#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACAT2	39	genome.wustl.edu	37	6	160189602	160189602	+	Silent	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr6:160189602C>T	ENST00000367048.4	+	4	2192	c.432C>T	c.(430-432)gaC>gaT	p.D144D	ACAT2_ENST00000541436.1_Silent_p.D173D	NM_005891.2	NP_005882.2	Q9BWD1	THIC_HUMAN	acetyl-CoA acetyltransferase 2	144					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acetyl-CoA C-acetyltransferase activity (GO:0003985)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(1)	9		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CACTGACTGACAGTATACTCT	0.398																																						dbGAP											0													179.0	161.0	167.0					6																	160189602		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF356877	CCDS5268.1	6q25.3	2014-05-19	2010-04-30		ENSG00000120437	ENSG00000120437	2.3.1.9		94	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	100678	"""acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase)"", ""acetyl-Coenzyme A acetyltransferase 2"""			2475872	Standard	NM_005891		Approved		uc010kjy.3	Q9BWD1	OTTHUMG00000015935	ENST00000367048.4:c.432C>T	6.37:g.160189602C>T			B7Z233|E1P5B1|Q16146|Q5TCL7|Q8TDM4	Silent	SNP	pfam_Thiolase_N,pfam_Thiolase_C,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	p.D173	ENST00000367048.4	37	c.519	CCDS5268.1	6																																																																																			ACAT2	-	pfam_Thiolase_N,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	ENSG00000120437		0.398	ACAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAT2	HGNC	protein_coding	OTTHUMT00000042912.1	89	0.00	0	C	NM_005891		160189602	160189602	+1	no_errors	ENST00000541436	ensembl	human	known	69_37n	silent	259	32.73	126	SNP	1.000	T
ADAMTS14	140766	genome.wustl.edu	37	10	72498656	72498656	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr10:72498656G>T	ENST00000373207.1	+	11	1658	c.1658G>T	c.(1657-1659)gGa>gTa	p.G553V	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.G556V	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	553	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						GGCCAGGATGGAGGCTGGAGC	0.632																																						dbGAP											0													75.0	68.0	70.0					10																	72498656		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.1658G>T	10.37:g.72498656G>T	ENSP00000362303:p.Gly553Val		Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.G556V	ENST00000373207.1	37	c.1667	CCDS7306.1	10	.	.	.	.	.	.	.	.	.	.	G	26.8	4.774576	0.90108	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.62364	0.03;0.03	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.87633	0.6226	H	0.98426	4.23	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.92566	0.6062	10	0.87932	D	0	.	17.8276	0.88671	0.0:0.0:1.0:0.0	.	486;553;556	Q8WXS8-2;Q8WXS8;Q5T4G1	.;ATS14_HUMAN;.	V	556;553	ENSP00000362304:G556V;ENSP00000362303:G553V	ENSP00000362303:G553V	G	+	2	0	ADAMTS14	72168662	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	9.657000	0.98554	2.533000	0.85409	0.455000	0.32223	GGA	ADAMTS14	-	superfamily_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000138316		0.632	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAMTS14	HGNC	protein_coding	OTTHUMT00000048522.1	88	0.00	0	G	NM_080722		72498656	72498656	+1	no_errors	ENST00000373208	ensembl	human	known	69_37n	missense	53	50.00	53	SNP	1.000	T
ADCY9	115	genome.wustl.edu	37	16	4057542	4057542	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr16:4057542T>A	ENST00000294016.3	-	3	2249	c.1711A>T	c.(1711-1713)Ata>Tta	p.I571L	ADCY9_ENST00000571889.1_5'UTR	NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	571					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TGACCCGATATCAGGTATGTC	0.517																																						dbGAP											0													85.0	79.0	81.0					16																	4057542		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.1711A>T	16.37:g.4057542T>A	ENSP00000294016:p.Ile571Leu		A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.I571L	ENST00000294016.3	37	c.1711	CCDS32382.1	16	.	.	.	.	.	.	.	.	.	.	T	15.32	2.799776	0.50208	.	.	ENSG00000162104	ENST00000294016	T	0.77877	-1.13	5.55	4.46	0.54185	Adenylyl cyclase class-3/4/guanylyl cyclase (3);	0.000000	0.85682	D	0.000000	T	0.67906	0.2943	L	0.39397	1.21	0.42046	D	0.991094	B	0.22541	0.071	B	0.22152	0.038	T	0.63883	-0.6536	10	0.48119	T	0.1	.	8.643	0.33989	0.0:0.0875:0.0:0.9125	.	571	O60503	ADCY9_HUMAN	L	571	ENSP00000294016:I571L	ENSP00000294016:I571L	I	-	1	0	ADCY9	3997543	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.284000	0.58983	1.036000	0.39998	0.523000	0.50628	ATA	ADCY9	-	pfam_A/G_cyclase,superfamily_A/G_cyclase	ENSG00000162104		0.517	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY9	HGNC	protein_coding	OTTHUMT00000438076.1	104	0.00	0	T			4057542	4057542	-1	no_errors	ENST00000294016	ensembl	human	known	69_37n	missense	78	31.58	36	SNP	1.000	A
AIM1	202	genome.wustl.edu	37	6	106967226	106967226	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr6:106967226G>C	ENST00000369066.3	+	2	1406	c.919G>C	c.(919-921)Gca>Cca	p.A307P		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TGTTGGGAGGGCAAAGCTGAA	0.438																																						dbGAP											0													58.0	58.0	58.0					6																	106967226		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.919G>C	6.37:g.106967226G>C	ENSP00000358062:p.Ala307Pro		Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.A307P	ENST00000369066.3	37	c.919	CCDS34506.1	6	.	.	.	.	.	.	.	.	.	.	G	19.17	3.776478	0.70107	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	D	0.83992	-1.79	5.73	5.73	0.89815	.	0.347275	0.20963	N	0.082540	D	0.89403	0.6705	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.89390	0.3688	10	0.72032	D	0.01	.	19.9002	0.96983	0.0:0.0:1.0:0.0	.	307	Q9Y4K1	AIM1_HUMAN	P	715;307	ENSP00000358062:A307P	ENSP00000285105:A715P	A	+	1	0	AIM1	107073919	1.000000	0.71417	0.975000	0.42487	0.256000	0.26092	6.776000	0.75023	2.709000	0.92574	0.655000	0.94253	GCA	AIM1	-	NULL	ENSG00000112297		0.438	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM1	HGNC	protein_coding	OTTHUMT00000041669.1	60	0.00	0	G			106967226	106967226	+1	no_errors	ENST00000369066	ensembl	human	known	69_37n	missense	91	35.46	50	SNP	1.000	C
ALMS1	7840	genome.wustl.edu	37	2	73747041	73747041	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr2:73747041C>T	ENST00000264448.6	+	11	9787	c.9676C>T	c.(9676-9678)Cat>Tat	p.H3226Y	ALMS1_ENST00000409009.1_Missense_Mutation_p.H3184Y	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	3226					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						AGATCGTGGACATGAAATTAT	0.403																																						dbGAP											0													134.0	127.0	130.0					2																	73747041		1845	4084	5929	-	-	-	SO:0001583	missense	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.9676C>T	2.37:g.73747041C>T	ENSP00000264448:p.His3226Tyr		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.H3226Y	ENST00000264448.6	37	c.9676	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	C	12.78	2.039159	0.35989	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.06068	3.35;3.35	5.41	1.3	0.21679	.	1.339030	0.04757	N	0.425649	T	0.05731	0.0150	L	0.34521	1.04	0.09310	N	1	B;B;B;B	0.25441	0.021;0.126;0.017;0.007	B;B;B;B	0.16289	0.009;0.015;0.015;0.009	T	0.39643	-0.9604	10	0.48119	T	0.1	.	4.0823	0.09932	0.3246:0.5002:0.0:0.1752	.	3226;3226;3184;3226	D6W5H5;Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;.;ALMS1_HUMAN	Y	3184;3226	ENSP00000386627:H3184Y;ENSP00000264448:H3226Y	ENSP00000264448:H3226Y	H	+	1	0	ALMS1	73600549	0.000000	0.05858	0.000000	0.03702	0.164000	0.22412	-0.105000	0.10907	0.344000	0.23847	0.650000	0.86243	CAT	ALMS1	-	NULL	ENSG00000116127		0.403	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	301	0.00	0	C	NM_015120		73747041	73747041	+1	no_errors	ENST00000264448	ensembl	human	known	69_37n	missense	190	27.76	73	SNP	0.000	T
ANKRD30A	91074	genome.wustl.edu	37	10	37490246	37490246	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr10:37490246A>T	ENST00000602533.1	+	31	2793	c.2694A>T	c.(2692-2694)aaA>aaT	p.K898N	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.K1017N|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.K898N			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	954					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						TAAGTGGAAAATTAGAAGGTA	0.338																																						dbGAP											0													75.0	71.0	72.0					10																	37490246		1805	4066	5871	-	-	-	SO:0001583	missense	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2694A>T	10.37:g.37490246A>T	ENSP00000473551:p.Lys898Asn		Q5W025	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.K898N	ENST00000602533.1	37	c.2694		10	.	.	.	.	.	.	.	.	.	.	a	6.664	0.491055	0.12702	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.16897	2.31;2.31	1.38	1.38	0.22167	.	.	.	.	.	T	0.12220	0.0297	L	0.48642	1.525	0.09310	N	1	B	0.31931	0.347	B	0.20577	0.03	T	0.20940	-1.0260	9	0.54805	T	0.06	.	4.9464	0.13991	1.0:0.0:0.0:0.0	.	954	Q9BXX3	AN30A_HUMAN	N	898;1017	ENSP00000354432:K898N;ENSP00000363792:K1017N	ENSP00000354432:K898N	K	+	3	2	ANKRD30A	37530252	0.895000	0.30542	0.001000	0.08648	0.002000	0.02628	1.582000	0.36568	0.914000	0.36822	0.362000	0.22060	AAA	ANKRD30A	-	NULL	ENSG00000148513		0.338	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	107	0.00	0	A	NM_052997		37490246	37490246	+1	no_errors	ENST00000361713	ensembl	human	known	69_37n	missense	113	34.68	60	SNP	0.001	T
ARID3C	138715	genome.wustl.edu	37	9	34623463	34623463	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr9:34623463G>A	ENST00000378909.2	-	4	916	c.824C>T	c.(823-825)gCg>gTg	p.A275V	DCTN3_ENST00000447983.2_5'Flank|DCTN3_ENST00000378916.4_5'Flank|DCTN3_ENST00000378913.2_5'Flank|DCTN3_ENST00000477738.2_5'Flank|DCTN3_ENST00000341694.2_5'Flank|DCTN3_ENST00000259632.7_5'Flank	NM_001017363.1	NP_001017363.1	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT-like)	275	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane raft (GO:0045121)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	14	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		GCATGCATGCGCTGGCAGGCC	0.662																																						dbGAP											0													50.0	57.0	54.0					9																	34623463		2197	4290	6487	-	-	-	SO:0001583	missense	0				CCDS35006.1	9p13.2	2013-02-07	2006-11-08		ENSG00000205143	ENSG00000205143		"""-"""	21209	protein-coding gene	gene with protein product			"""AT rich interactive domain 3C (BRIGHT- like)"""				Standard	NM_001017363		Approved		uc011lon.2	A6NKF2	OTTHUMG00000000445	ENST00000378909.2:c.824C>T	9.37:g.34623463G>A	ENSP00000368189:p.Ala275Val			Missense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.A275V	ENST00000378909.2	37	c.824	CCDS35006.1	9	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299234	0.40694	.	.	ENSG00000205143	ENST00000378909	T	0.45668	0.89	5.09	0.975	0.19721	.	2.020920	0.03270	N	0.184570	T	0.31888	0.0811	L	0.43152	1.355	0.09310	N	1	B	0.31769	0.339	B	0.18561	0.022	T	0.12528	-1.0544	10	0.29301	T	0.29	-2.4795	5.682	0.17782	0.2377:0.1392:0.6231:0.0	.	275	A6NKF2	ARI3C_HUMAN	V	275	ENSP00000368189:A275V	ENSP00000368189:A275V	A	-	2	0	ARID3C	34613463	0.000000	0.05858	0.027000	0.17364	0.298000	0.27526	-0.158000	0.10070	0.176000	0.19873	0.448000	0.29417	GCG	ARID3C	-	NULL	ENSG00000205143		0.662	ARID3C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID3C	HGNC	protein_coding	OTTHUMT00000348265.1	8	0.00	0	G	XM_071061		34623463	34623463	-1	no_errors	ENST00000378909	ensembl	human	known	69_37n	missense	14	48.15	13	SNP	0.002	A
B3GALT1	8708	genome.wustl.edu	37	2	168725803	168725803	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr2:168725803G>A	ENST00000392690.3	+	1	346	c.254G>A	c.(253-255)aGc>aAc	p.S85N	B3GALT1_ENST00000305861.1_Missense_Mutation_p.S85N|AC016723.4_ENST00000430546.1_RNA|AC016723.4_ENST00000436982.2_RNA			Q9Y5Z6	B3GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1	85					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			cervix(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18						ATCCTCATCAGCACCACTCAC	0.433																																						dbGAP											0													74.0	74.0	74.0					2																	168725803		2203	4300	6503	-	-	-	SO:0001583	missense	0			E07739	CCDS2227.1	2q24.3	2013-02-19			ENSG00000172318	ENSG00000172318		"""Beta 3-glycosyltransferases"""	916	protein-coding gene	gene with protein product		603093				9582303	Standard	NM_020981		Approved	beta3Gal-T1	uc002udz.1	Q9Y5Z6	OTTHUMG00000132163	ENST00000392690.3:c.254G>A	2.37:g.168725803G>A	ENSP00000376456:p.Ser85Asn		D3DPB8|Q53SS2	Missense_Mutation	SNP	pfam_Glyco_trans_31	p.S85N	ENST00000392690.3	37	c.254	CCDS2227.1	2	.	.	.	.	.	.	.	.	.	.	G	13.33	2.204087	0.38905	.	.	ENSG00000172318	ENST00000305861;ENST00000392690	T;T	0.37584	1.19;1.19	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.37732	0.1014	L	0.47716	1.5	0.48901	D	0.999724	B	0.30511	0.282	B	0.30105	0.111	T	0.04961	-1.0915	10	0.34782	T	0.22	-30.6905	20.8598	0.99761	0.0:0.0:1.0:0.0	.	85	Q9Y5Z6	B3GT1_HUMAN	N	85	ENSP00000303740:S85N;ENSP00000376456:S85N	ENSP00000303740:S85N	S	+	2	0	B3GALT1	168434049	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.477000	0.81069	2.937000	0.99478	0.650000	0.86243	AGC	B3GALT1	-	NULL	ENSG00000172318		0.433	B3GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GALT1	HGNC	protein_coding	OTTHUMT00000255211.2	141	0.00	0	G	NM_020981		168725803	168725803	+1	no_errors	ENST00000305861	ensembl	human	known	69_37n	missense	73	36.52	42	SNP	1.000	A
BBS2	583	genome.wustl.edu	37	16	56553673	56553673	+	Silent	SNP	G	G	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr16:56553673G>A	ENST00000245157.5	-	1	522	c.102C>T	c.(100-102)gcC>gcT	p.A34A	BBS2_ENST00000568104.1_Silent_p.A34A	NM_031885.3	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2	34					adult behavior (GO:0030534)|artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|cilium morphogenesis (GO:0060271)|fat cell differentiation (GO:0045444)|Golgi to plasma membrane protein transport (GO:0043001)|hippocampus development (GO:0021766)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|positive regulation of multicellular organism growth (GO:0040018)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sperm axoneme assembly (GO:0007288)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)	26						CCGTTTGGGTGGCGGCCGCCA	0.692									Bardet-Biedl syndrome																													dbGAP											0													36.0	36.0	36.0					16																	56553673		2197	4298	6495	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF342736	CCDS32451.1	16q21	2013-01-08				ENSG00000125124			967	protein-coding gene	gene with protein product		606151		BBS		11285252	Standard	NM_031885		Approved		uc002ejd.2	Q9BXC9		ENST00000245157.5:c.102C>T	16.37:g.56553673G>A			Q96CM0|Q96SN9	Silent	SNP	superfamily_WD40_repeat_dom,pirsf_Bardet-Biedl_syndrome_2_prot	p.A34	ENST00000245157.5	37	c.102	CCDS32451.1	16																																																																																			BBS2	-	superfamily_WD40_repeat_dom,pirsf_Bardet-Biedl_syndrome_2_prot	ENSG00000125124		0.692	BBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS2	HGNC	protein_coding	OTTHUMT00000434386.2	38	0.00	0	G	NM_031885		56553673	56553673	-1	no_errors	ENST00000245157	ensembl	human	known	69_37n	silent	72	28.00	28	SNP	1.000	A
BCL2L11	10018	genome.wustl.edu	37	2	111881572	111881572	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr2:111881572A>G	ENST00000393256.3	+	2	523	c.250A>G	c.(250-252)Aga>Gga	p.R84G	BCL2L11_ENST00000393253.2_Intron|BCL2L11_ENST00000337565.5_Intron|BCL2L11_ENST00000405953.1_Intron|BCL2L11_ENST00000308659.8_Intron|BCL2L11_ENST00000357757.2_Missense_Mutation_p.R84G	NM_001204106.1|NM_006538.4|NM_138621.4|NM_138627.3	NP_001191035.1|NP_006529.1|NP_619527.1|NP_619533.1	O43521	B2L11_HUMAN	BCL2-like 11 (apoptosis facilitator)	84					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|brain development (GO:0007420)|cell-matrix adhesion (GO:0007160)|cellular process regulating host cell cycle in response to virus (GO:0060154)|developmental pigmentation (GO:0048066)|ear development (GO:0043583)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of cell cycle (GO:0045787)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic organ morphogenesis (GO:0048563)|regulation of developmental pigmentation (GO:0048070)|regulation of organ growth (GO:0046620)|response to endoplasmic reticulum stress (GO:0034976)|spermatogenesis (GO:0007283)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|thymocyte apoptotic process (GO:0070242)|thymus development (GO:0048538)|tube formation (GO:0035148)	BIM-BCL-2 complex (GO:0097141)|BIM-BCL-xl complex (GO:0097140)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|mitochondrial outer membrane (GO:0005741)				endometrium(4)|large_intestine(3)|lung(2)|prostate(2)	11						CATCTTTATGAGAAGATCCTC	0.577																																						dbGAP											0													75.0	82.0	80.0					2																	111881572		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF032458	CCDS2089.1, CCDS2092.1, CCDS42731.1, CCDS56131.1, CCDS56132.1, CCDS56133.1, CCDS56134.1, CCDS56135.1, CCDS56136.1, CCDS74560.1, CCDS74561.1, CCDS74559.1	2q13	2014-09-17			ENSG00000153094	ENSG00000153094			994	protein-coding gene	gene with protein product		603827				9731710, 9430630	Standard	NM_006538		Approved	BOD, BimL, BimEL, BimS, BIM	uc002tgv.1	O43521	OTTHUMG00000131256	ENST00000393256.3:c.250A>G	2.37:g.111881572A>G	ENSP00000376943:p.Arg84Gly		A8K2W2|O43522|Q0MSE7|Q0MSE8|Q0MSE9|Q53R28|Q6JTU6|Q6T851|Q6TE14|Q6TE15|Q6TE16|Q6V402|Q8WYL6|Q8WYL7|Q8WYL8|Q8WYL9|Q8WYM0|Q8WYM1	Missense_Mutation	SNP	pfam_Bcl-x_interacting,pfam_Apoptosis_Bim_N,pirsf_Bcl-2-like_11	p.R84G	ENST00000393256.3	37	c.250	CCDS2089.1	2	.	.	.	.	.	.	.	.	.	.	A	18.76	3.692808	0.68271	.	.	ENSG00000153094	ENST00000432179;ENST00000357757;ENST00000393256	T;T;T	0.47177	0.85;0.85;0.85	5.5	2.9	0.33743	.	0.000000	0.64402	D	0.000001	T	0.52008	0.1708	L	0.27053	0.805	0.80722	D	1	D;D	0.61080	0.989;0.981	D;D	0.75020	0.985;0.966	T	0.53947	-0.8366	10	0.66056	D	0.02	-8.3634	10.7779	0.46361	0.7002:0.2998:0.0:0.0	.	84;84	O43521-11;O43521	.;B2L11_HUMAN	G	84	ENSP00000411870:R84G;ENSP00000350398:R84G;ENSP00000376943:R84G	ENSP00000350398:R84G	R	+	1	2	BCL2L11	111598043	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.486000	0.35530	0.994000	0.38892	0.533000	0.62120	AGA	BCL2L11	-	pirsf_Bcl-2-like_11	ENSG00000153094		0.577	BCL2L11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL2L11	HGNC	protein_coding	OTTHUMT00000254022.3	15	0.00	0	A			111881572	111881572	+1	no_errors	ENST00000393256	ensembl	human	known	69_37n	missense	151	33.48	76	SNP	1.000	G
BRCA2	675	genome.wustl.edu	37	13	32936802	32936802	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr13:32936802G>C	ENST00000380152.3	+	17	8181	c.7948G>C	c.(7948-7950)Gaa>Caa	p.E2650Q	BRCA2_ENST00000544455.1_Missense_Mutation_p.E2650Q			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2650					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		CCTAAGCCCAGAAAGGGTGCT	0.373			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	0													90.0	82.0	85.0					13																	32936802		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.7948G>C	13.37:g.32936802G>C	ENSP00000369497:p.Glu2650Gln		O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold-like,pirsf_DNA_recomb/repair_BRCA2,pfscan_BRCA2_repeat	p.E2650Q	ENST00000380152.3	37	c.7948	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	G	33	5.244817	0.95272	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	D;D	0.90563	-2.69;-2.69	5.66	5.66	0.87406	DNA recombination/repair protein BRCA2, helical domain (2);	0.000000	0.85682	D	0.000000	D	0.94608	0.8262	L	0.60904	1.88	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93917	0.7202	10	0.52906	T	0.07	.	20.1041	0.97884	0.0:0.0:1.0:0.0	.	2650	P51587	BRCA2_HUMAN	Q	2650	ENSP00000369497:E2650Q;ENSP00000439902:E2650Q	ENSP00000369497:E2650Q	E	+	1	0	BRCA2	31834802	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	9.789000	0.99068	2.826000	0.97356	0.655000	0.94253	GAA	BRCA2	-	pfam_DNA_recomb/repair_BRCA2_hlx,superfamily_DNA_recomb/repair_BRCA2_hlx,pirsf_DNA_recomb/repair_BRCA2	ENSG00000139618		0.373	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding	OTTHUMT00000046000.2	313	0.00	0	G	NM_000059		32936802	32936802	+1	no_errors	ENST00000380152	ensembl	human	known	69_37n	missense	120	33.70	61	SNP	1.000	C
C15orf39	56905	genome.wustl.edu	37	15	75500670	75500670	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr15:75500670G>A	ENST00000360639.2	+	2	2601	c.2281G>A	c.(2281-2283)Gac>Aac	p.D761N	RP11-69H7.3_ENST00000563568.1_RNA|C15orf39_ENST00000567617.1_Missense_Mutation_p.D761N|C15orf39_ENST00000394987.4_Missense_Mutation_p.D761N			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	761						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						agccccagGGGACTCCCTGGA	0.612																																						dbGAP											0													26.0	24.0	25.0					15																	75500670		2181	4287	6468	-	-	-	SO:0001583	missense	0			AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.2281G>A	15.37:g.75500670G>A	ENSP00000353854:p.Asp761Asn		B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Missense_Mutation	SNP	NULL	p.D761N	ENST00000360639.2	37	c.2281	CCDS10276.1	15	.	.	.	.	.	.	.	.	.	.	G	12.08	1.829776	0.32329	.	.	ENSG00000167173	ENST00000360639;ENST00000394987;ENST00000446981	T;T	0.18016	2.24;2.24	5.1	3.2	0.36748	.	0.691550	0.14296	N	0.328576	T	0.12347	0.0300	L	0.47716	1.5	0.09310	N	1	B;B	0.32160	0.231;0.358	B;B	0.31101	0.087;0.124	T	0.29058	-1.0024	10	0.17369	T	0.5	-4.9285	4.3039	0.10937	0.0862:0.1547:0.5995:0.1597	.	323;761	Q2VPA3;Q6ZRI6	.;CO039_HUMAN	N	761;761;159	ENSP00000353854:D761N;ENSP00000378438:D761N	ENSP00000353854:D761N	D	+	1	0	C15orf39	73287723	0.000000	0.05858	0.040000	0.18447	0.025000	0.11179	0.491000	0.22419	0.526000	0.28541	0.655000	0.94253	GAC	C15orf39	-	NULL	ENSG00000167173		0.612	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf39	HGNC	protein_coding	OTTHUMT00000286410.1	22	0.00	0	G	NM_015492		75500670	75500670	+1	no_errors	ENST00000360639	ensembl	human	known	69_37n	missense	58	14.49	10	SNP	0.000	A
C20orf195	79025	genome.wustl.edu	37	20	62187736	62187736	+	Silent	SNP	T	T	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr20:62187736T>C	ENST00000370098.3	+	2	812	c.720T>C	c.(718-720)taT>taC	p.Y240Y	C20orf195_ENST00000370097.1_Silent_p.Y240Y	NM_024059.2	NP_076964.1	Q9BVV2	CT195_HUMAN	chromosome 20 open reading frame 195	240	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular vesicular exosome (GO:0070062)				large_intestine(3)|lung(4)	7	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			CGGAGCAGTATGAGTTGCGCT	0.652																																						dbGAP											0													96.0	97.0	96.0					20																	62187736		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS13526.1	20q13.33	2014-02-12			ENSG00000125531	ENSG00000125531			28764	protein-coding gene	gene with protein product						12477932	Standard	NM_024059		Approved	MGC5356	uc002yfj.3	Q9BVV2	OTTHUMG00000032980	ENST00000370098.3:c.720T>C	20.37:g.62187736T>C				Silent	SNP	superfamily_Fibronectin_type3	p.Y240	ENST00000370098.3	37	c.720	CCDS13526.1	20																																																																																			C20orf195	-	superfamily_Fibronectin_type3	ENSG00000125531		0.652	C20orf195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf195	HGNC	protein_coding	OTTHUMT00000080155.1	13	0.00	0	T	NM_024059		62187736	62187736	+1	no_errors	ENST00000370097	ensembl	human	known	69_37n	silent	19	42.86	15	SNP	0.033	C
C5orf60	285679	genome.wustl.edu	37	5	179069969	179069969	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr5:179069969G>C	ENST00000448248.2	-	4	609	c.584C>G	c.(583-585)tCc>tGc	p.S195C	C5orf60_ENST00000506142.1_5'UTR	NM_001142306.1	NP_001135778.1	A6NFR6	CE060_HUMAN	chromosome 5 open reading frame 60	195	Ser-rich.					integral component of membrane (GO:0016021)				NS(1)|breast(1)|kidney(5)	7						TCGTGGCTTGGAGGAGCTCAG	0.627																																						dbGAP											0													59.0	65.0	63.0					5																	179069969		692	1591	2283	-	-	-	SO:0001583	missense	0			BC043435	CCDS47353.1	5q35.3	2010-08-19			ENSG00000204661	ENSG00000204661			27753	protein-coding gene	gene with protein product						12477932	Standard	NM_001142306		Approved		uc003mki.3	A6NFR6	OTTHUMG00000163221	ENST00000448248.2:c.584C>G	5.37:g.179069969G>C	ENSP00000404583:p.Ser195Cys		A1L488|B7ZM52|B7ZM53	Missense_Mutation	SNP	NULL	p.S195C	ENST00000448248.2	37	c.584	CCDS47353.1	5	.	.	.	.	.	.	.	.	.	.	g	10.19	1.283078	0.23392	.	.	ENSG00000204661	ENST00000448248	T	0.47177	0.85	0.436	0.436	0.16549	.	.	.	.	.	T	0.54095	0.1837	L	0.43923	1.385	0.09310	N	1	D;D	0.67145	0.996;0.996	D;D	0.65773	0.938;0.938	T	0.41734	-0.9492	8	0.87932	D	0	.	.	.	.	.	195;195	A6NFR6-2;A6NFR6-4	.;.	C	195	ENSP00000404583:S195C	ENSP00000404583:S195C	S	-	2	0	C5orf60	179002575	0.001000	0.12720	0.012000	0.15200	0.006000	0.05464	-0.555000	0.05999	0.468000	0.27243	0.205000	0.17691	TCC	C5orf60	-	NULL	ENSG00000204661		0.627	C5orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf60	HGNC	protein_coding	OTTHUMT00000372148.2	131	0.00	0	G	NM_001142306		179069969	179069969	-1	no_errors	ENST00000448248	ensembl	human	known	69_37n	missense	126	44.74	102	SNP	0.013	C
CACNA1B	774	genome.wustl.edu	37	9	140970316	140970316	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr9:140970316C>T	ENST00000371372.1	+	35	5048	c.4903C>T	c.(4903-4905)Cac>Tac	p.H1635Y	CACNA1B_ENST00000277551.2_Missense_Mutation_p.H1635Y|CACNA1B_ENST00000371357.1_Missense_Mutation_p.H1634Y|CACNA1B_ENST00000277549.5_Missense_Mutation_p.H829Y|CACNA1B_ENST00000371365.2_5'UTR|CACNA1B_ENST00000371363.1_Missense_Mutation_p.H1633Y|CACNA1B_ENST00000371355.4_Missense_Mutation_p.H1636Y	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1635					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CATCAACCGCCACAACAACTT	0.577																																						dbGAP											0													60.0	65.0	63.0					9																	140970316		1994	4176	6170	-	-	-	SO:0001583	missense	0			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.4903C>T	9.37:g.140970316C>T	ENSP00000360423:p.His1635Tyr		B1AQK5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.H1636Y	ENST00000371372.1	37	c.4906	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	C	20.2	3.955706	0.73902	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D;D	0.97430	-4.38;-4.38;-4.38;-4.38;-4.38;-4.38	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	D	0.97757	0.9264	L	0.46614	1.455	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.76575	0.988;0.988	D	0.98837	1.0753	10	0.87932	D	0	.	19.1693	0.93570	0.0:1.0:0.0:0.0	.	1634;1633	B1AQK7;B1AQK6	.;.	Y	1635;1635;829;1633;1634;1636	ENSP00000360423:H1635Y;ENSP00000277551:H1635Y;ENSP00000277549:H829Y;ENSP00000360414:H1633Y;ENSP00000360408:H1634Y;ENSP00000360406:H1636Y	ENSP00000277549:H829Y	H	+	1	0	CACNA1B	140090137	1.000000	0.71417	0.997000	0.53966	0.740000	0.42216	4.714000	0.61902	2.607000	0.88179	0.655000	0.94253	CAC	CACNA1B	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000148408		0.577	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	HGNC	protein_coding	OTTHUMT00000055380.1	123	0.00	0	C	NM_000718		140970316	140970316	+1	no_errors	ENST00000371355	ensembl	human	known	69_37n	missense	74	46.76	65	SNP	1.000	T
CAD	790	genome.wustl.edu	37	2	27448725	27448725	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr2:27448725C>A	ENST00000403525.1	+	12	1917	c.1773C>A	c.(1771-1773)gaC>gaA	p.D591E	CAD_ENST00000264705.4_Missense_Mutation_p.D591E			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCTAGTAGACAAGTCTCTGA	0.582																																						dbGAP											0													113.0	105.0	108.0					2																	27448725		2203	4300	6503	-	-	-	SO:0001583	missense	0			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.1773C>A	2.37:g.27448725C>A	ENSP00000384510:p.Asp591Glu		O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_Asp/Orn_carbamoyltranf_P-bd,pfam_GATASE_1,pfam_Asp_carbamoyltransf_Asp/Orn-bd,pfam_CarbamoylP_synth_lsu_oligo,pfam_CarbamoylP_synth_lsu_N,pfam_ATP-grasp_carboxylate-amine,pfam_MGS-like_dom,pfam_Dala_Dala_lig_C,pfam_Amidohydro_1,superfamily_Asp/Orn_carbamoylTrfase,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_fold,superfamily_MGS-like_dom,superfamily_Metal-dep_hydrolase_composite,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,prints_Asp_carbamoyltransf_euk,prints_Asp/Orn_carbamoylTrfase,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu,tigrfam_Asp_carbamoyltransf_euk	p.D591E	ENST00000403525.1	37	c.1773		2	.	.	.	.	.	.	.	.	.	.	C	7.732	0.699398	0.15106	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.95171	-3.63;-3.63	5.65	3.86	0.44501	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Carbamoyl-phosphate synthase, large subunit, CPS-domain (1);	0.000000	0.85682	D	0.000000	D	0.94029	0.8087	L	0.48362	1.52	0.46437	D	0.99904	P;D	0.89917	0.635;1.0	B;D	0.87578	0.259;0.998	D	0.90679	0.4604	10	0.02654	T	1	-1.4667	8.855	0.35223	0.0:0.7684:0.0:0.2316	.	591;591	F8VPD4;P27708	.;PYR1_HUMAN	E	591	ENSP00000264705:D591E;ENSP00000384510:D591E	ENSP00000264705:D591E	D	+	3	2	CAD	27302229	0.976000	0.34144	1.000000	0.80357	0.894000	0.52154	0.246000	0.18160	0.762000	0.33152	0.456000	0.33151	GAC	CAD	-	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,tigrfam_CarbamoylP_synth_lsu	ENSG00000084774		0.582	CAD-002	NOVEL	basic|exp_conf	protein_coding	CAD	HGNC	protein_coding	OTTHUMT00000324970.1	162	0.00	0	C			27448725	27448725	+1	no_errors	ENST00000264705	ensembl	human	known	69_37n	missense	275	31.08	124	SNP	1.000	A
CALCA	796	genome.wustl.edu	37	11	14989307	14989307	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr11:14989307G>C	ENST00000486207.1	-	3	329	c.321C>G	c.(319-321)aaC>aaG	p.N107K	CALCB_ENST00000523376.1_Intron|CALCA_ENST00000361010.3_Missense_Mutation_p.N107K			P06881	CALCA_HUMAN	calcitonin-related polypeptide alpha	107					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|cytosolic calcium ion homeostasis (GO:0051480)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor internalization (GO:0002031)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of blood pressure (GO:0045776)|negative regulation of bone resorption (GO:0045779)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of osteoclast differentiation (GO:0045671)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of vasodilation (GO:0045909)|protein phosphorylation (GO:0006468)|receptor internalization (GO:0031623)|regulation of blood pressure (GO:0008217)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	protein complex binding (GO:0032403)|receptor binding (GO:0005102)			central_nervous_system(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	8						GCACAAAGTTGTTCTTCACCA	0.552																																						dbGAP											0													88.0	82.0	84.0					11																	14989307		2200	4294	6494	-	-	-	SO:0001583	missense	0			X00356, M64486	CCDS7819.1, CCDS31432.1	11p15.2	2014-09-17	2008-02-20		ENSG00000110680	ENSG00000110680		"""Endogenous ligands"""	1437	protein-coding gene	gene with protein product	"""calcitonin"""	114130	"""calcitonin 1"""	CALC1		6546550	Standard	NM_001033953		Approved		uc001mlw.1	P01258	OTTHUMG00000159731	ENST00000486207.1:c.321C>G	11.37:g.14989307G>C	ENSP00000417833:p.Asn107Lys		Q93048|Q9UCP0	Missense_Mutation	SNP	pfam_Procalcitonin/adrenomedullin,smart_Calcitonin_peptide-like,prints_Procalcitonin_gene-rel_peptide,prints_Pro-islet_amyloid_polypep	p.N107K	ENST00000486207.1	37	c.321	CCDS31432.1	11	.	.	.	.	.	.	.	.	.	.	G	8.516	0.867723	0.17250	.	.	ENSG00000110680	ENST00000486207;ENST00000361010	T;T	0.20738	2.05;2.05	4.69	0.519	0.17035	Calcitonin peptide-like (1);	.	.	.	.	T	0.13670	0.0331	L	0.40543	1.245	0.80722	D	1	B	0.22080	0.064	B	0.27380	0.079	T	0.12863	-1.0531	9	0.18276	T	0.48	.	3.858	0.08984	0.1526:0.1285:0.586:0.1329	.	107	P06881	CALCA_HUMAN	K	107	ENSP00000417833:N107K;ENSP00000354286:N107K	ENSP00000354286:N107K	N	-	3	2	CALCA	14945883	1.000000	0.71417	0.000000	0.03702	0.156000	0.22039	2.390000	0.44416	0.110000	0.17919	0.655000	0.94253	AAC	CALCA	-	pfam_Procalcitonin/adrenomedullin,smart_Calcitonin_peptide-like,prints_Procalcitonin_gene-rel_peptide	ENSG00000110680		0.552	CALCA-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CALCA	HGNC	protein_coding	OTTHUMT00000357068.1	133	0.00	0	G	NM_001741		14989307	14989307	-1	no_errors	ENST00000361010	ensembl	human	known	69_37n	missense	91	24.59	30	SNP	0.995	C
CCDC170	80129	genome.wustl.edu	37	6	151907108	151907108	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr6:151907108A>G	ENST00000239374.7	+	7	1276	c.1177A>G	c.(1177-1179)Agg>Ggg	p.R393G	CCDC170_ENST00000367290.5_Missense_Mutation_p.R393G	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	393																	AGCTCTCCAGAGGGCCCAGAA	0.493																																						dbGAP											0													62.0	58.0	59.0					6																	151907108		1877	4118	5995	-	-	-	SO:0001583	missense	0			AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.1177A>G	6.37:g.151907108A>G	ENSP00000239374:p.Arg393Gly		Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_Smac_DIABLO-like	p.R393G	ENST00000239374.7	37	c.1177	CCDS43515.1	6	.	.	.	.	.	.	.	.	.	.	A	19.74	3.884055	0.72410	.	.	ENSG00000120262	ENST00000239374;ENST00000367290	T;T	0.09538	2.97;2.97	5.76	3.15	0.36227	.	0.136632	0.49916	D	0.000131	T	0.20981	0.0505	M	0.79805	2.47	0.44042	D	0.996773	D	0.89917	1.0	D	0.75020	0.985	T	0.01762	-1.1279	10	0.45353	T	0.12	-5.0274	11.9463	0.52930	0.7256:0.2744:0.0:0.0	.	393	Q8IYT3	CF097_HUMAN	G	393	ENSP00000239374:R393G;ENSP00000356259:R393G	ENSP00000239374:R393G	R	+	1	2	C6orf97	151948801	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	0.900000	0.28431	0.951000	0.37770	0.482000	0.46254	AGG	CCDC170	-	NULL	ENSG00000120262		0.493	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC170	HGNC	protein_coding	OTTHUMT00000042727.2	115	0.00	0	A	NM_025059		151907108	151907108	+1	no_errors	ENST00000367290	ensembl	human	known	69_37n	missense	248	25.30	84	SNP	1.000	G
CEACAM21	90273	genome.wustl.edu	37	19	42085765	42085765	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr19:42085765G>A	ENST00000401445.2	+	3	510	c.484G>A	c.(484-486)Gtg>Atg	p.V162M	CEACAM21_ENST00000187608.9_Missense_Mutation_p.V162M|CEACAM21_ENST00000482870.2_3'UTR|CEACAM21_ENST00000407170.2_Missense_Mutation_p.V34M			Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 21	162	Ig-like C2-type.					integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|urinary_tract(1)	13						GAAGGGCTCCGTGGTCCTGAC	0.537																																						dbGAP											0													56.0	62.0	60.0					19																	42085765		2077	4222	6299	-	-	-	SO:0001583	missense	0			AK023602	CCDS46086.1, CCDS46087.1, CCDS74373.1	19q13.2	2013-01-29			ENSG00000007129	ENSG00000007129		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28834	protein-coding gene	gene with protein product						12477932	Standard	XM_005278397		Approved	R29124_1, FLJ13540	uc002ore.4	Q3KPI0	OTTHUMG00000151062	ENST00000401445.2:c.484G>A	19.37:g.42085765G>A	ENSP00000385739:p.Val162Met		B7WNQ6|O75296|Q6UY47|Q96ER7	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V162M	ENST00000401445.2	37	c.484	CCDS46086.1	19	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483669	0.63962	.	.	ENSG00000007129	ENST00000407170;ENST00000187608;ENST00000401445	T;T;T	0.01215	5.16;5.16;5.16	3.56	-1.73	0.08081	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.05318	0.0141	M	0.89214	3.015	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.31166	-0.9953	9	0.87932	D	0	.	0.8444	0.01157	0.2314:0.204:0.3888:0.1757	.	162;162	Q3KPI0-2;Q3KPI0	.;CEA21_HUMAN	M	34;162;162	ENSP00000384380:V34M;ENSP00000187608:V162M;ENSP00000385739:V162M	ENSP00000187608:V162M	V	+	1	0	CEACAM21	46777605	0.000000	0.05858	0.000000	0.03702	0.760000	0.43138	-0.214000	0.09292	-0.259000	0.09432	0.385000	0.25706	GTG	CEACAM21	-	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000007129		0.537	CEACAM21-005	KNOWN	non_canonical_polymorphism|basic|appris_candidate_longest|CCDS	protein_coding	CEACAM21	HGNC	protein_coding	OTTHUMT00000321140.1	133	0.00	0	G	NM_033543		42085765	42085765	+1	no_errors	ENST00000401445	ensembl	human	known	69_37n	missense	38	49.35	38	SNP	0.000	A
CHRM2	1129	genome.wustl.edu	37	7	136700174	136700174	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr7:136700174T>A	ENST00000445907.2	+	3	1090	c.562T>A	c.(562-564)Ttt>Att	p.F188I	hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000586239.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000593789.1_RNA|CHRM2_ENST00000402486.3_Missense_Mutation_p.F188I|CHRM2_ENST00000401861.1_Missense_Mutation_p.F188I|hsa-mir-490_ENST00000439694.1_RNA|CHRM2_ENST00000453373.1_Missense_Mutation_p.F188I|hsa-mir-490_ENST00000597642.1_RNA|CHRM2_ENST00000320658.5_Missense_Mutation_p.F188I|CHRM2_ENST00000397608.3_Missense_Mutation_p.F188I	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	188					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TGCTGTCACCTTTGGTACGGC	0.483																																						dbGAP											0													95.0	86.0	89.0					7																	136700174		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.562T>A	7.37:g.136700174T>A	ENSP00000399745:p.Phe188Ile		Q4VBK6|Q9P1X9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Musac_M2_rcpt,prints_Musac_rcpt,prints_7TM_GPCR_Rhodpsn	p.F188I	ENST00000445907.2	37	c.562	CCDS5843.1	7	.	.	.	.	.	.	.	.	.	.	T	22.2	4.262516	0.80358	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46;-0.46;-0.46	5.51	5.51	0.81932	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	L	0.33624	1.015	0.80722	D	1	P	0.51057	0.941	P	0.57548	0.823	T	0.61903	-0.6967	10	0.02654	T	1	-1.4444	15.6399	0.76989	0.0:0.0:0.0:1.0	.	188	P08172	ACM2_HUMAN	I	188	ENSP00000399745:F188I;ENSP00000415386:F188I;ENSP00000319984:F188I;ENSP00000380733:F188I;ENSP00000384937:F188I;ENSP00000384401:F188I	ENSP00000319984:F188I	F	+	1	0	CHRM2	136350714	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.991000	0.88244	2.103000	0.63969	0.533000	0.62120	TTT	CHRM2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Musac_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000181072		0.483	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM2	HGNC	protein_coding	OTTHUMT00000341010.1	100	0.00	0	T			136700174	136700174	+1	no_errors	ENST00000320658	ensembl	human	known	69_37n	missense	74	26.73	27	SNP	1.000	A
CNTNAP5	129684	genome.wustl.edu	37	2	125262113	125262113	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr2:125262113G>A	ENST00000431078.1	+	8	1668	c.1304G>A	c.(1303-1305)cGc>cAc	p.R435H		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	435	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		ATGACAGAACGCGTAGCTGAA	0.507																																						dbGAP											0													57.0	60.0	59.0					2																	125262113		1959	4156	6115	-	-	-	SO:0001583	missense	0			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1304G>A	2.37:g.125262113G>A	ENSP00000399013:p.Arg435His		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.R435H	ENST00000431078.1	37	c.1304	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	G	4.652	0.121232	0.08881	.	.	ENSG00000155052	ENST00000431078	T	0.79141	-1.24	5.54	-1.91	0.07641	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	1.248430	0.05738	N	0.600904	T	0.49626	0.1568	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31447	-0.9943	10	0.40728	T	0.16	.	3.3025	0.06988	0.5976:0.1299:0.1429:0.1296	.	435	Q8WYK1	CNTP5_HUMAN	H	435	ENSP00000399013:R435H	ENSP00000399013:R435H	R	+	2	0	CNTNAP5	124978583	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.760000	0.04756	-0.381000	0.07882	0.650000	0.86243	CGC	CNTNAP5	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000155052		0.507	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	HGNC	protein_coding	OTTHUMT00000330864.3	178	0.00	0	G			125262113	125262113	+1	no_errors	ENST00000431078	ensembl	human	known	69_37n	missense	75	35.04	41	SNP	0.000	A
CREBBP	1387	genome.wustl.edu	37	16	3823824	3823825	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr16:3823824_3823825insT	ENST00000262367.5	-	13	3199_3200	c.2390_2391insA	c.(2389-2391)aacfs	p.N797fs	CREBBP_ENST00000382070.3_Frame_Shift_Ins_p.N759fs	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	797					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		ACGGGAACTGGTTCTGTGGCAG	0.619			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																															dbGAP		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0																																										-	-	-	SO:0001589	frameshift_variant	0			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.2391dupA	16.37:g.3823826_3823826dupT	ENSP00000262367:p.Asn797fs		D3DUC9|O00147|Q16376|Q4LE28	Frame_Shift_Ins	INS	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.N797fs	ENST00000262367.5	37	c.2391_2390	CCDS10509.1	16																																																																																			CREBBP	-	NULL	ENSG00000005339		0.619	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	60	0.00	0	-	NM_004380		3823824	3823825	-1	no_errors	ENST00000262367	ensembl	human	known	69_37n	frame_shift_ins	46	24.59	15	INS	0.983:0.987	T
CTCF	10664	genome.wustl.edu	37	16	67645308	67645308	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr16:67645308G>A	ENST00000264010.4	+	3	1017	c.573G>A	c.(571-573)tgG>tgA	p.W191*	CTCF_ENST00000401394.1_Intron|AC009095.4_ENST00000388909.4_RNA	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	191					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		ATCCTAGTTGGCAAAAAGACC	0.473																																					Colon(175;1200 1966 6945 23069 27405)	dbGAP											0													57.0	58.0	58.0					16																	67645308		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.573G>A	16.37:g.67645308G>A	ENSP00000264010:p.Trp191*		B5MC38|Q53XI7|Q59EL8	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.W191*	ENST00000264010.4	37	c.573	CCDS10841.1	16	.	.	.	.	.	.	.	.	.	.	G	38	6.801243	0.97849	.	.	ENSG00000102974	ENST00000264010	.	.	.	5.38	5.38	0.77491	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	19.3331	0.94299	0.0:0.0:1.0:0.0	.	.	.	.	X	191	.	ENSP00000264010:W191X	W	+	3	0	CTCF	66202809	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.802000	0.96397	0.655000	0.94253	TGG	CTCF	-	NULL	ENSG00000102974		0.473	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTCF	HGNC	protein_coding	OTTHUMT00000268870.2	101	0.00	0	G	NM_006565		67645308	67645308	+1	no_errors	ENST00000264010	ensembl	human	known	69_37n	nonsense	109	35.50	60	SNP	1.000	A
CTSF	8722	genome.wustl.edu	37	11	66335548	66335548	+	Silent	SNP	A	A	G	rs1127894	byFrequency	TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr11:66335548A>G	ENST00000310325.5	-	2	328	c.219T>C	c.(217-219)ggT>ggC	p.G73G	CTSF_ENST00000533168.1_5'Flank	NM_003793.3	NP_003784.2	Q9UBX1	CATF_HUMAN	cathepsin F	73					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|vesicle (GO:0031982)	cysteine-type endopeptidase activity (GO:0004197)			endometrium(1)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	19						GCGACCCCTGACCCGCCTGGA	0.682													G|||	2918	0.582668	0.8767	0.415	5008	,	,		10960	0.5407		0.5378	False		,,,				2504	0.3937					dbGAP											0													14.0	23.0	20.0					11																	66335548		2196	4292	6488	-	-	-	SO:0001819	synonymous_variant	0			AF071749	CCDS8144.1	11q13.2	2012-02-29			ENSG00000174080	ENSG00000174080		"""Cathepsins"""	2531	protein-coding gene	gene with protein product		603539				9822672, 10318784	Standard	NM_003793		Approved	CATSF, CLN13	uc001oip.3	Q9UBX1	OTTHUMG00000167090	ENST00000310325.5:c.219T>C	11.37:g.66335548A>G			B2R964|O95240|Q9NSU4|Q9UKQ5	Silent	SNP	pfam_Peptidase_C1A_C,pfam_Prot_inhib_I29,smart_Prot_inhib_I29,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.G73	ENST00000310325.5	37	c.219	CCDS8144.1	11																																																																																			CTSF	-	NULL	ENSG00000174080		0.682	CTSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSF	HGNC	protein_coding	OTTHUMT00000393047.1	8	0.00	0	A	NM_003793		66335548	66335548	-1	no_errors	ENST00000310325	ensembl	human	known	69_37n	silent	26	24.49	12	SNP	0.030	G
CTTNBP2NL	55917	genome.wustl.edu	37	1	112999478	112999478	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:112999478T>A	ENST00000271277.6	+	6	1589	c.1364T>A	c.(1363-1365)aTc>aAc	p.I455N	CTTNBP2NL_ENST00000607039.1_3'UTR	NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	455					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAAGTAGGGATCAACCAACGG	0.527																																						dbGAP											0													160.0	165.0	163.0					1																	112999478		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.1364T>A	1.37:g.112999478T>A	ENSP00000271277:p.Ile455Asn		B3KMS5|Q96B40	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N	p.I455N	ENST00000271277.6	37	c.1364	CCDS845.1	1	.	.	.	.	.	.	.	.	.	.	T	17.20	3.329645	0.60743	.	.	ENSG00000143079	ENST00000271277	T	0.29917	1.55	5.32	5.32	0.75619	.	0.094690	0.64402	D	0.000001	T	0.33556	0.0867	M	0.61703	1.905	0.80722	D	1	P	0.46859	0.885	P	0.52159	0.691	T	0.08764	-1.0706	10	0.48119	T	0.1	-11.1747	14.9445	0.71020	0.0:0.0:0.0:1.0	.	455	Q9P2B4	CT2NL_HUMAN	N	455	ENSP00000271277:I455N	ENSP00000271277:I455N	I	+	2	0	CTTNBP2NL	112801001	1.000000	0.71417	1.000000	0.80357	0.698000	0.40448	7.698000	0.84413	2.015000	0.59207	0.379000	0.24179	ATC	CTTNBP2NL	-	NULL	ENSG00000143079		0.527	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2NL	HGNC	protein_coding	OTTHUMT00000030686.1	135	0.00	0	T	NM_018704		112999478	112999478	+1	no_errors	ENST00000271277	ensembl	human	known	69_37n	missense	128	19.38	31	SNP	1.000	A
CUL5	8065	genome.wustl.edu	37	11	107968417	107968417	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr11:107968417G>A	ENST00000393094.2	+	17	2576	c.1960G>A	c.(1960-1962)Gtc>Atc	p.V654I		NM_003478.3	NP_003469.2	Q93034	CUL5_HUMAN	cullin 5	654					calcium ion transmembrane transport (GO:0070588)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cytosolic calcium ion homeostasis (GO:0051480)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|response to osmotic stress (GO:0006970)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul5-RING ubiquitin ligase complex (GO:0031466)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|receptor activity (GO:0004872)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		TGAACCTCAAGTCAACTCACC	0.363																																						dbGAP											0													130.0	123.0	125.0					11																	107968417		2201	4298	6499	-	-	-	SO:0001583	missense	0			X81882	CCDS31668.1	11q22.3	2011-05-24			ENSG00000166266	ENSG00000166266			2556	protein-coding gene	gene with protein product		601741				8681378, 9037604	Standard	XM_005271682		Approved	VACM-1	uc001pjv.3	Q93034	OTTHUMG00000166369	ENST00000393094.2:c.1960G>A	11.37:g.107968417G>A	ENSP00000376808:p.Val654Ile		A8K960|O14766|Q9BZC6	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.V654I	ENST00000393094.2	37	c.1960	CCDS31668.1	11	.	.	.	.	.	.	.	.	.	.	G	17.31	3.357347	0.61293	.	.	ENSG00000166266	ENST00000393094	T	0.73681	-0.77	5.49	5.49	0.81192	Cullin, N-terminal (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Cullin homology (1);	0.000000	0.85682	D	0.000000	T	0.66703	0.2816	L	0.28458	0.855	0.80722	D	1	B	0.15930	0.015	B	0.17098	0.017	T	0.59215	-0.7496	10	0.29301	T	0.29	-7.2837	19.7348	0.96198	0.0:0.0:1.0:0.0	.	654	Q93034	CUL5_HUMAN	I	654	ENSP00000376808:V654I	ENSP00000376808:V654I	V	+	1	0	CUL5	107473627	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.416000	0.97383	2.716000	0.92895	0.655000	0.94253	GTC	CUL5	-	pfam_Cullin_N,superfamily_Cullin_homology	ENSG00000166266		0.363	CUL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL5	HGNC	protein_coding	OTTHUMT00000389429.1	201	0.00	0	G			107968417	107968417	+1	no_errors	ENST00000393094	ensembl	human	known	69_37n	missense	129	50.19	131	SNP	1.000	A
CYFIP1	23191	genome.wustl.edu	37	15	22960793	22960793	+	Splice_Site	SNP	G	G	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr15:22960793G>C	ENST00000313077.7	+	18	2111	c.1986G>C	c.(1984-1986)gaG>gaC	p.E662D	CYFIP1_ENST00000560848.1_Splice_Site_p.E662D|CYFIP1_ENST00000435939.2_Splice_Site_p.E231D	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		TCCTCTGCAGGTACGTGCTCT	0.577																																						dbGAP											0													85.0	66.0	72.0					15																	22960793		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.1986-1G>C	15.37:g.22960793G>C				Missense_Mutation	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.E662D	ENST00000313077.7	37	c.1986	CCDS10009.1	15	.	.	.	.	.	.	.	.	.	.	G	18.81	3.702860	0.68501	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	T;T	0.26067	1.76;1.76	5.49	4.56	0.56223	.	0.000000	0.64402	D	0.000004	T	0.56499	0.1989	M	0.90369	3.11	0.80722	D	1	D;D;D	0.89917	0.992;1.0;1.0	D;D;D	0.87578	0.987;0.99;0.998	T	0.63532	-0.6616	9	.	.	.	.	12.6799	0.56916	0.1307:0.0:0.8693:0.0	.	690;231;662	E7EQ04;Q7L576-2;Q7L576	.;.;CYFP1_HUMAN	D	662;690;231	ENSP00000324549:E662D;ENSP00000405956:E231D	.	E	+	3	2	CYFIP1	20512234	1.000000	0.71417	1.000000	0.80357	0.270000	0.26580	4.683000	0.61679	2.734000	0.93682	0.655000	0.94253	GAG	CYFIP1	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000068793		0.577	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYFIP1	HGNC	protein_coding	OTTHUMT00000251136.2	23	0.00	0	G	NM_014608	Missense_Mutation	22960793	22960793	+1	no_errors	ENST00000313077	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	1.000	C
DGKI	9162	genome.wustl.edu	37	7	137266623	137266623	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr7:137266623C>A	ENST00000288490.5	-	15	1615	c.1615G>T	c.(1615-1617)Gtc>Ttc	p.V539F	DGKI_ENST00000453654.2_Missense_Mutation_p.V239F|DGKI_ENST00000446122.1_Missense_Mutation_p.V539F|DGKI_ENST00000424189.2_Missense_Mutation_p.V539F	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	539					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						TCCAGTGTGACATGGGCATCA	0.453																																						dbGAP											0													121.0	118.0	119.0					7																	137266623		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.1615G>T	7.37:g.137266623C>A	ENSP00000288490:p.Val539Phe		A4D1Q9|Q9NZ49	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V539F	ENST00000288490.5	37	c.1615	CCDS5845.1	7	.	.	.	.	.	.	.	.	.	.	C	29.1	4.980105	0.92982	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.39229	1.09;1.09;1.09	5.6	5.6	0.85130	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	T	0.68714	0.3031	M	0.80183	2.485	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.79108	0.985;0.992	T	0.71646	-0.4530	10	0.87932	D	0	.	19.5926	0.95522	0.0:1.0:0.0:0.0	.	239;539	E9PFX6;O75912	.;DGKI_HUMAN	F	239;487;539;539;539	ENSP00000392161:V239F;ENSP00000288490:V539F;ENSP00000399131:V539F	ENSP00000288490:V539F	V	-	1	0	DGKI	136917163	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.621000	0.83083	2.788000	0.95919	0.650000	0.86243	GTC	DGKI	-	pfam_Diacylglycerol_kin_accessory,smart_Diacylglycerol_kin_accessory	ENSG00000157680		0.453	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	130	0.00	0	C	NM_004717		137266623	137266623	-1	no_errors	ENST00000424189	ensembl	human	known	69_37n	missense	91	61.76	147	SNP	1.000	A
DHX40	79665	genome.wustl.edu	37	17	57654510	57654510	+	Intron	SNP	G	G	A	rs548816255		TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr17:57654510G>A	ENST00000251241.4	+	8	1120				DHX40_ENST00000451169.2_Missense_Mutation_p.V261M|DHX40_ENST00000425628.3_Intron	NM_024612.4	NP_078888.4	Q8IX18	DHX40_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 40								ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(7)|large_intestine(6)|lung(6)|prostate(1)	20	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					gattacaggcgtgagtcacca	0.458													G|||	1	0.000199681	0.0	0.0	5008	,	,		18780	0.0		0.0	False		,,,				2504	0.001					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF260270	CCDS11617.1, CCDS54150.1	17q22	2014-01-28	2003-06-13	2003-06-20		ENSG00000108406		"""DEAH-boxes"""	18018	protein-coding gene	gene with protein product		607570	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 40 (RNA helicase)"""	DDX40			Standard	NM_024612		Approved	ARG147, PAD, FLJ22060	uc002ixn.2	Q8IX18		ENST00000251241.4:c.974-117G>A	17.37:g.57654510G>A			B3KTJ5|C9JR60|Q5JPH4|Q8TC86|Q8WY53|Q9BXM1|Q9H6M9	Missense_Mutation	SNP	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V261M	ENST00000251241.4	37	c.781	CCDS11617.1	17	.	.	.	.	.	.	.	.	.	.	G	6.214	0.407590	0.11754	.	.	ENSG00000108406	ENST00000451169	T	0.04049	3.72	0.158	0.158	0.14942	.	.	.	.	.	T	0.05868	0.0153	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39078	-0.9631	6	0.52906	T	0.07	.	5.7274	0.18020	1.0E-4:0.0:0.9999:0.0	.	.	.	.	M	261	ENSP00000396039:V261M	ENSP00000396039:V261M	V	+	1	0	DHX40	55009292	0.146000	0.22672	0.012000	0.15200	0.013000	0.08279	1.060000	0.30530	0.202000	0.20498	0.205000	0.17691	GTG	DHX40	-	smart_Helicase_C,pfscan_Helicase_C	ENSG00000108406		0.458	DHX40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX40	HGNC	protein_coding	OTTHUMT00000446095.1	29	0.00	0	G	NM_024612		57654510	57654510	+1	no_errors	ENST00000451169	ensembl	human	known	69_37n	missense	47	12.96	7	SNP	0.140	A
DNAH6	1768	genome.wustl.edu	37	2	84785059	84785059	+	Splice_Site	SNP	G	G	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr2:84785059G>T	ENST00000237449.6	+	10	1811	c.1803G>T	c.(1801-1803)aaG>aaT	p.K601N	DNAH6_ENST00000398278.2_Splice_Site_p.K601N|DNAH6_ENST00000389394.3_Splice_Site_p.K601N			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	601	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						CTCAAATAAAGGTATGTTTAC	0.264																																						dbGAP											0													39.0	39.0	39.0					2																	84785059		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.1803+1G>T	2.37:g.84785059G>T			A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.K601N	ENST00000237449.6	37	c.1803	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	G	7.889	0.731795	0.15507	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.25414	1.8;1.93;1.8	5.09	5.09	0.68999	.	0.115327	0.38837	N	0.001548	T	0.25494	0.0620	L	0.38175	1.15	0.47407	D	0.999411	B;P	0.49090	0.006;0.919	B;P	0.45506	0.007;0.483	T	0.02042	-1.1224	10	0.16896	T	0.51	.	17.2596	0.87066	0.0:0.0:1.0:0.0	.	601;180	Q9C0G6;Q9C0G6-3	DYH6_HUMAN;.	N	601	ENSP00000374045:K601N;ENSP00000381326:K601N;ENSP00000237449:K601N	ENSP00000237449:K601N	K	+	3	2	DNAH6	84638570	1.000000	0.71417	1.000000	0.80357	0.330000	0.28571	6.228000	0.72288	2.363000	0.80096	0.561000	0.74099	AAG	DNAH6	-	NULL	ENSG00000115423		0.264	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	54	0.00	0	G	NM_001370	Missense_Mutation	84785059	84785059	+1	no_errors	ENST00000237449	ensembl	human	known	69_37n	missense	81	29.57	34	SNP	1.000	T
DND1	373863	genome.wustl.edu	37	5	140052285	140052285	+	Frame_Shift_Del	DEL	T	T	-	rs375722663	byFrequency	TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr5:140052285delT	ENST00000542735.1	-	3	392	c.349delA	c.(349-351)acgfs	p.T117fs		NM_194249.2	NP_919225.1	Q8IYX4	DND1_HUMAN	DND microRNA-mediated repression inhibitor 1	117	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of gene silencing by miRNA (GO:0060965)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)	p.T117fs*24(1)		central_nervous_system(1)|prostate(4)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGTGCAGCGTGGCGATGGCG	0.682													T|T|-|deletion	29	0.00579073	0.0	0.0173	5008	,	,		10844	0.002		0.0139	False		,,,				2504	0.001					dbGAP											1	Deletion - Frameshift(1)	central_nervous_system(1)											6.0	7.0	6.0					5																	140052285		2084	4099	6183	-	-	-	SO:0001589	frameshift_variant	0			AY321065	CCDS4236.1	5q31.3	2013-07-31	2013-07-31		ENSG00000256453	ENSG00000256453		"""RNA binding motif (RRM) containing"""	23799	protein-coding gene	gene with protein product		609385	"""dead end homolog 1 (zebrafish)"""			12932328	Standard	NM_194249		Approved	MGC34750, RBMS4	uc003lgt.3	Q8IYX4	OTTHUMG00000129499	ENST00000542735.1:c.349delA	5.37:g.140052285delT	ENSP00000445366:p.Thr117fs			Frame_Shift_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.T117fs	ENST00000542735.1	37	c.349	CCDS4236.1	5																																																																																			DND1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000256453		0.682	DND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DND1	HGNC	protein_coding	OTTHUMT00000251669.2	8	0.00	0	T	NM_194249		140052285	140052285	-1	no_errors	ENST00000542735	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	0.986	-
DNMBP	23268	genome.wustl.edu	37	10	101648689	101648689	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr10:101648689C>T	ENST00000324109.4	-	12	3269	c.3178G>A	c.(3178-3180)Gtg>Atg	p.V1060M	DNMBP_ENST00000543621.1_Missense_Mutation_p.V306M|DNMBP_ENST00000342239.3_Missense_Mutation_p.V1084M|DNMBP_ENST00000472036.1_5'UTR|DNMBP_ENST00000540316.1_De_novo_Start_InFrame	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	1060	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		ACAGCAGCCACCACTTTCACA	0.517																																						dbGAP											0													89.0	77.0	81.0					10																	101648689		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.3178G>A	10.37:g.101648689C>T	ENSP00000315659:p.Val1060Met		Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_BAR_dom,prints_p67phox,prints_Spectrin_alpha_SH3,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.V1084M	ENST00000324109.4	37	c.3250	CCDS7485.1	10	.	.	.	.	.	.	.	.	.	.	C	16.92	3.254476	0.59212	.	.	ENSG00000107554	ENST00000342239;ENST00000324109;ENST00000393570;ENST00000543621	T;T;T	0.58797	0.31;0.31;0.31	5.6	4.62	0.57501	BAR (3);	0.166497	0.28754	N	0.014245	T	0.51907	0.1702	L	0.29908	0.895	0.80722	D	1	P;P;P	0.51653	0.947;0.883;0.947	P;B;P	0.56751	0.805;0.317;0.805	T	0.52102	-0.8620	10	0.32370	T	0.25	-22.8726	3.1754	0.06566	0.197:0.4745:0.239:0.0895	.	1060;306;1084	Q6XZF7;Q6XZF7-2;Q5SVK8	DNMBP_HUMAN;.;.	M	1084;1060;306;306	ENSP00000344914:V1084M;ENSP00000315659:V1060M;ENSP00000443657:V306M	ENSP00000315659:V1060M	V	-	1	0	DNMBP	101638679	0.991000	0.36638	1.000000	0.80357	0.979000	0.70002	1.028000	0.30128	2.639000	0.89480	0.561000	0.74099	GTG	DNMBP	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000107554		0.517	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMBP	HGNC	protein_coding	OTTHUMT00000049832.2	100	0.00	0	C	NM_015221		101648689	101648689	-1	no_errors	ENST00000342239	ensembl	human	known	69_37n	missense	135	30.41	59	SNP	1.000	T
DOCK11	139818	genome.wustl.edu	37	X	117814519	117814519	+	Silent	SNP	A	A	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chrX:117814519A>G	ENST00000276202.7	+	49	5598	c.5535A>G	c.(5533-5535)aaA>aaG	p.K1845K	DOCK11_ENST00000276204.6_Silent_p.K1845K	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1845	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TTGATGACAAAGAACTCACAG	0.333																																						dbGAP											0													94.0	101.0	99.0					X																	117814519		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.5535A>G	X.37:g.117814519A>G			A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Silent	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.K1845	ENST00000276202.7	37	c.5535	CCDS35373.1	X																																																																																			DOCK11	-	NULL	ENSG00000147251		0.333	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	191	0.00	0	A	NM_144658		117814519	117814519	+1	no_errors	ENST00000276202	ensembl	human	known	69_37n	silent	139	38.50	87	SNP	1.000	G
DRAM1	55332	genome.wustl.edu	37	12	102295135	102295135	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr12:102295135C>T	ENST00000258534.8	+	3	705	c.266C>T	c.(265-267)aCt>aTt	p.T89I	DRAM1_ENST00000544152.1_Missense_Mutation_p.T89I	NM_018370.2	NP_060840.2	Q8N682	DRAM1_HUMAN	DNA-damage regulated autophagy modulator 1	89					apoptotic process (GO:0006915)|autophagy (GO:0006914)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12						TATTTCAGCACTCCTGTTTTT	0.383																																						dbGAP											0													197.0	183.0	188.0					12																	102295135		1888	4099	5987	-	-	-	SO:0001583	missense	0			BC018435, DA721965	CCDS41823.1	12q23.2	2014-02-12	2009-06-12		ENSG00000136048	ENSG00000136048			25645	protein-coding gene	gene with protein product	"""damage-regulated autophagy modulator"""	610776				16839881	Standard	NM_018370		Approved	FLJ11259, DRAM	uc001tix.3	Q8N682		ENST00000258534.8:c.266C>T	12.37:g.102295135C>T	ENSP00000258534:p.Thr89Ile		B7Z4T0|Q7L3E3|Q9NUN1	Missense_Mutation	SNP	pfam_Frag1/DRAM/Sfk1	p.T89I	ENST00000258534.8	37	c.266	CCDS41823.1	12	.	.	.	.	.	.	.	.	.	.	C	10.81	1.454305	0.26161	.	.	ENSG00000136048	ENST00000258534;ENST00000544152	.	.	.	4.69	2.63	0.31362	.	0.557133	0.19156	N	0.121338	T	0.21062	0.0507	N	0.10916	0.065	0.23940	N	0.996408	P;B	0.40731	0.728;0.213	B;B	0.39419	0.299;0.27	T	0.10800	-1.0614	9	0.18276	T	0.48	.	15.8582	0.79000	0.0:0.6573:0.3427:0.0	.	89;89	B7Z4T0;Q8N682	.;DRAM1_HUMAN	I	89	.	ENSP00000258534:T89I	T	+	2	0	DRAM1	100819266	0.698000	0.27777	0.999000	0.59377	0.916000	0.54674	0.852000	0.27764	1.067000	0.40740	-0.156000	0.13503	ACT	DRAM1	-	pfam_Frag1/DRAM/Sfk1	ENSG00000136048		0.383	DRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRAM1	HGNC	protein_coding	OTTHUMT00000409195.1	348	0.29	1	C	NM_018370		102295135	102295135	+1	no_errors	ENST00000258534	ensembl	human	known	69_37n	missense	561	34.00	289	SNP	0.727	T
DST	667	genome.wustl.edu	37	6	56357785	56357785	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr6:56357785A>T	ENST00000361203.3	-	79	19544	c.19537T>A	c.(19537-19539)Tct>Act	p.S6513T	DST_ENST00000446842.2_Missense_Mutation_p.S6298T|DST_ENST00000370788.2_Missense_Mutation_p.S4427T|DST_ENST00000340834.4_5'Flank|DST_ENST00000370769.4_Missense_Mutation_p.S6624T|DST_ENST00000312431.6_3'UTR|DST_ENST00000244364.6_Missense_Mutation_p.S4210T|DST_ENST00000421834.2_Missense_Mutation_p.S4536T|DST_ENST00000370754.5_Missense_Mutation_p.S6802T			Q03001	DYST_HUMAN	dystonin	6512					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CTTGGCCGAGAAGCTACATTT	0.433																																						dbGAP											0													102.0	99.0	100.0					6																	56357785		1903	4144	6047	-	-	-	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.19537T>A	6.37:g.56357785A>T	ENSP00000354508:p.Ser6513Thr		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.S6802T	ENST00000361203.3	37	c.20404		6	.	.	.	.	.	.	.	.	.	.	A	19.14	3.769590	0.69992	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73;0.73	5.43	5.43	0.79202	.	0.000000	0.49916	D	0.000123	T	0.51618	0.1685	L	0.56769	1.78	0.29065	N	0.883659	D;D;D;D;D	0.76494	0.995;0.999;0.998;0.986;0.987	D;D;D;P;P	0.91635	0.994;0.999;0.995;0.894;0.713	T	0.49560	-0.8927	9	0.12103	T	0.63	.	15.7797	0.78249	1.0:0.0:0.0:0.0	.	4536;6624;6802;6622;4210	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	T	4210;6802;6624;4536;6298;4427;6513	ENSP00000244364:S4210T;ENSP00000359790:S6802T;ENSP00000359805:S6624T;ENSP00000400883:S4536T;ENSP00000393645:S6298T;ENSP00000359824:S4427T;ENSP00000354508:S6513T	ENSP00000244364:S4210T	S	-	1	0	DST	56465744	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.195000	0.94971	2.195000	0.70347	0.477000	0.44152	TCT	DST	-	pfam_Spectrin_repeat,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000151914		0.433	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	276	0.00	0	A	NM_001723		56357785	56357785	-1	no_errors	ENST00000370754	ensembl	human	known	69_37n	missense	194	32.17	92	SNP	1.000	T
ERLEC1	27248	genome.wustl.edu	37	2	54035587	54035587	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr2:54035587G>T	ENST00000185150.4	+	9	1162	c.1031G>T	c.(1030-1032)tGc>tTc	p.C344F	GPR75-ASB3_ENST00000352846.3_Intron|ERLEC1_ENST00000378239.5_Intron|ERLEC1_ENST00000405123.3_Missense_Mutation_p.C344F|ASB3_ENST00000498475.2_Intron|ASB3_ENST00000406625.2_Intron	NM_015701.4	NP_056516.2	Q96DZ1	ERLEC_HUMAN	endoplasmic reticulum lectin 1	344	PRKCSH 2.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	glycoprotein binding (GO:0001948)			endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|stomach(1)|urinary_tract(1)	18						GGTTCTTACTGCTTTCGTGGG	0.403																																						dbGAP											0													99.0	103.0	101.0					2																	54035587		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF131849	CCDS1848.1, CCDS46283.1, CCDS46284.1	2p16	2010-03-19	2009-08-26	2009-08-26	ENSG00000068912	ENSG00000068912			25222	protein-coding gene	gene with protein product	"""erlectin 1"""	611229	"""chromosome 2 open reading frame 30"""	C2orf30		9110174, 8619474, 16531414, 18264092	Standard	NM_015701		Approved	CL25084, XTP3TPB, XTP3-B, ERLECTIN	uc002rxl.3	Q96DZ1	OTTHUMG00000129281	ENST00000185150.4:c.1031G>T	2.37:g.54035587G>T	ENSP00000185150:p.Cys344Phe		B2RDB4|B5MC72|O95901|Q6UWN7|Q9NUY7|Q9UQL4	Missense_Mutation	SNP	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom	p.C344F	ENST00000185150.4	37	c.1031	CCDS1848.1	2	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087172	0.76642	.	.	ENSG00000068912	ENST00000405123;ENST00000185150	T;T	0.03831	3.79;3.79	5.02	5.02	0.67125	Mannose-6-phosphate receptor, binding (1);Glucosidase II beta subunit-like (1);	0.000000	0.85682	D	0.000000	T	0.23094	0.0558	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00531	-1.1686	9	0.66056	D	0.02	-8.6877	18.6995	0.91615	0.0:0.0:1.0:0.0	.	344;344	B5MC72;Q96DZ1	.;ERLEC_HUMAN	F	344	ENSP00000385629:C344F;ENSP00000185150:C344F	ENSP00000185150:C344F	C	+	2	0	ERLEC1	53889091	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	9.605000	0.98321	2.479000	0.83701	0.491000	0.48974	TGC	ERLEC1	-	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom	ENSG00000068912		0.403	ERLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERLEC1	HGNC	protein_coding	OTTHUMT00000251404.1	217	0.00	0	G	NM_015701		54035587	54035587	+1	no_errors	ENST00000185150	ensembl	human	known	69_37n	missense	270	21.74	75	SNP	1.000	T
ERBB4	2066	genome.wustl.edu	37	2	212248654	212248654	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr2:212248654C>T	ENST00000342788.4	-	28	3923	c.3613G>A	c.(3613-3615)Gag>Aag	p.E1205K	ERBB4_ENST00000402597.1_Missense_Mutation_p.E1195K|ERBB4_ENST00000436443.1_Missense_Mutation_p.E1189K	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	1205					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	TACAGTGGCTCATTCACATAC	0.458										TSP Lung(8;0.080)																												dbGAP											0													246.0	239.0	242.0					2																	212248654		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.3613G>A	2.37:g.212248654C>T	ENSP00000342235:p.Glu1205Lys		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E1205K	ENST00000342788.4	37	c.3613	CCDS2394.1	2	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624167	0.66901	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;T;T	0.76448	-0.97;-1.02;-0.98	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.85470	0.5704	L	0.50333	1.59	0.58432	D	0.999998	D;P;D;D	0.71674	0.998;0.935;0.998;0.997	D;P;D;D	0.78314	0.991;0.62;0.991;0.985	T	0.81239	-0.1023	10	0.28530	T	0.3	.	20.3431	0.98773	0.0:1.0:0.0:0.0	.	1179;1195;1189;1205	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	K	1205;1189;1195	ENSP00000342235:E1205K;ENSP00000403204:E1189K;ENSP00000385565:E1195K	ENSP00000342235:E1205K	E	-	1	0	ERBB4	211956899	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	7.445000	0.80570	2.880000	0.98712	0.650000	0.86243	GAG	ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt	ENSG00000178568		0.458	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1	261	0.00	0	C	NM_001042599		212248654	212248654	-1	no_errors	ENST00000342788	ensembl	human	known	69_37n	missense	190	36.03	107	SNP	1.000	T
EXOC1	55763	genome.wustl.edu	37	4	56744164	56744164	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr4:56744164C>T	ENST00000381295.2	+	9	1504	c.1156C>T	c.(1156-1158)Ctc>Ttc	p.L386F	EXOC1_ENST00000346134.7_Missense_Mutation_p.L386F|EXOC1_ENST00000349598.6_Missense_Mutation_p.L386F	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	386					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					TAGAGATTTGCTCCGATATGC	0.393																																						dbGAP											0													145.0	131.0	136.0					4																	56744164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.1156C>T	4.37:g.56744164C>T	ENSP00000370695:p.Leu386Phe		Q504V4|Q8WUE7|Q96T15|Q9NZE4	Missense_Mutation	SNP	pfam_Exocyst_Exoc1	p.L386F	ENST00000381295.2	37	c.1156	CCDS3502.1	4	.	.	.	.	.	.	.	.	.	.	C	27.8	4.860655	0.91433	.	.	ENSG00000090989	ENST00000381295;ENST00000346134;ENST00000349598	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.74718	0.3753	L	0.54323	1.7	0.80722	D	1	D;D	0.71674	0.998;0.984	D;D	0.69654	0.965;0.954	T	0.68085	-0.5502	9	0.21540	T	0.41	.	19.7272	0.96168	0.0:1.0:0.0:0.0	.	386;386	Q9NV70-2;Q9NV70	.;EXOC1_HUMAN	F	386	.	ENSP00000326514:L386F	L	+	1	0	EXOC1	56438921	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.400000	0.79949	2.673000	0.90976	0.557000	0.71058	CTC	EXOC1	-	pfam_Exocyst_Exoc1	ENSG00000090989		0.393	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EXOC1	HGNC	protein_coding	OTTHUMT00000361799.1	135	0.00	0	C	NM_018261		56744164	56744164	+1	no_errors	ENST00000346134	ensembl	human	known	69_37n	missense	248	34.04	128	SNP	1.000	T
FADS2	9415	genome.wustl.edu	37	11	61608167	61608167	+	Silent	SNP	T	T	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr11:61608167T>A	ENST00000278840.4	+	4	1218	c.588T>A	c.(586-588)ctT>ctA	p.L196L	FADS2_ENST00000257261.6_Silent_p.L174L|FADS2_ENST00000522056.1_Silent_p.L165L|FADS2_ENST00000521849.1_Silent_p.L196L	NM_004265.2	NP_004256.1	O95864	FADS2_HUMAN	fatty acid desaturase 2	196					alpha-linolenic acid metabolic process (GO:0036109)|linoleic acid metabolic process (GO:0043651)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			breast(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20					Alpha-Linolenic Acid(DB00132)	GGAACCACCTTGTCCACAAAT	0.532																																						dbGAP											0													201.0	181.0	188.0					11																	61608167		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF084559	CCDS8012.1, CCDS60807.1, CCDS60808.1	11q12.2	2013-01-25			ENSG00000134824	ENSG00000134824	1.14.19.3	"""Fatty acid desaturases"""	3575	protein-coding gene	gene with protein product	"""delta-6-desaturase"""	606149		LLCDL2			Standard	NM_004265		Approved	FADSD6, D6D, TU13, DES6, SLL0262	uc001nsl.1	O95864	OTTHUMG00000163794	ENST00000278840.4:c.588T>A	11.37:g.61608167T>A			A8K2M6|B7Z634|Q6MZQ7|Q96H07|Q96SV8|Q9H3G3|Q9Y3X4	Silent	SNP	pfam_Fatty_acid_desaturase-1,pfam_Cyt_B5,superfamily_Cyt_B5,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5	p.L196	ENST00000278840.4	37	c.588	CCDS8012.1	11																																																																																			FADS2	-	pfam_Fatty_acid_desaturase-1,pirsf_Fatty_acid/sphinglp_desaturase	ENSG00000134824		0.532	FADS2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FADS2	HGNC	protein_coding	OTTHUMT00000375586.2	134	0.00	0	T	NM_004265		61608167	61608167	+1	no_errors	ENST00000278840	ensembl	human	known	69_37n	silent	289	32.63	140	SNP	0.000	A
FLG	2312	genome.wustl.edu	37	1	152280687	152280687	+	Silent	SNP	C	C	A	rs386635457|rs564482396	byFrequency	TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:152280687C>A	ENST00000368799.1	-	3	6710	c.6675G>T	c.(6673-6675)gtG>gtT	p.V2225V	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2225	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCCCTGGCCCACCAGTGAGT	0.552									Ichthyosis																													dbGAP											0													247.0	245.0	245.0					1																	152280687		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6675G>T	1.37:g.152280687C>A			Q01720|Q5T583|Q9UC71	Silent	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.V2225	ENST00000368799.1	37	c.6675	CCDS30860.1	1																																																																																			FLG	-	pfam_Filaggrin	ENSG00000143631		0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	161	0.00	0	C	NM_002016		152280687	152280687	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	silent	490	30.93	257	SNP	0.000	A
FMN2	56776	genome.wustl.edu	37	1	240497202	240497202	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:240497202C>A	ENST00000319653.9	+	12	4830	c.4600C>A	c.(4600-4602)Ctt>Att	p.L1534I	FMN2_ENST00000545751.1_Missense_Mutation_p.L130I	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1534	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TAGCAGAAGCCTTTTGTCATA	0.284																																						dbGAP											0													62.0	61.0	61.0					1																	240497202		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4600C>A	1.37:g.240497202C>A	ENSP00000318884:p.Leu1534Ile		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.L1534I	ENST00000319653.9	37	c.4600	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.684865	0.88639	.	.	ENSG00000155816	ENST00000319653;ENST00000545751;ENST00000537355	T;T	0.51325	0.71;0.71	5.75	5.75	0.90469	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.56097	D	0.000029	T	0.75072	0.3800	M	0.86651	2.83	0.80722	D	1	P;D;D;D	0.89917	0.733;1.0;1.0;0.999	B;D;D;D	0.91635	0.426;0.999;0.985;0.997	T	0.78648	-0.2122	10	0.87932	D	0	.	19.9525	0.97208	0.0:1.0:0.0:0.0	.	130;180;163;1534	B4DP05;F5H2C1;B4DN09;Q9NZ56	.;.;.;FMN2_HUMAN	I	1534;130;161	ENSP00000318884:L1534I;ENSP00000437918:L130I	ENSP00000318884:L1534I	L	+	1	0	FMN2	238563825	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.883000	0.63128	2.719000	0.93026	0.655000	0.94253	CTT	FMN2	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000155816		0.284	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	144	0.00	0	C	XM_371352		240497202	240497202	+1	no_errors	ENST00000319653	ensembl	human	known	69_37n	missense	185	25.90	65	SNP	1.000	A
FZD7	8324	genome.wustl.edu	37	2	202899638	202899638	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr2:202899638G>C	ENST00000286201.1	+	1	329	c.268G>C	c.(268-270)Gtg>Ctg	p.V90L	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	90	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						CTACCCGCTGGTGAAGGTGCA	0.607																																						dbGAP											0													111.0	106.0	107.0					2																	202899638		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.268G>C	2.37:g.202899638G>C	ENSP00000286201:p.Val90Leu		O94816|Q53S59|Q96B74	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.V90L	ENST00000286201.1	37	c.268	CCDS2351.1	2	.	.	.	.	.	.	.	.	.	.	G	16.66	3.186192	0.57909	.	.	ENSG00000155760	ENST00000286201	T	0.78816	-1.21	5.31	5.31	0.75309	Frizzled domain (5);	0.000000	0.85682	D	0.000000	D	0.85915	0.5808	M	0.71296	2.17	0.80722	D	1	D	0.53619	0.961	P	0.57244	0.816	D	0.87336	0.2328	10	0.72032	D	0.01	.	18.9805	0.92754	0.0:0.0:1.0:0.0	.	90	O75084	FZD7_HUMAN	L	90	ENSP00000286201:V90L	ENSP00000286201:V90L	V	+	1	0	FZD7	202607883	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	9.864000	0.99589	2.485000	0.83878	0.467000	0.42956	GTG	FZD7	-	pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom	ENSG00000155760		0.607	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD7	HGNC	protein_coding	OTTHUMT00000256314.1	19	0.00	0	G	NM_003507		202899638	202899638	+1	no_errors	ENST00000286201	ensembl	human	known	69_37n	missense	104	26.24	37	SNP	1.000	C
GATM	2628	genome.wustl.edu	37	15	45658366	45658366	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr15:45658366C>A	ENST00000396659.3	-	6	1195	c.856G>T	c.(856-858)Gct>Tct	p.A286S	GATM_ENST00000558336.1_Missense_Mutation_p.A286S	NM_001482.2	NP_001473.1	P50440	GATM_HUMAN	glycine amidinotransferase (L-arginine:glycine amidinotransferase)	286					cellular nitrogen compound metabolic process (GO:0034641)|creatine biosynthetic process (GO:0006601)|creatine metabolic process (GO:0006600)|embryo development (GO:0009790)|response to mercury ion (GO:0046689)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	glycine amidinotransferase activity (GO:0015068)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines (GO:0016813)			biliary_tract(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	15		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Glycine(DB00145)|L-Ornithine(DB00129)	TAGTCTGGAGCAAGATGCCTA	0.388																																						dbGAP											0													157.0	138.0	145.0					15																	45658366		2198	4298	6496	-	-	-	SO:0001583	missense	0			S68805	CCDS10122.1	15q15.1	2007-12-06			ENSG00000171766	ENSG00000171766	2.1.4.1		4175	protein-coding gene	gene with protein product		602360				8313955	Standard	NM_001482		Approved	AGAT	uc001zvc.3	P50440	OTTHUMG00000131427	ENST00000396659.3:c.856G>T	15.37:g.45658366C>A	ENSP00000379895:p.Ala286Ser		B4DH99|B4DPI3|Q53EQ4	Missense_Mutation	SNP	NULL	p.A286S	ENST00000396659.3	37	c.856	CCDS10122.1	15	.	.	.	.	.	.	.	.	.	.	C	14.03	2.413624	0.42817	.	.	ENSG00000171766	ENST00000396659	T	0.58506	0.33	4.95	4.02	0.46733	.	0.143363	0.64402	D	0.000006	T	0.37265	0.0997	N	0.11201	0.11	0.51233	D	0.999913	B;B	0.12013	0.002;0.005	B;B	0.13407	0.008;0.009	T	0.15178	-1.0446	10	0.31617	T	0.26	-9.1239	12.738	0.57236	0.1658:0.8342:0.0:0.0	.	286;286	P50440-3;P50440	.;GATM_HUMAN	S	286	ENSP00000379895:A286S	ENSP00000379895:A286S	A	-	1	0	GATM	43445658	1.000000	0.71417	0.989000	0.46669	0.995000	0.86356	4.292000	0.59031	1.426000	0.47256	0.655000	0.94253	GCT	GATM	-	NULL	ENSG00000171766		0.388	GATM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATM	HGNC	protein_coding	OTTHUMT00000254220.2	136	0.00	0	C	NM_001482		45658366	45658366	-1	no_errors	ENST00000396659	ensembl	human	known	69_37n	missense	115	46.26	99	SNP	0.999	A
GNAQ	2776	genome.wustl.edu	37	9	80412549	80412549	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr9:80412549C>A	ENST00000286548.4	-	4	714	c.492G>T	c.(490-492)ttG>ttT	p.L164F	GNAQ_ENST00000397476.3_5'UTR	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	164					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						CTACGCGGTCCAAGTCATTAA	0.488			Mis		uveal melanoma																																	dbGAP		Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	0													125.0	97.0	107.0					9																	80412549		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.492G>T	9.37:g.80412549C>A	ENSP00000286548:p.Leu164Phe		O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_Q,prints_Fungi_GproteinA	p.L164F	ENST00000286548.4	37	c.492	CCDS6658.1	9	.	.	.	.	.	.	.	.	.	.	C	18.25	3.581817	0.65992	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.90732	-2.72;-2.72	5.64	5.64	0.86602	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.94036	0.8089	M	0.85373	2.75	0.80722	D	1	P	0.39883	0.693	P	0.46629	0.522	D	0.94443	0.7660	10	0.87932	D	0	.	19.6996	0.96048	0.0:1.0:0.0:0.0	.	164	P50148	GNAQ_HUMAN	F	164;135	ENSP00000286548:L164F;ENSP00000391501:L135F	ENSP00000286548:L164F	L	-	3	2	GNAQ	79602369	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.748000	0.62148	2.662000	0.90505	0.655000	0.94253	TTG	GNAQ	-	pfam_Gprotein_alpha_su,superfamily_GproteinA_insert,smart_Gprotein_alpha_su	ENSG00000156052		0.488	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAQ	HGNC	protein_coding	OTTHUMT00000052761.1	112	0.88	1	C	NM_002072		80412549	80412549	-1	no_errors	ENST00000286548	ensembl	human	known	69_37n	missense	135	12.90	20	SNP	1.000	A
HAO2	51179	genome.wustl.edu	37	1	119927617	119927617	+	Missense_Mutation	SNP	G	G	A	rs587680125		TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:119927617G>A	ENST00000325945.3	+	4	575	c.502G>A	c.(502-504)Gac>Aac	p.D168N	HAO2_ENST00000361035.4_Missense_Mutation_p.D181N	NM_001005783.1|NM_016527.2	NP_001005783.1|NP_057611.1	Q9NYQ3	HAOX2_HUMAN	hydroxyacid oxidase 2 (long chain)	168	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				fatty acid oxidation (GO:0019395)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.0155)|LUSC - Lung squamous cell carcinoma(189;0.0856)		CAGGCGACATGACATTCGAAA	0.418													G|||	1	0.000199681	0.0	0.0	5008	,	,		22605	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													94.0	89.0	90.0					1																	119927617		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231917	CCDS901.1	1p13.3-p13.1	2008-07-18			ENSG00000116882	ENSG00000116882	1.1.3.15		4810	protein-coding gene	gene with protein product	"""(S)-2-hydroxy-acid oxidase"", ""glycolate oxidase"", ""long-chain L-2-hydroxy acid oxidase"", ""growth-inhibiting protein 16"""	605176				10777549	Standard	XM_005270913		Approved	HAOX2, GIG16	uc001ehr.1	Q9NYQ3	OTTHUMG00000012410	ENST00000325945.3:c.502G>A	1.37:g.119927617G>A	ENSP00000316339:p.Asp168Asn		Q2TU86|Q5QP00|Q9UJS6	Missense_Mutation	SNP	pfam_FMN-dep_DH,pfam_IMP_DH_GMPRt,pfam_Glu_synth_centr_C,pirsf_Alpha-hydoxy_acid_DH_FMN	p.D181N	ENST00000325945.3	37	c.541	CCDS901.1	1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.758438	0.49468	.	.	ENSG00000116882	ENST00000457318;ENST00000361035;ENST00000325945	T;T;T	0.37058	1.22;1.22;1.22	5.65	0.633	0.17712	Aldolase-type TIM barrel (1);FMN-dependent dehydrogenase (1);	0.090669	0.64402	N	0.000001	T	0.17408	0.0418	L	0.55213	1.73	0.33179	D	0.549279	B	0.17852	0.024	B	0.32465	0.146	T	0.14783	-1.0460	9	.	.	.	-12.2734	11.4789	0.50314	0.2752:0.0:0.7248:0.0	.	168	Q9NYQ3	HAOX2_HUMAN	N	143;181;168	ENSP00000393955:D143N;ENSP00000354314:D181N;ENSP00000316339:D168N	.	D	+	1	0	HAO2	119729140	1.000000	0.71417	0.000000	0.03702	0.002000	0.02628	2.922000	0.48860	-0.024000	0.13941	0.655000	0.94253	GAC	HAO2	-	pfam_FMN-dep_DH,pirsf_Alpha-hydoxy_acid_DH_FMN	ENSG00000116882		0.418	HAO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HAO2	HGNC	protein_coding	OTTHUMT00000034984.1	187	0.00	0	G	NM_001005783		119927617	119927617	+1	no_errors	ENST00000361035	ensembl	human	known	69_37n	missense	117	28.66	47	SNP	0.159	A
GON4L	54856	genome.wustl.edu	37	1	155753882	155753882	+	Splice_Site	SNP	T	T	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:155753882T>G	ENST00000368331.1	-	14	1837		c.e14-2		GON4L_ENST00000437809.1_Splice_Site|GON4L_ENST00000471341.1_Splice_Site|GON4L_ENST00000271883.5_Splice_Site|GON4L_ENST00000361040.5_Splice_Site	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.?(3)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					ATCTTGGAACTGTGGGCAAAG	0.473																																						dbGAP											3	Unknown(3)	kidney(3)											127.0	105.0	112.0					1																	155753882		2203	4298	6501	-	-	-	SO:0001630	splice_region_variant	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.1789-2A>C	1.37:g.155753882T>G			B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Splice_Site	SNP	-	e13-2	ENST00000368331.1	37	c.1789-2		1	.	.	.	.	.	.	.	.	.	.	T	16.61	3.171982	0.57584	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883;ENST00000539959;ENST00000361040;ENST00000368327	.	.	.	4.57	4.57	0.56435	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5988	0.56485	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	GON4L	154020506	1.000000	0.71417	0.957000	0.39632	0.981000	0.71138	5.799000	0.69101	2.049000	0.60858	0.482000	0.46254	.	GON4L	-	-	ENSG00000116580		0.473	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		123	0.00	0	T	NM_032292	Intron	155753882	155753882	-1	no_errors	ENST00000368331	ensembl	human	known	69_37n	splice_site	325	29.50	136	SNP	0.986	G
HERC2	8924	genome.wustl.edu	37	15	28501091	28501092	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr15:28501091_28501092delAG	ENST00000261609.7	-	19	2905_2906	c.2797_2798delCT	c.(2797-2799)cttfs	p.L934fs		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GCCCACCAGAAGATCAATCATG	0.49																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.2797_2798delCT	15.37:g.28501091_28501092delAG	ENSP00000261609:p.Leu934fs			Frame_Shift_Del	DEL	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5,superfamily_UBA-like,superfamily_CUB,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5,prints_Reg_chr_condens	p.L933fs	ENST00000261609.7	37	c.2798_2797	CCDS10021.1	15																																																																																			HERC2	-	NULL	ENSG00000128731		0.490	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	211	0.00	0	AG	NM_004667		28501091	28501092	-1	no_errors	ENST00000261609	ensembl	human	known	69_37n	frame_shift_del	233	16.49	46	DEL	0.992:1.000	-
HIVEP2	3097	genome.wustl.edu	37	6	143091275	143091275	+	Missense_Mutation	SNP	C	C	A	rs371439317		TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr6:143091275C>A	ENST00000367604.1	-	4	5240	c.4601G>T	c.(4600-4602)aGg>aTg	p.R1534M	HIVEP2_ENST00000367603.2_Missense_Mutation_p.R1534M|HIVEP2_ENST00000012134.2_Missense_Mutation_p.R1534M			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1534	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GAATGGCTCCCTGGAAGACGG	0.552																																					Esophageal Squamous(107;843 1510 13293 16805 42198)	dbGAP											0													57.0	61.0	60.0					6																	143091275		2008	4169	6177	-	-	-	SO:0001583	missense	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.4601G>T	6.37:g.143091275C>A	ENSP00000356576:p.Arg1534Met		Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R1534M	ENST00000367604.1	37	c.4601	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	C	7.284	0.609729	0.14066	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02369	4.32;4.32;4.32	5.8	3.0	0.34707	.	0.717835	0.14787	N	0.298447	T	0.00637	0.0021	N	0.14661	0.345	0.26674	N	0.971678	P	0.36495	0.556	B	0.34038	0.174	T	0.49485	-0.8935	10	0.41790	T	0.15	-6.7854	5.6025	0.17361	0.0:0.4791:0.2607:0.2601	.	1534	P31629	ZEP2_HUMAN	M	1534	ENSP00000356576:R1534M;ENSP00000356575:R1534M;ENSP00000012134:R1534M	ENSP00000012134:R1534M	R	-	2	0	HIVEP2	143132968	0.968000	0.33430	0.816000	0.32577	0.311000	0.27955	0.806000	0.27126	0.760000	0.33108	0.655000	0.94253	AGG	HIVEP2	-	NULL	ENSG00000010818		0.552	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1	89	0.00	0	C			143091275	143091275	-1	no_errors	ENST00000012134	ensembl	human	known	69_37n	missense	109	33.33	55	SNP	0.786	A
HYDIN	54768	genome.wustl.edu	37	16	71098655	71098655	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr16:71098655G>C	ENST00000393567.2	-	16	2314	c.2164C>G	c.(2164-2166)Ctt>Gtt	p.L722V	HYDIN_ENST00000448089.2_Missense_Mutation_p.L722V|HYDIN_ENST00000321489.5_Missense_Mutation_p.L722V|HYDIN_ENST00000541601.1_Missense_Mutation_p.L739V|HYDIN_ENST00000448691.1_Missense_Mutation_p.L722V|HYDIN_ENST00000538248.1_Missense_Mutation_p.L749V	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	722					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGATTGGCAAGCTGGAGTGTT	0.488																																						dbGAP											0													90.0	81.0	84.0					16																	71098655		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.2164C>G	16.37:g.71098655G>C	ENSP00000377197:p.Leu722Val		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.L722V	ENST00000393567.2	37	c.2164	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	G	17.30	3.353666	0.61293	.	.	ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089;ENST00000448691;ENST00000321489;ENST00000538248;ENST00000541601	T;T;T;T;T;T	0.06528	3.29;3.29;3.29;3.29;3.29;3.29	4.8	3.81	0.43845	.	0.000000	0.29653	U	0.011556	T	0.20536	0.0494	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.71674	0.998;0.998;0.998;0.974	D;D;D;P	0.70227	0.968;0.968;0.968;0.798	T	0.00444	-1.1735	10	0.41790	T	0.15	.	12.984	0.58581	0.0:0.0:0.8366:0.1633	.	749;739;722;722	B4DRN4;F5H6V3;Q4G0P3-5;F8WD23	.;.;.;.	V	722;722;722;722;722;749;739	ENSP00000377197:L722V;ENSP00000398544:L722V;ENSP00000394826:L722V;ENSP00000314736:L722V;ENSP00000444970:L749V;ENSP00000437341:L739V	ENSP00000313052:L722V	L	-	1	0	HYDIN	69656156	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	5.709000	0.68384	0.964000	0.38108	0.505000	0.49811	CTT	HYDIN	-	NULL	ENSG00000157423		0.488	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	303	0.00	0	G			71098655	71098655	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	missense	214	31.41	98	SNP	0.993	C
IGDCC3	9543	genome.wustl.edu	37	15	65667575	65667575	+	Missense_Mutation	SNP	A	A	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr15:65667575A>C	ENST00000327987.4	-	2	520	c.269T>G	c.(268-270)tTg>tGg	p.L90W		NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	90	Ig-like C2-type 1.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						ATTGGCCAGCAAGGTGGAGTG	0.592																																						dbGAP											0													85.0	66.0	72.0					15																	65667575		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.269T>G	15.37:g.65667575A>C	ENSP00000332773:p.Leu90Trp		O95215	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L90W	ENST00000327987.4	37	c.269	CCDS10205.1	15	.	.	.	.	.	.	.	.	.	.	A	17.04	3.288362	0.59976	.	.	ENSG00000174498	ENST00000327987	T	0.69306	-0.39	5.63	5.63	0.86233	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.089150	0.07015	N	0.825854	D	0.82742	0.5103	M	0.87038	2.855	0.33576	D	0.599238	D	0.64830	0.994	P	0.62813	0.907	T	0.78309	-0.2254	10	0.72032	D	0.01	-1.7599	8.2965	0.31988	0.8536:0.0:0.1464:0.0	.	90	Q8IVU1	IGDC3_HUMAN	W	90	ENSP00000332773:L90W	ENSP00000332773:L90W	L	-	2	0	IGDCC3	63454628	0.994000	0.37717	0.809000	0.32408	0.640000	0.38277	4.225000	0.58600	2.145000	0.66743	0.533000	0.62120	TTG	IGDCC3	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000174498		0.592	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	HGNC	protein_coding	OTTHUMT00000256826.1	31	0.00	0	A	NM_004884		65667575	65667575	-1	no_errors	ENST00000327987	ensembl	human	known	69_37n	missense	58	30.95	26	SNP	0.913	C
IGHV3-11	28450	genome.wustl.edu	37	14	106573233	106573233	+	RNA	SNP	T	T	C	rs201985526	byFrequency	TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr14:106573233T>C	ENST00000390601.2	-	0	470									immunoglobulin heavy variable 3-11 (gene/pseudogene)																		TCACTGTGTCTCTCGCACAGT	0.607																																						dbGAP											0													104.0	104.0	104.0					14																	106573233		1848	4080	5928	-	-	-			0			M99652		14q32.33	2012-02-08	2008-09-12		ENSG00000211941	ENSG00000211941		"""Immunoglobulins / IGH locus"""	5580	other	immunoglobulin gene			"""immunoglobulin heavy variable 3-11"""				Standard	NG_001019		Approved				OTTHUMG00000152277		14.37:g.106573233T>C				Silent	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.R117	ENST00000390601.2	37	c.351		14																																																																																			IGHV3-11	-	smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211941		0.607	IGHV3-11-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV3-11	HGNC	IG_V_gene	OTTHUMT00000325665.1	42	0.00	0	T	NG_001019		106573233	106573233	-1	no_stop_codon	ENST00000390601	ensembl	human	known	69_37n	silent	112	12.50	16	SNP	0.035	C
IL6R	3570	genome.wustl.edu	37	1	154437823	154437823	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:154437823C>G	ENST00000368485.3	+	10	1811	c.1374C>G	c.(1372-1374)gaC>gaG	p.D458E	IL6R_ENST00000344086.4_3'UTR	NM_000565.3	NP_000556.1	P08887	IL6RA_HUMAN	interleukin 6 receptor	458					acute-phase response (GO:0006953)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|endocrine pancreas development (GO:0031018)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatic immune response (GO:0002384)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of interleukin-8 production (GO:0032717)|neutrophil mediated immunity (GO:0002446)|positive regulation of activation of Janus kinase activity (GO:0010536)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|response to cytokine (GO:0034097)	apical plasma membrane (GO:0016324)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)|plasma membrane (GO:0005886)	ciliary neurotrophic factor binding (GO:0070119)|cytokine receptor activity (GO:0004896)|enzyme binding (GO:0019899)|interleukin-6 binding (GO:0019981)|protein homodimerization activity (GO:0042803)		IL6R/ATP8B2(2)	breast(2)|large_intestine(1)|ovary(3)	6	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)		Tocilizumab(DB06273)	GCCCTTATGACATCAGCAATA	0.567																																						dbGAP											0													66.0	70.0	69.0					1																	154437823		2203	4300	6503	-	-	-	SO:0001583	missense	0			X12830	CCDS1067.1, CCDS1068.1, CCDS72927.1	1q21	2013-01-11			ENSG00000160712	ENSG00000160712		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6019	protein-coding gene	gene with protein product		147880					Standard	NM_000565		Approved	CD126	uc001fez.2	P08887	OTTHUMG00000036073	ENST00000368485.3:c.1374C>G	1.37:g.154437823C>G	ENSP00000357470:p.Asp458Glu		A8KAE8|B2R6V4|Q16202|Q53EQ7|Q5FWG2|Q5VZ23	Missense_Mutation	SNP	pfam_IL6_recept-bd,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D458E	ENST00000368485.3	37	c.1374	CCDS1067.1	1	.	.	.	.	.	.	.	.	.	.	C	17.65	3.442221	0.63067	.	.	ENSG00000160712	ENST00000368485	T	0.17370	2.28	5.2	0.699	0.18093	.	0.000000	0.51477	D	0.000095	T	0.12902	0.0313	L	0.34521	1.04	0.28444	N	0.916683	D	0.76494	0.999	D	0.85130	0.997	T	0.06075	-1.0847	10	0.62326	D	0.03	-42.7316	7.3172	0.26507	0.0:0.5712:0.0:0.4288	.	458	P08887	IL6RA_HUMAN	E	458	ENSP00000357470:D458E	ENSP00000357470:D458E	D	+	3	2	IL6R	152704447	0.011000	0.17503	0.266000	0.24541	0.843000	0.47879	-0.279000	0.08479	0.219000	0.20840	0.655000	0.94253	GAC	IL6R	-	NULL	ENSG00000160712		0.567	IL6R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL6R	HGNC	protein_coding	OTTHUMT00000087911.1	92	0.00	0	C	NM_000565		154437823	154437823	+1	no_errors	ENST00000368485	ensembl	human	known	69_37n	missense	81	25.69	28	SNP	0.245	G
INSRR	3645	genome.wustl.edu	37	1	156814280	156814283	+	Frame_Shift_Del	DEL	CTGT	CTGT	-	rs148981168	byFrequency	TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	CTGT	CTGT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:156814280_156814283delCTGT	ENST00000368195.3	-	14	3104_3107	c.2708_2711delACAG	c.(2707-2712)gacagtfs	p.DS903fs	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	903	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GAAGGCAACACTGTCTGTCCAAGA	0.593																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.2708_2711delACAG	1.37:g.156814284_156814287delCTGT	ENSP00000357178:p.Asp903fs		O60724|Q5VZS3	Frame_Shift_Del	DEL	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D903fs	ENST00000368195.3	37	c.2711_2708	CCDS1160.1	1																																																																																			INSRR	-	pirsf_Tyr_kinase_insulin-like_rcpt,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000027644		0.593	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSRR	HGNC	protein_coding	OTTHUMT00000098929.1	59	0.00	0	CTGT	NM_014215		156814280	156814283	-1	no_errors	ENST00000368195	ensembl	human	known	69_37n	frame_shift_del	56	29.11	23	DEL	0.005:0.003:0.002:0.830	-
IQSEC2	23096	genome.wustl.edu	37	X	53268410	53268410	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chrX:53268410C>G	ENST00000375368.5	-	10	3252	c.3052G>C	c.(3052-3054)Gtg>Ctg	p.V1018L	IQSEC2_ENST00000396435.3_Missense_Mutation_p.V1028L|IQSEC2_ENST00000375365.2_Missense_Mutation_p.V823L			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	1018	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						TGCATTTCCACGAGGGGGAAA	0.507											OREG0019800	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													111.0	101.0	104.0					X																	53268410		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.3052G>C	X.37:g.53268410C>G	ENSP00000364517:p.Val1018Leu	991	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.V1028L	ENST00000375368.5	37	c.3082		X	.	.	.	.	.	.	.	.	.	.	C	9.448	1.089895	0.20390	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.41758	0.99;0.99;0.99	5.61	5.61	0.85477	.	0.414749	0.24818	N	0.035348	T	0.24624	0.0597	N	0.04116	-0.275	0.49051	D	0.999746	B;P	0.35468	0.242;0.503	B;B	0.40199	0.102;0.322	T	0.12016	-1.0564	10	0.02654	T	1	.	17.3443	0.87306	0.0:1.0:0.0:0.0	.	1028;823	Q5JU85-2;Q5JU85-3	.;.	L	1028;1018;823	ENSP00000379712:V1028L;ENSP00000364517:V1018L;ENSP00000364514:V823L	ENSP00000364514:V823L	V	-	1	0	IQSEC2	53285135	0.041000	0.20044	0.998000	0.56505	0.971000	0.66376	1.258000	0.32944	2.363000	0.80096	0.511000	0.50034	GTG	IQSEC2	-	smart_Pleckstrin_homology	ENSG00000124313		0.507	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		358	0.00	0	C	XM_291345		53268410	53268410	-1	no_errors	ENST00000396435	ensembl	human	known	69_37n	missense	178	19.82	44	SNP	1.000	G
ITGAD	3681	genome.wustl.edu	37	16	31422067	31422067	+	Silent	SNP	C	C	A	rs577953379		TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr16:31422067C>A	ENST00000389202.2	+	12	1273	c.1224C>A	c.(1222-1224)acC>acA	p.T408T		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	408					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GTTACTCCACCGAGCTAGCCC	0.667																																						dbGAP											0													26.0	28.0	27.0					16																	31422067		2195	4298	6493	-	-	-	SO:0001819	synonymous_variant	0			U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.1224C>A	16.37:g.31422067C>A			Q15575|Q15576	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.T408	ENST00000389202.2	37	c.1224	CCDS32438.1	16																																																																																			ITGAD	-	smart_Int_alpha_beta-p,prints_Integrin_alpha	ENSG00000156886		0.667	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAD	HGNC	protein_coding	OTTHUMT00000432836.1	37	0.00	0	C	NM_005353		31422067	31422067	+1	no_errors	ENST00000389202	ensembl	human	known	69_37n	silent	30	36.17	17	SNP	0.000	A
KIAA1804	84451	genome.wustl.edu	37	1	233515008	233515008	+	Silent	SNP	G	G	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:233515008G>A	ENST00000366624.3	+	9	2517	c.2256G>A	c.(2254-2256)ttG>ttA	p.L752L	MLK4_ENST00000366622.1_Silent_p.L198L	NM_032435.2	NP_115811.2																					AAGAACCGTTGCCCAAGGAAG	0.587																																						dbGAP											0													67.0	74.0	71.0					1																	233515008		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000366624.3:c.2256G>A	1.37:g.233515008G>A				Silent	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom	p.L752	ENST00000366624.3	37	c.2256	CCDS1598.1	1																																																																																			RP5-862P8.2	-	pirsf_MAPKKK9/10/11	ENSG00000143674		0.587	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1804	Clone_based_vega_gene	protein_coding	OTTHUMT00000092495.1	132	0.00	0	G			233515008	233515008	+1	no_errors	ENST00000366624	ensembl	human	known	69_37n	silent	92	44.97	76	SNP	0.632	A
KLK8	11202	genome.wustl.edu	37	19	51503734	51503734	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr19:51503734C>A	ENST00000600767.1	-	4	665	c.176G>T	c.(175-177)gGc>gTc	p.G59V	KLK8_ENST00000593490.1_Intron|CTB-147C22.9_ENST00000594512.1_RNA|KLK8_ENST00000347619.4_Intron|KLK8_ENST00000391806.2_Missense_Mutation_p.G104V|KLK8_ENST00000291726.7_Missense_Mutation_p.G59V|KLK8_ENST00000320838.5_Intron|KLK8_ENST00000598195.1_5'Flank			O60259	KLK8_HUMAN	kallikrein-related peptidase 8	59	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell death (GO:0008219)|keratinocyte proliferation (GO:0043616)|memory (GO:0007613)|negative regulation of axon regeneration (GO:0048681)|negative regulation of myelination (GO:0031642)|neuron projection morphogenesis (GO:0048812)|regulation of synapse organization (GO:0050807)|response to wounding (GO:0009611)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|prostate(1)	15		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.0033)|GBM - Glioblastoma multiforme(134;0.00888)		AAGGACACCGCCACAGAGTAG	0.592																																						dbGAP											0													69.0	69.0	69.0					19																	51503734		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB008390	CCDS12813.1, CCDS12814.1, CCDS12815.1, CCDS42600.1, CCDS74433.1	19q13	2011-09-07	2006-10-27			ENSG00000129455		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6369	protein-coding gene	gene with protein product		605644	"""kallikrein 8 (neuropsin/ovasin)"""	PRSS19		10102990, 9714609, 16800724, 16800723	Standard	NM_144505		Approved	HNP, TADG14, neuropsin, ovasin	uc002pur.1	O60259		ENST00000600767.1:c.176G>T	19.37:g.51503734C>A	ENSP00000472016:p.Gly59Val		Q5V9X1|Q5V9X2|Q8IW69|Q9HCB3|Q9NR68|Q9NR69|Q9UIL9|Q9UQ47	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.G104V	ENST00000600767.1	37	c.311	CCDS12813.1	19	.	.	.	.	.	.	.	.	.	.	C	21.1	4.099078	0.76983	.	.	ENSG00000129455	ENST00000391806;ENST00000291726	D;D	0.94000	-3.33;-3.33	4.72	4.72	0.59763	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.47093	D	0.000251	D	0.97726	0.9254	H	0.96239	3.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98794	1.0737	10	0.87932	D	0	.	15.2093	0.73206	0.0:1.0:0.0:0.0	.	59;104	O60259;O60259-2	KLK8_HUMAN;.	V	104;59	ENSP00000375682:G104V;ENSP00000291726:G59V	ENSP00000291726:G59V	G	-	2	0	KLK8	56195546	1.000000	0.71417	0.854000	0.33618	0.671000	0.39405	6.525000	0.73795	2.440000	0.82611	0.561000	0.74099	GGC	KLK8	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	ENSG00000129455		0.592	KLK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK8	HGNC	protein_coding	OTTHUMT00000465032.2	47	0.00	0	C	NM_007196		51503734	51503734	-1	no_errors	ENST00000391806	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	1.000	A
KIR2DL3	3804	genome.wustl.edu	37	19	55250982	55250982	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr19:55250982C>T	ENST00000342376.3	+	2	95	c.64C>T	c.(64-66)Cat>Tat	p.H22Y	KIR2DL3_ENST00000434419.2_Missense_Mutation_p.H22Y|KIR3DL1_ENST00000402254.2_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000538269.1_Intron|KIR3DL1_ENST00000541392.1_Intron	NM_015868.2	NP_056952.2	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3	22					immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		GGCCTGGCCACATGAGGGTGA	0.552																																						dbGAP											0													19.0	18.0	18.0					19																	55250982		1338	2430	3768	-	-	-	SO:0001583	missense	0			L41268	CCDS33107.1	19q13.4	2013-01-29				ENSG00000243772		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6331	protein-coding gene	gene with protein product		604938				7749980, 8662091	Standard	XM_006725426		Approved	cl-6, nkat2, nkat2a, nkat2b, p58, CD158B2		P43628	OTTHUMG00000065887	ENST00000342376.3:c.64C>T	19.37:g.55250982C>T	ENSP00000342215:p.His22Tyr		O43472|P78402|Q14944|Q14945|Q9UM51|Q9UQ70	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.H22Y	ENST00000342376.3	37	c.64	CCDS33107.1	19	.	.	.	.	.	.	.	.	.	.	C	3.142	-0.176056	0.06380	.	.	ENSG00000243772	ENST00000342376;ENST00000434419	T;T	0.00469	7.21;7.22	0.418	0.418	0.16429	Immunoglobulin-like fold (1);	.	.	.	.	T	0.00666	0.0022	L	0.48362	1.52	0.09310	N	1	B;D;B;B	0.60575	0.027;0.988;0.046;0.046	B;P;B;B	0.61201	0.04;0.885;0.013;0.013	T	0.55159	-0.8184	9	0.66056	D	0.02	.	4.1516	0.10240	1.0E-4:0.5501:0.4498:0.0	.	22;22;22;22	E3NZD7;P43628-2;P43628;E3NZD8	.;.;KI2L3_HUMAN;.	Y	22	ENSP00000342215:H22Y;ENSP00000415758:H22Y	ENSP00000342215:H22Y	H	+	1	0	KIR2DL3	59942794	0.000000	0.05858	0.026000	0.17262	0.011000	0.07611	-1.333000	0.02667	0.453000	0.26858	0.184000	0.17185	CAT	KIR2DL3	-	NULL	ENSG00000243772		0.552	KIR2DL3-001	KNOWN	basic|CCDS	protein_coding	KIR2DL3	HGNC	protein_coding	OTTHUMT00000141150.1	187	0.00	0	C			55250982	55250982	+1	no_errors	ENST00000434419	ensembl	human	known	69_37n	missense	345	40.82	238	SNP	0.041	T
KREMEN1	83999	genome.wustl.edu	37	22	29521252	29521252	+	Splice_Site	SNP	T	T	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr22:29521252T>G	ENST00000407188.1	+	5	473	c.473T>G	c.(472-474)tTt>tGt	p.F158C	KREMEN1_ENST00000400335.4_Splice_Site_p.F160C|KREMEN1_ENST00000400338.2_Splice_Site_p.F160C|KREMEN1_ENST00000327813.5_Splice_Site_p.F160C			Q96MU8	KREM1_HUMAN	kringle containing transmembrane protein 1	158	WSC. {ECO:0000255|PROSITE- ProRule:PRU00558}.				cell communication (GO:0007154)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	20						TTGTGGCAGTTTGCTGGGATG	0.547																																						dbGAP											0													171.0	175.0	174.0					22																	29521252		2155	4264	6419	-	-	-	SO:0001630	splice_region_variant	0			AB059618	CCDS43000.1, CCDS13849.1, CCDS43000.2	22q12.1	2008-03-27	2002-11-13	2002-11-15	ENSG00000183762	ENSG00000183762			17550	protein-coding gene	gene with protein product		609898	"""kringle containing transmembrane protein"""	KREMEN		11267660	Standard	NM_001039570		Approved	KRM1	uc011akm.1	Q96MU8	OTTHUMG00000030987	ENST00000407188.1:c.472-1T>G	22.37:g.29521252T>G			B0QY46|B0QY47|B1AJR5|Q5TIB9|Q6P3X6|Q9BY70|Q9UGS5|Q9UGU1	Missense_Mutation	SNP	pirsf_Kremen,pfam_Kringle,pfam_WSC_carb-bd,pfam_CUB,superfamily_Kringle-like,superfamily_CUB,smart_Kringle,smart_WSC_carb-bd_subgr,smart_CUB,pfscan_CUB,pfscan_Kringle,pfscan_WSC_carb-bd	p.F160C	ENST00000407188.1	37	c.479	CCDS43000.2	22	.	.	.	.	.	.	.	.	.	.	T	20.1	3.933311	0.73442	.	.	ENSG00000183762	ENST00000400335;ENST00000400338;ENST00000327813;ENST00000407188	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	5.5	5.5	0.81552	Carbohydrate-binding WSC (2);	0.093112	0.46758	D	0.000267	T	0.73583	0.3605	M	0.87097	2.86	0.45005	D	0.998022	D;D;D	0.89917	1.0;0.999;0.99	D;D;P	0.65443	0.934;0.935;0.723	T	0.76482	-0.2943	10	0.42905	T	0.14	.	13.8688	0.63605	0.0:0.0:0.0:1.0	.	158;160;160	Q96MU8;Q96MU8-2;Q96MU8-3	KREM1_HUMAN;.;.	C	160;160;160;158	ENSP00000383189:F160C;ENSP00000383192:F160C;ENSP00000331242:F160C;ENSP00000385431:F158C	ENSP00000331242:F160C	F	+	2	0	KREMEN1	27851252	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	7.431000	0.80335	2.232000	0.73038	0.528000	0.53228	TTT	KREMEN1	-	pirsf_Kremen,pfam_WSC_carb-bd,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	ENSG00000183762		0.547	KREMEN1-004	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	KREMEN1	HGNC	protein_coding	OTTHUMT00000320947.1	105	0.00	0	T		Missense_Mutation	29521252	29521252	+1	no_errors	ENST00000327813	ensembl	human	known	69_37n	missense	177	33.96	91	SNP	1.000	G
LRP8	7804	genome.wustl.edu	37	1	53727829	53727829	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:53727829A>G	ENST00000306052.6	-	12	1926	c.1825T>C	c.(1825-1827)Tcc>Ccc	p.S609P	LRP8_ENST00000347547.2_Missense_Mutation_p.S439P|LRP8_ENST00000354412.3_Missense_Mutation_p.S480P|LRP8_ENST00000371454.2_Missense_Mutation_p.S609P|LRP8_ENST00000465675.1_Missense_Mutation_p.S162P|LRP8_ENST00000460214.1_5'UTR	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	609					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						TCAATGCTGGACAGTTGGTGT	0.537																																						dbGAP											0													123.0	116.0	119.0					1																	53727829		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.1825T>C	1.37:g.53727829A>G	ENSP00000303634:p.Ser609Pro		B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.S609P	ENST00000306052.6	37	c.1825	CCDS578.1	1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.468823	0.84533	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000465675;ENST00000354412;ENST00000347547	D;D;D;D;D	0.97114	-4.25;-4.25;-4.25;-4.25;-4.25	6.16	5.02	0.67125	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	.	.	.	.	D	0.98504	0.9501	M	0.89095	3.005	0.58432	D	0.999999	D;D;D;D;D;D	0.76494	0.997;0.994;0.997;0.99;0.999;0.999	D;D;D;P;D;D	0.76071	0.985;0.927;0.978;0.774;0.987;0.974	D	0.98853	1.0759	9	0.72032	D	0.01	.	13.5418	0.61679	0.8699:0.1301:0.0:0.0	.	162;480;439;609;609;162	B3KU40;Q14114-2;Q14114-4;Q14114-3;Q14114;E9PP15	.;.;.;.;LRP8_HUMAN;.	P	609;609;162;480;439	ENSP00000303634:S609P;ENSP00000360509:S609P;ENSP00000437009:S162P;ENSP00000346391:S480P;ENSP00000334522:S439P	ENSP00000303634:S609P	S	-	1	0	LRP8	53500417	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.206000	0.65192	1.117000	0.41842	0.528000	0.53228	TCC	LRP8	-	pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000157193		0.537	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRP8	HGNC	protein_coding	OTTHUMT00000024699.1	119	0.00	0	A	NM_004631		53727829	53727829	-1	no_errors	ENST00000306052	ensembl	human	known	69_37n	missense	116	12.78	17	SNP	0.995	G
LRRFIP1	9208	genome.wustl.edu	37	2	238671248	238671248	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr2:238671248A>G	ENST00000392000.4	+	11	1009	c.892A>G	c.(892-894)Aga>Gga	p.R298G	LRRFIP1_ENST00000308482.9_Intron|LRRFIP1_ENST00000244815.5_Missense_Mutation_p.R274G|LRRFIP1_ENST00000289175.6_Missense_Mutation_p.R242G	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1	298					innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		TCTTTTAGGAAGAGCCAGTGA	0.443																																						dbGAP											0													37.0	37.0	37.0					2																	238671248		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.892A>G	2.37:g.238671248A>G	ENSP00000375857:p.Arg298Gly		E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	pfam_Leu-rich_rep_flightless-int_pr	p.R298G	ENST00000392000.4	37	c.892	CCDS46552.1	2	.	.	.	.	.	.	.	.	.	.	A	17.37	3.373317	0.61624	.	.	ENSG00000124831	ENST00000289175;ENST00000244815;ENST00000392000	T;T;T	0.52057	0.68;0.68;0.68	5.81	5.81	0.92471	.	0.292176	0.29876	N	0.010972	T	0.67192	0.2867	M	0.83774	2.66	0.34253	D	0.678966	P;P;P	0.52577	0.944;0.954;0.944	P;P;P	0.57057	0.714;0.812;0.714	T	0.79736	-0.1678	10	0.59425	D	0.04	-17.9798	15.3378	0.74273	1.0:0.0:0.0:0.0	.	242;298;274	Q32MZ4-3;Q32MZ4;Q32MZ4-2	.;LRRF1_HUMAN;.	G	242;274;298	ENSP00000289175:R242G;ENSP00000244815:R274G;ENSP00000375857:R298G	ENSP00000244815:R274G	R	+	1	2	LRRFIP1	238335987	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	3.811000	0.55620	2.225000	0.72522	0.528000	0.53228	AGA	LRRFIP1	-	pfam_Leu-rich_rep_flightless-int_pr	ENSG00000124831		0.443	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	LRRFIP1	HGNC	protein_coding	OTTHUMT00000317198.1	65	0.00	0	A	NM_004735		238671248	238671248	+1	no_errors	ENST00000392000	ensembl	human	known	69_37n	missense	83	28.45	33	SNP	1.000	G
MIS18BP1	55320	genome.wustl.edu	37	14	45711518	45711518	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr14:45711518G>C	ENST00000310806.4	-	4	1320	c.862C>G	c.(862-864)Ctc>Gtc	p.L288V	MIS18BP1_ENST00000492652.1_5'UTR	NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	288					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						TTAGTACTGAGAGTCTCAGCA	0.378																																						dbGAP											0													80.0	84.0	83.0					14																	45711518		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.862C>G	14.37:g.45711518G>C	ENSP00000309790:p.Leu288Val		D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Missense_Mutation	SNP	pfam_SANTA,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.L288V	ENST00000310806.4	37	c.862	CCDS9684.1	14	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.799898	0.00611	.	.	ENSG00000129534	ENST00000310806	T	0.15718	2.4	4.54	0.0416	0.14213	.	0.867772	0.09964	N	0.733061	T	0.09202	0.0227	L	0.29908	0.895	0.09310	N	1	B	0.25667	0.131	B	0.19148	0.024	T	0.39396	-0.9616	10	0.16896	T	0.51	1.1399	3.1672	0.06540	0.2134:0.0:0.4057:0.3809	.	288	Q6P0N0	M18BP_HUMAN	V	288	ENSP00000309790:L288V	ENSP00000309790:L288V	L	-	1	0	MIS18BP1	44781268	0.020000	0.18652	0.000000	0.03702	0.052000	0.14988	0.310000	0.19356	0.189000	0.20188	0.591000	0.81541	CTC	MIS18BP1	-	NULL	ENSG00000129534		0.378	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIS18BP1	HGNC	protein_coding	OTTHUMT00000276795.2	155	0.00	0	G			45711518	45711518	-1	no_errors	ENST00000310806	ensembl	human	known	69_37n	missense	76	37.70	46	SNP	0.000	C
MYO18B	84700	genome.wustl.edu	37	22	26422671	26422671	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr22:26422671C>G	ENST00000407587.2	+	43	6903	c.6734C>G	c.(6733-6735)cCc>cGc	p.P2245R	MYO18B_ENST00000335473.7_Missense_Mutation_p.P2244R|MYO18B_ENST00000536101.1_Missense_Mutation_p.P2244R			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2244						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GAAAAGCTGCCCAGTCCTTCA	0.607																																						dbGAP											0													24.0	26.0	25.0					22																	26422671		1909	4108	6017	-	-	-	SO:0001583	missense	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.6734C>G	22.37:g.26422671C>G	ENSP00000386096:p.Pro2245Arg		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd_dom,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.P2244R	ENST00000407587.2	37	c.6731		22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.7|21.7	4.194276|4.194276	0.78902|0.78902	.|.	.|.	ENSG00000133454|ENSG00000133454	ENST00000543971|ENST00000536101;ENST00000335473;ENST00000407587	T|D;D;D	0.54866|0.96913	0.55|-4.15;-4.15;-4.17	4.94|4.94	4.94|4.94	0.65067|0.65067	.|.	0.116110|0.116110	0.34002|0.34002	N|N	0.004359|0.004359	D|D	0.97561|0.97561	0.9201|0.9201	M|M	0.62723|0.62723	1.935|1.935	0.42346|0.42346	D|D	0.992353|0.992353	.|D;D;D;D;D	.|0.76494	.|0.999;0.999;0.999;0.999;0.999	.|D;D;D;D;D	.|0.76071	.|0.976;0.97;0.97;0.987;0.987	D|D	0.98722|0.98722	1.0709|1.0709	8|10	0.56958|0.87932	D|D	0.05|0	.|.	16.7087|16.7087	0.85379|0.85379	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1757;2246;2244;2245;2244	.|Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7	.|.;.;MY18B_HUMAN;.;.	A|R	194|2244;2244;2245	ENSP00000444262:P194A|ENSP00000441229:P2244R;ENSP00000334563:P2244R;ENSP00000386096:P2245R	ENSP00000444262:P194A|ENSP00000334563:P2244R	P|P	+|+	1|2	0|0	MYO18B|MYO18B	24752671|24752671	0.999000|0.999000	0.42202|0.42202	0.997000|0.997000	0.53966|0.53966	0.991000|0.991000	0.79684|0.79684	5.326000|5.326000	0.65875|0.65875	2.297000|2.297000	0.77311|0.77311	0.491000|0.491000	0.48974|0.48974	CCA|CCC	MYO18B	-	NULL	ENSG00000133454		0.607	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	63	0.00	0	C	NM_032608		26422671	26422671	+1	no_errors	ENST00000335473	ensembl	human	known	69_37n	missense	42	30.00	18	SNP	0.998	G
NAALADL1	10004	genome.wustl.edu	37	11	64825817	64825817	+	Silent	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr11:64825817C>T	ENST00000358658.3	-	1	204	c.177G>A	c.(175-177)gaG>gaA	p.E59E	NAALADL1_ENST00000355369.2_Silent_p.E59E|NAALADL1_ENST00000356632.3_Silent_p.E59E|NAALADL1_ENST00000339885.2_Silent_p.E59E|NAALADL1_ENST00000340252.4_Silent_p.E59E|NAALADL1_ENST00000355721.3_Silent_p.E59E	NM_005468.2	NP_005459.2	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 1	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	29						ACCTGAGGTTCTCCCGGATCC	0.637																																						dbGAP											0													54.0	52.0	53.0					11																	64825817		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			AF010141	CCDS31604.1	11q12	2011-08-16			ENSG00000168060	ENSG00000168060			23536	protein-coding gene	gene with protein product	"""ileal peptidase I100"""	602640				10085079	Standard	NM_005468		Approved		uc001ocn.3	Q9UQQ1	OTTHUMG00000165595	ENST00000358658.3:c.177G>A	11.37:g.64825817C>T			C9J8A1|C9J964|C9JL35|C9JSN0|O43176	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.E59	ENST00000358658.3	37	c.177	CCDS31604.1	11																																																																																			NAALADL1	-	NULL	ENSG00000168060		0.637	NAALADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALADL1	HGNC	protein_coding	OTTHUMT00000385162.1	37	0.00	0	C	NM_005468		64825817	64825817	-1	no_errors	ENST00000358658	ensembl	human	known	69_37n	silent	39	35.94	23	SNP	1.000	T
NFIA	4774	genome.wustl.edu	37	1	61869882	61869882	+	Silent	SNP	G	G	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:61869882G>A	ENST00000403491.3	+	8	1666	c.1182G>A	c.(1180-1182)gaG>gaA	p.E394E	NFIA_ENST00000371184.2_Silent_p.E265E|NFIA_ENST00000371185.2_Silent_p.E372E|NFIA_ENST00000485903.2_Silent_p.E351E|NFIA_ENST00000407417.3_Silent_p.E386E|NFIA_ENST00000479364.1_3'UTR|NFIA_ENST00000371191.1_Silent_p.E417E|NFIA_ENST00000371189.4_Silent_p.E439E|NFIA_ENST00000357977.5_Silent_p.E42E|NFIA_ENST00000371187.3_Silent_p.E394E	NM_001134673.3|NM_005595.4	NP_001128145.1|NP_005586.1	Q12857	NFIA_HUMAN	nuclear factor I/A	394					DNA replication (GO:0006260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to organic cyclic compound (GO:0014070)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		NFIA/EHF(2)	endometrium(1)|kidney(2)|large_intestine(8)|lung(20)|pancreas(1)|prostate(1)|skin(1)	34						ACCCTCAGGAGACGCTGAAAG	0.512																																						dbGAP											0													106.0	95.0	99.0					1																	61869882		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U07809	CCDS615.1, CCDS44156.1, CCDS53322.1, CCDS53321.1	1p31.3-p31.2	2008-02-05			ENSG00000162599	ENSG00000162599			7784	protein-coding gene	gene with protein product		600727				7590749	Standard	NM_001134673		Approved	NFI-L, KIAA1439	uc010oos.2	Q12857	OTTHUMG00000008618	ENST00000403491.3:c.1182G>A	1.37:g.61869882G>A			B4DRJ3|B4DS53|F5H0R0|F8W8W3|Q8TA97|Q9H3X9|Q9P2A9	Silent	SNP	pfam_CTF/NFI,pfam_CTF/NFI_DNA-bd_N,pfam_MAD_homology1_Dwarfin-type,smart_MAD_homology1_Dwarfin-type,pfscan_CTF/NFI_DNA-bd-dom	p.E439	ENST00000403491.3	37	c.1317	CCDS44156.1	1																																																																																			NFIA	-	pfam_CTF/NFI	ENSG00000162599		0.512	NFIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFIA	HGNC	protein_coding	OTTHUMT00000023799.3	131	0.00	0	G	NM_005595		61869882	61869882	+1	no_errors	ENST00000371189	ensembl	human	known	69_37n	silent	193	43.24	147	SNP	1.000	A
NKD1	85407	genome.wustl.edu	37	16	50664794	50664794	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr16:50664794G>T	ENST00000268459.3	+	8	892	c.668G>T	c.(667-669)tGg>tTg	p.W223L		NM_033119.4	NP_149110.1	Q969G9	NKD1_HUMAN	naked cuticle homolog 1 (Drosophila)	223					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of convergent extension involved in axis elongation (GO:1901233)|positive regulation of non-canonical Wnt signaling pathway via JNK cascade (GO:1901231)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|prostate(1)|urinary_tract(2)	23		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		CTGCGGAGCTGGGAGAAGAAG	0.607																																						dbGAP											0													42.0	36.0	38.0					16																	50664794		2182	4294	6476	-	-	-	SO:0001583	missense	0			AF358135	CCDS10743.1	16q12.1	2013-01-10			ENSG00000140807	ENSG00000140807		"""EF-hand domain containing"""	17045	protein-coding gene	gene with protein product		607851				11356022	Standard	NM_033119		Approved		uc002egg.2	Q969G9	OTTHUMG00000133169	ENST00000268459.3:c.668G>T	16.37:g.50664794G>T	ENSP00000268459:p.Trp223Leu		B2RC39|Q8WZ08	Missense_Mutation	SNP	pfscan_EF_HAND_2	p.W223L	ENST00000268459.3	37	c.668	CCDS10743.1	16	.	.	.	.	.	.	.	.	.	.	G	13.15	2.150397	0.37923	.	.	ENSG00000140807	ENST00000268459	T	0.61980	0.06	4.69	3.63	0.41609	.	0.432992	0.24755	N	0.035868	T	0.42698	0.1214	N	0.14661	0.345	0.25652	N	0.986088	B	0.02656	0.0	B	0.04013	0.001	T	0.34700	-0.9818	10	0.45353	T	0.12	-12.0657	10.5599	0.45140	0.0:0.1415:0.7157:0.1428	.	223	Q969G9	NKD1_HUMAN	L	223	ENSP00000268459:W223L	ENSP00000268459:W223L	W	+	2	0	NKD1	49222295	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.356000	0.44116	2.146000	0.66826	0.467000	0.42956	TGG	NKD1	-	NULL	ENSG00000140807		0.607	NKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKD1	HGNC	protein_coding	OTTHUMT00000256873.1	119	0.00	0	G			50664794	50664794	+1	no_errors	ENST00000268459	ensembl	human	known	69_37n	missense	34	34.62	18	SNP	0.999	T
NPTXR	23467	genome.wustl.edu	37	22	39218758	39218758	+	Silent	SNP	C	C	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr22:39218758C>G	ENST00000333039.2	-	5	1482	c.1359G>C	c.(1357-1359)ctG>ctC	p.L453L		NM_014293.3	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	453	Pentaxin.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			central_nervous_system(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	Melanoma(58;0.04)					GGGCTGGTGTCAGGGCGTGGT	0.617																																					Pancreas(139;2521 3281 36965)	dbGAP											0													55.0	45.0	49.0					22																	39218758		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF052163	CCDS33647.1	22q13.1	2007-01-25			ENSG00000221890	ENSG00000221890			7954	protein-coding gene	gene with protein product		609474				16497176	Standard	NM_014293		Approved		uc003awk.3	O95502	OTTHUMG00000150458	ENST00000333039.2:c.1359G>C	22.37:g.39218758C>G				Silent	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,prints_Pentaxin	p.L453	ENST00000333039.2	37	c.1359	CCDS33647.1	22																																																																																			NPTXR	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,prints_Pentaxin	ENSG00000221890		0.617	NPTXR-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	NPTXR	HGNC	protein_coding	OTTHUMT00000318194.2	40	0.00	0	C	NM_014293		39218758	39218758	-1	no_errors	ENST00000333039	ensembl	human	known	69_37n	silent	50	25.37	17	SNP	1.000	G
NR2E1	7101	genome.wustl.edu	37	6	108502082	108502082	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr6:108502082G>C	ENST00000368986.4	+	7	1519	c.811G>C	c.(811-813)Gtg>Ctg	p.V271L	NR2E1_ENST00000368983.3_Missense_Mutation_p.V308L	NM_003269.3	NP_003260.1	Q9Y466	NR2E1_HUMAN	nuclear receptor subfamily 2, group E, member 1	271	Ligand-binding. {ECO:0000250}.				aggressive behavior (GO:0002118)|amygdala development (GO:0021764)|anterior commissure morphogenesis (GO:0021960)|behavioral fear response (GO:0001662)|cell fate commitment (GO:0045165)|cerebral cortex neuron differentiation (GO:0021895)|dentate gyrus development (GO:0021542)|extracellular matrix organization (GO:0030198)|forebrain generation of neurons (GO:0021872)|gene expression (GO:0010467)|glial cell migration (GO:0008347)|layer formation in cerebral cortex (GO:0021819)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|olfactory bulb development (GO:0021772)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle (GO:0045787)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of stem cell proliferation (GO:2000648)|regulation of cell migration involved in sprouting angiogenesis (GO:0090049)|regulation of dendrite morphogenesis (GO:0048814)|regulation of timing of neuron differentiation (GO:0060164)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.V271L(2)		central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(16)|prostate(1)|skin(3)	30		all_cancers(87;8.13e-05)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00866)|Colorectal(196;0.0637)		BRCA - Breast invasive adenocarcinoma(108;0.013)|Epithelial(106;0.0521)|all cancers(137;0.068)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)		TTTACAAGAGGTGGTGGCTCG	0.423																																						dbGAP											2	Substitution - Missense(2)	lung(2)											140.0	131.0	134.0					6																	108502082		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13276	CCDS5063.1, CCDS69165.1	6q21	2013-01-16			ENSG00000112333	ENSG00000112333		"""Nuclear hormone receptors"""	7973	protein-coding gene	gene with protein product		603849		TLX		9628820	Standard	NM_003269		Approved	TLL, XTLL	uc003psg.3	Q9Y466	OTTHUMG00000015319	ENST00000368986.4:c.811G>C	6.37:g.108502082G>C	ENSP00000357982:p.Val271Leu		Q6ZMP8	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.V271L	ENST00000368986.4	37	c.811	CCDS5063.1	6	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855716	0.51376	.	.	ENSG00000112333	ENST00000368986;ENST00000368983	D;D	0.96265	-3.96;-3.96	5.02	5.02	0.67125	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.056583	0.64402	D	0.000001	D	0.85927	0.5811	N	0.03050	-0.425	0.80722	D	1	B	0.14012	0.009	B	0.18561	0.022	T	0.80547	-0.1334	10	0.35671	T	0.21	.	18.5138	0.90928	0.0:0.0:1.0:0.0	.	271	Q9Y466	NR2E1_HUMAN	L	271;308	ENSP00000357982:V271L;ENSP00000357979:V308L	ENSP00000357979:V308L	V	+	1	0	NR2E1	108608775	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.263000	0.95617	2.614000	0.88457	0.655000	0.94253	GTG	NR2E1	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core	ENSG00000112333		0.423	NR2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2E1	HGNC	protein_coding	OTTHUMT00000041712.2	54	0.00	0	G			108502082	108502082	+1	no_errors	ENST00000368986	ensembl	human	known	69_37n	missense	117	37.77	71	SNP	1.000	C
NUMA1	4926	genome.wustl.edu	37	11	71726884	71726884	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr11:71726884C>G	ENST00000393695.3	-	15	1996	c.1665G>C	c.(1663-1665)caG>caC	p.Q555H	NUMA1_ENST00000358965.6_Missense_Mutation_p.Q555H|NUMA1_ENST00000351960.6_Intron|RP11-849H4.4_ENST00000502284.1_RNA	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						TACTGCTTAGCTGCTCCACCT	0.612			T	RARA	APL						OREG0021187	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP		Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	0													157.0	155.0	156.0					11																	71726884		2200	4293	6493	-	-	-	SO:0001583	missense	0			Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.1665G>C	11.37:g.71726884C>G	ENSP00000377298:p.Gln555His	1132		Missense_Mutation	SNP	superfamily_Prefoldin	p.Q555H	ENST00000393695.3	37	c.1665	CCDS31633.1	11	.	.	.	.	.	.	.	.	.	.	C	14.63	2.593291	0.46214	.	.	ENSG00000137497	ENST00000358965;ENST00000393695;ENST00000359652;ENST00000542977;ENST00000537217	T;T;T;T	0.48522	2.6;2.61;1.39;0.81	5.95	2.95	0.34219	.	0.000000	0.64402	D	0.000001	T	0.55609	0.1931	L	0.46157	1.445	0.26678	N	0.971599	D;B;B;D	0.71674	0.998;0.11;0.051;0.998	D;B;B;D	0.80764	0.994;0.029;0.018;0.994	T	0.40701	-0.9549	10	0.66056	D	0.02	.	6.9613	0.24599	0.0:0.5681:0.2303:0.2016	.	561;39;555;555	Q4LE64;Q59HB8;Q14980-2;Q14980	.;.;.;NUMA1_HUMAN	H	555;555;118;555;555	ENSP00000351851:Q555H;ENSP00000377298:Q555H;ENSP00000444880:Q555H;ENSP00000442936:Q555H	ENSP00000351851:Q555H	Q	-	3	2	NUMA1	71404532	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.474000	0.22148	1.527000	0.49086	0.655000	0.94253	CAG	NUMA1	-	NULL	ENSG00000137497		0.612	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMA1	HGNC	protein_coding	OTTHUMT00000395769.1	48	0.00	0	C			71726884	71726884	-1	no_errors	ENST00000393695	ensembl	human	known	69_37n	missense	170	33.85	87	SNP	0.998	G
OGDHL	55753	genome.wustl.edu	37	10	50946058	50946058	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr10:50946058A>T	ENST00000374103.4	-	19	2537	c.2452T>A	c.(2452-2454)Tgc>Agc	p.C818S	OGDHL_ENST00000432695.1_Missense_Mutation_p.C609S|OGDHL_ENST00000419399.1_Missense_Mutation_p.C761S|OGDHL_ENST00000490844.1_5'UTR	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	818					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.N817>?(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						GGTGTGGAGCAGTTGACCACG	0.622																																						dbGAP											1	Complex(1)	large_intestine(1)											254.0	234.0	241.0					10																	50946058		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.2452T>A	10.37:g.50946058A>T	ENSP00000363216:p.Cys818Ser		A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.C818S	ENST00000374103.4	37	c.2452	CCDS7234.1	10	.	.	.	.	.	.	.	.	.	.	A	27.2	4.808169	0.90707	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	D;D;D	0.91351	-2.83;-2.83;-2.83	4.84	4.84	0.62591	Transketolase-like, pyrimidine-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.95825	0.8641	H	0.94503	3.545	0.80722	D	1	P;P;D	0.53151	0.896;0.896;0.958	P;P;P	0.58130	0.676;0.586;0.833	D	0.96850	0.9624	10	0.72032	D	0.01	.	14.424	0.67202	1.0:0.0:0.0:0.0	.	761;609;818	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	S	818;761;609	ENSP00000363216:C818S;ENSP00000401356:C761S;ENSP00000390240:C609S	ENSP00000363216:C818S	C	-	1	0	OGDHL	50616064	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.291000	0.96070	1.804000	0.52760	0.528000	0.53228	TGC	OGDHL	-	pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000197444		0.622	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGDHL	HGNC	protein_coding	OTTHUMT00000048007.1	175	0.00	0	A	NM_018245		50946058	50946058	-1	no_errors	ENST00000374103	ensembl	human	known	69_37n	missense	152	26.09	54	SNP	1.000	T
OR4K2	390431	genome.wustl.edu	37	14	20344945	20344945	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr14:20344945G>T	ENST00000298642.2	+	1	555	c.519G>T	c.(517-519)gaG>gaT	p.E173D		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GTCCCTATGAGGTAGACAGCT	0.458																																						dbGAP											0													430.0	423.0	425.0					14																	20344945		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.519G>T	14.37:g.20344945G>T	ENSP00000298642:p.Glu173Asp		B2RNK8|Q6IFA5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.E173D	ENST00000298642.2	37	c.519	CCDS32023.1	14	.	.	.	.	.	.	.	.	.	.	.	2.182	-0.387421	0.04932	.	.	ENSG00000165762	ENST00000298642	T	0.00145	8.67	5.12	-7.14	0.01527	GPCR, rhodopsin-like superfamily (1);	0.816714	0.10496	N	0.667840	T	0.00178	0.0005	M	0.73430	2.235	0.09310	N	1	B	0.06786	0.001	B	0.17979	0.02	T	0.15150	-1.0447	10	0.46703	T	0.11	.	8.0911	0.30801	0.6165:0.0:0.1753:0.2082	.	173	Q8NGD2	OR4K2_HUMAN	D	173	ENSP00000298642:E173D	ENSP00000298642:E173D	E	+	3	2	OR4K2	19414785	0.000000	0.05858	0.135000	0.22099	0.580000	0.36256	-2.785000	0.00770	-1.523000	0.01767	-1.012000	0.02466	GAG	OR4K2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000165762		0.458	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K2	HGNC	protein_coding	OTTHUMT00000409864.1	122	0.00	0	G			20344945	20344945	+1	no_errors	ENST00000298642	ensembl	human	known	69_37n	missense	260	33.50	131	SNP	0.000	T
PCCB	5096	genome.wustl.edu	37	3	136045650	136045650	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr3:136045650T>G	ENST00000251654.4	+	11	1166	c.1096T>G	c.(1096-1098)Ttg>Gtg	p.L366V	PCCB_ENST00000469217.1_Missense_Mutation_p.L386V|PCCB_ENST00000471595.1_Missense_Mutation_p.L366V|PCCB_ENST00000482086.1_Missense_Mutation_p.L250V|PCCB_ENST00000483687.1_Missense_Mutation_p.L347V|PCCB_ENST00000466072.1_Missense_Mutation_p.L386V|PCCB_ENST00000490504.1_Missense_Mutation_p.L309V|PCCB_ENST00000474833.1_3'UTR|PCCB_ENST00000468777.1_Missense_Mutation_p.L397V|PCCB_ENST00000478469.1_Intron|PCCB_ENST00000462637.1_Missense_Mutation_p.L343V	NM_000532.4	NP_000523.2	P05166	PCCB_HUMAN	propionyl CoA carboxylase, beta polypeptide	366	Carboxyltransferase.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	25					Biotin(DB00121)|L-Valine(DB00161)	TCTAGGATGCTTGGATATTAA	0.428																																						dbGAP											0													208.0	201.0	203.0					3																	136045650		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3089.1, CCDS54643.1	3q21-q22	2010-07-01	2010-04-30		ENSG00000114054	ENSG00000114054	6.4.1.3		8654	protein-coding gene	gene with protein product		232050	"""propionyl Coenzyme A carboxylase, beta polypeptide"""			2895916	Standard	NM_000532		Approved		uc003eqy.2	P05166	OTTHUMG00000159792	ENST00000251654.4:c.1096T>G	3.37:g.136045650T>G	ENSP00000251654:p.Leu366Val		B7Z2Z4|Q16813|Q96CX0	Missense_Mutation	SNP	pfam_Carboxyl_trans,pfscan_COA_CT_N,pfscan_COA_CT_C	p.L366V	ENST00000251654.4	37	c.1096	CCDS3089.1	3	.	.	.	.	.	.	.	.	.	.	T	19.91	3.915326	0.73098	.	.	ENSG00000114054	ENST00000251654;ENST00000490504;ENST00000483687;ENST00000468777;ENST00000462637;ENST00000466072;ENST00000482086;ENST00000471595;ENST00000469217	D;D;D;D;D;D;D;D;D	0.98585	-5.01;-5.01;-5.01;-5.01;-5.01;-5.01;-5.01;-5.01;-5.01	5.11	2.64	0.31445	Acetyl-coenzyme A carboxyltransferase, C-terminal (1);Carboxyl transferase (1);	0.000000	0.85682	D	0.000000	D	0.99230	0.9732	H	0.97940	4.11	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.998;0.998	D;D;D;D	0.91635	0.998;0.999;0.999;0.999	D	0.98574	1.0647	10	0.87932	D	0	.	9.5734	0.39442	0.0:0.145:0.0:0.855	.	283;386;366;366	B7Z7U9;B7Z2Z4;E9PDR0;P05166	.;.;.;PCCB_HUMAN	V	366;309;347;397;343;386;250;366;386	ENSP00000251654:L366V;ENSP00000418307:L309V;ENSP00000420639:L347V;ENSP00000419129:L397V;ENSP00000420391:L343V;ENSP00000420158:L386V;ENSP00000417253:L250V;ENSP00000417549:L366V;ENSP00000419027:L386V	ENSP00000251654:L366V	L	+	1	2	PCCB	137528340	1.000000	0.71417	0.994000	0.49952	0.986000	0.74619	2.991000	0.49409	0.385000	0.24970	0.459000	0.35465	TTG	PCCB	-	pfam_Carboxyl_trans,pfscan_COA_CT_C	ENSG00000114054		0.428	PCCB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCCB	HGNC	protein_coding	OTTHUMT00000357335.1	329	0.00	0	T			136045650	136045650	+1	no_errors	ENST00000251654	ensembl	human	known	69_37n	missense	194	49.35	189	SNP	1.000	G
PDE4DIP	9659	genome.wustl.edu	37	1	144921921	144921921	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:144921921C>T	ENST00000369354.3	-	9	1297	c.1108G>A	c.(1108-1110)Gct>Act	p.A370T	PDE4DIP_ENST00000369356.4_Missense_Mutation_p.A370T|PDE4DIP_ENST00000369351.3_Missense_Mutation_p.A370T|PDE4DIP_ENST00000529945.1_Missense_Mutation_p.A533T|PDE4DIP_ENST00000369349.3_Missense_Mutation_p.A370T|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.A507T|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.A507T|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.A436T|PDE4DIP_ENST00000479408.2_Missense_Mutation_p.A157T|PDE4DIP_ENST00000313431.9_Missense_Mutation_p.A533T			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	370					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TTGGCATCAGCCAGTTGGCGC	0.463			T	PDGFRB	MPD																																	dbGAP		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													382.0	395.0	391.0					1																	144921921		2203	4296	6499	-	-	-	SO:0001583	missense	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.1108G>A	1.37:g.144921921C>T	ENSP00000358360:p.Ala370Thr		A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.A370T	ENST00000369354.3	37	c.1108	CCDS30824.1	1	.	.	.	.	.	.	.	.	.	.	C	10.56	1.385680	0.25031	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000369353;ENST00000530740;ENST00000369359;ENST00000369351;ENST00000369349;ENST00000313431;ENST00000529945;ENST00000479408;ENST00000532801	T;T;T;T;T;T;T;T;T;T;T	0.46451	4.72;4.81;4.81;4.81;4.81;3.81;3.82;2.73;2.73;2.71;0.87	5.82	3.94	0.45596	.	.	.	.	.	T	0.11665	0.0284	N	0.20685	0.6	0.80722	D	1	B;B;B;B;B	0.26845	0.024;0.0;0.063;0.161;0.016	B;B;B;B;B	0.24006	0.01;0.003;0.023;0.05;0.015	T	0.06215	-1.0839	9	0.30078	T	0.28	.	8.2855	0.31926	0.0:0.7561:0.0:0.2439	.	533;370;533;436;370	E9PL24;Q5VU43-7;Q5VU43-2;Q5VU43-3;Q5VU43	.;.;.;.;MYOME_HUMAN	T	436;370;370;533;507;507;370;370;533;533;157;99	ENSP00000327209:A436T;ENSP00000358360:A370T;ENSP00000358363:A370T;ENSP00000435654:A507T;ENSP00000358366:A507T;ENSP00000358357:A370T;ENSP00000358355:A370T;ENSP00000316434:A533T;ENSP00000433392:A533T;ENSP00000436791:A157T;ENSP00000436751:A99T	ENSP00000327209:A436T	A	-	1	0	PDE4DIP	143633278	0.998000	0.40836	0.971000	0.41717	0.796000	0.44982	1.748000	0.38308	0.793000	0.33875	0.650000	0.86243	GCT	PDE4DIP	-	NULL	ENSG00000178104		0.463	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	206	0.00	0	C	NM_022359		144921921	144921921	-1	no_errors	ENST00000369356	ensembl	human	known	69_37n	missense	398	19.11	94	SNP	0.977	T
PKHD1	5314	genome.wustl.edu	37	6	51890477	51890477	+	Silent	SNP	A	A	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr6:51890477A>G	ENST00000371117.3	-	32	4406	c.4131T>C	c.(4129-4131)aaT>aaC	p.N1377N	PKHD1_ENST00000340994.4_Silent_p.N1377N	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1377	IPT/TIG 8; atypical.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CCACAGACATATTAGCAAATC	0.532																																						dbGAP											0													70.0	64.0	66.0					6																	51890477		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.4131T>C	6.37:g.51890477A>G			Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT_TIG_rcpt,smart_PbH1	p.N1377	ENST00000371117.3	37	c.4131	CCDS4935.1	6																																																																																			PKHD1	-	NULL	ENSG00000170927		0.532	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	101	0.00	0	A	NM_138694		51890477	51890477	-1	no_errors	ENST00000371117	ensembl	human	known	69_37n	silent	61	30.68	27	SNP	0.013	G
POU2F2	5452	genome.wustl.edu	37	19	42626508	42626508	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr19:42626508G>C	ENST00000526816.2	-	3	132	c.117C>G	c.(115-117)gaC>gaG	p.D39E	POU2F2_ENST00000524801.2_5'UTR|POU2F2_ENST00000389341.5_Missense_Mutation_p.D39E|POU2F2_ENST00000560398.1_Missense_Mutation_p.D39E|POU2F2_ENST00000533720.1_Missense_Mutation_p.D39E|POU2F2_ENST00000560558.1_Missense_Mutation_p.D39E|POU2F2_ENST00000529952.1_Missense_Mutation_p.D39E|POU2F2_ENST00000342301.4_Missense_Mutation_p.D39E|POU2F2_ENST00000529067.1_Missense_Mutation_p.D39E			P09086	PO2F2_HUMAN	POU class 2 homeobox 2	39					cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	GATGATTAGTGTCTGGTCCAT	0.577																																						dbGAP											0													130.0	120.0	124.0					19																	42626508		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.117C>G	19.37:g.42626508G>C	ENSP00000431603:p.Asp39Glu		Q16648|Q7M4M8|Q9BRS4	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU,prints_TF_octamer	p.D39E	ENST00000526816.2	37	c.117	CCDS56095.1	19	.	.	.	.	.	.	.	.	.	.	G	12.84	2.059466	0.36373	.	.	ENSG00000028277	ENST00000389341;ENST00000342301;ENST00000292077;ENST00000533720;ENST00000526816;ENST00000529067;ENST00000529952;ENST00000531773	D;D;D;T;D	0.83673	-1.63;-1.75;-1.7;-1.45;-1.67	3.56	2.52	0.30459	.	3.468220	0.00789	N	0.001334	D	0.86251	0.5888	L	0.29908	0.895	0.22457	N	0.999089	B;D;B	0.58970	0.004;0.984;0.049	B;D;B	0.68192	0.003;0.956;0.008	T	0.74526	-0.3636	10	0.54805	T	0.06	.	8.497	0.33134	0.1208:0.0:0.8792:0.0	.	39;39;39	P09086-4;P09086;P09086-3	.;PO2F2_HUMAN;.	E	39;39;39;39;38;39;39;27	ENSP00000373992:D39E;ENSP00000339369:D39E;ENSP00000437221:D39E;ENSP00000437224:D39E;ENSP00000436988:D39E	ENSP00000292077:D39E	D	-	3	2	POU2F2	47318348	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.837000	0.39201	2.005000	0.58758	0.478000	0.44815	GAC	POU2F2	-	NULL	ENSG00000028277		0.577	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	POU2F2	HGNC	protein_coding	OTTHUMT00000387329.3	121	0.00	0	G			42626508	42626508	-1	no_errors	ENST00000342301	ensembl	human	known	69_37n	missense	221	15.65	41	SNP	0.998	C
PRDM1	639	genome.wustl.edu	37	6	106553082	106553082	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr6:106553082C>G	ENST00000369096.4	+	5	1281	c.1047C>G	c.(1045-1047)agC>agG	p.S349R	PRDM1_ENST00000369091.2_Missense_Mutation_p.S313R|PRDM1_ENST00000369089.3_Missense_Mutation_p.S215R	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	349					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		GCCTCAAGAGCTCCAGCCCTC	0.622			"""D, N, Mis, F, S"""		DLBCL																																	dbGAP		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	0													69.0	59.0	63.0					6																	106553082		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.1047C>G	6.37:g.106553082C>G	ENSP00000358092:p.Ser349Arg		B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pirsf_Znf_PRDM1,pfscan_SET_dom,pfscan_Znf_C2H2	p.S349R	ENST00000369096.4	37	c.1047	CCDS5054.2	6	.	.	.	.	.	.	.	.	.	.	C	14.42	2.529920	0.45073	.	.	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278;ENST00000369089	T;T;T	0.48201	0.82;0.82;0.82	5.45	3.67	0.42095	.	0.060599	0.64402	D	0.000002	T	0.28499	0.0705	M	0.63428	1.95	0.39974	D	0.974823	P;P	0.50272	0.933;0.893	B;B	0.43123	0.348;0.409	T	0.06427	-1.0827	10	0.37606	T	0.19	-28.6544	7.9888	0.30229	0.0:0.6701:0.0:0.3299	.	215;349	Q86WM7;O75626	.;PRDM1_HUMAN	R	313;349;313;215	ENSP00000358087:S313R;ENSP00000358092:S349R;ENSP00000358085:S215R	ENSP00000358085:S215R	S	+	3	2	PRDM1	106659775	1.000000	0.71417	0.836000	0.33094	0.956000	0.61745	0.946000	0.29069	0.684000	0.31448	0.655000	0.94253	AGC	PRDM1	-	pirsf_Znf_PRDM1	ENSG00000057657		0.622	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM1	HGNC	protein_coding	OTTHUMT00000041661.3	70	0.00	0	C			106553082	106553082	+1	no_errors	ENST00000369096	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	1.000	G
PRKG2	5593	genome.wustl.edu	37	4	82125781	82125781	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr4:82125781C>G	ENST00000395578.1	-	2	537	c.421G>C	c.(421-423)Gaa>Caa	p.E141Q	PRKG2_ENST00000264399.1_Missense_Mutation_p.E141Q|PRKG2_ENST00000418486.2_Missense_Mutation_p.E141Q			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	141					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						AAGGAAAATTCAGGGGGTTTG	0.468																																						dbGAP											0													194.0	227.0	216.0					4																	82125781		2203	4300	6503	-	-	-	SO:0001583	missense	0			X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.421G>C	4.37:g.82125781C>G	ENSP00000378945:p.Glu141Gln		B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_cGMP-dependent_protein_kinase,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_cat_dom,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin	p.E141Q	ENST00000395578.1	37	c.421	CCDS3589.1	4	.	.	.	.	.	.	.	.	.	.	C	8.399	0.841613	0.16963	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486	T;T;T	0.69040	-0.25;-0.25;-0.37	5.31	5.31	0.75309	.	0.157442	0.56097	D	0.000040	T	0.36386	0.0965	N	0.03608	-0.345	0.80722	D	1	B;B	0.10296	0.003;0.001	B;B	0.14578	0.011;0.005	T	0.36986	-0.9725	10	0.13470	T	0.59	-29.1254	5.6746	0.17741	0.0:0.6739:0.1727:0.1534	.	141;141	E7EPE6;Q13237	.;KGP2_HUMAN	Q	141	ENSP00000378945:E141Q;ENSP00000264399:E141Q;ENSP00000389038:E141Q	ENSP00000264399:E141Q	E	-	1	0	PRKG2	82344805	0.905000	0.30787	0.996000	0.52242	0.984000	0.73092	2.278000	0.43426	2.747000	0.94245	0.585000	0.79938	GAA	PRKG2	-	pirsf_cGMP-dependent_protein_kinase	ENSG00000138669		0.468	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG2	HGNC	protein_coding	OTTHUMT00000252639.1	46	0.00	0	C	NM_006259		82125781	82125781	-1	no_errors	ENST00000264399	ensembl	human	known	69_37n	missense	48	42.17	35	SNP	0.952	G
PROC	5624	genome.wustl.edu	37	2	128186352	128186352	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr2:128186352A>G	ENST00000234071.3	+	9	1303	c.1216A>G	c.(1216-1218)Atg>Gtg	p.M406V	PROC_ENST00000409048.1_Missense_Mutation_p.M440V|PROC_ENST00000422777.3_Missense_Mutation_p.M406V|PROC_ENST00000453608.2_Missense_Mutation_p.M461V	NM_000312.3	NP_000303.1	P04070	PROC_HUMAN	protein C (inactivator of coagulation factors Va and VIIIa)	406	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood coagulation (GO:0030195)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0673)	Antihemophilic Factor(DB00025)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	TGGGGGGCCCATGGTCGCCTC	0.637																																						dbGAP											0													54.0	62.0	60.0					2																	128186352		2202	4300	6502	-	-	-	SO:0001583	missense	0			X02750	CCDS2145.1	2q13-q14	2014-01-30			ENSG00000115718	ENSG00000115718		"""Endogenous ligands"""	9451	protein-coding gene	gene with protein product	"""prepro-protein C"""	612283				2991887, 2437584	Standard	NM_000312		Approved		uc002tok.3	P04070	OTTHUMG00000131528	ENST00000234071.3:c.1216A>G	2.37:g.128186352A>G	ENSP00000234071:p.Met406Val		B4DPQ7|Q15189|Q15190|Q16001|Q53S74|Q9UC55	Missense_Mutation	SNP	pirsf_Pept_S1A_FX,pfam_Peptidase_S1_S6,pfam_GLA_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,prints_GLA_domain,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Peptidase_S1_S6	p.M461V	ENST00000234071.3	37	c.1381	CCDS2145.1	2	.	.	.	.	.	.	.	.	.	.	A	15.23	2.773185	0.49680	.	.	ENSG00000115718	ENST00000234071;ENST00000537436;ENST00000453608;ENST00000409048;ENST00000422777	D;D;D;D	0.92299	-3.01;-3.01;-3.01;-3.01	4.84	3.62	0.41486	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.53938	D	0.000055	D	0.90438	0.7006	N	0.12920	0.275	0.50632	D	0.999881	D;D;P;D	0.89917	0.999;0.997;0.707;1.0	D;D;B;D	0.87578	0.965;0.937;0.428;0.998	D	0.88165	0.2860	10	0.28530	T	0.3	.	11.0627	0.47957	0.8619:0.0:0.0:0.1381	.	461;462;440;406	B4DPQ7;B4DPQ3;E7END6;P04070	.;.;.;PROC_HUMAN	V	406;365;461;440;406	ENSP00000234071:M406V;ENSP00000404030:M461V;ENSP00000386679:M440V;ENSP00000409543:M406V	ENSP00000234071:M406V	M	+	1	0	PROC	127902822	0.997000	0.39634	1.000000	0.80357	0.775000	0.43874	3.699000	0.54778	2.042000	0.60477	0.533000	0.62120	ATG	PROC	-	pirsf_Pept_S1A_FX,pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Peptidase_S1_S6	ENSG00000115718		0.637	PROC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROC	HGNC	protein_coding	OTTHUMT00000254385.2	12	0.00	0	A	NM_000312		128186352	128186352	+1	no_errors	ENST00000453608	ensembl	human	known	69_37n	missense	27	30.00	12	SNP	1.000	G
PROL1	58503	genome.wustl.edu	37	4	71275628	71275628	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr4:71275628G>A	ENST00000399575.2	+	3	757	c.583G>A	c.(583-585)Gca>Aca	p.A195T		NM_021225.4	NP_067048.4	Q99935	PROL1_HUMAN	proline rich, lacrimal 1	195	Thr-rich.				negative regulation of endopeptidase activity (GO:0010951)|regulation of sensory perception of pain (GO:0051930)|retina homeostasis (GO:0001895)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)|peptidase inhibitor activity (GO:0030414)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	15		all_hematologic(202;0.196)				CATATCAGCAGCAACCCCCGC	0.493																																						dbGAP											0													131.0	144.0	140.0					4																	71275628		2072	4215	6287	-	-	-	SO:0001583	missense	0			S83198	CCDS43235.1	4q13.3	2011-10-28	2005-02-07		ENSG00000171199	ENSG00000171199			17279	protein-coding gene	gene with protein product		608936	"""proline rich 1"""			8670737	Standard	NM_021225		Approved	BPLP, PRL1, opiorphin	uc003hfi.3	Q99935	OTTHUMG00000160845	ENST00000399575.2:c.583G>A	4.37:g.71275628G>A	ENSP00000382485:p.Ala195Thr		A8MZ07|P85047	Missense_Mutation	SNP	NULL	p.A195T	ENST00000399575.2	37	c.583	CCDS43235.1	4	.	.	.	.	.	.	.	.	.	.	G	8.398	0.841400	0.16963	.	.	ENSG00000171199	ENST00000399575	T	0.26810	1.71	3.08	0.687	0.18020	.	.	.	.	.	T	0.16342	0.0393	L	0.36672	1.1	0.09310	N	1	B	0.32573	0.376	B	0.28784	0.094	T	0.21655	-1.0239	9	0.87932	D	0	.	3.7257	0.08474	0.247:0.3129:0.44:0.0	.	195	Q99935	PROL1_HUMAN	T	195	ENSP00000382485:A195T	ENSP00000382485:A195T	A	+	1	0	PROL1	71310217	0.000000	0.05858	0.008000	0.14137	0.072000	0.16883	-0.824000	0.04438	0.103000	0.17682	0.591000	0.81541	GCA	PROL1	-	NULL	ENSG00000171199		0.493	PROL1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	PROL1	HGNC	protein_coding	OTTHUMT00000362639.1	770	0.00	0	G	NM_021225		71275628	71275628	+1	no_errors	ENST00000399575	ensembl	human	putative	69_37n	missense	456	32.20	218	SNP	0.009	A
PUM1	9698	genome.wustl.edu	37	1	31439034	31439034	+	Silent	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:31439034C>T	ENST00000257075.5	-	13	1974	c.1881G>A	c.(1879-1881)caG>caA	p.Q627Q	PUM1_ENST00000424085.2_Silent_p.Q385Q|PUM1_ENST00000373742.2_Silent_p.Q568Q|PUM1_ENST00000426105.2_Silent_p.Q627Q|PUM1_ENST00000440538.2_Silent_p.Q601Q|PUM1_ENST00000423018.2_Silent_p.Q483Q|PUM1_ENST00000373741.4_Silent_p.Q663Q|PUM1_ENST00000490546.1_5'UTR|SNORD85_ENST00000363311.1_RNA|PUM1_ENST00000373747.3_Silent_p.Q628Q	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	627					membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		ggggctgaggctgCTGTGTTC	0.532																																						dbGAP											0													112.0	109.0	110.0					1																	31439034		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.1881G>A	1.37:g.31439034C>T			A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	pfam_Pumilio_RNA-bd_rpt,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.A645T	ENST00000257075.5	37	c.1933	CCDS338.1	1	.	.	.	.	.	.	.	.	.	.	C	4.781	0.145228	0.09134	.	.	ENSG00000134644	ENST00000525843;ENST00000498419	.	.	.	5.95	5.05	0.67936	.	.	.	.	.	T	0.71169	0.3308	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70637	-0.4817	4	.	.	.	-4.6468	15.3858	0.74699	0.0:0.9334:0.0:0.0666	.	.	.	.	T	645;339	.	.	A	-	1	0	PUM1	31211621	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.629000	0.37071	1.533000	0.49186	-0.137000	0.14449	GCC	PUM1	-	NULL	ENSG00000134644		0.532	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PUM1	HGNC	protein_coding	OTTHUMT00000010671.1	243	0.00	0	C			31439034	31439034	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000525843	ensembl	human	putative	69_37n	missense	313	27.50	121	SNP	1.000	T
QRICH2	84074	genome.wustl.edu	37	17	74288109	74288109	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr17:74288109C>G	ENST00000262765.5	-	4	2380	c.2201G>C	c.(2200-2202)gGt>gCt	p.G734A		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	734	Gln-rich.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						ctggaccaaaccaggctgatc	0.562																																						dbGAP											0													135.0	113.0	121.0					17																	74288109		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.2201G>C	17.37:g.74288109C>G	ENSP00000262765:p.Gly734Ala		A2RRE1|Q96LM3	Missense_Mutation	SNP	NULL	p.G734A	ENST00000262765.5	37	c.2201	CCDS32741.1	17	.	.	.	.	.	.	.	.	.	.	C	10.03	1.239394	0.22711	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.26957	1.7	4.23	-0.154	0.13399	.	.	.	.	.	T	0.40398	0.1115	M	0.83953	2.67	0.09310	N	1	D;D	0.55385	0.971;0.971	P;P	0.53224	0.721;0.654	T	0.25882	-1.0119	9	0.62326	D	0.03	-5.9039	7.4514	0.27240	0.0:0.5115:0.0:0.4885	.	734;734	B5MD94;Q9H0J4	.;QRIC2_HUMAN	A	734	ENSP00000262765:G734A	ENSP00000262765:G734A	G	-	2	0	QRICH2	71799704	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.257000	0.08745	-0.059000	0.13154	0.478000	0.44815	GGT	QRICH2	-	NULL	ENSG00000129646		0.562	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	QRICH2	HGNC	protein_coding	OTTHUMT00000395140.1	58	0.00	0	C	NM_032134		74288109	74288109	-1	no_errors	ENST00000262765	ensembl	human	known	69_37n	missense	161	21.46	44	SNP	0.000	G
RLF	6018	genome.wustl.edu	37	1	40654877	40654877	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:40654877G>C	ENST00000372771.4	+	2	415	c.388G>C	c.(388-390)Gta>Cta	p.V130L		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	130					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			TGGCAGATTAGTACTGTAAGT	0.398																																						dbGAP											0													133.0	111.0	119.0					1																	40654877		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.388G>C	1.37:g.40654877G>C	ENSP00000361857:p.Val130Leu		Q14CQ1|Q9NU60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V130L	ENST00000372771.4	37	c.388	CCDS448.1	1	.	.	.	.	.	.	.	.	.	.	G	16.62	3.174513	0.57692	.	.	ENSG00000117000	ENST00000372771	T	0.14766	2.48	5.34	5.34	0.76211	.	0.127627	0.52532	D	0.000074	T	0.13713	0.0332	L	0.44542	1.39	0.38970	D	0.958723	B	0.27351	0.176	B	0.19946	0.027	T	0.03221	-1.1059	10	0.62326	D	0.03	-11.4388	13.9592	0.64168	0.0:0.0:0.8484:0.1516	.	130	Q13129	RLF_HUMAN	L	130	ENSP00000361857:V130L	ENSP00000361857:V130L	V	+	1	0	RLF	40427464	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.258000	0.72487	2.508000	0.84585	0.655000	0.94253	GTA	RLF	-	NULL	ENSG00000117000		0.398	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLF	HGNC	protein_coding	OTTHUMT00000015767.1	241	0.00	0	G	NM_012421		40654877	40654877	+1	no_errors	ENST00000372771	ensembl	human	known	69_37n	missense	188	29.32	78	SNP	1.000	C
SAFB2	9667	genome.wustl.edu	37	19	5590388	5590388	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr19:5590388C>T	ENST00000252542.4	-	18	2690	c.2426G>A	c.(2425-2427)gGa>gAa	p.G809E		NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	809	Gly-rich.|Interacts with SAFB1.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		CTCTGGGGGTCCTCCGTGGCC	0.682																																					Ovarian(127;888 1728 23957 44128 52668)	dbGAP											0													22.0	24.0	23.0					19																	5590388		2201	4294	6495	-	-	-	SO:0001583	missense	0			D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.2426G>A	19.37:g.5590388C>T	ENSP00000252542:p.Gly809Glu		B4DKG3|Q8TB13	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SAP_DNA-bd,smart_SAP_DNA-bd,smart_RRM_dom,pfscan_SAP_DNA-bd,pfscan_RRM_dom	p.G809E	ENST00000252542.4	37	c.2426	CCDS32879.1	19	.	.	.	.	.	.	.	.	.	.	C	12.33	1.907120	0.33628	.	.	ENSG00000130254	ENST00000252542	T	0.09073	3.02	4.42	3.35	0.38373	.	0.135982	0.33127	N	0.005243	T	0.08044	0.0201	L	0.55481	1.735	0.28851	N	0.896045	P	0.50443	0.935	B	0.42245	0.381	T	0.06075	-1.0847	10	0.05525	T	0.97	-9.4958	11.5372	0.50645	0.0:0.8187:0.1813:0.0	.	809	Q14151	SAFB2_HUMAN	E	809	ENSP00000252542:G809E	ENSP00000252542:G809E	G	-	2	0	SAFB2	5541388	0.233000	0.23772	0.490000	0.27465	0.965000	0.64279	1.411000	0.34702	0.807000	0.34208	0.511000	0.50034	GGA	SAFB2	-	NULL	ENSG00000130254		0.682	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAFB2	HGNC	protein_coding	OTTHUMT00000451016.1	9	0.00	0	C	NM_014649		5590388	5590388	-1	no_errors	ENST00000252542	ensembl	human	known	69_37n	missense	2	71.43	5	SNP	0.917	T
SCN7A	6332	genome.wustl.edu	37	2	167262191	167262191	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr2:167262191C>A	ENST00000409855.1	-	25	5074	c.4948G>T	c.(4948-4950)Gat>Tat	p.D1650Y		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1650					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	ATATGAATATCTGATGTATTT	0.368																																						dbGAP											0													232.0	215.0	221.0					2																	167262191		1847	4096	5943	-	-	-	SO:0001583	missense	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.4948G>T	2.37:g.167262191C>A	ENSP00000386796:p.Asp1650Tyr			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.D1650Y	ENST00000409855.1	37	c.4948	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.260556	0.00021	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.96427	-4.01	4.75	0.915	0.19366	.	0.344115	0.24776	N	0.035693	D	0.92381	0.7582	N	0.21142	0.635	0.09310	N	0.999999	D	0.60575	0.988	P	0.57371	0.819	D	0.85728	0.1329	10	0.02654	T	1	.	6.0676	0.19871	0.0:0.5983:0.1429:0.2587	.	1650	Q01118	SCN7A_HUMAN	Y	1650	ENSP00000386796:D1650Y	ENSP00000259060:D1650Y	D	-	1	0	SCN7A	166970437	0.009000	0.17119	0.072000	0.20136	0.002000	0.02628	-0.238000	0.08977	0.050000	0.15949	-0.795000	0.03280	GAT	SCN7A	-	NULL	ENSG00000136546		0.368	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	363	0.00	0	C			167262191	167262191	-1	no_errors	ENST00000409855	ensembl	human	known	69_37n	missense	228	30.06	98	SNP	0.018	A
SEMA4A	64218	genome.wustl.edu	37	1	156124481	156124481	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:156124481C>T	ENST00000368285.3	+	2	379	c.112C>T	c.(112-114)Ccc>Tcc	p.P38S	SEMA4A_ENST00000368284.1_Intron|SEMA4A_ENST00000355014.2_Missense_Mutation_p.P38S|SEMA4A_ENST00000368286.2_5'UTR|SEMA4A_ENST00000368282.1_Missense_Mutation_p.P38S	NM_001193300.1|NM_022367.3	NP_001180229.1|NP_071762.2	Q9H3S1	SEM4A_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A	38	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|regulation of cell shape (GO:0008360)|regulation of endothelial cell migration (GO:0010594)|semaphorin-plexin signaling pathway (GO:0071526)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|ovary(2)|skin(2)	5	Hepatocellular(266;0.158)					CGGGCAGGGGCCCATGCCCAG	0.632																																						dbGAP											0													12.0	14.0	13.0					1																	156124481		2199	4297	6496	-	-	-	SO:0001583	missense	0			AK022416	CCDS1132.1, CCDS53378.1	1q22	2014-01-28			ENSG00000196189	ENSG00000196189		"""Semaphorins"""	10729	protein-coding gene	gene with protein product		607292		SEMAB		7748561	Standard	NM_022367		Approved	SemB, FLJ12287, CORD10	uc009wrq.3	Q9H3S1	OTTHUMG00000014042	ENST00000368285.3:c.112C>T	1.37:g.156124481C>T	ENSP00000357268:p.Pro38Ser		B2RDH8|B3KR76|Q5TCI5|Q5TCJ6|Q8WUA9	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.P38S	ENST00000368285.3	37	c.112	CCDS1132.1	1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.080880	0.76528	.	.	ENSG00000196189	ENST00000435124;ENST00000355014;ENST00000368285;ENST00000438830;ENST00000368282	T;T;T;T;T	0.19394	2.16;2.36;2.36;2.15;2.36	3.71	3.71	0.42584	Semaphorin/CD100 antigen (2);	1.091130	0.07328	N	0.878706	T	0.17704	0.0425	L	0.35487	1.065	0.54753	D	0.999985	D	0.89917	1.0	D	0.79108	0.992	T	0.35076	-0.9803	10	0.10377	T	0.69	.	8.7368	0.34534	0.2261:0.7739:0.0:0.0	.	38	Q9H3S1	SEM4A_HUMAN	S	38	ENSP00000401391:P38S;ENSP00000347117:P38S;ENSP00000357268:P38S;ENSP00000392865:P38S;ENSP00000357265:P38S	ENSP00000347117:P38S	P	+	1	0	SEMA4A	154391105	0.570000	0.26651	0.915000	0.36163	0.619000	0.37552	1.659000	0.37387	2.075000	0.62263	0.313000	0.20887	CCC	SEMA4A	-	superfamily_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000196189		0.632	SEMA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4A	HGNC	protein_coding	OTTHUMT00000039484.2	38	0.00	0	C	NM_022367		156124481	156124481	+1	no_errors	ENST00000355014	ensembl	human	known	69_37n	missense	28	29.79	14	SNP	0.586	T
SFXN5	94097	genome.wustl.edu	37	2	73268023	73268023	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr2:73268023T>G	ENST00000272433.2	-	3	339	c.209A>C	c.(208-210)tAt>tCt	p.Y70S	SFXN5_ENST00000474528.1_5'UTR|SFXN5_ENST00000410065.1_Missense_Mutation_p.Y70S	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5	70					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						CCCATGCTTATAGTCCTCCAG	0.537																																						dbGAP											0													43.0	43.0	43.0					2																	73268023		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.209A>C	2.37:g.73268023T>G	ENSP00000272433:p.Tyr70Ser		A8K116|Q494Y3|Q53T29	Missense_Mutation	SNP	pfam_Mtc,tigrfam_Mtc	p.Y70S	ENST00000272433.2	37	c.209	CCDS1922.1	2	.	.	.	.	.	.	.	.	.	.	T	21.2	4.109878	0.77210	.	.	ENSG00000144040	ENST00000272433;ENST00000410065;ENST00000442582	T;T;T	0.52057	0.68;0.68;0.68	5.36	5.36	0.76844	.	0.056952	0.64402	D	0.000001	T	0.68348	0.2991	M	0.82517	2.595	0.52099	D	0.999942	D;D	0.76494	0.999;0.987	D;D	0.69307	0.963;0.931	T	0.72228	-0.4354	10	0.54805	T	0.06	-14.3321	12.0418	0.53456	0.0:0.0:0.0:1.0	.	70;70	B8ZZJ6;Q8TD22	.;SFXN5_HUMAN	S	70	ENSP00000272433:Y70S;ENSP00000387076:Y70S;ENSP00000396825:Y70S	ENSP00000272433:Y70S	Y	-	2	0	SFXN5	73121531	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.996000	0.49449	2.178000	0.69098	0.533000	0.62120	TAT	SFXN5	-	pfam_Mtc,tigrfam_Mtc	ENSG00000144040		0.537	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN5	HGNC	protein_coding	OTTHUMT00000251991.1	66	0.00	0	T	NM_144579		73268023	73268023	-1	no_errors	ENST00000272433	ensembl	human	known	69_37n	missense	89	34.56	47	SNP	1.000	G
SIGLEC1	6614	genome.wustl.edu	37	20	3686511	3686511	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr20:3686511C>T	ENST00000344754.4	-	3	585	c.586G>A	c.(586-588)Gtc>Atc	p.V196I	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.V196I	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	196	Ig-like C2-type 1.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						AGGTGGCCGACGCCGGTGGGC	0.642																																						dbGAP											0													94.0	88.0	90.0					20																	3686511		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.586G>A	20.37:g.3686511C>T	ENSP00000341141:p.Val196Ile		Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V196I	ENST00000344754.4	37	c.586	CCDS13060.1	20	.	.	.	.	.	.	.	.	.	.	C	0.530	-0.858460	0.02610	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.77098	-1.07;-1.07	4.68	-7.08	0.01558	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.798511	0.10596	N	0.656192	T	0.54532	0.1864	N	0.11927	0.2	0.09310	N	1	B;B;B	0.29627	0.252;0.162;0.134	B;B;B	0.18561	0.02;0.022;0.013	T	0.25676	-1.0125	10	0.36615	T	0.2	.	14.4185	0.67168	0.0:0.6103:0.0:0.3897	.	196;196;196	Q9BZZ2-2;Q9BZZ2;Q9BZZ2-3	.;SN_HUMAN;.	I	196	ENSP00000341141:V196I;ENSP00000202578:V196I	ENSP00000202578:V196I	V	-	1	0	SIGLEC1	3634511	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.530000	0.02221	-1.449000	0.01938	-1.244000	0.01528	GTC	SIGLEC1	-	pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000088827		0.642	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC1	HGNC	protein_coding	OTTHUMT00000077761.2	28	0.00	0	C	NM_023068		3686511	3686511	-1	no_errors	ENST00000344754	ensembl	human	known	69_37n	missense	63	32.26	30	SNP	0.000	T
SLC17A8	246213	genome.wustl.edu	37	12	100795569	100795569	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr12:100795569G>A	ENST00000323346.5	+	6	1004	c.691G>A	c.(691-693)Gca>Aca	p.A231T	SLC17A8_ENST00000392989.3_Missense_Mutation_p.A231T|snoU13_ENST00000459038.1_RNA	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	231					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						CTATGCAGGGGCAGTGGTTGC	0.443																																						dbGAP											0													265.0	252.0	256.0					12																	100795569		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.691G>A	12.37:g.100795569G>A	ENSP00000316909:p.Ala231Thr		B3KXZ6|B7ZKV4|Q17RQ8	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A231T	ENST00000323346.5	37	c.691	CCDS9077.1	12	.	.	.	.	.	.	.	.	.	.	G	16.79	3.219505	0.58560	.	.	ENSG00000179520	ENST00000323346;ENST00000392989	T;T	0.58060	0.36;0.36	5.45	5.45	0.79879	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.56366	0.1980	N	0.20986	0.625	0.80722	D	1	D;D	0.67145	0.996;0.984	D;D	0.72625	0.978;0.939	T	0.44298	-0.9337	10	0.02654	T	1	.	19.661	0.95871	0.0:0.0:1.0:0.0	.	231;231	Q8NDX2;Q8NDX2-2	VGLU3_HUMAN;.	T	231	ENSP00000316909:A231T;ENSP00000376715:A231T	ENSP00000316909:A231T	A	+	1	0	SLC17A8	99319700	1.000000	0.71417	0.978000	0.43139	0.427000	0.31564	9.796000	0.99103	2.714000	0.92807	0.563000	0.77884	GCA	SLC17A8	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000179520		0.443	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A8	HGNC	protein_coding	OTTHUMT00000408673.2	229	0.00	0	G	NM_139319		100795569	100795569	+1	no_errors	ENST00000323346	ensembl	human	known	69_37n	missense	671	27.82	259	SNP	1.000	A
SLC25A14	9016	genome.wustl.edu	37	X	129483303	129483303	+	Silent	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chrX:129483303C>T	ENST00000218197.5	+	4	623	c.396C>T	c.(394-396)ttC>ttT	p.F132F	SLC25A14_ENST00000467496.1_3'UTR|SLC25A14_ENST00000543953.1_Silent_p.F97F|SLC25A14_ENST00000545805.1_Silent_p.F132F|SLC25A14_ENST00000361980.5_Silent_p.F129F|SLC25A14_ENST00000339231.3_Silent_p.F129F	NM_001282195.1|NM_001282196.1|NM_001282198.1	NP_001269124.1|NP_001269125.1|NP_001269127.1	O95258	UCP5_HUMAN	solute carrier family 25 (mitochondrial carrier, brain), member 14	132					aerobic respiration (GO:0009060)|mitochondrial transport (GO:0006839)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)	22						AGCGCTTATTCGTAGAACGTT	0.373																																						dbGAP											0													117.0	91.0	100.0					X																	129483303		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF078544	CCDS14623.1, CCDS14624.1, CCDS76020.1, CCDS76021.1	Xq24	2013-05-22			ENSG00000102078	ENSG00000102078		"""Solute carriers"""	10984	protein-coding gene	gene with protein product		300242				9852133	Standard	XM_005262485		Approved	BMCP1, UCP5	uc004evp.1	O95258	OTTHUMG00000022394	ENST00000218197.5:c.396C>T	X.37:g.129483303C>T			D3DTG2|Q0VDH7|Q9HC60|Q9HC61	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.F129	ENST00000218197.5	37	c.387	CCDS14623.1	X																																																																																			SLC25A14	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom	ENSG00000102078		0.373	SLC25A14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A14	HGNC	protein_coding	OTTHUMT00000058253.1	286	0.00	0	C	NM_022810, NM_003951		129483303	129483303	+1	no_errors	ENST00000339231	ensembl	human	known	69_37n	silent	192	16.88	39	SNP	1.000	T
SLC44A2	57153	genome.wustl.edu	37	19	10742750	10742750	+	Silent	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr19:10742750C>T	ENST00000335757.5	+	10	1117	c.741C>T	c.(739-741)ctC>ctT	p.L247L	SLC44A2_ENST00000586078.1_Silent_p.L247L|SLC44A2_ENST00000407327.4_Silent_p.L245L			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	247					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	CGATGAGCCTCCTGTTCATCA	0.572																																						dbGAP											0													293.0	255.0	267.0					19																	10742750		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.741C>T	19.37:g.10742750C>T			B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Silent	SNP	pfam_Choline_transptr-like	p.L247	ENST00000335757.5	37	c.741	CCDS12245.1	19																																																																																			SLC44A2	-	NULL	ENSG00000129353		0.572	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC44A2	HGNC	protein_coding	OTTHUMT00000452045.1	66	0.00	0	C			10742750	10742750	+1	no_errors	ENST00000335757	ensembl	human	known	69_37n	silent	178	74.61	526	SNP	1.000	T
SMOC2	64094	genome.wustl.edu	37	6	168910709	168910709	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr6:168910709C>A	ENST00000356284.2	+	2	419	c.199C>A	c.(199-201)Caa>Aaa	p.Q67K	SMOC2_ENST00000354536.5_Missense_Mutation_p.Q67K	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	67	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		TTGTGAATTTCAACGTGCCAA	0.478																																						dbGAP											0													108.0	102.0	104.0					6																	168910709		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.199C>A	6.37:g.168910709C>A	ENSP00000348630:p.Gln67Lys		B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_SPARC/Testican_Ca-bd-dom,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Thyroglobulin_1,smart_Prot_inh_Kazal,smart_Thyroglobulin_1,pfscan_EF_HAND_2,pfscan_Thyroglobulin_1	p.Q67K	ENST00000356284.2	37	c.199	CCDS55076.1	6	.	.	.	.	.	.	.	.	.	.	C	21.8	4.208945	0.79240	.	.	ENSG00000112562	ENST00000356284;ENST00000354536;ENST00000366793	T;T	0.04275	3.66;3.66	4.87	4.87	0.63330	Proteinase inhibitor I1, Kazal (1);Thyroglobulin type-1 (1);Protease inhibitor, Kazal-type (1);	0.066790	0.64402	D	0.000005	T	0.02193	0.0068	N	0.20766	0.605	0.39853	D	0.973277	B;P	0.38395	0.416;0.629	B;B	0.41088	0.347;0.155	T	0.62709	-0.6797	10	0.20519	T	0.43	-2.2289	17.3738	0.87386	0.0:1.0:0.0:0.0	.	67;67	Q9H3U7;Q9H3U7-2	SMOC2_HUMAN;.	K	67	ENSP00000348630:Q67K;ENSP00000346537:Q67K	ENSP00000346537:Q67K	Q	+	1	0	SMOC2	168653558	1.000000	0.71417	0.820000	0.32676	0.603000	0.37013	6.775000	0.75018	2.385000	0.81259	0.442000	0.29010	CAA	SMOC2	-	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Thyroglobulin_1,smart_Prot_inh_Kazal	ENSG00000112562		0.478	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMOC2	HGNC	protein_coding	OTTHUMT00000043201.1	67	0.00	0	C			168910709	168910709	+1	no_errors	ENST00000354536	ensembl	human	known	69_37n	missense	139	53.04	157	SNP	1.000	A
SOGA1	140710	genome.wustl.edu	37	20	35444226	35444226	+	Missense_Mutation	SNP	A	A	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr20:35444226A>C	ENST00000357779.3	-	5	1231	c.905T>G	c.(904-906)cTg>cGg	p.L302R	SOGA1_ENST00000456801.2_Missense_Mutation_p.L143R|SOGA1_ENST00000279034.6_Missense_Mutation_p.L302R|SOGA1_ENST00000237536.4_Missense_Mutation_p.L540R			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	302					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						CTCGTTCAGCAGCAGCTTGTT	0.632																																						dbGAP											0													15.0	18.0	17.0					20																	35444226		2122	4257	6379	-	-	-	SO:0001583	missense	0			AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.905T>G	20.37:g.35444226A>C	ENSP00000350424:p.Leu302Arg		A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	pfam_DUF3166	p.L302R	ENST00000357779.3	37	c.905		20	.	.	.	.	.	.	.	.	.	.	A	21.2	4.112287	0.77210	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.36520	1.25;1.29;1.36;1.34	5.09	5.09	0.68999	.	0.097920	0.47852	D	0.000202	T	0.57946	0.2088	M	0.69358	2.11	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.61695	-0.7010	10	0.72032	D	0.01	-18.9815	13.9812	0.64306	1.0:0.0:0.0:0.0	.	302	O94964-4	.	R	540;302;143;302	ENSP00000237536:L540R;ENSP00000279034:L302R;ENSP00000413886:L143R;ENSP00000350424:L302R	ENSP00000237536:L540R	L	-	2	0	KIAA0889	34877640	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	9.139000	0.94554	2.138000	0.66242	0.533000	0.62120	CTG	SOGA1	-	pfam_DUF3166	ENSG00000149639		0.632	SOGA1-201	KNOWN	basic	protein_coding	SOGA1	HGNC	protein_coding		51	0.00	0	A	NM_199181		35444226	35444226	-1	no_errors	ENST00000357779	ensembl	human	known	69_37n	missense	41	33.87	21	SNP	1.000	C
CTBS	1486	genome.wustl.edu	37	1	85018772	85018772	+	3'UTR	DEL	A	A	-			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:85018772delA	ENST00000370630.5	-	0	3116				CTBS_ENST00000477677.1_5'Flank	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-						chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)	p.I452fs*1(2)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		ACTGGCACAGAAAAAAAAAAT	0.239																																						dbGAP											2	Deletion - Frameshift(2)	large_intestine(1)|central_nervous_system(1)								84,112,2696		6,0,72,9,94,1265	4.0	4.0	4.0			4.5	1.0	1		5	187,225,6094		21,3,142,14,194,2879	no	near-gene-3				27,3,214,23,288,4144	A1A1,A1A2,A1R,A2A2,A2R,RR		6.3326,6.7773,6.4695			85018772	271,337,8790	1533	3494	5027	-	-	-	SO:0001624	3_prime_UTR_variant	0			M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.*1910T>-	1.37:g.85018772delA			Q5VX50	RNA	DEL	-	NULL	ENST00000370630.5	37	NULL	CCDS698.1	1																																																																																			SPATA1	-	-	ENSG00000122432		0.239	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA1	HGNC	protein_coding	OTTHUMT00000027457.2	17	0.00	0	A	NM_004388		85018772	85018772	+1	no_errors	ENST00000460286	ensembl	human	known	69_37n	rna	11	21.43	3	DEL	1.000	-
STAB2	55576	genome.wustl.edu	37	12	104097010	104097010	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr12:104097010A>T	ENST00000388887.2	+	35	4003	c.3799A>T	c.(3799-3801)Att>Ttt	p.I1267F		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						AGTTCTGGAAATTCAGAAGAA	0.388																																						dbGAP											0													101.0	95.0	97.0					12																	104097010		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.3799A>T	12.37:g.104097010A>T	ENSP00000373539:p.Ile1267Phe			Missense_Mutation	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF_laminin,smart_Prot_inh_squash,smart_EGF-like_Ca-bd,smart_FAS1_domain,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.I1267F	ENST00000388887.2	37	c.3799	CCDS31888.1	12	.	.	.	.	.	.	.	.	.	.	A	27.4	4.829466	0.90955	.	.	ENSG00000136011	ENST00000388887	T	0.65549	-0.16	5.8	5.8	0.92144	FAS1 domain (2);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	T	0.76321	0.3971	M	0.70595	2.14	0.54753	D	0.999989	D	0.89917	1.0	D	0.91635	0.999	T	0.72450	-0.4290	10	0.13470	T	0.59	.	16.1448	0.81559	1.0:0.0:0.0:0.0	.	1267	Q8WWQ8	STAB2_HUMAN	F	1267	ENSP00000373539:I1267F	ENSP00000373539:I1267F	I	+	1	0	STAB2	102621140	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.531000	0.53546	2.216000	0.71823	0.482000	0.46254	ATT	STAB2	-	superfamily_FAS1_domain,superfamily_Growth_fac_rcpt,smart_FAS1_domain	ENSG00000136011		0.388	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	HGNC	protein_coding	OTTHUMT00000407089.1	61	0.00	0	A			104097010	104097010	+1	no_errors	ENST00000388887	ensembl	human	known	69_37n	missense	161	31.78	75	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152826437	152826437	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr6:152826437T>G	ENST00000367255.5	-	9	1278	c.677A>C	c.(676-678)gAc>gCc	p.D226A	SYNE1_ENST00000466159.2_Missense_Mutation_p.D226A|SYNE1_ENST00000423061.1_Missense_Mutation_p.D233A|SYNE1_ENST00000367253.4_Missense_Mutation_p.D226A|SYNE1_ENST00000413186.2_Missense_Mutation_p.D226A|SYNE1_ENST00000367248.3_Missense_Mutation_p.D233A|SYNE1_ENST00000265368.4_Missense_Mutation_p.D226A|SYNE1_ENST00000448038.1_Missense_Mutation_p.D233A|SYNE1_ENST00000341594.5_Missense_Mutation_p.D226A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	226	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGTCTCCAAGTCCACCAATTC	0.463										HNSCC(10;0.0054)																												dbGAP											0													140.0	119.0	126.0					6																	152826437		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.677A>C	6.37:g.152826437T>G	ENSP00000356224:p.Asp226Ala		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.D226A	ENST00000367255.5	37	c.677	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	21.7	4.194889	0.78902	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	D;D;D;D;D;D;D;D;D;D	0.96459	-4.02;-4.02;-4.02;-4.02;-4.02;-4.02;-4.02;-4.02;-4.02;-4.02	5.74	5.74	0.90152	Calponin homology domain (5);	0.231170	0.32736	N	0.005720	D	0.98707	0.9566	H	0.96633	3.855	0.80722	D	1	B;B;B;D;D	0.67145	0.063;0.065;0.433;0.994;0.996	B;B;B;D;D	0.68192	0.111;0.065;0.318;0.947;0.956	D	0.99601	1.0978	10	0.72032	D	0.01	.	16.0961	0.81127	0.0:0.0:0.0:1.0	.	226;226;226;226;233	B3W695;Q8NF91;F5H4Q0;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	A	226;233;226;233;226;226;233;226;226;226	ENSP00000356224:D226A;ENSP00000396024:D233A;ENSP00000265368:D226A;ENSP00000390975:D233A;ENSP00000341887:D226A;ENSP00000356222:D226A;ENSP00000356217:D233A;ENSP00000414510:D226A;ENSP00000446021:D226A;ENSP00000441264:D226A	ENSP00000265368:D226A	D	-	2	0	SYNE1	152868130	1.000000	0.71417	0.998000	0.56505	0.937000	0.57800	8.040000	0.89188	2.208000	0.71279	0.519000	0.50382	GAC	SYNE1	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000131018		0.463	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	172	0.00	0	T	NM_182961		152826437	152826437	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	293	22.77	87	SNP	1.000	G
TBRG1	84897	genome.wustl.edu	37	11	124494848	124494848	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr11:124494848G>T	ENST00000441174.3	+	2	376	c.172G>T	c.(172-174)Gaa>Taa	p.E58*	TBRG1_ENST00000375005.4_5'UTR	NM_032811.2	NP_116200.2	Q3YBR2	TBRG1_HUMAN	transforming growth factor beta regulator 1	58					cell cycle arrest (GO:0007050)|DNA replication (GO:0006260)|negative regulation of cell proliferation (GO:0008285)|nucleolus to nucleoplasm transport (GO:0032066)|protein stabilization (GO:0050821)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				kidney(1)|prostate(1)	2	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0218)		TATTTGTGATGAAATTGCTCG	0.308																																						dbGAP											0													121.0	110.0	114.0					11																	124494848		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AK074140	CCDS8448.2	11q24.2	2008-02-05			ENSG00000154144	ENSG00000154144			29551	protein-coding gene	gene with protein product	"""nuclear interactor of ARF and MDM2"""	610614				7654366, 17110379	Standard	NM_032811		Approved	FLJ14621, TB-5, NIAM	uc001qak.4	Q3YBR2	OTTHUMG00000153024	ENST00000441174.3:c.172G>T	11.37:g.124494848G>T	ENSP00000409016:p.Glu58*		Q53GJ5|Q66ZJ6|Q69YS7|Q8TCS4|Q8TEI4|Q96SV0	Nonsense_Mutation	SNP	pfam_FYrich_N,pfam_FYrich_C,smart_FYrich_N,smart_FYrich_C	p.E58*	ENST00000441174.3	37	c.172	CCDS8448.2	11	.	.	.	.	.	.	.	.	.	.	G	37	6.167250	0.97343	.	.	ENSG00000154144	ENST00000441174	.	.	.	5.46	5.46	0.80206	.	0.058690	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-16.5894	16.8609	0.86018	0.0:0.0:1.0:0.0	.	.	.	.	X	58	.	ENSP00000284290:E58X	E	+	1	0	TBRG1	124000058	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.103000	0.89550	2.840000	0.97914	0.655000	0.94253	GAA	TBRG1	-	NULL	ENSG00000154144		0.308	TBRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBRG1	HGNC	protein_coding	OTTHUMT00000329057.2	70	0.00	0	G	NM_032811		124494848	124494848	+1	no_errors	ENST00000441174	ensembl	human	known	69_37n	nonsense	106	35.76	59	SNP	1.000	T
TEX13A	56157	genome.wustl.edu	37	X	104464663	104464663	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chrX:104464663T>G	ENST00000413579.1	-	2	530	c.419A>C	c.(418-420)cAg>cCg	p.Q140P	IL1RAPL2_ENST00000372582.1_Intron|TEX13A_ENST00000372578.3_Missense_Mutation_p.Q140P|TEX13A_ENST00000372575.1_Missense_Mutation_p.Q140P|IL1RAPL2_ENST00000344799.4_Intron			Q9BXU3	TX13A_HUMAN	testis expressed 13A	140							zinc ion binding (GO:0008270)			large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						TCTCTCTTTCTGCACCTCCAC	0.602																																						dbGAP											0													34.0	34.0	34.0					X																	104464663		2132	4203	6335	-	-	-	SO:0001583	missense	0			AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.419A>C	X.37:g.104464663T>G	ENSP00000399753:p.Gln140Pro		B1B1G8|Q32NB6	Missense_Mutation	SNP	pfam_Znf_RanBP2,pfscan_Znf_RanBP2	p.Q140P	ENST00000413579.1	37	c.419		X	.	.	.	.	.	.	.	.	.	.	T	10.99	1.508036	0.27036	.	.	ENSG00000133149	ENST00000372578;ENST00000372575;ENST00000413579	.	.	.	2.84	-1.07	0.09968	.	0.842428	0.09692	N	0.768180	T	0.51415	0.1673	.	.	.	0.09310	N	1	D;D	0.71674	0.998;0.998	D;D	0.64877	0.93;0.93	T	0.41627	-0.9498	8	0.44086	T	0.13	.	5.7591	0.18190	0.0:0.3569:0.0:0.6431	.	140;140	C9JWK0;Q9BXU3	.;TX13A_HUMAN	P	140	.	ENSP00000361656:Q140P	Q	-	2	0	TEX13A	104351319	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.629000	0.05508	-0.326000	0.08564	0.412000	0.27726	CAG	TEX13A	-	NULL	ENSG00000133149		0.602	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	TEX13A	HGNC	protein_coding		38	0.00	0	T	NM_031274		104464663	104464663	-1	no_errors	ENST00000413579	ensembl	human	known	69_37n	missense	24	36.84	14	SNP	0.001	G
TFAP4	7023	genome.wustl.edu	37	16	4312598	4312598	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr16:4312598T>C	ENST00000204517.6	-	2	522	c.194A>G	c.(193-195)aAc>aGc	p.N65S		NM_003223.2	NP_003214.1	Q01664	TFAP4_HUMAN	transcription factor AP-4 (activating enhancer binding protein 4)	65	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cellular response to dexamethasone stimulus (GO:0071549)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						GAATCCCGCGTTGATGCTCTG	0.632																																						dbGAP											0													125.0	117.0	120.0					16																	4312598		2197	4300	6497	-	-	-	SO:0001583	missense	0			X57435	CCDS10510.1	16p13	2013-05-21	2001-11-28		ENSG00000090447	ENSG00000090447		"""Basic helix-loop-helix proteins"""	11745	protein-coding gene	gene with protein product		600743	"""transcription factor AP-4 (activating enhancer-binding protein 4)"""			2123466	Standard	NM_003223		Approved	AP-4, bHLHc41	uc010uxg.2	Q01664	OTTHUMG00000129435	ENST00000204517.6:c.194A>G	16.37:g.4312598T>C	ENSP00000204517:p.Asn65Ser		O60409	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.N65S	ENST00000204517.6	37	c.194	CCDS10510.1	16	.	.	.	.	.	.	.	.	.	.	T	27.6	4.841995	0.91197	.	.	ENSG00000090447	ENST00000204517	D	0.99369	-5.78	5.57	5.57	0.84162	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99309	0.9758	M	0.78285	2.405	0.80722	D	1	D	0.69078	0.997	D	0.74348	0.983	D	0.99113	1.0847	10	0.72032	D	0.01	.	14.7174	0.69280	0.0:0.0:0.0:1.0	.	65	Q01664	TFAP4_HUMAN	S	65	ENSP00000204517:N65S	ENSP00000204517:N65S	N	-	2	0	TFAP4	4252599	1.000000	0.71417	0.992000	0.48379	0.945000	0.59286	5.720000	0.68470	2.116000	0.64780	0.482000	0.46254	AAC	TFAP4	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000090447		0.632	TFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP4	HGNC	protein_coding	OTTHUMT00000251595.2	35	0.00	0	T	NM_003223		4312598	4312598	-1	no_errors	ENST00000204517	ensembl	human	known	69_37n	missense	80	29.20	33	SNP	1.000	C
TGFB1	7040	genome.wustl.edu	37	19	41850696	41850696	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr19:41850696delG	ENST00000221930.5	-	3	1456	c.590delC	c.(589-591)tctfs	p.S197fs		NM_000660.4	NP_000651.3	P01137	TGFB1_HUMAN	transforming growth factor, beta 1	197	Arm domain. {ECO:0000250}.				active induction of host immune response by virus (GO:0046732)|adaptive immune response based on somatic recombination of immune receptors built from immunoglobulin superfamily domains (GO:0002460)|aging (GO:0007568)|ATP biosynthetic process (GO:0006754)|blood coagulation (GO:0007596)|branch elongation involved in mammary gland duct branching (GO:0060751)|cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cell-cell junction organization (GO:0045216)|cellular calcium ion homeostasis (GO:0006874)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to organic cyclic compound (GO:0071407)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation (GO:0002062)|common-partner SMAD protein phosphorylation (GO:0007182)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|defense response to fungus, incompatible interaction (GO:0009817)|digestive tract development (GO:0048565)|embryo development (GO:0009790)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|evasion or tolerance of host defenses by virus (GO:0019049)|extracellular matrix assembly (GO:0085029)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|face morphogenesis (GO:0060325)|female pregnancy (GO:0007565)|frontal suture morphogenesis (GO:0060364)|germ cell migration (GO:0008354)|hematopoietic progenitor cell differentiation (GO:0002244)|hyaluronan catabolic process (GO:0030214)|inflammatory response (GO:0006954)|inner ear development (GO:0048839)|lens fiber cell differentiation (GO:0070306)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lymph node development (GO:0048535)|macrophage derived foam cell differentiation (GO:0010742)|mammary gland branching involved in thelarche (GO:0060744)|MAPK cascade (GO:0000165)|mitotic cell cycle checkpoint (GO:0007093)|modulation by virus of host morphology or physiology (GO:0019048)|mononuclear cell proliferation (GO:0032943)|myelination (GO:0042552)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA replication (GO:0008156)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of extracellular matrix disassembly (GO:0010716)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of ossification (GO:0030279)|negative regulation of phagocytosis (GO:0050765)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|ossification involved in bone remodeling (GO:0043932)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|phosphate-containing compound metabolic process (GO:0006796)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of bone mineralization (GO:0030501)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of exit from mitosis (GO:0031536)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of isotype switching to IgA isotypes (GO:0048298)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NAD+ ADP-ribosyltransferase activity (GO:1901666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of odontogenesis (GO:0042482)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein localization to nucleus (GO:1900182)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein secretion (GO:0050714)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein export from nucleus (GO:0006611)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|receptor catabolic process (GO:0032801)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of binding (GO:0051098)|regulation of blood vessel remodeling (GO:0060312)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of cartilage development (GO:0061035)|regulation of cell migration (GO:0030334)|regulation of DNA binding (GO:0051101)|regulation of miRNA metabolic process (GO:2000628)|regulation of protein import into nucleus (GO:0042306)|regulation of sodium ion transport (GO:0002028)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulatory T cell differentiation (GO:0045066)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to laminar fluid shear stress (GO:0034616)|response to progesterone (GO:0032570)|response to radiation (GO:0009314)|response to vitamin D (GO:0033280)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|T cell homeostasis (GO:0043029)|tolerance induction to self antigen (GO:0002513)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|viral life cycle (GO:0019058)	axon (GO:0030424)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	antigen binding (GO:0003823)|cytokine activity (GO:0005125)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(1)|large_intestine(2)|lung(4)|skin(1)	8					Hyaluronidase(DB00070)	GACATCAAAAGATAACCACTC	0.552																																						dbGAP											0													107.0	75.0	86.0					19																	41850696		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			X02812	CCDS33031.1	19q13.1	2014-01-30	2007-02-16			ENSG00000105329		"""Endogenous ligands"""	11766	protein-coding gene	gene with protein product	"""Camurati-Engelmann disease"", ""prepro-transforming growth factor beta-1"""	190180		TGFB, DPD1		10631145, 10843814	Standard	NM_000660		Approved	CED, TGFbeta	uc002oqh.2	P01137		ENST00000221930.5:c.590delC	19.37:g.41850696delG	ENSP00000221930:p.Ser197fs		A8K792|Q9UCG4	Frame_Shift_Del	DEL	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,pirsf_TGF-beta,prints_TGFb1,prints_TGF-beta	p.S197fs	ENST00000221930.5	37	c.590	CCDS33031.1	19																																																																																			TGFB1	-	pfam_TGF-b_N,pirsf_TGF-beta,prints_TGF-beta	ENSG00000105329		0.552	TGFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFB1	HGNC	protein_coding	OTTHUMT00000463500.2	15	0.00	0	G			41850696	41850696	-1	no_errors	ENST00000221930	ensembl	human	known	69_37n	frame_shift_del	32	49.32	36	DEL	1.000	-
TIMM44	10469	genome.wustl.edu	37	19	7998974	7998974	+	Splice_Site	SNP	C	C	A	rs370688548		TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr19:7998974C>A	ENST00000270538.3	-	5	811	c.543G>T	c.(541-543)caG>caT	p.Q181H	TIMM44_ENST00000598968.1_5'Flank	NM_006351.3	NP_006342.2	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44 homolog (yeast)	181					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			NS(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	17						CTGGGCTCACCTGGGAGAGGG	0.697																																						dbGAP											0													65.0	71.0	69.0					19																	7998974		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF026030	CCDS12192.1	19p13.3-p13.2	2008-07-04				ENSG00000104980			17316	protein-coding gene	gene with protein product		605058				10848612, 10339406	Standard	NM_006351		Approved	TIM44	uc002miz.3	O43615		ENST00000270538.3:c.543+1G>T	19.37:g.7998974C>A			A8K0R9|D6W664|Q8N193	Missense_Mutation	SNP	pfam_Tim44-related/Ribosome_L45,smart_Tim44-related/Ribosome_L45,pirsf_Tim44,tigrfam_Tim44	p.Q181H	ENST00000270538.3	37	c.543	CCDS12192.1	19	.	.	.	.	.	.	.	.	.	.	C	18.88	3.717903	0.68844	.	.	ENSG00000104980	ENST00000270538	T	0.78126	-1.15	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.73521	0.3597	L	0.53729	1.69	0.80722	D	1	B	0.32040	0.353	B	0.29716	0.106	T	0.70626	-0.4820	9	.	.	.	-41.1195	16.9319	0.86192	0.0:1.0:0.0:0.0	.	181	O43615	TIM44_HUMAN	H	181	ENSP00000270538:Q181H	.	Q	-	3	2	TIMM44	7904974	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.491000	0.66887	2.606000	0.88127	0.561000	0.74099	CAG	TIMM44	-	pirsf_Tim44,tigrfam_Tim44	ENSG00000104980		0.697	TIMM44-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	TIMM44	HGNC	protein_coding	OTTHUMT00000461596.3	23	0.00	0	C		Missense_Mutation	7998974	7998974	-1	no_errors	ENST00000270538	ensembl	human	known	69_37n	missense	40	66.94	83	SNP	1.000	A
TLE4	7091	genome.wustl.edu	37	9	82323054	82323054	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr9:82323054G>T	ENST00000376552.2	+	12	1976	c.958G>T	c.(958-960)Gtc>Ttc	p.V320F	TLE4_ENST00000265284.6_Missense_Mutation_p.V295F|TLE4_ENST00000376544.3_Missense_Mutation_p.V251F|TLE4_ENST00000376537.4_Missense_Mutation_p.V352F|TLE4_ENST00000376520.4_Missense_Mutation_p.V352F|TLE4_ENST00000376534.4_5'UTR	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	320					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						TACTACTCCCGTCTCAAAGTC	0.428																																						dbGAP											0													90.0	84.0	86.0					9																	82323054		1863	4099	5962	-	-	-	SO:0001583	missense	0			M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.958G>T	9.37:g.82323054G>T	ENSP00000365735:p.Val320Phe		F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Missense_Mutation	SNP	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.V352F	ENST00000376552.2	37	c.1054	CCDS43837.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.5|28.5	4.923110|4.923110	0.92319|0.92319	.|.	.|.	ENSG00000106829|ENSG00000106829	ENST00000496114|ENST00000376552;ENST00000376544;ENST00000376520;ENST00000376537;ENST00000265284;ENST00000428713;ENST00000490347;ENST00000467142	.|T;T;T;T;T;T;T;T	.|0.50548	.|0.85;0.74;0.96;0.95;0.95;1.35;1.81;1.34	6.03|6.03	6.03|6.03	0.97812|0.97812	.|.	.|0.112301	.|0.64402	.|D	.|0.000013	T|T	0.60444|0.60444	0.2269|0.2269	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	.|P;P;P;P	.|0.49696	.|0.915;0.924;0.907;0.927	.|P;B;P;P	.|0.51385	.|0.533;0.422;0.5;0.668	T|T	0.52609|0.52609	-0.8553|-0.8553	5|10	.|0.28530	.|T	.|0.3	-19.0175|-19.0175	20.5568|20.5568	0.99304|0.99304	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|295;251;352;320	.|F8W6T6;Q04727-2;Q04727-3;Q04727	.|.;.;.;TLE4_HUMAN	L|F	110|320;251;352;352;295;286;139;48	.|ENSP00000365735:V320F;ENSP00000365727:V251F;ENSP00000365703:V352F;ENSP00000365720:V352F;ENSP00000265284:V295F;ENSP00000409313:V286F;ENSP00000417844:V139F;ENSP00000418409:V48F	.|ENSP00000265284:V295F	R|V	+|+	2|1	0|0	TLE4|TLE4	81512874|81512874	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	7.956000|7.956000	0.87863|0.87863	2.861000|2.861000	0.98227|0.98227	0.655000|0.655000	0.94253|0.94253	CGT|GTC	TLE4	-	NULL	ENSG00000106829		0.428	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	TLE4	HGNC	protein_coding	OTTHUMT00000052792.4	224	0.00	0	G	XM_212237		82323054	82323054	+1	no_errors	ENST00000376520	ensembl	human	known	69_37n	missense	124	31.87	58	SNP	1.000	T
TMEM57	55219	genome.wustl.edu	37	1	25810708	25810708	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr1:25810708G>T	ENST00000374343.4	+	7	1435	c.1256G>T	c.(1255-1257)cGa>cTa	p.R419L	TMEM57_ENST00000399766.3_Missense_Mutation_p.R192L|TMEM57_ENST00000399763.3_Missense_Mutation_p.R61L	NM_018202.4	NP_060672.2	Q8N5G2	MACOI_HUMAN	transmembrane protein 57	419					brain development (GO:0007420)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|synapse (GO:0045202)		p.R419Q(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		AGCACCGAGCGAGGGATCCGC	0.552																																						dbGAP											1	Substitution - Missense(1)	skin(1)											71.0	72.0	72.0					1																	25810708		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001609	CCDS30638.1, CCDS60034.1	1p36.11	2008-02-05			ENSG00000204178	ENSG00000204178			25572	protein-coding gene	gene with protein product		610301				12459264, 15255972	Standard	XM_005245931		Approved	FLJ10747	uc001bkk.3	Q8N5G2	OTTHUMG00000003473	ENST00000374343.4:c.1256G>T	1.37:g.25810708G>T	ENSP00000363463:p.Arg419Leu		B1AK00|Q2TLX5|Q2TLX6|Q9NVG6	Missense_Mutation	SNP	pfam_Macoilin,superfamily_Prefoldin	p.R419L	ENST00000374343.4	37	c.1256	CCDS30638.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.512917	0.96402	.	.	ENSG00000204178	ENST00000399766;ENST00000399763;ENST00000374343	T;D;T	0.83075	1.56;-1.68;2.53	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.91331	0.7266	M	0.79258	2.445	0.80722	D	1	P;D;D	0.89917	0.907;0.985;1.0	P;P;D	0.73380	0.56;0.803;0.98	D	0.91138	0.4943	10	0.56958	D	0.05	-6.6293	19.1076	0.93303	0.0:0.0:1.0:0.0	.	61;192;419	Q8N5G2-2;Q8N5G2-3;Q8N5G2	.;.;MACOI_HUMAN	L	192;61;419	ENSP00000382668:R192L;ENSP00000382666:R61L;ENSP00000363463:R419L	ENSP00000363463:R419L	R	+	2	0	TMEM57	25683295	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.447000	0.97595	2.759000	0.94783	0.650000	0.86243	CGA	TMEM57	-	pfam_Macoilin,superfamily_Prefoldin	ENSG00000204178		0.552	TMEM57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM57	HGNC	protein_coding	OTTHUMT00000009659.2	46	0.00	0	G	NM_018202		25810708	25810708	+1	no_errors	ENST00000374343	ensembl	human	known	69_37n	missense	39	23.53	12	SNP	1.000	T
TRMT12	55039	genome.wustl.edu	37	8	125464331	125464331	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr8:125464331C>G	ENST00000328599.3	+	1	1284	c.1163C>G	c.(1162-1164)aCc>aGc	p.T388S	TRMT12_ENST00000521443.1_Intron	NM_017956.3	NP_060426.2	Q53H54	TYW2_HUMAN	tRNA methyltransferase 12 homolog (S. cerevisiae)	388					tRNA processing (GO:0008033)		transferase activity (GO:0016740)			breast(2)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TCACCAGCCACCAAGCCAGAG	0.488																																						dbGAP											0													45.0	41.0	42.0					8																	125464331		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF313041	CCDS6349.1	8q24.13	2011-05-09	2006-11-16		ENSG00000183665	ENSG00000183665			26091	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 2"""	611244	"""tRNA methyltranferase 12 homolog (S. cerevisiae)"""			16005430, 17150819	Standard	NM_017956		Approved	FLJ20772, Trm12, TYW2	uc003yra.4	Q53H54	OTTHUMG00000165022	ENST00000328599.3:c.1163C>G	8.37:g.125464331C>G	ENSP00000329858:p.Thr388Ser		Q6PKB9|Q96F21|Q9NWK6	Missense_Mutation	SNP	pfam_tRNA_Trfase_Trm5/Tyw2	p.T388S	ENST00000328599.3	37	c.1163	CCDS6349.1	8	.	.	.	.	.	.	.	.	.	.	C	1.515	-0.548433	0.04024	.	.	ENSG00000183665	ENST00000328599	T	0.41758	0.99	5.21	2.4	0.29515	.	1.281710	0.05104	N	0.487754	T	0.31358	0.0794	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21690	-1.0238	10	0.08837	T	0.75	0.1016	4.1019	0.10017	0.1637:0.5903:0.1581:0.0879	.	388	Q53H54	TYW2_HUMAN	S	388	ENSP00000329858:T388S	ENSP00000329858:T388S	T	+	2	0	TRMT12	125533512	0.001000	0.12720	0.001000	0.08648	0.960000	0.62799	-0.377000	0.07456	0.286000	0.22352	0.561000	0.74099	ACC	TRMT12	-	NULL	ENSG00000183665		0.488	TRMT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT12	HGNC	protein_coding	OTTHUMT00000381465.1	49	0.00	0	C	NM_017956		125464331	125464331	+1	no_errors	ENST00000328599	ensembl	human	known	69_37n	missense	38	25.49	13	SNP	0.009	G
TTN	7273	genome.wustl.edu	37	2	179606022	179606022	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr2:179606022T>C	ENST00000591111.1	-	46	11211	c.10987A>G	c.(10987-10989)Acc>Gcc	p.T3663A	TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T3980A|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.T3617A|TTN_ENST00000342175.6_Missense_Mutation_p.T3809A|TTN_ENST00000359218.5_Missense_Mutation_p.T3742A			Q8WZ42	TITIN_HUMAN	titin	13969	Ig-like 22.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAAACACTGGTGCAAAGCTGC	0.453																																						dbGAP											0													107.0	104.0	105.0					2																	179606022		1915	4124	6039	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10987A>G	2.37:g.179606022T>C	ENSP00000465570:p.Thr3663Ala		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.T3809A	ENST00000591111.1	37	c.11425		2	.	.	.	.	.	.	.	.	.	.	T	10.92	1.486062	0.26686	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.66460	-0.21;-0.21;-0.21	5.87	5.87	0.94306	.	.	.	.	.	T	0.56688	0.2002	L	0.37897	1.145	0.23192	N	0.998146	B;B;B	0.26002	0.139;0.139;0.139	B;B;B	0.28305	0.088;0.088;0.088	T	0.53408	-0.8443	9	0.87932	D	0	.	7.182	0.25778	0.1729:0.0:0.1237:0.7034	.	3617;3742;3809	D3DPF9;E7EQE6;E7ET18	.;.;.	A	3617;3809;3742;3617	ENSP00000434586:T3617A;ENSP00000340554:T3809A;ENSP00000352154:T3742A	ENSP00000340554:T3809A	T	-	1	0	TTN	179314267	1.000000	0.71417	0.999000	0.59377	0.740000	0.42216	3.421000	0.52742	2.371000	0.80710	0.533000	0.62120	ACC	TTN	-	pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.453	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	71	0.00	0	T	NM_133378		179606022	179606022	-1	no_errors	ENST00000342175	ensembl	human	known	69_37n	missense	38	36.67	22	SNP	0.915	C
UPF3B	65109	genome.wustl.edu	37	X	118971940	118971940	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chrX:118971940C>T	ENST00000276201.2	-	10	1151	c.1082G>A	c.(1081-1083)cGa>cAa	p.R361Q	UPF3B_ENST00000345865.2_Missense_Mutation_p.R348Q|UPF3B_ENST00000478840.1_5'Flank	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	361	Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						CTCTCTTTCTCGAAGTATGCG	0.463																																						dbGAP											0													155.0	133.0	141.0					X																	118971940		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.1082G>A	X.37:g.118971940C>T	ENSP00000276201:p.Arg361Gln		D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Missense_Mutation	SNP	pfam_Nonsense_mediated_decay_UPF3	p.R361Q	ENST00000276201.2	37	c.1082	CCDS14588.1	X	.	.	.	.	.	.	.	.	.	.	C	16.35	3.098485	0.56183	.	.	ENSG00000125351	ENST00000276201;ENST00000345865	T;T	0.78126	-1.14;-1.15	5.83	4.97	0.65823	.	0.266734	0.40728	N	0.001037	T	0.68458	0.3003	L	0.56280	1.765	0.22728	N	0.99881	P;P	0.37997	0.614;0.48	B;B	0.26094	0.066;0.03	T	0.60332	-0.7284	10	0.35671	T	0.21	.	12.5333	0.56128	0.0:0.9179:0.0:0.0821	.	348;361	Q9BZI7-2;Q9BZI7	.;REN3B_HUMAN	Q	361;348	ENSP00000276201:R361Q;ENSP00000245418:R348Q	ENSP00000276201:R361Q	R	-	2	0	UPF3B	118855968	0.899000	0.30636	0.117000	0.21633	0.985000	0.73830	2.725000	0.47294	1.234000	0.43709	0.526000	0.51066	CGA	UPF3B	-	NULL	ENSG00000125351		0.463	UPF3B-001	KNOWN	basic|CCDS	protein_coding	UPF3B	HGNC	protein_coding	OTTHUMT00000058068.1	239	0.00	0	C			118971940	118971940	-1	no_errors	ENST00000276201	ensembl	human	known	69_37n	missense	316	20.95	84	SNP	0.355	T
VCAN	1462	genome.wustl.edu	37	5	82815833	82815833	+	Missense_Mutation	SNP	A	A	T	rs545968358		TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr5:82815833A>T	ENST00000265077.3	+	7	2273	c.1708A>T	c.(1708-1710)Acc>Tcc	p.T570S	VCAN_ENST00000512590.2_Missense_Mutation_p.T522S|VCAN_ENST00000343200.5_Intron|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Missense_Mutation_p.T570S	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	570	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TGATGAGAGCACCTTGATCTT	0.433																																						dbGAP											0													146.0	140.0	142.0					5																	82815833		2203	4300	6503	-	-	-	SO:0001583	missense	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.1708A>T	5.37:g.82815833A>T	ENSP00000265077:p.Thr570Ser		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EGF-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Link,smart_EGF-like,smart_EGF-like_Ca-bd,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.T570S	ENST00000265077.3	37	c.1708	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	A	5.338	0.247724	0.10130	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	T;T;T	0.36340	1.26;1.26;1.26	5.87	5.87	0.94306	.	0.303193	0.28393	N	0.015501	T	0.30198	0.0757	L	0.56769	1.78	0.09310	N	1	P;P	0.42692	0.607;0.787	B;B	0.34652	0.187;0.158	T	0.38243	-0.9670	10	0.32370	T	0.25	.	9.6212	0.39723	0.8344:0.0:0.0:0.1656	.	570;570	P13611-3;P13611	.;CSPG2_HUMAN	S	570;570;522	ENSP00000265077:T570S;ENSP00000342768:T570S;ENSP00000425959:T522S	ENSP00000265077:T570S	T	+	1	0	VCAN	82851589	0.183000	0.23186	0.089000	0.20774	0.252000	0.25951	4.247000	0.58750	2.248000	0.74166	0.533000	0.62120	ACC	VCAN	-	NULL	ENSG00000038427		0.433	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	114	0.00	0	A	NM_004385		82815833	82815833	+1	no_errors	ENST00000265077	ensembl	human	known	69_37n	missense	59	46.36	51	SNP	0.020	T
VCX3B	425054	genome.wustl.edu	37	X	8433833	8433833	+	Silent	SNP	C	C	T	rs201223234		TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chrX:8433833C>T	ENST00000381032.1	+	3	457	c.150C>T	c.(148-150)cgC>cgT	p.R50R	VCX3B_ENST00000444481.1_Silent_p.R50R|VCX3B_ENST00000453306.1_Silent_p.R50R|VCX3B_ENST00000440654.2_Silent_p.R50R|VCX3B_ENST00000381029.4_Silent_p.R50R	NM_001001888.3	NP_001001888.3	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	50						nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|urinary_tract(3)	11						GAGGGAGACGCGGGAAGAAAG	0.642																																						dbGAP											0													1.0	1.0	1.0					X																	8433833		135	573	708	-	-	-	SO:0001819	synonymous_variant	0				CCDS48077.1, CCDS48077.2	Xp22.31	2009-01-14			ENSG00000205642	ENSG00000205642			31838	protein-coding gene	gene with protein product							Standard	NM_001001888		Approved	VCX-C	uc011mht.2	Q9H321	OTTHUMG00000021106	ENST00000381032.1:c.150C>T	X.37:g.8433833C>T			C9JS46|Q4KN12	Silent	SNP	NULL	p.R50	ENST00000381032.1	37	c.150	CCDS48077.2	X																																																																																			VCX3B	-	NULL	ENSG00000205642		0.642	VCX3B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	VCX3B	HGNC	protein_coding	OTTHUMT00000055691.1	14	0.00	0	C			8433833	8433833	+1	no_errors	ENST00000444481	ensembl	human	known	69_37n	silent	165	26.87	61	SNP	0.000	T
VPS52	6293	genome.wustl.edu	37	6	33231848	33231848	+	Silent	SNP	A	A	G	rs551574533		TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr6:33231848A>G	ENST00000445902.2	-	15	1775	c.1557T>C	c.(1555-1557)gcT>gcC	p.A519A	VPS52_ENST00000478934.1_5'UTR|VPS52_ENST00000436044.2_Silent_p.A394A|VPS52_ENST00000482399.1_3'UTR	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	519					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						TACTGACAAGAGCGGAGGAGA	0.547																																						dbGAP											0													153.0	145.0	148.0					6																	33231848		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.1557T>C	6.37:g.33231848A>G			A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Silent	SNP	pfam_Vps52,pfam_Exocyst_Exoc1	p.A519	ENST00000445902.2	37	c.1557	CCDS4770.2	6																																																																																			VPS52	-	pfam_Vps52	ENSG00000223501		0.547	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS52	HGNC	protein_coding	OTTHUMT00000076598.2	98	0.00	0	A	NM_022553		33231848	33231848	-1	no_errors	ENST00000445902	ensembl	human	known	69_37n	silent	102	49.50	100	SNP	0.995	G
VWA3A	146177	genome.wustl.edu	37	16	22134947	22134947	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr16:22134947G>C	ENST00000389398.5	+	16	1547	c.1451G>C	c.(1450-1452)aGa>aCa	p.R484T	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	484						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		CAGCTCAGCAGAGCTATGCGG	0.567																																						dbGAP											0													102.0	103.0	102.0					16																	22134947		2002	4174	6176	-	-	-	SO:0001583	missense	0			AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.1451G>C	16.37:g.22134947G>C	ENSP00000374049:p.Arg484Thr		A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.R484T	ENST00000389398.5	37	c.1451	CCDS45441.1	16	.	.	.	.	.	.	.	.	.	.	G	2.553	-0.303609	0.05495	.	.	ENSG00000175267	ENST00000389398;ENST00000299840	T	0.12039	2.72	5.83	3.85	0.44370	.	0.354305	0.27956	N	0.017174	T	0.09642	0.0237	L	0.29908	0.895	0.18873	N	0.999984	B;B	0.25772	0.048;0.134	B;B	0.24006	0.05;0.045	T	0.20438	-1.0275	10	0.40728	T	0.16	.	7.6913	0.28569	0.3171:0.0:0.6829:0.0	.	484;108	A6NCI4;A6NCI4-2	VWA3A_HUMAN;.	T	484;107	ENSP00000374049:R484T	ENSP00000299840:R107T	R	+	2	0	VWA3A	22042448	0.996000	0.38824	0.645000	0.29479	0.016000	0.09150	1.379000	0.34340	1.449000	0.47699	0.563000	0.77884	AGA	VWA3A	-	NULL	ENSG00000175267		0.567	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3A	HGNC	protein_coding	OTTHUMT00000430052.1	171	0.00	0	G			22134947	22134947	+1	no_errors	ENST00000389398	ensembl	human	known	69_37n	missense	56	45.63	47	SNP	0.031	C
ZIM3	114026	genome.wustl.edu	37	19	57647274	57647274	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr19:57647274T>A	ENST00000269834.1	-	5	816	c.431A>T	c.(430-432)aAt>aTt	p.N144I	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATCGTGAGAATTATTTTGTAC	0.363																																						dbGAP											0													190.0	185.0	187.0					19																	57647274		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.431A>T	19.37:g.57647274T>A	ENSP00000269834:p.Asn144Ile		Q14CA6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N144I	ENST00000269834.1	37	c.431	CCDS33125.1	19	.	.	.	.	.	.	.	.	.	.	T	7.495	0.651402	0.14516	.	.	ENSG00000141946	ENST00000269834	T	0.04706	3.57	2.08	0.969	0.19686	.	.	.	.	.	T	0.06826	0.0174	L	0.39898	1.24	0.09310	N	1	B	0.26318	0.146	B	0.38921	0.285	T	0.42189	-0.9466	9	0.59425	D	0.04	.	7.3741	0.26818	0.0:0.0:0.2227:0.7773	.	144	Q96PE6	ZIM3_HUMAN	I	144	ENSP00000269834:N144I	ENSP00000269834:N144I	N	-	2	0	ZIM3	62339086	0.009000	0.17119	0.000000	0.03702	0.008000	0.06430	1.513000	0.35823	0.204000	0.20548	0.260000	0.18958	AAT	ZIM3	-	NULL	ENSG00000141946		0.363	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIM3	HGNC	protein_coding	OTTHUMT00000465078.1	197	0.00	0	T			57647274	57647274	-1	no_errors	ENST00000269834	ensembl	human	known	69_37n	missense	183	29.89	78	SNP	0.002	A
ZNF597	146434	genome.wustl.edu	37	16	3487525	3487525	+	Silent	SNP	C	C	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr16:3487525C>T	ENST00000301744.4	-	4	409	c.174G>A	c.(172-174)aaG>aaA	p.K58K		NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	58	KRAB.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						TAATCTCAGGCTTGCCTTCCT	0.418																																						dbGAP											0													48.0	49.0	49.0					16																	3487525		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.174G>A	16.37:g.3487525C>T				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K58	ENST00000301744.4	37	c.174	CCDS10505.1	16																																																																																			ZNF597	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box	ENSG00000167981		0.418	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF597	HGNC	protein_coding	OTTHUMT00000251511.2	60	0.00	0	C	NM_152457		3487525	3487525	-1	no_errors	ENST00000301744	ensembl	human	known	69_37n	silent	71	36.61	41	SNP	0.001	T
ZNF613	79898	genome.wustl.edu	37	19	52448266	52448266	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0AT-01A-11D-A045-09	TCGA-AN-A0AT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f848b66f-bd9e-4fba-afd4-eb58848d1ef4	1dab1c73-daeb-4900-9fa1-61656237024a	g.chr19:52448266G>T	ENST00000293471.6	+	6	1809	c.1130G>T	c.(1129-1131)tGt>tTt	p.C377F	ZNF613_ENST00000601794.1_3'UTR|ZNF613_ENST00000391794.4_Missense_Mutation_p.C341F	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	377					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		TGCCGTGATTGTGGAAAAGGC	0.403																																						dbGAP											0													96.0	91.0	93.0					19																	52448266		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.1130G>T	19.37:g.52448266G>T	ENSP00000293471:p.Cys377Phe		Q96SS9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C377F	ENST00000293471.6	37	c.1130	CCDS33089.1	19	.	.	.	.	.	.	.	.	.	.	G	18.14	3.557027	0.65425	.	.	ENSG00000176024	ENST00000293471;ENST00000391794;ENST00000535279	D;D	0.85861	-2.04;-2.04	3.25	3.25	0.37280	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37053	N	0.002279	D	0.94729	0.8299	H	0.97365	3.99	0.43137	D	0.994881	D	0.89917	1.0	D	0.91635	0.999	D	0.96402	0.9297	10	0.87932	D	0	.	13.7721	0.63032	0.0:0.0:1.0:0.0	.	377	Q6PF04	ZN613_HUMAN	F	377;341;51	ENSP00000293471:C377F;ENSP00000375671:C341F	ENSP00000293471:C377F	C	+	2	0	ZNF613	57140078	1.000000	0.71417	0.951000	0.38953	0.991000	0.79684	8.269000	0.89878	1.828000	0.53243	0.655000	0.94253	TGT	ZNF613	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000176024		0.403	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF613	HGNC	protein_coding	OTTHUMT00000461104.2	91	0.00	0	G	NM_024840		52448266	52448266	+1	no_errors	ENST00000293471	ensembl	human	known	69_37n	missense	173	29.39	72	SNP	1.000	T
