#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACOX3	8310	genome.wustl.edu	37	4	8416065	8416065	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr4:8416065T>G	ENST00000356406.5	-	5	574	c.497A>C	c.(496-498)aAt>aCt	p.N166T	ACOX3_ENST00000503233.1_Missense_Mutation_p.N166T|ACOX3_ENST00000413009.2_Missense_Mutation_p.N166T	NM_003501.2	NP_003492.2	O15254	ACOX3_HUMAN	acyl-CoA oxidase 3, pristanoyl	166					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(17)|prostate(1)|skin(3)|stomach(1)	42						GGCCTTGGTATTACTGCCGTG	0.463																																						dbGAP											0													172.0	148.0	156.0					4																	8416065		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11411	CCDS3401.1, CCDS47017.1	4p15.3	2010-04-30	2010-04-30		ENSG00000087008	ENSG00000087008	1.3.3.6		121	protein-coding gene	gene with protein product		603402	"""acyl-Coenzyme A oxidase 3, pristanoyl"""			9271077	Standard	NM_003501		Approved		uc003glc.4	O15254	OTTHUMG00000090509	ENST00000356406.5:c.497A>C	4.37:g.8416065T>G	ENSP00000348775:p.Asn166Thr		Q96AJ8	Missense_Mutation	SNP	pfam_Acyl-CoA_oxidase_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_Oxase/DH_1,superfamily_AcylCo_DH/oxidase_C,superfamily_AcylCoA_DH/oxidase,pirsf_Acyl-CoA_oxidase	p.N166T	ENST00000356406.5	37	c.497	CCDS3401.1	4	.	.	.	.	.	.	.	.	.	.	T	14.44	2.535543	0.45176	.	.	ENSG00000087008	ENST00000413009;ENST00000356406;ENST00000503233;ENST00000514423	D;D;D;D	0.99032	-3.7;-3.7;-3.7;-5.35	4.14	4.14	0.48551	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (2);	0.000000	0.85682	D	0.000000	D	0.99483	0.9816	H	0.97186	3.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.98256	1.0496	10	0.72032	D	0.01	-27.8402	12.3131	0.54940	0.0:0.0:0.0:1.0	.	166;166;166	B2R856;O15254-2;O15254	.;.;ACOX3_HUMAN	T	166;166;166;71	ENSP00000413994:N166T;ENSP00000348775:N166T;ENSP00000421625:N166T;ENSP00000427321:N71T	ENSP00000348775:N166T	N	-	2	0	ACOX3	8466965	1.000000	0.71417	0.569000	0.28460	0.035000	0.12851	6.437000	0.73421	1.752000	0.51891	0.528000	0.53228	AAT	ACOX3	-	pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCoA_DH/oxidase,pirsf_Acyl-CoA_oxidase	ENSG00000087008		0.463	ACOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOX3	HGNC	protein_coding	OTTHUMT00000206997.4	125	0.00	0	T			8416065	8416065	-1	no_errors	ENST00000356406	ensembl	human	known	69_37n	missense	20	75.00	60	SNP	1.000	G
ADAM12	8038	genome.wustl.edu	37	10	127760205	127760205	+	Silent	SNP	C	C	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr10:127760205C>T	ENST00000368679.4	-	12	1482	c.1173G>A	c.(1171-1173)gtG>gtA	p.V391V	ADAM12_ENST00000467145.1_5'Flank|ADAM12_ENST00000368676.4_Silent_p.V391V	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	391	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		AACTGCTGAACACCATGGGAA	0.557																																						dbGAP											0													66.0	63.0	64.0					10																	127760205		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.1173G>A	10.37:g.127760205C>T			O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Silent	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,prints_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.V391	ENST00000368679.4	37	c.1173	CCDS7653.1	10																																																																																			ADAM12	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000148848		0.557	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM12	HGNC	protein_coding	OTTHUMT00000050961.1	91	0.00	0	C			127760205	127760205	-1	no_errors	ENST00000368679	ensembl	human	known	69_37n	silent	87	39.16	56	SNP	1.000	T
AKAP8	10270	genome.wustl.edu	37	19	15472955	15472955	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr19:15472955G>C	ENST00000269701.2	-	10	1328	c.1268C>G	c.(1267-1269)aCc>aGc	p.T423S		NM_005858.3	NP_005849.1	O43823	AKAP8_HUMAN	A kinase (PRKA) anchor protein 8	423					mitotic chromosome condensation (GO:0007076)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	condensed chromosome (GO:0000793)|female pronucleus (GO:0001939)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)	26						GGGCAGCTTGGTGCTTATGAA	0.537																																					GBM(190;1671 2163 3274 27186 30476)	dbGAP											0													91.0	87.0	89.0					19																	15472955		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11997	CCDS12329.1	19p13.12	2012-05-16			ENSG00000105127	ENSG00000105127		"""A-kinase anchor proteins"""	378	protein-coding gene	gene with protein product	"""A-kinase anchor protein, 95kDa"""	604692				9473338	Standard	NM_005858		Approved	AKAP95, DKFZp586B1222	uc002nav.3	O43823		ENST00000269701.2:c.1268C>G	19.37:g.15472955G>C	ENSP00000269701:p.Thr423Ser			Missense_Mutation	SNP	pfam_AKAP95	p.T423S	ENST00000269701.2	37	c.1268	CCDS12329.1	19	.	.	.	.	.	.	.	.	.	.	G	19.19	3.779892	0.70222	.	.	ENSG00000105127	ENST00000269701;ENST00000537303	T	0.43294	0.95	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000011	T	0.56470	0.1987	L	0.46157	1.445	0.27340	N	0.956546	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.50684	-0.8799	10	0.39692	T	0.17	-34.0769	13.8963	0.63773	0.0:0.1529:0.8471:0.0	.	423;423	Q8NE02;O43823	.;AKAP8_HUMAN	S	423;172	ENSP00000269701:T423S	ENSP00000269701:T423S	T	-	2	0	AKAP8	15333955	1.000000	0.71417	0.990000	0.47175	0.904000	0.53231	3.336000	0.52113	2.593000	0.87608	0.462000	0.41574	ACC	AKAP8	-	pfam_AKAP95	ENSG00000105127		0.537	AKAP8-004	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP8	HGNC	protein_coding	OTTHUMT00000461293.3	67	0.00	0	G	NM_005858		15472955	15472955	-1	no_errors	ENST00000269701	ensembl	human	known	69_37n	missense	51	43.96	40	SNP	0.995	C
ANKRD30A	91074	genome.wustl.edu	37	10	37430800	37430800	+	Silent	SNP	T	T	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr10:37430800T>A	ENST00000602533.1	+	7	906	c.807T>A	c.(805-807)ccT>ccA	p.P269P	ANKRD30A_ENST00000361713.1_Silent_p.P269P|ANKRD30A_ENST00000374660.1_Silent_p.P269P			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	325					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P269P(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						AAAAAACACCTGATGAGGCTG	0.473																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)											61.0	63.0	62.0					10																	37430800		1881	4118	5999	-	-	-	SO:0001819	synonymous_variant	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.807T>A	10.37:g.37430800T>A			Q5W025	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P269	ENST00000602533.1	37	c.807		10																																																																																			ANKRD30A	-	NULL	ENSG00000148513		0.473	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	98	0.00	0	T	NM_052997		37430800	37430800	+1	no_errors	ENST00000361713	ensembl	human	known	69_37n	silent	67	33.66	34	SNP	0.009	A
ARPC1A	10552	genome.wustl.edu	37	7	98946502	98946502	+	Silent	SNP	G	G	T	rs372101437		TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr7:98946502G>T	ENST00000262942.5	+	5	544	c.420G>T	c.(418-420)ccG>ccT	p.P140P	ARPC1A_ENST00000432884.2_Silent_p.P93P	NM_001190996.1|NM_006409.3	NP_001177925.1|NP_006400.2	Q92747	ARC1A_HUMAN	actin related protein 2/3 complex, subunit 1A, 41kDa	140					actin cytoskeleton organization (GO:0030036)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of actin filament polymerization (GO:0030833)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	actin binding (GO:0003779)			endometrium(3)|large_intestine(5)|liver(2)|lung(7)|ovary(1)|prostate(1)	19	all_cancers(62;4.46e-09)|all_epithelial(64;3.44e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0258)		STAD - Stomach adenocarcinoma(171;0.215)			TTAAAAAGCCGATTCGCTCCA	0.478																																						dbGAP											0													145.0	122.0	130.0					7																	98946502		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y08999	CCDS5660.1	7q22.1	2013-03-14	2002-08-29		ENSG00000241685	ENSG00000241685		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	703	protein-coding gene	gene with protein product	"""actin binding protein (Schizosaccharomyces pombe sop2-like)"", ""SOP2-like protein"""	604220	"""actin related protein 2/3 complex, subunit 1A (41 kD)"""			8978670, 9230079	Standard	NM_006409		Approved	SOP2Hs, SOP2L, Arc40	uc003upx.2	Q92747	OTTHUMG00000154553	ENST00000262942.5:c.420G>T	7.37:g.98946502G>T			A4D276|B4DLQ7|D6W5S1|Q7Z5U8|Q86WU5|Q8IXQ0	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P140	ENST00000262942.5	37	c.420	CCDS5660.1	7																																																																																			ARPC1A	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1	ENSG00000241685		0.478	ARPC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPC1A	HGNC	protein_coding	OTTHUMT00000335908.1	118	0.00	0	G	NM_006409		98946502	98946502	+1	no_errors	ENST00000262942	ensembl	human	known	69_37n	silent	105	31.37	48	SNP	0.018	T
ATAD2B	54454	genome.wustl.edu	37	2	24046432	24046432	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr2:24046432A>T	ENST00000238789.5	-	16	2170	c.1827T>A	c.(1825-1827)tgT>tgA	p.C609*	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	609						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TATCGGCTCCACAGTAGCCTA	0.448																																						dbGAP											0													61.0	59.0	60.0					2																	24046432		1941	4136	6077	-	-	-	SO:0001587	stop_gained	0			AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.1827T>A	2.37:g.24046432A>T	ENSP00000238789:p.Cys609*		B9ZVQ5|Q6ZNA6|Q8N9E7	Nonsense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,pfam_IstB_ATP-bd,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.C609*	ENST00000238789.5	37	c.1827	CCDS46227.1	2	.	.	.	.	.	.	.	.	.	.	A	31	5.086794	0.94100	.	.	ENSG00000119778	ENST00000238789;ENST00000458510	.	.	.	5.07	2.7	0.31948	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.7247	0.40324	0.8309:0.0:0.1691:0.0	.	.	.	.	X	609;47	.	ENSP00000238789:C609X	C	-	3	2	ATAD2B	23899936	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.298000	0.33412	0.366000	0.24427	0.533000	0.62120	TGT	ATAD2B	-	NULL	ENSG00000119778		0.448	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	ATAD2B	HGNC	protein_coding	OTTHUMT00000324333.1	71	0.00	0	A	NM_017552		24046432	24046432	-1	no_errors	ENST00000238789	ensembl	human	known	69_37n	nonsense	31	46.55	27	SNP	1.000	T
AZI2	64343	genome.wustl.edu	37	3	28365652	28365652	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr3:28365652G>A	ENST00000479665.1	-	8	1591	c.1060C>T	c.(1060-1062)Cct>Tct	p.P354S	CMC1_ENST00000466830.1_3'UTR|AZI2_ENST00000295748.3_5'UTR	NM_022461.3	NP_071906.1	Q9H6S1	AZI2_HUMAN	5-azacytidine induced 2	354					dendritic cell differentiation (GO:0097028)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-alpha production (GO:0032607)|interferon-gamma production (GO:0032609)|interleukin-6 production (GO:0032635)|mitotic cell cycle (GO:0000278)|T cell activation (GO:0042110)|tumor necrosis factor production (GO:0032640)	cytoplasm (GO:0005737)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15						GATTTAGGAGGACTTGGAAAT	0.398																																						dbGAP											0													156.0	157.0	156.0					3																	28365652		2203	4299	6502	-	-	-	SO:0001583	missense	0			AC093142	CCDS2647.1, CCDS46782.1, CCDS46783.1	3p23	2006-03-01			ENSG00000163512	ENSG00000163512			24002	protein-coding gene	gene with protein product		609916				10580148	Standard	NM_001134432		Approved	NAP1, FLJ21939, AZ2	uc003ceb.4	Q9H6S1	OTTHUMG00000130573	ENST00000479665.1:c.1060C>T	3.37:g.28365652G>A	ENSP00000419371:p.Pro354Ser		A8K3M2|C9JB40|H7BXU6|Q86W99|Q9BQF1	Missense_Mutation	SNP	NULL	p.P354S	ENST00000479665.1	37	c.1060	CCDS2647.1	3	.	.	.	.	.	.	.	.	.	.	G	24.7	4.560317	0.86335	.	.	ENSG00000163512	ENST00000479665	.	.	.	6.17	5.28	0.74379	.	0.047700	0.85682	D	0.000000	T	0.78528	0.4297	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81093	-0.1089	9	0.72032	D	0.01	-9.8756	17.5067	0.87748	0.0:0.1239:0.8761:0.0	.	354	Q9H6S1	AZI2_HUMAN	S	354	.	ENSP00000419371:P354S	P	-	1	0	AZI2	28340656	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.241000	0.78201	1.578000	0.49821	0.655000	0.94253	CCT	AZI2	-	NULL	ENSG00000163512		0.398	AZI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZI2	HGNC	protein_coding	OTTHUMT00000252998.2	127	0.00	0	G	NM_203326		28365652	28365652	-1	no_errors	ENST00000479665	ensembl	human	known	69_37n	missense	21	74.39	61	SNP	1.000	A
C10orf2	56652	genome.wustl.edu	37	10	102748073	102748073	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr10:102748073C>T	ENST00000311916.2	+	1	291	c.106C>T	c.(106-108)Cct>Tct	p.P36S	MRPL43_ENST00000370242.4_5'Flank|MRPL43_ENST00000370236.1_5'Flank|C10orf2_ENST00000473656.1_Intron|MRPL43_ENST00000318325.2_5'Flank|MRPL43_ENST00000370241.3_5'Flank|MRPL43_ENST00000477279.1_5'Flank|MRPL43_ENST00000370234.4_5'Flank|RP11-108L7.4_ENST00000447344.1_RNA|MRPL43_ENST00000299179.5_5'Flank|C10orf2_ENST00000370228.1_Missense_Mutation_p.P36S|MRPL43_ENST00000493646.1_5'Flank|MRPL43_ENST00000318364.8_5'Flank|MRPL43_ENST00000342071.1_5'Flank	NM_001163813.1|NM_021830.4	NP_001157285.1|NP_068602.2	Q96RR1	PEO1_HUMAN	chromosome 10 open reading frame 2	36					cell death (GO:0008219)|DNA unwinding involved in DNA replication (GO:0006268)|mitochondrial DNA replication (GO:0006264)|protein hexamerization (GO:0034214)|protein homooligomerization (GO:0051260)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial nucleoid (GO:0042645)	5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|stomach(1)	24		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CCCAGGCCCTCCTCGCAGACG	0.602																																						dbGAP											0													66.0	70.0	68.0					10																	102748073		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF292004	CCDS7506.1, CCDS53570.1	10q24	2013-05-13			ENSG00000107815	ENSG00000107815			1160	protein-coding gene	gene with protein product	"""twinkle"", ""T7 helicase-related protein with intramitochondrial nucleoid localization"""	606075	"""infantile onset spinocerebellar ataxia (autosomal recessive)"""	IOSCA		11431692, 10645945, 16135556	Standard	NM_021830		Approved	PEO, PEO1, TWINKLE, FLJ21832, TWINL	uc001ksf.2	Q96RR1	OTTHUMG00000018917	ENST00000311916.2:c.106C>T	10.37:g.102748073C>T	ENSP00000309595:p.Pro36Ser		B2CQL2|Q6MZX2|Q6PJP5|Q96RR0	Missense_Mutation	SNP	pfam_Circ_KaiC/RadA,pfam_DNA_helicase_DnaB-like_C,pfscan_DNA_helicase_DnaB-like_C	p.P36S	ENST00000311916.2	37	c.106	CCDS7506.1	10	.	.	.	.	.	.	.	.	.	.	C	7.343	0.621204	0.14193	.	.	ENSG00000107815	ENST00000311916;ENST00000370228	D;D	0.94793	-3.22;-3.52	5.59	2.74	0.32292	.	0.138708	0.48286	N	0.000185	D	0.89504	0.6734	L	0.54323	1.7	0.30612	N	0.759422	B;B	0.10296	0.003;0.001	B;B	0.14023	0.01;0.005	T	0.78532	-0.2168	10	0.15499	T	0.54	-19.8514	5.0555	0.14531	0.1439:0.618:0.0:0.2381	.	36;36	Q96RR1-2;Q96RR1	.;PEO1_HUMAN	S	36	ENSP00000309595:P36S;ENSP00000359248:P36S	ENSP00000309595:P36S	P	+	1	0	C10orf2	102738063	0.096000	0.21769	0.999000	0.59377	0.171000	0.22731	0.474000	0.22148	0.744000	0.32741	-0.409000	0.06214	CCT	C10orf2	-	NULL	ENSG00000107815		0.602	C10orf2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf2	HGNC	protein_coding	OTTHUMT00000049886.1	27	0.00	0	C	NM_021830		102748073	102748073	+1	no_errors	ENST00000311916	ensembl	human	known	69_37n	missense	16	48.39	15	SNP	0.989	T
C12orf40	283461	genome.wustl.edu	37	12	40076596	40076596	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr12:40076596C>A	ENST00000324616.5	+	8	1024	c.870C>A	c.(868-870)aaC>aaA	p.N290K	C12orf40_ENST00000398716.1_Missense_Mutation_p.N213K|C12orf40_ENST00000405531.3_Missense_Mutation_p.N290K	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	290										breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						CTACTCCTAACCTTCTATCAG	0.318																																						dbGAP											0													130.0	126.0	127.0					12																	40076596		1832	4077	5909	-	-	-	SO:0001583	missense	0			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.870C>A	12.37:g.40076596C>A	ENSP00000317671:p.Asn290Lys		B7WNU1|Q8IXY6|Q8N818|V9HW02	Missense_Mutation	SNP	NULL	p.N290K	ENST00000324616.5	37	c.870	CCDS41770.1	12	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.560968	0.00910	.	.	ENSG00000180116	ENST00000405531;ENST00000398716;ENST00000324616	T;T	0.41400	1.0;1.01	5.12	-5.05	0.02955	.	0.635697	0.15283	N	0.270594	T	0.18045	0.0433	N	0.19112	0.55	0.09310	N	1	B	0.18610	0.029	B	0.18871	0.023	T	0.09335	-1.0679	10	0.30078	T	0.28	.	2.044	0.03557	0.1531:0.1466:0.2079:0.4924	.	290	Q86WS4	CL040_HUMAN	K	290;213;290	ENSP00000383897:N290K;ENSP00000317671:N290K	ENSP00000317671:N290K	N	+	3	2	C12orf40	38362863	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.481000	0.06552	-0.943000	0.03691	0.491000	0.48974	AAC	C12orf40	-	NULL	ENSG00000180116		0.318	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf40	HGNC	protein_coding	OTTHUMT00000257664.2	230	0.00	0	C	NM_173599		40076596	40076596	+1	no_errors	ENST00000324616	ensembl	human	known	69_37n	missense	107	44.27	85	SNP	0.000	A
C1QTNF9B	387911	genome.wustl.edu	37	13	24465799	24465799	+	Silent	SNP	G	G	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr13:24465799G>A	ENST00000382140.2	-	5	691	c.631C>T	c.(631-633)Ctg>Ttg	p.L211L	C1QTNF9B_ENST00000382145.1_Intron|C1QTNF9B-AS1_ENST00000435039.2_RNA|C1QTNF9B-AS1_ENST00000417034.1_RNA|C1QTNF9B_ENST00000382137.3_Silent_p.L211L|C1QTNF9B_ENST00000382057.3_Intron|MIPEP_ENST00000382172.3_5'Flank|MIPEP_ENST00000469167.1_5'Flank|C1QTNF9B_ENST00000556521.1_Intron|C1QTNF9B-AS1_ENST00000382133.4_RNA			B2RNN3	C1T9B_HUMAN	C1q and tumor necrosis factor related protein 9B	211	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|large_intestine(3)|lung(1)	6						AACTTGCTCAGCACCGTGAGC	0.453																																						dbGAP											0													107.0	117.0	114.0					13																	24465799		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC110413	CCDS31947.1	13q12.12	2011-05-08			ENSG00000205863	ENSG00000205863			34072	protein-coding gene	gene with protein product		614148				17544811	Standard	NM_001007537		Approved	CTRP9B	uc010tcv.1	B2RNN3	OTTHUMG00000016570	ENST00000382140.2:c.631C>T	13.37:g.24465799G>A			A2A3T6|B9EH31|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	Silent	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.L211	ENST00000382140.2	37	c.631	CCDS31947.1	13																																																																																			C1QTNF9B	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q	ENSG00000205863		0.453	C1QTNF9B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	C1QTNF9B	HGNC	protein_coding	OTTHUMT00000044162.3	210	0.00	0	G	NM_001007537		24465799	24465799	-1	no_errors	ENST00000382137	ensembl	human	known	69_37n	silent	309	19.53	75	SNP	0.000	A
C1QTNF9	338872	genome.wustl.edu	37	13	24895535	24895535	+	Silent	SNP	C	C	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr13:24895535C>T	ENST00000382071.2	+	4	716	c.631C>T	c.(631-633)Ctg>Ttg	p.L211L	AL359736.1_ENST00000422229.2_Missense_Mutation_p.S11N|C1QTNF9_ENST00000332018.4_Silent_p.L211L|C1QTNF9-AS1_ENST00000449656.1_RNA			P0C862	C1T9A_HUMAN	C1q and tumor necrosis factor related protein 9	211	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				endometrium(1)|kidney(2)|lung(6)	9		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)		GCTCACGGTGCTGAGCAAGTT	0.458																																						dbGAP											0													73.0	51.0	58.0					13																	24895535		2203	4292	6495	-	-	-	SO:0001819	synonymous_variant	0			BC040438	CCDS9306.1	13q12.12	2010-08-18			ENSG00000240654	ENSG00000240654			28732	protein-coding gene	gene with protein product		614285				12975309, 18787108	Standard	NM_178540		Approved	MGC48915, CTRP9, C1QTNF9A, AQL1	uc001upj.3	P0C862	OTTHUMG00000016576	ENST00000382071.2:c.631C>T	13.37:g.24895535C>T			A2A3T6|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	Missense_Mutation	SNP	NULL	p.S11N	ENST00000382071.2	37	c.32	CCDS9306.1	13	.	.	.	.	.	.	.	.	.	.	N	13.85	2.358771	0.41801	.	.	ENSG00000205850	ENST00000422229	.	.	.	3.96	-0.102	0.13613	.	.	.	.	.	T	0.18467	0.0443	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22347	-1.0219	5	0.24483	T	0.36	.	0.2321	0.00181	0.3045:0.2655:0.1403:0.2896	.	.	.	.	N	11	.	ENSP00000396192:S11N	S	-	2	0	AL359736.1	23793535	0.000000	0.05858	0.648000	0.29521	0.936000	0.57629	0.415000	0.21181	0.046000	0.15833	0.430000	0.28490	AGC	AL359736.1	-	NULL	ENSG00000205850		0.458	C1QTNF9-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C1QTNF9B-AS1	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000044177.1	116	0.00	0	C	NM_178540		24895535	24895535	-1	no_errors	ENST00000422229	ensembl	human	known	69_37n	missense	86	39.44	56	SNP	0.001	T
KDF1	126695	genome.wustl.edu	37	1	27278442	27278443	+	Frame_Shift_Ins	INS	-	-	G	rs535449942		TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:27278442_27278443insG	ENST00000320567.5	-	2	517_518	c.429_430insC	c.(427-432)cccagcfs	p.S144fs		NM_152365.2	NP_689578.2	Q8NAX2	KDF1_HUMAN		144					developmental growth (GO:0048589)|establishment of skin barrier (GO:0061436)|keratinocyte development (GO:0003334)|limb epidermis development (GO:0060887)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|positive regulation of epidermal cell differentiation (GO:0045606)|regulation of epidermal cell division (GO:0010482)	cell cortex (GO:0005938)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.37e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.22e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		TCCCGCCGGCTGGGGGGTGCAC	0.634																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0																														ENST00000320567.5:c.430dupC	1.37:g.27278448_27278448dupG	ENSP00000319179:p.Ser144fs		Q5QP32|Q8N0S7	Frame_Shift_Ins	INS	NULL	p.S143fs	ENST00000320567.5	37	c.430_429	CCDS293.1	1																																																																																			C1orf172	-	NULL	ENSG00000175707		0.634	C1orf172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf172	HGNC	protein_coding	OTTHUMT00000012340.1	20	0.00	0	-			27278442	27278443	-1	no_errors	ENST00000320567	ensembl	human	known	69_37n	frame_shift_ins	5	44.44	4	INS	0.989:0.427	G
C4orf17	84103	genome.wustl.edu	37	4	100443690	100443690	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr4:100443690A>G	ENST00000326581.4	+	3	523	c.161A>G	c.(160-162)gAt>gGt	p.D54G	C4orf17_ENST00000514652.1_Missense_Mutation_p.D54G|C4orf17_ENST00000503257.1_3'UTR	NM_032149.2	NP_115525.2	Q53FE4	CD017_HUMAN	chromosome 4 open reading frame 17	54										central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|prostate(1)|urinary_tract(3)	18				OV - Ovarian serous cystadenocarcinoma(123;2.08e-08)		ACTGTGAATGATGATGAGAAT	0.398																																						dbGAP											0													173.0	151.0	158.0					4																	100443690		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136838	CCDS3649.1	4q23	2008-02-05			ENSG00000138813	ENSG00000138813			25274	protein-coding gene	gene with protein product						11230166	Standard	NM_032149		Approved	DKFZP434G072	uc003huw.3	Q53FE4	OTTHUMG00000131027	ENST00000326581.4:c.161A>G	4.37:g.100443690A>G	ENSP00000322582:p.Asp54Gly		Q6FI84|Q6IS77|Q8NA78|Q9H0D9	Missense_Mutation	SNP	NULL	p.D54G	ENST00000326581.4	37	c.161	CCDS3649.1	4	.	.	.	.	.	.	.	.	.	.	A	16.33	3.093932	0.56075	.	.	ENSG00000138813	ENST00000326581;ENST00000514652	T;T	0.33654	1.4;1.4	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000018	T	0.58192	0.2105	M	0.79693	2.465	0.37910	D	0.931347	D	0.76494	0.999	D	0.64595	0.927	T	0.67848	-0.5564	10	0.87932	D	0	-10.9795	11.2377	0.48951	1.0:0.0:0.0:0.0	.	54	Q53FE4	CD017_HUMAN	G	54	ENSP00000322582:D54G;ENSP00000427663:D54G	ENSP00000322582:D54G	D	+	2	0	C4orf17	100662713	1.000000	0.71417	1.000000	0.80357	0.363000	0.29612	3.659000	0.54489	2.151000	0.67156	0.528000	0.53228	GAT	C4orf17	-	NULL	ENSG00000138813		0.398	C4orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf17	HGNC	protein_coding	OTTHUMT00000253670.2	233	0.00	0	A	NM_032149		100443690	100443690	+1	no_errors	ENST00000326581	ensembl	human	known	69_37n	missense	276	22.47	80	SNP	1.000	G
CACNA1H	8912	genome.wustl.edu	37	16	1265025	1265025	+	Silent	SNP	C	C	G	rs61382101	byFrequency	TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr16:1265025C>G	ENST00000348261.5	+	28	5231	c.4983C>G	c.(4981-4983)gtC>gtG	p.V1661V	CACNA1H_ENST00000565831.1_Silent_p.V1655V|CACNA1H_ENST00000358590.4_Silent_p.V1655V	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1661					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	TCGTGTTTGTCTTCGAGGCTG	0.632																																						dbGAP											0													158.0	160.0	159.0					16																	1265025		2072	4197	6269	-	-	-	SO:0001819	synonymous_variant	0			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.4983C>G	16.37:g.1265025C>G			B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_PKD_2	p.L408V	ENST00000348261.5	37	c.1222	CCDS45375.1	16																																																																																			CACNA1H	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000196557		0.632	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	HGNC	protein_coding	OTTHUMT00000421601.1	35	0.00	0	C	NM_001005407		1265025	1265025	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000569107	ensembl	human	novel	69_37n	missense	27	34.15	14	SNP	0.225	G
RANBP3	8498	genome.wustl.edu	37	19	5914711	5914713	+	IGR	DEL	GCG	GCG	-	rs367710141		TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	GCG	GCG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr19:5914711_5914713delGCG	ENST00000340578.6	-	0	3233				AC104532.4_ENST00000591109.1_RNA|CAPS_ENST00000452990.2_In_Frame_Del_p.74_75SG>R|AC104532.2_ENST00000588891.1_3'UTR|CAPS_ENST00000588776.1_In_Frame_Del_p.160_161SG>R|CAPS_ENST00000222125.5_In_Frame_Del_p.74_75SG>R	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3						intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						CGCAATGGCAGCGGGACGCTGGA	0.665																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4			19.37:g.5914711_5914713delGCG			B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	In_Frame_Del	DEL	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.SG74in_frame_delR	ENST00000340578.6	37	c.221_223	CCDS42478.1	19																																																																																			CAPS	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000105519		0.665	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAPS	HGNC	protein_coding	OTTHUMT00000452304.1	34	0.00	0	GCG	NM_007322		5914711	5914713	+1	no_errors	ENST00000222125	ensembl	human	known	69_37n	in_frame_del	17	52.78	19	DEL	0.737:0.741:0.995	-
CCNE1	898	genome.wustl.edu	37	19	30313495	30313495	+	Silent	SNP	C	C	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr19:30313495C>T	ENST00000262643.3	+	11	1374	c.1095C>T	c.(1093-1095)gaC>gaT	p.D365D	CCNE1_ENST00000357943.5_Silent_p.D322D|CCNE1_ENST00000444983.2_Silent_p.D350D	NM_001238.2	NP_001229.1	P24864	CCNE1_HUMAN	cyclin E1	365					androgen receptor signaling pathway (GO:0030521)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|Wnt signaling pathway (GO:0016055)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|skin(1)	20	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)			CCCACAGAGACAGCTTGGATT	0.502			A		serous ovarian																																	dbGAP		Dom	yes		19	19q12	898	cyclin E1		E	0													166.0	169.0	168.0					19																	30313495		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M73812	CCDS12419.1	19q12	2014-07-03			ENSG00000105173	ENSG00000105173			1589	protein-coding gene	gene with protein product	"""cyclin Es"", ""cyclin Et"""	123837		CCNE		1833066	Standard	NM_001238		Approved		uc002nsn.3	P24864	OTTHUMG00000177626	ENST00000262643.3:c.1095C>T	19.37:g.30313495C>T			A8K684|Q14091|Q8NFG1|Q92501|Q9UD21	Silent	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.D365	ENST00000262643.3	37	c.1095	CCDS12419.1	19																																																																																			CCNE1	-	pirsf_Cyclin_A/B/D/E	ENSG00000105173		0.502	CCNE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNE1	HGNC	protein_coding	OTTHUMT00000438138.1	95	0.00	0	C	NM_001238		30313495	30313495	+1	no_errors	ENST00000262643	ensembl	human	known	69_37n	silent	93	43.98	73	SNP	1.000	T
CEP170	9859	genome.wustl.edu	37	1	243354442	243354442	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:243354442G>C	ENST00000366542.1	-	8	1037	c.986C>G	c.(985-987)cCc>cGc	p.P329R	CEP170_ENST00000366544.1_Missense_Mutation_p.P329R|CEP170_ENST00000366543.1_Missense_Mutation_p.P329R	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	329						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			TTTGTTTTCGGGTGCCATCAT	0.438																																						dbGAP											0													86.0	74.0	78.0					1																	243354442		1855	4102	5957	-	-	-	SO:0001583	missense	0			AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.986C>G	1.37:g.243354442G>C	ENSP00000355500:p.Pro329Arg		O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,superfamily_Fibronectin_type3,smart_FHA_dom,pfscan_FHA_dom	p.P329R	ENST00000366542.1	37	c.986	CCDS44339.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.18|19.18	3.777655|3.777655	0.70107|0.70107	.|.	.|.	ENSG00000143702|ENSG00000143702	ENST00000336415|ENST00000366542;ENST00000366544;ENST00000366543;ENST00000424081	T|T;T;T	0.29917|0.44482	1.55|0.92;0.93;0.93	4.91|4.91	4.91|4.91	0.64330|0.64330	.|.	0.121167|0.121167	0.52532|0.52532	D|D	0.000069|0.000069	T|T	0.41696|0.41696	0.1170|0.1170	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.52170	.|0.951;0.823;0.725	.|P;P;B	.|0.47528	.|0.549;0.516;0.347	T|T	0.43212|0.43212	-0.9405|-0.9405	8|10	0.02654|0.62326	T|D	1|0.03	-11.2156|-11.2156	18.1223|18.1223	0.89576|0.89576	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|329;329;329	.|Q5SW79-3;Q5SW79-2;Q5SW79	.|.;.;CE170_HUMAN	A|R	231|329;329;329;227	ENSP00000338161:P231A|ENSP00000355500:P329R;ENSP00000355502:P329R;ENSP00000355501:P329R	ENSP00000338161:P231A|ENSP00000355500:P329R	P|P	-|-	1|2	0|0	CEP170|CEP170	241421065|241421065	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.851000|0.851000	0.48451|0.48451	9.471000|9.471000	0.97696|0.97696	2.282000|2.282000	0.76494|0.76494	0.455000|0.455000	0.32223|0.32223	CCG|CCC	CEP170	-	NULL	ENSG00000143702		0.438	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	CEP170	HGNC	protein_coding	OTTHUMT00000096178.2	185	0.00	0	G	NM_014812		243354442	243354442	-1	no_errors	ENST00000366542	ensembl	human	known	69_37n	missense	343	12.66	50	SNP	0.934	C
COL4A2	1284	genome.wustl.edu	37	13	111155500	111155500	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr13:111155500G>A	ENST00000360467.5	+	42	4216	c.3910G>A	c.(3910-3912)Gct>Act	p.A1304T	COL4A2-AS1_ENST00000417970.2_RNA	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	1304	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			ACCAGGTTCTGCTGCTCTTCC	0.642																																						dbGAP											0													64.0	69.0	67.0					13																	111155500		1854	4098	5952	-	-	-	SO:0001583	missense	0			AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.3910G>A	13.37:g.111155500G>A	ENSP00000353654:p.Ala1304Thr		Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.A1304T	ENST00000360467.5	37	c.3910	CCDS41907.1	13	.	.	.	.	.	.	.	.	.	.	G	8.535	0.871948	0.17322	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.93426	-3.22	4.6	1.53	0.23141	.	0.544689	0.16482	N	0.212537	D	0.82793	0.5114	N	0.04746	-0.17	0.09310	N	1	B	0.32968	0.392	B	0.37989	0.262	T	0.74484	-0.3650	10	0.37606	T	0.19	.	4.0213	0.09667	0.1026:0.2889:0.4803:0.1283	.	1304	P08572	CO4A2_HUMAN	T	1304	ENSP00000353654:A1304T	ENSP00000257309:A1304T	A	+	1	0	COL4A2	109953501	0.000000	0.05858	0.047000	0.18901	0.532000	0.34746	-0.244000	0.08903	0.875000	0.35847	0.555000	0.69702	GCT	COL4A2	-	pfam_Collagen	ENSG00000134871		0.642	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A2	HGNC	protein_coding	OTTHUMT00000045761.2	39	0.00	0	G	NM_001846		111155500	111155500	+1	no_errors	ENST00000360467	ensembl	human	known	69_37n	missense	39	58.95	56	SNP	0.068	A
COL7A1	1294	genome.wustl.edu	37	3	48608296	48608296	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr3:48608296G>A	ENST00000328333.8	-	94	7377	c.7270C>T	c.(7270-7272)Cgg>Tgg	p.R2424W	COL7A1_ENST00000454817.1_Missense_Mutation_p.R2392W	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2424	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R2424W(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CCCCTCACCCGCTCTCCACTA	0.667																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											34.0	29.0	31.0					3																	48608296		2202	4300	6502	-	-	-	SO:0001583	missense	0			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.7270C>T	3.37:g.48608296G>A	ENSP00000332371:p.Arg2424Trp		Q14054|Q16507	Missense_Mutation	SNP	pfam_Collagen,pfam_Fibronectin_type3,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.R2424W	ENST00000328333.8	37	c.7270	CCDS2773.1	3	.	.	.	.	.	.	.	.	.	.	G	9.142	1.014011	0.19277	.	.	ENSG00000114270	ENST00000328333;ENST00000454817;ENST00000422991	D;D;D	0.96334	-3.98;-3.98;-3.98	5.24	3.36	0.38483	.	0.000000	0.41396	D	0.000897	D	0.97791	0.9275	M	0.83483	2.645	0.44834	D	0.997842	D	0.89917	1.0	D	0.76071	0.987	D	0.98036	1.0379	10	0.66056	D	0.02	.	12.5534	0.56240	0.0:0.0:0.5423:0.4577	.	2424	Q02388	CO7A1_HUMAN	W	2424;2392;89	ENSP00000332371:R2424W;ENSP00000412569:R2392W;ENSP00000391608:R89W	ENSP00000332371:R2424W	R	-	1	2	COL7A1	48583300	0.980000	0.34600	1.000000	0.80357	0.284000	0.27059	0.318000	0.19504	1.174000	0.42811	0.655000	0.94253	CGG	COL7A1	-	pfam_Collagen	ENSG00000114270		0.667	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	HGNC	protein_coding	OTTHUMT00000257519.1	39	0.00	0	G	NM_000094		48608296	48608296	-1	no_errors	ENST00000328333	ensembl	human	known	69_37n	missense	11	73.91	34	SNP	1.000	A
CRNKL1	51340	genome.wustl.edu	37	20	20033188	20033188	+	Silent	SNP	C	C	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr20:20033188C>T	ENST00000377340.2	-	2	313	c.282G>A	c.(280-282)gaG>gaA	p.E94E	C20orf26_ENST00000377309.2_5'UTR|CRNKL1_ENST00000377327.4_Silent_p.E82E|CRNKL1_ENST00000536226.1_5'Flank|C20orf26_ENST00000389656.3_5'UTR|C20orf26_ENST00000245957.5_5'Flank|C20orf26_ENST00000377306.1_5'Flank	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	94					mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						GCTGCGCGTCCTCCTTGCGGC	0.652																																						dbGAP											0													57.0	52.0	54.0					20																	20033188		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.282G>A	20.37:g.20033188C>T			A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Missense_Mutation	SNP	NULL	p.R51K	ENST00000377340.2	37	c.152	CCDS33446.1	20																																																																																			CRNKL1	-	NULL	ENSG00000101343		0.652	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	CRNKL1	HGNC	protein_coding	OTTHUMT00000127787.1	39	0.00	0	C			20033188	20033188	-1	no_errors	ENST00000496549	ensembl	human	known	69_37n	missense	28	42.86	21	SNP	0.813	T
CROCC	9696	genome.wustl.edu	37	1	17263261	17263261	+	Silent	SNP	G	G	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:17263261G>A	ENST00000375541.5	+	9	1155	c.1086G>A	c.(1084-1086)ctG>ctA	p.L362L	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		AACAGGCCCTGCTGCAGGCCC	0.682																																						dbGAP											0													22.0	21.0	21.0					1																	17263261		2201	4290	6491	-	-	-	SO:0001819	synonymous_variant	0			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.1086G>A	1.37:g.17263261G>A				Silent	SNP	superfamily_Prefoldin,superfamily_t-SNARE	p.L362	ENST00000375541.5	37	c.1086	CCDS30616.1	1																																																																																			CROCC	-	NULL	ENSG00000058453		0.682	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2	21	0.00	0	G	NM_014675		17263261	17263261	+1	no_errors	ENST00000375541	ensembl	human	known	69_37n	silent	10	47.37	9	SNP	0.997	A
DDX55	57696	genome.wustl.edu	37	12	124094567	124094567	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr12:124094567C>G	ENST00000238146.4	+	7	683	c.633C>G	c.(631-633)aaC>aaG	p.N211K	DDX55_ENST00000538744.1_Missense_Mutation_p.N211K	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	211	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		AAGTGGAGAACCTGGTGAGAG	0.572																																						dbGAP											0													64.0	65.0	64.0					12																	124094567		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.633C>G	12.37:g.124094567C>G	ENSP00000238146:p.Asn211Lys		Q658L6|Q8IYH0|Q9HCH7	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.N211K	ENST00000238146.4	37	c.633	CCDS9251.1	12	.	.	.	.	.	.	.	.	.	.	C	7.135	0.580584	0.13686	.	.	ENSG00000111364	ENST00000238146;ENST00000538449;ENST00000538744	T;T	0.39592	2.73;1.07	5.98	5.98	0.97165	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.171905	0.64402	D	0.000007	T	0.24967	0.0606	N	0.04724	-0.175	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.10450	0.005;0.001;0.001	T	0.06552	-1.0820	10	0.36615	T	0.2	-25.3078	14.5745	0.68235	0.0:0.9305:0.0:0.0694	.	211;211;211	B4DVE4;Q8NHQ9;F5H5U2	.;DDX55_HUMAN;.	K	211	ENSP00000238146:N211K;ENSP00000443114:N211K	ENSP00000238146:N211K	N	+	3	2	DDX55	122660520	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	1.447000	0.35101	2.843000	0.97960	0.585000	0.79938	AAC	DDX55	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000111364		0.572	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX55	HGNC	protein_coding	OTTHUMT00000400616.2	114	0.00	0	C			124094567	124094567	+1	no_errors	ENST00000238146	ensembl	human	known	69_37n	missense	81	43.36	62	SNP	1.000	G
DEFB112	245915	genome.wustl.edu	37	6	50011348	50011348	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr6:50011348A>T	ENST00000322246.4	-	2	281	c.282T>A	c.(280-282)aaT>aaA	p.N94K		NM_001037498.1	NP_001032587.1	Q30KQ8	DB112_HUMAN	defensin, beta 112	94					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	Lung NSC(77;0.042)					TTGGGATCCAATTATTTGGGT	0.403																																						dbGAP											0													152.0	128.0	136.0					6																	50011348		2203	4300	6503	-	-	-	SO:0001583	missense	0			DQ012016	CCDS34476.1	6p12.3	2010-03-30			ENSG00000180872	ENSG00000180872		"""Defensins, beta"""	18093	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037498		Approved	DEFB-12	uc011dws.2	Q30KQ8	OTTHUMG00000160215	ENST00000322246.4:c.282T>A	6.37:g.50011348A>T	ENSP00000319126:p.Asn94Lys		Q8NET0	Missense_Mutation	SNP	NULL	p.N94K	ENST00000322246.4	37	c.282	CCDS34476.1	6	.	.	.	.	.	.	.	.	.	.	A	7.281	0.609172	0.14066	.	.	ENSG00000180872	ENST00000322246	.	.	.	0.649	-0.973	0.10297	.	.	.	.	.	T	0.02418	0.0074	N	0.08118	0	0.09310	N	1	P	0.45531	0.86	B	0.26094	0.066	T	0.35798	-0.9774	7	0.87932	D	0	.	.	.	.	.	94	Q30KQ8	DB112_HUMAN	K	94	.	ENSP00000319126:N94K	N	-	3	2	DEFB112	50119307	0.004000	0.15560	0.000000	0.03702	0.000000	0.00434	-0.298000	0.08265	-0.380000	0.07894	-0.426000	0.05927	AAT	DEFB112	-	NULL	ENSG00000180872		0.403	DEFB112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB112	HGNC	protein_coding	OTTHUMT00000359672.1	102	0.00	0	A	NM_001037498		50011348	50011348	-1	no_errors	ENST00000322246	ensembl	human	known	69_37n	missense	66	41.07	46	SNP	0.000	T
DLGAP1	9229	genome.wustl.edu	37	18	3534227	3534227	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr18:3534227T>G	ENST00000315677.3	-	10	3039	c.2444A>C	c.(2443-2445)gAg>gCg	p.E815A	DLGAP1_ENST00000400150.3_Missense_Mutation_p.E531A|DLGAP1_ENST00000534970.1_Missense_Mutation_p.E499A|DLGAP1_ENST00000539435.1_Missense_Mutation_p.E523A|DLGAP1_ENST00000400155.1_Missense_Mutation_p.E521A|DLGAP1_ENST00000400149.3_Missense_Mutation_p.E505A|DLGAP1_ENST00000584874.1_Missense_Mutation_p.E815A|DLGAP1_ENST00000515196.2_Missense_Mutation_p.E815A|DLGAP1_ENST00000581527.1_Missense_Mutation_p.E815A|DLGAP1_ENST00000400147.2_Missense_Mutation_p.E513A|DLGAP1_ENST00000400145.2_Missense_Mutation_p.E513A|DLGAP1_ENST00000581699.1_Missense_Mutation_p.E521A	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	815					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				TTCTTCCCGCTCCATCTGTTG	0.607																																						dbGAP											0													108.0	99.0	102.0					18																	3534227		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.2444A>C	18.37:g.3534227T>G	ENSP00000316377:p.Glu815Ala		A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	pfam_GKAP	p.E815A	ENST00000315677.3	37	c.2444	CCDS11836.1	18	.	.	.	.	.	.	.	.	.	.	T	25.2	4.613540	0.87359	.	.	ENSG00000170579	ENST00000315677;ENST00000400147;ENST00000400150;ENST00000400149;ENST00000400155;ENST00000534970;ENST00000539435;ENST00000400145;ENST00000515196	T;T;T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.50837	0.1639	M	0.86502	2.82	0.80722	D	1	P;P;P;P;P;P;P;P	0.50819	0.939;0.805;0.635;0.805;0.635;0.86;0.787;0.581	P;P;P;P;P;B;P;P	0.48921	0.492;0.492;0.515;0.492;0.595;0.359;0.595;0.46	T	0.61402	-0.7070	10	0.87932	D	0	-34.2374	16.3721	0.83368	0.0:0.0:0.0:1.0	.	815;499;511;521;523;513;815;513	B7Z9Y4;B7Z2H2;B7Z2J5;A8MWN8;B7Z2I2;O14490-3;O14490;O14490-2	.;.;.;.;.;.;DLGP1_HUMAN;.	A	815;513;531;505;521;499;523;513;815	ENSP00000316377:E815A;ENSP00000383011:E513A;ENSP00000383014:E531A;ENSP00000383013:E505A;ENSP00000383019:E521A;ENSP00000437817:E499A;ENSP00000446312:E523A;ENSP00000383010:E513A;ENSP00000445973:E815A	ENSP00000316377:E815A	E	-	2	0	DLGAP1	3524227	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.040000	0.89188	2.257000	0.74773	0.533000	0.62120	GAG	DLGAP1	-	pfam_GKAP	ENSG00000170579		0.607	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP1	HGNC	protein_coding	OTTHUMT00000254394.4	92	0.00	0	T			3534227	3534227	-1	no_errors	ENST00000315677	ensembl	human	known	69_37n	missense	75	35.59	42	SNP	1.000	G
ENPP7	339221	genome.wustl.edu	37	17	77705071	77705071	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr17:77705071T>C	ENST00000328313.5	+	1	391	c.170T>C	c.(169-171)aTg>aCg	p.M57T		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7											breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CTGGACGCCATGGCCCGAGAC	0.622																																						dbGAP											0													57.0	49.0	52.0					17																	77705071		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.170T>C	17.37:g.77705071T>C	ENSP00000332656:p.Met57Thr			Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Metalloenzyme,superfamily_Alkaline_phosphatase_core	p.M57T	ENST00000328313.5	37	c.170	CCDS11763.1	17	.	.	.	.	.	.	.	.	.	.	T	14.41	2.525941	0.44969	.	.	ENSG00000182156	ENST00000328313	T	0.73469	-0.75	4.64	3.54	0.40534	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.044638	0.85682	D	0.000000	T	0.76681	0.4021	M	0.84326	2.69	0.58432	D	0.999995	B	0.20459	0.045	B	0.30572	0.117	T	0.74922	-0.3499	10	0.87932	D	0	-44.0113	10.2897	0.43588	0.1482:0.0:0.0:0.8518	.	57	Q6UWV6	ENPP7_HUMAN	T	57	ENSP00000332656:M57T	ENSP00000332656:M57T	M	+	2	0	ENPP7	75319666	1.000000	0.71417	0.998000	0.56505	0.892000	0.51952	2.130000	0.42064	0.764000	0.33197	0.459000	0.35465	ATG	ENPP7	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000182156		0.622	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ENPP7	HGNC	protein_coding	OTTHUMT00000437038.1	33	0.00	0	T	NM_178543		77705071	77705071	+1	no_errors	ENST00000328313	ensembl	human	known	69_37n	missense	87	28.10	34	SNP	1.000	C
F5	2153	genome.wustl.edu	37	1	169541502	169541502	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:169541502C>G	ENST00000367797.3	-	3	531	c.330G>C	c.(328-330)ttG>ttC	p.L110F	F5_ENST00000367796.3_Missense_Mutation_p.L110F|F5_ENST00000546081.1_5'UTR	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	110	F5/8 type A 1.|Plastocyanin-like 1.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GATGGATGCTCAAGGGCTTAT	0.328																																						dbGAP											0													68.0	70.0	69.0					1																	169541502		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.330G>C	1.37:g.169541502C>G	ENSP00000356771:p.Leu110Phe		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.L110F	ENST00000367797.3	37	c.330	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703753	0.48412	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.98901	-5.22;-5.22	5.35	1.8	0.24995	Cupredoxin (2);Multicopper oxidase, type 3 (1);	1.060450	0.07250	N	0.865809	D	0.97445	0.9164	L	0.42245	1.32	0.80722	D	1	D	0.63880	0.993	D	0.65874	0.939	D	0.93393	0.6753	10	0.39692	T	0.17	-2.5766	7.0613	0.25127	0.0:0.3508:0.0:0.6492	.	110	P12259	FA5_HUMAN	F	110	ENSP00000356771:L110F;ENSP00000356770:L110F	ENSP00000356770:L110F	L	-	3	2	F5	167808126	0.986000	0.35501	0.986000	0.45419	0.972000	0.66771	0.260000	0.18424	0.335000	0.23614	-0.414000	0.06135	TTG	F5	-	pfam_Cu-oxidase_3,superfamily_Cupredoxin	ENSG00000198734		0.328	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	101	0.00	0	C	NM_000130		169541502	169541502	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	missense	146	24.35	47	SNP	0.991	G
EXO1	9156	genome.wustl.edu	37	1	242030258	242030258	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:242030258T>G	ENST00000366548.3	+	11	1761	c.1168T>G	c.(1168-1170)Ttg>Gtg	p.L390V	EXO1_ENST00000518483.1_Missense_Mutation_p.L390V|EXO1_ENST00000348581.5_Missense_Mutation_p.L390V	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	390	Interaction with MLH1.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			TGCCCCACAATTGAAGGAAAA	0.428								Editing and processing nucleases																														dbGAP											0													104.0	95.0	98.0					1																	242030258		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.1168T>G	1.37:g.242030258T>G	ENSP00000355506:p.Leu390Val		O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Missense_Mutation	SNP	pfam_XPG/RAD2_endonuclease,pfam_XPG_DNA_repair_N,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG/RAD2_endonuclease,smart_HhH2,prints_XPGC_Rad_DNA_repair	p.L390V	ENST00000366548.3	37	c.1168	CCDS1620.1	1	.	.	.	.	.	.	.	.	.	.	T	4.461	0.085389	0.08583	.	.	ENSG00000174371	ENST00000366548;ENST00000348581;ENST00000518483	T;T;T	0.37752	1.25;1.25;1.18	5.75	-5.55	0.02536	.	0.862057	0.10114	N	0.714296	T	0.23289	0.0563	L	0.43701	1.375	0.09310	N	1	B;B;B	0.16166	0.009;0.016;0.009	B;B;B	0.16289	0.006;0.015;0.006	T	0.34453	-0.9828	10	0.14252	T	0.57	-4.1765	9.3325	0.38030	0.0:0.4752:0.1168:0.408	.	390;390;390	A8K5H6;Q9UQ84-4;Q9UQ84	.;.;EXO1_HUMAN	V	390	ENSP00000355506:L390V;ENSP00000311873:L390V;ENSP00000430251:L390V	ENSP00000311873:L390V	L	+	1	2	EXO1	240096881	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.262000	0.02852	-1.145000	0.02858	0.533000	0.62120	TTG	EXO1	-	NULL	ENSG00000174371		0.428	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXO1	HGNC	protein_coding	OTTHUMT00000096405.1	170	0.00	0	T	NM_006027		242030258	242030258	+1	no_errors	ENST00000348581	ensembl	human	known	69_37n	missense	278	27.42	105	SNP	0.000	G
FAM98A	25940	genome.wustl.edu	37	2	33810243	33810243	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr2:33810243C>G	ENST00000238823.8	-	8	1297	c.1157G>C	c.(1156-1158)gGa>gCa	p.G386A	FAM98A_ENST00000441530.2_Missense_Mutation_p.G191A|FAM98A_ENST00000403368.1_3'UTR|FAM98A_ENST00000498340.1_5'Flank			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	387	Gly-rich.						poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					ACCACTCCCTCCATCTGTCCA	0.567																																						dbGAP											0													261.0	218.0	233.0					2																	33810243		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.1157G>C	2.37:g.33810243C>G	ENSP00000238823:p.Gly386Ala		B2RNA2|Q9Y3Y6	Missense_Mutation	SNP	pfam_Uncharacterised_FAM98	p.G386A	ENST00000238823.8	37	c.1157	CCDS33179.1	2	.	.	.	.	.	.	.	.	.	.	C	14.47	2.545072	0.45280	.	.	ENSG00000119812	ENST00000238823;ENST00000395190;ENST00000441530	T;D	0.90676	0.8;-2.71	5.4	5.4	0.78164	.	0.303968	0.29775	N	0.011222	D	0.85579	0.5729	N	0.08118	0	0.80722	D	1	P;P;P;P	0.52842	0.956;0.956;0.93;0.956	P;P;P;P	0.47102	0.47;0.47;0.537;0.47	D	0.88270	0.2929	10	0.54805	T	0.06	-9.5366	19.1748	0.93600	0.0:1.0:0.0:0.0	.	387;217;386;224	Q8NCA5;B4DY25;Q8NCA5-2;B3KTW4	FA98A_HUMAN;.;.;.	A	386;387;191	ENSP00000238823:G386A;ENSP00000408716:G191A	ENSP00000238823:G386A	G	-	2	0	FAM98A	33663747	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	3.539000	0.53604	2.532000	0.85374	0.313000	0.20887	GGA	FAM98A	-	NULL	ENSG00000119812		0.567	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM98A	HGNC	protein_coding	OTTHUMT00000325457.2	394	0.00	0	C	NM_015475		33810243	33810243	-1	no_errors	ENST00000238823	ensembl	human	known	69_37n	missense	329	41.98	238	SNP	1.000	G
FCRL5	83416	genome.wustl.edu	37	1	157512676	157512676	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:157512676T>A	ENST00000361835.3	-	6	1253	c.1096A>T	c.(1096-1098)Agt>Tgt	p.S366C	FCRL5_ENST00000368191.3_Missense_Mutation_p.S281C|FCRL5_ENST00000368190.3_Missense_Mutation_p.S366C|FCRL5_ENST00000356953.4_Missense_Mutation_p.S366C|FCRL5_ENST00000368189.3_Missense_Mutation_p.S366C	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	366	Ig-like C2-type 3.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				ACAGCCTTACTGGGCTTGGCG	0.567																																						dbGAP											0													128.0	123.0	124.0					1																	157512676		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1096A>T	1.37:g.157512676T>A	ENSP00000354691:p.Ser366Cys		A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S366C	ENST00000361835.3	37	c.1096	CCDS1165.1	1	.	.	.	.	.	.	.	.	.	.	T	14.44	2.536046	0.45176	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191;ENST00000368189	T;T;T;T;T	0.07216	3.21;3.21;3.21;3.21;3.21	3.05	3.05	0.35203	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.21801	0.0525	M	0.94101	3.495	0.27707	N	0.945603	D;D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;1.0;1.0	D;P;P;D;D;D	0.97110	0.995;0.904;0.893;0.979;0.993;1.0	T	0.06679	-1.0813	9	0.52906	T	0.07	.	7.7716	0.29012	0.0:0.0:0.0:1.0	.	397;281;366;366;366;366	B4DW39;F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9-4;Q96RD9	.;.;.;.;.;FCRL5_HUMAN	C	366;366;366;281;366	ENSP00000354691:S366C;ENSP00000349434:S366C;ENSP00000357173:S366C;ENSP00000357174:S281C;ENSP00000357172:S366C	ENSP00000349434:S366C	S	-	1	0	FCRL5	155779300	0.330000	0.24705	0.008000	0.14137	0.014000	0.08584	2.959000	0.49153	1.381000	0.46364	0.260000	0.18958	AGT	FCRL5	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000143297		0.567	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	103	0.00	0	T	NM_031281		157512676	157512676	-1	no_errors	ENST00000356953	ensembl	human	known	69_37n	missense	155	23.65	48	SNP	0.017	A
GABRA4	2557	genome.wustl.edu	37	4	46973128	46973128	+	Silent	SNP	T	T	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr4:46973128T>C	ENST00000264318.3	-	7	1828	c.846A>G	c.(844-846)aaA>aaG	p.K282K		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	282					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	GAACTGATTCTTTATTTATCC	0.343																																					Ovarian(6;283 369 8234 12290 33402)	dbGAP											0													61.0	60.0	60.0					4																	46973128		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.846A>G	4.37:g.46973128T>C			Q8IYR7	Silent	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABBAa4_rcpt,prints_GABAA_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.K282	ENST00000264318.3	37	c.846	CCDS3473.1	4																																																																																			GABRA4	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000109158		0.343	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA4	HGNC	protein_coding	OTTHUMT00000216893.1	168	0.00	0	T			46973128	46973128	-1	no_errors	ENST00000264318	ensembl	human	known	69_37n	silent	57	52.89	64	SNP	0.998	C
GLIS1	148979	genome.wustl.edu	37	1	54059934	54059934	+	Silent	SNP	C	C	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:54059934C>T	ENST00000312233.2	-	3	1208	c.642G>A	c.(640-642)cgG>cgA	p.R214R		NM_147193.2	NP_671726.2			GLIS family zinc finger 1											endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						TCTCGATGTGCCGCACCAGCT	0.687																																						dbGAP											0													80.0	59.0	66.0					1																	54059934		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.642G>A	1.37:g.54059934C>T				Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R214	ENST00000312233.2	37	c.642	CCDS582.1	1																																																																																			GLIS1	-	smart_Znf_C2H2-like	ENSG00000174332		0.687	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS1	HGNC	protein_coding	OTTHUMT00000022109.1	19	0.00	0	C	NM_147193		54059934	54059934	-1	no_errors	ENST00000312233	ensembl	human	known	69_37n	silent	12	70.73	29	SNP	1.000	T
GNPTAB	79158	genome.wustl.edu	37	12	102159023	102159023	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr12:102159023G>C	ENST00000299314.7	-	13	1934	c.1672C>G	c.(1672-1674)Cca>Gca	p.P558A	RNU6-101P_ENST00000410323.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	558					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						TCACCTTTTGGAATAATATAG	0.358																																						dbGAP											0													112.0	110.0	111.0					12																	102159023		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.1672C>G	12.37:g.102159023G>C	ENSP00000299314:p.Pro558Ala		A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	pfam_DMAP1-bd,pfam_Notch_dom,pfam_DUF3184,superfamily_Notch_dom,smart_Notch_dom,pfscan_EF_HAND_2,pfscan_Notch_dom	p.P558A	ENST00000299314.7	37	c.1672	CCDS9088.1	12	.	.	.	.	.	.	.	.	.	.	G	22.6	4.306276	0.81247	.	.	ENSG00000111670	ENST00000299314	D	0.97138	-4.26	5.96	5.08	0.68730	.	0.000000	0.85682	D	0.000000	D	0.96969	0.9010	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.65684	0.937	D	0.97839	1.0267	10	0.72032	D	0.01	-16.2415	15.2943	0.73891	0.0669:0.0:0.9331:0.0	.	558	Q3T906	GNPTA_HUMAN	A	558	ENSP00000299314:P558A	ENSP00000299314:P558A	P	-	1	0	GNPTAB	100683154	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.230000	0.95299	1.536000	0.49237	0.655000	0.94253	CCA	GNPTAB	-	NULL	ENSG00000111670		0.358	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	HGNC	protein_coding	OTTHUMT00000409182.1	156	0.00	0	G			102159023	102159023	-1	no_errors	ENST00000299314	ensembl	human	known	69_37n	missense	102	43.33	78	SNP	1.000	C
GOLGA6D	653643	genome.wustl.edu	37	15	75580671	75580671	+	Missense_Mutation	SNP	G	G	C	rs201109551	byFrequency	TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr15:75580671G>C	ENST00000434739.3	+	7	571	c.530G>C	c.(529-531)tGt>tCt	p.C177S		NM_001145224.1	NP_001138696.1	P0CG33	GOG6D_HUMAN	golgin A6 family, member D	177						Golgi apparatus (GO:0005794)				kidney(1)|lung(1)	2						CGGGCTCTCTGTGCTGTGTCT	0.557																																						dbGAP											0													14.0	14.0	14.0					15																	75580671		681	1577	2258	-	-	-	SO:0001583	missense	0				CCDS45308.1	15q24.2	2013-05-10	2010-02-12	2009-09-04	ENSG00000140478	ENSG00000140478			32204	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6D"""				Standard	NM_001145224		Approved		uc010uma.2	P0CG33	OTTHUMG00000172672	ENST00000434739.3:c.530G>C	15.37:g.75580671G>C	ENSP00000391085:p.Cys177Ser			Missense_Mutation	SNP	NULL	p.C177S	ENST00000434739.3	37	c.530	CCDS45308.1	15	.	.	.	.	.	.	.	.	.	.	-	0.008	-1.914881	0.00503	.	.	ENSG00000140478	ENST00000434739	T	0.06371	3.31	1.57	0.589	0.17452	.	.	.	.	.	T	0.01353	0.0044	N	0.00382	-1.575	0.20307	N	0.999918	B	0.06786	0.001	B	0.04013	0.001	T	0.45963	-0.9225	9	0.02654	T	1	.	7.744	0.28858	0.0:0.7322:0.2678:0.0	.	177	P0CG33	GOG6D_HUMAN	S	177	ENSP00000391085:C177S	ENSP00000391085:C177S	C	+	2	0	GOLGA6D	73367724	0.991000	0.36638	0.005000	0.12908	0.131000	0.20780	3.167000	0.50793	0.233000	0.21120	-1.252000	0.01501	TGT	GOLGA6D	-	NULL	ENSG00000140478		0.557	GOLGA6D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6D	HGNC	protein_coding	OTTHUMT00000419798.1	23	0.00	0	G	NM_001145224		75580671	75580671	+1	no_errors	ENST00000434739	ensembl	human	known	69_37n	missense	4	50.00	4	SNP	0.999	C
GON4L	54856	genome.wustl.edu	37	1	155744795	155744795	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:155744795G>C	ENST00000368331.1	-	17	2396	c.2348C>G	c.(2347-2349)aCt>aGt	p.T783S	GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000437809.1_Missense_Mutation_p.T783S|GON4L_ENST00000271883.5_Missense_Mutation_p.T783S|GON4L_ENST00000361040.5_Missense_Mutation_p.T783S	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	783					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCTCCTACCAGTCTTCTTGAC	0.448																																						dbGAP											0													25.0	25.0	25.0					1																	155744795		2202	4281	6483	-	-	-	SO:0001583	missense	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.2348C>G	1.37:g.155744795G>C	ENSP00000357315:p.Thr783Ser		B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	pfam_PAH,superfamily_PAH,superfamily_Homeodomain-like,pfscan_Myb-like_dom	p.T783S	ENST00000368331.1	37	c.2348		1	.	.	.	.	.	.	.	.	.	.	G	7.768	0.706777	0.15239	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883;ENST00000539959;ENST00000361040;ENST00000368327	T;T;T;T	0.11821	2.93;2.93;2.93;2.74	4.57	2.53	0.30540	.	0.567811	0.17626	N	0.167578	T	0.02267	0.0070	N	0.22421	0.69	0.29221	N	0.873945	B;B;B;B;B	0.24043	0.0;0.009;0.012;0.058;0.096	B;B;B;B;B	0.22753	0.004;0.015;0.041;0.012;0.028	T	0.45512	-0.9256	10	0.15952	T	0.53	.	6.3978	0.21622	0.0:0.2519:0.4417:0.3063	.	563;783;783;783;783	Q6PHZ4;A4PB68;Q3T8J9-2;Q3T8J9;Q3T8J9-3	.;.;.;GON4L_HUMAN;.	S	783;783;783;783;783;233	ENSP00000396117:T783S;ENSP00000357315:T783S;ENSP00000271883:T783S;ENSP00000354322:T783S	ENSP00000271883:T783S	T	-	2	0	GON4L	154011419	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	0.835000	0.27531	1.104000	0.41587	0.484000	0.47621	ACT	GON4L	-	NULL	ENSG00000116580		0.448	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		144	0.00	0	G	NM_032292		155744795	155744795	-1	no_errors	ENST00000368331	ensembl	human	known	69_37n	missense	215	26.87	79	SNP	0.990	C
GRIN2B	2904	genome.wustl.edu	37	12	13768083	13768083	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr12:13768083C>T	ENST00000609686.1	-	7	1828	c.1619G>A	c.(1618-1620)cGc>cAc	p.R540H		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	540					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCCATTGCTGCGTGACACCAT	0.493																																						dbGAP											0													191.0	149.0	163.0					12																	13768083		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1619G>A	12.37:g.13768083C>T	ENSP00000477455:p.Arg540His		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R540H	ENST00000609686.1	37	c.1619	CCDS8662.1	12	.	.	.	.	.	.	.	.	.	.	C	29.6	5.020182	0.93462	.	.	ENSG00000150086	ENST00000279593	T	0.28255	1.62	6.17	6.17	0.99709	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.63070	0.2480	M	0.87617	2.895	0.80722	D	1	D	0.76494	0.999	D	0.65233	0.933	T	0.66296	-0.5959	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	540	Q13224	NMDE2_HUMAN	H	540	ENSP00000279593:R540H	ENSP00000279593:R540H	R	-	2	0	GRIN2B	13659350	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.813000	0.86123	2.941000	0.99782	0.655000	0.94253	CGC	GRIN2B	-	pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000150086		0.493	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2B	HGNC	protein_coding	OTTHUMT00000268014.2	171	0.00	0	C			13768083	13768083	-1	no_errors	ENST00000279593	ensembl	human	known	69_37n	missense	102	37.80	62	SNP	1.000	T
IL1RAPL2	26280	genome.wustl.edu	37	X	104961445	104961445	+	Silent	SNP	G	G	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chrX:104961445G>A	ENST00000372582.1	+	7	1614	c.858G>A	c.(856-858)aaG>aaA	p.K286K	IL1RAPL2_ENST00000344799.4_Silent_p.K286K	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	286	Ig-like C2-type 3.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AAGGAGAAAAGTTTATTGAAG	0.433																																						dbGAP											0													171.0	160.0	164.0					X																	104961445		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.858G>A	X.37:g.104961445G>A			Q2M3U3|Q9NZN0	Silent	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1,prints_Interleukin-1_rcpt_II	p.K286	ENST00000372582.1	37	c.858	CCDS14517.1	X																																																																																			IL1RAPL2	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000189108		0.433	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL2	HGNC	protein_coding	OTTHUMT00000057785.1	560	0.00	0	G	NM_017416		104961445	104961445	+1	no_errors	ENST00000344799	ensembl	human	known	69_37n	silent	276	26.84	102	SNP	1.000	A
IPO9	55705	genome.wustl.edu	37	1	201798352	201798352	+	Silent	SNP	G	G	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:201798352G>A	ENST00000361565.4	+	1	84	c.15G>A	c.(13-15)gcG>gcA	p.A5A	IPO9-AS1_ENST00000413035.1_RNA|IPO9-AS1_ENST00000421449.1_RNA|IPO9-AS1_ENST00000421159.1_RNA|IPO9_ENST00000464348.1_3'UTR	NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	5					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						CGGCGGCGGCGGCAGCTGGTG	0.706																																						dbGAP											0													6.0	8.0	7.0					1																	201798352		2097	4128	6225	-	-	-	SO:0001819	synonymous_variant	0			AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.15G>A	1.37:g.201798352G>A			B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Silent	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.A5	ENST00000361565.4	37	c.15	CCDS1415.1	1																																																																																			IPO9	-	NULL	ENSG00000198700		0.706	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO9	HGNC	protein_coding	OTTHUMT00000087088.1	16	0.00	0	G	NM_018085		201798352	201798352	+1	no_errors	ENST00000361565	ensembl	human	known	69_37n	silent	37	28.85	15	SNP	0.994	A
ITGB4	3691	genome.wustl.edu	37	17	73738675	73738675	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr17:73738675T>A	ENST00000200181.3	+	25	2982	c.2795T>A	c.(2794-2796)aTg>aAg	p.M932K	ITGB4_ENST00000450894.3_Missense_Mutation_p.M932K|ITGB4_ENST00000449880.2_Missense_Mutation_p.M932K|ITGB4_ENST00000579662.1_Missense_Mutation_p.M932K|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000339591.3_Missense_Mutation_p.M932K	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	932					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCCCGGGGCATGGTGGAGTTC	0.682																																						dbGAP											0													55.0	48.0	50.0					17																	73738675		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.2795T>A	17.37:g.73738675T>A	ENSP00000200181:p.Met932Lys		A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	pirsf_Integrin_bsu-4,pfam_Integrin_bsu_N,pfam_Fibronectin_type3,pfam_Calx_beta,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Fibronectin_type3,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,smart_Calx_beta,smart_Fibronectin_type3,pfscan_Fibronectin_type3,prints_Integrin_bsu	p.M932K	ENST00000200181.3	37	c.2795	CCDS11727.1	17	.	.	.	.	.	.	.	.	.	.	T	13.81	2.347239	0.41599	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.74526	-0.85;-0.8;-0.8	5.52	5.52	0.82312	.	0.114616	0.64402	D	0.000011	T	0.66528	0.2798	N	0.19112	0.55	0.41066	D	0.985416	P;P;P	0.49961	0.929;0.93;0.883	B;B;P	0.45428	0.399;0.225;0.48	T	0.73307	-0.4024	10	0.87932	D	0	.	15.6342	0.76937	0.0:0.0:0.0:1.0	.	932;932;932	P16144-3;A0AVL6;P16144	.;.;ITB4_HUMAN	K	932	ENSP00000200181:M932K;ENSP00000344079:M932K;ENSP00000400217:M932K	ENSP00000200181:M932K	M	+	2	0	ITGB4	71250270	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.073000	0.57570	2.117000	0.64856	0.533000	0.62120	ATG	ITGB4	-	pirsf_Integrin_bsu-4	ENSG00000132470		0.682	ITGB4-001	KNOWN	basic|CCDS	protein_coding	ITGB4	HGNC	protein_coding	OTTHUMT00000448334.1	21	0.00	0	T			73738675	73738675	+1	no_errors	ENST00000200181	ensembl	human	known	69_37n	missense	31	31.11	14	SNP	1.000	A
ITGB5	3693	genome.wustl.edu	37	3	124567323	124567323	+	Silent	SNP	C	C	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr3:124567323C>G	ENST00000296181.4	-	4	740	c.444G>C	c.(442-444)ctG>ctC	p.L148L		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	148	VWFA.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		CCTTCATGGACAGGGAGAGGT	0.557																																						dbGAP											0													122.0	105.0	111.0					3																	124567323		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.444G>C	3.37:g.124567323C>G			B0LPF8|B2RD70	Silent	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,smart_VWF_A,prints_Integrin_bsu	p.L148	ENST00000296181.4	37	c.444	CCDS3030.1	3																																																																																			ITGB5	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N,smart_VWF_A,prints_Integrin_bsu	ENSG00000082781		0.557	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB5	HGNC	protein_coding	OTTHUMT00000355286.3	123	0.00	0	C	NM_002213		124567323	124567323	-1	no_errors	ENST00000296181	ensembl	human	known	69_37n	silent	151	30.73	67	SNP	1.000	G
KATNB1	10300	genome.wustl.edu	37	16	57775730	57775730	+	Splice_Site	SNP	G	G	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr16:57775730G>A	ENST00000379661.3	+	3	563		c.e3+1			NM_005886.2	NP_005877.2			katanin p80 (WD repeat containing) subunit B 1											cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_neural(199;0.223)				CTGCATCATGGTGAGCCCCGA	0.647																																						dbGAP											0													29.0	27.0	28.0					16																	57775730		2198	4300	6498	-	-	-	SO:0001630	splice_region_variant	0			AF052432	CCDS10788.1	16q12.2	2013-01-09	2003-03-13		ENSG00000140854	ENSG00000140854		"""WD repeat domain containing"""	6217	protein-coding gene	gene with protein product		602703	"""katanin p80 (WD40-containing) subunit B 1"""			9568719	Standard	XM_006721121		Approved		uc002eml.1	Q9BVA0	OTTHUMG00000133467	ENST00000379661.3:c.171+1G>A	16.37:g.57775730G>A				Splice_Site	SNP	-	e2+1	ENST00000379661.3	37	c.171+1	CCDS10788.1	16	.	.	.	.	.	.	.	.	.	.	G	23.9	4.465024	0.84425	.	.	ENSG00000140854	ENST00000379661	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6626	0.85245	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KATNB1	56333231	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.480000	0.97931	2.263000	0.75096	0.655000	0.94253	.	KATNB1	-	-	ENSG00000140854		0.647	KATNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KATNB1	HGNC	protein_coding	OTTHUMT00000257343.3	35	0.00	0	G		Intron	57775730	57775730	+1	no_errors	ENST00000379661	ensembl	human	known	69_37n	splice_site	24	48.94	23	SNP	1.000	A
KIAA0226	9711	genome.wustl.edu	37	3	197427914	197427915	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr3:197427914_197427915insG	ENST00000296343.5	-	7	829_830	c.830_831insC	c.(829-831)ccafs	p.P277fs	KIAA0226_ENST00000389665.5_Frame_Shift_Ins_p.P277fs|KIAA0226_ENST00000449205.1_Frame_Shift_Ins_p.P277fs|KIAA0226_ENST00000467303.1_5'Flank|KIAA0226_ENST00000273582.5_Frame_Shift_Ins_p.P217fs	NM_014687.1	NP_055502.1	Q92622	RUBIC_HUMAN	KIAA0226	277	Ser-rich.				autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)|negative regulation of autophagy (GO:0010507)|negative regulation of endocytosis (GO:0045806)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)				NS(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		AGACTGAAACTGGGGGGGCTTG	0.554																																					Esophageal Squamous(3;167 355 3763 15924)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			D86979	CCDS43195.1, CCDS46987.1	3q29	2011-08-09			ENSG00000145016	ENSG00000145016			28991	protein-coding gene	gene with protein product	"""RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein"""	613516				9039502, 19270693, 20826435	Standard	XM_005269374		Approved	rubicon, rundataxin	uc003fyc.2	Q92622	OTTHUMG00000155452	ENST00000296343.5:c.831dupC	3.37:g.197427921_197427921dupG	ENSP00000296343:p.Pro277fs		Q96CK5	Frame_Shift_Ins	INS	pfam_Run,smart_Run,pfscan_Run	p.V278fs	ENST00000296343.5	37	c.831_830	CCDS43195.1	3																																																																																			KIAA0226	-	NULL	ENSG00000145016		0.554	KIAA0226-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0226	HGNC	protein_coding	OTTHUMT00000340184.1	38	0.00	0	-	XM_032901		197427914	197427915	-1	no_errors	ENST00000296343	ensembl	human	known	69_37n	frame_shift_ins	41	10.87	5	INS	0.000:0.000	G
ICE1	23379	genome.wustl.edu	37	5	5464610	5464610	+	Silent	SNP	G	G	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr5:5464610G>A	ENST00000296564.7	+	13	5385	c.5163G>A	c.(5161-5163)ccG>ccA	p.P1721P		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1721	Pro-rich.				positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						CGGCCACGCCGAAGCACGCAC	0.602																																						dbGAP											0													56.0	57.0	57.0					5																	5464610		2085	4218	6303	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000296564.7:c.5163G>A	5.37:g.5464610G>A			Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Silent	SNP	superfamily_Vitellinogen_superhlx	p.P1721	ENST00000296564.7	37	c.5163	CCDS47187.1	5																																																																																			KIAA0947	-	NULL	ENSG00000164151		0.602	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	47	0.00	0	G			5464610	5464610	+1	no_errors	ENST00000296564	ensembl	human	known	69_37n	silent	3	85.71	18	SNP	0.413	A
KIF7	374654	genome.wustl.edu	37	15	90190208	90190209	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr15:90190208_90190209insC	ENST00000394412.3	-	7	1716_1717	c.1640_1641insG	c.(1639-1641)ggcfs	p.G547fs		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	547	Sufficient for interaction with NPHP1.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			GGAGCCGCGGGCCCCCCCAGCC	0.693											OREG0023460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.1641dupG	15.37:g.90190215_90190215dupC	ENSP00000377934:p.Gly547fs	1273	Q3SXY0|Q6UXE9|Q8IW72	Frame_Shift_Ins	INS	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R549fs	ENST00000394412.3	37	c.1641_1640	CCDS32325.2	15																																																																																			KIF7	-	NULL	ENSG00000166813		0.693	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF7	HGNC	protein_coding	OTTHUMT00000347782.1	36	0.00	0	-	NM_198525		90190208	90190209	-1	no_errors	ENST00000394412	ensembl	human	known	69_37n	frame_shift_ins	26	13.33	4	INS	0.002:0.000	C
KLHL38	340359	genome.wustl.edu	37	8	124664078	124664078	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr8:124664078C>G	ENST00000325995.7	-	1	1112	c.1089G>C	c.(1087-1089)tgG>tgC	p.W363C	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	363										breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						CCCCCAGCCTCCACTGATTGA	0.577																																						dbGAP											0													62.0	64.0	63.0					8																	124664078		2018	4190	6208	-	-	-	SO:0001583	missense	0				CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.1089G>C	8.37:g.124664078C>G	ENSP00000321475:p.Trp363Cys		A0PK12	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.W363C	ENST00000325995.7	37	c.1089	CCDS43766.1	8	.	.	.	.	.	.	.	.	.	.	C	17.88	3.496168	0.64186	.	.	ENSG00000175946	ENST00000325995	T	0.79352	-1.26	5.18	5.18	0.71444	Kelch-type beta propeller (1);	0.107851	0.64402	D	0.000002	D	0.90601	0.7053	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92323	0.5867	10	0.87932	D	0	.	19.0609	0.93093	0.0:1.0:0.0:0.0	.	363	Q2WGJ6	KLH38_HUMAN	C	363	ENSP00000321475:W363C	ENSP00000321475:W363C	W	-	3	0	KLHL38	124733259	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.729000	0.84864	2.571000	0.86741	0.561000	0.74099	TGG	KLHL38	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000175946		0.577	KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL38	HGNC	protein_coding	OTTHUMT00000381288.1	94	0.00	0	C			124664078	124664078	-1	no_errors	ENST00000325995	ensembl	human	known	69_37n	missense	120	28.14	47	SNP	1.000	G
LCA5L	150082	genome.wustl.edu	37	21	40794925	40794925	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr21:40794925C>A	ENST00000358268.2	-	5	1342	c.814G>T	c.(814-816)Gac>Tac	p.D272Y	LCA5L_ENST00000485895.2_Missense_Mutation_p.D272Y|LCA5L_ENST00000288350.3_Missense_Mutation_p.D272Y|LCA5L_ENST00000380671.2_Missense_Mutation_p.D272Y			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	272										breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				TCATTTGCGTCCATTTTTGTT	0.373																																						dbGAP											0													128.0	128.0	128.0					21																	40794925		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.814G>T	21.37:g.40794925C>A	ENSP00000351008:p.Asp272Tyr		D3DSI0|Q3ZCT0	Missense_Mutation	SNP	NULL	p.D272Y	ENST00000358268.2	37	c.814	CCDS13665.1	21	.	.	.	.	.	.	.	.	.	.	C	16.46	3.130034	0.56721	.	.	ENSG00000157578	ENST00000288350;ENST00000380671;ENST00000358268	T;T;T	0.77489	-1.1;-1.1;-1.1	5.05	5.05	0.67936	.	0.139070	0.48286	D	0.000181	T	0.70422	0.3222	L	0.29908	0.895	0.29531	N	0.852792	B	0.29085	0.232	B	0.27887	0.084	T	0.70784	-0.4778	10	0.87932	D	0	-24.208	18.7961	0.91994	0.0:1.0:0.0:0.0	.	272	O95447	LCA5L_HUMAN	Y	272	ENSP00000288350:D272Y;ENSP00000370046:D272Y;ENSP00000351008:D272Y	ENSP00000288350:D272Y	D	-	1	0	LCA5L	39716795	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.232000	0.65332	2.512000	0.84698	0.650000	0.86243	GAC	LCA5L	-	NULL	ENSG00000157578		0.373	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LCA5L	HGNC	protein_coding	OTTHUMT00000141807.2	114	0.00	0	C	NM_152505		40794925	40794925	-1	no_errors	ENST00000288350	ensembl	human	known	69_37n	missense	61	47.86	56	SNP	1.000	A
KRTAP10-11	386678	genome.wustl.edu	37	21	46066670	46066670	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr21:46066670T>G	ENST00000334670.8	+	1	340	c.295T>G	c.(295-297)Tgc>Ggc	p.C99G	TSPEAR_ENST00000323084.4_Intron	NM_198692.2	NP_941965.2	P60412	KR10B_HUMAN	keratin associated protein 10-11	99	25 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	12						ccagcaggcctgctgtgtgcc	0.647																																						dbGAP											0													96.0	99.0	98.0					21																	46066670		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB076359	CCDS42962.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000243489	ENSG00000243489		"""Keratin associated proteins"""	20528	protein-coding gene	gene with protein product			"""keratin associated protein 10-11"""	KRTAP18-11			Standard	NM_198692		Approved	KRTAP18.11, KAP18.11, KAP10.11	uc002zfr.4	P60412	OTTHUMG00000057626	ENST00000334670.8:c.295T>G	21.37:g.46066670T>G	ENSP00000334197:p.Cys99Gly		A2RRF9	Missense_Mutation	SNP	NULL	p.C99G	ENST00000334670.8	37	c.295	CCDS42962.1	21	.	.	.	.	.	.	.	.	.	.	t	4.898	0.166862	0.09339	.	.	ENSG00000243489	ENST00000334670	T	0.00976	5.48	3.37	2.14	0.27477	.	.	.	.	.	T	0.03053	0.0090	H	0.98701	4.305	0.24382	N	0.994782	P	0.43826	0.818	B	0.36289	0.221	T	0.39502	-0.9611	9	0.87932	D	0	.	2.8211	0.05471	0.2224:0.1259:0.0:0.6517	.	99	P60412	KR10B_HUMAN	G	99	ENSP00000334197:C99G	ENSP00000334197:C99G	C	+	1	0	KRTAP10-11	44891098	0.997000	0.39634	0.023000	0.16930	0.072000	0.16883	1.998000	0.40796	0.297000	0.22615	0.374000	0.22700	TGC	KRTAP10-11	-	NULL	ENSG00000243489		0.647	KRTAP10-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-11	HGNC	protein_coding	OTTHUMT00000128029.1	150	0.00	0	T	NM_198692		46066670	46066670	+1	no_errors	ENST00000334670	ensembl	human	known	69_37n	missense	120	39.09	77	SNP	0.874	G
LRBA	987	genome.wustl.edu	37	4	151223890	151223890	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr4:151223890C>T	ENST00000357115.3	-	54	8180	c.7937G>A	c.(7936-7938)cGt>cAt	p.R2646H	LRBA_ENST00000503716.1_5'UTR|LRBA_ENST00000510413.1_Missense_Mutation_p.R2635H|LRBA_ENST00000535741.1_Missense_Mutation_p.R2635H	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2646						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R2646L(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TGACTCAGAACGAGCAAGGCA	0.393																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											156.0	141.0	146.0					4																	151223890		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.7937G>A	4.37:g.151223890C>T	ENSP00000349629:p.Arg2646His		Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom	p.R2646H	ENST00000357115.3	37	c.7937	CCDS3773.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.4|26.4	4.735418|4.735418	0.89482|0.89482	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115|ENST00000509835	T;T;T|.	0.59906|.	0.23;0.23;0.23|.	5.78|5.78	5.78|5.78	0.91487|0.91487	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82737|0.82737	0.5102|0.5102	M|M	0.82630|0.82630	2.6|2.6	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;0.999;0.998;1.0|.	D;D;D;D|.	0.97110|.	0.998;0.996;0.92;1.0|.	T|T	0.82922|0.82922	-0.0217|-0.0217	10|5	0.54805|.	T|.	0.06|.	.|.	20.0172|20.0172	0.97481|0.97481	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2646;2635;2635;541|.	P50851;F5H1X8;P50851-2;Q68D03|.	LRBA_HUMAN;.;.;.|.	H|I	2635;2635;2646|1288	ENSP00000446299:R2635H;ENSP00000421552:R2635H;ENSP00000349629:R2646H|.	ENSP00000349629:R2646H|.	R|V	-|-	2|1	0|0	LRBA|LRBA	151443340|151443340	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	7.818000|7.818000	0.86416|0.86416	2.723000|2.723000	0.93209|0.93209	0.585000|0.585000	0.79938|0.79938	CGT|GTT	LRBA	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000198589		0.393	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	HGNC	protein_coding	OTTHUMT00000364939.1	107	0.00	0	C			151223890	151223890	-1	no_errors	ENST00000357115	ensembl	human	known	69_37n	missense	84	43.24	64	SNP	1.000	T
LSM14B	149986	genome.wustl.edu	37	20	60708435	60708435	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr20:60708435G>C	ENST00000279068.6	+	8	1236	c.1076G>C	c.(1075-1077)cGg>cCg	p.R359P	LSM14B_ENST00000253001.4_Missense_Mutation_p.R359P	NM_144703.2	NP_653304.2	Q9BX40	LS14B_HUMAN	LSM14B, SCD6 homolog B (S. cerevisiae)	359					multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)	ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|lung(4)	8	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			CGCAGTTCTCGGGGCGGATTC	0.637																																						dbGAP											0													83.0	98.0	93.0					20																	60708435		1997	4145	6142	-	-	-	SO:0001583	missense	0			AF172328	CCDS46626.1	20q13.33	2010-01-27	2006-12-21	2006-01-24	ENSG00000149657	ENSG00000149657			15887	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 40"", ""family with sequence similarity 61, member B"", ""LSM14 homolog B (SCD6, S. cerevisiae)"""	C20orf40, FAM61B			Standard	NM_144703		Approved	FT005, bA11M20.3, FLJ25473, LSM13, RAP55B	uc010gjy.1	Q9BX40	OTTHUMG00000032901	ENST00000279068.6:c.1076G>C	20.37:g.60708435G>C	ENSP00000279068:p.Arg359Pro		Q6PFW8|Q96LH8	Missense_Mutation	SNP	pfam_FDF_dom,superfamily_LSM_dom	p.R359P	ENST00000279068.6	37	c.1076	CCDS46626.1	20	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780508	0.70222	.	.	ENSG00000149657	ENST00000279068;ENST00000253001	T;T	0.58797	0.35;0.31	4.7	2.69	0.31865	.	0.000000	0.85682	D	0.000000	T	0.52468	0.1736	N	0.24115	0.695	0.44908	D	0.997923	P;D;D	0.58620	0.911;0.971;0.983	B;P;P	0.55824	0.397;0.615;0.785	T	0.52518	-0.8565	10	0.66056	D	0.02	.	7.8358	0.29369	0.0819:0.0:0.759:0.159	.	279;359;359	E9PG81;Q9BX40;Q9BX40-2	.;LS14B_HUMAN;.	P	359	ENSP00000279068:R359P;ENSP00000253001:R359P	ENSP00000253001:R359P	R	+	2	0	LSM14B	60141830	1.000000	0.71417	0.469000	0.27204	0.946000	0.59487	7.243000	0.78219	0.560000	0.29169	0.655000	0.94253	CGG	LSM14B	-	NULL	ENSG00000149657		0.637	LSM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM14B	HGNC	protein_coding	OTTHUMT00000079996.4	108	0.00	0	G	NM_144703		60708435	60708435	+1	no_errors	ENST00000253001	ensembl	human	known	69_37n	missense	15	91.21	166	SNP	0.944	C
MAPK4	5596	genome.wustl.edu	37	18	48255592	48255592	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr18:48255592G>T	ENST00000400384.2	+	6	2168	c.1132G>T	c.(1132-1134)Gta>Tta	p.V378L	MAPK4_ENST00000592595.1_3'UTR|MAPK4_ENST00000540640.1_Missense_Mutation_p.V167L	NM_002747.3	NP_002738.2	P31152	MK04_HUMAN	mitogen-activated protein kinase 4	378					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			lung(4)|skin(3)|upper_aerodigestive_tract(1)	8		Colorectal(6;0.0297)		Colorectal(21;0.156)		CGCCAGCGAGGTACAGCGCGA	0.677																																						dbGAP											0													36.0	40.0	39.0					18																	48255592		2025	4122	6147	-	-	-	SO:0001583	missense	0			X59727	CCDS42437.1	18q21.1	2012-10-02			ENSG00000141639	ENSG00000141639		"""Mitogen-activated protein kinase cascade / Kinases"""	6878	protein-coding gene	gene with protein product		176949		PRKM4		8290275	Standard	XM_005258299		Approved	Erk3-related, Erk4	uc002lev.3	P31152	OTTHUMG00000179853	ENST00000400384.2:c.1132G>T	18.37:g.48255592G>T	ENSP00000383234:p.Val378Leu		A1A4C4|Q0VG04	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_ERK3/4	p.V378L	ENST00000400384.2	37	c.1132	CCDS42437.1	18	.	.	.	.	.	.	.	.	.	.	G	32	5.134849	0.94517	.	.	ENSG00000141639	ENST00000400384;ENST00000540640	T;T	0.73789	-0.78;1.0	5.51	5.51	0.81932	.	0.000000	0.52532	D	0.000069	T	0.79149	0.4397	L	0.34521	1.04	0.80722	D	1	D	0.69078	0.997	P	0.60682	0.878	T	0.81185	-0.1048	10	0.72032	D	0.01	-21.1197	18.1863	0.89793	0.0:0.0:1.0:0.0	.	378	P31152	MK04_HUMAN	L	378;167	ENSP00000383234:V378L;ENSP00000439231:V167L	ENSP00000383234:V378L	V	+	1	0	MAPK4	46509590	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	8.288000	0.89921	2.575000	0.86900	0.561000	0.74099	GTA	MAPK4	-	NULL	ENSG00000141639		0.677	MAPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK4	HGNC	protein_coding	OTTHUMT00000448631.2	10	0.00	0	G	NM_002747		48255592	48255592	+1	no_errors	ENST00000400384	ensembl	human	known	69_37n	missense	4	60.00	6	SNP	1.000	T
MBD5	55777	genome.wustl.edu	37	2	149247300	149247300	+	Silent	SNP	T	T	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr2:149247300T>C	ENST00000407073.1	+	12	4397	c.3400T>C	c.(3400-3402)Tta>Cta	p.L1134L	MBD5_ENST00000404807.1_Silent_p.L1367L	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1134					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		TGGTGACCCATTAAATCTCTC	0.527																																						dbGAP											0													97.0	96.0	97.0					2																	149247300		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.3400T>C	2.37:g.149247300T>C			A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Silent	SNP	superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd,pfscan_PWWP	p.L1134	ENST00000407073.1	37	c.3400	CCDS33302.1	2																																																																																			MBD5	-	NULL	ENSG00000204406		0.527	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD5	HGNC	protein_coding	OTTHUMT00000318111.2	118	0.00	0	T			149247300	149247300	+1	no_errors	ENST00000407073	ensembl	human	known	69_37n	silent	89	39.04	57	SNP	0.077	C
MFI2	4241	genome.wustl.edu	37	3	196748288	196748288	+	Silent	SNP	C	C	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr3:196748288C>A	ENST00000296350.5	-	6	812	c.699G>T	c.(697-699)ctG>ctT	p.L233L	MFI2_ENST00000296351.4_Silent_p.L233L	NM_005929.5	NP_005920.2	P08582	TRFM_HUMAN	antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5	233	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of plasminogen activation (GO:0010756)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ferric iron binding (GO:0008199)|iron ion binding (GO:0005506)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(1)	20	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		CCGTGTTCTCCAGTACCGTGC	0.672																																						dbGAP											0													95.0	82.0	86.0					3																	196748288		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3325.1, CCDS3326.1	3q28-q29	2012-10-02			ENSG00000163975	ENSG00000163975		"""CD molecules"""	7037	protein-coding gene	gene with protein product	"""melanotransferrin"", ""membrane-bound transferrin-like protein"""	155750					Standard	NM_033316		Approved	CD228, FLJ38863, MAP97, MGC4856, MTF1	uc003fxk.4	P08582	OTTHUMG00000155518	ENST00000296350.5:c.699G>T	3.37:g.196748288C>A			Q9BQE2	Silent	SNP	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	p.L233	ENST00000296350.5	37	c.699	CCDS3325.1	3																																																																																			MFI2	-	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin	ENSG00000163975		0.672	MFI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MFI2	HGNC	protein_coding	OTTHUMT00000340458.1	37	0.00	0	C			196748288	196748288	-1	no_errors	ENST00000296350	ensembl	human	known	69_37n	silent	36	30.77	16	SNP	1.000	A
PRKCA	5578	genome.wustl.edu	37	17	64783222	64783222	+	Intron	SNP	G	G	C	rs570305912		TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr17:64783222G>C	ENST00000413366.3	+	15	1739				MIR634_ENST00000385208.1_RNA	NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	GCCATCGAGGGTTGGGGCTTG	0.493																																						dbGAP											0													94.0	87.0	89.0					17																	64783222		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0				CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.1713+130G>C	17.37:g.64783222G>C			B5BU22|Q15137|Q32M72|Q96RE4	RNA	SNP	-	NULL	ENST00000413366.3	37	NULL	CCDS11664.1	17																																																																																			MIR634	-	-	ENSG00000207943		0.493	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR634	HGNC	protein_coding	OTTHUMT00000446976.1	90	0.00	0	G			64783222	64783222	+1	no_errors	ENST00000385208	ensembl	human	known	69_37n	rna	150	28.91	61	SNP	0.032	C
MUC16	94025	genome.wustl.edu	37	19	9065209	9065209	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr19:9065209C>T	ENST00000397910.4	-	3	22440	c.22237G>A	c.(22237-22239)Gca>Aca	p.A7413T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7415	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGCTACTTGCTGGTAATGTG	0.512																																						dbGAP											0													82.0	81.0	81.0					19																	9065209		2020	4183	6203	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.22237G>A	19.37:g.9065209C>T	ENSP00000381008:p.Ala7413Thr		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.A7413T	ENST00000397910.4	37	c.22237	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	N	7.244	0.601773	0.13939	.	.	ENSG00000181143	ENST00000397910	T	0.21932	1.98	2.66	-2.84	0.05751	.	.	.	.	.	T	0.09512	0.0234	N	0.08118	0	.	.	.	B	0.13145	0.007	B	0.12156	0.007	T	0.26780	-1.0093	8	0.87932	D	0	.	6.6719	0.23074	0.0:0.503:0.0:0.497	.	7413	B5ME49	.	T	7413	ENSP00000381008:A7413T	ENSP00000381008:A7413T	A	-	1	0	MUC16	8926209	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.349000	0.07731	-0.430000	0.07318	-0.262000	0.10625	GCA	MUC16	-	NULL	ENSG00000181143		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	236	0.00	0	C	NM_024690		9065209	9065209	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	179	36.52	103	SNP	0.000	T
MYNN	55892	genome.wustl.edu	37	3	169500356	169500356	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr3:169500356C>T	ENST00000349841.5	+	5	1987	c.1324C>T	c.(1324-1326)Cct>Tct	p.P442S	MYNN_ENST00000392733.1_Missense_Mutation_p.P442S|MYNN_ENST00000544106.1_Missense_Mutation_p.P442S|MYNN_ENST00000356716.4_Missense_Mutation_p.P442S|RP11-362K14.5_ENST00000602342.1_RNA	NM_018657.4	NP_061127.1	Q9NPC7	MYNN_HUMAN	myoneurin	442					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			TGGAGAAAAGCCTTATGTATG	0.453																																						dbGAP											0													217.0	184.0	195.0					3																	169500356		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF148848	CCDS3207.1, CCDS54671.1	3q26.31	2013-01-09			ENSG00000085274	ENSG00000085274		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	14955	protein-coding gene	gene with protein product		606042				10873615	Standard	NM_001185118		Approved	SBBIZ1, ZBTB31, ZNF902	uc010hwo.3	Q9NPC7		ENST00000349841.5:c.1324C>T	3.37:g.169500356C>T	ENSP00000326240:p.Pro442Ser		B2R6C9|Q6QHA6|Q6QHA7|Q6R3G1|Q6R3G2|Q6R4A0|Q7Z716|Q7Z717|Q86Z11|Q86Z12|Q9NS01|Q9UIW8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.P442S	ENST00000349841.5	37	c.1324	CCDS3207.1	3	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113910	0.77210	.	.	ENSG00000085274	ENST00000356716;ENST00000349841;ENST00000392733;ENST00000544106	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	5.78	5.78	0.91487	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000001	T	0.43299	0.1241	M	0.63208	1.945	0.80722	D	1	D;D	0.89917	0.97;1.0	B;D	0.85130	0.399;0.997	T	0.17868	-1.0355	10	0.87932	D	0	.	20.0027	0.97425	0.0:1.0:0.0:0.0	.	442;442	Q9NPC7-2;Q9NPC7	.;MYNN_HUMAN	S	442	ENSP00000349150:P442S;ENSP00000326240:P442S;ENSP00000376492:P442S;ENSP00000440637:P442S	ENSP00000326240:P442S	P	+	1	0	MYNN	170983050	1.000000	0.71417	1.000000	0.80357	0.159000	0.22180	7.818000	0.86416	2.733000	0.93635	0.655000	0.94253	CCT	MYNN	-	pfscan_Znf_C2H2	ENSG00000085274		0.453	MYNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYNN	HGNC	protein_coding	OTTHUMT00000467801.1	148	0.00	0	C	NM_018657		169500356	169500356	+1	no_errors	ENST00000349841	ensembl	human	known	69_37n	missense	136	62.01	222	SNP	1.000	T
NAMPTL	646309	genome.wustl.edu	37	10	36812168	36812168	+	5'UTR	SNP	A	A	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr10:36812168A>T	ENST00000543053.1	-	0	155									nicotinamide phosphoribosyltransferase-like											biliary_tract(1)|breast(3)|lung(9)|stomach(1)	14						ATCCCCTTGAATAACTCTAAG	0.373																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					10p11.21	2013-03-27	2008-11-06	2008-11-06	ENSG00000229644	ENSG00000229644			17633	other	unknown			"""pre-B-cell colony enhancing factor 2"""	PBEF2		8289818	Standard	NG_005593		Approved	bA92J19.4			OTTHUMG00000017964	ENST00000543053.1:c.-62T>A	10.37:g.36812168A>T				Missense_Mutation	SNP	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nicotinamide_PRibTrfase	p.I332N	ENST00000543053.1	37	c.995		10	.	.	.	.	.	.	.	.	.	.	a	14.77	2.635021	0.47049	.	.	ENSG00000229644	ENST00000440465	.	.	.	1.79	1.79	0.24919	.	0.000000	0.85682	D	0.000000	T	0.62319	0.2418	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63664	-0.6586	6	0.87932	D	0	-6.4571	7.3787	0.26843	1.0:0.0:0.0:0.0	.	.	.	.	N	332	.	ENSP00000407952:I332N	I	-	2	0	NAMPTL	36852174	1.000000	0.71417	0.873000	0.34254	0.935000	0.57460	4.507000	0.60434	0.879000	0.35944	0.375000	0.23000	ATT	NAMPTL	-	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nicotinamide_PRibTrfase	ENSG00000229644		0.373	NAMPTL-201	KNOWN	basic|appris_principal	protein_coding	NAMPTL	HGNC	protein_coding		201	0.00	0	A	NG_005593		36812168	36812168	-1	no_start_codon	ENST00000440465	ensembl	human	known	69_37n	missense	133	45.04	109	SNP	1.000	T
NOS1AP	9722	genome.wustl.edu	37	1	162326813	162326813	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:162326813T>C	ENST00000361897.5	+	8	1228	c.826T>C	c.(826-828)Tcg>Ccg	p.S276P	NOS1AP_ENST00000530878.1_Missense_Mutation_p.S271P	NM_001164757.1|NM_014697.2	NP_001158229.1|NP_055512.1	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor protein	276					regulation of apoptotic process (GO:0042981)|regulation of nitric oxide biosynthetic process (GO:0045428)|regulation of nitric-oxide synthase activity (GO:0050999)		nitric-oxide synthase binding (GO:0050998)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	32	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			TTCTTCTTCCTCGAAGCCTCC	0.607																																						dbGAP											0													144.0	142.0	143.0					1																	162326813		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007933	CCDS1237.1, CCDS44267.1, CCDS53421.1	1q23.3	2010-08-20			ENSG00000198929	ENSG00000198929			16859	protein-coding gene	gene with protein product	"""C-terminal PDZ domain ligand of neuronal nitric oxide synthase"""	605551				9455484, 9459447	Standard	NM_001126060		Approved	KIAA0464, CAPON	uc001gbv.2	O75052	OTTHUMG00000024049	ENST00000361897.5:c.826T>C	1.37:g.162326813T>C	ENSP00000355133:p.Ser276Pro		B7ZLF5|O43564|Q3T551|Q5VU95	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	p.S276P	ENST00000361897.5	37	c.826	CCDS1237.1	1	.	.	.	.	.	.	.	.	.	.	T	10.32	1.318721	0.23994	.	.	ENSG00000198929	ENST00000530878;ENST00000361897	T;T	0.77750	-1.12;-1.12	4.66	1.12	0.20585	.	0.742227	0.13370	N	0.393009	T	0.32675	0.0837	N	0.17082	0.46	.	.	.	B;B;B	0.22604	0.072;0.0;0.0	B;B;B	0.18263	0.021;0.0;0.0	T	0.03249	-1.1056	9	0.29301	T	0.29	.	0.4004	0.00425	0.1806:0.2375:0.1878:0.3941	.	271;271;276	E9PSG0;B7ZLF5;O75052	.;.;CAPON_HUMAN	P	271;276	ENSP00000431586:S271P;ENSP00000355133:S276P	ENSP00000355133:S276P	S	+	1	0	NOS1AP	160593437	0.001000	0.12720	0.110000	0.21437	0.045000	0.14185	0.119000	0.15626	0.369000	0.24510	0.533000	0.62120	TCG	NOS1AP	-	NULL	ENSG00000198929		0.607	NOS1AP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NOS1AP	HGNC	protein_coding	OTTHUMT00000060555.2	35	0.00	0	T	NM_014697		162326813	162326813	+1	no_errors	ENST00000361897	ensembl	human	known	69_37n	missense	62	25.30	21	SNP	0.004	C
NUSAP1	51203	genome.wustl.edu	37	15	41650380	41650380	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr15:41650380A>G	ENST00000559596.1	+	6	671	c.584A>G	c.(583-585)gAa>gGa	p.E195G	NUSAP1_ENST00000560177.1_Missense_Mutation_p.E194G|NUSAP1_ENST00000450318.1_Missense_Mutation_p.E195G|NUSAP1_ENST00000450592.2_Missense_Mutation_p.E172G|NUSAP1_ENST00000560747.1_Missense_Mutation_p.E194G|NUSAP1_ENST00000260359.6_Missense_Mutation_p.E180G|NUSAP1_ENST00000414849.2_Missense_Mutation_p.E195G|NUSAP1_ENST00000558123.1_3'UTR			Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1	195					establishment of mitotic spindle localization (GO:0040001)|mitotic chromosome condensation (GO:0007076)|mitotic cytokinesis (GO:0000281)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of mitosis (GO:0045840)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	13		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		CATTTTAAGGAAATGGAGTCC	0.264																																						dbGAP											0													42.0	42.0	42.0					15																	41650380		1793	4032	5825	-	-	-	SO:0001583	missense	0			AF290612	CCDS45234.1, CCDS45236.1, CCDS58356.1, CCDS58357.1, CCDS58358.1, CCDS73708.1	15q14	2008-02-05				ENSG00000137804			18538	protein-coding gene	gene with protein product		612818				12963707	Standard	NM_016359		Approved	FLJ13421, LNP, ANKT, NuSAP1, SAPL, BM037, PRO0310p1, Q0310	uc001zns.4	Q9BXS6		ENST00000559596.1:c.584A>G	15.37:g.41650380A>G	ENSP00000453403:p.Glu195Gly		B4DDF1|E7ERR5|J3KN21|Q53GW2|Q8TBT4|Q96E58|Q96FJ1|Q9GZM9|Q9NZ85|Q9UI70	Missense_Mutation	SNP	NULL	p.E195G	ENST00000559596.1	37	c.584	CCDS45234.1	15	.	.	.	.	.	.	.	.	.	.	A	15.89	2.967364	0.53507	.	.	ENSG00000137804	ENST00000260359;ENST00000414849;ENST00000450318;ENST00000450592	T;T;T	0.34072	1.38;1.38;1.38	4.74	3.62	0.41486	.	0.275487	0.39615	N	0.001304	T	0.42743	0.1216	M	0.65975	2.015	0.25412	N	0.988343	P;P;P;B;B;P;P	0.42993	0.501;0.642;0.797;0.223;0.227;0.797;0.797	B;P;P;B;B;P;P	0.48738	0.381;0.503;0.588;0.246;0.193;0.588;0.588	T	0.35674	-0.9779	10	0.72032	D	0.01	.	6.8566	0.24044	0.8967:0.0:0.1033:0.0	.	172;195;194;194;195;195;195	E7ERR5;E9PB35;Q9BXS6-3;Q9BXS6-5;A8K4B4;Q9BXS6;Q9BXS6-2	.;.;.;.;.;NUSAP_HUMAN;.	G	195;195;195;172	ENSP00000400746:E195G;ENSP00000401351:E195G;ENSP00000401014:E172G	ENSP00000260359:E195G	E	+	2	0	NUSAP1	39437672	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.274000	0.72587	0.852000	0.35287	0.454000	0.30748	GAA	NUSAP1	-	NULL	ENSG00000137804		0.264	NUSAP1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUSAP1	HGNC	protein_coding	OTTHUMT00000419427.1	24	0.00	0	A	NM_016359		41650380	41650380	+1	no_errors	ENST00000559596	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	1.000	G
OR10V1	390201	genome.wustl.edu	37	11	59480439	59480439	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr11:59480439T>A	ENST00000307552.2	-	1	898	c.880A>T	c.(880-882)Agg>Tgg	p.R294W	STX3_ENST00000300150.7_5'Flank	NM_001005324.1	NP_001005324.1	Q8NGI7	O10V1_HUMAN	olfactory receptor, family 10, subfamily V, member 1	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|liver(1)|lung(10)|skin(1)	16						TCCTTGTTCCTCAAACTATAG	0.433																																						dbGAP											0													131.0	142.0	138.0					11																	59480439		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065807	CCDS31565.1	11q12.1	2012-08-09			ENSG00000172289	ENSG00000172289		"""GPCR / Class A : Olfactory receptors"""	15136	protein-coding gene	gene with protein product							Standard	NM_001005324		Approved		uc001nof.1	Q8NGI7	OTTHUMG00000167406	ENST00000307552.2:c.880A>T	11.37:g.59480439T>A	ENSP00000302199:p.Arg294Trp		Q6IFD9|Q96R50	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R294W	ENST00000307552.2	37	c.880	CCDS31565.1	11	.	.	.	.	.	.	.	.	.	.	T	16.41	3.115039	0.56505	.	.	ENSG00000172289	ENST00000307552	T	0.41065	1.01	4.62	4.62	0.57501	.	0.000000	0.64402	D	0.000015	T	0.71550	0.3353	H	0.94345	3.525	0.32325	N	0.56193	D	0.65815	0.995	D	0.70935	0.971	T	0.82756	-0.0300	10	0.87932	D	0	.	12.4423	0.55631	0.0:0.0:0.0:1.0	.	294	Q8NGI7	O10V1_HUMAN	W	294	ENSP00000302199:R294W	ENSP00000302199:R294W	R	-	1	2	OR10V1	59237015	0.042000	0.20092	1.000000	0.80357	0.946000	0.59487	1.268000	0.33062	2.100000	0.63781	0.444000	0.29173	AGG	OR10V1	-	prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000172289		0.433	OR10V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10V1	HGNC	protein_coding	OTTHUMT00000394517.1	154	0.00	0	T	NM_001005324		59480439	59480439	-1	no_errors	ENST00000307552	ensembl	human	known	69_37n	missense	131	42.54	97	SNP	1.000	A
OR10S1	219873	genome.wustl.edu	37	11	123847945	123847945	+	Nonsense_Mutation	SNP	T	T	A	rs200962413		TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr11:123847945T>A	ENST00000531945.1	-	1	543	c.454A>T	c.(454-456)Aga>Tga	p.R152*		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CACATCCTTCTGTTCATGGCC	0.572																																						dbGAP											0													101.0	90.0	94.0					11																	123847945		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0			BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.454A>T	11.37:g.123847945T>A	ENSP00000431914:p.Arg152*		B9EH43|Q6IEV3|Q96R78	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R152*	ENST00000531945.1	37	c.454	CCDS31701.1	11	.	.	.	.	.	.	.	.	.	.	T	15.33	2.800785	0.50315	.	.	ENSG00000196248	ENST00000531945	.	.	.	4.74	2.26	0.28386	.	0.947127	0.08417	U	0.948900	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-3.1862	7.446	0.27211	0.1225:0.0:0.2767:0.6007	.	.	.	.	X	152	.	ENSP00000431914:R152X	R	-	1	2	OR10S1	123353155	0.000000	0.05858	0.146000	0.22360	0.281000	0.26958	-0.025000	0.12413	0.820000	0.34516	0.467000	0.42956	AGA	OR10S1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000196248		0.572	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10S1	HGNC	protein_coding	OTTHUMT00000387265.2	124	0.00	0	T	NM_001004474		123847945	123847945	-1	no_errors	ENST00000531945	ensembl	human	known	69_37n	nonsense	126	23.95	40	SNP	0.001	A
PCDHB2	56133	genome.wustl.edu	37	5	140474886	140474886	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr5:140474886A>T	ENST00000194155.4	+	1	660	c.512A>T	c.(511-513)aAt>aTt	p.N171I		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	171	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGTCTCCAAAATTACACAATC	0.403																																						dbGAP											0													31.0	33.0	32.0					5																	140474886		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.512A>T	5.37:g.140474886A>T	ENSP00000194155:p.Asn171Ile		Q4KMU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N171I	ENST00000194155.4	37	c.512	CCDS4244.1	5	.	.	.	.	.	.	.	.	.	.	A	12.07	1.828577	0.32329	.	.	ENSG00000112852	ENST00000194155	T	0.51071	0.72	5.32	0.369	0.16151	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.45836	0.1362	L	0.49778	1.585	0.09310	N	1	P	0.47962	0.903	P	0.48921	0.595	T	0.35798	-0.9774	9	0.87932	D	0	.	5.9933	0.19478	0.4047:0.3838:0.2115:0.0	.	171	Q9Y5E7	PCDB2_HUMAN	I	171	ENSP00000194155:N171I	ENSP00000194155:N171I	N	+	2	0	PCDHB2	140455070	0.000000	0.05858	0.835000	0.33067	0.705000	0.40729	-2.663000	0.00849	-0.088000	0.12506	-0.408000	0.06270	AAT	PCDHB2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000112852		0.403	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2	42	0.00	0	A	NM_018936		140474886	140474886	+1	no_errors	ENST00000194155	ensembl	human	known	69_37n	missense	22	54.90	28	SNP	0.049	T
PDE3A	5139	genome.wustl.edu	37	12	20522722	20522723	+	Frame_Shift_Ins	INS	-	-	G	rs149604740	byFrequency	TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr12:20522722_20522723insG	ENST00000359062.3	+	1	544_545	c.504_505insG	c.(505-507)gggfs	p.G169fs	RP11-284H19.1_ENST00000535755.1_RNA	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	169					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	CCGCCTGCTGCGGGGGGGAAGC	0.693																																						dbGAP											0										19,3941		0,19,1961						4.3	1.0			16	13,7811		0,13,3899	no	frameshift	PDE3A	NM_000921.4		0,32,5860	A1A1,A1R,RR		0.1662,0.4798,0.2716				32,11752				-	-	-	SO:0001589	frameshift_variant	0				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.511dupG	12.37:g.20522729_20522729dupG	ENSP00000351957:p.Gly169fs		O60865|Q13348|Q17RD1	Frame_Shift_Ins	INS	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.E170fs	ENST00000359062.3	37	c.504_505	CCDS31754.1	12																																																																																			PDE3A	-	NULL	ENSG00000172572		0.693	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE3A	HGNC	protein_coding	OTTHUMT00000401756.2	11	0.00	0	-			20522722	20522723	+1	no_errors	ENST00000359062	ensembl	human	known	69_37n	frame_shift_ins	10	23.08	3	INS	1.000:1.000	G
PHACTR4	65979	genome.wustl.edu	37	1	28800394	28800394	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:28800394T>G	ENST00000373839.3	+	7	1413	c.1152T>G	c.(1150-1152)atT>atG	p.I384M	PHACTR4_ENST00000493669.1_3'UTR|PHACTR4_ENST00000373836.3_Missense_Mutation_p.I394M	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	384	Pro-rich.				actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		ACCAGGAGATTCCCCAGCAGG	0.522																																						dbGAP											0													74.0	75.0	74.0					1																	28800394		1877	4102	5979	-	-	-	SO:0001583	missense	0			AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.1152T>G	1.37:g.28800394T>G	ENSP00000362945:p.Ile384Met		A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Missense_Mutation	SNP	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.I394M	ENST00000373839.3	37	c.1182	CCDS41293.1	1	.	.	.	.	.	.	.	.	.	.	T	8.580	0.882039	0.17467	.	.	ENSG00000204138	ENST00000373839;ENST00000373836;ENST00000373838	T;T	0.22743	1.94;1.94	5.75	2.1	0.27182	.	1.049520	0.07442	N	0.897567	T	0.20292	0.0488	L	0.36672	1.1	0.09310	N	1	B;B	0.32526	0.374;0.257	B;B	0.38616	0.277;0.143	T	0.38373	-0.9664	10	0.33141	T	0.24	0.0535	7.5358	0.27710	0.0:0.395:0.0:0.605	.	394;384	Q8IZ21-2;Q8IZ21	.;PHAR4_HUMAN	M	384;394;383	ENSP00000362945:I384M;ENSP00000362942:I394M	ENSP00000362942:I394M	I	+	3	3	PHACTR4	28672981	0.000000	0.05858	0.022000	0.16811	0.343000	0.28985	0.151000	0.16283	0.433000	0.26313	0.533000	0.62120	ATT	PHACTR4	-	NULL	ENSG00000204138		0.522	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHACTR4	HGNC	protein_coding	OTTHUMT00000009868.4	118	0.00	0	T	NM_023923		28800394	28800394	+1	no_errors	ENST00000373836	ensembl	human	known	69_37n	missense	238	26.09	84	SNP	0.077	G
PHC3	80012	genome.wustl.edu	37	3	169854406	169854406	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr3:169854406G>C	ENST00000494943.1	-	7	752	c.684C>G	c.(682-684)agC>agG	p.S228R	PHC3_ENST00000495893.2_Missense_Mutation_p.S240R|PHC3_ENST00000467570.1_Missense_Mutation_p.S187R			Q8NDX5	PHC3_HUMAN	polyhomeotic homolog 3 (Drosophila)	228	Ser-rich.				multicellular organismal development (GO:0007275)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|upper_aerodigestive_tract(2)	26	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			CATTCTGTGAGCTAGATAATA	0.368																																						dbGAP											0													154.0	135.0	141.0					3																	169854406		1888	4109	5997	-	-	-	SO:0001583	missense	0				CCDS46952.1	3q26.32	2014-01-28	2006-09-12		ENSG00000173889	ENSG00000173889		"""Sterile alpha motif (SAM) domain containing"""	15682	protein-coding gene	gene with protein product	"""early development regulator 3"", ""polyhomeotic like 3"""		"""polyhomeotic like 3 (Drosophila)"""			12167701, 12384788	Standard	NM_024947		Approved	EDR3, FLJ12967, FLJ12729, HPH3	uc003fgl.2	Q8NDX5	OTTHUMG00000158777	ENST00000494943.1:c.684C>G	3.37:g.169854406G>C	ENSP00000420271:p.Ser228Arg		A2RRP9|Q5HYF0|Q6NSG2|Q8NFT7|Q8NFZ1|Q8TBM2|Q9H971|Q9H9I4	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.S240R	ENST00000494943.1	37	c.720		3	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982626	0.74474	.	.	ENSG00000173889	ENST00000494943;ENST00000495893;ENST00000467570;ENST00000466189;ENST00000475729	T;T	0.33865	1.39;1.39	5.38	4.27	0.50696	.	0.131188	0.53938	D	0.000048	T	0.39759	0.1090	L	0.48642	1.525	0.80722	D	1	D;D;D;D;D	0.64830	0.994;0.994;0.99;0.994;0.987	D;P;D;D;P	0.74348	0.983;0.76;0.962;0.983;0.696	T	0.53244	-0.8466	10	0.05721	T	0.95	-7.8869	3.9677	0.09439	0.3314:0.0:0.6686:0.0	.	187;187;228;240;240	B4E2T1;E7EX82;Q8NDX5;Q8NDX5-3;Q8NDX5-7	.;.;PHC3_HUMAN;.;.	R	228;240;187;154;240	ENSP00000420271:S228R;ENSP00000420294:S240R	ENSP00000417860:S154R	S	-	3	2	PHC3	171337100	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.581000	0.53914	2.677000	0.91161	0.591000	0.81541	AGC	PHC3	-	NULL	ENSG00000173889		0.368	PHC3-004	KNOWN	basic	protein_coding	PHC3	HGNC	protein_coding	OTTHUMT00000352182.3	355	0.00	0	G	NM_024947		169854406	169854406	-1	no_errors	ENST00000495893	ensembl	human	known	69_37n	missense	401	24.20	128	SNP	1.000	C
PRAMEF22	653606	genome.wustl.edu	37	1	13036693	13036693	+	Silent	SNP	A	A	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:13036693A>G	ENST00000376187.1	+	2	765	c.765A>G	c.(763-765)gaA>gaG	p.E255E	PRAMEF6_ENST00000376192.5_Intron	NM_001100631.1	NP_001094101.1	A3QJZ6	PRA22_HUMAN	PRAME family member 22	255					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					kidney(1)|large_intestine(2)|lung(1)|skin(1)	5						ACAGCCAAGAACAGTTAGTTG	0.498																																						dbGAP											0													1.0	1.0	1.0					1																	13036693		699	1427	2126	-	-	-	SO:0001819	synonymous_variant	0					1p36.21	2013-01-17			ENSG00000204508			"""-"""	34393	protein-coding gene	gene with protein product							Standard	NM_001100631		Approved	PRAMEF3L	uc009vnq.1	A3QJZ6	OTTHUMG00000074726	ENST00000376187.1:c.765A>G	1.37:g.13036693A>G			A6NMM3	Silent	SNP	NULL	p.E255	ENST00000376187.1	37	c.765	CCDS41256.1	1																																																																																			PRAMEF22	-	NULL	ENSG00000204508		0.498	PRAMEF22-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	PRAMEF22	HGNC	protein_coding	OTTHUMT00000158511.1	39	0.00	0	A	NM_001100631		13036693	13036693	+1	no_errors	ENST00000376187	ensembl	human	known	69_37n	silent	43	43.42	33	SNP	0.007	G
PRDM4	11108	genome.wustl.edu	37	12	108134960	108134960	+	Silent	SNP	G	G	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr12:108134960G>A	ENST00000228437.5	-	10	2146	c.1687C>T	c.(1687-1689)Ctg>Ttg	p.L563L	RP11-864J10.4_ENST00000546829.1_RNA|RP11-864J10.4_ENST00000546714.1_RNA	NM_012406.3	NP_036538.3	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	563					cell proliferation (GO:0008283)|negative regulation of cell cycle (GO:0045786)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|methyltransferase activity (GO:0008168)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	20						TGGCTGGTCAGATGGGCTTTG	0.468																																						dbGAP											0													144.0	127.0	133.0					12																	108134960		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF144757	CCDS9115.1	12q23-q24.1	2013-01-08				ENSG00000110851		"""Zinc fingers, C2H2-type"""	9348	protein-coding gene	gene with protein product		605780				10552934	Standard	NM_012406		Approved	PFM1	uc001tmp.3	Q9UKN5	OTTHUMG00000169914	ENST00000228437.5:c.1687C>T	12.37:g.108134960G>A			Q9UFA6	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pirsf_Znf_PRDM4,pfscan_SET_dom,pfscan_Znf_C2H2	p.L563	ENST00000228437.5	37	c.1687	CCDS9115.1	12																																																																																			PRDM4	-	smart_Znf_C2H2-like,pirsf_Znf_PRDM4	ENSG00000110851		0.468	PRDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM4	HGNC	protein_coding	OTTHUMT00000406546.1	171	0.00	0	G	NM_012406		108134960	108134960	-1	no_errors	ENST00000228437	ensembl	human	known	69_37n	silent	117	42.08	85	SNP	1.000	A
RORC	6097	genome.wustl.edu	37	1	151787698	151787698	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:151787698C>T	ENST00000318247.6	-	5	609	c.502G>A	c.(502-504)Gag>Aag	p.E168K	RORC_ENST00000356728.6_Missense_Mutation_p.E147K|RORC_ENST00000392697.3_Missense_Mutation_p.E222K|RORC_ENST00000480719.1_5'Flank	NM_005060.3	NP_005051.2	P51449	RORG_HUMAN	RAR-related orphan receptor C	168	Hinge. {ECO:0000255}.				adipose tissue development (GO:0060612)|cellular response to sterol (GO:0036315)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lymph node development (GO:0048535)|negative regulation of thymocyte apoptotic process (GO:0070244)|Peyer's patch development (GO:0048541)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of fat cell differentiation (GO:0045598)|regulation of gamma-delta T cell differentiation (GO:0045586)|regulation of glucose metabolic process (GO:0010906)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|T cell differentiation in thymus (GO:0033077)|T-helper 17 cell differentiation (GO:0072539)|T-helper cell differentiation (GO:0042093)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			GCAGAAGCCTCAGGCAGGTCA	0.647																																						dbGAP											0													28.0	29.0	29.0					1																	151787698		2203	4300	6503	-	-	-	SO:0001583	missense	0			U16997	CCDS1004.1, CCDS30856.1	1q21	2013-01-16			ENSG00000143365	ENSG00000143365		"""Nuclear hormone receptors"""	10260	protein-coding gene	gene with protein product		602943				7811290	Standard	NM_005060		Approved	RZRG, RORG, NR1F3, TOR	uc001ezh.3	P51449	OTTHUMG00000013053	ENST00000318247.6:c.502G>A	1.37:g.151787698C>T	ENSP00000327025:p.Glu168Lys		Q5SZR9|Q8N5V7|Q8NCY8	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ROR_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt	p.E222K	ENST00000318247.6	37	c.664	CCDS1004.1	1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.161430	0.78226	.	.	ENSG00000143365	ENST00000356728;ENST00000392697;ENST00000318247	D;D;D	0.94650	-3.44;-3.48;-3.45	5.43	5.43	0.79202	.	1.102340	0.06991	U	0.821534	D	0.94555	0.8246	M	0.62723	1.935	0.42943	D	0.994358	P;B;P;B	0.51351	0.92;0.057;0.944;0.041	B;B;P;B	0.52267	0.422;0.05;0.694;0.074	D	0.89481	0.3750	10	0.30854	T	0.27	.	16.7436	0.85466	0.0:1.0:0.0:0.0	.	168;222;168;147	B6ZGS6;B4DPR1;P51449;F1D8P6	.;.;RORG_HUMAN;.	K	147;222;168	ENSP00000349164:E147K;ENSP00000376461:E222K;ENSP00000327025:E168K	ENSP00000327025:E168K	E	-	1	0	RORC	150054322	0.990000	0.36364	0.961000	0.40146	0.992000	0.81027	3.056000	0.49923	2.532000	0.85374	0.563000	0.77884	GAG	RORC	-	NULL	ENSG00000143365		0.647	RORC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RORC	HGNC	protein_coding	OTTHUMT00000036626.1	33	0.00	0	C			151787698	151787698	-1	no_errors	ENST00000392697	ensembl	human	known	69_37n	missense	36	24.49	12	SNP	0.995	T
RRP12	23223	genome.wustl.edu	37	10	99126551	99126551	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr10:99126551C>G	ENST00000370992.4	-	27	3274	c.3163G>C	c.(3163-3165)Gag>Cag	p.E1055Q	RRP12_ENST00000315563.6_Missense_Mutation_p.E955Q|RRP12_ENST00000414986.1_Missense_Mutation_p.E994Q|RRP12_ENST00000479481.1_5'UTR|RRP12_ENST00000536831.1_Missense_Mutation_p.E773Q	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	1055	Glu-rich.					integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		tcttcttcctcctccACGGCA	0.647																																						dbGAP											0													102.0	118.0	112.0					10																	99126551		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.3163G>C	10.37:g.99126551C>G	ENSP00000360031:p.Glu1055Gln		B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Missense_Mutation	SNP	pfam_Uncharacterised_NUC173,superfamily_ARM-type_fold	p.E1055Q	ENST00000370992.4	37	c.3163	CCDS7457.1	10	.	.	.	.	.	.	.	.	.	.	C	7.264	0.605698	0.14002	.	.	ENSG00000052749	ENST00000370992;ENST00000315563;ENST00000414986;ENST00000536831	T;T;T;T	0.34859	1.34;1.35;1.35;1.35	4.81	4.81	0.61882	.	.	.	.	.	T	0.21801	0.0525	N	0.19112	0.55	0.40204	D	0.97755	B;B;B;B	0.13594	0.004;0.008;0.007;0.004	B;B;B;B	0.12837	0.002;0.006;0.008;0.002	T	0.09079	-1.0691	9	0.20519	T	0.43	-6.6291	9.1409	0.36903	0.1466:0.774:0.0:0.0794	.	994;955;773;1055	E9PCK7;Q5JTH9-2;F5H456;Q5JTH9	.;.;.;RRP12_HUMAN	Q	1055;955;994;773	ENSP00000360031:E1055Q;ENSP00000324315:E955Q;ENSP00000414863:E994Q;ENSP00000446184:E773Q	ENSP00000324315:E955Q	E	-	1	0	RRP12	99116541	0.005000	0.15991	0.983000	0.44433	0.045000	0.14185	1.330000	0.33781	2.228000	0.72767	0.561000	0.74099	GAG	RRP12	-	NULL	ENSG00000052749		0.647	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RRP12	HGNC	protein_coding	OTTHUMT00000049699.4	48	0.00	0	C	NM_015179		99126551	99126551	-1	no_errors	ENST00000370992	ensembl	human	known	69_37n	missense	49	46.74	43	SNP	1.000	G
RUSC1	23623	genome.wustl.edu	37	1	155298046	155298046	+	Silent	SNP	C	C	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:155298046C>G	ENST00000368352.5	+	9	2671	c.2520C>G	c.(2518-2520)ccC>ccG	p.P840P	RUSC1_ENST00000462780.1_3'UTR|RUSC1_ENST00000368347.4_Silent_p.P430P|RUSC1_ENST00000292254.4_Silent_p.P371P|RUSC1_ENST00000368354.3_Silent_p.P734P|RUSC1_ENST00000368349.4_Silent_p.P371P	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1	840					positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			CCTCAGCACCCAGGATGGTGC	0.547																																						dbGAP											0													81.0	78.0	79.0					1																	155298046		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.2520C>G	1.37:g.155298046C>G			B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Silent	SNP	pfam_Run,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Run,smart_SH3_domain,pfscan_Run,pfscan_SH3_domain	p.P840	ENST00000368352.5	37	c.2520	CCDS41410.1	1																																																																																			RUSC1	-	superfamily_SH3_domain	ENSG00000160753		0.547	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUSC1	HGNC	protein_coding	OTTHUMT00000039071.1	34	0.00	0	C			155298046	155298046	+1	no_errors	ENST00000368352	ensembl	human	known	69_37n	silent	50	24.24	16	SNP	0.579	G
SBSN	374897	genome.wustl.edu	37	19	36018958	36018958	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr19:36018958C>T	ENST00000452271.2	-	1	254	c.226G>A	c.(226-228)Ggg>Agg	p.G76R	SBSN_ENST00000518157.1_Missense_Mutation_p.G76R	NM_001166034.1	NP_001159506.1	Q6UWP8	SBSN_HUMAN	suprabasin	76	Ala/Gly/His-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				large_intestine(5)|lung(6)|ovary(1)|prostate(2)	14	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GTGTGGCTCCCCATGTTGCTA	0.562																																						dbGAP											0													245.0	216.0	226.0					19																	36018958		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358701	CCDS12464.1, CCDS54253.1	19q13.13	2008-02-05							24950	protein-coding gene	gene with protein product		609969				12228223	Standard	NM_198538		Approved	UNQ698, HLAR698	uc002oad.2	Q6UWP8		ENST00000452271.2:c.226G>A	19.37:g.36018958C>T	ENSP00000430242:p.Gly76Arg		A8K5J0|E9PBV3	Missense_Mutation	SNP	NULL	p.G76R	ENST00000452271.2	37	c.226	CCDS54253.1	19	.	.	.	.	.	.	.	.	.	.	C	15.98	2.992034	0.54041	.	.	ENSG00000189001	ENST00000452271;ENST00000518157	T;T	0.59638	0.25;0.44	4.97	3.9	0.45041	.	0.000000	0.50627	D	0.000119	T	0.70561	0.3238	M	0.61703	1.905	0.09310	N	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.987;1.0	T	0.62129	-0.6919	10	0.87932	D	0	.	10.435	0.44430	0.1951:0.8049:0.0:0.0	.	76;76	Q6UWP8;E9PBV3	SBSN_HUMAN;.	R	76	ENSP00000430242:G76R;ENSP00000428771:G76R	ENSP00000430242:G76R	G	-	1	0	SBSN	40710798	1.000000	0.71417	0.100000	0.21137	0.846000	0.48090	2.308000	0.43690	1.006000	0.39211	0.555000	0.69702	GGG	SBSN	-	NULL	ENSG00000189001		0.562	SBSN-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	SBSN	HGNC	protein_coding	OTTHUMT00000109463.3	54	0.00	0	C	NM_198538		36018958	36018958	-1	no_errors	ENST00000518157	ensembl	human	known	69_37n	missense	58	40.82	40	SNP	0.045	T
SH3PXD2A	9644	genome.wustl.edu	37	10	105484097	105484098	+	Frame_Shift_Ins	INS	-	-	G	rs149867987		TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr10:105484097_105484098insG	ENST00000369774.4	-	5	604_605	c.328_329insC	c.(328-330)cacfs	p.H110fs	SH3PXD2A_ENST00000355946.2_Frame_Shift_Ins_p.H110fs			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	110	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		CTGTGAGATGTGGGGGGGCAGC	0.535																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.329dupC	10.37:g.105484104_105484104dupG	ENSP00000358789:p.His110fs		D3DR98|O43302|Q5TCZ2|Q5TDQ8	Frame_Shift_Ins	INS	pfam_SH3_domain,pfam_SH3_2,pfam_Phox,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.H110fs	ENST00000369774.4	37	c.329_328		10																																																																																			SH3PXD2A	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000107957		0.535	SH3PXD2A-001	KNOWN	basic	protein_coding	SH3PXD2A	HGNC	protein_coding	OTTHUMT00000050178.1	35	0.00	0	-	NM_014631		105484097	105484098	-1	no_errors	ENST00000369774	ensembl	human	known	69_37n	frame_shift_ins	25	16.67	5	INS	1.000:0.989	G
SI	6476	genome.wustl.edu	37	3	164737418	164737418	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr3:164737418delC	ENST00000264382.3	-	28	3457	c.3395delG	c.(3394-3396)ggafs	p.G1132fs		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1132	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TGTGAACATTCCCCAAGTATT	0.438										HNSCC(35;0.089)																												dbGAP											0													138.0	128.0	131.0					3																	164737418		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3395delG	3.37:g.164737418delC	ENSP00000264382:p.Gly1132fs		A2RUC3|Q1JQ80|Q1RMC2	Frame_Shift_Del	DEL	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.G1132fs	ENST00000264382.3	37	c.3395	CCDS3196.1	3																																																																																			SI	-	superfamily_Glyco_hydro-type_carb-bd	ENSG00000090402		0.438	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	201	0.00	0	C	NM_001041		164737418	164737418	-1	no_errors	ENST00000264382	ensembl	human	known	69_37n	frame_shift_del	242	31.37	112	DEL	1.000	-
SLC16A12	387700	genome.wustl.edu	37	10	91198842	91198842	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr10:91198842T>C	ENST00000341233.4	-	6	847	c.457A>G	c.(457-459)Agt>Ggt	p.S153G	SLC16A12_ENST00000371790.4_Missense_Mutation_p.S183G	NM_213606.3	NP_998771.3	Q6ZSM3	MOT12_HUMAN	solute carrier family 16, member 12	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(4)|skin(1)|stomach(1)	14						CCAATGCCACTTCCTGACATG	0.498																																						dbGAP											0													123.0	117.0	119.0					10																	91198842		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7404.1, CCDS7404.2	10q23.32	2013-07-18	2013-07-18		ENSG00000152779	ENSG00000152779		"""Solute carriers"""	23094	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 12"""	611910	"""solute carrier family 16 (monocarboxylic acid transporters), member 12"", ""solute carrier family 16, member 12 (monocarboxylic acid transporter 12)"""				Standard	NM_213606		Approved	MCT12	uc001kgm.3	Q6ZSM3	OTTHUMG00000018714	ENST00000341233.4:c.457A>G	10.37:g.91198842T>C	ENSP00000343022:p.Ser153Gly		Q5M9M9|Q5T7J2|Q6ZV76	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S183G	ENST00000341233.4	37	c.547		10	.	.	.	.	.	.	.	.	.	.	T	23.0	4.362865	0.82353	.	.	ENSG00000152779	ENST00000341233;ENST00000371790	T;T	0.52057	0.68;0.68	5.86	5.86	0.93980	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.69886	0.3161	M	0.77712	2.385	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72487	-0.4278	10	0.56958	D	0.05	.	15.7408	0.77894	0.0:0.0:0.0:1.0	.	153	Q6ZSM3	MOT12_HUMAN	G	153;183	ENSP00000343022:S153G;ENSP00000360855:S183G	ENSP00000343022:S153G	S	-	1	0	SLC16A12	91188822	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.982000	0.88131	2.367000	0.80283	0.528000	0.53228	AGT	SLC16A12	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000152779		0.498	SLC16A12-201	KNOWN	basic|appris_principal	protein_coding	SLC16A12	HGNC	protein_coding		54	0.00	0	T	NM_213606		91198842	91198842	-1	no_errors	ENST00000371790	ensembl	human	known	69_37n	missense	70	35.19	38	SNP	1.000	C
SLC26A9	115019	genome.wustl.edu	37	1	205898368	205898368	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:205898368G>T	ENST00000367135.3	-	7	947	c.834C>A	c.(832-834)caC>caA	p.H278Q	SLC26A9_ENST00000367134.2_Missense_Mutation_p.H278Q|SLC26A9_ENST00000340781.4_Missense_Mutation_p.H278Q	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	278					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)			NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			AGCGAATCTTGTGCATGTAGC	0.567																																						dbGAP											0													204.0	191.0	195.0					1																	205898368		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.834C>A	1.37:g.205898368G>T	ENSP00000356103:p.His278Gln		A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.H278Q	ENST00000367135.3	37	c.834	CCDS30990.1	1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.776745	0.49786	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.92752	-3.1;-3.1;-3.1	5.45	5.45	0.79879	Sulphate transporter (1);	0.190743	0.42420	D	0.000710	D	0.85856	0.5794	L	0.31752	0.955	0.37294	D	0.908405	P;P	0.43231	0.642;0.801	B;B	0.43360	0.193;0.417	D	0.84525	0.0630	10	0.33141	T	0.24	.	4.8728	0.13640	0.0802:0.1478:0.6188:0.1532	.	278;278	Q7LBE3;B1AVM8	S26A9_HUMAN;.	Q	278	ENSP00000341682:H278Q;ENSP00000356103:H278Q;ENSP00000356102:H278Q	ENSP00000341682:H278Q	H	-	3	2	SLC26A9	204164991	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.863000	0.27913	2.547000	0.85894	0.561000	0.74099	CAC	SLC26A9	-	pfam_Sulph_transpt,tigrfam_SulP_transpt	ENSG00000174502		0.567	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A9	HGNC	protein_coding	OTTHUMT00000087742.1	189	0.00	0	G	NM_052934		205898368	205898368	-1	no_errors	ENST00000340781	ensembl	human	known	69_37n	missense	394	18.76	91	SNP	1.000	T
SLC30A8	169026	genome.wustl.edu	37	8	118169971	118169971	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr8:118169971G>T	ENST00000456015.2	+	4	460	c.460G>T	c.(460-462)Gtg>Ttg	p.V154L	SLC30A8_ENST00000519688.1_Missense_Mutation_p.V105L|SLC30A8_ENST00000427715.2_Missense_Mutation_p.V105L|SLC30A8_ENST00000521243.1_Missense_Mutation_p.V105L	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	154					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			CATCTGGGTGGTGACTGGCGT	0.532																																					Ovarian(162;1202 1922 6011 16223 52092)	dbGAP											0													322.0	284.0	297.0					8																	118169971		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.460G>T	8.37:g.118169971G>T	ENSP00000415011:p.Val154Leu		A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.V154L	ENST00000456015.2	37	c.460	CCDS6322.1	8	.	.	.	.	.	.	.	.	.	.	G	17.52	3.410639	0.62399	.	.	ENSG00000164756	ENST00000521243;ENST00000427715;ENST00000519688;ENST00000456015	T;T;T;T	0.61392	0.11;0.11;0.11;0.11	5.77	1.47	0.22746	.	0.181299	0.47852	D	0.000205	T	0.42314	0.1197	N	0.12611	0.24	0.54753	D	0.999985	P	0.40376	0.715	P	0.46685	0.524	T	0.14839	-1.0458	10	0.29301	T	0.29	-4.6289	9.8721	0.41180	0.3603:0.0:0.6397:0.0	.	154	Q8IWU4	ZNT8_HUMAN	L	105;105;105;154	ENSP00000428545:V105L;ENSP00000407505:V105L;ENSP00000431069:V105L;ENSP00000415011:V154L	ENSP00000407505:V105L	V	+	1	0	SLC30A8	118239152	1.000000	0.71417	0.991000	0.47740	0.721000	0.41392	1.318000	0.33643	0.367000	0.24454	0.655000	0.94253	GTG	SLC30A8	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000164756		0.532	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A8	HGNC	protein_coding	OTTHUMT00000381205.1	268	0.00	0	G	NM_173851		118169971	118169971	+1	no_errors	ENST00000456015	ensembl	human	known	69_37n	missense	711	17.13	147	SNP	1.000	T
SLC35C2	51006	genome.wustl.edu	37	20	44983581	44983582	+	In_Frame_Ins	INS	-	-	GCA			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr20:44983581_44983582insGCA	ENST00000372227.1	-	7	1140_1141	c.600_601insTGC	c.(598-603)accatg>accTGCatg	p.200_201TM>TCM	SLC35C2_ENST00000372230.5_In_Frame_Ins_p.200_201TM>TCM|SLC35C2_ENST00000243896.2_In_Frame_Ins_p.200_201TM>TCM|SLC35C2_ENST00000372229.1_In_Frame_Ins_p.67_68TM>TCM|SLC35C2_ENST00000543605.1_In_Frame_Ins_p.229_230TM>TCM|SLC35C2_ENST00000317734.8_In_Frame_Ins_p.179_180TM>TCM|SLC35C2_ENST00000493599.1_5'Flank	NM_001281458.1|NM_001281460.1	NP_001268387.1|NP_001268389.1	Q9NQQ7	S35C2_HUMAN	solute carrier family 35 (GDP-fucose transporter), member C2	200					negative regulation of gene expression (GO:0010629)|positive regulation of Notch signaling pathway (GO:0045747)|protein O-linked fucosylation (GO:0036066)|transport (GO:0006810)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	16		Myeloproliferative disorder(115;0.0122)				AGGTGGAACATGGTGTCGATGG	0.634																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0				CCDS13396.1, CCDS13397.1, CCDS63292.1	20q13.12	2013-07-17	2013-07-17	2003-10-10	ENSG00000080189	ENSG00000080189		"""Solute carriers"""	17117	protein-coding gene	gene with protein product			"""ovarian cancer overexpressed 1"", ""solute carrier family 35, member C2"""	C20orf5, OVCOV1		10810093, 11549316	Standard	NM_173179		Approved	CGI-15, bA394O2.1	uc002xrq.3	Q9NQQ7	OTTHUMG00000033050	ENST00000372227.1:c.600_601insTGC	20.37:g.44983581_44983582insGCA	ENSP00000361301:p.Thr200_Met201insCys		B7Z6V6|E1P5T0|Q53GK3|Q5JW05|Q96CJ8|Q9Y304	In_Frame_Ins	INS	pfam_DUF250,pfam_UAA	p.229in_frame_insC	ENST00000372227.1	37	c.688_687	CCDS13396.1	20																																																																																			SLC35C2	-	pfam_DUF250,pfam_UAA	ENSG00000080189		0.634	SLC35C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC35C2	HGNC	protein_coding	OTTHUMT00000080363.1	88	0.00	0	-	NM_015945		44983581	44983582	-1	no_errors	ENST00000543605	ensembl	human	known	69_37n	in_frame_ins	112	26.32	40	INS	1.000:1.000	GCA
SNCAIP	9627	genome.wustl.edu	37	5	121780331	121780331	+	Missense_Mutation	SNP	G	G	T	rs373891275		TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr5:121780331G>T	ENST00000261368.8	+	8	1758	c.1496G>T	c.(1495-1497)cGg>cTg	p.R499L	SNCAIP_ENST00000379533.2_Missense_Mutation_p.R546L|SNCAIP_ENST00000261367.7_Missense_Mutation_p.R546L|SNCAIP_ENST00000504884.2_3'UTR|SNCAIP_ENST00000379536.2_Missense_Mutation_p.R439L|CTC-210G5.1_ENST00000503529.1_RNA|SNCAIP_ENST00000414317.2_Missense_Mutation_p.R101L|SNCAIP_ENST00000503116.2_3'UTR|SNCAIP_ENST00000542191.1_Missense_Mutation_p.R57L|SNCAIP_ENST00000379538.3_Missense_Mutation_p.R133L|CTC-210G5.1_ENST00000510972.1_RNA|CTC-210G5.1_ENST00000509993.1_RNA|CTC-210G5.1_ENST00000506053.1_RNA|CTC-210G5.1_ENST00000505546.1_RNA	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	499					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		AGCGCCGAGCGGCAGGGGCAC	0.542																																						dbGAP											0													87.0	84.0	85.0					5																	121780331		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.1496G>T	5.37:g.121780331G>T	ENSP00000261368:p.Arg499Leu		D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R546L	ENST00000261368.8	37	c.1637	CCDS4131.1	5	.	.	.	.	.	.	.	.	.	.	G	32	5.126905	0.94429	.	.	ENSG00000064692	ENST00000542191;ENST00000509154;ENST00000261368;ENST00000379533;ENST00000379536;ENST00000379538;ENST00000261367;ENST00000414317;ENST00000447854	T;T;T;T;T;T;T;T	0.66460	1.43;0.67;-0.21;-0.21;0.67;1.43;-0.21;-0.21	5.66	5.66	0.87406	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.75042	0.3796	L	0.31578	0.945	0.58432	D	0.999997	D;D;D;D;D;D;D;D	0.89917	0.991;0.999;1.0;0.999;0.999;1.0;0.997;1.0	D;D;D;D;D;D;D;D	0.87578	0.937;0.997;0.998;0.976;0.996;0.991;0.986;0.995	T	0.74609	-0.3608	10	0.45353	T	0.12	-19.0604	19.7543	0.96284	0.0:0.0:1.0:0.0	.	439;127;101;439;133;133;546;499	D6R9G8;Q9NVG1;B7Z995;Q9Y6H5-4;Q9Y6H5-5;Q9Y6H5-2;Q9Y6H5-3;Q9Y6H5	.;.;.;.;.;.;.;SNCAP_HUMAN	L	57;439;499;546;439;133;546;101;139	ENSP00000441681:R57L;ENSP00000422106:R439L;ENSP00000261368:R499L;ENSP00000368848:R546L;ENSP00000368851:R439L;ENSP00000368854:R133L;ENSP00000261367:R546L;ENSP00000394392:R101L	ENSP00000261367:R546L	R	+	2	0	SNCAIP	121808230	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	5.694000	0.68272	2.680000	0.91292	0.561000	0.74099	CGG	SNCAIP	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000064692		0.542	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCAIP	HGNC	protein_coding	OTTHUMT00000250888.1	99	0.00	0	G			121780331	121780331	+1	no_errors	ENST00000379533	ensembl	human	known	69_37n	missense	117	18.75	27	SNP	1.000	T
SPATS1	221409	genome.wustl.edu	37	6	44320474	44320474	+	Missense_Mutation	SNP	A	A	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr6:44320474A>C	ENST00000288390.2	+	2	498	c.151A>C	c.(151-153)Agt>Cgt	p.S51R	SPATS1_ENST00000323108.8_Missense_Mutation_p.S51R|RP11-444E17.6_ENST00000505802.1_3'UTR			Q496A3	SPAS1_HUMAN	spermatogenesis associated, serine-rich 1	51										NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(5)|skin(1)|urinary_tract(1)	14	all_lung(25;0.00469)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TGCTAATTGCAGTGATTTTCT	0.358																																						dbGAP											0													116.0	108.0	111.0					6																	44320474		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058171	CCDS4911.1	6p21.1	2003-08-08			ENSG00000249481	ENSG00000249481			22957	protein-coding gene	gene with protein product							Standard	NM_145026		Approved	SPATA8, FLJ25442, SRSP1	uc021yzz.1	Q496A3	OTTHUMG00000014764	ENST00000288390.2:c.151A>C	6.37:g.44320474A>C	ENSP00000424400:p.Ser51Arg		Q496A2|Q496A5|Q96LJ0	Missense_Mutation	SNP	NULL	p.S51R	ENST00000288390.2	37	c.151	CCDS4911.1	6	.	.	.	.	.	.	.	.	.	.	A	8.645	0.896778	0.17686	.	.	ENSG00000249481	ENST00000323108;ENST00000288390	T;T	0.49720	0.77;0.77	3.92	-0.0235	0.13943	.	1.491510	0.04356	N	0.356554	T	0.15262	0.0368	L	0.40543	1.245	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.12142	-1.0559	10	0.18710	T	0.47	.	6.2149	0.20649	0.628:0.0:0.372:0.0	.	51	Q496A3	SPAS1_HUMAN	R	51	ENSP00000437552:S51R;ENSP00000424400:S51R	ENSP00000424400:S51R	S	+	1	0	SPATS1	44428452	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.147000	0.16202	0.003000	0.14656	-0.290000	0.09829	AGT	SPATS1	-	NULL	ENSG00000249481		0.358	SPATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATS1	HGNC	protein_coding	OTTHUMT00000040738.2	193	0.00	0	A	NM_145026		44320474	44320474	+1	no_errors	ENST00000288390	ensembl	human	known	69_37n	missense	124	45.89	106	SNP	0.000	C
SUGP1	57794	genome.wustl.edu	37	19	19414553	19414553	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr19:19414553G>C	ENST00000247001.5	-	5	989	c.642C>G	c.(640-642)taC>taG	p.Y214*	SUGP1_ENST00000585763.1_Intron	NM_172231.3	NP_757386.2	Q8IWZ8	SUGP1_HUMAN	SURP and G patch domain containing 1	214					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	22						GGTTATCCTTGTAGTCCTCCA	0.557																																						dbGAP											0													196.0	210.0	205.0					19																	19414553		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF521128	CCDS12399.1	19p13	2013-01-28	2010-08-10	2010-08-10		ENSG00000105705		"""G patch domain containing"""	18643	protein-coding gene	gene with protein product		607992	"""splicing factor 4"""	SF4		12594045	Standard	NM_172231		Approved	F23858, DKFZp434E2216, RBP	uc002nmh.3	Q8IWZ8		ENST00000247001.5:c.642C>G	19.37:g.19414553G>C	ENSP00000247001:p.Tyr214*		O60378|Q6P3X9|Q8TCQ4|Q8WWT4|Q8WWT5|Q9NTG3	Nonsense_Mutation	SNP	pfam_Surp,pfam_G_patch_dom,superfamily_Surp,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.Y214*	ENST00000247001.5	37	c.642	CCDS12399.1	19	.	.	.	.	.	.	.	.	.	.	G	22.7	4.320520	0.81469	.	.	ENSG00000105705	ENST00000247001	.	.	.	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	10.5605	0.45142	0.0893:0.0:0.9107:0.0	.	.	.	.	X	214	.	ENSP00000247001:Y214X	Y	-	3	2	SUGP1	19275553	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.627000	0.74258	2.359000	0.80004	0.650000	0.86243	TAC	SUGP1	-	pfam_Surp,superfamily_Surp,smart_Surp,pfscan_Surp	ENSG00000105705		0.557	SUGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUGP1	HGNC	protein_coding	OTTHUMT00000460128.4	91	0.00	0	G	NM_021164		19414553	19414553	-1	no_errors	ENST00000247001	ensembl	human	known	69_37n	nonsense	62	44.14	49	SNP	1.000	C
SUGP1	57794	genome.wustl.edu	37	19	19414555	19414555	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr19:19414555delA	ENST00000247001.5	-	5	987	c.640delT	c.(640-642)tacfs	p.Y214fs	SUGP1_ENST00000585763.1_Intron	NM_172231.3	NP_757386.2	Q8IWZ8	SUGP1_HUMAN	SURP and G patch domain containing 1	214					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	22						TTATCCTTGTAGTCCTCCATA	0.547																																						dbGAP											0													194.0	209.0	204.0					19																	19414555		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF521128	CCDS12399.1	19p13	2013-01-28	2010-08-10	2010-08-10		ENSG00000105705		"""G patch domain containing"""	18643	protein-coding gene	gene with protein product		607992	"""splicing factor 4"""	SF4		12594045	Standard	NM_172231		Approved	F23858, DKFZp434E2216, RBP	uc002nmh.3	Q8IWZ8		ENST00000247001.5:c.640delT	19.37:g.19414555delA	ENSP00000247001:p.Tyr214fs		O60378|Q6P3X9|Q8TCQ4|Q8WWT4|Q8WWT5|Q9NTG3	Frame_Shift_Del	DEL	pfam_Surp,pfam_G_patch_dom,superfamily_Surp,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.Y214fs	ENST00000247001.5	37	c.640	CCDS12399.1	19																																																																																			SUGP1	-	pfam_Surp,superfamily_Surp,smart_Surp,pfscan_Surp	ENSG00000105705		0.547	SUGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUGP1	HGNC	protein_coding	OTTHUMT00000460128.4	92	0.00	0	A	NM_021164		19414555	19414555	-1	no_errors	ENST00000247001	ensembl	human	known	69_37n	frame_shift_del	60	43.12	47	DEL	1.000	-
TCEAL5	340543	genome.wustl.edu	37	X	102528976	102528976	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chrX:102528976T>A	ENST00000372680.1	-	3	810	c.516A>T	c.(514-516)caA>caT	p.Q172H		NM_001012979.2	NP_001012997.1	Q5H9L2	TCAL5_HUMAN	transcription elongation factor A (SII)-like 5	172					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						GTACATCTCTTTGCATCCAAT	0.512																																						dbGAP											0													139.0	128.0	132.0					X																	102528976		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35356.1	Xq22.2	2014-03-21			ENSG00000204065	ENSG00000204065			22282	protein-coding gene	gene with protein product						16221301	Standard	NM_001012979		Approved	WEX4	uc004ejz.2	Q5H9L2	OTTHUMG00000022092	ENST00000372680.1:c.516A>T	X.37:g.102528976T>A	ENSP00000361765:p.Gln172His		A2RUJ4	Missense_Mutation	SNP	pfam_TF_A-like/BEX-like	p.Q172H	ENST00000372680.1	37	c.516	CCDS35356.1	X	.	.	.	.	.	.	.	.	.	.	T	14.69	2.610289	0.46527	.	.	ENSG00000204065	ENST00000372680	T	0.09630	2.96	2.35	1.18	0.20946	.	0.207805	0.24363	N	0.039180	T	0.20210	0.0486	L	0.60845	1.875	0.24486	N	0.994327	D	0.67145	0.996	D	0.67900	0.954	T	0.05178	-1.0901	10	0.72032	D	0.01	.	3.6427	0.08173	0.0:0.2008:0.0:0.7992	.	172	Q5H9L2	TCAL5_HUMAN	H	172	ENSP00000361765:Q172H	ENSP00000361765:Q172H	Q	-	3	2	TCEAL5	102415632	0.995000	0.38212	0.902000	0.35471	0.935000	0.57460	-0.067000	0.11579	0.244000	0.21351	0.242000	0.17961	CAA	TCEAL5	-	pfam_TF_A-like/BEX-like	ENSG00000204065		0.512	TCEAL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEAL5	HGNC	protein_coding	OTTHUMT00000057696.1	1348	0.00	0	T	XM_291334		102528976	102528976	-1	no_errors	ENST00000372680	ensembl	human	known	69_37n	missense	1047	40.37	711	SNP	0.901	A
TCN2	6948	genome.wustl.edu	37	22	31019054	31019054	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr22:31019054C>A	ENST00000215838.3	+	8	1700	c.1206C>A	c.(1204-1206)aaC>aaA	p.N402K	TCN2_ENST00000405742.3_Missense_Mutation_p.N398K|TCN2_ENST00000407817.3_Missense_Mutation_p.N375K			P20062	TCO2_HUMAN	transcobalamin II	402					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|prostate(2)|urinary_tract(1)	22					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAGACCCCAACACCCCACTGT	0.562																																						dbGAP											0													73.0	70.0	71.0					22																	31019054		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13881.1, CCDS54519.1	22q12.2	2014-09-17	2010-05-11		ENSG00000185339	ENSG00000185339			11653	protein-coding gene	gene with protein product	"""macrocytic anemia"""	613441	"""transcobalamin II; macrocytic anemia"""			1708393, 7742531	Standard	NM_000355		Approved	D22S676, D22S750, TC2	uc003aip.2	P20062	OTTHUMG00000151095	ENST00000215838.3:c.1206C>A	22.37:g.31019054C>A	ENSP00000215838:p.Asn402Lys		Q96FD4|Q9BVI8|Q9UCI5|Q9UCI6|Q9UDM0	Missense_Mutation	SNP	pfam_Cbl-bd_transpt_euk,superfamily_Terpenoid_cyclase/PrenylTrfase	p.N402K	ENST00000215838.3	37	c.1206	CCDS13881.1	22	.	.	.	.	.	.	.	.	.	.	C	8.085	0.773203	0.16051	.	.	ENSG00000185339	ENST00000215838;ENST00000405742;ENST00000407817	T;T;T	0.32272	1.46;1.46;1.46	5.51	3.39	0.38822	.	0.332151	0.28499	N	0.015138	T	0.21062	0.0507	L	0.39020	1.185	0.80722	D	1	B;B;B	0.30068	0.026;0.267;0.091	B;B;B	0.20767	0.008;0.031;0.01	T	0.03852	-1.0998	10	0.37606	T	0.19	-14.2257	9.7156	0.40272	0.0:0.8346:0.0:0.1654	.	375;398;402	Q96FD4;B5MBX2;P20062	.;.;TCO2_HUMAN	K	402;398;375	ENSP00000215838:N402K;ENSP00000385914:N398K;ENSP00000384914:N375K	ENSP00000215838:N402K	N	+	3	2	TCN2	29349054	0.824000	0.29247	0.702000	0.30337	0.040000	0.13550	1.319000	0.33655	0.677000	0.31305	0.585000	0.79938	AAC	TCN2	-	NULL	ENSG00000185339		0.562	TCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCN2	HGNC	protein_coding	OTTHUMT00000321282.2	29	0.00	0	C	NM_000355		31019054	31019054	+1	no_errors	ENST00000215838	ensembl	human	known	69_37n	missense	30	48.33	29	SNP	0.960	A
TDRD5	163589	genome.wustl.edu	37	1	179659890	179659890	+	Silent	SNP	T	T	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:179659890T>C	ENST00000367614.1	+	17	3117	c.2758T>C	c.(2758-2760)Ttg>Ctg	p.L920L	TDRD5_ENST00000444136.1_Silent_p.L974L|TDRD5_ENST00000294848.8_Silent_p.L920L	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	920					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						TGCTATTACATTGTACAAAGA	0.408																																						dbGAP											0													83.0	81.0	82.0					1																	179659890		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2758T>C	1.37:g.179659890T>C			A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Silent	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.L974	ENST00000367614.1	37	c.2920	CCDS1332.1	1																																																																																			TDRD5	-	NULL	ENSG00000162782		0.408	TDRD5-002	KNOWN	basic|CCDS	protein_coding	TDRD5	HGNC	protein_coding	OTTHUMT00000085295.1	98	0.00	0	T	NM_173533		179659890	179659890	+1	no_errors	ENST00000444136	ensembl	human	known	69_37n	silent	141	24.19	45	SNP	0.006	C
TMEM131	23505	genome.wustl.edu	37	2	98428967	98428967	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr2:98428967C>G	ENST00000186436.5	-	17	2008	c.1780G>C	c.(1780-1782)Gta>Cta	p.V594L		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	594						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						TCCACAGCTACAAGTTCTATT	0.323																																						dbGAP											0													106.0	96.0	99.0					2																	98428967		1824	4078	5902	-	-	-	SO:0001583	missense	0			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.1780G>C	2.37:g.98428967C>G	ENSP00000186436:p.Val594Leu			Missense_Mutation	SNP	pfam_DUF3651_TMEM131	p.V594L	ENST00000186436.5	37	c.1780	CCDS46368.1	2	.	.	.	.	.	.	.	.	.	.	C	3.527	-0.096506	0.07010	.	.	ENSG00000075568	ENST00000186436	T	0.27720	1.65	5.14	3.22	0.36961	.	0.189467	0.47093	D	0.000249	T	0.08358	0.0208	N	0.02539	-0.55	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24799	-1.0150	10	0.02654	T	1	-10.6498	3.8962	0.09141	0.1419:0.5582:0.2104:0.0895	.	594	Q92545	TM131_HUMAN	L	594	ENSP00000186436:V594L	ENSP00000186436:V594L	V	-	1	0	TMEM131	97795399	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	1.505000	0.35736	1.533000	0.49186	0.655000	0.94253	GTA	TMEM131	-	NULL	ENSG00000075568		0.323	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	HGNC	protein_coding	OTTHUMT00000329285.2	129	0.00	0	C	XM_371542		98428967	98428967	-1	no_errors	ENST00000186436	ensembl	human	known	69_37n	missense	77	42.54	57	SNP	0.996	G
TNXB	7148	genome.wustl.edu	37	6	32011575	32011575	+	Silent	SNP	C	C	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr6:32011575C>T	ENST00000375244.3	-	35	11682	c.11481G>A	c.(11479-11481)tcG>tcA	p.S3827S	TNXB_ENST00000451343.1_Silent_p.S256S|TNXB_ENST00000375247.2_Silent_p.S3825S			P22105	TENX_HUMAN	tenascin XB	3872	Fibronectin type-III 30. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						AGCCTCGGACCGAGACCACGG	0.627																																						dbGAP											0													103.0	126.0	118.0					6																	32011575		1511	2709	4220	-	-	-	SO:0001819	synonymous_variant	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.11481G>A	6.37:g.32011575C>T			P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.S3825	ENST00000375244.3	37	c.11475		6																																																																																			TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.627	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	12	0.00	0	C	NM_019105		32011575	32011575	-1	no_errors	ENST00000375247	ensembl	human	known	69_37n	silent	6	70.00	14	SNP	0.003	T
TTC39A	22996	genome.wustl.edu	37	1	51767912	51767913	+	Intron	INS	-	-	C	rs375305601		TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:51767912_51767913insC	ENST00000447632.2	-	11	1048				TTC39A_ENST00000413473.2_Intron|TTC39A_ENST00000371750.5_Intron|TTC39A_ENST00000451380.1_Intron|TTC39A_ENST00000371747.3_Intron|TTC39A_ENST00000262676.5_Frame_Shift_Ins_p.G368fs|TTC39A_ENST00000262675.7_Intron			Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A									p.0?(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(2)|prostate(2)|skin(3)|urinary_tract(1)	17						TTCTCTCTTGGCCCCCCCCCCG	0.644																																						dbGAP											2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)																																								-	-	-	SO:0001627	intron_variant	0			AB007921	CCDS44143.1, CCDS44144.1, CCDS72789.1, CCDS72790.1	1p32.3	2013-01-11	2008-06-23	2008-06-23	ENSG00000085831	ENSG00000085831		"""Tetratricopeptide (TTC) repeat domain containing"""	18657	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 34"""	C1orf34		9455484, 9461476	Standard	XM_005270643		Approved	KIAA0452, DEME-6	uc010onf.2	Q5SRH9	OTTHUMG00000008193	ENST00000447632.2:c.999+115->G	1.37:g.51767922_51767922dupC			B7Z782|E7EQY9|G3XAF8|O43417|O75040|Q5SRH5|Q5SRH6|Q5SRH7|Q5SRH8|Q5SRI0|Q5SRI1|Q5SRI2|Q5T7S1|Q6PIU8|Q9BT24	Frame_Shift_Ins	INS	pfam_OMP_IML2_mit/TPR_39	p.Q369fs	ENST00000447632.2	37	c.1104_1103		1																																																																																			TTC39A	-	NULL	ENSG00000085831		0.644	TTC39A-004	KNOWN	basic	protein_coding	TTC39A	HGNC	protein_coding	OTTHUMT00000022434.2	9	0.00	0	-			51767912	51767913	-1	no_errors	ENST00000262676	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.000:0.000	C
TTN	7273	genome.wustl.edu	37	2	179576811	179576811	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr2:179576811G>A	ENST00000591111.1	-	94	27019	c.26795C>T	c.(26794-26796)aCg>aTg	p.T8932M	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.T9249M|TTN_ENST00000342992.6_Missense_Mutation_p.T8005M|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13077	Ig-like 72.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.T8005M(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGTAAGTCGTAGTGGGTCT	0.403																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											60.0	61.0	60.0					2																	179576811		1863	4102	5965	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.26795C>T	2.37:g.179576811G>A	ENSP00000465570:p.Thr8932Met		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.T8005M	ENST00000591111.1	37	c.24014		2	.	.	.	.	.	.	.	.	.	.	G	6.793	0.515309	0.12944	.	.	ENSG00000155657	ENST00000342992	T	0.42513	0.97	5.47	2.53	0.30540	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.32823	0.0842	L	0.37697	1.125	0.18873	N	0.999985	B	0.16396	0.017	B	0.11329	0.006	T	0.28586	-1.0039	9	0.87932	D	0	.	8.899	0.35484	0.067:0.0:0.5312:0.4019	.	8932	Q8WZ42	TITIN_HUMAN	M	8005	ENSP00000343764:T8005M	ENSP00000343764:T8005M	T	-	2	0	TTN	179285056	0.114000	0.22134	0.052000	0.19188	0.789000	0.44602	0.529000	0.23019	0.282000	0.22254	-0.119000	0.15052	ACG	TTN	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000155657		0.403	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	43	0.00	0	G	NM_133378		179576811	179576811	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	0.038	A
TTN	7273	genome.wustl.edu	37	2	179588692	179588692	+	Silent	SNP	G	G	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr2:179588692G>C	ENST00000591111.1	-	71	20567	c.20343C>G	c.(20341-20343)gtC>gtG	p.V6781V	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Silent_p.V7098V|TTN_ENST00000342992.6_Silent_p.V5854V			Q8WZ42	TITIN_HUMAN	titin	12379	Ig-like 49.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCAATGTGCAGACATTATCTG	0.438																																						dbGAP											0													118.0	114.0	115.0					2																	179588692		1979	4168	6147	-	-	-	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.20343C>G	2.37:g.179588692G>C			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.V5854	ENST00000591111.1	37	c.17562		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000155657		0.438	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	86	0.00	0	G	NM_133378		179588692	179588692	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	silent	42	35.38	23	SNP	1.000	C
UBA1	7317	genome.wustl.edu	37	X	47070446	47070446	+	Silent	SNP	G	G	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chrX:47070446G>A	ENST00000335972.6	+	20	2469	c.2286G>A	c.(2284-2286)ctG>ctA	p.L762L	UBA1_ENST00000377269.3_Silent_p.L210L|UBA1_ENST00000377351.4_Silent_p.L762L	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	762					cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CCCTGCATCTGGACTATGTGA	0.622																																						dbGAP											0													87.0	67.0	74.0					X																	47070446		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.2286G>A	X.37:g.47070446G>A			Q5JRR8|Q96E13	Silent	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.L762	ENST00000335972.6	37	c.2286	CCDS14275.1	X																																																																																			UBA1	-	pfam_UBact_repeat,superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1	ENSG00000130985		0.622	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA1	HGNC	protein_coding	OTTHUMT00000056389.1	148	0.00	0	G	NM_003334		47070446	47070446	+1	no_errors	ENST00000335972	ensembl	human	known	69_37n	silent	84	47.17	75	SNP	1.000	A
UCK2	7371	genome.wustl.edu	37	1	165865513	165865513	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:165865513T>C	ENST00000367879.4	+	4	746	c.443T>C	c.(442-444)cTg>cCg	p.L148P	UCK2_ENST00000372212.4_Intron|UCK2_ENST00000470820.1_5'UTR|UCK2_ENST00000462329.1_3'UTR|RP11-525G13.2_ENST00000455257.2_RNA|UCK2_ENST00000469256.2_5'UTR	NM_012474.4	NP_036606.2	Q9BZX2	UCK2_HUMAN	uridine-cytidine kinase 2	148					cellular response to oxygen levels (GO:0071453)|CTP salvage (GO:0044211)|feeding behavior (GO:0007631)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|response to axon injury (GO:0048678)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					GTACGAGACCTGTTCCAGATG	0.552																																						dbGAP											0													210.0	202.0	205.0					1																	165865513		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF236637	CCDS1252.1	1p32	2012-10-02	2004-07-13	2004-07-14	ENSG00000143179	ENSG00000143179	2.7.1.48		12562	protein-coding gene	gene with protein product		609329	"""uridine monophosphate kinase"""	UMPK			Standard	NM_012474		Approved		uc001gdp.3	Q9BZX2	OTTHUMG00000040117	ENST00000367879.4:c.443T>C	1.37:g.165865513T>C	ENSP00000356853:p.Leu148Pro		Q5VV91|Q7KZV3|Q92528|Q96KG5|Q9BU42	Missense_Mutation	SNP	pfam_PRK/URK,pfam_Depp_CoAkinase,prints_Uridine_kinase,prints_PRK,tigrfam_Uridine_kinase	p.L148P	ENST00000367879.4	37	c.443	CCDS1252.1	1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.662685	0.88251	.	.	ENSG00000143179	ENST00000367879	.	.	.	5.36	5.36	0.76844	Phosphoribulokinase/uridine kinase (1);	0.136793	0.50627	D	0.000109	D	0.85660	0.5748	H	0.97874	4.095	0.53688	D	0.999979	D	0.67145	0.996	D	0.70016	0.967	D	0.91178	0.4974	8	0.87932	D	0	-23.8687	13.3171	0.60413	0.0:0.0:0.0:1.0	.	148	Q9BZX2	UCK2_HUMAN	P	148	.	ENSP00000356853:L148P	L	+	2	0	UCK2	164132137	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.760000	0.85248	2.032000	0.59987	0.533000	0.62120	CTG	UCK2	-	pfam_PRK/URK,pfam_Depp_CoAkinase,prints_PRK,tigrfam_Uridine_kinase	ENSG00000143179		0.552	UCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCK2	HGNC	protein_coding	OTTHUMT00000096753.1	91	0.00	0	T	NM_012474		165865513	165865513	+1	no_errors	ENST00000367879	ensembl	human	known	69_37n	missense	178	24.89	59	SNP	1.000	C
UHRF1BP1	54887	genome.wustl.edu	37	6	34827338	34827338	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr6:34827338C>T	ENST00000192788.5	+	14	3376	c.3205C>T	c.(3205-3207)Ccc>Tcc	p.P1069S	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.P1069S	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	1069							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						GTTGTCCCTGCCCCCAGCCAA	0.502																																						dbGAP											0													126.0	125.0	125.0					6																	34827338		2088	4218	6306	-	-	-	SO:0001583	missense	0			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.3205C>T	6.37:g.34827338C>T	ENSP00000192788:p.Pro1069Ser		Q9NXE0	Missense_Mutation	SNP	NULL	p.P1069S	ENST00000192788.5	37	c.3205	CCDS43455.1	6	.	.	.	.	.	.	.	.	.	.	C	5.300	0.240791	0.10077	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.08546	3.08;3.08	5.57	5.57	0.84162	.	0.330595	0.30850	N	0.008756	T	0.02418	0.0074	N	0.14661	0.345	0.46336	D	0.998999	B	0.32829	0.386	B	0.31495	0.131	T	0.52801	-0.8527	10	0.15499	T	0.54	-19.2421	17.7256	0.88364	0.0:1.0:0.0:0.0	.	1069	Q6BDS2	URFB1_HUMAN	S	1069	ENSP00000192788:P1069S;ENSP00000400628:P1069S	ENSP00000192788:P1069S	P	+	1	0	UHRF1BP1	34935316	0.974000	0.33945	0.995000	0.50966	0.219000	0.24729	3.037000	0.49775	2.600000	0.87896	0.655000	0.94253	CCC	UHRF1BP1	-	NULL	ENSG00000065060		0.502	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1	HGNC	protein_coding	OTTHUMT00000040260.1	104	0.00	0	C	NM_017754		34827338	34827338	+1	no_errors	ENST00000192788	ensembl	human	known	69_37n	missense	58	43.14	44	SNP	0.968	T
USH2A	7399	genome.wustl.edu	37	1	216221986	216221986	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr1:216221986A>T	ENST00000307340.3	-	31	6439	c.6053T>A	c.(6052-6054)aTa>aAa	p.I2018K	USH2A_ENST00000366943.2_Missense_Mutation_p.I2018K	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2018	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCCTGTCAATATGCCTATAAT	0.408										HNSCC(13;0.011)																												dbGAP											0													136.0	134.0	135.0					1																	216221986		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.6053T>A	1.37:g.216221986A>T	ENSP00000305941:p.Ile2018Lys		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.I2018K	ENST00000307340.3	37	c.6053	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.711607	0.30322	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.56444	0.46;0.46	6.16	3.85	0.44370	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.307756	0.23208	N	0.050719	T	0.52058	0.1711	M	0.73598	2.24	0.37551	D	0.918695	P	0.38677	0.642	B	0.40741	0.339	T	0.54556	-0.8276	10	0.26408	T	0.33	.	9.056	0.36405	0.8013:0.0:0.1987:0.0	.	2018	O75445	USH2A_HUMAN	K	2018	ENSP00000305941:I2018K;ENSP00000355910:I2018K	ENSP00000305941:I2018K	I	-	2	0	USH2A	214288609	0.022000	0.18835	0.737000	0.30932	0.521000	0.34408	0.934000	0.28910	1.163000	0.42636	0.528000	0.53228	ATA	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.408	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	356	0.00	0	A	NM_007123		216221986	216221986	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	407	30.14	176	SNP	0.930	T
USPL1	10208	genome.wustl.edu	37	13	31221139	31221139	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr13:31221139G>T	ENST00000255304.4	+	7	1525	c.1183G>T	c.(1183-1185)Ggt>Tgt	p.G395C		NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	395	SUMO-binding.|USP.				Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		TGCCCATTTTGGTCCATGTAA	0.323																																					Ovarian(60;318 1180 1554 28110 31601)	dbGAP											0													99.0	95.0	97.0					13																	31221139		2203	4300	6503	-	-	-	SO:0001583	missense	0			X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.1183G>T	13.37:g.31221139G>T	ENSP00000255304:p.Gly395Cys		Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	pfscan_Peptidase_C19	p.G395C	ENST00000255304.4	37	c.1183	CCDS9336.1	13	.	.	.	.	.	.	.	.	.	.	G	21.9	4.215034	0.79352	.	.	ENSG00000132952	ENST00000255304	T	0.02763	4.17	5.56	5.56	0.83823	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (1);	0.144789	0.64402	D	0.000009	T	0.15392	0.0371	M	0.70595	2.14	0.40562	D	0.981227	D	0.89917	1.0	D	0.87578	0.998	T	0.00024	-1.2325	10	0.87932	D	0	-26.1148	17.6744	0.88226	0.0:0.0:1.0:0.0	.	395	Q5W0Q7	USPL1_HUMAN	C	395	ENSP00000255304:G395C	ENSP00000255304:G395C	G	+	1	0	USPL1	30119139	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.985000	0.49362	2.781000	0.95711	0.650000	0.86243	GGT	USPL1	-	pfscan_Peptidase_C19	ENSG00000132952		0.323	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USPL1	HGNC	protein_coding	OTTHUMT00000044369.1	382	0.00	0	G	NM_005800		31221139	31221139	+1	no_errors	ENST00000255304	ensembl	human	known	69_37n	missense	212	46.60	185	SNP	1.000	T
VAMP7	6845	genome.wustl.edu	37	X	155169387	155169387	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chrX:155169387G>T	ENST00000286448.6	+	7	689	c.524G>T	c.(523-525)aGc>aTc	p.S175I	VAMP7_ENST00000460621.1_Missense_Mutation_p.S134I|VAMP7_ENST00000262640.6_Missense_Mutation_p.Q152H|VAMP7_ENST00000479687.1_3'UTR	NM_001145149.2|NM_005638.5	NP_001138621.1|NP_005629.1	P51809	VAMP7_HUMAN	vesicle-associated membrane protein 7	175	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				calcium ion-dependent exocytosis (GO:0017156)|endosome to lysosome transport (GO:0008333)|eosinophil degranulation (GO:0043308)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi to plasma membrane protein transport (GO:0043001)|membrane organization (GO:0061024)|neutrophil degranulation (GO:0043312)|phagocytosis, engulfment (GO:0006911)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of protein targeting to vacuolar membrane (GO:1900483)|SNARE complex assembly (GO:0035493)|triglyceride transport (GO:0034197)|vesicle fusion (GO:0006906)|vesicle fusion with Golgi apparatus (GO:0048280)|vesicle-mediated transport (GO:0016192)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|synapse (GO:0045202)				large_intestine(1)|lung(8)	9	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AAAACTACCAGCAGAAATCTT	0.388																																						dbGAP											0													485.0	497.0	493.0					X																	155169387		2203	4296	6499	-	-	-	SO:0001583	missense	0			AJ295938	CCDS14770.4, CCDS48199.1, CCDS55548.1	Xq28 and Yq12	2013-02-13	2007-12-05	2007-12-05	ENSG00000124333	ENSG00000124333		"""Pseudoautosomal regions / PAR2"", ""Vesicle-associated membrane proteins"""	11486	protein-coding gene	gene with protein product		300053	"""synaptobrevin-like 1"""	SYBL1		8640232, 11440841	Standard	NM_001145149		Approved	VAMP-7, TI-VAMP	uc004fns.3	P51809	OTTHUMG00000022679	ENST00000286448.6:c.524G>T	X.37:g.155169387G>T	ENSP00000286448:p.Ser175Ile		Q53GY7|Q7Z409|Q9H4A7	Missense_Mutation	SNP	superfamily_Longin-like_dom,pfscan_Longin_dom	p.Q152H	ENST00000286448.6	37	c.456	CCDS14770.4	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.15|15.15	2.749413|2.749413	0.49257|0.49257	.|.	.|.	ENSG00000124333|ENSG00000124333	ENST00000262640|ENST00000286448;ENST00000460621	T|T;T	0.20200|0.54675	2.09|0.56;0.56	2.99|2.99	2.99|2.99	0.34606|0.34606	.|Synaptobrevin (2);	0.439260|.	0.25166|.	N|.	0.032639|.	T|T	0.69033|0.69033	0.3066|0.3066	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|D;D;D;D	0.30664|0.89917	0.289|1.0;0.983;0.999;0.991	B|D;D;D;D	0.38056|0.75484	0.264|0.986;0.961;0.959;0.945	T|T	0.57201|0.57201	-0.7852|-0.7852	9|8	0.87932|0.87932	D|D	0|0	.|.	11.0619|11.0619	0.47953|0.47953	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	152|108;136;134;175	P51809-2|B4DE96;B4DIH9;P51809-3;P51809	.|.;.;.;VAMP7_HUMAN	H|I	152|175;134	ENSP00000262640:Q152H|ENSP00000286448:S175I;ENSP00000427822:S134I	ENSP00000262640:Q152H|ENSP00000286448:S175I	Q|S	+|+	3|2	2|0	VAMP7|VAMP7	154822581|154822581	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.548000|0.548000	0.35241|0.35241	7.862000|7.862000	0.87013|0.87013	1.514000|1.514000	0.48869|0.48869	0.279000|0.279000	0.19357|0.19357	CAG|AGC	VAMP7	-	NULL	ENSG00000124333		0.388	VAMP7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VAMP7	HGNC	protein_coding	OTTHUMT00000058843.1	1724	0.12	2	G	NM_005638		155169387	155169387	+1	no_errors	ENST00000262640	ensembl	human	known	69_37n	missense	1829	29.45	764	SNP	1.000	T
VN1R2	317701	genome.wustl.edu	37	19	53762388	53762388	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr19:53762388A>G	ENST00000341702.3	+	1	844	c.760A>G	c.(760-762)Agt>Ggt	p.S254G		NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	254					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		TGCCCCACTTAGTGATGAAGT	0.433																																						dbGAP											0													130.0	121.0	124.0					19																	53762388		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.760A>G	19.37:g.53762388A>G	ENSP00000351244:p.Ser254Gly		A1L411|Q8TDU4	Missense_Mutation	SNP	pfam_Vmron_rcpt_1,pfam_7TM_GPCR_Rhodpsn,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_supfam,prints_Vmron_rcpt_1	p.S254G	ENST00000341702.3	37	c.760	CCDS12862.1	19	.	.	.	.	.	.	.	.	.	.	A	1.167	-0.642046	0.03531	.	.	ENSG00000196131	ENST00000341702	T	0.14516	2.5	2.97	-5.95	0.02241	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.04952	0.0133	N	0.10945	0.07	0.09310	N	1	B	0.24963	0.115	B	0.26094	0.066	T	0.33752	-0.9856	9	0.21540	T	0.41	.	2.332	0.04238	0.5256:0.1259:0.1033:0.2451	.	254	Q8NFZ6	VN1R2_HUMAN	G	254	ENSP00000351244:S254G	ENSP00000351244:S254G	S	+	1	0	VN1R2	58454200	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.057000	0.03486	-2.550000	0.00480	-1.187000	0.01702	AGT	VN1R2	-	pfam_Vmron_rcpt_1,pfam_7TM_GPCR_Rhodpsn,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196131		0.433	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VN1R2	HGNC	protein_coding	OTTHUMT00000464285.1	65	0.00	0	A	NM_173856		53762388	53762388	+1	no_errors	ENST00000341702	ensembl	human	known	69_37n	missense	75	12.79	11	SNP	0.000	G
VNN2	8875	genome.wustl.edu	37	6	133077134	133077134	+	Missense_Mutation	SNP	C	C	G	rs185267705		TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr6:133077134C>G	ENST00000326499.6	-	3	509	c.385G>C	c.(385-387)Gcc>Ccc	p.A129P	VNN2_ENST00000525270.1_Missense_Mutation_p.A76P|RP1-55C23.7_ENST00000430895.1_RNA|VNN2_ENST00000526192.1_5'UTR|VNN2_ENST00000525289.1_Missense_Mutation_p.A129P	NM_004665.2	NP_004656	O95498	VNN2_HUMAN	vanin 2	129	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				cellular component movement (GO:0006928)|pantothenate metabolic process (GO:0015939)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		TTGTCCTTGGCCAGGCAGCTG	0.358																																						dbGAP											0													98.0	85.0	90.0					6																	133077134		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB026705	CCDS5161.1, CCDS5162.1, CCDS56451.1	6q23-q24	2013-02-13			ENSG00000112303	ENSG00000112303	3.5.1.92	"""Vanins"""	12706	protein-coding gene	gene with protein product	"""pantetheinase"""	603571				9790769, 11491533	Standard	NM_078488		Approved	FOAP-4, GPI-80	uc003qdt.3	O95498	OTTHUMG00000015588	ENST00000326499.6:c.385G>C	6.37:g.133077134C>G	ENSP00000322276:p.Ala129Pro		A0AUZ3|A6NDY1|A8K4E3|A8K7W0|B2DFZ0|B2DFZ1|B2DFZ2|B2DFZ3|F6XL73|Q2XUN1|Q9UJF3|Q9UMW2	Missense_Mutation	SNP	pirsf_Biotinidase_euk,pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	p.A129P	ENST00000326499.6	37	c.385	CCDS5161.1	6	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321513	0.60634	.	.	ENSG00000112303	ENST00000326499;ENST00000525270;ENST00000525289;ENST00000524919;ENST00000530536	D;D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.73;-2.73	5.05	5.05	0.67936	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	0.000000	0.64402	D	0.000009	D	0.97445	0.9164	H	0.98370	4.215	0.46586	D	0.999113	D;D	0.89917	1.0;1.0	D;D	0.97110	0.987;1.0	D	0.99041	1.0824	10	0.87932	D	0	-10.5284	18.7711	0.91892	0.0:1.0:0.0:0.0	.	129;129	O95498-2;O95498	.;VNN2_HUMAN	P	129;76;129;129;76	ENSP00000322276:A129P;ENSP00000436822:A76P;ENSP00000436935:A129P;ENSP00000431451:A129P;ENSP00000434210:A76P	ENSP00000322276:A129P	A	-	1	0	VNN2	133118827	1.000000	0.71417	0.955000	0.39395	0.123000	0.20343	4.115000	0.57865	2.515000	0.84797	0.603000	0.83216	GCC	VNN2	-	pirsf_Biotinidase_euk,pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	ENSG00000112303		0.358	VNN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VNN2	HGNC	protein_coding	OTTHUMT00000042264.2	249	0.00	0	C			133077134	133077134	-1	no_errors	ENST00000326499	ensembl	human	known	69_37n	missense	251	29.89	107	SNP	0.994	G
CFAP44	55779	genome.wustl.edu	37	3	113146069	113146069	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr3:113146069C>A	ENST00000295868.2	-	3	380	c.218G>T	c.(217-219)aGt>aTt	p.S73I	WDR52_ENST00000393845.2_Missense_Mutation_p.S73I|WDR52-AS1_ENST00000473329.1_RNA|WDR52-AS1_ENST00000498480.1_RNA	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						CTGAAATGAACTCAAACTTCC	0.363																																						dbGAP											0													197.0	174.0	182.0					3																	113146069		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000295868.2:c.218G>T	3.37:g.113146069C>A	ENSP00000295868:p.Ser73Ile			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S73I	ENST00000295868.2	37	c.218	CCDS2972.1	3	.	.	.	.	.	.	.	.	.	.	C	16.42	3.118171	0.56505	.	.	ENSG00000206530	ENST00000393845;ENST00000295868;ENST00000473143	T;T;T	0.58940	2.55;0.6;0.3	4.15	1.22	0.21188	.	.	.	.	.	T	0.36663	0.0975	L	0.34521	1.04	0.29704	N	0.839927	P	0.40476	0.718	B	0.33690	0.168	T	0.27773	-1.0064	9	0.35671	T	0.21	.	3.6844	0.08323	0.0:0.5554:0.2087:0.2359	.	73	Q96MT7	WDR52_HUMAN	I	73	ENSP00000377428:S73I;ENSP00000295868:S73I;ENSP00000419671:S73I	ENSP00000295868:S73I	S	-	2	0	WDR52	114628759	0.001000	0.12720	0.440000	0.26846	0.162000	0.22319	-0.766000	0.04725	0.251000	0.21505	0.557000	0.71058	AGT	WDR52	-	NULL	ENSG00000206530		0.363	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR52	HGNC	protein_coding	OTTHUMT00000354128.3	251	0.00	0	C			113146069	113146069	-1	no_errors	ENST00000393845	ensembl	human	known	69_37n	missense	300	24.05	95	SNP	0.574	A
ZFP91	80829	genome.wustl.edu	37	11	58384774	58384775	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr11:58384774_58384775insA	ENST00000316059.6	+	11	1479_1480	c.1308_1309insA	c.(1309-1311)aaafs	p.K437fs	ZFP91-CNTF_ENST00000389919.4_Frame_Shift_Ins_p.K437fs	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein	437					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				ATATCTGTGGCAAAAAATTTGA	0.46																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391	ENST00000316059.6:c.1314dupA	11.37:g.58384780_58384780dupA	ENSP00000339030:p.Lys437fs		A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Frame_Shift_Ins	INS	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F438fs	ENST00000316059.6	37	c.1308_1309	CCDS31553.1	11																																																																																			ZFP91	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186660		0.460	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP91	HGNC	protein_coding	OTTHUMT00000268674.1	78	0.00	0	-	NM_053023		58384774	58384775	+1	no_errors	ENST00000316059	ensembl	human	known	69_37n	frame_shift_ins	35	40.68	24	INS	1.000:1.000	A
ZNF841	284371	genome.wustl.edu	37	19	52568485	52568485	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AN-A04D-01A-21W-A050-09	TCGA-AN-A04D-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9407735f-19e3-49d0-b783-cd9672dfa6a9	f491c9e0-384e-4dc9-973f-d4513f9acef9	g.chr19:52568485T>A	ENST00000426391.2	-	5	2853	c.2302A>T	c.(2302-2304)Aaa>Taa	p.K768*	ZNF432_ENST00000598446.1_Intron|ZNF841_ENST00000594295.1_Nonsense_Mutation_p.K884*|ZNF841_ENST00000389534.4_Nonsense_Mutation_p.K884*|ZNF841_ENST00000359973.2_Nonsense_Mutation_p.K460*|CTC-471J1.2_ENST00000569091.1_RNA			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	768					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						ATGTAAGATTTGCCACACTCA	0.418																																						dbGAP											0													247.0	203.0	216.0					19																	52568485		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.2302A>T	19.37:g.52568485T>A	ENSP00000415453:p.Lys768*		B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K884*	ENST00000426391.2	37	c.2650		19	.	.	.	.	.	.	.	.	.	.	T	44	10.574226	0.99430	.	.	ENSG00000197608	ENST00000389534;ENST00000426391;ENST00000359973	.	.	.	1.69	0.379	0.16213	.	.	.	.	.	.	.	.	.	.	.	0.54753	D	0.999986	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.1527	0.15019	0.0:0.2056:0.0:0.7944	.	.	.	.	X	884;768;460	.	ENSP00000353060:K460X	K	-	1	0	ZNF841	57260297	0.779000	0.28652	0.002000	0.10522	0.856000	0.48823	2.090000	0.41682	-0.112000	0.11979	0.260000	0.18958	AAA	ZNF841	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197608		0.418	ZNF841-001	PUTATIVE	basic	protein_coding	ZNF841	HGNC	protein_coding	OTTHUMT00000462435.1	249	0.00	0	T	XM_209155		52568485	52568485	-1	no_errors	ENST00000389534	ensembl	human	known	69_37n	nonsense	168	45.10	138	SNP	0.753	A
