#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM32	203102	genome.wustl.edu	37	8	39111964	39111964	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr8:39111964C>T	ENST00000379907.4	+	18	2061	c.1934C>T	c.(1933-1935)tCg>tTg	p.S645L	ADAM32_ENST00000519315.1_Missense_Mutation_p.S539L|ADAM32_ENST00000437682.2_Missense_Mutation_p.S546L	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	645	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			TGCCATTGTTCGCCAGGCTAT	0.363																																						dbGAP											0													48.0	46.0	47.0					8																	39111964		1831	4079	5910	-	-	-	SO:0001583	missense	0			BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.1934C>T	8.37:g.39111964C>T	ENSP00000369238:p.Ser645Leu		Q8TC42	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.S645L	ENST00000379907.4	37	c.1934	CCDS47846.1	8	.	.	.	.	.	.	.	.	.	.	C	1.419	-0.573413	0.03882	.	.	ENSG00000197140	ENST00000437682;ENST00000519315;ENST00000379907	D;D;D	0.87491	-2.26;-2.26;-2.26	4.06	-7.54	0.01332	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	3.647890	0.01190	N	0.007305	T	0.80177	0.4575	M	0.66939	2.045	0.09310	N	1	P;P;B;B	0.52170	0.87;0.951;0.114;0.074	B;B;B;B	0.36092	0.101;0.217;0.011;0.031	T	0.75434	-0.3319	10	0.30078	T	0.28	.	5.7257	0.18013	0.5765:0.1463:0.0:0.2773	.	546;69;539;645	E7EPX8;Q6ZP86;E7ER82;Q8TC27	.;.;.;ADA32_HUMAN	L	546;539;645	ENSP00000405978:S546L;ENSP00000429422:S539L;ENSP00000369238:S645L	ENSP00000369238:S645L	S	+	2	0	ADAM32	39231121	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.431000	0.02432	-1.735000	0.01353	-0.314000	0.08810	TCG	ADAM32	-	pfscan_EG-like_dom	ENSG00000197140		0.363	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM32	HGNC	protein_coding	OTTHUMT00000377089.1	44	0.00	0	C	NM_145004		39111964	39111964	+1	no_errors	ENST00000379907	ensembl	human	known	69_37n	missense	39	20.41	10	SNP	0.000	T
AIPL1	23746	genome.wustl.edu	37	17	6337388	6337388	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr17:6337388C>T	ENST00000381129.3	-	2	207	c.127G>A	c.(127-129)Gat>Aat	p.D43N	AIPL1_ENST00000575265.1_Missense_Mutation_p.D43N|AIPL1_ENST00000571740.1_Missense_Mutation_p.D43N|AIPL1_ENST00000250087.5_Missense_Mutation_p.D43N|AIPL1_ENST00000576776.1_Missense_Mutation_p.D43N|AIPL1_ENST00000576307.1_Intron|AIPL1_ENST00000570466.1_Intron|AIPL1_ENST00000574506.1_Intron	NM_001033055.1|NM_014336.3	NP_001028227.1|NP_055151.3	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting protein-like 1	43					negative regulation of apoptotic process (GO:0043066)|phototransduction, visible light (GO:0007603)|protein farnesylation (GO:0018343)|protein folding (GO:0006457)|regulation of cGMP metabolic process (GO:0030823)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)	farnesylated protein binding (GO:0001918)|unfolded protein binding (GO:0051082)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	12				COAD - Colon adenocarcinoma(228;0.141)		CGCTCCTCATCACATTTCATG	0.557																																						dbGAP											0													130.0	90.0	104.0					17																	6337388		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF148864	CCDS11075.1, CCDS32539.1, CCDS32540.1, CCDS67130.1, CCDS67131.1, CCDS67132.1, CCDS67133.1	17p13.1	2013-01-08	2001-11-29		ENSG00000129221	ENSG00000129221			359	protein-coding gene	gene with protein product		604392	"""aryl hydrocarbon receptor-interacting protein-like 1"""	LCA4		10615133, 14555765, 15365173	Standard	NM_001285402		Approved		uc002gcp.3	Q9NZN9	OTTHUMG00000102043	ENST00000381129.3:c.127G>A	17.37:g.6337388C>T	ENSP00000370521:p.Asp43Asn		D3DTM4|Q659W3|Q659W4|Q6ZZB6|Q8N6A0|Q9H873|Q9NS10	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,smart_TPR_repeat,pfscan_TPR-contain_dom	p.D43N	ENST00000381129.3	37	c.127	CCDS11075.1	17	.	.	.	.	.	.	.	.	.	.	C	10.49	1.364771	0.24684	.	.	ENSG00000129221	ENST00000381129;ENST00000250087;ENST00000444243	D;D	0.92911	-3.13;-3.13	4.91	2.92	0.33932	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (1);	0.148075	0.64402	D	0.000013	D	0.85191	0.5640	L	0.28740	0.885	0.43919	D	0.99656	B;B;B;B	0.30439	0.02;0.02;0.279;0.041	B;B;B;B	0.32289	0.04;0.028;0.143;0.06	T	0.80127	-0.1512	10	0.34782	T	0.22	-31.3741	8.5047	0.33179	0.0:0.811:0.0:0.189	.	43;43;43;43	Q659W3;F1T0C4;Q9NZN9-3;Q9NZN9	.;.;.;AIPL1_HUMAN	N	43	ENSP00000370521:D43N;ENSP00000250087:D43N	ENSP00000250087:D43N	D	-	1	0	AIPL1	6278112	0.768000	0.28519	0.036000	0.18154	0.275000	0.26752	1.347000	0.33975	1.053000	0.40415	0.650000	0.86243	GAT	AIPL1	-	pfam_PPIase_FKBP_dom	ENSG00000129221		0.557	AIPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AIPL1	HGNC	protein_coding	OTTHUMT00000219828.3	45	0.00	0	C	NM_014336		6337388	6337388	-1	no_errors	ENST00000381129	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	0.973	T
C10orf2	56652	genome.wustl.edu	37	10	102750656	102750656	+	Silent	SNP	C	C	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr10:102750656C>T	ENST00000311916.2	+	4	1808	c.1623C>T	c.(1621-1623)gtC>gtT	p.V541V	C10orf2_ENST00000473656.1_3'UTR|C10orf2_ENST00000370228.1_Silent_p.V541V	NM_001163813.1|NM_021830.4	NP_001157285.1|NP_068602.2	Q96RR1	PEO1_HUMAN	chromosome 10 open reading frame 2	541	SF4 helicase. {ECO:0000255|PROSITE- ProRule:PRU00596}.				cell death (GO:0008219)|DNA unwinding involved in DNA replication (GO:0006268)|mitochondrial DNA replication (GO:0006264)|protein hexamerization (GO:0034214)|protein homooligomerization (GO:0051260)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial nucleoid (GO:0042645)	5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|stomach(1)	24		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TCATCGGGGTCTTTCGGAAGT	0.468																																						dbGAP											0													193.0	190.0	191.0					10																	102750656		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF292004	CCDS7506.1, CCDS53570.1	10q24	2013-05-13			ENSG00000107815	ENSG00000107815			1160	protein-coding gene	gene with protein product	"""twinkle"", ""T7 helicase-related protein with intramitochondrial nucleoid localization"""	606075	"""infantile onset spinocerebellar ataxia (autosomal recessive)"""	IOSCA		11431692, 10645945, 16135556	Standard	NM_021830		Approved	PEO, PEO1, TWINKLE, FLJ21832, TWINL	uc001ksf.2	Q96RR1	OTTHUMG00000018917	ENST00000311916.2:c.1623C>T	10.37:g.102750656C>T			B2CQL2|Q6MZX2|Q6PJP5|Q96RR0	Silent	SNP	pfam_Circ_KaiC/RadA,pfam_DNA_helicase_DnaB-like_C,pfscan_DNA_helicase_DnaB-like_C	p.V541	ENST00000311916.2	37	c.1623	CCDS7506.1	10																																																																																			C10orf2	-	pfam_Circ_KaiC/RadA,pfam_DNA_helicase_DnaB-like_C,pfscan_DNA_helicase_DnaB-like_C	ENSG00000107815		0.468	C10orf2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf2	HGNC	protein_coding	OTTHUMT00000049886.1	129	0.00	0	C	NM_021830		102750656	102750656	+1	no_errors	ENST00000311916	ensembl	human	known	69_37n	silent	66	31.25	30	SNP	0.999	T
ATRNL1	26033	genome.wustl.edu	37	10	116853435	116853435	+	5'UTR	SNP	G	G	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr10:116853435G>T	ENST00000355044.3	+	0	52				ATRNL1_ENST00000529665.1_3'UTR|ATRNL1_ENST00000527407.1_5'UTR	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1						G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		GGTTTTCTGCGGCCGGAATTC	0.726																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.-75G>T	10.37:g.116853435G>T			O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	RNA	SNP	-	NULL	ENST00000355044.3	37	NULL	CCDS7592.1	10																																																																																			ATRNL1	-	-	ENSG00000107518		0.726	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	HGNC	protein_coding	OTTHUMT00000050507.3	103	0.00	0	G	XM_049349		116853435	116853435	+1	no_errors	ENST00000527407	ensembl	human	known	69_37n	rna	41	49.38	40	SNP	0.178	T
NUTM1	256646	genome.wustl.edu	37	15	34640201	34640201	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr15:34640201G>T	ENST00000333756.4	+	2	203	c.48G>T	c.(46-48)atG>atT	p.M16I	NUTM1_ENST00000537011.1_Missense_Mutation_p.M44I|NUTM1_ENST00000438749.3_Missense_Mutation_p.M34I	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	16	Pro-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)											ATATGAGCATGAAACCTAGTG	0.537																																						dbGAP											0													106.0	96.0	100.0					15																	34640201		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.48G>T	15.37:g.34640201G>T	ENSP00000329448:p.Met16Ile		B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	NULL	p.M16I	ENST00000333756.4	37	c.48	CCDS32190.1	15	.	.	.	.	.	.	.	.	.	.	G	18.80	3.701487	0.68501	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000354999;ENST00000333756	T;T;T	0.20332	2.08;2.08;2.08	5.69	5.69	0.88448	Nuclear Testis  protein, N-terminal (1);	0.754755	0.12209	N	0.489542	T	0.23727	0.0574	L	0.50333	1.59	0.29813	N	0.831465	B;B;B	0.30146	0.27;0.228;0.27	B;B;B	0.28011	0.085;0.051;0.085	T	0.07102	-1.0790	10	0.37606	T	0.19	.	15.3253	0.74157	0.0:0.0:1.0:0.0	.	34;44;16	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	I	44;34;16;16	ENSP00000444896:M44I;ENSP00000407031:M34I;ENSP00000329448:M16I	ENSP00000329448:M16I	M	+	3	0	C15orf55	32427493	0.966000	0.33281	0.961000	0.40146	0.522000	0.34438	4.707000	0.61852	2.692000	0.91855	0.655000	0.94253	ATG	C15orf55	-	NULL	ENSG00000184507		0.537	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf55	HGNC	protein_coding	OTTHUMT00000418026.1	30	0.00	0	G	NM_175741		34640201	34640201	+1	no_errors	ENST00000333756	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	0.992	T
MISP	126353	genome.wustl.edu	37	19	758149	758149	+	Silent	SNP	G	G	A			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr19:758149G>A	ENST00000215582.6	+	2	1306	c.1203G>A	c.(1201-1203)ccG>ccA	p.P401P		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	401					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											TCCTCAGCCCGGCCCCAGATG	0.701																																						dbGAP											0													15.0	15.0	15.0					19																	758149		2181	4280	6461	-	-	-	SO:0001819	synonymous_variant	0			BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.1203G>A	19.37:g.758149G>A				Silent	SNP	NULL	p.P401	ENST00000215582.6	37	c.1203	CCDS12042.1	19																																																																																			C19orf21	-	NULL	ENSG00000099812		0.701	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf21	HGNC	protein_coding	OTTHUMT00000457600.2	56	0.00	0	G	NM_173481		758149	758149	+1	no_errors	ENST00000215582	ensembl	human	known	69_37n	silent	48	32.39	23	SNP	0.000	A
CACNG7	59284	genome.wustl.edu	37	19	54417817	54417817	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr19:54417817C>T	ENST00000391767.1	+	3	472	c.260C>T	c.(259-261)aCg>aTg	p.T87M	CACNG7_ENST00000222212.2_Missense_Mutation_p.T87M|CACNG7_ENST00000468076.1_Intron|CACNG7_ENST00000391766.1_Missense_Mutation_p.T87M			P62955	CCG7_HUMAN	calcium channel, voltage-dependent, gamma subunit 7	87					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0711)		AATTTGGTGACGGAAAACACG	0.552																																						dbGAP											0													76.0	68.0	70.0					19																	54417817		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF288387	CCDS12868.1	19q13.4	2008-05-02			ENSG00000105605	ENSG00000105605		"""Calcium channel subunits"""	13626	protein-coding gene	gene with protein product		606899				11170751	Standard	NM_031896		Approved		uc002qcr.2	P62955	OTTHUMG00000064852	ENST00000391767.1:c.260C>T	19.37:g.54417817C>T	ENSP00000375647:p.Thr87Met		Q52LL8|Q8VBX3|Q8WXS6|Q9BXT1	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_g7su,prints_VDCC_gsu	p.T87M	ENST00000391767.1	37	c.260	CCDS12868.1	19	.	.	.	.	.	.	.	.	.	.	C	19.80	3.894276	0.72639	.	.	ENSG00000105605	ENST00000391767;ENST00000222212;ENST00000391766	T;T;T	0.78003	-0.16;-0.16;-1.14	2.96	2.96	0.34315	.	0.000000	0.85682	D	0.000000	T	0.80549	0.4644	L	0.48642	1.525	0.58432	D	0.999999	D	0.69078	0.997	P	0.61070	0.883	T	0.80632	-0.1296	10	0.46703	T	0.11	-15.8597	12.156	0.54077	0.0:1.0:0.0:0.0	.	87	P62955	CCG7_HUMAN	M	87	ENSP00000375647:T87M;ENSP00000222212:T87M;ENSP00000375646:T87M	ENSP00000222212:T87M	T	+	2	0	CACNG7	59109629	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.426000	0.73374	1.979000	0.57680	0.561000	0.74099	ACG	CACNG7	-	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_g7su	ENSG00000105605		0.552	CACNG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG7	HGNC	protein_coding	OTTHUMT00000139240.2	49	0.00	0	C			54417817	54417817	+1	no_errors	ENST00000222212	ensembl	human	known	69_37n	missense	25	30.56	11	SNP	1.000	T
CORIN	10699	genome.wustl.edu	37	4	47597910	47597910	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr4:47597910C>T	ENST00000273857.4	-	22	2956	c.2957G>A	c.(2956-2958)gGt>gAt	p.G986D	CORIN_ENST00000508498.1_Missense_Mutation_p.G847D|CORIN_ENST00000505909.1_Missense_Mutation_p.G949D|CORIN_ENST00000502252.1_Missense_Mutation_p.G919D	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	986	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						AAGAGGCCCACCGCTGTCACC	0.498																																						dbGAP											0													60.0	58.0	59.0					4																	47597910		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.2957G>A	4.37:g.47597910C>T	ENSP00000273857:p.Gly986Asp		B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	pirsf_Peptidase_S1A_corin,pfam_Peptidase_S1_S6,pfam_LDrepeatLR_classA_rpt,pfam_Frizzled_dom,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Frizzled_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_Frizzled_dom,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1_S6,pfscan_Frizzled_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.G986D	ENST00000273857.4	37	c.2957	CCDS3477.1	4	.	.	.	.	.	.	.	.	.	.	C	19.69	3.875562	0.72180	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909	D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34	5.2	5.2	0.72013	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.126293	0.52532	D	0.000071	D	0.99912	0.9958	H	0.97516	4.02	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.74348	0.983;0.942	D	0.96222	0.9161	10	0.87932	D	0	.	17.2704	0.87099	0.0:1.0:0.0:0.0	.	919;986	B4E1Y7;Q9Y5Q5	.;CORIN_HUMAN	D	986;847;919;949	ENSP00000273857:G986D;ENSP00000425597:G847D;ENSP00000424212:G919D;ENSP00000425401:G949D	ENSP00000273857:G986D	G	-	2	0	CORIN	47292667	1.000000	0.71417	0.968000	0.41197	0.354000	0.29330	7.636000	0.83301	2.591000	0.87537	0.563000	0.77884	GGT	CORIN	-	pirsf_Peptidase_S1A_corin,pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	ENSG00000145244		0.498	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORIN	HGNC	protein_coding	OTTHUMT00000216906.2	31	0.00	0	C			47597910	47597910	-1	no_errors	ENST00000273857	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	T
CPXCR1	53336	genome.wustl.edu	37	X	88008507	88008507	+	Missense_Mutation	SNP	T	T	A			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chrX:88008507T>A	ENST00000276127.4	+	3	351	c.92T>A	c.(91-93)aTa>aAa	p.I31K	CPXCR1_ENST00000373111.1_Missense_Mutation_p.I31K	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	31							metal ion binding (GO:0046872)			NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						AGTACAGACATAGAGTCTCCA	0.438																																						dbGAP											0													41.0	36.0	38.0					X																	88008507		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.92T>A	X.37:g.88008507T>A	ENSP00000276127:p.Ile31Lys		B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.I31K	ENST00000276127.4	37	c.92	CCDS14458.1	X	.	.	.	.	.	.	.	.	.	.	T	8.110	0.778646	0.16120	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.24151	1.87;1.87	3.29	0.728	0.18260	.	0.528144	0.15794	N	0.244287	T	0.10551	0.0258	N	0.14661	0.345	0.09310	N	1	B	0.24368	0.102	B	0.21151	0.033	T	0.24799	-1.0150	9	.	.	.	.	2.0918	0.03659	0.2726:0.1546:0.0:0.5728	.	31	Q8N123	CPXCR_HUMAN	K	31	ENSP00000276127:I31K;ENSP00000362203:I31K	.	I	+	2	0	CPXCR1	87895163	0.000000	0.05858	0.002000	0.10522	0.134000	0.20937	-0.430000	0.06973	0.054000	0.16065	0.425000	0.28330	ATA	CPXCR1	-	NULL	ENSG00000147183		0.438	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXCR1	HGNC	protein_coding	OTTHUMT00000057418.1	63	0.00	0	T	NM_033048		88008507	88008507	+1	no_errors	ENST00000276127	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	0.002	A
EFTUD1P1	648809	genome.wustl.edu	37	15	84789912	84789912	+	IGR	SNP	G	G	A			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr15:84789912G>A								EFTUD1P1 (7484 upstream) : RP13-262C2.3 (50017 downstream)																							GAAGCTTGCAGCAGCGCAGGG	0.493																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															15.37:g.84789912G>A				RNA	SNP	-	NULL		37	NULL		15																																																																																			EFTUD1P1	-	-	ENSG00000259404	0	0.493					EFTUD1P1	HGNC			80	0.00	0	G			84789912	84789912	+1	no_errors	ENST00000560381	ensembl	human	known	69_37n	rna	46	16.36	9	SNP	0.999	A
FREM1	158326	genome.wustl.edu	37	9	14806824	14806824	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr9:14806824C>T	ENST00000380880.3	-	18	3892	c.3109G>A	c.(3109-3111)Gag>Aag	p.E1037K	FREM1_ENST00000380881.4_Missense_Mutation_p.E1038K|FREM1_ENST00000422223.2_Missense_Mutation_p.E1037K			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1037					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		GAGCAGCCCTCATCTACAACA	0.438																																						dbGAP											0													48.0	49.0	48.0					9																	14806824		2053	4205	6258	-	-	-	SO:0001583	missense	0			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.3109G>A	9.37:g.14806824C>T	ENSP00000370262:p.Glu1037Lys		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.E1038K	ENST00000380880.3	37	c.3112	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	C	18.32	3.597640	0.66332	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.44881	0.91;0.91;0.91	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.74846	0.3770	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79988	-0.1571	10	0.72032	D	0.01	-24.5513	20.1986	0.98248	0.0:1.0:0.0:0.0	.	1037	Q5H8C1	FREM1_HUMAN	K	1038;1037;1037	ENSP00000370263:E1038K;ENSP00000412940:E1037K;ENSP00000370262:E1037K	ENSP00000370257:E1040K	E	-	1	0	FREM1	14796824	1.000000	0.71417	1.000000	0.80357	0.027000	0.11550	7.398000	0.79919	2.781000	0.95711	0.650000	0.86243	GAG	FREM1	-	NULL	ENSG00000164946		0.438	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2	31	0.00	0	C	NM_144966		14806824	14806824	-1	no_errors	ENST00000380881	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	1.000	T
GATA3	2625	genome.wustl.edu	37	10	8111433	8111434	+	Splice_Site	DEL	CA	CA	-	rs111853237		TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr10:8111433_8111434delCA	ENST00000346208.3	+	5	1376		c.e5-1		GATA3_ENST00000379328.3_Splice_Site|GATA3_ENST00000461472.1_Splice_Site			P23771	GATA3_HUMAN	GATA binding protein 3						anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.?(7)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TCCCCACTCTCAGTCTGCAGCC	0.48			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	7	Unknown(7)	breast(7)																																								-	-	-	SO:0001630	splice_region_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.922-1CA>-	10.37:g.8111433_8111434delCA			Q5VWG7|Q5VWG8|Q96J16	Splice_Site	DEL	-	e4-2	ENST00000346208.3	37	c.925-3_925-2	CCDS7083.1	10																																																																																			GATA3	-	-	ENSG00000107485		0.480	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	81	0	0	CA	NM_001002295	Intron	8111433	8111434	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	splice_site_del	48	14.04	8	DEL	1.000:1.000	-
GJE1	100126572	genome.wustl.edu	37	6	142455822	142455822	+	Silent	SNP	G	G	A	rs547675373		TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr6:142455822G>A	ENST00000450456.2	+	3	450	c.381G>A	c.(379-381)gcG>gcA	p.A127A				Q8NFK1	CXG3_HUMAN	gap junction protein, epsilon 1, 23kDa	148					cell communication (GO:0007154)|myelination (GO:0042552)|sensory perception of sound (GO:0007605)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)											TTAGTCTAGCGGCAATAGCAT	0.333																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					6q24.1	2013-01-16			ENSG00000203733	ENSG00000203733		"""Ion channels / Gap junction proteins (connexins)"""	33251	other	unknown						18849090	Standard	NG_033968		Approved	CX23		A6NN92	OTTHUMG00000015706	ENST00000450456.2:c.381G>A	6.37:g.142455822G>A			A4D296|Q86XI9	Silent	SNP	pfam_Connexin_CCC,pfam_Connexin_N	p.A127	ENST00000450456.2	37	c.381		6																																																																																			GJE1	-	pfam_Connexin_CCC	ENSG00000203733		0.333	GJE1-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	GJE1	HGNC	protein_coding	OTTHUMT00000042482.2	73	0.00	0	G			142455822	142455822	+1	no_errors	ENST00000450456	ensembl	human	known	69_37n	silent	27	15.62	5	SNP	0.997	A
LRRC25	126364	genome.wustl.edu	37	19	18507240	18507240	+	Silent	SNP	T	T	C			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr19:18507240T>C	ENST00000339007.3	-	1	1187	c.534A>G	c.(532-534)ggA>ggG	p.G178G	LRRC25_ENST00000595840.1_Silent_p.G178G	NM_145256.2	NP_660299.2	Q8N386	LRC25_HUMAN	leucine rich repeat containing 25	178						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(3)|skin(1)	8						CGATGGCAAGTCCAAGAAGCA	0.657																																						dbGAP											0													27.0	27.0	27.0					19																	18507240		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AK095435	CCDS12377.1	19p13.11	2013-09-20			ENSG00000175489	ENSG00000175489			29806	protein-coding gene	gene with protein product		607518				12384430	Standard	NM_145256		Approved	MAPA, FLJ38116	uc002niw.3	Q8N386	OTTHUMG00000183361	ENST00000339007.3:c.534A>G	19.37:g.18507240T>C			Q6IQ00|Q8N9A5	Silent	SNP	NULL	p.G178	ENST00000339007.3	37	c.534	CCDS12377.1	19																																																																																			LRRC25	-	NULL	ENSG00000175489		0.657	LRRC25-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRC25	HGNC	protein_coding	OTTHUMT00000466342.1	55	0.00	0	T	NM_145256		18507240	18507240	-1	no_errors	ENST00000339007	ensembl	human	known	69_37n	silent	51	29.17	21	SNP	0.000	C
METAP1	23173	genome.wustl.edu	37	4	99955394	99955394	+	Silent	SNP	G	G	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr4:99955394G>T	ENST00000296411.6	+	3	314	c.180G>T	c.(178-180)gcG>gcT	p.A60A	METAP1_ENST00000544031.1_Silent_p.A10A|METAP1_ENST00000506548.1_3'UTR	NM_015143.2	NP_055958.2	P53582	MAP11_HUMAN	methionyl aminopeptidase 1	60					N-terminal protein amino acid modification (GO:0031365)|peptidyl-methionine modification (GO:0018206)|phototransduction, visible light (GO:0007603)|platelet aggregation (GO:0070527)|protein initiator methionine removal (GO:0070084)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of translation (GO:0006417)|rhodopsin mediated signaling pathway (GO:0016056)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic ribosome (GO:0022626)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metalloaminopeptidase activity (GO:0070006)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(123;3.12e-07)		ATGAAAAGGCGAAGCGAGAAG	0.463																																						dbGAP											0													130.0	110.0	116.0					4																	99955394		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			D42084	CCDS47110.1	4q23	2010-08-20			ENSG00000164024	ENSG00000164024	3.4.11.18		15789	protein-coding gene	gene with protein product	"""Peptidase M"""	610151				7788527, 12144506	Standard	NM_015143		Approved	KIAA0094, MetAP1A, MAP1A	uc003huf.4	P53582	OTTHUMG00000161231	ENST00000296411.6:c.180G>T	4.37:g.99955394G>T			B4E2E6	Silent	SNP	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,prints_Pept_M24_MAP,tigrfam_Pept_M24A_MAP1	p.A60	ENST00000296411.6	37	c.180	CCDS47110.1	4																																																																																			METAP1	-	NULL	ENSG00000164024		0.463	METAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METAP1	HGNC	protein_coding	OTTHUMT00000364237.1	21	0.00	0	G	NM_015143		99955394	99955394	+1	no_errors	ENST00000296411	ensembl	human	known	69_37n	silent	10	54.55	12	SNP	0.933	T
MUC12	10071	genome.wustl.edu	37	7	100643116	100643116	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr7:100643116C>T	ENST00000379442.3	+	5	9701	c.9701C>T	c.(9700-9702)gCg>gTg	p.A3234V	MUC12_ENST00000536621.1_Missense_Mutation_p.A3091V			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	3234	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GAAACAACAGCGTTACCTGGC	0.537																																						dbGAP											0													1.0	1.0	1.0					7																	100643116		463	1074	1537	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.9701C>T	7.37:g.100643116C>T	ENSP00000368755:p.Ala3234Val		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.A3234V	ENST00000379442.3	37	c.9701		7	.	.	.	.	.	.	.	.	.	.	C	3.164	-0.171466	0.06421	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12774	2.65;2.65	0.869	-1.74	0.08056	.	.	.	.	.	T	0.05044	0.0135	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.34477	-0.9827	7	0.25106	T	0.35	.	3.142	0.06458	0.0:0.4155:0.2447:0.3398	.	.	.	.	V	3234;3091	ENSP00000368755:A3234V;ENSP00000441929:A3091V	ENSP00000368755:A3234V	A	+	2	0	MUC12	100429836	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.020000	0.00643	-1.942000	0.01040	-1.050000	0.02344	GCG	MUC12	-	NULL	ENSG00000205277		0.537	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	21	0.00	0	C	XM_379904		100643116	100643116	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	0.000	T
NEDD9	4739	genome.wustl.edu	37	6	11185729	11185729	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr6:11185729T>C	ENST00000379446.5	-	7	2337	c.2171A>G	c.(2170-2172)aAc>aGc	p.N724S	RP3-510L9.1_ENST00000500636.2_RNA|NEDD9_ENST00000504387.1_Missense_Mutation_p.N724S	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	724	Divergent helix-loop-helix motif.				actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			GTCAATGGCGTTGAGAAGGGA	0.532																																						dbGAP											0													181.0	145.0	157.0					6																	11185729		2203	4300	6503	-	-	-	SO:0001583	missense	0			L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.2171A>G	6.37:g.11185729T>C	ENSP00000368759:p.Asn724Ser		A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Missense_Mutation	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.N724S	ENST00000379446.5	37	c.2171	CCDS4520.1	6	.	.	.	.	.	.	.	.	.	.	T	18.82	3.704635	0.68615	.	.	ENSG00000111859	ENST00000379446;ENST00000504387	T;T	0.21031	2.03;2.03	6.11	4.95	0.65309	CAS family, DUF3513 (1);	0.116572	0.85682	D	0.000000	T	0.10337	0.0253	L	0.37800	1.135	0.80722	D	1	B;P;P	0.37708	0.22;0.568;0.606	B;B;B	0.42112	0.111;0.376;0.33	T	0.09357	-1.0678	10	0.29301	T	0.29	-37.9371	12.1967	0.54300	0.0:0.0661:0.0:0.9339	.	724;724;724	G5E9Y9;A8K9G7;Q14511	.;.;CASL_HUMAN	S	724	ENSP00000368759:N724S;ENSP00000422871:N724S	ENSP00000368759:N724S	N	-	2	0	NEDD9	11293715	1.000000	0.71417	0.933000	0.37362	0.875000	0.50365	4.666000	0.61554	1.135000	0.42183	0.533000	0.62120	AAC	NEDD9	-	pfam_CAS_DUF3513	ENSG00000111859		0.532	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEDD9	HGNC	protein_coding	OTTHUMT00000039853.2	64	0.00	0	T	NM_006403		11185729	11185729	-1	no_errors	ENST00000379446	ensembl	human	known	69_37n	missense	19	58.70	27	SNP	0.998	C
NOS2	4843	genome.wustl.edu	37	17	26116700	26116700	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr17:26116700T>C	ENST00000313735.6	-	3	358	c.125A>G	c.(124-126)gAt>gGt	p.D42G		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	42					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	CTGAAGGTCATCCTGTGTCAC	0.547																																						dbGAP											0													197.0	154.0	169.0					17																	26116700		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.125A>G	17.37:g.26116700T>C	ENSP00000327251:p.Asp42Gly		A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_met,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.D42G	ENST00000313735.6	37	c.125	CCDS11223.1	17	.	.	.	.	.	.	.	.	.	.	T	14.78	2.636361	0.47049	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.01871	4.59	4.99	4.99	0.66335	.	0.000000	0.64402	D	0.000014	T	0.05364	0.0142	M	0.71581	2.175	0.42246	D	0.991951	P;P	0.48911	0.9;0.917	P;B	0.44990	0.466;0.445	T	0.20042	-1.0287	10	0.59425	D	0.04	.	12.3613	0.55205	0.0:0.0:0.0:1.0	.	42;42	F8WEM3;P35228	.;NOS2_HUMAN	G	42	ENSP00000327251:D42G	ENSP00000305638:D42G	D	-	2	0	NOS2	23140827	1.000000	0.71417	1.000000	0.80357	0.108000	0.19459	3.758000	0.55220	2.020000	0.59435	0.374000	0.22700	GAT	NOS2	-	pirsf_NOS_met	ENSG00000007171		0.547	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS2	HGNC	protein_coding	OTTHUMT00000255597.1	47	0.00	0	T	NM_000625		26116700	26116700	-1	no_errors	ENST00000313735	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	1.000	C
NRCAM	4897	genome.wustl.edu	37	7	107823310	107823310	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr7:107823310G>A	ENST00000425651.2	-	20	2358	c.2359C>T	c.(2359-2361)Cgc>Tgc	p.R787C	NRCAM_ENST00000379022.4_Missense_Mutation_p.R787C|NRCAM_ENST00000379028.3_Missense_Mutation_p.R787C|NRCAM_ENST00000379024.4_Missense_Mutation_p.R768C|NRCAM_ENST00000413765.2_Missense_Mutation_p.R768C|NRCAM_ENST00000351718.4_Missense_Mutation_p.R771C	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	787	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						TCTTTCTGGCGCCAGCTAACT	0.433																																						dbGAP											0													93.0	90.0	91.0					7																	107823310		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.2359C>T	7.37:g.107823310G>A	ENSP00000401244:p.Arg787Cys		A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R787C	ENST00000425651.2	37	c.2359	CCDS47686.1	7	.	.	.	.	.	.	.	.	.	.	G	21.0	4.079911	0.76528	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022	T;T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27;0.27	5.72	5.72	0.89469	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.044921	0.85682	D	0.000000	T	0.79528	0.4461	M	0.88570	2.965	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;1.0;0.998;0.995	T	0.82458	-0.0447	10	0.62326	D	0.03	.	14.6985	0.69139	0.0:0.0:0.855:0.145	.	787;768;768;771;787	Q92823-5;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;NRCAM_HUMAN	C	787;787;768;787;771;768;787;787	ENSP00000368314:R787C;ENSP00000407858:R768C;ENSP00000325269:R771C;ENSP00000368310:R768C;ENSP00000401244:R787C;ENSP00000368308:R787C	ENSP00000325269:R771C	R	-	1	0	NRCAM	107610546	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.774000	0.62339	2.683000	0.91414	0.650000	0.86243	CGC	NRCAM	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000091129		0.433	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NRCAM	HGNC	protein_coding	OTTHUMT00000337942.2	42	0.00	0	G	NM_001037132		107823310	107823310	-1	no_errors	ENST00000379028	ensembl	human	known	69_37n	missense	35	40.68	24	SNP	1.000	A
NYNRIN	57523	genome.wustl.edu	37	14	24886207	24886207	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr14:24886207C>T	ENST00000382554.3	+	9	5570	c.5252C>T	c.(5251-5253)tCc>tTc	p.S1751F		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1751	Integrase catalytic. {ECO:0000255|PROSITE-ProRule:PRU00457}.				DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						TTCAGGGCCTCCTCCACTGAT	0.607																																						dbGAP											0													29.0	33.0	31.0					14																	24886207		2043	4195	6238	-	-	-	SO:0001583	missense	0			AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.5252C>T	14.37:g.24886207C>T	ENSP00000371994:p.Ser1751Phe		Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	pfam_RNase_Zc3h12,superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core	p.S1751F	ENST00000382554.3	37	c.5252	CCDS45090.1	14	.	.	.	.	.	.	.	.	.	.	C	14.25	2.478176	0.44044	.	.	ENSG00000205978	ENST00000382554	T	0.12984	2.63	5.3	4.39	0.52855	.	.	.	.	.	T	0.15132	0.0365	N	0.19112	0.55	0.28188	N	0.927896	D	0.54772	0.968	P	0.50860	0.652	T	0.03773	-1.1005	9	0.87932	D	0	.	12.1931	0.54282	0.0:0.915:0.0:0.085	.	1751	Q9P2P1	NYNRI_HUMAN	F	1751	ENSP00000371994:S1751F	ENSP00000371994:S1751F	S	+	2	0	NYNRIN	23956047	0.015000	0.18098	0.996000	0.52242	0.602000	0.36980	1.006000	0.29847	2.757000	0.94681	0.655000	0.94253	TCC	NYNRIN	-	NULL	ENSG00000205978		0.607	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYNRIN	HGNC	protein_coding	OTTHUMT00000412939.1	42	0.00	0	C			24886207	24886207	+1	no_errors	ENST00000382554	ensembl	human	known	69_37n	missense	23	51.06	24	SNP	0.916	T
OSBPL5	114879	genome.wustl.edu	37	11	3114834	3114834	+	Silent	SNP	C	C	G	rs202021793		TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr11:3114834C>G	ENST00000263650.7	-	17	2028	c.1869G>C	c.(1867-1869)ccG>ccC	p.P623P	OSBPL5_ENST00000478260.1_Silent_p.P77P|OSBPL5_ENST00000389989.3_Silent_p.P555P|OSBPL5_ENST00000525498.1_Silent_p.P534P|OSBPL5_ENST00000542243.1_Silent_p.P254P|OSBPL5_ENST00000348039.5_Silent_p.P555P	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5	623					cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)	p.P623P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		CCTCCCCGCTCGGGGTCCAGA	0.672																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											89.0	74.0	79.0					11																	3114834		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.1869G>C	11.37:g.3114834C>G			A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Silent	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P623	ENST00000263650.7	37	c.1869	CCDS31344.1	11																																																																																			OSBPL5	-	pfam_Oxysterol-bd	ENSG00000021762		0.672	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL5	HGNC	protein_coding	OTTHUMT00000032332.2	84	0.00	0	C			3114834	3114834	-1	no_errors	ENST00000263650	ensembl	human	known	69_37n	silent	35	42.62	26	SNP	0.000	G
OTUD4	54726	genome.wustl.edu	37	4	146058951	146058953	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	TGT	TGT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr4:146058951_146058953delTGT	ENST00000447906.2	-	21	3161_3163	c.2974_2976delACA	c.(2974-2976)acadel	p.T992del	OTUD4_ENST00000455611.2_Intron|OTUD4_ENST00000454497.2_In_Frame_Del_p.T927del			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	992					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					TTACTTTTTCTGTTTTTTCTTTC	0.443																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.2974_2976delACA	4.37:g.146058951_146058953delTGT	ENSP00000395487:p.Thr992del		B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	In_Frame_Del	DEL	pfam_OTU,pfscan_OTU	p.T992in_frame_del	ENST00000447906.2	37	c.2976_2974		4																																																																																			OTUD4	-	NULL	ENSG00000164164		0.443	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	OTUD4	HGNC	protein_coding	OTTHUMT00000365117.2	53	0.00	0	TGT	NM_017493		146058951	146058953	-1	no_errors	ENST00000447906	ensembl	human	known	69_37n	in_frame_del	30	37.50	18	DEL	1.000:1.000:0.936	-
OTUD7A	161725	genome.wustl.edu	37	15	31822945	31822945	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr15:31822945C>T	ENST00000307050.4	-	4	709	c.617G>A	c.(616-618)gGg>gAg	p.G206E	OTUD7A_ENST00000382902.1_Missense_Mutation_p.G206E	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	206	Catalytic. {ECO:0000250}.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding. {ECO:0000250}.				protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		GTTCCCATCCCCTGTTGTGGC	0.542																																						dbGAP											0													135.0	107.0	116.0					15																	31822945		2201	4300	6501	-	-	-	SO:0001583	missense	0			AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.617G>A	15.37:g.31822945C>T	ENSP00000305926:p.Gly206Glu		Q8IWK5	Missense_Mutation	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.G206E	ENST00000307050.4	37	c.617	CCDS10026.1	15	.	.	.	.	.	.	.	.	.	.	C	34	5.359368	0.95854	.	.	ENSG00000169918	ENST00000307050;ENST00000382902	T;T	0.37058	1.22;1.22	6.06	6.06	0.98353	Ovarian tumour, otubain (2);	0.000000	0.85682	D	0.000000	T	0.69378	0.3104	M	0.88450	2.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73186	-0.4062	10	0.87932	D	0	-41.9431	20.6397	0.99537	0.0:1.0:0.0:0.0	.	206;206	Q8TE49-2;Q8TE49	.;OTU7A_HUMAN	E	206	ENSP00000305926:G206E;ENSP00000372358:G206E	ENSP00000305926:G206E	G	-	2	0	OTUD7A	29610237	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.992000	0.76238	2.880000	0.98712	0.650000	0.86243	GGG	OTUD7A	-	pfam_OTU,pfscan_OTU	ENSG00000169918		0.542	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7A	HGNC	protein_coding	OTTHUMT00000251393.2	89	0.00	0	C	NM_130901		31822945	31822945	-1	no_errors	ENST00000382902	ensembl	human	known	69_37n	missense	54	10.00	6	SNP	1.000	T
PDPR	55066	genome.wustl.edu	37	16	70176575	70176575	+	Missense_Mutation	SNP	A	A	G	rs2549566	byFrequency	TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr16:70176575A>G	ENST00000288050.4	+	13	2548	c.1591A>G	c.(1591-1593)Aag>Gag	p.K531E	PDPR_ENST00000568530.1_Missense_Mutation_p.K531E|PDPR_ENST00000398122.3_Missense_Mutation_p.K431E|PDPR_ENST00000562100.1_3'UTR	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	531					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		CTCTTTCACAAAGTTTGAGAT	0.353																																						dbGAP											0													145.0	154.0	151.0					16																	70176575		1963	4167	6130	-	-	-	SO:0001583	missense	0				CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.1591A>G	16.37:g.70176575A>G	ENSP00000288050:p.Lys531Glu		A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_FAD_bind_dom	p.K531E	ENST00000288050.4	37	c.1591	CCDS45520.1	16	.	.	.	.	.	.	.	.	.	.	A	27.4	4.831687	0.91036	.	.	ENSG00000090857	ENST00000288050;ENST00000398122;ENST00000205055	T;T	0.74842	-0.88;-0.88	4.99	4.99	0.66335	Glycine cleavage T-protein, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87935	0.6303	M	0.89534	3.04	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.74023	0.925;0.982	D	0.90503	0.4475	10	0.87932	D	0	.	14.1577	0.65428	1.0:0.0:0.0:0.0	rs2549566	259;531	Q9NWE6;Q8NCN5	.;PDPR_HUMAN	E	531;431;259	ENSP00000288050:K531E;ENSP00000381190:K431E	ENSP00000205055:K259E	K	+	1	0	PDPR	68734076	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.020000	0.93667	2.005000	0.58758	0.454000	0.30748	AAG	PDPR	-	pfam_GCV_T_N	ENSG00000090857		0.353	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDPR	HGNC	protein_coding	OTTHUMT00000434502.1	70	0.00	0	A	NM_017990		70176575	70176575	+1	no_errors	ENST00000288050	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	1.000	G
PKD1L1	168507	genome.wustl.edu	37	7	47879188	47879188	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr7:47879188C>G	ENST00000289672.2	-	36	5675	c.5625G>C	c.(5623-5625)tgG>tgC	p.W1875C		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1875	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GGCTGATGAACCAGCCTGGGG	0.652																																						dbGAP											0													39.0	27.0	31.0					7																	47879188		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.5625G>C	7.37:g.47879188C>G	ENSP00000289672:p.Trp1875Cys		Q6UWK1	Missense_Mutation	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.W1875C	ENST00000289672.2	37	c.5625	CCDS34633.1	7	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856682	0.71834	.	.	ENSG00000158683	ENST00000289672	T	0.73152	-0.72	5.09	5.09	0.68999	Lipoxygenase, LH2 (3);Lipase/lipooxygenase, PLAT/LH2 (1);	0.181563	0.38272	N	0.001750	D	0.89026	0.6598	H	0.96175	3.78	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	D	0.92381	0.5913	10	0.87932	D	0	-10.0057	16.3119	0.82874	0.0:1.0:0.0:0.0	.	1875	Q8TDX9	PK1L1_HUMAN	C	1875	ENSP00000289672:W1875C	ENSP00000289672:W1875C	W	-	3	0	PKD1L1	47845713	1.000000	0.71417	0.945000	0.38365	0.893000	0.52053	5.036000	0.64164	2.512000	0.84698	0.655000	0.94253	TGG	PKD1L1	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	ENSG00000158683		0.652	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	90	0.00	0	C	NM_138295		47879188	47879188	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	missense	57	46.73	50	SNP	1.000	G
POM121	9883	genome.wustl.edu	37	7	72416136	72416136	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr7:72416136C>G	ENST00000434423.2	+	12	3541	c.3541C>G	c.(3541-3543)Ccc>Gcc	p.P1181A	POM121_ENST00000395270.1_Missense_Mutation_p.P916A|NSUN5P2_ENST00000388955.4_RNA|POM121_ENST00000358357.3_Missense_Mutation_p.P916A|POM121_ENST00000446813.1_Missense_Mutation_p.P916A|POM121_ENST00000257622.4_Missense_Mutation_p.P916A			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	1181	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				CACCGCCACCCCCACCTTTGG	0.642																																						dbGAP											0													25.0	27.0	26.0					7																	72416136		2203	4297	6500	-	-	-	SO:0001583	missense	0			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.3541C>G	7.37:g.72416136C>G	ENSP00000405562:p.Pro1181Ala		A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	NULL	p.P1181A	ENST00000434423.2	37	c.3541		7	.	.	.	.	.	.	.	.	.	.	C	3.797	-0.042548	0.07452	.	.	ENSG00000196313	ENST00000446813;ENST00000257622;ENST00000395270;ENST00000358357;ENST00000434423	T;T;T;T;T	0.10860	2.88;2.83;2.88;2.83;3.0	3.16	3.16	0.36331	.	0.202315	0.24652	N	0.036715	T	0.19046	0.0457	L	0.41079	1.255	0.36530	D	0.870672	D	0.89917	1.0	D	0.83275	0.996	T	0.08848	-1.0702	10	0.09843	T	0.71	.	11.958	0.52993	0.0:1.0:0.0:0.0	.	916	A8MXF9	.	A	916;916;916;916;1181	ENSP00000393020:P916A;ENSP00000257622:P916A;ENSP00000378687:P916A;ENSP00000351124:P916A;ENSP00000405562:P1181A	ENSP00000257622:P916A	P	+	1	0	POM121	72054072	0.981000	0.34729	0.958000	0.39756	0.024000	0.10985	2.758000	0.47565	1.766000	0.52107	0.391000	0.25812	CCC	POM121	-	NULL	ENSG00000196313		0.642	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	POM121	HGNC	protein_coding	OTTHUMT00000347344.1	105	0.00	0	C			72416136	72416136	+1	no_errors	ENST00000434423	ensembl	human	known	69_37n	missense	88	33.83	45	SNP	0.988	G
PRKD1	5587	genome.wustl.edu	37	14	30099920	30099920	+	Intron	SNP	G	G	A			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr14:30099920G>A	ENST00000331968.5	-	10	1902				PRKD1_ENST00000415220.2_Intron	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		GATGAGCTTTGGGCTGGTTAG	0.493																																						dbGAP											0													92.0	74.0	80.0					14																	30099920		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.1672+27C>T	14.37:g.30099920G>A			A6NL64|B2RAF6	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P148L	ENST00000331968.5	37	c.443	CCDS9637.1	14	.	.	.	.	.	.	.	.	.	.	G	7.491	0.650747	0.14516	.	.	ENSG00000184304	ENST00000546371	T	0.24151	1.87	0.694	-0.267	0.12938	.	.	.	.	.	T	0.23926	0.0579	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.28138	-1.0053	5	0.62326	D	0.03	.	.	.	.	.	.	.	.	L	148	ENSP00000447333:P148L	ENSP00000447333:P148L	P	-	2	0	PRKD1	29169671	0.030000	0.19436	0.000000	0.03702	0.008000	0.06430	-0.661000	0.05311	-0.143000	0.11334	-0.136000	0.14681	CCA	PRKD1	-	NULL	ENSG00000184304		0.493	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKD1	HGNC	protein_coding	OTTHUMT00000276611.2	48	0.00	0	G	NM_002742		30099920	30099920	-1	no_start_codon	ENST00000546371	ensembl	human	putative	69_37n	missense	22	63.93	39	SNP	0.007	A
PRPF19	27339	genome.wustl.edu	37	11	60670977	60670977	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr11:60670977G>A	ENST00000227524.4	-	3	405	c.200C>T	c.(199-201)tCa>tTa	p.S67L		NM_014502.4	NP_055317.1			pre-mRNA processing factor 19											haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	22						GCTGGTGGCTGAGGGAGGCTT	0.537																																						dbGAP											0													49.0	55.0	53.0					11																	60670977		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC018698	CCDS7995.1	11q12.2	2014-05-20	2013-06-10	2005-04-01	ENSG00000110107	ENSG00000110107		"""WD repeat domain containing"", ""U-box domain containing"""	17896	protein-coding gene	gene with protein product	"""nuclear matrix protein NMP200 related to splicing factor PRP19"", ""psoralen 4"""	608330	"""PRP19/PSO4 homolog (S. cerevisiae)"", ""PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)"""	PRP19		12960389	Standard	NM_014502		Approved	UBOX4, NMP200, PSO4, hPSO4	uc001nqf.3	Q9UMS4	OTTHUMG00000167798	ENST00000227524.4:c.200C>T	11.37:g.60670977G>A	ENSP00000227524:p.Ser67Leu			Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Pre-mRNA_splic_Prp19,pfam_Ubox_domain,superfamily_WD40_repeat_dom,smart_Ubox_domain,smart_WD40_repeat,pfscan_Ricin_B_lectin,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S67L	ENST00000227524.4	37	c.200	CCDS7995.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.337311	0.95758	.	.	ENSG00000110107	ENST00000227524;ENST00000541371	T	0.62639	0.01	5.08	5.08	0.68730	U box domain (1);Pre-mRNA-splicing factor 19 (1);	0.122142	0.56097	D	0.000025	T	0.78175	0.4242	M	0.79475	2.455	0.80722	D	1	P	0.49783	0.928	P	0.59703	0.862	T	0.80732	-0.1251	10	0.72032	D	0.01	-9.4806	18.2782	0.90089	0.0:0.0:1.0:0.0	.	67	Q9UMS4	PRP19_HUMAN	L	67	ENSP00000227524:S67L	ENSP00000227524:S67L	S	-	2	0	PRPF19	60427553	1.000000	0.71417	0.989000	0.46669	0.998000	0.95712	9.210000	0.95106	2.646000	0.89796	0.561000	0.74099	TCA	PRPF19	-	pfam_Pre-mRNA_splic_Prp19,smart_Ubox_domain	ENSG00000110107		0.537	PRPF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF19	HGNC	protein_coding	OTTHUMT00000396334.1	56	0.00	0	G	NM_014502		60670977	60670977	-1	no_errors	ENST00000227524	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	1.000	A
RYR2	6262	genome.wustl.edu	37	1	237777439	237777439	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr1:237777439C>T	ENST00000366574.2	+	37	5328	c.5011C>T	c.(5011-5013)Cgg>Tgg	p.R1671W	RYR2_ENST00000360064.6_Missense_Mutation_p.R1669W|RYR2_ENST00000542537.1_Missense_Mutation_p.R1655W	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1671	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGGGAACCACCGGGTGGCCCA	0.517																																						dbGAP											0													64.0	65.0	65.0					1																	237777439		2064	4206	6270	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5011C>T	1.37:g.237777439C>T	ENSP00000355533:p.Arg1671Trp		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.R1669W	ENST00000366574.2	37	c.5005	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.091736	0.76756	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97232	-4.3;-4.26;-4.29	5.78	3.8	0.43715	.	0.000000	0.64402	D	0.000015	D	0.98369	0.9458	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.99497	1.0952	10	0.87932	D	0	.	14.9582	0.71135	0.3679:0.6321:0.0:0.0	.	1671	Q92736	RYR2_HUMAN	W	1671;1669;1655	ENSP00000355533:R1671W;ENSP00000353174:R1669W;ENSP00000443798:R1655W	ENSP00000353174:R1669W	R	+	1	2	RYR2	235844062	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.533000	0.36040	1.402000	0.46780	0.655000	0.94253	CGG	RYR2	-	NULL	ENSG00000198626		0.517	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	110	0.00	0	C	NM_001035		237777439	237777439	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	44	52.17	48	SNP	1.000	T
SRSF8	10929	genome.wustl.edu	37	11	94801915	94801915	+	RNA	SNP	C	C	G			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr11:94801915C>G	ENST00000529911.1	+	0	1555					NM_032102.3	NP_115285.1	Q9BRL6	SRSF8_HUMAN	serine/arginine-rich splicing factor 8						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)										TCTGATTGCTCCTGGGGAAAA	0.498																																						dbGAP											0																																										-	-	-			0			AF031166	CCDS73370.1	11q21	2014-05-06	2010-06-22	2010-06-22	ENSG00000180771	ENSG00000263465		"""Serine/arginine-rich splicing factors"""	16988	protein-coding gene	gene with protein product	"""SR splicing factor 8"""	603269	"""splicing factor, arginine/serine-rich 2B"""	SFRS2B		9671500, 20516191	Standard	NM_032102		Approved	SRP46	uc001pff.3	Q9BRL6	OTTHUMG00000188534		11.37:g.94801915C>G			B2R6B8|Q6PF01|Q96TA3	RNA	SNP	-	NULL	ENST00000529911.1	37	NULL		11																																																																																			SRSF8	-	-	ENSG00000180771		0.498	SRSF8-002	KNOWN	basic	polymorphic_pseudogene	SRSF8	HGNC	polymorphic_pseudogene	OTTHUMT00000390962.3	64	0.00	0	C	NM_032102		94801915	94801915	+1	no_errors	ENST00000529911	ensembl	human	known	69_37n	rna	25	47.92	23	SNP	1.000	G
TIE1	7075	genome.wustl.edu	37	1	43785333	43785333	+	Intron	SNP	G	G	A			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr1:43785333G>A	ENST00000372476.3	+	19	3186				TIE1_ENST00000473014.1_3'UTR|TIE1_ENST00000433781.2_Intron	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1						angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGACACAGGTGTGTCTTGGGT	0.502																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.3107+133G>A	1.37:g.43785333G>A			B5A949|B5A950	RNA	SNP	-	NULL	ENST00000372476.3	37	NULL	CCDS482.1	1																																																																																			TIE1	-	-	ENSG00000066056		0.502	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIE1	HGNC	protein_coding	OTTHUMT00000019011.1	8	0.00	0	G	NM_005424		43785333	43785333	+1	no_errors	ENST00000473014	ensembl	human	known	69_37n	rna	10	28.57	4	SNP	0.000	A
TUBGCP6	85378	genome.wustl.edu	37	22	50659708	50659708	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr22:50659708C>T	ENST00000248846.5	-	16	3184	c.3080G>A	c.(3079-3081)gGg>gAg	p.G1027E	TUBGCP6_ENST00000439308.2_Missense_Mutation_p.G1027E|TUBGCP6_ENST00000491449.1_5'UTR			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1027	9 X 27 AA tandem repeats.				G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TGACACCTGCCCAAAGAGCCG	0.677																																						dbGAP											0													46.0	48.0	47.0					22																	50659708		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.3080G>A	22.37:g.50659708C>T	ENSP00000248846:p.Gly1027Glu		Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	pfam_Spc97_Spc98	p.G1027E	ENST00000248846.5	37	c.3080	CCDS14087.1	22	.	.	.	.	.	.	.	.	.	.	C	12.06	1.823137	0.32237	.	.	ENSG00000128159	ENST00000248846;ENST00000439308	T;T	0.11063	3.23;2.81	3.84	-1.27	0.09347	.	1.623460	0.03795	N	0.263469	T	0.07369	0.0186	N	0.14661	0.345	0.09310	N	1	B;B;P	0.40970	0.044;0.002;0.734	B;B;B	0.42030	0.081;0.007;0.373	T	0.24333	-1.0163	10	0.32370	T	0.25	.	4.7027	0.12835	0.0:0.3857:0.1628:0.4515	.	1019;1027;1027	B2RWN4;Q96RT7;Q96RT7-3	.;GCP6_HUMAN;.	E	1027	ENSP00000248846:G1027E;ENSP00000397387:G1027E	ENSP00000248846:G1027E	G	-	2	0	TUBGCP6	49001835	0.000000	0.05858	0.002000	0.10522	0.022000	0.10575	-0.637000	0.05459	-0.029000	0.13827	0.655000	0.94253	GGG	TUBGCP6	-	pfam_Spc97_Spc98	ENSG00000128159		0.677	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP6	HGNC	protein_coding	OTTHUMT00000075004.3	54	0.00	0	C	NM_020461		50659708	50659708	-1	no_errors	ENST00000248846	ensembl	human	known	69_37n	missense	43	29.51	18	SNP	0.001	T
VAV3	10451	genome.wustl.edu	37	1	108299953	108299953	+	Splice_Site	SNP	T	T	C			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr1:108299953T>C	ENST00000370056.4	-	11	1292		c.e11-2		VAV3_ENST00000527011.1_Splice_Site|VAV3_ENST00000371846.4_Splice_Site|VAV3_ENST00000343258.4_Splice_Site	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor						angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		GACCAGTTCCTATTTGGAAGA	0.338																																						dbGAP											0													138.0	128.0	131.0					1																	108299953		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.1018-2A>G	1.37:g.108299953T>C			B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Splice_Site	SNP	-	e11-2	ENST00000370056.4	37	c.1018-2	CCDS785.1	1	.	.	.	.	.	.	.	.	.	.	t	18.43	3.621655	0.66787	.	.	ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000490388;ENST00000371846	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1962	0.82025	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	VAV3	108101476	1.000000	0.71417	0.984000	0.44739	0.638000	0.38207	7.588000	0.82629	2.224000	0.72417	0.520000	0.50463	.	VAV3	-	-	ENSG00000134215		0.338	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV3	HGNC	protein_coding	OTTHUMT00000030242.2	43	0.00	0	T	NM_006113	Intron	108299953	108299953	-1	no_errors	ENST00000370056	ensembl	human	known	69_37n	splice_site	24	11.11	3	SNP	1.000	C
WDR87	83889	genome.wustl.edu	37	19	38377603	38377603	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr19:38377603C>G	ENST00000303868.5	-	6	6815	c.6591G>C	c.(6589-6591)tgG>tgC	p.W2197C	WDR87_ENST00000447313.2_Missense_Mutation_p.W2236C	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	2197	Glu-rich.									NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TCCTCTTTCTCCACCTTCGTT	0.413																																						dbGAP											0													253.0	192.0	210.0					19																	38377603		692	1591	2283	-	-	-	SO:0001583	missense	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.6591G>C	19.37:g.38377603C>G	ENSP00000368025:p.Trp2197Cys		Q9BWV9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W2236C	ENST00000303868.5	37	c.6708	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	C	9.036	0.988423	0.18966	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.64260	-0.09;-0.09	4.42	0.518	0.17030	.	.	.	.	.	T	0.42154	0.1190	N	0.14661	0.345	0.09310	N	1	D;D	0.54047	0.964;0.964	B;B	0.40602	0.334;0.334	T	0.29610	-1.0006	9	0.56958	D	0.05	.	10.2793	0.43530	0.0:0.7855:0.0:0.2145	.	2197;2236	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	C	2236;2197	ENSP00000405012:W2236C;ENSP00000368025:W2197C	ENSP00000368025:W2197C	W	-	3	0	WDR87	43069443	0.000000	0.05858	0.000000	0.03702	0.087000	0.18053	-0.800000	0.04555	0.037000	0.15575	0.542000	0.68232	TGG	WDR87	-	superfamily_ARM-type_fold	ENSG00000171804		0.413	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	56	0.00	0	C	XM_940478		38377603	38377603	-1	no_errors	ENST00000447313	ensembl	human	known	69_37n	missense	43	29.51	18	SNP	0.000	G
ZBTB20	26137	genome.wustl.edu	37	3	114070183	114070183	+	Missense_Mutation	SNP	A	A	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr3:114070183A>T	ENST00000474710.1	-	4	920	c.742T>A	c.(742-744)Tac>Aac	p.Y248N	ZBTB20_ENST00000462705.1_Missense_Mutation_p.Y175N|ZBTB20_ENST00000471418.1_Missense_Mutation_p.Y175N|ZBTB20_ENST00000464560.1_Missense_Mutation_p.Y175N|ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20-AS1_ENST00000467304.1_RNA|ZBTB20_ENST00000393785.2_Missense_Mutation_p.Y175N|ZBTB20_ENST00000357258.3_Missense_Mutation_p.Y175N|ZBTB20_ENST00000481632.1_Missense_Mutation_p.Y175N|ZBTB20-AS1_ENST00000496219.1_RNA	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	248						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		GAGCACGCGTAGAGTGCCGAG	0.657																																					NSCLC(69;748 1344 9802 11203 30933)	dbGAP											0													82.0	73.0	76.0					3																	114070183		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.742T>A	3.37:g.114070183A>T	ENSP00000419153:p.Tyr248Asn		Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.Y248N	ENST00000474710.1	37	c.742	CCDS54626.1	3	.	.	.	.	.	.	.	.	.	.	A	17.63	3.436899	0.62955	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.10763	2.88;2.88;2.88;2.88;2.84;2.88;2.88	5.52	5.52	0.82312	.	0.063724	0.64402	D	0.000004	T	0.21267	0.0512	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.02161	-1.1203	10	0.87932	D	0	.	15.8108	0.78561	1.0:0.0:0.0:0.0	.	248	Q9HC78	ZBT20_HUMAN	N	175;175;175;175;248;175;175	ENSP00000420324:Y175N;ENSP00000377375:Y175N;ENSP00000418092:Y175N;ENSP00000419902:Y175N;ENSP00000419153:Y248N;ENSP00000349803:Y175N;ENSP00000417307:Y175N	ENSP00000349803:Y175N	Y	-	1	0	ZBTB20	115552873	1.000000	0.71417	0.991000	0.47740	0.847000	0.48162	8.761000	0.91691	2.320000	0.78422	0.528000	0.53228	TAC	ZBTB20	-	NULL	ENSG00000181722		0.657	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	ZBTB20	HGNC	protein_coding	OTTHUMT00000354951.1	46	0.00	0	A	NM_015642		114070183	114070183	-1	no_errors	ENST00000474710	ensembl	human	known	69_37n	missense	20	48.72	19	SNP	1.000	T
ZNF608	57507	genome.wustl.edu	37	5	124036959	124036959	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EI-01A-11D-A27P-09	TCGA-AC-A5EI-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bbdeaaa2-efd9-4442-997d-c7353f245f66	38f6baf0-4400-4c12-8eab-3e24d38e39ec	g.chr5:124036959C>T	ENST00000306315.5	-	2	1345	c.910G>A	c.(910-912)Gac>Aac	p.D304N	ZNF608_ENST00000504926.1_5'UTR	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	304							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		AACAGGGGGTCAACCTGAAAG	0.463																																						dbGAP											0													106.0	106.0	106.0					5																	124036959		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.910G>A	5.37:g.124036959C>T	ENSP00000307746:p.Asp304Asn		A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	NULL	p.D304N	ENST00000306315.5	37	c.910	CCDS34219.1	5	.	.	.	.	.	.	.	.	.	.	C	24.8	4.573842	0.86542	.	.	ENSG00000168916	ENST00000306315;ENST00000509799;ENST00000513986	T	0.46451	0.87	5.93	5.93	0.95920	.	0.143577	0.49305	D	0.000156	T	0.24005	0.0581	N	0.08118	0	0.47476	D	0.999435	P	0.41393	0.748	B	0.32533	0.147	T	0.06789	-1.0807	9	.	.	.	-30.7839	20.3539	0.98825	0.0:1.0:0.0:0.0	.	304	Q9ULD9	ZN608_HUMAN	N	304	ENSP00000307746:D304N	.	D	-	1	0	ZNF608	124064858	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.946000	0.56644	2.826000	0.97356	0.655000	0.94253	GAC	ZNF608	-	NULL	ENSG00000168916		0.463	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	HGNC	protein_coding	OTTHUMT00000371300.1	56	0.00	0	C	XM_114432		124036959	124036959	-1	no_errors	ENST00000306315	ensembl	human	known	69_37n	missense	53	14.52	9	SNP	1.000	T
