUMT00000021427.1	47	0.00	0	A	NM_199044		46827728	46827728	+1	no_errors	ENST00000307089	ensembl	human	known	69_37n	rna	47	16.07	9	SNP	0.000	C
NSUN4	387338	genome.wustl.edu	37	1	46827769	46827769	+	3'UTR	SNP	C	C	T	rs1053628	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:46827769C>T	ENST00000474844.1	+	0	2056				NSUN4_ENST00000537428.1_3'UTR|NSUN4_ENST00000498008.1_3'UTR	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4						rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)			endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					GTTTGCTGCCCGCTTAGGGGC	0.473													C|||	661	0.131989	0.1331	0.147	5008	,	,		20210	0.0179		0.2724	False		,,,				2504	0.093					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	ENST00000474844.1:c.*251C>T	1.37:g.46827769C>T			A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	RNA	SNP	-	NULL	ENST00000474844.1	37	NULL	CCDS534.1	1																																																																																			NSUN4	-	-	ENSG00000117481		0.473	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN4	HGNC	protein_coding	OTTHUMT00000021427.1	40	0.00	0	C	NM_199044		46827769	46827769	+1	no_errors	ENST00000307089	ensembl	human	known	69_37n	rna	56	13.85	9	SNP	0.007	T
NWD1	284434	genome.wustl.edu	37	19	16842052	16842052	+	Missense_Mutation	SNP	G	G	T	rs8107776	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr19:16842052G>T	ENST00000552788.1	+	1	44	c.44G>T	c.(43-45)tGc>tTc	p.C15F	NWD1_ENST00000549814.1_Missense_Mutation_p.C15F|NWD1_ENST00000523826.1_5'UTR|NWD1_ENST00000379808.3_Missense_Mutation_p.C15F|NWD1_ENST00000524140.2_Missense_Mutation_p.C15F			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	15				C -> F (in Ref. 1; CAH18655). {ECO:0000305}.			ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ACCCTGAAGTGCCAGACCTTC	0.498													g|||	2480	0.495208	0.6407	0.3718	5008	,	,		16503	0.2619		0.6133	False		,,,				2504	0.5051					dbGAP											0																																										-	-	-	SO:0001583	missense	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.44G>T	19.37:g.16842052G>T	ENSP00000447224:p.Cys15Phe		C9J021|Q68CT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.C15F	ENST00000552788.1	37	c.44		19	1082	0.49542124542124544	313	0.6361788617886179	159	0.43922651933701656	153	0.2674825174825175	457	0.6029023746701847	g	7.655	0.683798	0.14907	.	.	ENSG00000188039	ENST00000524140;ENST00000549814;ENST00000379808;ENST00000552788	T;T;T;T	0.55413	0.52;0.58;0.52;0.58	4.68	-2.14	0.07123	.	1.465170	0.04678	N	0.411842	T	0.00012	0.0000	N	0.08118	0	0.20489	P	0.999892517	B	0.02656	0.0	B	0.01281	0.0	T	0.43589	-0.9382	9	0.08599	T	0.76	.	2.026	0.03519	0.1803:0.2826:0.3931:0.144	rs8107776;rs56832634	15	Q149M9-3	.	F	15	ENSP00000428579:C15F;ENSP00000447548:C15F;ENSP00000369136:C15F;ENSP00000447224:C15F	ENSP00000369136:C15F	C	+	2	0	NWD1	16703052	0.993000	0.37304	0.418000	0.26571	0.470000	0.32858	0.024000	0.13555	-0.140000	0.11394	0.437000	0.28790	TGC	NWD1	-	NULL	ENSG00000188039		0.498	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	41	0.00	0	G	NM_001007525		16842052	16842052	+1	no_errors	ENST00000379808	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	0.578	T
OBP2A	29991	genome.wustl.edu	37	9	138441760	138441760	+	3'UTR	SNP	C	C	A	rs7859414	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr9:138441760C>A	ENST00000539850.1	+	0	882				OBP2A_ENST00000342114.4_3'UTR|OBP2A_ENST00000371776.1_3'UTR|OBP2A_ENST00000340780.3_Missense_Mutation_p.S219R			Q9NY56	OBP2A_HUMAN	odorant binding protein 2A						response to stimulus (GO:0050896)|sensory perception of chemical stimulus (GO:0007606)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)			endometrium(1)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	11				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		TACCCTCCAGCCATGACCCTT	0.657													.|||	1285	0.256589	0.525	0.1643	5008	,	,		16036	0.1617		0.1958	False		,,,				2504	0.1196					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AJ251029	CCDS6992.1	9q34	2014-01-22			ENSG00000122136	ENSG00000122136		"""Lipocalins"""	23380	protein-coding gene	gene with protein product		164320					Standard	NM_014582		Approved	hOBPIIa, OBP, LCN13	uc004cgb.3	Q9NY56	OTTHUMG00000020909	ENST00000539850.1:c.*343C>A	9.37:g.138441760C>A			Q5T8A3|Q9NY50|Q9NY53|Q9NY54|Q9NY55	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_von_Ebner_gland	p.S219R	ENST00000539850.1	37	c.657	CCDS6992.1	9	519	0.23763736263736263	241	0.4898373983739837	60	0.16574585635359115	82	0.14335664335664336	136	0.17941952506596306	c	8.402	0.842167	0.16963	.	.	ENSG00000122136	ENST00000340780	T	0.30448	1.53	1.66	0.73	0.18271	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	P	0.36647	0.563	B	0.21151	0.033	T	0.47586	-0.9106	7	0.62326	D	0.03	-1.6179	4.1119	0.10063	0.0:0.7775:0.0:0.2225	rs7859414	219	Q5T8A5	.	R	219	ENSP00000342097:S219R	ENSP00000342097:S219R	S	+	3	2	OBP2A	137581581	0.001000	0.12720	0.005000	0.12908	0.095000	0.18619	0.863000	0.27913	0.285000	0.22329	0.299000	0.19835	AGC	OBP2A	-	NULL	ENSG00000122136		0.657	OBP2A-006	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	OBP2A	HGNC	protein_coding	OTTHUMT00000397904.1	94	0.00	0	C	NM_014582		138441760	138441760	+1	no_errors	ENST00000340780	ensembl	human	known	69_37n	missense	61	12.86	9	SNP	0.004	A
OBSCN	84033	genome.wustl.edu	37	1	228465346	228465346	+	Intron	SNP	A	A	G	rs493945	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:228465346A>G	ENST00000422127.1	+	25	6798				OBSCN_ENST00000284548.11_Intron|OBSCN_ENST00000359599.6_Intron|RP5-1139B12.3_ENST00000602529.1_RNA|OBSCN_ENST00000366709.4_Intron|OBSCN_ENST00000570156.2_Missense_Mutation_p.N2674D|RP5-1139B12.3_ENST00000602947.1_RNA|OBSCN_ENST00000366707.4_Intron	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCCCACTGACAACGTGCGCAT	0.647													A|||	1653	0.330072	0.3585	0.3617	5008	,	,		15447	0.378		0.3638	False		,,,				2504	0.1851					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.6755-109A>G	1.37:g.228465346A>G			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	p.N93D	ENST00000422127.1	37	c.277	CCDS58065.1	1																																																																																			OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000154358		0.647	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		88	0.00	0	A	NM_052843		228465346	228465346	+1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000493813	ensembl	human	putative	69_37n	missense	55	19.12	13	SNP	1.000	G
OR10C1	442194	genome.wustl.edu	37	6	29408468	29408468	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr6:29408468C>T	ENST00000444197.2	+	1	1386	c.676C>T	c.(676-678)Cgg>Tgg	p.R226W	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	226						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						TACCATCTTCCGGATCCCATC	0.562																																						dbGAP											0													209.0	230.0	223.0					6																	29408468		1511	2709	4220	-	-	-	SO:0001583	missense	0				CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.676C>T	6.37:g.29408468C>T	ENSP00000419119:p.Arg226Trp		Q5SUN7|Q96R18	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R226W	ENST00000444197.2	37	c.676	CCDS34364.1	6	.	.	.	.	.	.	.	.	.	.	C	9.739	1.164450	0.21538	.	.	ENSG00000206474	ENST00000444197	T	0.00269	8.37	3.49	1.62	0.23740	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36303	N	0.002677	T	0.00241	0.0007	M	0.91406	3.205	0.09310	N	1	D	0.63046	0.992	P	0.55303	0.773	T	0.16305	-1.0407	10	0.87932	D	0	.	11.1256	0.48317	0.6825:0.3175:0.0:0.0	.	226	Q96KK4	O10C1_HUMAN	W	226	ENSP00000419119:R226W	ENSP00000419119:R226W	R	+	1	2	OR10C1	29516447	0.000000	0.05858	0.017000	0.16124	0.067000	0.16453	-0.056000	0.11787	0.170000	0.19704	-0.248000	0.11899	CGG	OR10C1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000206474		0.562	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10C1	HGNC	protein_coding	OTTHUMT00000076415.2	64	0.00	0	C			29408468	29408468	+1	no_errors	ENST00000444197	ensembl	human	known	69_37n	missense	48	27.27	18	SNP	0.008	T
OR13C5	138799	genome.wustl.edu	37	9	107361599	107361599	+	Missense_Mutation	SNP	G	G	C	rs6479260	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr9:107361599G>C	ENST00000374779.2	-	1	189	c.96C>G	c.(94-96)ttC>ttG	p.F32L		NM_001004482.1	NP_001004482.1	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C, member 5	32			F -> L (in dbSNP:rs6479260).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(4)	28						CATACATTATGAAGATGAGCA	0.428													G|||	2125	0.424321	0.6074	0.2233	5008	,	,		20416	0.5724		0.1789	False		,,,				2504	0.4192					dbGAP											0													34.0	37.0	36.0					9																	107361599		2189	4275	6464	-	-	-	SO:0001583	missense	0				CCDS35091.1	9q31.1	2012-10-03			ENSG00000255800	ENSG00000277556		"""GPCR / Class A : Olfactory receptors"""	15100	protein-coding gene	gene with protein product							Standard	NM_001004482		Approved		uc011lvp.2	Q8NGS8	OTTHUMG00000020408	ENST00000374779.2:c.96C>G	9.37:g.107361599G>C	ENSP00000363911:p.Phe32Leu		B2RNE5|B9EGW5|Q6IF53	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F32L	ENST00000374779.2	37	c.96	CCDS35091.1	9	810	0.3708791208791209	269	0.5467479674796748	79	0.21823204419889503	330	0.5769230769230769	132	0.1741424802110818	G	0.259	-1.001024	0.02128	.	.	ENSG00000255800	ENST00000374779	T	0.00287	8.29	3.84	-7.68	0.01268	.	0.299519	0.16915	N	0.194324	T	0.00012	0.0000	N	0.00090	-2.18	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.42749	-0.9433	9	0.02654	T	1	.	4.6893	0.12772	0.1137:0.5361:0.2321:0.1181	rs6479260;rs12378458;rs41329544;rs57119072;rs6479260	32	Q8NGS8	O13C5_HUMAN	L	32	ENSP00000363911:F32L	ENSP00000363911:F32L	F	-	3	2	OR13C5	106401420	0.000000	0.05858	0.000000	0.03702	0.146000	0.21551	-6.006000	0.00086	-2.343000	0.00623	-0.638000	0.03974	TTC	OR13C5	-	prints_7TM_GPCR_Rhodpsn	ENSG00000255800		0.428	OR13C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C5	HGNC	protein_coding	OTTHUMT00000053479.2	22	0.00	0	G	NM_001004482		107361599	107361599	-1	no_errors	ENST00000374779	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.000	C
OR3A3	8392	genome.wustl.edu	37	17	3324255	3324255	+	Missense_Mutation	SNP	C	C	T	rs769432	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:3324255C>T	ENST00000291231.1	+	1	394	c.394C>T	c.(394-396)Ctc>Ttc	p.L132F		NM_012373.2	NP_036505.2	P47888	OR3A3_HUMAN	olfactory receptor, family 3, subfamily A, member 3	132			L -> F (in dbSNP:rs769432).		signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(1)	9						CTATGACCGACTCCTGGCCAT	0.597													T|||	1781	0.355631	0.4244	0.3573	5008	,	,		20875	0.128		0.5815	False		,,,				2504	0.2638					dbGAP											0													11.0	13.0	12.0					17																	3324255		2147	4208	6355	-	-	-	SO:0001583	missense	0			U04688	CCDS11025.1	17p13.3	2012-08-09			ENSG00000159961	ENSG00000159961		"""GPCR / Class A : Olfactory receptors"""	8284	protein-coding gene	gene with protein product				OR3A6, OR3A7, OR3A8P		8004088, 9500546	Standard	NM_012373		Approved	OR17-201, OR17-137, OR17-16	uc010vrd.2	P47888	OTTHUMG00000090649	ENST00000291231.1:c.394C>T	17.37:g.3324255C>T	ENSP00000291231:p.Leu132Phe		Q2VPE4|Q6IFM6|Q9P1Q4|Q9UBE7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L132F	ENST00000291231.1	37	c.394	CCDS11025.1	17	828	0.3791208791208791	209	0.4247967479674797	138	0.3812154696132597	79	0.1381118881118881	402	0.5303430079155673	T	5.740	0.320985	0.10845	.	.	ENSG00000159961	ENST00000291231	T	0.35236	1.32	2.51	2.51	0.30379	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00012	0.0000	N	0.00335	-1.625	0.49213	P	2.3399999999995647E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.45556	-0.9253	8	0.10902	T	0.67	.	7.1237	0.25458	0.0:0.1198:0.0:0.8802	rs769432;rs7224902;rs12937427;rs769432	132	P47888	OR3A3_HUMAN	F	132	ENSP00000291231:L132F	ENSP00000291231:L132F	L	+	1	0	OR3A3	3271005	0.699000	0.27786	0.909000	0.35828	0.879000	0.50718	4.049000	0.57397	0.373000	0.24621	-0.275000	0.10095	CTC	OR3A3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000159961		0.597	OR3A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR3A3	HGNC	protein_coding	OTTHUMT00000207309.1	34	0.00	0	C			3324255	3324255	+1	no_errors	ENST00000291231	ensembl	human	known	69_37n	missense	16	26.09	6	SNP	1.000	T
OR7E19P	26651	genome.wustl.edu	37	19	9376507	9376507	+	RNA	SNP	C	C	T			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr19:9376507C>T	ENST00000588789.1	-	0	114									olfactory receptor, family 7, subfamily E, member 19 pseudogene																		TGAATTGTAACACAATCTGAT	0.403																																						dbGAP											0																																										-	-	-			0					19p13.2	2014-03-20			ENSG00000225980	ENSG00000225980		"""GPCR / Class A : Olfactory receptors"""	8390	pseudogene	pseudogene				OR7E65			Standard	NG_002356		Approved	OR19-7			OTTHUMG00000179940		19.37:g.9376507C>T				RNA	SNP	-	NULL	ENST00000588789.1	37	NULL		19																																																																																			OR7E19P	-	-	ENSG00000225980		0.403	OR7E19P-002	KNOWN	basic	processed_transcript	OR7E19P	HGNC	pseudogene	OTTHUMT00000449009.1	38	0.00	0	C			9376507	9376507	-1	no_errors	ENST00000588789	ensembl	human	known	69_37n	rna	30	11.76	4	SNP	0.000	T
OTOG	340990	genome.wustl.edu	37	11	17593709	17593709	+	Missense_Mutation	SNP	T	T	C	rs7106548|rs386751105	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr11:17593709T>C	ENST00000399391.2	+	17	2074	c.2074T>C	c.(2074-2076)Tct>Cct	p.S692P	OTOG_ENST00000399397.1_Missense_Mutation_p.S619P	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	692	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.		S -> P (in dbSNP:rs7106548).		adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						CCCGCTGGTCTCTGGCTCCCC	0.592													C|||	2208	0.440895	0.6664	0.3242	5008	,	,		16926	0.3204		0.4155	False		,,,				2504	0.3691					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.2074T>C	11.37:g.17593709T>C	ENSP00000382323:p.Ser692Pro		A8MTX6|A8MUJ0|B7WPC4	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.S692P	ENST00000399391.2	37	c.2074	CCDS59225.1	11	904	0.4139194139194139	327	0.6646341463414634	116	0.32044198895027626	144	0.2517482517482518	317	0.4182058047493404	C	8.490	0.861886	0.17178	.	.	ENSG00000188162	ENST00000399391;ENST00000399397	T;T	0.16196	2.36;2.47	5.4	-4.21	0.03812	.	1.182810	0.06452	N	0.727832	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	.	.	.	.	.	.	T	0.34204	-0.9838	7	0.25106	T	0.35	.	8.5735	0.33583	0.0:0.2638:0.2909:0.4453	rs7106548;rs52794588;rs60134828;rs7106548	.	.	.	P	692;619	ENSP00000382323:S692P;ENSP00000382329:S619P	ENSP00000382323:S692P	S	+	1	0	OTOG	17550285	0.000000	0.05858	0.003000	0.11579	0.641000	0.38312	0.032000	0.13732	-1.041000	0.03266	-0.213000	0.12676	TCT	OTOG	-	NULL	ENSG00000188162		0.592	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		42	0.00	0	T			17593709	17593709	+1	no_errors	ENST00000399391	ensembl	human	known	69_37n	missense	30	25.00	10	SNP	0.000	C
OTOG	340990	genome.wustl.edu	37	11	17596313	17596313	+	Silent	SNP	G	G	A	rs4757548	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr11:17596313G>A	ENST00000399391.2	+	19	2376	c.2376G>A	c.(2374-2376)ccG>ccA	p.P792P	OTOG_ENST00000399397.1_Silent_p.P719P	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	792	TIL.				adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						GCGTGGCCCCGTGTGGACGTA	0.632													G|||	1672	0.333866	0.3759	0.2435	5008	,	,		20095	0.2986		0.3976	False		,,,				2504	0.3119					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.2376G>A	11.37:g.17596313G>A			A8MTX6|A8MUJ0|B7WPC4	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.P792	ENST00000399391.2	37	c.2376	CCDS59225.1	11																																																																																			OTOG	-	pfam_TIL_dom,superfamily_TIL_dom	ENSG00000188162		0.632	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		103	0.00	0	G			17596313	17596313	+1	no_errors	ENST00000399391	ensembl	human	known	69_37n	silent	47	20.34	12	SNP	0.010	A
PCDHA4	56144	genome.wustl.edu	37	5	140187102	140187102	+	Silent	SNP	A	A	G	rs3822347	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr5:140187102A>G	ENST00000530339.1	+	1	330	c.330A>G	c.(328-330)gtA>gtG	p.V110V	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000356878.4_Silent_p.V110V|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Silent_p.V110V|PCDHA3_ENST00000522353.2_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	110	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGTGATCGTAGACAGGCCGC	0.562																																						dbGAP											0													71.0	78.0	75.0					5																	140187102		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.330A>G	5.37:g.140187102A>G			O75285|Q2M253	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V110	ENST00000530339.1	37	c.330	CCDS54916.1	5																																																																																			PCDHA4	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204967		0.562	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	HGNC	protein_coding	OTTHUMT00000372864.2	83	0.00	0	A	NM_018907		140187102	140187102	+1	no_errors	ENST00000530339	ensembl	human	known	69_37n	silent	77	11.49	10	SNP	0.999	G
PCDHB16	57717	genome.wustl.edu	37	5	140563656	140563656	+	Missense_Mutation	SNP	G	G	A	rs17844648	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr5:140563656G>A	ENST00000361016.2	+	1	2677	c.1522G>A	c.(1522-1524)Gca>Aca	p.A508T		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	508	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.		A -> T (in dbSNP:rs56327450).		calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCCATCAACGCAGACAACGG	0.682													G|||	808	0.161342	0.2655	0.196	5008	,	,		11928	0.0536		0.167	False		,,,				2504	0.1012					dbGAP											0													31.0	32.0	32.0					5																	140563656		2152	4189	6341	-	-	-	SO:0001583	missense	0			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1522G>A	5.37:g.140563656G>A	ENSP00000354293:p.Ala508Thr		B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A508T	ENST00000361016.2	37	c.1522	CCDS4251.1	5	317	0.14514652014652016	120	0.24390243902439024	63	0.17403314917127072	30	0.05244755244755245	104	0.13720316622691292	g	8.751	0.921300	0.17982	.	.	ENSG00000196963	ENST00000361016	T	0.47869	0.83	4.26	2.16	0.27623	Cadherin (4);Cadherin-like (1);	0.833276	0.09771	N	0.757982	T	0.00012	0.0000	N	0.11818	0.18	0.58432	P	1.999999999946489E-6	P	0.36587	0.559	B	0.35413	0.202	T	0.17992	-1.0351	9	0.46703	T	0.11	.	1.8655	0.03198	0.1902:0.1415:0.4691:0.1993	rs56327450	508	Q9NRJ7	PCDBG_HUMAN	T	508	ENSP00000354293:A508T	ENSP00000354293:A508T	A	+	1	0	PCDHB16	140543840	0.000000	0.05858	0.224000	0.23877	0.037000	0.13140	-0.701000	0.05075	0.777000	0.33496	0.580000	0.79431	GCA	PCDHB16	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196963		0.682	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB16	HGNC	protein_coding	OTTHUMT00000251800.1	71	0.00	0	G	NM_020957		140563656	140563656	+1	no_errors	ENST00000361016	ensembl	human	known	69_37n	missense	61	15.28	11	SNP	0.066	A
PCDHB14	56122	genome.wustl.edu	37	5	140603611	140603611	+	Silent	SNP	C	C	T	rs201192118		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr5:140603611C>T	ENST00000239449.4	+	1	534	c.534C>T	c.(532-534)ttC>ttT	p.F178F	PCDHB14_ENST00000515856.2_Silent_p.F25F	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	178	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATTCTCACTTCTACATTAAAA	0.418																																					Ovarian(141;50 1831 27899 33809 37648)	dbGAP											0													76.0	78.0	77.0					5																	140603611		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.534C>T	5.37:g.140603611C>T			B4DPE2|Q4FZA4|Q4KN11	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F178	ENST00000239449.4	37	c.534	CCDS4256.1	5																																																																																			PCDHB14	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120327		0.418	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	HGNC	protein_coding	OTTHUMT00000251814.2	27	0.00	0	C	NM_018934		140603611	140603611	+1	no_errors	ENST00000239449	ensembl	human	known	69_37n	silent	18	33.33	9	SNP	0.883	T
PCDHB18	54660	genome.wustl.edu	37	5	140615861	140615861	+	RNA	SNP	G	G	A	rs6871453	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr5:140615861G>A	ENST00000526308.1	+	0	1924					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						GGTACCTCGGGCGGCCGAGCC	0.701													G|||	590	0.117812	0.1271	0.1801	5008	,	,		10180	0.0397		0.159	False		,,,				2504	0.0992					dbGAP											0																																										-	-	-			0			AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140615861G>A			B3KTF8	RNA	SNP	-	NULL	ENST00000526308.1	37	NULL		5																																																																																			PCDHB18	-	-	ENSG00000146001		0.701	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	HGNC	pseudogene	OTTHUMT00000394776.1	72	0.00	0	G			140615861	140615861	+1	no_errors	ENST00000526308	ensembl	human	known	69_37n	rna	67	14.10	11	SNP	0.014	A
PGBD3	267004	genome.wustl.edu	37	10	50724809	50724809	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr10:50724809C>T	ENST00000374127.3	-	2	553	c.352G>A	c.(352-354)Gac>Aac	p.D118N	ERCC6-PGBD3_ENST00000447839.2_Missense_Mutation_p.D586N|PGBD3_ENST00000508005.2_Missense_Mutation_p.D118N|PGBD3_ENST00000603152.1_Missense_Mutation_p.D586N|ERCC6_ENST00000355832.5_Intron|ERCC6-PGBD3_ENST00000515869.1_Missense_Mutation_p.D586N	NM_170753.2	NP_736609.2	Q8N328	PGBD3_HUMAN	piggyBac transposable element derived 3	118								p.D118N(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(16)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	33						ACAGTTAGGTCGGCTTTTTTC	0.423																																						dbGAP											1	Substitution - Missense(1)	lung(1)											147.0	137.0	140.0					10																	50724809		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074682	CCDS7230.1	10q11	2011-03-24			ENSG00000243251	ENSG00000243251			19400	protein-coding gene	gene with protein product							Standard	NM_170753		Approved	FLJ90201		Q8N328	OTTHUMG00000018193	ENST00000374127.3:c.352G>A	10.37:g.50724809C>T	ENSP00000363242:p.Asp118Asn		B3KQC4|Q5W0M0|Q6PIH0	Missense_Mutation	SNP	NULL	p.D118N	ENST00000374127.3	37	c.352	CCDS7230.1	10	.	.	.	.	.	.	.	.	.	.	C	12.64	1.997814	0.35226	.	.	ENSG00000243251;ENSG00000243251;ENSG00000258838;ENSG00000258838	ENST00000374127;ENST00000508005;ENST00000515869;ENST00000447839	T;T;T;T	0.14640	2.49;2.49;3.37;3.37	0.468	0.468	0.16732	.	.	.	.	.	T	0.10337	0.0253	N	0.19112	0.55	0.09310	N	1	D;B	0.53312	0.959;0.033	P;B	0.47705	0.555;0.0	T	0.30592	-0.9973	8	0.30078	T	0.28	-6.3091	.	.	.	.	586;118	E7EV46;Q8N328	.;PGBD3_HUMAN	N	118;118;586;586	ENSP00000363242:D118N;ENSP00000426963:D118N;ENSP00000423550:D586N;ENSP00000387966:D586N	ENSP00000387966:D586N	D	-	1	0	PGBD3;RP11-123B3.6	50394815	0.925000	0.31364	0.018000	0.16275	0.017000	0.09413	1.799000	0.38824	0.488000	0.27723	0.491000	0.48974	GAC	PGBD3	-	NULL	ENSG00000243251		0.423	PGBD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PGBD3	HGNC	protein_coding	OTTHUMT00000047988.1	104	0.95	1	C			50724809	50724809	-1	no_errors	ENST00000374127	ensembl	human	known	69_37n	missense	43	31.25	20	SNP	0.334	T
PGC	5225	genome.wustl.edu	37	6	41708938	41708938	+	Intron	SNP	C	C	G	rs4711690	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr6:41708938C>G	ENST00000373025.3	-	6	710				PGC_ENST00000425343.2_Missense_Mutation_p.Q241H	NM_002630.3	NP_002621.1	P20142	PEPC_HUMAN	progastricsin (pepsinogen C)						digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|skin(1)	16	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			TCTCTGGTAGCTGGAGTGTGG	0.502													C|||	1061	0.211861	0.27	0.2853	5008	,	,		16480	0.254		0.1282	False		,,,				2504	0.1237					dbGAP											0													68.0	66.0	66.0					6																	41708938		692	1591	2283	-	-	-	SO:0001627	intron_variant	0				CCDS4859.1, CCDS55000.1	6p21.1	2012-10-02			ENSG00000096088	ENSG00000096088	3.4.23.3		8890	protein-coding gene	gene with protein product		169740					Standard	NM_002630		Approved		uc003ora.2	P20142	OTTHUMG00000014683	ENST00000373025.3:c.648-590G>C	6.37:g.41708938C>G			B4DVZ3|Q5T3D7|Q5T3D8	Missense_Mutation	SNP	pfam_Peptidase_A1,pfam_Propep_A1,superfamily_Peptidase_aspartic	p.Q241H	ENST00000373025.3	37	c.723	CCDS4859.1	6	474	0.21703296703296704	143	0.29065040650406504	88	0.2430939226519337	147	0.256993006993007	96	0.1266490765171504	C	11.13	1.548399	0.27652	.	.	ENSG00000096088	ENST00000425343	T	0.61040	0.14	2.66	-2.47	0.06442	.	.	.	.	.	T	0.26268	0.0641	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.34428	-0.9829	5	0.66056	D	0.02	.	1.0076	0.01490	0.365:0.2559:0.2457:0.1334	rs4711690;rs4711690	.	.	.	H	241	ENSP00000405094:Q241H	ENSP00000405094:Q241H	Q	-	3	2	PGC	41816916	0.000000	0.05858	0.000000	0.03702	0.417000	0.31264	-0.514000	0.06298	-0.586000	0.05898	0.561000	0.74099	CAG	PGC	-	NULL	ENSG00000096088		0.502	PGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGC	HGNC	protein_coding	OTTHUMT00000040521.2	59	0.00	0	C			41708938	41708938	-1	no_errors	ENST00000425343	ensembl	human	known	69_37n	missense	45	23.33	14	SNP	0.000	G
JADE2	23338	genome.wustl.edu	37	5	133861426	133861426	+	5'UTR	SNP	G	G	T	rs75304543|rs11545742	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr5:133861426G>T	ENST00000282605.4	+	0	80				PHF15_ENST00000395003.1_5'Flank|PHF15_ENST00000361895.2_5'UTR|PHF15_ENST00000402835.1_5'Flank|PHF15_ENST00000515554.1_3'UTR																NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCTATTTTTTGGGGGGGGTGA	0.602													G|||	705	0.140775	0.0038	0.1628	5008	,	,		7201	0.3472		0.1362	False		,,,				2504	0.1022					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0																														ENST00000282605.4:c.-7G>T	5.37:g.133861426G>T				Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.L14F	ENST00000282605.4	37	c.42		5	396	0.1813186813186813	22	0.044715447154471545	56	0.15469613259668508	204	0.35664335664335667	114	0.1503957783641161	G	7.905	0.735241	0.15574	.	.	ENSG00000043143	ENST00000448712	.	.	.	2.14	1.22	0.21188	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.999999999935623	B	0.02656	0.0	B	0.01281	0.0	T	0.43507	-0.9387	6	0.16420	T	0.52	.	9.5573	0.39346	0.0:0.0:0.7887:0.2113	.	14	B3KPL2	.	F	14	.	ENSP00000393804:L14F	L	+	3	2	PHF15	133889325	0.031000	0.19500	0.819000	0.32651	0.752000	0.42762	-0.470000	0.06639	0.436000	0.26393	0.194000	0.17425	TTG	PHF15	-	NULL	ENSG00000043143		0.602	PHF15-003	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	PHF15	HGNC	protein_coding	OTTHUMT00000251170.1	45	0.00	0	G			133861426	133861426	+1	no_errors	ENST00000448712	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	0.899	T
PIEZO2	63895	genome.wustl.edu	37	18	10705744	10705744	+	Splice_Site	SNP	G	G	A	rs7227022	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr18:10705744G>A	ENST00000503781.3	-	37	5249	c.5250C>T	c.(5248-5250)agC>agT	p.S1750S	PIEZO2_ENST00000302079.6_Splice_Site_p.S1750S|RP11-856M7.2_ENST00000584167.1_RNA|PIEZO2_ENST00000580640.1_Splice_Site_p.S1775S	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	1750					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										GCGTGGGCTCGCTGTTGGGAG	0.592													g|||	1493	0.298123	0.23	0.3833	5008	,	,		20798	0.3661		0.2594	False		,,,				2504	0.2996					dbGAP											0													5.0	5.0	5.0					18																	10705744		679	1567	2246	-	-	-	SO:0001630	splice_region_variant	0			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.5250-1C>T	18.37:g.10705744G>A			B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Silent	SNP	pfam_DUF3595	p.S1775	ENST00000503781.3	37	c.5325		18																																																																																			PIEZO2	-	NULL	ENSG00000154864		0.592	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	PIEZO2	HGNC	protein_coding	OTTHUMT00000442385.4	22	0.00	0	G	NM_022068	Silent	10705744	10705744	-1	no_errors	ENST00000580640	ensembl	human	novel	69_37n	silent	17	19.05	4	SNP	0.208	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	18	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	1.000	G
PILRB	29990	genome.wustl.edu	37	7	99954457	99954457	+	5'UTR	SNP	G	G	T	rs41280971	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr7:99954457G>T	ENST00000452089.1	+	0	927				STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA|PILRB_ENST00000448382.1_Silent_p.G78G|PILRB_ENST00000444073.1_5'UTR|PILRB_ENST00000609309.1_5'Flank|PILRB_ENST00000610247.1_5'UTR			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ACAGATCAGGGAGGCTGTCGT	0.592													g|||	525	0.104832	0.1074	0.1023	5008	,	,		20187	0.0278		0.1759	False		,,,				2504	0.1094					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000452089.1:c.-133G>T	7.37:g.99954457G>T			Q69YF9|Q9HBS0	Splice_Site	SNP	-	e0+2	ENST00000452089.1	37	c.1+2	CCDS43622.1	7	227	0.10393772893772894	43	0.08739837398373984	36	0.09944751381215469	12	0.02097902097902098	136	0.17941952506596306	.	0.109	-1.140830	0.01728	.	.	ENSG00000121716	ENST00000413850	.	.	.	2.19	-4.37	0.03633	.	.	.	.	.	.	.	.	.	.	.	0.54753	P	1.0999999999983245E-5	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.1628	0.00105	0.3665:0.2079:0.1916:0.234	rs41280971	.	.	.	.	-1	.	.	.	+	.	.	PILRB	99792393	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.166000	0.00575	-1.252000	0.02491	-0.457000	0.05445	.	PILRB	-	-	ENSG00000121716		0.592	PILRB-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PILRB	HGNC	protein_coding	OTTHUMT00000339923.2	39	0.00	0	G	NM_178238		99954457	99954457	+1	no_errors	ENST00000420688	ensembl	human	known	69_37n	splice_site	30	18.92	7	SNP	0.000	T
PLG	5340	genome.wustl.edu	37	6	161173946	161173946	+	Silent	SNP	T	T	G	rs11060	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr6:161173946T>G	ENST00000308192.9	+	19	2349	c.2286T>G	c.(2284-2286)ggT>ggG	p.G762G		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	762	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	ACAGTGGAGGTCCTCTGGTTT	0.468													T|||	3411	0.68111	0.5348	0.7075	5008	,	,		18500	0.9782		0.5249	False		,,,				2504	0.7147					dbGAP											0													97.0	91.0	93.0					6																	161173946		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.2286T>G	6.37:g.161173946T>G			Q15146|Q5TEH4|Q6PA00	Silent	SNP	pirsf_Pept_S1A_plasmin,pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.G762	ENST00000308192.9	37	c.2286	CCDS5279.1	6																																																																																			PLG	-	pirsf_Pept_S1A_plasmin,pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Peptidase_S1_S6	ENSG00000122194		0.468	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	HGNC	protein_coding	OTTHUMT00000042959.2	94	0.00	0	T	NM_000301		161173946	161173946	+1	no_errors	ENST00000308192	ensembl	human	known	69_37n	silent	49	16.67	10	SNP	0.999	G
POP5	51367	genome.wustl.edu	37	12	121018862	121018862	+	Intron	SNP	C	C	T	rs10774559	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr12:121018862C>T	ENST00000357500.4	-	2	199				POP5_ENST00000341039.2_Intron|POP5_ENST00000542776.1_Intron	NM_015918.3	NP_057002.2	Q969H6	POP5_HUMAN	processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)						tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)	ribonuclease P activity (GO:0004526)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	all_neural(191;0.077)|Medulloblastoma(191;0.0922)					CGGCGCCTGCCCCCTCCACAT	0.647													C|||	1295	0.258586	0.0582	0.3934	5008	,	,		16028	0.2579		0.3519	False		,,,				2504	0.3384					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ306296	CCDS9202.1, CCDS9203.1	12q24.31	2012-05-21			ENSG00000167272	ENSG00000167272			17689	protein-coding gene	gene with protein product		609992				11413139	Standard	NM_198202		Approved		uc001tys.3	Q969H6	OTTHUMG00000169023	ENST00000357500.4:c.163+55G>A	12.37:g.121018862C>T			A6NL80|Q53FS5|Q9Y2Q6	RNA	SNP	-	NULL	ENST00000357500.4	37	NULL	CCDS9202.1	12																																																																																			POP5	-	-	ENSG00000167272		0.647	POP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP5	HGNC	protein_coding	OTTHUMT00000401993.1	38	0.00	0	C	NM_015918		121018862	121018862	-1	no_errors	ENST00000543355	ensembl	human	known	69_37n	rna	30	29.55	13	SNP	0.006	T
POPDC2	64091	genome.wustl.edu	37	3	119361250	119361250	+	3'UTR	SNP	A	A	G	rs8007	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:119361250A>G	ENST00000264231.3	-	0	1334				POPDC2_ENST00000474523.1_5'UTR|POPDC2_ENST00000493094.1_3'UTR	NM_022135.2	NP_071418.2	Q9HBU9	POPD2_HUMAN	popeye domain containing 2						regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sinoatrial node cell development (GO:0060931)	integral component of membrane (GO:0016021)	cAMP binding (GO:0030552)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.242)		GAAAAGAGGCATGCCTATCAG	0.527													G|||	2408	0.480831	0.5061	0.4813	5008	,	,		21300	0.3393		0.4602	False		,,,				2504	0.6135					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF204173	CCDS2992.1	3q13.33	2004-01-15			ENSG00000121577	ENSG00000121577			17648	protein-coding gene	gene with protein product		605823				10882522	Standard	NM_022135		Approved	POP2	uc031sbc.1	Q9HBU9	OTTHUMG00000159438	ENST00000264231.3:c.*73T>C	3.37:g.119361250A>G			Q86UE7	RNA	SNP	-	NULL	ENST00000264231.3	37	NULL	CCDS2992.1	3																																																																																			POPDC2	-	-	ENSG00000121577		0.527	POPDC2-002	KNOWN	basic|CCDS	protein_coding	POPDC2	HGNC	protein_coding	OTTHUMT00000355378.1	35	0.00	0	A	NM_022135		119361250	119361250	-1	no_errors	ENST00000474523	ensembl	human	known	69_37n	rna	24	14.29	4	SNP	0.000	G
HELZ2	85441	genome.wustl.edu	37	20	62202615	62202615	+	Intron	SNP	G	G	A	rs76623277|rs73622827	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr20:62202615G>A	ENST00000467148.1	-	2	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CTCCTGCCCCGCTCCAAGCTC	0.692																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.279-394C>T	20.37:g.62202615G>A			Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	RNA	SNP	-	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			RP4-697K14.7	-	-	ENSG00000130589		0.692	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIC285	Clone_based_vega_gene	protein_coding	OTTHUMT00000354127.1	45	0.00	0	G	NM_001037335		62202615	62202615	-1	no_errors	ENST00000479540	ensembl	human	known	69_37n	rna	46	22.03	13	SNP	0.382	A
PRRC2C	23215	genome.wustl.edu	37	1	171496952	171496952	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:171496952T>C	ENST00000338920.4	+	11	1454	c.1217T>C	c.(1216-1218)cTg>cCg	p.L406P	PRRC2C_ENST00000367742.3_Missense_Mutation_p.L408P|PRRC2C_ENST00000392078.3_Missense_Mutation_p.L408P|PRRC2C_ENST00000426496.2_Missense_Mutation_p.L406P|PRRC2C_ENST00000476522.1_3'UTR	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	406					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										TCTTCACATCTGCCACCACCT	0.383																																						dbGAP											0													81.0	85.0	84.0					1																	171496952		2203	4299	6502	-	-	-	SO:0001583	missense	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.1217T>C	1.37:g.171496952T>C	ENSP00000343629:p.Leu406Pro		Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	pfam_BAT2_N	p.L408P	ENST00000338920.4	37	c.1223	CCDS1296.2	1	.	.	.	.	.	.	.	.	.	.	T	11.63	1.697141	0.30142	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000483654	T;T;T;T	0.05786	3.39;3.39;3.39;3.39	5.12	5.12	0.69794	.	0.000000	0.32819	U	0.005610	T	0.11836	0.0288	L	0.56769	1.78	0.49299	D	0.999778	D;D	0.76494	0.999;0.998	D;D	0.87578	0.998;0.993	T	0.01951	-1.1241	10	0.41790	T	0.15	.	11.5877	0.50929	0.0:0.0:0.0:1.0	.	406;408	Q9Y520-4;E7EPN9	.;.	P	408;406;406;408;406;162;164	ENSP00000375928:L408P;ENSP00000410219:L406P;ENSP00000356716:L408P;ENSP00000343629:L406P	ENSP00000343629:L406P	L	+	2	0	PRRC2C	169763576	0.997000	0.39634	0.989000	0.46669	0.914000	0.54420	3.640000	0.54350	2.065000	0.61736	0.260000	0.18958	CTG	PRRC2C	-	NULL	ENSG00000117523		0.383	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRRC2C	HGNC	protein_coding	OTTHUMT00000314826.4	39	0.00	0	T	NM_015172		171496952	171496952	+1	no_errors	ENST00000392078	ensembl	human	known	69_37n	missense	35	10.00	4	SNP	0.989	C
PSCA	8000	genome.wustl.edu	37	8	143762932	143762932	+	3'UTR	SNP	G	G	A	rs2976392	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr8:143762932G>A	ENST00000513264.1	+	0	295				PSCA_ENST00000301258.4_Intron|PSCA_ENST00000505305.1_3'UTR			O43653	PSCA_HUMAN	prostate stem cell antigen							anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)	2	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GTCCGCATCTGTGTGCTGTTT	0.612													A|||	2029	0.405152	0.3676	0.5072	5008	,	,		18996	0.3413		0.4463	False		,,,				2504	0.407					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF043498	CCDS47925.1, CCDS47925.2	8q24.2	2004-02-03				ENSG00000167653			9500	protein-coding gene	gene with protein product		602470				9465086	Standard	NM_005672		Approved		uc022bcd.1	O43653		ENST00000513264.1:c.*48G>A	8.37:g.143762932G>A			Q6UW92	RNA	SNP	-	NULL	ENST00000513264.1	37	NULL		8																																																																																			PSCA	-	-	ENSG00000167653		0.612	PSCA-002	PUTATIVE	basic	protein_coding	PSCA	HGNC	protein_coding	OTTHUMT00000367113.2	78	0.00	0	G	NM_005672		143762932	143762932	+1	no_errors	ENST00000505305	ensembl	human	known	69_37n	rna	43	17.31	9	SNP	0.000	A
RASGRP2	10235	genome.wustl.edu	37	11	64506871	64506871	+	Silent	SNP	G	G	T			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr11:64506871G>T	ENST00000354024.3	-	8	1026	c.774C>A	c.(772-774)ctC>ctA	p.L258L	RASGRP2_ENST00000394432.3_Silent_p.L258L|RASGRP2_ENST00000377494.1_Silent_p.L258L|RASGRP2_ENST00000377497.3_Silent_p.L258L	NM_153819.1	NP_722541.1	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2 (calcium and DAG-regulated)	258	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				blood coagulation (GO:0007596)|cellular response to calcium ion (GO:0071277)|platelet activation (GO:0030168)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GGGTCTCCTTGAGGCGGGAGA	0.627																																						dbGAP											0													79.0	78.0	78.0					11																	64506871		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			U78170	CCDS31598.1	11q13	2014-09-17			ENSG00000068831	ENSG00000068831		"""EF-hand domain containing"""	9879	protein-coding gene	gene with protein product		605577				9789079	Standard	NM_001098670		Approved	CALDAG-GEFI	uc009ypv.3	Q7LDG7	OTTHUMG00000045420	ENST00000354024.3:c.774C>A	11.37:g.64506871G>T			A6NDC7|O00538|Q9UL65	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_EF_hand_Ca-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.L258	ENST00000354024.3	37	c.774	CCDS31598.1	11																																																																																			RASGRP2	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000068831		0.627	RASGRP2-002	NOVEL	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	RASGRP2	HGNC	protein_coding	OTTHUMT00000142062.1	56	0.00	0	G	NM_153819		64506871	64506871	-1	no_errors	ENST00000377494	ensembl	human	known	69_37n	silent	33	10.81	4	SNP	1.000	T
RBMXL1	494115	genome.wustl.edu	37	1	89449434	89449434	+	Missense_Mutation	SNP	T	T	C	rs2893084	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:89449434T>C	ENST00000321792.5	-	2	503	c.76A>G	c.(76-78)Aca>Gca	p.T26A	RBMXL1_ENST00000413769.1_5'UTR|CCBL2_ENST00000370491.3_Intron|CCBL2_ENST00000260508.4_Intron|CCBL2_ENST00000370485.2_Intron|CCBL2_ENST00000446900.2_Intron|RBMXL1_ENST00000399794.2_Missense_Mutation_p.T26A	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	26	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										CCAAATACTGTTTCAAGAGCT	0.413											OREG0013593	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													184.0	183.0	183.0					1																	89449434		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.76A>G	1.37:g.89449434T>C	ENSP00000318415:p.Thr26Ala	1267		Missense_Mutation	SNP	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.T26A	ENST00000321792.5	37	c.76	CCDS716.1	1	.	.	.	.	.	.	.	.	.	.	T	3.554	-0.091124	0.07053	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	D;D	0.85171	-1.95;-1.95	1.28	-2.56	0.06268	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.275039	0.28382	N	0.015553	T	0.30885	0.0779	N	0.03224	-0.385	0.20873	N	0.999835	B	0.02656	0.0	B	0.06405	0.002	T	0.49818	-0.8899	10	0.02654	T	1	7.3308	6.0529	0.19794	0.0:0.6607:0.0:0.3393	rs2893084	26	Q96E39	RBMXL_HUMAN	A	26	ENSP00000318415:T26A;ENSP00000446099:T26A	ENSP00000318415:T26A	T	-	1	0	RBMXL1	89222022	1.000000	0.71417	0.482000	0.27366	0.917000	0.54804	1.281000	0.33214	-0.855000	0.04125	-0.760000	0.03462	ACA	RBMXL1	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	ENSG00000213516		0.413	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL1	HGNC	protein_coding	OTTHUMT00000029403.3	63	0.00	0	T	NM_019610		89449434	89449434	-1	no_errors	ENST00000321792	ensembl	human	known	69_37n	missense	60	14.29	10	SNP	0.996	C
RGPD3	653489	genome.wustl.edu	37	2	107073469	107073469	+	Silent	SNP	T	T	A	rs62152528		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr2:107073469T>A	ENST00000409886.3	-	4	450	c.363A>T	c.(361-363)gcA>gcT	p.A121A	RGPD3_ENST00000304514.7_Silent_p.A121A	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	121					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						AAAGTTTTGCTGCTCTTTCCA	0.333																																						dbGAP											0													165.0	142.0	149.0					2																	107073469		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.363A>T	2.37:g.107073469T>A			B8ZZM4	Silent	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.A121	ENST00000409886.3	37	c.363	CCDS46379.1	2																																																																																			RGPD3	-	NULL	ENSG00000153165		0.333	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	231	0.00	0	T	XM_929931		107073469	107073469	-1	no_errors	ENST00000304514	ensembl	human	known	69_37n	silent	184	20.69	48	SNP	0.995	A
RGPD3	653489	genome.wustl.edu	37	2	107073501	107073501	+	Missense_Mutation	SNP	C	C	T	rs62152530		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr2:107073501C>T	ENST00000409886.3	-	4	418	c.331G>A	c.(331-333)Gat>Aat	p.D111N	RGPD3_ENST00000304514.7_Missense_Mutation_p.D111N	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	111					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						GCTCTTCCATCAGTAACATCA	0.343																																						dbGAP											0													160.0	135.0	143.0					2																	107073501		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.331G>A	2.37:g.107073501C>T	ENSP00000386588:p.Asp111Asn		B8ZZM4	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.D111N	ENST00000409886.3	37	c.331	CCDS46379.1	2	1686	0.771978021978022	323	0.6565040650406504	272	0.7513812154696132	552	0.965034965034965	539	0.7110817941952506	.	15.13	2.743126	0.49151	.	.	ENSG00000153165	ENST00000409886;ENST00000304514;ENST00000440524	T;T	0.37235	1.21;1.21	2.57	2.57	0.30868	Tetratricopeptide-like helical (1);	.	.	.	.	T	0.00012	0.0000	M	0.68952	2.095	0.32569	P	0.530029	D	0.57571	0.98	D	0.72338	0.977	T	0.11542	-1.0583	8	0.31617	T	0.26	-28.2164	10.9	0.47045	0.0:1.0:0.0:0.0	.	111	A6NKT7	RGPD3_HUMAN	N	111;111;54	ENSP00000386588:D111N;ENSP00000303659:D111N	ENSP00000303659:D111N	D	-	1	0	RGPD3	106439933	1.000000	0.71417	1.000000	0.80357	0.558000	0.35554	5.084000	0.64462	1.430000	0.47334	0.164000	0.16699	GAT	RGPD3	-	NULL	ENSG00000153165		0.343	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	243	0.00	0	C	XM_929931		107073501	107073501	-1	no_errors	ENST00000304514	ensembl	human	known	69_37n	missense	213	17.44	45	SNP	0.999	T
RGPD3	653489	genome.wustl.edu	37	2	107084739	107084739	+	Silent	SNP	A	A	G	rs6718521	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr2:107084739A>G	ENST00000409886.3	-	1	93	c.6T>C	c.(4-6)agT>agC	p.S2S	RGPD3_ENST00000304514.7_Silent_p.S2S	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	2					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						CCTTGCTGCAACTCATCGCGC	0.657													.|||	2209	0.441094	0.2088	0.4409	5008	,	,		12001	0.8313		0.2952	False		,,,				2504	0.5031					dbGAP											0													65.0	93.0	84.0					2																	107084739		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.6T>C	2.37:g.107084739A>G			B8ZZM4	Silent	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.S2	ENST00000409886.3	37	c.6	CCDS46379.1	2																																																																																			RGPD3	-	NULL	ENSG00000153165		0.657	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	135	0.74	1	A	XM_929931		107084739	107084739	-1	no_errors	ENST00000304514	ensembl	human	known	69_37n	silent	92	12.38	13	SNP	0.992	G
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037819	10037819	+	RNA	SNP	T	T	G	rs5005396		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chrY:10037819T>G	ENST00000515896.1	+	0	56									RNA, 5.8S ribosomal pseudogene 6																		CAGCTAGCTGTGAGAATTAAT	0.527																																						dbGAP											0																																										-	-	-			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037819T>G				RNA	SNP	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.527	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA		74	0.00	0	T			10037819	10037819	+1	no_errors	ENST00000515896	ensembl	human	known	69_37n	rna	48	12.73	7	SNP	1.000	G
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037863	10037863	+	RNA	DEL	C	C	-	rs373540942		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chrY:10037863delC	ENST00000515896.1	+	0	100									RNA, 5.8S ribosomal pseudogene 6																		ATCGACACTTCGAACGCACTT	0.552																																						dbGAP											0																																										-	-	-			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037863delC				RNA	DEL	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.552	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA		41	0.00	0	C			10037863	10037863	+1	no_errors	ENST00000515896	ensembl	human	known	69_37n	rna	30	12.82	5	DEL	1.000	-
RP1L1	94137	genome.wustl.edu	37	8	10467605	10467605	+	Missense_Mutation	SNP	C	C	T	rs61503212		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr8:10467605C>T	ENST00000382483.3	-	4	4226	c.4003G>A	c.(4003-4005)Ggg>Agg	p.G1335R		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1351	8 X 16 AA approximate tandem repeats of T-E-E-G-L-Q-E-E-G-V-Q-L-E-E-T-K.		G -> R (in allele RP1L1-2 and allele RP1L1-3; dbSNP:rs61503212).|Missing (in allele RP1L1-1).		cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		aactgcaccccctcttcttgc	0.468																																						dbGAP											0													120.0	116.0	117.0					8																	10467605		1948	4134	6082	-	-	-	SO:0001583	missense	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4003G>A	8.37:g.10467605C>T	ENSP00000371923:p.Gly1335Arg		Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.G1335R	ENST00000382483.3	37	c.4003	CCDS43708.1	8	.	.	.	.	.	.	.	.	.	.	C	11.32	1.604607	0.28623	.	.	ENSG00000183638	ENST00000382483	T	0.05996	3.36	2.64	-0.606	0.11619	.	.	.	.	.	T	0.02970	0.0088	N	0.08118	0	0.80722	P	0.0	B	0.29862	0.259	B	0.23018	0.043	T	0.36962	-0.9726	8	0.48119	T	0.1	.	7.1242	0.25463	0.0:0.3817:0.0:0.6183	rs61503212	1335	A6NKC6	.	R	1335	ENSP00000371923:G1335R	ENSP00000371923:G1335R	G	-	1	0	RP1L1	10505015	0.000000	0.05858	0.004000	0.12327	0.295000	0.27426	0.159000	0.16442	-0.082000	0.12640	0.462000	0.41574	GGG	RP1L1	-	NULL	ENSG00000183638		0.468	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	238	0.00	0	C			10467605	10467605	-1	no_errors	ENST00000382483	ensembl	human	known	69_37n	missense	236	12.92	35	SNP	0.000	T
AVL9	23080	genome.wustl.edu	37	7	32956941	32956941	+	Intron	SNP	C	C	T	rs2278817	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr7:32956941C>T	ENST00000404479.1	+	11	1215				RP9P_ENST00000381639.3_RNA			Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)						cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						GAATGTTGAACAAGTCACATC	0.413													C|||	1647	0.328874	0.4667	0.2378	5008	,	,		21510	0.1687		0.2724	False		,,,				2504	0.4305					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000404479.1:c.1216-112281C>T	7.37:g.32956941C>T			Q92573	RNA	SNP	-	NULL	ENST00000404479.1	37	NULL		7																																																																																			RP9P	-	-	ENSG00000205763		0.413	AVL9-201	KNOWN	basic	protein_coding	RP9P	HGNC	protein_coding		67	0.00	0	C	NM_015060		32956941	32956941	-1	no_errors	ENST00000381639	ensembl	human	known	69_37n	rna	43	10.42	5	SNP	0.000	T
RPS10P7	376693	genome.wustl.edu	37	1	201489565	201489565	+	lincRNA	SNP	C	C	T	rs4345829	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:201489565C>T	ENST00000441932.1	+	0	1735				RP11-134G8.7_ENST00000454651.1_RNA	NR_026667.1				ribosomal protein S10 pseudogene 7																		TACCTACAAACGGAGTGCTGT	0.572													C|||	1264	0.252396	0.1399	0.3329	5008	,	,		17295	0.0873		0.5775	False		,,,				2504	0.183					dbGAP											0																																										-	-	-			0					1q32.1	2010-06-16				ENSG00000223396			36423	pseudogene	pseudogene						19123937	Standard	NR_026667		Approved		uc010ppt.3				1.37:g.201489565C>T				RNA	SNP	-	NULL	ENST00000441932.1	37	NULL		1																																																																																			RPS10P7	-	-	ENSG00000223396		0.572	RPS10P7-001	KNOWN	basic	lincRNA	RPS10P7	HGNC	lincRNA	OTTHUMT00000087024.1	21	0.00	0	C	NR_026667		201489565	201489565	+1	no_errors	ENST00000441932	ensembl	human	known	69_37n	rna	12	25.00	4	SNP	1.000	T
RRN3P2	653390	genome.wustl.edu	37	16	29124421	29124421	+	RNA	SNP	T	T	C	rs386790202|rs1641997	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr16:29124421T>C	ENST00000564580.1	+	0	1499							A6NIE6	RN3P2_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 2																		TGCTTTGAAATGCCAGCGACT	0.388													.|||	3469	0.692692	0.8313	0.7363	5008	,	,		18614	0.5317		0.672	False		,,,				2504	0.6616					dbGAP											0																																										-	-	-			0					16p11.2	2011-12-02			ENSG00000103472	ENSG00000103472			37619	pseudogene	pseudogene							Standard	NR_003369		Approved		uc002dsf.4	A6NIE6			16.37:g.29124421T>C				RNA	SNP	-	NULL	ENST00000564580.1	37	NULL		16																																																																																			RRN3P2	-	-	ENSG00000103472		0.388	RRN3P2-001	KNOWN	basic	processed_transcript	RRN3P2	HGNC	pseudogene	OTTHUMT00000433243.1	101	0.98	1	T	NR_003369		29124421	29124421	+1	no_errors	ENST00000427965	ensembl	human	known	69_37n	rna	63	14.86	11	SNP	1.000	C
RSPH10B	222967	genome.wustl.edu	37	7	5983063	5983063	+	Missense_Mutation	SNP	C	C	T	rs148485394	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr7:5983063C>T	ENST00000405415.1	-	14	2036	c.1650G>A	c.(1648-1650)atG>atA	p.M550I	RSPH10B_ENST00000337579.3_Missense_Mutation_p.M550I|RSPH10B_ENST00000539903.1_3'UTR|RSPH10B_ENST00000404406.1_Missense_Mutation_p.M550I|RSPH10B_ENST00000535104.1_5'UTR|RSPH10B_ENST00000441023.2_Missense_Mutation_p.M550I			P0C881	R10B1_HUMAN	radial spoke head 10 homolog B (Chlamydomonas)	550										breast(1)|kidney(1)|lung(4)|ovary(1)|skin(4)	11		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)		TCATGTAACTCATAGAGTAGA	0.428																																						dbGAP											0													30.0	29.0	29.0					7																	5983063		2164	4268	6432	-	-	-	SO:0001583	missense	0				CCDS34598.1	7p22.2	2008-07-04			ENSG00000155026	ENSG00000155026			27362	protein-coding gene	gene with protein product						16507594	Standard	NM_173565		Approved		uc003sph.1	P0C881	OTTHUMG00000152378	ENST00000405415.1:c.1650G>A	7.37:g.5983063C>T	ENSP00000385443:p.Met550Ile		A6NMW7|Q86ST9|Q8NE68	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.M550I	ENST00000405415.1	37	c.1650	CCDS34598.1	7	420	0.19230769230769232	86	0.17479674796747968	87	0.24033149171270718	42	0.07342657342657342	205	0.2704485488126649	C	2.557	-0.302794	0.05495	.	.	ENSG00000155026	ENST00000405415;ENST00000404406;ENST00000337579;ENST00000354951;ENST00000441023	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	3.38	2.48	0.30137	.	0.193985	0.44285	D	0.000471	T	0.00012	0.0000	L	0.60455	1.87	0.09310	P	0.99999528627	B;B;B	0.33288	0.406;0.068;0.112	B;B;B	0.28232	0.087;0.013;0.04	T	0.15378	-1.0439	9	0.40728	T	0.16	.	5.6003	0.17349	0.1944:0.6963:0.0:0.1094	.	251;550;409	B7Z298;P0C881;F5GXE3	.;R10B1_HUMAN;.	I	550;550;550;409;550	ENSP00000385443:M550I;ENSP00000384097:M550I;ENSP00000338556:M550I;ENSP00000400988:M550I	ENSP00000338556:M550I	M	-	3	0	RSPH10B	5949589	0.985000	0.35326	0.060000	0.19600	0.014000	0.08584	0.436000	0.21526	0.734000	0.32515	0.551000	0.68910	ATG	RSPH10B	-	NULL	ENSG00000155026		0.428	RSPH10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH10B	HGNC	protein_coding	OTTHUMT00000325465.2	65	0.00	0	C	NM_173565		5983063	5983063	-1	no_errors	ENST00000337579	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.767	T
SAMSN1	64092	genome.wustl.edu	37	21	15954593	15954593	+	Missense_Mutation	SNP	G	G	A	rs2822786	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr21:15954593G>A	ENST00000285670.2	-	2	299	c.125C>T	c.(124-126)cCt>cTt	p.P42L	SAMSN1-AS1_ENST00000449214.1_RNA	NM_001256370.1	NP_001243299.1	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	0					negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		TTCAGGAAAAGGCTTCCAGTG	0.453													G|||	1159	0.23143	0.0212	0.3156	5008	,	,		18614	0.2679		0.341	False		,,,				2504	0.3057					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000285670.2:c.125C>T	21.37:g.15954593G>A	ENSP00000285670:p.Pro42Leu		B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Missense_Mutation	SNP	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.P42L	ENST00000285670.2	37	c.125	CCDS58786.1	21	544	0.2490842490842491	22	0.044715447154471545	100	0.27624309392265195	168	0.2937062937062937	254	0.33509234828496043	G	12.34	1.908162	0.33721	.	.	ENSG00000155307	ENST00000285670	T	0.43688	0.94	5.87	1.88	0.25563	.	0.804248	0.10751	N	0.638314	T	0.00012	0.0000	.	.	.	0.51767	P	6.499999999998174E-5	B	0.12013	0.005	B	0.12156	0.007	T	0.29336	-1.0015	8	0.87932	D	0	.	10.0958	0.42475	0.0612:0.0:0.5892:0.3496	rs2822786;rs17274360;rs52820672;rs58195465;rs2822786	42	F8WAA1	.	L	42	ENSP00000285670:P42L	ENSP00000285670:P42L	P	-	2	0	SAMSN1	14876464	0.000000	0.05858	0.013000	0.15412	0.514000	0.34195	0.579000	0.23788	0.125000	0.18397	0.655000	0.94253	CCT	SAMSN1	-	NULL	ENSG00000155307		0.453	SAMSN1-001	NOVEL	basic|CCDS	protein_coding	SAMSN1	HGNC	protein_coding	OTTHUMT00000157913.1	50	0.00	0	G			15954593	15954593	-1	no_errors	ENST00000285670	ensembl	human	novel	69_37n	missense	48	17.24	10	SNP	0.013	A
SENP3	26168	genome.wustl.edu	37	17	7474992	7474992	+	3'UTR	SNP	G	G	A	rs10468481	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:7474992G>A	ENST00000429205.2	+	0	1965				EIF4A1_ENST00000380512.5_5'Flank|EIF4A1_ENST00000577269.1_5'Flank|EIF4A1_ENST00000582746.1_5'Flank|EIF4A1_ENST00000293831.8_5'Flank|SENP3_ENST00000321337.7_3'UTR|SENP3-EIF4A1_ENST00000579777.1_RNA|SENP3_ENST00000578868.1_3'UTR			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3							cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				TGTGCAGGGGGTGGCTACAGA	0.478													G|||	1360	0.271565	0.0182	0.2666	5008	,	,		9576	0.3115		0.3807	False		,,,				2504	0.4642					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.*191G>A	17.37:g.7474992G>A			Q66K15|Q86VS7|Q96PS4|Q9Y3W9	RNA	SNP	-	NULL	ENST00000429205.2	37	NULL		17																																																																																			SENP3	-	-	ENSG00000161956		0.478	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	SENP3	HGNC	protein_coding		16	0.00	0	G	NM_015670		7474992	7474992	+1	no_errors	ENST00000578868	ensembl	human	known	69_37n	rna	12	25.00	4	SNP	0.575	A
SEPT6	23157	genome.wustl.edu	37	X	118759301	118759301	+	Intron	SNP	G	G	A			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chrX:118759301G>A	ENST00000343984.5	-	9	1545				SEPT6_ENST00000467310.1_5'UTR|SEPT6_ENST00000394610.1_3'UTR|SEPT6_ENST00000354228.4_Intron|SEPT6_ENST00000489216.1_3'UTR|SEPT6_ENST00000360156.7_3'UTR|SEPT6_ENST00000354416.3_Intron	NM_015129.5	NP_055944.2	Q14141	SEPT6_HUMAN	septin 6						cytokinesis (GO:0000910)|viral process (GO:0016032)	axon terminus (GO:0043679)|kinetochore (GO:0000776)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)	GTP binding (GO:0005525)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(3)	17						AGCTTACCAGGACCCTGGGTC	0.443			T	MLL	AML																																	dbGAP		Dom	yes		X	Xq24	23157	septin 6		L	0													86.0	78.0	81.0					X																	118759301		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			D50918	CCDS14583.1, CCDS14584.1, CCDS14585.1	Xq24	2013-01-21			ENSG00000125354	ENSG00000125354		"""Septins"""	15848	protein-coding gene	gene with protein product		300683				8590280, 10744683	Standard	NM_015129		Approved	KIAA0128, SEP2, SEPT2, MGC16619, MGC20339	uc004erv.3	Q14141	OTTHUMG00000022280	ENST00000343984.5:c.1280+3979C>T	X.37:g.118759301G>A			Q5JTK0|Q969W5|Q96A13|Q96GR1|Q96P86|Q96P87	RNA	SNP	-	NULL	ENST00000343984.5	37	NULL	CCDS14584.1	X																																																																																			SEPT6	-	-	ENSG00000125354		0.443	SEPT6-001	KNOWN	basic|CCDS	protein_coding	SEPT6	HGNC	protein_coding	OTTHUMT00000058059.1	34	0.00	0	G	NM_145802		118759301	118759301	-1	no_errors	ENST00000467310	ensembl	human	known	69_37n	rna	18	37.93	11	SNP	1.000	A
SERPINB10	5273	genome.wustl.edu	37	18	61575232	61575232	+	5'UTR	SNP	A	A	G	rs1006961	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr18:61575232A>G	ENST00000238508.3	+	0	8					NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				ATCTCTTACTACAGGAGCAAA	0.333													A|||	1748	0.349042	0.3669	0.3559	5008	,	,		16452	0.499		0.2296	False		,,,				2504	0.2883					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.-52A>G	18.37:g.61575232A>G			Q4VAX4|Q4VAX7	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.T196A	ENST00000238508.3	37	c.586	CCDS11990.1	18	720	0.32967032967032966	172	0.34959349593495936	118	0.3259668508287293	261	0.4562937062937063	169	0.22295514511873352	A	1.123	-0.654834	0.03480	.	.	ENSG00000242550	ENST00000397996	.	.	.	5.72	-1.56	0.08532	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.99999845424	.	.	.	.	.	.	T	0.46978	-0.9152	3	.	.	.	.	1.5904	0.02653	0.32:0.2901:0.2708:0.1192	rs1006961;rs1006961	.	.	.	A	196	.	.	T	+	1	0	SERPINB10	59726212	0.198000	0.23374	0.017000	0.16124	0.251000	0.25915	-0.300000	0.08243	-0.521000	0.06426	0.383000	0.25322	ACA	SERPINB10	-	superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000242550		0.333	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB10	HGNC	protein_coding	OTTHUMT00000134012.3	43	0.00	0	A	NM_005024		61575232	61575232	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000397996	ensembl	human	putative	69_37n	missense	62	11.43	8	SNP	0.794	G
SGIP1	84251	genome.wustl.edu	37	1	67160981	67160981	+	Intron	SNP	C	C	T	rs1325268	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:67160981C>T	ENST00000371037.4	+	18	1647				SGIP1_ENST00000237247.6_Intron|SGIP1_ENST00000371039.1_Intron|SGIP1_ENST00000371035.3_Intron|SGIP1_ENST00000435165.2_5'UTR|SGIP1_ENST00000371036.3_Intron	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1						endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						TTCCCTTTTTCCTGCACGCTA	0.423													C|||	1393	0.278155	0.2572	0.2622	5008	,	,		16101	0.2212		0.3181	False		,,,				2504	0.3354					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.1571-136C>T	1.37:g.67160981C>T			A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	RNA	SNP	-	NULL	ENST00000371037.4	37	NULL	CCDS30744.1	1																																																																																			SGIP1	-	-	ENSG00000118473		0.423	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGIP1	HGNC	protein_coding	OTTHUMT00000025395.4	56	0.00	0	C	NM_032291		67160981	67160981	+1	no_errors	ENST00000320161	ensembl	human	putative	69_37n	rna	28	22.22	8	SNP	0.929	T
SH2B1	25970	genome.wustl.edu	37	16	28883875	28883875	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr16:28883875C>A	ENST00000322610.8	+	10	2185	c.1746C>A	c.(1744-1746)aaC>aaA	p.N582K	SH2B1_ENST00000563674.1_Intron|SH2B1_ENST00000545570.1_Missense_Mutation_p.N272K|SH2B1_ENST00000337120.5_Missense_Mutation_p.N582K|SH2B1_ENST00000538342.1_Missense_Mutation_p.N246K|SH2B1_ENST00000359285.5_Missense_Mutation_p.N582K|SH2B1_ENST00000395532.4_Missense_Mutation_p.N582K			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1	582	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						TGTCGCTGAACGAGGAGGGTC	0.642																																						dbGAP											0													112.0	100.0	104.0					16																	28883875		2197	4300	6497	-	-	-	SO:0001583	missense	0			AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.1746C>A	16.37:g.28883875C>A	ENSP00000321221:p.Asn582Lys		A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	pfam_Phe_ZIP,pfam_Pleckstrin_homology,pfam_SH2,superfamily_Phe_ZIP,smart_Pleckstrin_homology,smart_SH2,prints_SH2,pfscan_SH2	p.N582K	ENST00000322610.8	37	c.1746	CCDS53996.1	16	.	.	.	.	.	.	.	.	.	.	c	16.46	3.130360	0.56721	.	.	ENSG00000178188	ENST00000322610;ENST00000545570;ENST00000359285;ENST00000538342;ENST00000395532;ENST00000337120	T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4	5.23	-5.28	0.02755	SH2 motif (4);	0.127712	0.49916	D	0.000138	T	0.58481	0.2125	L	0.41961	1.31	0.42114	D	0.991399	D;D;D;D;D	0.89917	1.0;1.0;0.995;0.998;0.999	D;D;D;D;D	0.85130	0.995;0.997;0.947;0.932;0.959	T	0.61023	-0.7146	10	0.49607	T	0.09	-20.3365	14.5807	0.68288	0.0:0.6144:0.0:0.3856	.	246;272;582;582;582	B4DLN5;F5GXU7;Q9NRF2-2;Q9NRF2-3;Q9NRF2	.;.;.;.;SH2B1_HUMAN	K	582;272;582;246;582;582	ENSP00000321221:N582K;ENSP00000440354:N272K;ENSP00000352232:N582K;ENSP00000438784:N246K;ENSP00000378903:N582K;ENSP00000337163:N582K	ENSP00000321221:N582K	N	+	3	2	SH2B1	28791376	0.000000	0.05858	0.898000	0.35279	0.995000	0.86356	-3.185000	0.00567	-1.181000	0.02730	-0.156000	0.13503	AAC	SH2B1	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000178188		0.642	SH2B1-001	KNOWN	basic|CCDS	protein_coding	SH2B1	HGNC	protein_coding	OTTHUMT00000432666.1	34	0.00	0	C	NM_015503		28883875	28883875	+1	no_errors	ENST00000322610	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	0.815	A
SHH	6469	genome.wustl.edu	37	7	155599095	155599095	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr7:155599095G>A	ENST00000297261.2	-	2	607	c.457C>T	c.(457-459)Cgc>Tgc	p.R153C	SHH_ENST00000472308.1_5'Flank	NM_000193.2	NP_000184.1	Q15465	SHH_HUMAN	sonic hedgehog	153					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|artery development (GO:0060840)|axon guidance (GO:0007411)|Bergmann glial cell differentiation (GO:0060020)|blood coagulation (GO:0007596)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|branching morphogenesis of an epithelial tube (GO:0048754)|bud outgrowth involved in lung branching (GO:0060447)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway (GO:0060070)|CD4-positive or CD8-positive, alpha-beta T cell lineage commitment (GO:0043369)|cell development (GO:0048468)|cell fate specification (GO:0001708)|cell-cell signaling (GO:0007267)|cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|cerebellar granule cell precursor proliferation (GO:0021930)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|dorsal/ventral neural tube patterning (GO:0021904)|dorsal/ventral pattern formation (GO:0009953)|ectoderm development (GO:0007398)|embryo development (GO:0009790)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal system development (GO:0048706)|endocytosis (GO:0006897)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|establishment of cell polarity (GO:0030010)|forebrain development (GO:0030900)|formation of anatomical boundary (GO:0048859)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|hindgut morphogenesis (GO:0007442)|inner ear development (GO:0048839)|intein-mediated protein splicing (GO:0016539)|intermediate filament organization (GO:0045109)|left lung development (GO:0060459)|limb bud formation (GO:0060174)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|lymphoid progenitor cell differentiation (GO:0002320)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal smoothened signaling pathway involved in prostate gland development (GO:0060783)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephros development (GO:0001656)|midbrain development (GO:0030901)|multicellular structure septum development (GO:0080125)|myoblast differentiation (GO:0045445)|myotube differentiation (GO:0014902)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of kidney smooth muscle cell differentiation (GO:2000357)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ureter smooth muscle cell differentiation (GO:2000062)|negative thymic T cell selection (GO:0045060)|neural crest cell migration (GO:0001755)|neuroblast proliferation (GO:0007405)|neuron fate commitment (GO:0048663)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|organ formation (GO:0048645)|osteoblast development (GO:0002076)|palate development (GO:0060021)|pancreas development (GO:0031016)|pattern specification process (GO:0007389)|patterning of blood vessels (GO:0001569)|polarity specification of anterior/posterior axis (GO:0009949)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of kidney smooth muscle cell differentiation (GO:2000358)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sclerotome development (GO:0061189)|positive regulation of skeletal muscle cell proliferation (GO:0014858)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureter smooth muscle cell differentiation (GO:2000063)|positive regulation of Wnt signaling pathway (GO:0030177)|positive thymic T cell selection (GO:0045059)|primary prostatic bud elongation (GO:0060516)|prostate epithelial cord elongation (GO:0060523)|prostate gland development (GO:0030850)|protein localization to nucleus (GO:0034504)|regulation of cell proliferation (GO:0042127)|regulation of mesenchymal cell proliferation involved in prostate gland development (GO:0060782)|regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900175)|regulation of odontogenesis (GO:0042481)|regulation of prostatic bud formation (GO:0060685)|regulation of protein localization to nucleus (GO:1900180)|regulation of proteolysis (GO:0030162)|renal system development (GO:0072001)|right lung development (GO:0060458)|salivary gland cavitation (GO:0060662)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|somite development (GO:0061053)|spinal cord dorsal/ventral patterning (GO:0021513)|spinal cord motor neuron differentiation (GO:0021522)|stem cell development (GO:0048864)|striated muscle tissue development (GO:0014706)|T cell differentiation in thymus (GO:0033077)|telencephalon regionalization (GO:0021978)|thalamus development (GO:0021794)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|trachea morphogenesis (GO:0060439)|vasculogenesis (GO:0001570)|ventral midline development (GO:0007418)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|laminin-1 binding (GO:0043237)|morphogen activity (GO:0016015)|patched binding (GO:0005113)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			central_nervous_system(3)|kidney(1)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00882)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTGCGGTCGCGGTCAGACGTG	0.632																																						dbGAP											0													107.0	84.0	92.0					7																	155599095		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5942.1	7q36	2010-06-25	2010-06-25		ENSG00000164690	ENSG00000164690			10848	protein-coding gene	gene with protein product		600725	"""sonic hedgehog (Drosophila) homolog"", ""sonic hedgehog homolog (Drosophila)"""	HPE3, HLP3		7590746	Standard	NM_000193		Approved	HHG1, SMMCI, TPT, TPTPS, MCOPCB5	uc003wmk.1	Q15465	OTTHUMG00000151349	ENST00000297261.2:c.457C>T	7.37:g.155599095G>A	ENSP00000297261:p.Arg153Cys		A4D247|Q75MC9	Missense_Mutation	SNP	pirsf_Hedgehog,pfam_Hedgehog_signaling_dom,pfam_Hint_dom,superfamily_Hedgehog_sig/DD-Pept_Zn-bd_dom,smart_Hint_dom_N,smart_Hint_dom_C,pfscan_Intein_splice_site,prints_Hedgehog	p.R153C	ENST00000297261.2	37	c.457	CCDS5942.1	7	.	.	.	.	.	.	.	.	.	.	G	18.78	3.696580	0.68386	.	.	ENSG00000164690	ENST00000297261;ENST00000430104	D;D	0.99663	-6.33;-6.33	3.35	2.44	0.29823	Hedgehog/DD-peptidase (2);Hedgehog, N-terminal signaling domain (1);	0.000000	0.85682	D	0.000000	D	0.99651	0.9871	M	0.93763	3.455	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.996	D	0.98372	1.0554	10	0.87932	D	0	.	12.2007	0.54323	0.0:0.0:0.8287:0.1713	.	153;156;66	Q15465;D9ZGF9;C9JC48	SHH_HUMAN;.;.	C	153;66	ENSP00000297261:R153C;ENSP00000396621:R66C	ENSP00000297261:R153C	R	-	1	0	SHH	155291856	1.000000	0.71417	0.944000	0.38274	0.922000	0.55478	0.870000	0.28010	0.699000	0.31761	0.561000	0.74099	CGC	SHH	-	pirsf_Hedgehog,pfam_Hedgehog_signaling_dom,superfamily_Hedgehog_sig/DD-Pept_Zn-bd_dom,prints_Hedgehog	ENSG00000164690		0.632	SHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHH	HGNC	protein_coding	OTTHUMT00000322327.1	60	0.00	0	G	NM_000193		155599095	155599095	-1	no_errors	ENST00000297261	ensembl	human	known	69_37n	missense	31	34.04	16	SNP	1.000	A
SLC18A2	6571	genome.wustl.edu	37	10	119037009	119037009	+	3'UTR	SNP	A	A	C	rs10377	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr10:119037009A>C	ENST00000298472.5	+	0	1920				SLC18A2_ENST00000497497.1_3'UTR	NM_003054.4	NP_003045.2	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 2						aging (GO:0007568)|cellular response to ammonium ion (GO:0071242)|cellular response to drug (GO:0035690)|death (GO:0016265)|dopamine transport (GO:0015872)|endocytic recycling (GO:0032456)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|negative regulation of neurotransmitter transport (GO:0051589)|neurotransmitter loading into synaptic vesicle (GO:0098700)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to corticosterone (GO:0051412)|response to herbicide (GO:0009635)|response to starvation (GO:0042594)|response to zinc ion (GO:0010043)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)|terminal bouton (GO:0043195)	amine transmembrane transporter activity (GO:0005275)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)|serotonin transmembrane transporter activity (GO:0015222)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)	29		Colorectal(252;0.19)		all cancers(201;0.029)	Amphetamine(DB00182)|Benzphetamine(DB00865)|Deserpidine(DB01089)|Dextroamphetamine(DB01576)|Ephedra(DB01363)|Ephedrine(DB01364)|Isometheptene(DB06706)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Propylhexedrine(DB06714)|Reserpine(DB00206)|Tetrabenazine(DB04844)	ttatgtatttaattttattaa	0.239													A|||	2264	0.452077	0.2897	0.5476	5008	,	,		15205	0.5327		0.501	False		,,,				2504	0.4703					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L14269	CCDS7599.1	10q25	2013-07-18	2013-07-18		ENSG00000165646	ENSG00000165646		"""Solute carriers"""	10935	protein-coding gene	gene with protein product		193001		VMAT2			Standard	NM_003054		Approved	SVMT, SVAT	uc001ldd.2	Q05940	OTTHUMG00000019121	ENST00000298472.5:c.*232A>C	10.37:g.119037009A>C			B2RC96|D3DRC4|Q15876|Q4G147|Q5VW49|Q9H3P6	RNA	SNP	-	NULL	ENST00000298472.5	37	NULL	CCDS7599.1	10																																																																																			SLC18A2	-	-	ENSG00000165646		0.239	SLC18A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18A2	HGNC	protein_coding	OTTHUMT00000050563.1	41	0.00	0	A	NM_003054		119037009	119037009	+1	no_errors	ENST00000497497	ensembl	human	known	69_37n	rna	43	16.98	9	SNP	1.000	C
SLC47A1	55244	genome.wustl.edu	37	17	19460972	19460972	+	Intron	SNP	G	G	A	rs1054715	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:19460972G>A	ENST00000270570.4	+	10	1007				SLC47A1_ENST00000575023.1_Intron|SLC47A1_ENST00000395585.1_Intron|SNORA59B_ENST00000458926.1_RNA|SLC47A1_ENST00000571335.1_Intron|SLC47A1_ENST00000542886.1_Intron|SLC47A1_ENST00000457293.1_Intron|RP11-1113L8.1_ENST00000574267.1_RNA|SLC47A1_ENST00000436810.2_Intron	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1						organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	tcagttacccgtagatgtagt	0.517													-|||	1176	0.234824	0.2042	0.147	5008	,	,		16364	0.4375		0.1809	False		,,,				2504	0.1851					dbGAP											0													58.0	55.0	56.0					17																	19460972		876	1984	2860	-	-	-	SO:0001627	intron_variant	0				CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.921+1597G>A	17.37:g.19460972G>A			Q53HF5|Q6PD77|Q86VL4|Q9NVA3	RNA	SNP	-	NULL	ENST00000270570.4	37	NULL	CCDS11209.1	17																																																																																			SNORA59B	-	-	ENSG00000238977		0.517	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA59B	HGNC	protein_coding	OTTHUMT00000132250.1	25	0.00	0	G	NM_018242		19460972	19460972	+1	no_errors	ENST00000458926	ensembl	human	known	69_37n	rna	15	21.05	4	SNP	0.201	A
SPEN	23013	genome.wustl.edu	37	1	16255141	16255142	+	Frame_Shift_Ins	INS	-	-	GA			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:16255141_16255142insGA	ENST00000375759.3	+	11	2610_2611	c.2406_2407insGA	c.(2407-2409)gagfs	p.E803fs		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	803	Arg-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CGGAGAGAGTGGAGAGAGAGAG	0.431																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.2417_2418dupGA	1.37:g.16255150_16255151dupGA	ENSP00000364912:p.Glu803fs		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Frame_Shift_Ins	INS	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.R806fs	ENST00000375759.3	37	c.2406_2407	CCDS164.1	1																																																																																			SPEN	-	NULL	ENSG00000065526		0.431	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	25	0.00	0	-	NM_015001		16255141	16255142	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	frame_shift_ins	16	23.81	5	INS	0.001:0.999	GA
AKNAD1	254268	genome.wustl.edu	37	1	109399934	109399934	+	5'Flank	SNP	T	T	C	rs12736534	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:109399934T>C	ENST00000370001.3	-	0	0				SPATA42_ENST00000369989.2_RNA|AKNAD1_ENST00000369995.3_5'Flank|SPATA42_ENST00000417241.1_RNA|AKNAD1_ENST00000357393.4_Intron	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1							cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						TTTACTTTATTATGAAGTCTA	0.458													C|||	290	0.0579073	0.0802	0.0432	5008	,	,		22431	0.001		0.0944	False		,,,				2504	0.0593					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231		1.37:g.109399934T>C	Exception_encountered		B9EK62|Q5T1N0|Q8N990|Q8NCN9	RNA	SNP	-	NULL	ENST00000370001.3	37	NULL	CCDS791.2	1																																																																																			RP11-475E11.5	-	-	ENSG00000203897		0.458	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SRG7	Clone_based_vega_gene	protein_coding	OTTHUMT00000030923.2	36	0.00	0	T	NM_152763		109399934	109399934	+1	no_errors	ENST00000369989	ensembl	human	known	69_37n	rna	25	16.67	5	SNP	0.000	C
SSBP2	23635	genome.wustl.edu	37	5	80716163	80716163	+	3'UTR	SNP	T	T	G	rs10746	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr5:80716163T>G	ENST00000320672.4	-	0	1456				SSBP2_ENST00000515395.1_3'UTR|SSBP2_ENST00000509053.1_3'UTR|SSBP2_ENST00000514493.1_3'UTR|SSBP2_ENST00000505980.1_3'UTR|SSBP2_ENST00000510060.1_5'UTR	NM_001256732.1|NM_001256733.1|NM_012446.3	NP_001243661.1|NP_001243662.1|NP_036578.2	P81877	SSBP2_HUMAN	single-stranded DNA binding protein 2						regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)		SSBP2/JAK2(4)	central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)		TGGACCCGCTTTCTTCACAAA	0.383													T|||	698	0.139377	0.0386	0.183	5008	,	,		19215	0.0427		0.2594	False		,,,				2504	0.2209					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF077048	CCDS4056.1, CCDS58960.1, CCDS58961.1, CCDS58962.1, CCDS58963.1, CCDS75268.1	5q14.1	2012-05-25	2001-11-28		ENSG00000145687	ENSG00000145687			15831	protein-coding gene	gene with protein product		607389	"""single-stranded DNA-binding protein 2"""			11230166, 11042152	Standard	NM_001256732		Approved	HSPC116	uc003khp.4	P81877	OTTHUMG00000119039	ENST00000320672.4:c.*160A>C	5.37:g.80716163T>G			B2R5W1|B7Z1J2|B7Z2L9|B7Z665|D6RH18|E9PB74|E9PDA8|Q8N2Q2|Q9BWW6|Q9Y4T7	RNA	SNP	-	NULL	ENST00000320672.4	37	NULL	CCDS4056.1	5																																																																																			SSBP2	-	-	ENSG00000145687		0.383	SSBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSBP2	HGNC	protein_coding	OTTHUMT00000239249.1	46	0.00	0	T	NM_012446		80716163	80716163	-1	no_errors	ENST00000510060	ensembl	human	known	69_37n	rna	39	13.33	6	SNP	1.000	G
ST3GAL6	10402	genome.wustl.edu	37	3	98501080	98501080	+	Intron	SNP	C	C	T	rs3772100	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:98501080C>T	ENST00000483910.1	+	6	624				ST3GAL6_ENST00000265261.6_Intron|ST3GAL6_ENST00000394162.1_Intron|ST3GAL6_ENST00000462152.1_Intron|ST3GAL6_ENST00000468553.1_Missense_Mutation_p.P122L	NM_001271146.1	NP_001258075.1	Q9Y274	SIA10_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 6						carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|cellular response to interleukin-6 (GO:0071354)|glycolipid metabolic process (GO:0006664)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,3-sialyltransferase activity (GO:0052798)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(1)	19						ATGAGGCTTCCGCCTGCTGGA	0.418													C|||	795	0.158746	0.2519	0.1009	5008	,	,		21470	0.0417		0.163	False		,,,				2504	0.1902					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF119391	CCDS2933.1, CCDS59452.1, CCDS74968.1	3q12.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000064225	ENSG00000064225		"""Sialyltransferases"""	18080	protein-coding gene	gene with protein product		607156	"""sialyltransferase 10 (alpha-2,3-sialyltransferase VI)"""	SIAT10		10206952	Standard	NM_006100		Approved	ST3GALVI	uc010hpd.4	Q9Y274	OTTHUMG00000159047	ENST00000483910.1:c.336-2709C>T	3.37:g.98501080C>T			B2RCH2|B3KMI1|D3DN39|F8W6U0	Missense_Mutation	SNP	NULL	p.P122L	ENST00000483910.1	37	c.365	CCDS2933.1	3	325	0.1488095238095238	122	0.24796747967479674	44	0.12154696132596685	35	0.06118881118881119	124	0.16358839050131926	C	8.126	0.782064	0.16189	.	.	ENSG00000064225	ENST00000468553	.	.	.	0.225	0.225	0.15325	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.25868	P	0.9837414	.	.	.	.	.	.	T	0.14117	-1.0484	3	0.62326	D	0.03	.	.	.	.	rs3772100	.	.	.	L	122	.	ENSP00000420474:P122L	P	+	2	0	ST3GAL6	99983770	0.992000	0.36948	0.382000	0.26119	0.406000	0.30931	-0.485000	0.06520	0.300000	0.22699	0.305000	0.20034	CCG	ST3GAL6	-	NULL	ENSG00000064225		0.418	ST3GAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST3GAL6	HGNC	protein_coding	OTTHUMT00000353013.2	50	0.00	0	C	NM_006100		98501080	98501080	+1	no_errors	ENST00000468553	ensembl	human	novel	69_37n	missense	30	14.29	5	SNP	0.742	T
STAG3	10734	genome.wustl.edu	37	7	99795215	99795215	+	Intron	SNP	C	C	G	rs62482167	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr7:99795215C>G	ENST00000426455.1	+	11	1472				STAG3_ENST00000394018.2_Intron|STAG3_ENST00000440830.1_3'UTR|STAG3_ENST00000317296.5_Intron	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3						chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ATGAGTACTGCTGTGATCCTT	0.453													C|||	710	0.141773	0.1513	0.1369	5008	,	,		22160	0.0883		0.17	False		,,,				2504	0.1585					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.1066-186C>G	7.37:g.99795215C>G			A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	RNA	SNP	-	NULL	ENST00000426455.1	37	NULL	CCDS34703.1	7																																																																																			STAG3	-	-	ENSG00000066923		0.453	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	STAG3	HGNC	protein_coding	OTTHUMT00000338734.2	31	0.00	0	C	NM_012447		99795215	99795215	+1	no_errors	ENST00000440830	ensembl	human	known	69_37n	rna	41	10.87	5	SNP	0.096	G
NPEPL1	79716	genome.wustl.edu	37	20	57266913	57266913	+	5'Flank	SNP	T	T	C	rs6123823	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr20:57266913T>C	ENST00000356091.6	+	0	0				NPEPL1_ENST00000525967.1_Intron|NPEPL1_ENST00000525817.1_Intron|STX16-NPEPL1_ENST00000530122.1_Intron	NM_024663.3	NP_078939.3	Q8NDH3	PEPL1_HUMAN	aminopeptidase-like 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)			TTTAAATGACTCCTGGGTGGA	0.532													T|||	1354	0.270367	0.09	0.2939	5008	,	,		15216	0.38		0.3419	False		,,,				2504	0.3108					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AK021645	CCDS46621.1, CCDS56200.1, CCDS56201.1	20q13.32	2008-07-02			ENSG00000215440	ENSG00000215440			16244	protein-coding gene	gene with protein product						14702039	Standard	NM_001204872		Approved	FLJ11583, bA261P9.2	uc010zzs.1	Q8NDH3	OTTHUMG00000033060		20.37:g.57266913T>C	Exception_encountered		A6NGZ0|B4DMW7|B7ZBN0|E9PN47|G5EA34|Q53G37|Q5W083|Q8TF28|Q8WUI2|Q9H1T6|Q9HAI5	RNA	SNP	-	NULL	ENST00000356091.6	37	NULL	CCDS46621.1	20																																																																																			STX16-NPEPL1	-	-	ENSG00000254995		0.532	NPEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX16-NPEPL1	HGNC	protein_coding	OTTHUMT00000080402.6	36	0.00	0	T	NM_024663		57266913	57266913	+1	no_errors	ENST00000413559	ensembl	human	putative	69_37n	rna	29	14.71	5	SNP	0.003	C
SYCP3	50511	genome.wustl.edu	37	12	102122900	102122900	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr12:102122900A>G	ENST00000392927.3	-	8	775	c.644T>C	c.(643-645)aTt>aCt	p.I215T	SYCP3_ENST00000392924.1_Missense_Mutation_p.I215T|SYCP3_ENST00000266743.2_Missense_Mutation_p.I215T	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	215	Gln-rich.				male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						TTCCATCATAATTTTTTTTTG	0.254																																						dbGAP											0													53.0	55.0	55.0					12																	102122900		2197	4284	6481	-	-	-	SO:0001583	missense	0			AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.644T>C	12.37:g.102122900A>G	ENSP00000376658:p.Ile215Thr			Missense_Mutation	SNP	pfam_Cor1/Xlr/Xmr	p.I215T	ENST00000392927.3	37	c.644	CCDS9087.1	12	.	.	.	.	.	.	.	.	.	.	A	14.61	2.585355	0.46110	.	.	ENSG00000139351	ENST00000266743;ENST00000392927;ENST00000392924	.	.	.	5.37	4.15	0.48705	.	0.204155	0.40554	N	0.001068	T	0.55513	0.1925	M	0.78049	2.395	0.40497	D	0.980609	P	0.40534	0.72	B	0.35931	0.214	T	0.63821	-0.6550	9	0.46703	T	0.11	-8.3774	11.975	0.53087	0.8552:0.1448:0.0:0.0	.	215	Q8IZU3	SYCP3_HUMAN	T	215	.	ENSP00000266743:I215T	I	-	2	0	SYCP3	100647031	1.000000	0.71417	0.987000	0.45799	0.984000	0.73092	4.954000	0.63631	2.025000	0.59659	0.374000	0.22700	ATT	SYCP3	-	NULL	ENSG00000139351		0.254	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	SYCP3	HGNC	protein_coding	OTTHUMT00000316478.2	35	0.00	0	A	NM_153694		102122900	102122900	-1	no_errors	ENST00000266743	ensembl	human	known	69_37n	missense	27	27.03	10	SNP	0.999	G
TAMM41	132001	genome.wustl.edu	37	3	11886451	11886451	+	Intron	SNP	G	G	A	rs380999	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:11886451G>A	ENST00000444133.2	-	2	278				TAMM41_ENST00000273037.5_Intron|TAMM41_ENST00000455809.1_Intron			Q96BW9	TAM41_HUMAN	TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)						cardiolipin biosynthetic process (GO:0032049)|CDP-diacylglycerol biosynthetic process (GO:0016024)	extrinsic component of mitochondrial inner membrane (GO:0031314)	phosphatidate cytidylyltransferase activity (GO:0004605)										GGACACGTGAGTTAAACAGAC	0.507													G|||	809	0.161542	0.1604	0.1888	5008	,	,		17922	0.0179		0.2654	False		,,,				2504	0.1851					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS2607.1, CCDS68345.1	3p25.2	2013-10-18	2011-08-09	2011-08-09	ENSG00000144559	ENSG00000144559			25187	protein-coding gene	gene with protein product		614948	"""chromosome 3 open reading frame 31"""	C3orf31		19237595	Standard	XM_005264873		Approved	MGC16471, DKFZp434E0519	uc003bwh.3	Q96BW9	OTTHUMG00000129741	ENST00000444133.2:c.136-766C>T	3.37:g.11886451G>A			B4DIY7|C9J2U4	Silent	SNP	pfam_Mmp37	p.N85	ENST00000444133.2	37	c.255		3																																																																																			TAMM41	-	NULL	ENSG00000144559		0.507	TAMM41-008	PUTATIVE	basic	protein_coding	TAMM41	HGNC	protein_coding	OTTHUMT00000339258.2	24	0.00	0	G	NM_138807		11886451	11886451	-1	no_errors	ENST00000417723	ensembl	human	known	69_37n	silent	7	36.36	4	SNP	0.000	A
TBC1D3P5	440419	genome.wustl.edu	37	17	25753033	25753033	+	RNA	SNP	T	T	C	rs13341669	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:25753033T>C	ENST00000586223.1	+	0	1478					NR_033892.1				TBC1 domain family, member 3 pseudogene 5																		CTGGCTTCTCTGGGTGCTGAA	0.607													T|||	2918	0.582668	0.6505	0.4669	5008	,	,		18363	0.6845		0.5547	False		,,,				2504	0.4969					dbGAP											0																																										-	-	-			0					17q11.1	2014-03-20			ENSG00000266433	ENSG00000266433			43567	pseudogene	pseudogene							Standard	NR_033892		Approved		uc002gzg.3		OTTHUMG00000179156		17.37:g.25753033T>C				RNA	SNP	-	NULL	ENST00000586223.1	37	NULL		17																																																																																			TBC1D3P5	-	-	ENSG00000266433		0.607	TBC1D3P5-003	KNOWN	non_canonical_TEC|basic	processed_transcript	TBC1D3P5	HGNC	pseudogene	OTTHUMT00000451073.1	90	0.00	0	T	NR_033892		25753033	25753033	+1	no_errors	ENST00000581469	ensembl	human	known	69_37n	rna	47	17.54	10	SNP	0.012	C
TDH	157739	genome.wustl.edu	37	8	11213708	11213708	+	RNA	SNP	T	T	A	rs199645849		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr8:11213708T>A	ENST00000534302.1	+	0	266									L-threonine dehydrogenase (pseudogene)																		CCGGTCCGCTTTCTGGGCATC	0.522																																						dbGAP											0																																										-	-	-			0			AJ301562		8p23.1	2013-09-26	2013-09-26		ENSG00000154316	ENSG00000154316		"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	15547	pseudogene	pseudogene	"""short chain dehydrogenase/reductase family 14E, member 1 (pseudogene)"""	615174	"""L-threonine dehydrogenase"""			11896452, 12361482, 19027726	Standard	NR_001578		Approved	FLJ25033, SDR14E1P	uc003wtq.1	Q8IZJ6	OTTHUMG00000165365		8.37:g.11213708T>A				RNA	SNP	-	NULL	ENST00000534302.1	37	NULL		8																																																																																			TDH	-	-	ENSG00000154316		0.522	TDH-002	KNOWN	basic	processed_transcript	TDH	HGNC	pseudogene	OTTHUMT00000385807.1	49	0.00	0	T	NM_152566		11213708	11213708	+1	no_errors	ENST00000525246	ensembl	human	known	69_37n	rna	22	18.52	5	SNP	0.862	A
TDRD12	91646	genome.wustl.edu	37	19	33281924	33281924	+	Missense_Mutation	SNP	A	A	G	rs11881633	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr19:33281924A>G	ENST00000444215.2	+	13	1557	c.1237A>G	c.(1237-1239)Aag>Gag	p.K413E				Q587J7	TDR12_HUMAN	tudor domain containing 12	413				K -> E (in Ref. 2; BC049000). {ECO:0000305}.	cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			NS(1)|breast(1)|endometrium(3)|lung(2)|prostate(1)|skin(1)	9	Esophageal squamous(110;0.137)					GAACAAGATCAAGCCCTGCTT	0.502													G|||	3239	0.646765	0.7776	0.4452	5008	,	,		15767	0.8115		0.5497	False		,,,				2504	0.5429					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK023134	CCDS46038.1	19q13.11	2013-01-23				ENSG00000173809		"""Tudor domain containing"""	25044	protein-coding gene	gene with protein product						11441184	Standard	NM_001110822		Approved	ECAT8, FLJ13072	uc002ntq.2	Q587J7		ENST00000444215.2:c.1237A>G	19.37:g.33281924A>G	ENSP00000416248:p.Lys413Glu			Missense_Mutation	SNP	pfam_Tudor,pfam_DNA/RNA_helicase_DEAD/DEAH_N	p.K413E	ENST00000444215.2	37	c.1237		19	1429	0.6543040293040293	372	0.7560975609756098	167	0.4613259668508287	476	0.8321678321678322	414	0.5461741424802111	G	0.368	-0.935515	0.02340	.	.	ENSG00000173809	ENST00000444215	T	0.40756	1.02	5.52	4.48	0.54585	.	0.000000	0.56097	N	0.000029	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999454965	B	0.02656	0.0	B	0.01281	0.0	T	0.40905	-0.9538	8	0.02654	T	1	-16.9834	8.936	0.35700	0.1713:0.0:0.8287:0.0	rs11881633;rs17206178;rs52791794;rs60455482;rs11881633	413	Q587J7	TDR12_HUMAN	E	413	ENSP00000416248:K413E	ENSP00000416248:K413E	K	+	1	0	TDRD12	37973764	0.995000	0.38212	0.705000	0.30386	0.013000	0.08279	2.614000	0.46359	0.828000	0.34709	-0.119000	0.15052	AAG	TDRD12	-	NULL	ENSG00000173809		0.502	TDRD12-001	KNOWN	basic|appris_principal	protein_coding	TDRD12	HGNC	protein_coding	OTTHUMT00000435933.1	40	0.00	0	A	NM_001015890		33281924	33281924	+1	no_errors	ENST00000444215	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	0.850	G
TPSAB1	7177	genome.wustl.edu	37	16	1291622	1291622	+	Missense_Mutation	SNP	A	A	G	rs149113013	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr16:1291622A>G	ENST00000338844.3	+	4	454	c.421A>G	c.(421-423)Acc>Gcc	p.T141A	TPSAB1_ENST00000461509.2_Missense_Mutation_p.T148A	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	141	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		T -> A (in dbSNP:rs1800992). {ECO:0000269|PubMed:10898108}.|T -> M (in allele alpha).		defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				CCACACGGTCACCCTGCCCCC	0.662													A|||	1009	0.201478	0.2874	0.2695	5008	,	,		17793	0.1171		0.1918	False		,,,				2504	0.1339					dbGAP											0													30.0	25.0	26.0					16																	1291622		2198	4297	6495	-	-	-	SO:0001583	missense	0			M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.421A>G	16.37:g.1291622A>G	ENSP00000343577:p.Thr141Ala		D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.T141A	ENST00000338844.3	37	c.421	CCDS10431.1	16	448	0.20512820512820512	154	0.3130081300813008	86	0.23756906077348067	75	0.13111888111888112	133	0.17546174142480211	A	0.171	-1.071903	0.01918	.	.	ENSG00000172236	ENST00000338844;ENST00000461509	T;T	0.80994	-1.44;-1.44	3.74	0.17	0.15021	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.872655	0.09671	N	0.771165	T	0.00012	0.0000	N	0.03268	-0.37	0.45477	P	0.0015540000000000553	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.06463	-1.0825	9	0.33141	T	0.24	.	7.8036	0.29189	0.3416:0.0:0.0:0.6584	.	132;141	Q15661-2;Q15661	.;TRYB1_HUMAN	A	141;148	ENSP00000343577:T141A;ENSP00000418247:T148A	ENSP00000343577:T141A	T	+	1	0	TPSAB1	1231623	0.000000	0.05858	0.458000	0.27068	0.169000	0.22640	0.545000	0.23268	0.161000	0.19458	0.392000	0.25879	ACC	TPSAB1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000172236		0.662	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TPSAB1	HGNC	protein_coding	OTTHUMT00000206914.1	39	0.00	0	A	NM_003294		1291622	1291622	+1	no_errors	ENST00000562675	ensembl	human	known	69_37n	missense	26	10.34	3	SNP	0.983	G
TPTE2P1	646405	genome.wustl.edu	37	13	25542441	25542441	+	RNA	SNP	G	G	A	rs11149278	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr13:25542441G>A	ENST00000429698.1	-	0	184							Q5T6R2	TPT2L_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 1																		ctttgtgggggaaagacacag	0.542													G|||	831	0.165935	0.0946	0.1643	5008	,	,		20630	0.3333		0.167	False		,,,				2504	0.09					dbGAP											0																																										-	-	-			0					13q12.12-q12.13	2012-10-03			ENSG00000253771	ENSG00000253771			35196	pseudogene	pseudogene							Standard	NR_026730		Approved		uc010tdh.2	Q5T6R2	OTTHUMG00000016596		13.37:g.25542441G>A			B3KST4|B4DMH9	RNA	SNP	-	NULL	ENST00000429698.1	37	NULL		13																																																																																			TPTE2P1	-	-	ENSG00000253771		0.542	TPTE2P1-003	KNOWN	basic	processed_transcript	TPTE2P1	HGNC	pseudogene	OTTHUMT00000044206.1	39	0.00	0	G			25542441	25542441	-1	no_errors	ENST00000381871	ensembl	human	known	69_37n	rna	25	13.79	4	SNP	0.000	A
TRABD2B	388630	genome.wustl.edu	37	1	48459907	48459907	+	Silent	SNP	C	C	T	rs3814006	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr1:48459907C>T	ENST00000606738.2	-	2	570	c.465G>A	c.(463-465)gcG>gcA	p.A155A	TRABD2B_ENST00000435576.2_5'Flank	NM_001194986.1	NP_001181915.1	A6NFA1	TIKI2_HUMAN	TraB domain containing 2B	155					metabolic process (GO:0008152)|negative regulation of Wnt signaling pathway (GO:0030178)|protein oxidation (GO:0018158)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|Wnt-protein binding (GO:0017147)										CCCAGTTGCCCGCGATGGCAT	0.612													C|||	830	0.165735	0.0144	0.2233	5008	,	,		19246	0.253		0.2793	False		,,,				2504	0.1227					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS58000.1	1p33	2012-07-04			ENSG00000204018				44200	protein-coding gene	gene with protein product		614913					Standard	NM_001194986		Approved		uc021ong.1	A6NFA1	OTTHUMG00000007960	ENST00000606738.2:c.465G>A	1.37:g.48459907C>T			I6U4Y0	Silent	SNP	superfamily_SuperAg_toxin_C_Staph/Strep	p.A155	ENST00000606738.2	37	c.465	CCDS58000.1	1																																																																																			TRABD2B	-	NULL	ENSG00000204018		0.612	TRABD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRABD2B	HGNC	protein_coding	OTTHUMT00000021842.3	25	0.00	0	C	NM_001194986		48459907	48459907	-1	no_errors	ENST00000371865	ensembl	human	known	69_37n	silent	36	12.20	5	SNP	0.479	T
TRBV20OR9-2	6962	genome.wustl.edu	37	9	33618497	33618497	+	RNA	SNP	G	G	A	rs2380835	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr9:33618497G>A	ENST00000379435.3	+	0	409									T cell receptor beta variable 20/OR9-2 (non-functional)																		TACATCTGCAGTGCTAGAGAC	0.582											OREG0019139	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	g|||	2141	0.427516	0.1195	0.5058	5008	,	,		16583	0.5228		0.5457	False		,,,				2504	0.5685					dbGAP											0																																										-	-	-			0			L05149		9p21	2012-02-07	2008-09-11		ENSG00000205274	ENSG00000205274		"""T cell receptors / TRB orphons"""	12197	other	T cell receptor gene	"""T-cell receptor, beta variable region 2, orphon"""		"""T cell receptor beta variable 20/OR9-2"""	TCRBV2O		8384723	Standard	NG_001337		Approved	TRBV20/OR9-2, TCRBV20S2, TCRBV2S2O			OTTHUMG00000019781		9.37:g.33618497G>A		841		Missense_Mutation	SNP	pfam_Ig_V-set,pfscan_Ig-like	p.S128N	ENST00000379435.3	37	c.383		9																																																																																			TRBV20OR9-2	-	pfam_Ig_V-set,pfscan_Ig-like	ENSG00000205274		0.582	TRBV20OR9-2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV20OR9-2	HGNC	TR_V_gene	OTTHUMT00000052089.2	25	0.00	0	G	NG_001337		33618497	33618497	+1	no_stop_codon	ENST00000379435	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.167	A
TREML3P	340206	genome.wustl.edu	37	6	41184870	41184870	+	RNA	SNP	T	T	C	rs57146460	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr6:41184870T>C	ENST00000564680.1	-	0	340									triggering receptor expressed on myeloid cells-like 3, pseudogene																		CCTACCTGTGTTTGTTGGGAG	0.592													T|||	327	0.0652955	0.2337	0.0202	5008	,	,		18131	0.0		0.004	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0			AF534825		6p21.1	2012-04-20	2012-04-20	2012-04-20	ENSG00000184106	ENSG00000184106			30806	pseudogene	pseudogene	"""TREM like transcript 3"""	609716	"""triggering receptor expressed on myeloid cells-like 3"""	TREML3		12645956	Standard	NR_027256		Approved	TLT3	uc003oqb.3		OTTHUMG00000177313		6.37:g.41184870T>C				RNA	SNP	-	NULL	ENST00000564680.1	37	NULL		6																																																																																			TREML3P	-	-	ENSG00000184106		0.592	TREML3P-002	KNOWN	basic	processed_transcript	TREML3P	HGNC	pseudogene	OTTHUMT00000436224.1	86	0.00	0	T			41184870	41184870	-1	no_errors	ENST00000564680	ensembl	human	known	69_37n	rna	54	10.00	6	SNP	0.000	C
TRGC1	6966	genome.wustl.edu	37	7	38299727	38299727	+	RNA	SNP	T	T	C	rs138027161		TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr7:38299727T>C	ENST00000443402.2	-	0	482					NM_001003799.1|NM_001003806.1	NP_001003799.1|NP_001003806.1	P0CF51	TRGC1_HUMAN	T cell receptor gamma constant 1							integral component of membrane (GO:0016021)											GCCGTTCTTCTAAGCAGACAG	0.478																																						dbGAP											0													48.0	57.0	54.0					7																	38299727		1880	4116	5996	-	-	-			0			M14996		7p14	2012-02-07			ENSG00000211689	ENSG00000211689		"""T cell receptors / TRG locus"""	12275	other	T cell receptor gene	"""T-cell receptor, gamma, constant region C1"""	186970		TCRGC1		2879283	Standard	NG_001336		Approved	C1		P0CF51	OTTHUMG00000155219		7.37:g.38299727T>C				Silent	SNP	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	p.L161	ENST00000443402.2	37	c.483		7																																																																																			TRGC1	-	NULL	ENSG00000211689		0.478	TRGC1-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	TR_C_gene	TRGC1	HGNC	TR_C_gene	OTTHUMT00000338825.3	56	0.00	0	T	NG_001336		38299727	38299727	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000443402	ensembl	human	known	69_37n	silent	61	17.57	13	SNP	0.008	C
TRPM3	80036	genome.wustl.edu	37	9	73391369	73391369	+	Missense_Mutation	SNP	T	T	C	rs11142587	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr9:73391369T>C	ENST00000396283.1	-	9	1118	c.799A>G	c.(799-801)Aaa>Gaa	p.K267E	TRPM3_ENST00000377105.1_Intron|TRPM3_ENST00000377110.3_Intron|TRPM3_ENST00000396280.5_Intron|TRPM3_ENST00000377106.1_Intron|TRPM3_ENST00000396285.1_Intron|TRPM3_ENST00000396292.4_Intron|TRPM3_ENST00000357533.2_Intron|TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000408909.2_Intron|TRPM3_ENST00000423814.3_Intron|TRPM3_ENST00000377101.1_Intron|TRPM3_ENST00000358082.3_Intron|TRPM3_ENST00000360823.2_Intron			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	0					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TCTTCCTTTTTTCTTTCTCTT	0.388													T|||	902	0.180112	0.0136	0.2493	5008	,	,		19009	0.3889		0.1859	False		,,,				2504	0.135					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000396283.1:c.799A>G	9.37:g.73391369T>C	ENSP00000379579:p.Lys267Glu		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	NULL	p.K267E	ENST00000396283.1	37	c.799		9	433	0.19826007326007325	9	0.018292682926829267	83	0.2292817679558011	203	0.3548951048951049	138	0.1820580474934037	T	8.348	0.830331	0.16749	.	.	ENSG00000083067	ENST00000396283	T	0.68903	-0.36	3.35	-3.6	0.04570	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.21449	-1.0245	5	0.11485	T	0.65	.	4.4425	0.11580	0.178:0.4472:0.0:0.3748	rs11142587;rs52812618;rs60214925;rs11142587	.	.	.	E	267	ENSP00000379579:K267E	ENSP00000379579:K267E	K	-	1	0	TRPM3	72581189	0.005000	0.15991	0.000000	0.03702	0.021000	0.10359	1.164000	0.31810	-0.775000	0.04584	0.533000	0.62120	AAA	TRPM3	-	NULL	ENSG00000083067		0.388	TRPM3-002	PUTATIVE	basic	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000052611.3	50	0.00	0	T	NM_206945		73391369	73391369	-1	no_errors	ENST00000396283	ensembl	human	putative	69_37n	missense	46	13.21	7	SNP	0.000	C
TUBBP5	643224	genome.wustl.edu	37	9	141069521	141069521	+	RNA	SNP	T	T	C	rs13297914	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr9:141069521T>C	ENST00000503395.1	+	0	1023									tubulin, beta pseudogene 5																		CTCACGCAGATCGGGCAGTGC	0.692													.|||	1613	0.322085	0.0658	0.5418	5008	,	,		11621	0.3155		0.4523	False		,,,				2504	0.3855					dbGAP											0																																										-	-	-			0			AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141069521T>C				RNA	SNP	-	NULL	ENST00000503395.1	37	NULL		9																																																																																			TUBBP5	-	-	ENSG00000159247		0.692	TUBBP5-003	KNOWN	basic	processed_transcript	TUBBP5	HGNC	pseudogene	OTTHUMT00000373087.1	64	0.00	0	T	NR_027156		141069521	141069521	+1	no_errors	ENST00000290377	ensembl	human	known	69_37n	rna	48	11.11	6	SNP	0.999	C
TUBBP5	643224	genome.wustl.edu	37	9	141071552	141071552	+	RNA	SNP	C	C	T	rs11137403	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr9:141071552C>T	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5																		AATGTTCAGGCGCAAGGCCTT	0.532													.|||	1624	0.324281	0.0719	0.5389	5008	,	,		20136	0.3185		0.4543	False		,,,				2504	0.3855					dbGAP											0																																										-	-	-			0			AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141071552C>T				RNA	SNP	-	NULL	ENST00000503395.1	37	NULL		9																																																																																			TUBBP5	-	-	ENSG00000159247		0.532	TUBBP5-003	KNOWN	basic	processed_transcript	TUBBP5	HGNC	pseudogene	OTTHUMT00000373087.1	104	0.00	0	C	NR_027156		141071552	141071552	+1	no_errors	ENST00000290377	ensembl	human	known	69_37n	rna	66	17.50	14	SNP	1.000	T
TXLNG	55787	genome.wustl.edu	37	X	16860134	16860134	+	3'UTR	SNP	T	T	C	rs3747366	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chrX:16860134T>C	ENST00000380122.5	+	0	1893				TXLNG_ENST00000398155.4_3'UTR|TXLNG_ENST00000485153.1_3'UTR	NM_018360.2	NP_060830.2	Q9NUQ3	TXLNG_HUMAN	taxilin gamma						cell cycle (GO:0007049)|regulation of bone mineralization (GO:0030500)|regulation of cell cycle (GO:0051726)|regulation of cell cycle process (GO:0010564)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)	protein heterodimerization activity (GO:0046982)			breast(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	15						CATGTGTTCATTGCCTTGTCC	0.443													T|||	1423	0.376954	0.2421	0.3602	3775	,	,		11967	0.4435		0.2465	False		,,,				2504	0.1616					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK002071	CCDS14178.1, CCDS55373.1	Xp22.2	2014-05-07	2010-04-20	2010-04-20	ENSG00000086712	ENSG00000086712			18578	protein-coding gene	gene with protein product	"""lipopolysaccharide specific response-5 protein"", ""factor inhibiting activating transcription factor 4 (ATF4)-mediated transcription"""	300677	"""chromosome X open reading frame 15"""	CXorf15		15911876, 15184072, 16831913	Standard	NM_018360		Approved	FLJ11209, LSR5, FIAT, MGC126621, MGC126625, TXLNGX	uc004cxq.2	Q9NUQ3	OTTHUMG00000021196	ENST00000380122.5:c.*245T>C	X.37:g.16860134T>C			Q2KQ75|Q5JNZ7|Q9P0X1	RNA	SNP	-	NULL	ENST00000380122.5	37	NULL	CCDS14178.1	X																																																																																			TXLNG	-	-	ENSG00000086712		0.443	TXLNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXLNG	HGNC	protein_coding	OTTHUMT00000055912.1	32	0.00	0	T	NM_018360		16860134	16860134	+1	no_errors	ENST00000485153	ensembl	human	known	69_37n	rna	34	17.07	7	SNP	0.000	C
UGGT1	56886	genome.wustl.edu	37	2	128947505	128947505	+	3'UTR	SNP	G	G	A	rs11542865	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr2:128947505G>A	ENST00000259253.6	+	0	4904				UGGT1_ENST00000465836.1_3'UTR|UGGT1_ENST00000375990.3_3'UTR	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1						'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TTAAAGCTCTGTTGGATTTGT	0.488													g|||	2171	0.433506	0.4387	0.3804	5008	,	,		18675	0.3234		0.4105	False		,,,				2504	0.6012					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.*189G>A	2.37:g.128947505G>A			Q53QP2|Q53SL3|Q8IW30|Q9H8I4	RNA	SNP	-	NULL	ENST00000259253.6	37	NULL	CCDS2154.1	2																																																																																			UGGT1	-	-	ENSG00000136731		0.488	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT1	HGNC	protein_coding	OTTHUMT00000254435.2	81	0.00	0	G	NM_020120		128947505	128947505	+1	no_errors	ENST00000465836	ensembl	human	putative	69_37n	rna	49	19.67	12	SNP	0.000	A
UNC45A	55898	genome.wustl.edu	37	15	91496462	91496462	+	Silent	SNP	G	G	T			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr15:91496462G>T	ENST00000418476.2	+	19	2539	c.2499G>T	c.(2497-2499)ctG>ctT	p.L833L	AC068831.6_ENST00000553321.1_RNA|RCCD1_ENST00000555155.1_5'Flank|UNC45A_ENST00000394275.2_Silent_p.L818L|RCCD1_ENST00000394258.2_5'Flank|RCCD1_ENST00000556618.1_5'Flank	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	833					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			ATGATGAGCTGCTACAGCGGG	0.622																																						dbGAP											0													83.0	90.0	88.0					15																	91496462		2198	4298	6496	-	-	-	SO:0001819	synonymous_variant	0				CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.2499G>T	15.37:g.91496462G>T			A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Silent	SNP	pfam_UNC-45/Ring3,superfamily_ARM-type_fold,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L833	ENST00000418476.2	37	c.2499	CCDS10367.1	15																																																																																			UNC45A	-	superfamily_ARM-type_fold	ENSG00000140553		0.622	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UNC45A	HGNC	protein_coding	OTTHUMT00000280406.2	21	0.00	0	G	NM_018671		91496462	91496462	+1	no_errors	ENST00000418476	ensembl	human	known	69_37n	silent	8	27.27	3	SNP	1.000	T
USP17L2	377630	genome.wustl.edu	37	8	11996086	11996086	+	Missense_Mutation	SNP	G	G	A	rs75476700	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr8:11996086G>A	ENST00000333796.3	-	1	500	c.184C>T	c.(184-186)Ctt>Ttt	p.L62F	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	62					apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						CTGGGAGCAAGCTGTCTTGCC	0.552													g|||	1272	0.253994	0.0734	0.2233	5008	,	,		18263	0.5437		0.2336	False		,,,				2504	0.2423					dbGAP											0													45.0	60.0	55.0					8																	11996086		1256	2768	4024	-	-	-	SO:0001583	missense	0			BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.184C>T	8.37:g.11996086G>A	ENSP00000333329:p.Leu62Phe			Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19	p.L62F	ENST00000333796.3	37	c.184	CCDS43713.1	8	526	0.24084249084249085	24	0.04878048780487805	83	0.2292817679558011	261	0.4562937062937063	158	0.20844327176781002	g	11.42	1.632670	0.29068	.	.	ENSG00000223443	ENST00000333796	T	0.13420	2.59	0.36	-0.721	0.11189	.	0.202259	0.31542	N	0.007464	T	0.00012	0.0000	L	0.32530	0.975	0.32221	P	0.575226	B	0.31174	0.311	B	0.26094	0.066	T	0.48258	-0.9051	9	0.87932	D	0	.	3.779	0.08673	0.6271:0.0:0.3729:0.0	.	62	Q6R6M4	U17L2_HUMAN	F	62	ENSP00000333329:L62F	ENSP00000333329:L62F	L	-	1	0	USP17L2	12033495	0.098000	0.21812	0.001000	0.08648	0.001000	0.01503	0.177000	0.16801	-0.387000	0.07809	-0.385000	0.06624	CTT	USP17L2	-	NULL	ENSG00000223443		0.552	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP17L2	HGNC	protein_coding	OTTHUMT00000383303.2	27	0.00	0	G	NM_201402		11996086	11996086	-1	no_errors	ENST00000333796	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	0.886	A
VPS52	6293	genome.wustl.edu	37	6	33232055	33232055	+	Intron	SNP	G	G	A	rs213202	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr6:33232055G>A	ENST00000445902.2	-	14	1743				VPS52_ENST00000482399.1_Intron|VPS52_ENST00000478934.1_Intron|VPS52_ENST00000436044.2_Intron	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)						ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						TGCTCATAGCGTGGCCCATGA	0.542													G|||	2062	0.411741	0.3321	0.379	5008	,	,		20589	0.5794		0.3847	False		,,,				2504	0.3978					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.1524+95C>T	6.37:g.33232055G>A			A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	RNA	SNP	-	NULL	ENST00000445902.2	37	NULL	CCDS4770.2	6																																																																																			VPS52	-	-	ENSG00000223501		0.542	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS52	HGNC	protein_coding	OTTHUMT00000076598.2	43	0.00	0	G	NM_022553		33232055	33232055	-1	no_errors	ENST00000493674	ensembl	human	putative	69_37n	rna	30	18.92	7	SNP	0.000	A
WDR43	23160	genome.wustl.edu	37	2	29165225	29165225	+	Silent	SNP	G	G	A			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr2:29165225G>A	ENST00000407426.3	+	16	1838	c.1782G>A	c.(1780-1782)aaG>aaA	p.K594K		NM_015131.1	NP_055946.1	Q15061	WDR43_HUMAN	WD repeat domain 43	594						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.K637N(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	20	Acute lymphoblastic leukemia(172;0.155)					CTGGACAGAAGGCAAAGTTGG	0.403																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											116.0	110.0	112.0					2																	29165225		1880	4112	5992	-	-	-	SO:0001819	synonymous_variant	0			D87716	CCDS46251.1	2p23.3	2013-01-09			ENSG00000163811	ENSG00000163811		"""WD repeat domain containing"""	28945	protein-coding gene	gene with protein product	"""UTP5, small subunit (SSU) processome component, homolog (yeast)"""					7584026, 7584028, 17699751	Standard	NM_015131		Approved	KIAA0007, NET12, UTP5	uc002rmo.2	Q15061	OTTHUMG00000152015	ENST00000407426.3:c.1782G>A	2.37:g.29165225G>A			Q15395|Q92577	Missense_Mutation	SNP	pfam_SSU_processome_Utp12,superfamily_ARM-type_fold	p.R146K	ENST00000407426.3	37	c.437	CCDS46251.1	2	.	.	.	.	.	.	.	.	.	.	G	8.063	0.768446	0.15983	.	.	ENSG00000163811	ENST00000446643	.	.	.	4.55	0.367	0.16140	.	.	.	.	.	T	0.55481	0.1923	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48570	-0.9024	4	.	.	.	-3.4803	8.7953	0.34876	0.0776:0.0:0.3689:0.5535	.	.	.	.	K	146	.	.	R	+	2	0	WDR43	29018729	1.000000	0.71417	0.997000	0.53966	0.905000	0.53344	0.735000	0.26115	0.176000	0.19873	0.561000	0.74099	AGG	WDR43	-	superfamily_ARM-type_fold	ENSG00000163811		0.403	WDR43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR43	HGNC	protein_coding	OTTHUMT00000324865.1	75	0.00	0	G	XM_087089		29165225	29165225	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000446643	ensembl	human	putative	69_37n	missense	52	28.38	21	SNP	0.995	A
WDR49	151790	genome.wustl.edu	37	3	167339312	167339312	+	Intron	SNP	C	C	A	rs78839458	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:167339312C>A	ENST00000308378.3	-	2	241				WDR49_ENST00000479765.1_Missense_Mutation_p.W242C|WDR49_ENST00000453925.2_5'Flank	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49											breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						GAGGATCATACCAATAATCCA	0.363													C|||	295	0.0589058	0.2148	0.0159	5008	,	,		19375	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.65-17056G>T	3.37:g.167339312C>A			Q8N297	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_EF_HAND_2,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W242C	ENST00000308378.3	37	c.726	CCDS3201.1	3	123	0.05631868131868132	118	0.23983739837398374	5	0.013812154696132596	0	0.0	0	0.0	C	16.59	3.166836	0.57476	.	.	ENSG00000174776	ENST00000479765;ENST00000488012	T	0.27402	1.67	5.41	5.41	0.78517	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.09310	P	1.0	D	0.89917	1.0	D	0.85130	0.997	T	0.00130	-1.2014	7	0.35671	T	0.21	.	17.9793	0.89136	0.0:1.0:0.0:0.0	.	242	E9PDB0	.	C	242;95	ENSP00000419749:W242C	ENSP00000419749:W242C	W	-	3	0	WDR49	168822006	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.007000	0.63984	2.531000	0.85337	0.655000	0.94253	TGG	WDR49	-	superfamily_WD40_repeat_dom	ENSG00000174776		0.363	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR49	HGNC	protein_coding	OTTHUMT00000350592.3	50	0.00	0	C	NM_178824		167339312	167339312	-1	no_errors	ENST00000479765	ensembl	human	putative	69_37n	missense	31	16.22	6	SNP	1.000	A
XXYLT1	152002	genome.wustl.edu	37	3	194842877	194842877	+	Intron	SNP	A	A	G	rs35896123|rs58370605	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:194842877A>G	ENST00000310380.6	-	3	894				XXYLT1_ENST00000429994.1_Intron|XXYLT1_ENST00000355729.4_Intron|XXYLT1_ENST00000356740.5_Silent_p.S15S|XXYLT1_ENST00000437101.1_Intron	NM_152531.4	NP_689744.3	Q8NBI6	XXLT1_HUMAN	xyloside xylosyltransferase 1							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring pentosyl groups (GO:0016763)										aaggggtgacagagctcttca	0.527													G|||	2719	0.542931	0.5983	0.4251	5008	,	,		18834	0.8323		0.2922	False		,,,				2504	0.5112					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK075551	CCDS43188.1	3q29	2013-02-22	2011-10-19	2011-10-19	ENSG00000173950	ENSG00000173950		"""Glycosyltransferase family 8 domain containing"""	26639	protein-coding gene	gene with protein product		614552	"""chromosome 3 open reading frame 21"""	C3orf21		22117070	Standard	NM_152531		Approved	FLJ35155	uc003fum.4	Q8NBI6	OTTHUMG00000155915	ENST00000310380.6:c.785+34300T>C	3.37:g.194842877A>G			D3DNW5|Q8NAL3|Q8WV03|Q96ME0	Silent	SNP	pfam_Glyco_trans_8	p.S15	ENST00000310380.6	37	c.45	CCDS43188.1	3																																																																																			XXYLT1	-	NULL	ENSG00000173950		0.527	XXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XXYLT1	HGNC	protein_coding	OTTHUMT00000342290.1	60	0.00	0	A	NM_152531		194842877	194842877	-1	no_errors	ENST00000356740	ensembl	human	known	69_37n	silent	44	13.73	7	SNP	0.004	G
ZBP1	81030	genome.wustl.edu	37	20	56182183	56182183	+	Intron	SNP	G	G	C	rs4811888	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr20:56182183G>C	ENST00000371173.3	-	8	1271				ZBP1_ENST00000395822.3_Intron|ZBP1_ENST00000343535.4_Missense_Mutation_p.Q423E|ZBP1_ENST00000340462.4_Intron	NM_001160417.1|NM_030776.2	NP_001153889.1|NP_110403.2	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1						innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|left-handed Z-DNA binding (GO:0003692)|RNA binding (GO:0003723)			large_intestine(11)|lung(8)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	27	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			agatggatctgggcaaagtaa	0.363													G|||	666	0.132987	0.0461	0.1196	5008	,	,		21179	0.249		0.1421	False		,,,				2504	0.1309					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ300575	CCDS13461.1, CCDS54477.1, CCDS54478.1	20q13.31	2009-08-21	2002-07-25	2002-07-26	ENSG00000124256	ENSG00000124256			16176	protein-coding gene	gene with protein product	"""DNA-dependent activator of IRFs"""	606750	"""chromosome 20 open reading frame 183"""	C20orf183		11842111	Standard	NM_030776		Approved	dJ718J7.3, DLM1, DLM-1, DAI	uc002xyo.3	Q9H171	OTTHUMG00000032824	ENST00000371173.3:c.1094-2358C>G	20.37:g.56182183G>C			A2A2F7|B3KVA1|F5GYT1|Q5JY39|Q9BYW4	Missense_Mutation	SNP	pfam_dsRNA_A_deaminase,smart_dsRNA_A_deaminase	p.Q423E	ENST00000371173.3	37	c.1267	CCDS13461.1	20	334	0.15293040293040294	26	0.052845528455284556	43	0.11878453038674033	150	0.26223776223776224	115	0.1517150395778364	G	3.928	-0.016703	0.07681	.	.	ENSG00000124256	ENST00000343535	T	0.08984	3.03	0.336	0.336	0.15958	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.42816	-0.9429	4	0.87932	D	0	.	.	.	.	rs4811888;rs7409712;rs52817727;rs4811888	.	.	.	E	423	ENSP00000340584:Q423E	ENSP00000340584:Q423E	Q	-	1	0	ZBP1	55615589	0.010000	0.17322	0.029000	0.17559	0.027000	0.11550	-0.721000	0.04963	0.385000	0.24970	0.385000	0.25706	CAG	ZBP1	-	NULL	ENSG00000124256		0.363	ZBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZBP1	HGNC	protein_coding	OTTHUMT00000079849.1	8	0.00	0	G	NM_030776		56182183	56182183	-1	no_errors	ENST00000343535	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.038	C
ZC3H12D	340152	genome.wustl.edu	37	6	149782908	149782908	+	Intron	SNP	A	A	G	rs376757	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr6:149782908A>G	ENST00000409806.3	-	3	764				ZC3H12D_ENST00000416573.2_Intron|ZC3H12D_ENST00000389942.5_Intron|ZC3H12D_ENST00000542614.1_Intron|ZC3H12D_ENST00000409948.1_Intron			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D						negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		tatcgatgttagaagtgcACC	0.438													A|||	1494	0.298323	0.4879	0.2478	5008	,	,		22166	0.1141		0.3509	False		,,,				2504	0.2137					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0					6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.445+58T>C	6.37:g.149782908A>G			A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	RNA	SNP	-	NULL	ENST00000409806.3	37	NULL		6																																																																																			ZC3H12D	-	-	ENSG00000178199		0.438	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	ZC3H12D	HGNC	protein_coding	OTTHUMT00000286400.2	69	0.00	0	A	NM_207360		149782908	149782908	-1	no_errors	ENST00000462655	ensembl	human	known	69_37n	rna	41	12.77	6	SNP	0.000	G
ZCCHC9	84240	genome.wustl.edu	37	5	80608545	80608545	+	3'UTR	SNP	G	G	A	rs2270825	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr5:80608545G>A	ENST00000254037.2	+	0	4035				ZCCHC9_ENST00000407610.3_3'UTR|ZCCHC9_ENST00000380199.5_3'UTR|ZCCHC9_ENST00000506458.1_3'UTR			Q8N567	ZCHC9_HUMAN	zinc finger, CCHC domain containing 9						negative regulation of phosphatase activity (GO:0010923)		poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)	13		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;8.18e-45)|Epithelial(54;2.72e-39)|all cancers(79;7.33e-34)		CCCGCTTCACGAGTTAGAGTT	0.383													G|||	415	0.0828674	0.1135	0.0908	5008	,	,		17708	0.0536		0.0775	False		,,,				2504	0.0716					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC014841	CCDS4054.1	5q14.1	2013-01-09			ENSG00000131732	ENSG00000131732		"""Zinc fingers, CCHC domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25424	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 41"""					12477932	Standard	NM_032280		Approved	DKFZp761J139, PPP1R41	uc003khi.3	Q8N567	OTTHUMG00000119014	ENST00000254037.2:c.*64G>A	5.37:g.80608545G>A			B2RAE7|Q9H027	RNA	SNP	-	NULL	ENST00000254037.2	37	NULL	CCDS4054.1	5																																																																																			ZCCHC9	-	-	ENSG00000131732		0.383	ZCCHC9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZCCHC9	HGNC	protein_coding	OTTHUMT00000239213.1	41	0.00	0	G	NM_032280		80608545	80608545	+1	no_errors	ENST00000506458	ensembl	human	known	69_37n	rna	31	11.43	4	SNP	0.000	A
ZFAND2A	90637	genome.wustl.edu	37	7	1192572	1192572	+	3'UTR	SNP	C	C	A	rs1133122	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr7:1192572C>A	ENST00000316495.3	-	0	830				ZFAND2A_ENST00000401903.1_Intron	NM_182491.2	NP_872297.2	Q8N6M9	ZFN2A_HUMAN	zinc finger, AN1-type domain 2A						cellular response to arsenic-containing substance (GO:0071243)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	zinc ion binding (GO:0008270)			lung(2)|ovary(1)	3		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.82e-15)		TTATTATAGTCCCATCTCCCT	0.468													C|||	552	0.110224	0.0741	0.1787	5008	,	,		20199	0.0268		0.1461	False		,,,				2504	0.1595					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC029558	CCDS5323.1	7p22.3	2010-04-23			ENSG00000178381	ENSG00000178381		"""Zinc fingers, AN1-type domain containing"""	28073	protein-coding gene	gene with protein product	"""arsenite inducible RNA associated protein"""	610699				20185824	Standard	NM_182491		Approved	AIRAP	uc003skc.3	Q8N6M9	OTTHUMG00000119019	ENST00000316495.3:c.*133G>T	7.37:g.1192572C>A			A4D220	Silent	SNP	pfam_Znf_AN1,smart_Znf_AN1	p.G196	ENST00000316495.3	37	c.588	CCDS5323.1	7																																																																																			ZFAND2A	-	NULL	ENSG00000178381		0.468	ZFAND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND2A	HGNC	protein_coding	OTTHUMT00000239220.2	34	0.00	0	C	NM_182491		1192572	1192572	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000397083	ensembl	human	putative	69_37n	silent	37	17.78	8	SNP	0.002	A
ZNF259P1	442240	genome.wustl.edu	37	6	109107340	109107340	+	RNA	SNP	T	T	C	rs3751127	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr6:109107340T>C	ENST00000572422.1	-	0	900									zinc finger protein 259 pseudogene 1																		TGGAGGGTGATCCTGGTGCCC	0.493													T|||	1699	0.339257	0.2504	0.3948	5008	,	,		20136	0.2837		0.4026	False		,,,				2504	0.4121					dbGAP											0																																										-	-	-			0			Z95118		6q21	2012-10-05	2009-11-20	2009-11-20	ENSG00000219565	ENSG00000219565			13052	pseudogene	pseudogene			"""zinc finger protein 259, pseudogene"""	ZNF259P			Standard	NG_009460		Approved	354J5			OTTHUMG00000016136		6.37:g.109107340T>C				RNA	SNP	-	NULL	ENST00000572422.1	37	NULL		6																																																																																			ZNF259P1	-	-	ENSG00000219565		0.493	ZNF259P1-002	KNOWN	basic	processed_transcript	ZNF259P1	HGNC	pseudogene	OTTHUMT00000436273.1	35	0.00	0	T	NG_009460		109107340	109107340	-1	no_errors	ENST00000572422	ensembl	human	known	69_37n	rna	27	12.90	4	SNP	1.000	C
ZNF271	10778	genome.wustl.edu	37	18	32887914	32887914	+	RNA	SNP	A	A	G	rs1131709	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr18:32887914A>G	ENST00000399070.3	+	0	2308					NR_024565.1|NR_024566.1		Q14591	ZN271_HUMAN	zinc finger protein 271						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(9)	12						CATTAAAACCACACTGGATCC	0.423													A|||	2447	0.488618	0.5666	0.4553	5008	,	,		19419	0.372		0.5338	False		,,,				2504	0.4806					dbGAP											0																																										-	-	-			0			X78930		18q12.2	2013-04-03			ENSG00000257267	ENSG00000257267		"""Zinc fingers, C2H2-type"""	13065	other	unknown		604754				7865130, 11777961	Standard	NR_024565		Approved	HZF7, ZNFEB	uc002kyp.4	Q14591	OTTHUMG00000132563		18.37:g.32887914A>G			B3KN34|Q96T29|Q9BSX2|Q9UN33|Q9Y5B7	RNA	SNP	-	NULL	ENST00000399070.3	37	NULL		18																																																																																			ZNF271	-	-	ENSG00000257267		0.423	ZNF271-002	KNOWN	basic	processed_transcript	ZNF271	HGNC	pseudogene	OTTHUMT00000255767.2	11	0.00	0	A	NR_024565		32887914	32887914	+1	no_errors	ENST00000399070	ensembl	human	known	69_37n	rna	18	18.18	4	SNP	0.990	G
ZNF286B	729288	genome.wustl.edu	37	17	18584123	18584123	+	Silent	SNP	A	A	G	rs200143783	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr17:18584123A>G	ENST00000545289.1	-	3	307	c.57T>C	c.(55-57)tcT>tcC	p.S19S	ZNF286B_ENST00000285274.5_Silent_p.S19S	NM_001145045.1	NP_001138517.1	P0CG31	Z286B_HUMAN	zinc finger protein 286B	19					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(1)	2						GGAAATGGGGAGAATCCTGGG	0.463																																						dbGAP											0													92.0	99.0	97.0					17																	18584123		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS58523.1	17p11.2	2013-01-08			ENSG00000249459	ENSG00000249459		"""Zinc fingers, C2H2-type"""	33241	protein-coding gene	gene with protein product	"""zinc finger protein 590"""		"""zinc finger protein 286-like"", ""zinc finger 286C pseudogene"""	ZNF286L, ZNF286C			Standard	NM_001145045		Approved	ZNF590	uc010vyd.1	P0CG31	OTTHUMG00000178136	ENST00000545289.1:c.57T>C	17.37:g.18584123A>G				Missense_Mutation	SNP	NULL	p.L93P	ENST00000545289.1	37	c.278	CCDS58523.1	17																																																																																			ZNF286B	-	NULL	ENSG00000249459		0.463	ZNF286B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF286B	HGNC	protein_coding		73	0.00	0	A	XM_001723047		18584123	18584123	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000443457	ensembl	human	putative	69_37n	missense	30	14.29	5	SNP	0.982	G
ZNF518A	9849	genome.wustl.edu	37	10	97922576	97922576	+	RNA	SNP	A	A	G	rs11591374	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr10:97922576A>G	ENST00000534948.1	+	0	7352							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		TGTTTTTTCAATGCTAGTTAA	0.264													A|||	469	0.0936502	0.1513	0.0793	5008	,	,		17453	0.005		0.162	False		,,,				2504	0.047					dbGAP											0																																										-	-	-			0			AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97922576A>G			A0PJI5|O15044|Q32MP4	RNA	SNP	-	NULL	ENST00000534948.1	37	NULL		10																																																																																			ZNF518A	-	-	ENSG00000177853		0.264	ZNF518A-202	KNOWN	basic	processed_transcript	ZNF518A	HGNC	processed_transcript		40	0.00	0	A	NM_014803		97922576	97922576	+1	no_errors	ENST00000534948	ensembl	human	known	69_37n	rna	29	12.12	4	SNP	0.009	G
ZNF420	147923	genome.wustl.edu	37	19	37605917	37605917	+	Intron	SNP	G	G	A	rs7258360	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr19:37605917G>A	ENST00000337995.3	+	5	351				ZNF420_ENST00000304239.7_Intron|ZNF585A_ENST00000588723.1_5'UTR	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			gaattttaatggagctaagag	0.388													A|||	2309	0.461062	0.6551	0.5648	5008	,	,		16991	0.1944		0.496	False		,,,				2504	0.364					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.137-12113G>A	19.37:g.37605917G>A			B2RDY6|Q96ML5	RNA	SNP	-	NULL	ENST00000337995.3	37	NULL	CCDS12498.1	19																																																																																			ZNF585A	-	-	ENSG00000196967		0.388	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF585A	HGNC	protein_coding	OTTHUMT00000109587.3	14	0.00	0	G	NM_144689		37605917	37605917	-1	no_errors	ENST00000588723	ensembl	human	known	69_37n	rna	15	28.57	6	SNP	0.164	A
ZNF420	147923	genome.wustl.edu	37	19	37606028	37606028	+	Intron	SNP	T	T	C	rs4806412	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr19:37606028T>C	ENST00000337995.3	+	5	351				ZNF420_ENST00000304239.7_Intron|ZNF585A_ENST00000588723.1_5'UTR	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			aatctctcgttgacttgtcct	0.507													C|||	2489	0.497005	0.7844	0.5778	5008	,	,		17514	0.1944		0.496	False		,,,				2504	0.364					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.137-12002T>C	19.37:g.37606028T>C			B2RDY6|Q96ML5	RNA	SNP	-	NULL	ENST00000337995.3	37	NULL	CCDS12498.1	19																																																																																			ZNF585A	-	-	ENSG00000196967		0.507	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF585A	HGNC	protein_coding	OTTHUMT00000109587.3	66	0.00	0	T	NM_144689		37606028	37606028	-1	no_errors	ENST00000588723	ensembl	human	known	69_37n	rna	49	18.33	11	SNP	0.067	C
ZNF585A	199704	genome.wustl.edu	37	19	37642917	37642917	+	Silent	SNP	G	G	A	rs77675231	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr19:37642917G>A	ENST00000356958.4	-	5	2142	c.1884C>T	c.(1882-1884)caC>caT	p.H628H	ZNF585A_ENST00000355533.2_Intron|ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000392157.2_Silent_p.H573H|ZNF585A_ENST00000292841.5_Silent_p.H573H			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	628					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCTCTCCTGTGTGAACTGGCT	0.493													G|||	2519	0.502995	0.8086	0.5778	5008	,	,		19421	0.1944		0.497	False		,,,				2504	0.3609					dbGAP											0													38.0	37.0	37.0					19																	37642917		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.1884C>T	19.37:g.37642917G>A			Q8TE95|Q96MV3	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H628	ENST00000356958.4	37	c.1884		19																																																																																			ZNF585A	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196967		0.493	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	ZNF585A	HGNC	protein_coding	OTTHUMT00000457980.2	36	0.00	0	G	NM_152655		37642917	37642917	-1	no_errors	ENST00000356958	ensembl	human	known	69_37n	silent	38	15.56	7	SNP	1.000	A
AC006116.24	0	genome.wustl.edu	37	19	56888454	56888454	+	RNA	SNP	A	A	C	rs2304125	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr19:56888454A>C	ENST00000591836.1	-	0	199				ZNF542_ENST00000490123.1_RNA																							TCGTCAATCAACTCTCATTCA	0.393													A|||	768	0.153355	0.1014	0.0937	5008	,	,		20404	0.3085		0.1282	False		,,,				2504	0.1319					dbGAP											0																																										-	-	-			0																															19.37:g.56888454A>C				RNA	SNP	-	NULL	ENST00000591836.1	37	NULL		19																																																																																			ZNF542	-	-	ENSG00000240225		0.393	AC006116.24-001	KNOWN	basic	sense_intronic	ZNF542	HGNC	sense_intronic	OTTHUMT00000459747.1	26	0.00	0	A			56888454	56888454	+1	no_errors	ENST00000467807	ensembl	human	known	69_37n	rna	24	11.11	3	SNP	0.000	C
ZNF717	100131827	genome.wustl.edu	37	3	75786832	75786832	+	Missense_Mutation	SNP	C	C	T	rs11122676	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr3:75786832C>T	ENST00000478296.1	-	4	2068	c.1792G>A	c.(1792-1794)Gta>Ata	p.V598I	ZNF717_ENST00000491507.1_Intron|ZNF717_ENST00000477374.1_Intron|ZNF717_ENST00000400845.3_Missense_Mutation_p.V641I|ZNF717_ENST00000422325.1_Missense_Mutation_p.V648I|MIR4273_ENST00000582824.1_RNA			Q9BY31	ZN717_HUMAN	zinc finger protein 717	641					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						TCATTACATACGTAAGGTTTC	0.428													c|||	3378	0.674521	0.5204	0.7277	5008	,	,		9783	0.8254		0.7326	False		,,,				2504	0.6299					dbGAP											0													41.0	45.0	44.0					3																	75786832		633	1557	2190	-	-	-	SO:0001583	missense	0			AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965	ENST00000478296.1:c.1792G>A	3.37:g.75786832C>T	ENSP00000419377:p.Val598Ile			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V648I	ENST00000478296.1	37	c.1942		3	875	0.40064102564102566	211	0.42886178861788615	156	0.430939226519337	210	0.36713286713286714	298	0.39313984168865435	.	6.675	0.493088	0.12702	.	.	ENSG00000227124	ENST00000478296;ENST00000422325;ENST00000400845	T;T;T	0.18810	2.19;2.19;2.19	1.71	-1.23	0.09465	.	.	.	.	.	T	0.00012	0.0000	L	0.31926	0.97	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.46498	-0.9187	8	0.49607	T	0.09	.	3.1934	0.06625	0.2062:0.5238:0.0:0.27	rs11122676;rs13061393;rs59040583	648	C9JSV9	.	I	598;648;641	ENSP00000419377:V598I;ENSP00000409514:V648I;ENSP00000383643:V641I	ENSP00000383643:V641I	V	-	1	0	ZNF717	75869522	0.000000	0.05858	0.004000	0.12327	0.005000	0.04900	-6.469000	0.00065	-0.338000	0.08413	-1.572000	0.00871	GTA	ZNF717	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000227124		0.428	ZNF717-002	NOVEL	not_organism_supported|basic	protein_coding	ZNF717	HGNC	protein_coding	OTTHUMT00000352764.2	23	0.00	0	C	NM_001128223		75786832	75786832	-1	no_errors	ENST00000422325	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	0.002	T
ZNF761	388561	genome.wustl.edu	37	19	53960224	53960224	+	RNA	SNP	T	T	C	rs2708741	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr19:53960224T>C	ENST00000454407.1	+	0	2916							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		GGAGAATTCATACTGGAGAGA	0.403													t|||	1962	0.391773	0.4123	0.5375	5008	,	,		22106	0.2401		0.3996	False		,,,				2504	0.409					dbGAP											0																																										-	-	-			0			AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53960224T>C			Q6ZNB9	RNA	SNP	-	NULL	ENST00000454407.1	37	NULL		19																																																																																			ZNF761	-	-	ENSG00000160336		0.403	ZNF761-203	KNOWN	basic	processed_transcript	ZNF761	HGNC	processed_transcript		21	0.00	0	T	NM_001008401		53960224	53960224	+1	no_errors	ENST00000334095	ensembl	human	known	69_37n	rna	16	27.27	6	SNP	1.000	C
ZNF761	388561	genome.wustl.edu	37	19	53960338	53960338	+	RNA	SNP	A	A	G	rs2708740	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr19:53960338A>G	ENST00000454407.1	+	0	3030							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		CAGTGTAATGAGTGTGGCAAA	0.423													a|||	1963	0.391973	0.4123	0.5375	5008	,	,		21856	0.2401		0.3996	False		,,,				2504	0.41					dbGAP											0																																										-	-	-			0			AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53960338A>G			Q6ZNB9	RNA	SNP	-	NULL	ENST00000454407.1	37	NULL		19																																																																																			ZNF761	-	-	ENSG00000160336		0.423	ZNF761-203	KNOWN	basic	processed_transcript	ZNF761	HGNC	processed_transcript		36	0.00	0	A	NM_001008401		53960338	53960338	+1	no_errors	ENST00000334095	ensembl	human	known	69_37n	rna	29	17.14	6	SNP	0.912	G
ZNF786	136051	genome.wustl.edu	37	7	148769555	148769555	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr7:148769555C>G	ENST00000491431.1	-	4	373	c.309G>C	c.(307-309)caG>caC	p.Q103H	ZNF786_ENST00000451334.3_Missense_Mutation_p.Q66H|ZNF786_ENST00000316286.9_Missense_Mutation_p.Q17H	NM_152411.3	NP_689624.2	Q8N393	ZN786_HUMAN	zinc finger protein 786	103					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(2)	26	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			AATTCATAGCCTGCTGGCTTC	0.443																																						dbGAP											0													46.0	42.0	43.0					7																	148769555		1902	4118	6020	-	-	-	SO:0001583	missense	0			AK095701, AL834510	CCDS47738.1	7q36.1	2013-01-08			ENSG00000197362	ENSG00000197362		"""Zinc fingers, C2H2-type"", ""-"""	21806	protein-coding gene	gene with protein product							Standard	NM_152411		Approved	DKFZp762I137	uc003wfh.2	Q8N393	OTTHUMG00000158975	ENST00000491431.1:c.309G>C	7.37:g.148769555C>G	ENSP00000417470:p.Gln103His		A1A568|B4DMI1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q103H	ENST00000491431.1	37	c.309	CCDS47738.1	7	.	.	.	.	.	.	.	.	.	.	C	11.01	1.512133	0.27036	.	.	ENSG00000197362	ENST00000316286;ENST00000538412;ENST00000491431;ENST00000451334	T;T;T	0.09911	2.93;3.15;3.07	4.41	0.7	0.18099	.	0.715100	0.11549	N	0.552974	T	0.04724	0.0128	N	0.08118	0	0.09310	N	1	B	0.19073	0.033	B	0.17979	0.02	T	0.39901	-0.9591	10	0.42905	T	0.14	-0.7909	3.0774	0.06251	0.1838:0.3139:0.0:0.5023	.	103	Q8N393	ZN786_HUMAN	H	17;17;103;66	ENSP00000313516:Q17H;ENSP00000417470:Q103H;ENSP00000404984:Q66H	ENSP00000313516:Q17H	Q	-	3	2	ZNF786	148400488	0.000000	0.05858	0.270000	0.24601	0.367000	0.29736	0.154000	0.16343	-0.024000	0.13941	-1.108000	0.02087	CAG	ZNF786	-	NULL	ENSG00000197362		0.443	ZNF786-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF786	HGNC	protein_coding	OTTHUMT00000352751.1	23	0.00	0	C	NM_152411		148769555	148769555	-1	no_errors	ENST00000491431	ensembl	human	known	69_37n	missense	15	34.78	8	SNP	0.067	G
ZNRD1-AS1	80862	genome.wustl.edu	37	6	30025179	30025179	+	RNA	SNP	G	G	A	rs6911724	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr6:30025179G>A	ENST00000431012.1	-	0	492				ZNRD1-AS1_ENST00000422224.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000452229.1_RNA|ZNRD1-AS1_ENST00000376797.3_RNA|ZNRD1-AS1_ENST00000437417.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000421692.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		TGTCTAAATGGTTTGTTCTTA	0.398													A|||	837	0.167133	0.2943	0.1081	5008	,	,		19870	0.1548		0.0805	False		,,,				2504	0.1391					dbGAP											0																																										-	-	-			0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.30025179G>A				RNA	SNP	-	NULL	ENST00000431012.1	37	NULL		6																																																																																			ZNRD1-AS1	-	-	ENSG00000204623		0.398	ZNRD1-AS1-005	KNOWN	basic|exp_conf	antisense	ZNRD1-AS1	HGNC	antisense	OTTHUMT00000253082.1	33	0.00	0	G	NR_026751		30025179	30025179	-1	no_errors	ENST00000421692	ensembl	human	known	69_37n	rna	40	11.11	5	SNP	0.000	A
ZNRD1-AS1	80862	genome.wustl.edu	37	6	30025285	30025285	+	RNA	SNP	C	C	T	rs6911634	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr6:30025285C>T	ENST00000431012.1	-	0	386				ZNRD1-AS1_ENST00000422224.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000452229.1_RNA|ZNRD1-AS1_ENST00000376797.3_RNA|ZNRD1-AS1_ENST00000437417.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000421692.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		CTTCTACGCTCTGGGTTGTTT	0.363													T|||	837	0.167133	0.2943	0.1081	5008	,	,		20099	0.1548		0.0805	False		,,,				2504	0.1391					dbGAP											0																																										-	-	-			0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.30025285C>T				RNA	SNP	-	NULL	ENST00000431012.1	37	NULL		6																																																																																			ZNRD1-AS1	-	-	ENSG00000204623		0.363	ZNRD1-AS1-005	KNOWN	basic|exp_conf	antisense	ZNRD1-AS1	HGNC	antisense	OTTHUMT00000253082.1	44	0.00	0	C	NR_026751		30025285	30025285	-1	no_errors	ENST00000421692	ensembl	human	known	69_37n	rna	59	14.49	10	SNP	0.009	T
ZRSR1	7310	genome.wustl.edu	37	5	112227799	112227799	+	Missense_Mutation	SNP	A	A	G	rs712665	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr5:112227799A>G	ENST00000391338.1	+	1	487	c.463A>G	c.(463-465)Agt>Ggt	p.S155G	REEP5_ENST00000379638.4_Intron|REEP5_ENST00000513339.1_Intron|REEP5_ENST00000504247.1_Intron|CTC-487M23.5_ENST00000602872.1_RNA|CTC-487M23.8_ENST00000512790.1_3'UTR|CTC-487M23.8_ENST00000506997.1_3'UTR|REEP5_ENST00000545426.1_Intron|REEP5_ENST00000474542.2_Intron	NM_001204199.1	NP_001191128.1	Q15695	U2AFL_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1	155						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|skin(1)|stomach(2)	4						TTTAGAAAATAGTACCACATG	0.433													G|||	1884	0.376198	0.6831	0.2867	5008	,	,		20786	0.1815		0.3638	False		,,,				2504	0.2382					dbGAP											0																																										-	-	-	SO:0001583	missense	0			D49676		5q22.2	2013-02-12	2006-09-26	2006-09-26	ENSG00000212643	ENSG00000212643		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	12456	protein-coding gene	gene with protein product	"""U2(RNU2) small nuclear RNA auxiliary factor pseudogene 1"""	601079	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein-like"", ""U2(RNU2) small nuclear RNA auxillary factor 1-like 1"", ""U2 small nuclear RNA auxillary factor 1-like 1"""	U2AFBPL, U2AF1P, U2AF1L1		7956352	Standard	NG_005419		Approved	U2AF1-RS1, U2AF1RS1	uc021ycm.1	Q15695	OTTHUMG00000163143	ENST00000391338.1:c.463A>G	5.37:g.112227799A>G	ENSP00000375133:p.Ser155Gly		B2R901|Q13570|Q2M3R8	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_RRM_dom,smart_Znf_CCCH,smart_RRM_dom_euk,pfscan_RRM_dom,prints_U2_small	p.S155G	ENST00000391338.1	37	c.463		5	797	0.3649267399267399	315	0.6402439024390244	109	0.3011049723756906	109	0.19055944055944055	264	0.3482849604221636	G	2.141	-0.396859	0.04899	.	.	ENSG00000212643	ENST00000391338	.	.	.	2.31	2.31	0.28768	.	0.322273	0.37219	N	0.002193	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.10296	0.003	B	0.06405	0.002	T	0.47086	-0.9144	7	0.02654	T	1	.	7.0754	0.25201	0.154:0.0:0.846:0.0	rs712665;rs1619690;rs3733965;rs58992073;rs712665	155	Q15695	U2AFL_HUMAN	G	155	.	ENSP00000375133:S155G	S	+	1	0	ZRSR1	112255698	1.000000	0.71417	0.026000	0.17262	0.556000	0.35491	2.463000	0.45058	0.094000	0.17404	-0.349000	0.07799	AGT	ZRSR1	-	NULL	ENSG00000212643		0.433	ZRSR1-001	KNOWN	basic|appris_principal	protein_coding	ZRSR1	HGNC	protein_coding	OTTHUMT00000371801.1	47	0.00	0	A	NM_005083		112227799	112227799	+1	no_errors	ENST00000391338	ensembl	human	known	69_37n	missense	48	12.73	7	SNP	0.991	G
ZRSR1	7310	genome.wustl.edu	37	5	112228765	112228765	+	Missense_Mutation	SNP	C	C	A	rs459102	byFrequency	TCGA-AC-A3TN-01A-11D-A228-09	TCGA-AC-A3TN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2d825f75-6959-459c-841b-e3b2429ec572	969c88bd-6867-4191-91a3-13feecd5a397	g.chr5:112228765C>A	ENST00000391338.1	+	1	1453	c.1429C>A	c.(1429-1431)Caa>Aaa	p.Q477K	REEP5_ENST00000379638.4_Intron|REEP5_ENST00000513339.1_Intron|REEP5_ENST00000504247.1_Intron|CTC-487M23.5_ENST00000602872.1_RNA|CTC-487M23.8_ENST00000512790.1_3'UTR|REEP5_ENST00000545426.1_Intron|REEP5_ENST00000474542.2_Intron	NM_001204199.1	NP_001191128.1	Q15695	U2AFL_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1	477						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|skin(1)|stomach(2)	4						TCAGAGTCCCCAATCCAAATA	0.463													A|||	2349	0.46905	0.8533	0.3415	5008	,	,		13121	0.3482		0.3678	False		,,,				2504	0.2689					dbGAP											0																																										-	-	-	SO:0001583	missense	0			D49676		5q22.2	2013-02-12	2006-09-26	2006-09-26	ENSG00000212643	ENSG00000212643		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	12456	protein-coding gene	gene with protein product	"""U2(RNU2) small nuclear RNA auxiliary factor pseudogene 1"""	601079	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein-like"", ""U2(RNU2) small nuclear RNA auxillary factor 1-like 1"", ""U2 small nuclear RNA auxillary factor 1-like 1"""	U2AFBPL, U2AF1P, U2AF1L1		7956352	Standard	NG_005419		Approved	U2AF1-RS1, U2AF1RS1	uc021ycm.1	Q15695	OTTHUMG00000163143	ENST00000391338.1:c.1429C>A	5.37:g.112228765C>A	ENSP00000375133:p.Gln477Lys		B2R901|Q13570|Q2M3R8	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_RRM_dom,smart_Znf_CCCH,smart_RRM_dom_euk,pfscan_RRM_dom,prints_U2_small	p.Q477K	ENST00000391338.1	37	c.1429		5	983	0.4500915750915751	404	0.8211382113821138	131	0.36187845303867405	183	0.31993006993006995	265	0.3496042216358839	A	3.274	-0.148580	0.06627	.	.	ENSG00000212643	ENST00000391338	.	.	.	1.48	1.48	0.22813	.	0.380640	0.28803	N	0.014099	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41610	-0.9499	7	0.02654	T	1	.	5.7537	0.18160	0.7244:0.2756:0.0:0.0	rs459102;rs712667;rs818788;rs3193242;rs61177009	477	Q15695	U2AFL_HUMAN	K	477	.	ENSP00000375133:Q477K	Q	+	1	0	ZRSR1	112256664	0.981000	0.34729	0.037000	0.18230	0.060000	0.15804	0.237000	0.17985	0.051000	0.15978	-0.520000	0.04383	CAA	ZRSR1	-	NULL	ENSG00000212643		0.463	ZRSR1-001	KNOWN	basic|appris_principal	protein_coding	ZRSR1	HGNC	protein_coding	OTTHUMT00000371801.1	39	0.00	0	C	NM_005083		112228765	112228765	+1	no_errors	ENST00000391338	ensembl	human	known	69_37n	missense	44	15.38	8	SNP	0.280	A
