#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AACS	65985	genome.wustl.edu	37	12	125603260	125603261	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	CC	CC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr12:125603260_125603261delCC	ENST00000316519.6	+	10	1276_1277	c.1070_1071delCC	c.(1069-1071)tccfs	p.S357fs	AACS_ENST00000316543.10_5'UTR|AACS_ENST00000545511.1_5'Flank|AACS_ENST00000261686.6_Frame_Shift_Del_p.S357fs	NM_023928.3	NP_076417.2	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	357					adipose tissue development (GO:0060612)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cellular response to testosterone stimulus (GO:0071394)|fatty acid metabolic process (GO:0006631)|liver development (GO:0001889)|positive regulation of insulin secretion (GO:0032024)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to purine-containing compound (GO:0014074)|response to starvation (GO:0042594)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)	acetoacetate-CoA ligase activity (GO:0030729)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|liver(1)|lung(16)|ovary(1)|stomach(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		TACGATGGCTCCCCCCTGGTGC	0.594																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK022451	CCDS9263.1	12q24.31	2010-09-29			ENSG00000081760	ENSG00000081760	6.2.1.16	"""Acyl-CoA synthetase family"""	21298	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 1"""	614364				12623130, 17762044	Standard	NM_023928		Approved	FLJ12389, SUR-5, ACSF1	uc001uhc.3	Q86V21	OTTHUMG00000168550	ENST00000316519.6:c.1070_1071delCC	12.37:g.125603264_125603265delCC	ENSP00000324842:p.Ser357fs		Q49AB9|Q49AC3|Q658Q8|Q8IWD2|Q8NEW5|Q9BSJ9|Q9H829|Q9HA19	Frame_Shift_Del	DEL	pfam_AMP-dep_Synth/Lig,pfam_Acyl-CoA_synth_DUF3448,tigrfam_Acac_CoA_synth	p.L359fs	ENST00000316519.6	37	c.1070_1071	CCDS9263.1	12																																																																																			AACS	-	pfam_AMP-dep_Synth/Lig,tigrfam_Acac_CoA_synth	ENSG00000081760		0.594	AACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AACS	HGNC	protein_coding	OTTHUMT00000400202.1	73	0.00	0	CC	NM_023928		125603260	125603261	+1	no_errors	ENST00000316519	ensembl	human	known	69_37n	frame_shift_del	18	10.00	2	DEL	1.000:0.999	-
ARSE	415	genome.wustl.edu	37	X	2853148	2853148	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chrX:2853148G>A	ENST00000381134.3	-	11	1561	c.1495C>T	c.(1495-1497)Ccg>Tcg	p.P499S	ARSE_ENST00000545496.1_Missense_Mutation_p.P524S|ARSE_ENST00000540563.1_Missense_Mutation_p.P454S	NM_000047.2	NP_000038.2	P51690	ARSE_HUMAN	arylsulfatase E (chondrodysplasia punctata 1)	499					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CCAAAGCACGGGCAGACCTTT	0.537																																						dbGAP											0													91.0	67.0	75.0					X																	2853148		2203	4300	6503	-	-	-	SO:0001583	missense	0			X83573	CCDS14122.1, CCDS75948.1, CCDS75949.1	Xp22.33	2013-02-14			ENSG00000157399	ENSG00000157399		"""Arylsulfatase family"""	719	protein-coding gene	gene with protein product		300180		CDPX, CDPX1		7720070	Standard	NM_000047		Approved		uc004crc.4	P51690	OTTHUMG00000137358	ENST00000381134.3:c.1495C>T	X.37:g.2853148G>A	ENSP00000370526:p.Pro499Ser		Q53FT2|Q53FU8	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.P524S	ENST00000381134.3	37	c.1570	CCDS14122.1	X	.	.	.	.	.	.	.	.	.	.	G	0.102	-1.150261	0.01700	.	.	ENSG00000157399	ENST00000540563;ENST00000545496;ENST00000381134	D;D;D	0.93659	-3.26;-3.26;-3.26	3.45	2.53	0.30540	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.306287	0.31484	N	0.007576	D	0.88894	0.6561	L	0.41632	1.29	0.26324	N	0.977621	B;B;B	0.29909	0.109;0.109;0.261	B;B;B	0.36378	0.142;0.099;0.223	T	0.74386	-0.3682	10	0.10377	T	0.69	.	11.7387	0.51780	0.0:0.1764:0.8236:0.0	.	454;524;499	F5H324;F5GYY5;P51690	.;.;ARSE_HUMAN	S	454;524;499	ENSP00000438198:P454S;ENSP00000441417:P524S;ENSP00000370526:P499S	ENSP00000370526:P499S	P	-	1	0	ARSE	2863148	0.999000	0.42202	0.015000	0.15790	0.034000	0.12701	1.692000	0.37731	0.306000	0.22856	0.284000	0.19432	CCG	ARSE	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000157399		0.537	ARSE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSE	HGNC	protein_coding	OTTHUMT00000055643.1	137	0.00	0	G	NM_000047		2853148	2853148	-1	no_errors	ENST00000545496	ensembl	human	known	69_37n	missense	68	46.03	58	SNP	0.820	A
AKAP4	8852	genome.wustl.edu	37	X	49957345	49957345	+	Silent	SNP	C	C	T			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chrX:49957345C>T	ENST00000376056.2	-	5	2142	c.1992G>A	c.(1990-1992)gcG>gcA	p.A664A	AKAP4_ENST00000376064.3_Silent_p.A664A|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Silent_p.A290A|AKAP4_ENST00000358526.2_Silent_p.A673A					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					ATTGTTCTTCCGCTTTGTCAG	0.468																																						dbGAP											0													128.0	89.0	102.0					X																	49957345		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.1992G>A	X.37:g.49957345C>T				Silent	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.A673	ENST00000376056.2	37	c.2019	CCDS14330.1	X																																																																																			AKAP4	-	pfam_AKAP_110_C,smart_AKAP_110	ENSG00000147081		0.468	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP4	HGNC	protein_coding	OTTHUMT00000056552.1	172	0.00	0	C	NM_003886		49957345	49957345	-1	no_errors	ENST00000358526	ensembl	human	known	69_37n	silent	121	42.18	89	SNP	0.012	T
BPHL	670	genome.wustl.edu	37	6	3140669	3140669	+	Silent	SNP	T	T	A			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr6:3140669T>A	ENST00000380379.5	+	6	763	c.714T>A	c.(712-714)atT>atA	p.I238I	BPHL_ENST00000380368.2_3'UTR|BPHL_ENST00000380375.3_Silent_p.I221I|RP1-40E16.11_ENST00000447644.1_RNA|BPHL_ENST00000434640.1_Silent_p.I221I	NM_004332.2	NP_004323.2	Q86WA6	BPHL_HUMAN	biphenyl hydrolase-like (serine hydrolase)	238					cellular amino acid metabolic process (GO:0006520)|response to toxic substance (GO:0009636)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)	13	Ovarian(93;0.0386)	all_hematologic(90;0.108)				CCGCCTTGATTGTGCACGGTG	0.562																																						dbGAP											0													182.0	166.0	172.0					6																	3140669		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X81372	CCDS4483.2	6p25	2008-08-29	2008-08-29		ENSG00000137274	ENSG00000137274			1094	protein-coding gene	gene with protein product	"""breast epithelial mucin-associated antigen"""	603156		MCNAA		7759552, 9721218, 15832508	Standard	NM_004332		Approved	Bph-rp	uc003mva.3	Q86WA6	OTTHUMG00000014140	ENST00000380379.5:c.714T>A	6.37:g.3140669T>A			Q00306|Q13855|Q3KP51	Nonsense_Mutation	SNP	NULL	p.L4*	ENST00000380379.5	37	c.11	CCDS4483.2	6	.	.	.	.	.	.	.	.	.	.	T	12.11	1.840703	0.32513	.	.	ENSG00000137274	ENST00000423798	.	.	.	5.56	-4.16	0.03869	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-24.6974	6.5694	0.22531	0.1566:0.4389:0.0:0.4045	.	.	.	.	X	4	.	.	L	+	2	0	BPHL	3085668	0.016000	0.18221	0.778000	0.31720	0.980000	0.70556	-1.561000	0.02158	-0.424000	0.07382	0.533000	0.62120	TTG	BPHL	-	NULL	ENSG00000137274		0.562	BPHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPHL	HGNC	protein_coding	OTTHUMT00000039670.5	53	0.00	0	T			3140669	3140669	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000423798	ensembl	human	putative	69_37n	nonsense	47	33.80	24	SNP	0.793	A
BST2	684	genome.wustl.edu	37	19	17516273	17516273	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr19:17516273C>G	ENST00000252593.6	-	1	184	c.112G>C	c.(112-114)Ggg>Cgg	p.G38R	BST2_ENST00000527220.1_5'UTR|CTD-2521M24.9_ENST00000500836.2_lincRNA	NM_004335.2	NP_004326.1	Q10589	BST2_HUMAN	bone marrow stromal cell antigen 2	38					B cell activation (GO:0042113)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of intracellular transport of viral material (GO:1901253)|negative regulation of plasmacytoid dendritic cell cytokine production (GO:0002737)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of actin cytoskeleton organization (GO:0032956)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metalloendopeptidase inhibitor activity (GO:0008191)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(2)	9						AAGGGCACCCCCAGAATCACG	0.552																																						dbGAP											0													131.0	107.0	115.0					19																	17516273		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12358.1	19p13.2	2009-10-30				ENSG00000130303		"""CD molecules"""	1119	protein-coding gene	gene with protein product		600534				7607676	Standard	NM_004335		Approved	CD317, tetherin	uc002ngl.3	Q10589		ENST00000252593.6:c.112G>C	19.37:g.17516273C>G	ENSP00000252593:p.Gly38Arg		A8K4Y4|Q53G07	Missense_Mutation	SNP	superfamily_Prefoldin	p.G38R	ENST00000252593.6	37	c.112	CCDS12358.1	19	.	.	.	.	.	.	.	.	.	.	C	13.10	2.134826	0.37728	.	.	ENSG00000130303	ENST00000416178;ENST00000252593	T	0.46451	0.87	2.89	-5.78	0.02362	.	5.074890	0.00986	N	0.003443	T	0.50343	0.1610	L	0.51422	1.61	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.58081	-0.7699	10	0.52906	T	0.07	0.1706	0.4861	0.00556	0.3377:0.267:0.1953:0.2	.	38	Q10589	BST2_HUMAN	R	38	ENSP00000252593:G38R	ENSP00000252593:G38R	G	-	1	0	BST2	17377273	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.587000	0.02108	-1.777000	0.01283	-0.500000	0.04577	GGG	BST2	-	NULL	ENSG00000130303		0.552	BST2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	BST2	HGNC	protein_coding	OTTHUMT00000387346.1	153	0.00	0	C	NM_004335		17516273	17516273	-1	no_errors	ENST00000252593	ensembl	human	known	69_37n	missense	84	34.88	45	SNP	0.000	G
TMEM127	55654	genome.wustl.edu	37	2	96933656	96933657	+	5'Flank	INS	-	-	G			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr2:96933656_96933657insG	ENST00000258439.3	-	0	0				TMEM127_ENST00000432959.1_5'Flank|CIAO1_ENST00000488633.1_Frame_Shift_Ins_p.Q162fs	NM_001193304.2|NM_017849.3	NP_001180233.1|NP_060319.1	O75204	TM127_HUMAN	transmembrane protein 127						negative regulation of cell proliferation (GO:0008285)|negative regulation of TOR signaling (GO:0032007)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)	5						GGCACCCAAGTCAGGAGGTAAG	0.5																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AK000514	CCDS2018.1	2q11.2	2014-09-17			ENSG00000135956	ENSG00000135956			26038	protein-coding gene	gene with protein product		613403				10493829	Standard	NM_017849		Approved	FLJ20507, FLJ22257	uc002svr.3	O75204	OTTHUMG00000130454		2.37:g.96933656_96933657insG	Exception_encountered		D3DXH0	Frame_Shift_Ins	INS	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q161fs	ENST00000258439.3	37	c.483_484	CCDS2018.1	2																																																																																			CIAO1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000144021		0.500	TMEM127-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIAO1	HGNC	protein_coding	OTTHUMT00000252845.3	31	0.00	0	-	NM_017849		96933656	96933657	+1	no_errors	ENST00000488633	ensembl	human	known	69_37n	frame_shift_ins	21	36.36	12	INS	0.535:0.999	G
TMEM127	55654	genome.wustl.edu	37	2	96933659	96933660	+	5'Flank	INS	-	-	CC	rs201951574		TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr2:96933659_96933660insCC	ENST00000258439.3	-	0	0				TMEM127_ENST00000432959.1_5'Flank|CIAO1_ENST00000488633.1_Frame_Shift_Ins_p.E163fs	NM_001193304.2|NM_017849.3	NP_001180233.1|NP_060319.1	O75204	TM127_HUMAN	transmembrane protein 127						negative regulation of cell proliferation (GO:0008285)|negative regulation of TOR signaling (GO:0032007)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)	5						ACCCAAGTCAGGAGGTAAGAGT	0.5																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AK000514	CCDS2018.1	2q11.2	2014-09-17			ENSG00000135956	ENSG00000135956			26038	protein-coding gene	gene with protein product		613403				10493829	Standard	NM_017849		Approved	FLJ20507, FLJ22257	uc002svr.3	O75204	OTTHUMG00000130454		2.37:g.96933659_96933660insCC	Exception_encountered		D3DXH0	Frame_Shift_Ins	INS	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E162fs	ENST00000258439.3	37	c.486_487	CCDS2018.1	2																																																																																			CIAO1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000144021		0.500	TMEM127-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIAO1	HGNC	protein_coding	OTTHUMT00000252845.3	29	0.00	0	-	NM_017849		96933659	96933660	+1	no_errors	ENST00000488633	ensembl	human	known	69_37n	frame_shift_ins	20	37.50	12	INS	0.999:1.000	CC
CORO6	84940	genome.wustl.edu	37	17	27948434	27948434	+	Silent	SNP	G	G	A			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr17:27948434G>A	ENST00000445145.2	-	1	7	c.6C>T	c.(4-6)agC>agT	p.S2S	CORO6_ENST00000577909.1_Intron|CORO6_ENST00000345068.5_Silent_p.S2S|CORO6_ENST00000584969.1_Silent_p.S2S|CORO6_ENST00000388767.3_Silent_p.S2S|CORO6_ENST00000580212.1_Silent_p.S2S|RP11-68I3.10_ENST00000582367.1_RNA|RP11-68I3.2_ENST00000581474.1_RNA			Q6QEF8	CORO6_HUMAN	coronin 6	2					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)	actin filament binding (GO:0051015)			breast(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(2)	14						CCACACGTCTGCTCATAGCTG	0.592																																						dbGAP											0													38.0	39.0	39.0					17																	27948434		2133	4265	6398	-	-	-	SO:0001819	synonymous_variant	0			AF193039	CCDS11252.2	17q11.2	2013-01-10			ENSG00000167549	ENSG00000167549		"""Coronins"", ""WD repeat domain containing"""	21356	protein-coding gene	gene with protein product							Standard	NM_032854		Approved	FLJ14871	uc002hel.2	Q6QEF8	OTTHUMG00000132732	ENST00000445145.2:c.6C>T	17.37:g.27948434G>A			B3KU26|Q71MF3|Q8WYH7|Q96K02	Silent	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S2	ENST00000445145.2	37	c.6		17																																																																																			CORO6	-	NULL	ENSG00000167549		0.592	CORO6-202	KNOWN	basic|appris_candidate_longest	protein_coding	CORO6	HGNC	protein_coding	OTTHUMT00000447831.1	55	0.00	0	G	NM_032854		27948434	27948434	-1	no_errors	ENST00000345068	ensembl	human	known	69_37n	silent	18	30.77	8	SNP	1.000	A
CREB3L3	84699	genome.wustl.edu	37	19	4171690	4171690	+	Silent	SNP	C	C	T			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr19:4171690C>T	ENST00000078445.2	+	10	1257	c.1110C>T	c.(1108-1110)cgC>cgT	p.R370R	CREB3L3_ENST00000602257.1_Silent_p.R368R|CREB3L3_ENST00000252587.3_Missense_Mutation_p.A259V|CREB3L3_ENST00000602147.1_Missense_Mutation_p.R335C|CREB3L3_ENST00000595923.1_Silent_p.R369R	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3	370					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCCTCCCGCGTGGCTGCTG	0.647																																						dbGAP											0													65.0	78.0	74.0					19																	4171690		2202	4288	6490	-	-	-	SO:0001819	synonymous_variant	0				CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.1110C>T	19.37:g.4171690C>T			B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd	p.A259V	ENST00000078445.2	37	c.776	CCDS12121.1	19	.	.	.	.	.	.	.	.	.	.	C	16.28	3.077895	0.55753	.	.	ENSG00000060566	ENST00000252587	T	0.79653	-1.29	3.53	-7.06	0.01568	.	.	.	.	.	T	0.69415	0.3108	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.63620	-0.6596	6	0.72032	D	0.01	-17.5649	2.1179	0.03718	0.1228:0.2784:0.3671:0.2318	.	.	.	.	V	259	ENSP00000252587:A259V	ENSP00000252587:A259V	A	+	2	0	CREB3L3	4122690	0.000000	0.05858	0.797000	0.32132	0.747000	0.42532	-5.444000	0.00122	-1.508000	0.01800	0.561000	0.74099	GCG	CREB3L3	-	NULL	ENSG00000060566		0.647	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CREB3L3	HGNC	protein_coding	OTTHUMT00000457922.1	19	0.00	0	C	NM_032607		4171690	4171690	+1	no_errors	ENST00000252587	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	0.427	T
DCLK2	166614	genome.wustl.edu	37	4	151153908	151153908	+	Silent	SNP	C	C	T			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr4:151153908C>T	ENST00000296550.7	+	10	2248	c.1494C>T	c.(1492-1494)aaC>aaT	p.N498N	DCLK2_ENST00000302176.8_Silent_p.N515N|DCLK2_ENST00000506325.1_Silent_p.N497N	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	498	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					TGGTGTACAACTTAGCCAATG	0.453																																					GBM(195;186 2215 13375 16801 37459)	dbGAP											0													267.0	231.0	243.0					4																	151153908		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.1494C>T	4.37:g.151153908C>T			C9J5Q9|Q59GC8|Q8N399	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Doublecortin_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Doublecortin_dom,pfscan_Prot_kinase_cat_dom	p.N515	ENST00000296550.7	37	c.1545	CCDS34076.1	4																																																																																			DCLK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000170390		0.453	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCLK2	HGNC	protein_coding	OTTHUMT00000364952.1	124	0.00	0	C	NM_001040260		151153908	151153908	+1	no_errors	ENST00000302176	ensembl	human	known	69_37n	silent	87	30.95	39	SNP	1.000	T
DLGAP2	9228	genome.wustl.edu	37	8	1497608	1497608	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr8:1497608C>T	ENST00000421627.2	+	2	883	c.749C>T	c.(748-750)gCg>gTg	p.A250V		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	329					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)		p.A272V(1)		breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		TACCCCGACGCGCTGCAGAGC	0.677																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											56.0	65.0	62.0					8																	1497608		2094	4234	6328	-	-	-	SO:0001583	missense	0			AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.749C>T	8.37:g.1497608C>T	ENSP00000400258:p.Ala250Val		A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	pfam_GKAP	p.A250V	ENST00000421627.2	37	c.749	CCDS47760.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.076|9.076	0.998044|0.998044	0.19043|0.19043	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	T|.	0.18502|.	2.21|.	5.3|5.3	4.4|4.4	0.53042|0.53042	.|.	0.775970|.	0.12861|.	N|.	0.433112|.	T|T	0.36441|0.36441	0.0967|0.0967	L|L	0.38953|0.38953	1.18|1.18	0.09310|0.09310	N|N	1|1	B;B|.	0.17268|.	0.021;0.012|.	B;B|.	0.09377|.	0.004;0.002|.	T|T	0.21518|0.21518	-1.0243|-1.0243	10|5	0.48119|.	T|.	0.1|.	-3.4101|-3.4101	8.2044|8.2044	0.31443|0.31443	0.1534:0.7641:0.0:0.0825|0.1534:0.7641:0.0:0.0825	.|.	329;329|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	V|C	295;250|267	ENSP00000400258:A250V|.	ENSP00000348366:A295V|.	A|R	+|+	2|1	0|0	DLGAP2|DLGAP2	1485015|1485015	0.061000|0.061000	0.20836|0.20836	0.001000|0.001000	0.08648|0.08648	0.399000|0.399000	0.30720|0.30720	3.326000|3.326000	0.52037|0.52037	1.154000|1.154000	0.42482|0.42482	0.655000|0.655000	0.94253|0.94253	GCG|CGC	DLGAP2	-	NULL	ENSG00000198010		0.677	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP2	HGNC	protein_coding	OTTHUMT00000374478.1	40	0.00	0	C	NM_004745		1497608	1497608	+1	no_errors	ENST00000421627	ensembl	human	known	69_37n	missense	34	26.09	12	SNP	0.006	T
DNASE2	1777	genome.wustl.edu	37	19	12991929	12991929	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr19:12991929C>G	ENST00000222219.3	-	2	216	c.124G>C	c.(124-126)Ggg>Cgg	p.G42R	DNASE2_ENST00000538460.1_Missense_Mutation_p.G42R|CTD-2265O21.7_ENST00000592400.1_RNA	NM_001375.2	NP_001366.1	O00115	DNS2A_HUMAN	deoxyribonuclease II, lysosomal	42					apoptotic DNA fragmentation (GO:0006309)|DNA metabolic process (GO:0006259)|erythrocyte differentiation (GO:0030218)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)|DNA binding (GO:0003677)			breast(1)|large_intestine(1)|lung(4)|ovary(1)	7						GCCGCCTCCCCGGACCCTCTA	0.637																																						dbGAP											0													38.0	43.0	41.0					19																	12991929		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF045937	CCDS12284.1	19p13.2	2012-10-02			ENSG00000105612	ENSG00000105612	3.1.22.1		2960	protein-coding gene	gene with protein product		126350		DNL, DNL2		1586130	Standard	NM_001375		Approved		uc002mvn.1	O00115		ENST00000222219.3:c.124G>C	19.37:g.12991929C>G	ENSP00000222219:p.Gly42Arg		B2RD06|B7Z4K6|O43910	Missense_Mutation	SNP	pfam_DNase_II	p.G42R	ENST00000222219.3	37	c.124	CCDS12284.1	19	.	.	.	.	.	.	.	.	.	.	C	5.374	0.254319	0.10185	.	.	ENSG00000105612	ENST00000222219;ENST00000538460	T;T	0.13657	2.57;2.57	4.39	-0.613	0.11594	.	0.860710	0.10406	N	0.678543	T	0.11580	0.0282	L	0.49571	1.57	0.09310	N	1	B;B	0.29253	0.239;0.061	B;B	0.34824	0.19;0.059	T	0.42207	-0.9465	10	0.15499	T	0.54	.	4.3901	0.11335	0.0:0.35:0.375:0.275	.	42;42	B7Z4K6;O00115	.;DNS2A_HUMAN	R	42	ENSP00000222219:G42R;ENSP00000445988:G42R	ENSP00000222219:G42R	G	-	1	0	DNASE2	12852929	0.000000	0.05858	0.113000	0.21522	0.039000	0.13416	0.143000	0.16115	0.130000	0.18549	-0.311000	0.09066	GGG	DNASE2	-	pfam_DNase_II	ENSG00000105612		0.637	DNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNASE2	HGNC	protein_coding	OTTHUMT00000451790.1	62	0.00	0	C			12991929	12991929	-1	no_errors	ENST00000222219	ensembl	human	known	69_37n	missense	24	50.00	24	SNP	0.014	G
DOC2A	8448	genome.wustl.edu	37	16	30018123	30018123	+	Silent	SNP	C	C	T			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr16:30018123C>T	ENST00000350119.4	-	8	1051	c.861G>A	c.(859-861)tcG>tcA	p.S287S	DOC2A_ENST00000564979.1_Silent_p.S287S|DOC2A_ENST00000564944.1_Silent_p.S287S	NM_001282062.1|NM_001282063.1|NM_001282068.1|NM_003586.2	NP_001268991.1|NP_001268992.1|NP_001268997.1|NP_003577.2	Q14183	DOC2A_HUMAN	double C2-like domains, alpha	287	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Interaction with UNC13D.				nervous system development (GO:0007399)|regulation of calcium ion-dependent exocytosis (GO:0017158)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|lysosome (GO:0005764)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)	9						CGTAGGGGTCCGAGTAACCGT	0.652																																						dbGAP											0													62.0	67.0	65.0					16																	30018123		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			D31897	CCDS10666.1	16p11.2	2014-07-02			ENSG00000149927	ENSG00000149927		"""Synaptotagmins"""	2985	protein-coding gene	gene with protein product		604567				7826360, 9736751	Standard	NM_003586		Approved		uc002dvn.3	Q14183	OTTHUMG00000132109	ENST00000350119.4:c.861G>A	16.37:g.30018123C>T			B4DEJ2|H3BNH6|Q6P4G4|Q7Z5G0|Q8IVX0	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin,prints_C2_dom	p.G124R	ENST00000350119.4	37	c.370	CCDS10666.1	16																																																																																			DOC2A	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_C2_dom	ENSG00000149927		0.652	DOC2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOC2A	HGNC	protein_coding	OTTHUMT00000255148.2	89	0.00	0	C	NM_003586		30018123	30018123	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000564357	ensembl	human	novel	69_37n	missense	53	37.65	32	SNP	0.008	T
DPPA2	151871	genome.wustl.edu	37	3	109031471	109031471	+	Silent	SNP	G	G	A	rs572153453	byFrequency	TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr3:109031471G>A	ENST00000478945.1	-	3	348	c.102C>T	c.(100-102)gaC>gaT	p.D34D		NM_138815.3	NP_620170.3	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	34					lung-associated mesenchyme development (GO:0060484)|positive regulation of stem cell proliferation (GO:2000648)|regulation of histone methylation (GO:0031060)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CCATATTTGCGTCATCTTTAA	0.413													G|||	2	0.000399361	0.0008	0.0	5008	,	,		18068	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													182.0	166.0	171.0					3																	109031471		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY283672	CCDS2956.1	3q13.13	2010-05-04			ENSG00000163530	ENSG00000163530			19197	protein-coding gene	gene with protein product	"""cancer/testis antigen 100"""	614445				15583978	Standard	NM_138815		Approved	PESCRG1, CT100	uc003dxo.3	Q7Z7J5	OTTHUMG00000159227	ENST00000478945.1:c.102C>T	3.37:g.109031471G>A			Q8WVF0	Silent	SNP	pfscan_SAP_DNA-bd	p.D34	ENST00000478945.1	37	c.102	CCDS2956.1	3																																																																																			DPPA2	-	NULL	ENSG00000163530		0.413	DPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA2	HGNC	protein_coding	OTTHUMT00000353938.1	240	0.00	0	G	NM_138815		109031471	109031471	-1	no_errors	ENST00000478945	ensembl	human	known	69_37n	silent	107	43.09	81	SNP	0.001	A
DUOX2	50506	genome.wustl.edu	37	15	45396252	45396252	+	Splice_Site	SNP	C	C	T			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr15:45396252C>T	ENST00000603300.1	-	20	2763		c.e20-1		DUOX2_ENST00000389039.6_Splice_Site	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2						adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		TCTGGGGAGCCTGGGAAGAAA	0.507																																						dbGAP											0													102.0	94.0	97.0					15																	45396252		2198	4298	6496	-	-	-	SO:0001630	splice_region_variant	0			AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.2561-1G>A	15.37:g.45396252C>T			A8MQ13|D2XI64|Q9NR02|Q9UHF9	Splice_Site	SNP	-	e19-1	ENST00000603300.1	37	c.2561-1	CCDS10117.1	15	.	.	.	.	.	.	.	.	.	.	C	23.5	4.428560	0.83667	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1568	0.89694	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DUOX2	43183544	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	6.928000	0.75846	2.579000	0.87056	0.563000	0.77884	.	DUOX2	-	-	ENSG00000140279		0.507	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DUOX2	HGNC	protein_coding		116	0.85	1	C	NM_014080	Intron	45396252	45396252	-1	no_errors	ENST00000389039	ensembl	human	known	69_37n	splice_site	79	23.30	24	SNP	1.000	T
GIPC3	126326	genome.wustl.edu	37	19	3589526	3589527	+	Frame_Shift_Ins	INS	-	-	G	rs202075236	byFrequency	TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr19:3589526_3589527insG	ENST00000322315.5	+	4	723_724	c.678_679insG	c.(679-681)gggfs	p.G227fs		NM_133261.2	NP_573568.1	Q8TF64	GIPC3_HUMAN	GIPC PDZ domain containing family, member 3	227										breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCTTCGTTCTGGGGGGGCTGC	0.609																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB073738	CCDS32871.1	19p13.3	2011-11-29				ENSG00000179855			18183	protein-coding gene	gene with protein product		608792	"""chromosome 19 open reading frame 64"", ""deafness, autosomal recessive 72"", ""deafness, autosomal recessive 15"""	C19orf64, DFNB72, DFNB15		11836571, 21326233	Standard	NM_133261		Approved	DFNB95	uc002lyd.4	Q8TF64		ENST00000322315.5:c.685dupG	19.37:g.3589533_3589533dupG	ENSP00000319254:p.Gly227fs		O75227	Frame_Shift_Ins	INS	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_UCP038083_PDZ,pfscan_PDZ	p.A228fs	ENST00000322315.5	37	c.678_679	CCDS32871.1	19																																																																																			GIPC3	-	pirsf_UCP038083_PDZ	ENSG00000179855		0.609	GIPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIPC3	HGNC	protein_coding	OTTHUMT00000394577.1	45	0.00	0	-	NM_133261		3589526	3589527	+1	no_errors	ENST00000322315	ensembl	human	known	69_37n	frame_shift_ins	44	10.20	5	INS	0.411:0.803	G
ELAVL1	1994	genome.wustl.edu	37	19	8032461	8032461	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr19:8032461G>A	ENST00000407627.2	-	5	773	c.644C>T	c.(643-645)gCg>gTg	p.A215V	ELAVL1_ENST00000351593.5_Missense_Mutation_p.A242V|ELAVL1_ENST00000596459.1_Missense_Mutation_p.A215V|ELAVL1_ENST00000593807.1_Intron	NM_001419.2	NP_001410.2	Q15717	ELAV1_HUMAN	ELAV like RNA binding protein 1	215					3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA stabilization (GO:0048255)|multicellular organismal development (GO:0007275)|positive regulation of translation (GO:0045727)|regulation of stem cell maintenance (GO:2000036)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|double-stranded RNA binding (GO:0003725)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						GAATCTCTGCGCCTGGTGGTG	0.617																																						dbGAP											0													56.0	51.0	53.0					19																	8032461		2203	4300	6503	-	-	-	SO:0001583	missense	0			U38175	CCDS12193.1	19p13.2	2013-10-03	2013-10-03			ENSG00000066044		"""RNA binding motif (RRM) containing"""	3312	protein-coding gene	gene with protein product	"""embryonic lethal, abnormal vision, drosophila, homolog-like 1"", ""Hu antigen R"""	603466	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)"""	HUR		8626503, 9003489	Standard	NM_001419		Approved	HuR, Hua, MelG	uc002mjb.3	Q15717		ENST00000407627.2:c.644C>T	19.37:g.8032461G>A	ENSP00000385269:p.Ala215Val		B4DVB8|Q53XN6|Q9BTT1	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA,tigrfam_ELAD_HUD_SF	p.A242V	ENST00000407627.2	37	c.725	CCDS12193.1	19	.	.	.	.	.	.	.	.	.	.	G	22.0	4.229714	0.79688	.	.	ENSG00000066044	ENST00000407627;ENST00000351593	T;T	0.17054	2.32;2.3	6.17	6.17	0.99709	.	0.045986	0.85682	D	0.000000	T	0.29588	0.0738	M	0.85041	2.73	0.80722	D	1	B	0.20261	0.043	B	0.13407	0.009	T	0.03130	-1.1069	10	0.41790	T	0.15	.	18.3732	0.90420	0.0:0.0:1.0:0.0	.	215	Q15717	ELAV1_HUMAN	V	215;242	ENSP00000385269:A215V;ENSP00000264073:A242V	ENSP00000264073:A242V	A	-	2	0	ELAVL1	7938461	1.000000	0.71417	0.981000	0.43875	0.952000	0.60782	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	GCG	ELAVL1	-	tigrfam_ELAD_HUD_SF	ENSG00000066044		0.617	ELAVL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELAVL1	HGNC	protein_coding	OTTHUMT00000461494.3	41	0.00	0	G	NM_001419		8032461	8032461	-1	no_errors	ENST00000351593	ensembl	human	known	69_37n	missense	31	51.52	34	SNP	1.000	A
GPATCH3	63906	genome.wustl.edu	37	1	27219895	27219895	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr1:27219895C>A	ENST00000361720.5	-	4	1119	c.1096G>T	c.(1096-1098)Gtg>Ttg	p.V366L		NM_022078.2	NP_071361.2	Q96I76	GPTC3_HUMAN	G patch domain containing 3	366							nucleic acid binding (GO:0003676)			endometrium(2)|large_intestine(1)|lung(11)|skin(1)	15		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		TCATAGTACACACTCATGTCC	0.473																																						dbGAP											0													404.0	383.0	390.0					1																	27219895		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007767	CCDS290.1	1p35.3-p35.1	2013-01-28		2006-12-13	ENSG00000198746	ENSG00000198746		"""G patch domain containing"""	25720	protein-coding gene	gene with protein product				GPATC3			Standard	NM_022078		Approved	FLJ12455	uc001bne.3	Q96I76	OTTHUMG00000004229	ENST00000361720.5:c.1096G>T	1.37:g.27219895C>A	ENSP00000354645:p.Val366Leu		Q5JYH2|Q8NDJ2|Q9H9Z3	Missense_Mutation	SNP	pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	p.V366L	ENST00000361720.5	37	c.1096	CCDS290.1	1	.	.	.	.	.	.	.	.	.	.	C	14.16	2.453485	0.43531	.	.	ENSG00000198746	ENST00000361720;ENST00000536641;ENST00000374122	T	0.45276	0.9	5.27	2.17	0.27698	.	0.284832	0.34156	N	0.004205	T	0.33177	0.0854	M	0.63843	1.955	0.38637	D	0.951515	P	0.35612	0.512	B	0.28784	0.094	T	0.28839	-1.0031	10	0.56958	D	0.05	-11.5986	7.26	0.26197	0.0:0.6246:0.0:0.3754	.	366	Q96I76	GPTC3_HUMAN	L	366;348;177	ENSP00000354645:V366L	ENSP00000354645:V366L	V	-	1	0	GPATCH3	27092482	1.000000	0.71417	0.886000	0.34754	0.971000	0.66376	1.720000	0.38022	0.778000	0.33520	0.655000	0.94253	GTG	GPATCH3	-	NULL	ENSG00000198746		0.473	GPATCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH3	HGNC	protein_coding	OTTHUMT00000012181.1	124	0.00	0	C	NM_022078		27219895	27219895	-1	no_errors	ENST00000361720	ensembl	human	known	69_37n	missense	44	26.67	16	SNP	0.867	A
GPR162	27239	genome.wustl.edu	37	12	6934684	6934685	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr12:6934684_6934685insC	ENST00000311268.3	+	3	1690_1691	c.903_904insC	c.(904-906)cccfs	p.P302fs	LEPREL2_ENST00000396725.2_RNA|LEPREL2_ENST00000606935.1_RNA|LEPREL2_ENST00000251761.8_RNA|GPR162_ENST00000382315.3_5'UTR|GPR162_ENST00000428545.2_Frame_Shift_Ins_p.P18fs	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						CGGACTCGGCGCCCCCCTGGAT	0.668											OREG0021636	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.909dupC	12.37:g.6934690_6934690dupC	ENSP00000311528:p.Pro302fs	637	Q16664|Q59EH5|Q66K56	Frame_Shift_Ins	INS	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_GPCR_162,prints_GPCR_153/162	p.W303fs	ENST00000311268.3	37	c.903_904	CCDS8563.1	12																																																																																			GPR162	-	pfam_7TM_GPCR_Rhodpsn	ENSG00000250510		0.668	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR162	HGNC	protein_coding	OTTHUMT00000399478.1	32	0.00	0	-	NM_019858		6934684	6934685	+1	no_errors	ENST00000311268	ensembl	human	known	69_37n	frame_shift_ins	20	13.04	3	INS	0.313:0.996	C
HOXA1	3198	genome.wustl.edu	37	7	27134949	27134949	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr7:27134949C>T	ENST00000343060.4	-	1	644	c.583G>A	c.(583-585)Gca>Aca	p.A195T	HOXA1_ENST00000355633.5_Missense_Mutation_p.R127H|HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000495032.1_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	195					abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.A195T(1)		endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GTCTCCGATGCGGGGGAGCGA	0.552																																						dbGAP											1	Substitution - Missense(1)	prostate(1)											73.0	83.0	80.0					7																	27134949		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.583G>A	7.37:g.27134949C>T	ENSP00000343246:p.Ala195Thr		A4D184|B2R8U7|O43363	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.A195T	ENST00000343060.4	37	c.583	CCDS5401.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.137|0.137	-1.106497|-1.106497	0.01828|0.01828	.|.	.|.	ENSG00000105991|ENSG00000105991	ENST00000343060|ENST00000355633	T|T	0.31510|0.46451	1.49|0.87	5.01|5.01	0.0365|0.0365	0.14192|0.14192	.|.	0.828379|.	0.11276|.	N|.	0.580903|.	T|T	0.18299|0.18299	0.0439|0.0439	N|N	0.21194|0.21194	0.64|0.64	0.20638|0.20638	N|N	0.999877|0.999877	B|P	0.02656|0.39181	0.0|0.663	B|B	0.01281|0.27500	0.0|0.08	T|T	0.11299|0.11299	-1.0593|-1.0593	10|9	0.14656|0.31617	T|T	0.56|0.26	.|.	1.8696|1.8696	0.03205|0.03205	0.2104:0.4625:0.117:0.2101|0.2104:0.4625:0.117:0.2101	.|.	195|127	P49639|E7ERT8	HXA1_HUMAN|.	T|H	195|127	ENSP00000343246:A195T|ENSP00000347851:R127H	ENSP00000343246:A195T|ENSP00000347851:R127H	A|R	-|-	1|2	0|0	HOXA1|HOXA1	27101474|27101474	1.000000|1.000000	0.71417|0.71417	0.456000|0.456000	0.27044|0.27044	0.491000|0.491000	0.33493|0.33493	1.508000|1.508000	0.35769|0.35769	0.135000|0.135000	0.18707|0.18707	0.561000|0.561000	0.74099|0.74099	GCA|CGC	HOXA1	-	NULL	ENSG00000105991		0.552	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HOXA1	HGNC	protein_coding	OTTHUMT00000358454.1	94	0.00	0	C			27134949	27134949	-1	no_errors	ENST00000343060	ensembl	human	known	69_37n	missense	76	24.00	24	SNP	0.610	T
KALRN	8997	genome.wustl.edu	37	3	124380761	124380761	+	Silent	SNP	C	C	T			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr3:124380761C>T	ENST00000291478.5	+	12	1400	c.1237C>T	c.(1237-1239)Ctg>Ttg	p.L413L	KALRN_ENST00000459915.1_Silent_p.L202L|KALRN_ENST00000428018.2_Silent_p.L381L|KALRN_ENST00000393496.1_Silent_p.L451L|KALRN_ENST00000360013.3_Silent_p.L2110L	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2109					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TCTAGGACGTCTGCAGGGCTT	0.507																																						dbGAP											0													185.0	158.0	167.0					3																	124380761		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.1237C>T	3.37:g.124380761C>T			A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Silent	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.L2110	ENST00000291478.5	37	c.6328	CCDS3028.1	3																																																																																			KALRN	-	superfamily_DH-domain	ENSG00000160145		0.507	KALRN-001	KNOWN	basic|CCDS	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000246891.5	136	0.00	0	C	NM_003947		124380761	124380761	+1	no_errors	ENST00000360013	ensembl	human	known	69_37n	silent	105	11.02	13	SNP	1.000	T
KCTD16	57528	genome.wustl.edu	37	5	143853657	143853657	+	Silent	SNP	T	T	C			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr5:143853657T>C	ENST00000507359.3	+	3	2358	c.1267T>C	c.(1267-1269)Tta>Cta	p.L423L	KCTD16_ENST00000512467.1_Silent_p.L423L	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	423					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			ATCTGAACTTTTAAGGAAGTA	0.368																																						dbGAP											0													42.0	48.0	46.0					5																	143853657		2175	4287	6462	-	-	-	SO:0001819	synonymous_variant	0			AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.1267T>C	5.37:g.143853657T>C			Q9P2M9	Silent	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.L423	ENST00000507359.3	37	c.1267	CCDS34260.1	5																																																																																			KCTD16	-	NULL	ENSG00000183775		0.368	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCTD16	HGNC	protein_coding	OTTHUMT00000371898.3	27	0.00	0	T	XM_098368		143853657	143853657	+1	no_errors	ENST00000507359	ensembl	human	known	69_37n	silent	30	33.33	15	SNP	0.927	C
MARC1	64757	genome.wustl.edu	37	1	220986673	220986673	+	Silent	SNP	A	A	T			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr1:220986673A>T	ENST00000366910.5	+	7	1113	c.927A>T	c.(925-927)ggA>ggT	p.G309G	MARC1_ENST00000496110.1_3'UTR	NM_022746.3	NP_073583.3	Q5VT66	MARC1_HUMAN	mitochondrial amidoxime reducing component 1	309	MOSC. {ECO:0000255|PROSITE- ProRule:PRU00670}.				detoxification of nitrogen compound (GO:0051410)|nitrate metabolic process (GO:0042126)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|nitrate reductase activity (GO:0008940)|pyridoxal phosphate binding (GO:0030170)										AGTTATATGGAAAATCACCAC	0.488																																						dbGAP											0													207.0	199.0	202.0					1																	220986673		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK026043	CCDS1526.1	1q41	2011-11-02	2011-11-02	2011-11-02	ENSG00000186205	ENSG00000186205			26189	protein-coding gene	gene with protein product		614126	"""MOCO sulphurase C-terminal domain containing 1"""	MOSC1		11886751	Standard	NM_022746		Approved	FLJ22390	uc001hms.3	Q5VT66	OTTHUMG00000037353	ENST00000366910.5:c.927A>T	1.37:g.220986673A>T			A8K447|B2D078|Q5VVS9|Q5VVT0|Q5VVT1|Q8N9P5|Q96FN8|Q9H6C7	Nonsense_Mutation	SNP	pfam_MoCF_Sase_C,pfam_MOSC_N,superfamily_Pyrv_Knase-like_insert_dom	p.K235*	ENST00000366910.5	37	c.703	CCDS1526.1	1	.	.	.	.	.	.	.	.	.	.	A	9.545	1.114397	0.20795	.	.	ENSG00000186205	ENST00000407981	.	.	.	5.54	1.62	0.23740	.	.	.	.	.	.	.	.	.	.	.	0.34059	D	0.657115	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.256	7.2105	0.25931	0.6535:0.2724:0.0742:0.0	.	.	.	.	X	235	.	.	K	+	1	0	MOSC1	219053296	0.815000	0.29118	0.193000	0.23327	0.994000	0.84299	0.404000	0.20999	0.454000	0.26884	0.533000	0.62120	AAA	MARC1	-	pfam_MoCF_Sase_C,superfamily_Pyrv_Knase-like_insert_dom	ENSG00000186205		0.488	MARC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARC1	HGNC	protein_coding	OTTHUMT00000090904.1	140	0.00	0	A	NM_022746		220986673	220986673	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000407981	ensembl	human	putative	69_37n	nonsense	175	22.47	51	SNP	0.378	T
MEOX2	4223	genome.wustl.edu	37	7	15666489	15666489	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr7:15666489C>T	ENST00000262041.5	-	2	981	c.572G>A	c.(571-573)aGg>aAg	p.R191K		NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	191					angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		AAATGCTGTCCTTTCTTTCCT	0.393																																					Esophageal Squamous(140;197 1769 16409 18257 29929)	dbGAP											0													357.0	308.0	325.0					7																	15666489		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.572G>A	7.37:g.15666489C>T	ENSP00000262041:p.Arg191Lys		B2R8I7|O75263|Q9UPL6	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.R191K	ENST00000262041.5	37	c.572	CCDS34605.1	7	.	.	.	.	.	.	.	.	.	.	C	36	5.620721	0.96660	.	.	ENSG00000106511	ENST00000262041	D	0.99089	-5.41	5.74	5.74	0.90152	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99453	0.9806	M	0.90082	3.085	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98832	1.0751	10	0.87932	D	0	-16.3916	19.9317	0.97122	0.0:1.0:0.0:0.0	.	191	P50222	MEOX2_HUMAN	K	191	ENSP00000262041:R191K	ENSP00000262041:R191K	R	-	2	0	MEOX2	15633014	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.716000	0.92895	0.591000	0.81541	AGG	MEOX2	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000106511		0.393	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEOX2	HGNC	protein_coding	OTTHUMT00000326058.2	365	0.00	0	C	NM_005924		15666489	15666489	-1	no_errors	ENST00000262041	ensembl	human	known	69_37n	missense	166	49.54	163	SNP	1.000	T
MRPL24	79590	genome.wustl.edu	37	1	156708153	156708153	+	Silent	SNP	G	G	A			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr1:156708153G>A	ENST00000361531.2	-	3	397	c.261C>T	c.(259-261)gtC>gtT	p.V87V	MRPL24_ENST00000478899.1_5'Flank|MRPL24_ENST00000368211.4_Silent_p.V87V			Q96A35	RM24_HUMAN	mitochondrial ribosomal protein L24	87	KOW.				translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(1)|lung(4)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCCCTCCCACGACCACCCAGT	0.562																																						dbGAP											0													267.0	247.0	254.0					1																	156708153		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB051341	CCDS1155.1	1q23.1	2012-11-14			ENSG00000143314	ENSG00000143314		"""Mitochondrial ribosomal proteins / large subunits"""	14037	protein-coding gene	gene with protein product		611836					Standard	NM_145729		Approved	MRP-L18	uc001fpx.1	Q96A35	OTTHUMG00000041296	ENST00000361531.2:c.261C>T	1.37:g.156708153G>A			D3DVC8|Q53G65|Q53HT0|Q5SYZ9|Q5SZ00|Q5SZ02|Q96Q70|Q9H7G3	Silent	SNP	pfam_KOW,superfamily_Translation_prot_SH3-like,smart_KOW,tigrfam_Ribosomal_L24	p.V87	ENST00000361531.2	37	c.261	CCDS1155.1	1																																																																																			MRPL24	-	pfam_KOW,superfamily_Translation_prot_SH3-like,tigrfam_Ribosomal_L24	ENSG00000143314		0.562	MRPL24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL24	HGNC	protein_coding	OTTHUMT00000098955.1	227	0.00	0	G	NM_145729		156708153	156708153	-1	no_errors	ENST00000361531	ensembl	human	known	69_37n	silent	234	25.16	79	SNP	0.013	A
MUC16	94025	genome.wustl.edu	37	19	9061379	9061379	+	Silent	SNP	T	T	C			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr19:9061379T>C	ENST00000397910.4	-	3	26270	c.26067A>G	c.(26065-26067)acA>acG	p.T8689T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8691	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGGAGTTGATGTGGAAACAC	0.478																																						dbGAP											0													110.0	103.0	105.0					19																	9061379		1963	4146	6109	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.26067A>G	19.37:g.9061379T>C			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.T8689	ENST00000397910.4	37	c.26067	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	196	0.00	0	T	NM_024690		9061379	9061379	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	256	36.95	150	SNP	0.000	C
MYO7B	4648	genome.wustl.edu	37	2	128382968	128382968	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr2:128382968delC	ENST00000409816.2	+	29	4027	c.3995delC	c.(3994-3996)gccfs	p.A1332fs	RP11-286H15.1_ENST00000609697.1_RNA|MYO7B_ENST00000389524.4_Frame_Shift_Del_p.A1332fs|MYO7B_ENST00000409090.1_Frame_Shift_Del_p.A185fs|MYO7B_ENST00000428314.1_Frame_Shift_Del_p.A1332fs			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1332	FERM 1. {ECO:0000255|PROSITE- ProRule:PRU00084}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GAGCTGCTGGCCCGGCACTGC	0.667																																						dbGAP											0													17.0	22.0	20.0					2																	128382968		2114	4213	6327	-	-	-	SO:0001589	frameshift_variant	0				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.3995delC	2.37:g.128382968delC	ENSP00000386461:p.Ala1332fs		Q14786|Q8TEE1	Frame_Shift_Del	DEL	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.R1333fs	ENST00000409816.2	37	c.3995	CCDS46405.1	2																																																																																			MYO7B	-	superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000169994		0.667	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	10	0.00	0	C	XM_291001		128382968	128382968	+1	no_errors	ENST00000389524	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	1.000	-
NLRP8	126205	genome.wustl.edu	37	19	56466066	56466066	+	Silent	SNP	C	C	T			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr19:56466066C>T	ENST00000291971.3	+	3	713	c.642C>T	c.(640-642)atC>atT	p.I214I	NLRP8_ENST00000590542.1_Silent_p.I214I	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	214	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CTCCTGGGATCGGAAAAACAA	0.532																																						dbGAP											0													87.0	71.0	76.0					19																	56466066		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.642C>T	19.37:g.56466066C>T			Q7RTR4	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.I214	ENST00000291971.3	37	c.642	CCDS12937.1	19																																																																																			NLRP8	-	pfscan_NACHT_NTPase	ENSG00000179709		0.532	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	HGNC	protein_coding	OTTHUMT00000457462.1	82	0.00	0	C	NM_176811		56466066	56466066	+1	no_errors	ENST00000291971	ensembl	human	known	69_37n	silent	52	38.10	32	SNP	0.001	T
NOTUM	147111	genome.wustl.edu	37	17	79914941	79914942	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr17:79914941_79914942insC	ENST00000409678.3	-	7	1087_1088	c.704_705insG	c.(703-705)ggcfs	p.G235fs		NM_178493.5	NP_848588.3	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog (Drosophila)	235						extracellular region (GO:0005576)	hydrolase activity (GO:0016787)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	15	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			GCACCCCGGTGCCCCCCGCGCT	0.698																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC060882	CCDS32771.2	17q25.3	2008-02-05			ENSG00000185269	ENSG00000185269			27106	protein-coding gene	gene with protein product		609847					Standard	NM_178493		Approved		uc010wvg.2	Q6P988	OTTHUMG00000154416	ENST00000409678.3:c.705dupG	17.37:g.79914947_79914947dupC	ENSP00000387310:p.Gly235fs		Q8N410|Q8NI82	Frame_Shift_Ins	INS	pfam_Pec_acetylest	p.T236fs	ENST00000409678.3	37	c.705_704	CCDS32771.2	17																																																																																			NOTUM	-	pfam_Pec_acetylest	ENSG00000185269		0.698	NOTUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTUM	HGNC	protein_coding	OTTHUMT00000335123.2	15	0.00	0	-	NM_178493		79914941	79914942	-1	no_errors	ENST00000409678	ensembl	human	known	69_37n	frame_shift_ins	10	23.08	3	INS	1.000:1.000	C
OTOF	9381	genome.wustl.edu	37	2	26706481	26706481	+	Missense_Mutation	SNP	C	C	T	rs202229610		TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr2:26706481C>T	ENST00000272371.2	-	13	1367	c.1241G>A	c.(1240-1242)cGc>cAc	p.R414H	OTOF_ENST00000403946.3_Missense_Mutation_p.R414H	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	414	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCCCACTGGCGTTCGGGGGG	0.597																																					GBM(102;732 1451 20652 24062 31372)	dbGAP											0													41.0	41.0	41.0					2																	26706481		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.1241G>A	2.37:g.26706481C>T	ENSP00000272371:p.Arg414His		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.R414H	ENST00000272371.2	37	c.1241	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.469496	0.96274	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	D;D	0.82344	-1.6;-1.6	5.22	5.22	0.72569	C2 calcium/lipid-binding domain, CaLB (1);	0.047194	0.85682	N	0.000000	D	0.92551	0.7634	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.92994	0.6417	10	0.49607	T	0.09	-21.3736	18.4462	0.90685	0.0:1.0:0.0:0.0	.	414	Q9HC10	OTOF_HUMAN	H	414	ENSP00000272371:R414H;ENSP00000385255:R414H	ENSP00000272371:R414H	R	-	2	0	OTOF	26559985	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.702000	0.84576	2.454000	0.82982	0.638000	0.83543	CGC	OTOF	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000115155		0.597	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3	26	0.00	0	C			26706481	26706481	-1	no_errors	ENST00000272371	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	1.000	T
PAX8	7849	genome.wustl.edu	37	2	113993061	113993061	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr2:113993061G>A	ENST00000429538.3	-	9	1191	c.997C>T	c.(997-999)Cag>Tag	p.Q333*	AC016683.6_ENST00000422956.2_RNA|PAX8_ENST00000397647.3_Intron|PAX8_ENST00000263335.7_Intron|PAX8_ENST00000348715.5_Silent_p.C306C|AC016683.6_ENST00000553869.2_RNA|AC016683.6_ENST00000431844.2_RNA|AC016683.6_ENST00000333145.5_RNA|AC016683.6_ENST00000445745.1_RNA|AC016683.6_ENST00000456685.1_RNA|AC016683.6_ENST00000437551.1_RNA|AC016683.6_ENST00000556070.1_RNA|AC016683.6_ENST00000436293.2_RNA|AC016683.6_ENST00000451179.1_RNA|PAX8_ENST00000263334.5_Silent_p.C306C	NM_003466.3	NP_003457.1	Q06710	PAX8_HUMAN	paired box 8	333					anatomical structure morphogenesis (GO:0009653)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular response to gonadotropin stimulus (GO:0071371)|central nervous system development (GO:0007417)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesonephros development (GO:0001823)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric nephron tubule formation (GO:0072289)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|otic vesicle development (GO:0071599)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|regulation of apoptotic process (GO:0042981)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of thyroid-stimulating hormone secretion (GO:2000612)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone signaling pathway (GO:0038194)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid-stimulating hormone receptor activity (GO:0004996)|transcription regulatory region DNA binding (GO:0044212)		PAX8/PPARG(117)	breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|skin(1)	20						CCGACTTGCTGCAGATCCAAA	0.597			T	PPARG	follicular thyroid		Thyroid dysgenesis																														Ovarian(188;7 2067 9084 29802 29892)	dbGAP		Dom	yes		2	2q12-q14	7849	paired box gene 8	yes	E	0													41.0	50.0	47.0					2																	113993061		1904	4135	6039	-	-	-	SO:0001587	stop_gained	0			X69699	CCDS42735.1, CCDS42736.1, CCDS46398.1, CCDS46399.1	2q13	2011-06-20	2007-07-12		ENSG00000125618	ENSG00000125618		"""Paired boxes"", ""Homeoboxes / PRD class"""	8622	protein-coding gene	gene with protein product		167415	"""paired box gene 8"""			8431641, 7981748	Standard	NM_003466		Approved		uc010yxt.2	Q06710	OTTHUMG00000128529	ENST00000429538.3:c.997C>T	2.37:g.113993061G>A	ENSP00000395498:p.Gln333*		Q09155|Q16337|Q16338|Q16339|Q4ZG35|Q96J49	Nonsense_Mutation	SNP	pfam_Paired_dom,pfam_Pax2_C,superfamily_Homeodomain-like,smart_Paired_dom,prints_Paired_dom,pfscan_Paired_dom	p.Q333*	ENST00000429538.3	37	c.997	CCDS46398.1	2	.	.	.	.	.	.	.	.	.	.	G	40	8.202555	0.98704	.	.	ENSG00000125618	ENST00000429538	.	.	.	5.64	5.64	0.86602	.	1.136310	0.06463	N	0.729789	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	17.1975	0.86897	0.0:0.0:1.0:0.0	.	.	.	.	X	333	.	ENSP00000395498:Q333X	Q	-	1	0	PAX8	113709532	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.974000	0.56852	2.655000	0.90218	0.655000	0.94253	CAG	PAX8	-	NULL	ENSG00000125618		0.597	PAX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX8	HGNC	protein_coding	OTTHUMT00000250353.5	51	0.00	0	G			113993061	113993061	-1	no_errors	ENST00000429538	ensembl	human	known	69_37n	nonsense	27	30.77	12	SNP	1.000	A
PCNT	5116	genome.wustl.edu	37	21	47819611	47819611	+	Silent	SNP	T	T	C			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr21:47819611T>C	ENST00000359568.5	+	25	4799	c.4692T>C	c.(4690-4692)atT>atC	p.I1564I	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1564					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AAGAAGAAATTAAACGTCTGG	0.398																																						dbGAP											0													104.0	110.0	108.0					21																	47819611		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.4692T>C	21.37:g.47819611T>C			O43152|Q7Z7C9	Silent	SNP	pfam_PACT_domain	p.I1564	ENST00000359568.5	37	c.4692	CCDS33592.1	21																																																																																			PCNT	-	NULL	ENSG00000160299		0.398	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	75	0.00	0	T	NM_006031		47819611	47819611	+1	no_errors	ENST00000359568	ensembl	human	known	69_37n	silent	39	20.41	10	SNP	0.000	C
QARS	5859	genome.wustl.edu	37	3	49135886	49135886	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr3:49135886C>G	ENST00000306125.6	-	21	2321	c.1984G>C	c.(1984-1986)Gag>Cag	p.E662Q	QARS_ENST00000470225.1_5'Flank|QARS_ENST00000414533.1_Missense_Mutation_p.E651Q			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	662					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	CAGGTCACCTCCAGACTCTCT	0.562																																						dbGAP											0													56.0	59.0	58.0					3																	49135886		2203	4300	6503	-	-	-	SO:0001583	missense	0			X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.1984G>C	3.37:g.49135886C>G	ENSP00000307567:p.Glu662Gln		B4DWJ2	Missense_Mutation	SNP	pfam_Glu/Gln-tRNA-synth_Ib_cat-dom,pfam_Gln-tRNA-synth_Ib_RNA-bd_N,pfam_Glu/Gln-tRNA-synth_Ib_codon-bd,pfam_Gln-tRNA-synth_Ib_RNA-bd_2,superfamily_Ribosomal_L25/Gln-tRNA_synth,prints_Glu/Gln-tRNA-synth_Ib,tigrfam_Gln-tRNA-synth_Ib	p.E662Q	ENST00000306125.6	37	c.1984	CCDS2788.1	3	.	.	.	.	.	.	.	.	.	.	C	13.35	2.211821	0.39102	.	.	ENSG00000172053	ENST00000453392;ENST00000306125;ENST00000414533	T;T	0.24538	1.85;1.85	5.8	4.93	0.64822	Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain (1);Ribosomal protein L25/Gln-tRNA synthetase, beta-barrel domain (1);Glutamyl/glutaminyl-tRNA synthetase, class Ib, anti-codon binding domain (1);	0.147598	0.64402	D	0.000015	T	0.27169	0.0666	L	0.35644	1.08	0.80722	D	1	B;B	0.20368	0.044;0.044	B;B	0.35813	0.211;0.211	T	0.05869	-1.0859	10	0.29301	T	0.29	-23.1189	14.567	0.68185	0.0:0.9295:0.0:0.0705	.	651;662	B4DWJ2;P47897	.;SYQ_HUMAN	Q	182;662;651	ENSP00000307567:E662Q;ENSP00000390015:E651Q	ENSP00000307567:E662Q	E	-	1	0	QARS	49110890	1.000000	0.71417	0.984000	0.44739	0.625000	0.37756	3.721000	0.54941	1.477000	0.48234	0.561000	0.74099	GAG	QARS	-	pfam_Glu/Gln-tRNA-synth_Ib_codon-bd,superfamily_Ribosomal_L25/Gln-tRNA_synth,tigrfam_Gln-tRNA-synth_Ib	ENSG00000172053		0.562	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QARS	HGNC	protein_coding	OTTHUMT00000345689.2	54	0.00	0	C	NM_005051		49135886	49135886	-1	no_errors	ENST00000306125	ensembl	human	known	69_37n	missense	51	15.00	9	SNP	1.000	G
RAD54L2	23132	genome.wustl.edu	37	3	51664777	51664777	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr3:51664777G>A	ENST00000409535.2	+	6	780	c.655G>A	c.(655-657)Gaa>Aaa	p.E219K	RAD54L2_ENST00000296477.3_5'UTR	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	219						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		GGACAGCAGTGAATCTGTCAG	0.488																																						dbGAP											0													97.0	82.0	87.0					3																	51664777		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.655G>A	3.37:g.51664777G>A	ENSP00000386520:p.Glu219Lys		Q8TB57|Q9BV54	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E219K	ENST00000409535.2	37	c.655	CCDS33765.2	3	.	.	.	.	.	.	.	.	.	.	G	18.80	3.701860	0.68501	.	.	ENSG00000164080	ENST00000409535	T	0.22743	1.94	5.8	5.8	0.92144	.	0.212901	0.47093	D	0.000248	T	0.16557	0.0398	N	0.17082	0.46	0.80722	D	1	B	0.22276	0.067	B	0.21917	0.037	T	0.06481	-1.0824	10	0.30078	T	0.28	-19.948	19.0588	0.93078	0.0:0.0:1.0:0.0	.	219	Q9Y4B4	ARIP4_HUMAN	K	219	ENSP00000386520:E219K	ENSP00000386520:E219K	E	+	1	0	RAD54L2	51639817	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.282000	0.78630	2.744000	0.94065	0.655000	0.94253	GAA	RAD54L2	-	NULL	ENSG00000164080		0.488	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L2	HGNC	protein_coding	OTTHUMT00000328700.2	134	0.00	0	G	NM_015106		51664777	51664777	+1	no_errors	ENST00000409535	ensembl	human	known	69_37n	missense	155	20.51	40	SNP	1.000	A
RBMXL3	139804	genome.wustl.edu	37	X	114426666	114426666	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chrX:114426666G>A	ENST00000424776.3	+	1	2704	c.2662G>A	c.(2662-2664)Gaa>Aaa	p.E888K	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	888	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CCACTACACCGAAGCCTACAG	0.637																																						dbGAP											0													30.0	30.0	30.0					X																	114426666		692	1591	2283	-	-	-	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.2662G>A	X.37:g.114426666G>A	ENSP00000417451:p.Glu888Lys		B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E888K	ENST00000424776.3	37	c.2662	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	G	12.57	1.976345	0.34848	.	.	ENSG00000175718	ENST00000424776	T	0.05319	3.46	0.95	0.95	0.19572	.	.	.	.	.	T	0.02380	0.0073	N	0.08118	0	0.20926	N	0.999828	P	0.45986	0.87	B	0.26517	0.07	T	0.45411	-0.9263	9	0.87932	D	0	.	7.6289	0.28228	1.0E-4:0.0:0.9999:0.0	.	888	Q8N7X1	RMXL3_HUMAN	K	888	ENSP00000417451:E888K	ENSP00000417451:E888K	E	+	1	0	RBMXL3	114332922	0.274000	0.24191	0.010000	0.14722	0.011000	0.07611	2.578000	0.46051	0.177000	0.19895	0.179000	0.17066	GAA	RBMXL3	-	NULL	ENSG00000175718		0.637	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	65	0.00	0	G	NM_001145346		114426666	114426666	+1	no_errors	ENST00000424776	ensembl	human	known	69_37n	missense	15	48.28	14	SNP	0.999	A
SCN7A	6332	genome.wustl.edu	37	2	167298248	167298248	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr2:167298248C>A	ENST00000409855.1	-	14	1941	c.1815G>T	c.(1813-1815)aaG>aaT	p.K605N		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	605					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	ACTTTCCCAACTTGAAAATTC	0.358																																						dbGAP											0													79.0	76.0	77.0					2																	167298248		1910	4141	6051	-	-	-	SO:0001583	missense	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1815G>T	2.37:g.167298248C>A	ENSP00000386796:p.Lys605Asn			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.K605N	ENST00000409855.1	37	c.1815	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	C	17.64	3.440556	0.63067	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992	D;D	0.98012	-4.66;-4.66	4.78	0.673	0.17941	Ion transport (1);	0.000000	0.64402	D	0.000017	D	0.98485	0.9495	H	0.94620	3.56	0.36906	D	0.890671	D	0.63880	0.993	P	0.60473	0.875	D	0.98274	1.0505	10	0.87932	D	0	.	7.6257	0.28210	0.0:0.491:0.0:0.509	.	605	Q01118	SCN7A_HUMAN	N	605	ENSP00000386796:K605N;ENSP00000413699:K605N	ENSP00000259060:K605N	K	-	3	2	SCN7A	167006494	0.062000	0.20869	0.890000	0.34922	0.946000	0.59487	-0.195000	0.09546	0.010000	0.14839	0.585000	0.79938	AAG	SCN7A	-	pfam_Ion_trans_dom	ENSG00000136546		0.358	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	161	0.00	0	C			167298248	167298248	-1	no_errors	ENST00000409855	ensembl	human	known	69_37n	missense	76	36.67	44	SNP	0.954	A
SLC28A3	64078	genome.wustl.edu	37	9	86894959	86894959	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr9:86894959T>C	ENST00000376238.4	-	16	1808	c.1759A>G	c.(1759-1761)Atc>Gtc	p.I587V	SLC28A3_ENST00000537648.1_Missense_Mutation_p.I518V|RP11-380F14.2_ENST00000419815.1_RNA	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	587					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)			endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	CCCGAGGCGATATCACGCTTT	0.532																																					Ovarian(106;425 1539 34835 42413 43572)	dbGAP											0													73.0	57.0	63.0					9																	86894959		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.1759A>G	9.37:g.86894959T>C	ENSP00000365413:p.Ile587Val		A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Missense_Mutation	SNP	pfam_Nucleos_tra2_C,pfam_Nuclsd_transpt2,pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac	p.I587V	ENST00000376238.4	37	c.1759	CCDS6670.1	9	.	.	.	.	.	.	.	.	.	.	T	19.33	3.806460	0.70682	.	.	ENSG00000197506	ENST00000376238;ENST00000537648	T;T	0.07327	3.2;3.2	6.03	6.03	0.97812	Na dependent nucleoside transporter, C-terminal (1);	0.047687	0.85682	D	0.000000	T	0.13072	0.0317	L	0.54863	1.705	0.58432	D	0.999995	B	0.33379	0.41	B	0.40329	0.326	T	0.10660	-1.0620	10	0.10902	T	0.67	-27.3154	16.5724	0.84622	0.0:0.0:0.0:1.0	.	587	Q9HAS3	S28A3_HUMAN	V	587;518	ENSP00000365413:I587V;ENSP00000446438:I518V	ENSP00000365413:I587V	I	-	1	0	SLC28A3	86084779	1.000000	0.71417	0.989000	0.46669	0.721000	0.41392	3.020000	0.49643	2.313000	0.78055	0.455000	0.32223	ATC	SLC28A3	-	pfam_Nucleos_tra2_C,tigrfam_C_nuclsd_transpt_met_bac	ENSG00000197506		0.532	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC28A3	HGNC	protein_coding	OTTHUMT00000052874.1	112	0.00	0	T	NM_022127		86894959	86894959	-1	no_errors	ENST00000376238	ensembl	human	known	69_37n	missense	59	58.16	82	SNP	1.000	C
MTCL1	23255	genome.wustl.edu	37	18	8796377	8796377	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr18:8796377C>T	ENST00000306329.11	+	7	3115	c.3115C>T	c.(3115-3117)Ctc>Ttc	p.L1039F	SOGA2_ENST00000400050.3_Missense_Mutation_p.L679F|SOGA2_ENST00000518815.1_Missense_Mutation_p.L35F|SOGA2_ENST00000517570.1_Missense_Mutation_p.L679F|SOGA2_ENST00000359865.3_Missense_Mutation_p.L720F|SOGA2_ENST00000306285.7_Missense_Mutation_p.L35F																							GAACATTTTCCTCTTCTACGT	0.527																																						dbGAP											0													112.0	110.0	111.0					18																	8796377		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000306329.11:c.3115C>T	18.37:g.8796377C>T	ENSP00000305027:p.Leu1039Phe			Missense_Mutation	SNP	pfam_DUF3166	p.L720F	ENST00000306329.11	37	c.2158		18	.	.	.	.	.	.	.	.	.	.	C	24.2	4.507540	0.85282	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	5.91	5.91	0.95273	.	0.000000	0.49305	D	0.000159	T	0.71937	0.3399	M	0.69823	2.125	0.42374	D	0.992464	D;D	0.76494	0.999;0.997	D;D	0.85130	0.997;0.954	T	0.73883	-0.3842	10	0.72032	D	0.01	-23.0829	15.7276	0.77774	0.0:0.864:0.136:0.0	.	1030;720	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	F	741;679;720;679;35	ENSP00000429556:L679F;ENSP00000352927:L720F;ENSP00000382924:L679F;ENSP00000303670:L35F	ENSP00000303670:L35F	L	+	1	0	CCDC165	8786377	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.129000	0.50500	2.801000	0.96364	0.655000	0.94253	CTC	SOGA2	-	NULL	ENSG00000168502		0.527	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	SOGA2	HGNC	protein_coding	OTTHUMT00000444141.1	169	0.00	0	C			8796377	8796377	+1	no_errors	ENST00000359865	ensembl	human	known	69_37n	missense	58	52.07	63	SNP	1.000	T
TBP	6908	genome.wustl.edu	37	6	170871216	170871216	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr6:170871216C>G	ENST00000392092.2	+	3	671	c.392C>G	c.(391-393)cCc>cGc	p.P131R	TBP_ENST00000540980.1_Missense_Mutation_p.P111R|TBP_ENST00000230354.6_Missense_Mutation_p.P131R	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	131					cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		ACAACTGCACCCTTGCCGGGC	0.612																																						dbGAP											0													158.0	140.0	146.0					6																	170871216		2203	4300	6503	-	-	-	SO:0001583	missense	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.392C>G	6.37:g.170871216C>G	ENSP00000375942:p.Pro131Arg		B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Missense_Mutation	SNP	pfam_TBP,prints_TBP	p.P131R	ENST00000392092.2	37	c.392	CCDS5315.1	6	.	.	.	.	.	.	.	.	.	.	C	18.53	3.643935	0.67244	.	.	ENSG00000112592	ENST00000421512;ENST00000392092;ENST00000540980;ENST00000230354;ENST00000392091;ENST00000423353	T;T;D;T;T	0.89617	1.01;1.23;-2.54;1.23;1.23	5.6	4.72	0.59763	.	0.155750	0.64402	D	0.000019	T	0.75759	0.3893	N	0.24115	0.695	0.58432	D	0.999993	P	0.46395	0.877	B	0.39299	0.296	T	0.80830	-0.1207	10	0.51188	T	0.08	-8.5197	14.8856	0.70567	0.0:0.9299:0.0:0.0701	.	131	P20226	TBP_HUMAN	R	131;131;111;131;108;131	ENSP00000400008:P131R;ENSP00000375942:P131R;ENSP00000442132:P111R;ENSP00000230354:P131R;ENSP00000416482:P131R	ENSP00000230354:P131R	P	+	2	0	TBP	170713141	0.997000	0.39634	0.992000	0.48379	0.959000	0.62525	3.227000	0.51262	2.643000	0.89663	0.655000	0.94253	CCC	TBP	-	NULL	ENSG00000112592		0.612	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	281	0.00	0	C	NM_003194		170871216	170871216	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	missense	147	38.49	92	SNP	1.000	G
TES	26136	genome.wustl.edu	37	7	115892485	115892485	+	Silent	SNP	T	T	C			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr7:115892485T>C	ENST00000358204.4	+	6	1247	c.1032T>C	c.(1030-1032)aaT>aaC	p.N344N	TES_ENST00000393481.2_Silent_p.N335N|AC002066.1_ENST00000446355.2_RNA|TES_ENST00000537767.1_Silent_p.N102N|AC073130.3_ENST00000444244.1_RNA	NM_015641.3	NP_056456.1	Q9UGI8	TES_HUMAN	testis derived transcript (3 LIM domains)	344	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(4)|lung(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	12	Lung NSC(10;0.0137)|all_lung(10;0.0148)	Breast(660;0.0602)	STAD - Stomach adenocarcinoma(10;0.00878)			TGATGGTCAATGACAAGCCCG	0.468																																						dbGAP											0													170.0	153.0	159.0					7																	115892485		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ250865	CCDS5763.1, CCDS5764.1	7q31.2	2004-04-20			ENSG00000135269	ENSG00000135269			14620	protein-coding gene	gene with protein product		606085				10950921	Standard	NM_015641		Approved	DKFZP586B2022, TESS-2, TESTIN	uc003vho.3	Q9UGI8	OTTHUMG00000023092	ENST00000358204.4:c.1032T>C	7.37:g.115892485T>C			A4D0U6|Q9GZQ1|Q9HAJ9	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.M131T	ENST00000358204.4	37	c.392	CCDS5763.1	7	.	.	.	.	.	.	.	.	.	.	T	9.904	1.207683	0.22205	.	.	ENSG00000135269	ENST00000393484	.	.	.	5.65	0.696	0.18075	.	.	.	.	.	T	0.51856	0.1699	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38845	-0.9642	4	.	.	.	-3.6425	6.0369	0.19712	0.0:0.2742:0.1257:0.6001	.	.	.	.	T	131	.	.	M	+	2	0	TES	115679721	0.157000	0.22836	0.988000	0.46212	0.996000	0.88848	-0.502000	0.06390	0.165000	0.19558	0.533000	0.62120	ATG	TES	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000135269		0.468	TES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TES	HGNC	protein_coding	OTTHUMT00000059413.2	162	0.00	0	T	NM_015641		115892485	115892485	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000393484	ensembl	human	putative	69_37n	missense	73	46.32	63	SNP	0.974	C
TRIP12	9320	genome.wustl.edu	37	2	230678717	230678717	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr2:230678717C>T	ENST00000283943.5	-	12	1889	c.1711G>A	c.(1711-1713)Gaa>Aaa	p.E571K	TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389045.3_Missense_Mutation_p.E274K|TRIP12_ENST00000389044.4_Missense_Mutation_p.E619K	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	571					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CTGAAGAATTCTAGGTACAGC	0.348																																						dbGAP											0													59.0	57.0	58.0					2																	230678717		2203	4300	6503	-	-	-	SO:0001583	missense	0			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1711G>A	2.37:g.230678717C>T	ENSP00000283943:p.Glu571Lys		D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ARM-type_fold,smart_HECT,pfscan_HECT,pfscan_WWE-dom	p.E571K	ENST00000283943.5	37	c.1711	CCDS33391.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.199865	0.94997	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.33654	1.4;1.4;1.4	5.75	3.92	0.45320	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.29223	0.0727	L	0.38175	1.15	0.80722	D	1	B;B;B;B	0.14012	0.009;0.001;0.001;0.001	B;B;B;B	0.12837	0.008;0.002;0.002;0.002	T	0.13229	-1.0517	10	0.87932	D	0	.	11.3787	0.49743	0.1252:0.8086:0.0:0.0662	.	577;274;619;571	D4HL82;Q14CF1;Q14CA3;Q14669	.;.;.;TRIPC_HUMAN	K	571;274;619	ENSP00000283943:E571K;ENSP00000373697:E274K;ENSP00000373696:E619K	ENSP00000283943:E571K	E	-	1	0	TRIP12	230386961	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	6.054000	0.71096	1.426000	0.47256	0.551000	0.68910	GAA	TRIP12	-	superfamily_ARM-type_fold	ENSG00000153827		0.348	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	HGNC	protein_coding	OTTHUMT00000331861.3	87	0.00	0	C	NM_004238		230678717	230678717	-1	no_errors	ENST00000283943	ensembl	human	known	69_37n	missense	36	36.84	21	SNP	1.000	T
TRMT1	55621	genome.wustl.edu	37	19	13218608	13218608	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr19:13218608G>A	ENST00000592062.1	-	14	2033	c.1463C>T	c.(1462-1464)aCg>aTg	p.T488M	TRMT1_ENST00000221504.8_Missense_Mutation_p.T459M|TRMT1_ENST00000437766.1_Missense_Mutation_p.T488M|TRMT1_ENST00000357720.4_Missense_Mutation_p.T488M			Q9NXH9	TRM1_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)	488	Trm1 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00958}.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	GBM - Glioblastoma multiforme(1328;0.0356)		AGGGGCATCCGTCTTCACAGC	0.637																																						dbGAP											0													83.0	65.0	71.0					19																	13218608		2164	4203	6367	-	-	-	SO:0001583	missense	0			AF196479	CCDS12293.1, CCDS45997.1	19p13.13	2012-06-12	2012-06-12						25980	protein-coding gene	gene with protein product		611669				10982862	Standard	NM_001142554		Approved	FLJ20244, TRM1	uc002mwl.3	Q9NXH9		ENST00000592062.1:c.1463C>T	19.37:g.13218608G>A	ENSP00000466967:p.Thr488Met		O76103|Q548Y5|Q8WVA6	Missense_Mutation	SNP	pfam_tRNA_MeTrfase_TRM1,pfam_Znf_CCCH,pfam_tRNA_Trfase_Trm5/Tyw2,smart_Znf_CCCH,tigrfam_tRNA_MeTrfase_TRM1	p.T488M	ENST00000592062.1	37	c.1463	CCDS12293.1	19	.	.	.	.	.	.	.	.	.	.	G	17.86	3.493405	0.64186	.	.	ENSG00000104907	ENST00000357720;ENST00000437766;ENST00000221504	.	.	.	3.87	3.87	0.44632	.	0.000000	0.85682	D	0.000000	D	0.86439	0.5933	H	0.96048	3.76	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90490	0.4466	9	0.87932	D	0	-16.1857	13.3524	0.60609	0.0:0.0:1.0:0.0	.	459;488	Q9NXH9-2;Q9NXH9	.;TRM1_HUMAN	M	488;488;459	.	ENSP00000221504:T459M	T	-	2	0	TRMT1	13079608	1.000000	0.71417	0.904000	0.35570	0.474000	0.32979	9.005000	0.93587	1.996000	0.58369	0.462000	0.41574	ACG	TRMT1	-	pfam_tRNA_MeTrfase_TRM1,tigrfam_tRNA_MeTrfase_TRM1	ENSG00000104907		0.637	TRMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT1	HGNC	protein_coding	OTTHUMT00000452780.2	94	0.00	0	G	NM_017722		13218608	13218608	-1	no_errors	ENST00000357720	ensembl	human	known	69_37n	missense	73	39.17	47	SNP	0.998	A
TTLL12	23170	genome.wustl.edu	37	22	43569738	43569738	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr22:43569738G>A	ENST00000216129.6	-	9	1387	c.1324C>T	c.(1324-1326)Cga>Tga	p.R442*	TTLL12_ENST00000484118.1_5'Flank|TTLL12_ENST00000494035.1_5'Flank	NM_015140.3	NP_055955.1	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	442	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)					central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	13		Ovarian(80;0.221)|Glioma(61;0.222)				GTGCTCTCTCGGTGCCGGATG	0.677																																						dbGAP											0													64.0	59.0	61.0					22																	43569738		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D63487	CCDS14047.1	22q13.31	2013-02-14	2006-02-02		ENSG00000100304	ENSG00000100304		"""Tubulin tyrosine ligase-like family"""	28974	protein-coding gene	gene with protein product						15890843	Standard	NM_015140		Approved	KIAA0153	uc003bdp.3	Q14166	OTTHUMG00000150682	ENST00000216129.6:c.1324C>T	22.37:g.43569738G>A	ENSP00000216129:p.Arg442*		Q20WK5|Q9UGU3	Nonsense_Mutation	SNP	pfam_Tub_tyr_ligase	p.R442*	ENST00000216129.6	37	c.1324	CCDS14047.1	22	.	.	.	.	.	.	.	.	.	.	G	38	6.952297	0.97960	.	.	ENSG00000100304	ENST00000216129;ENST00000423379	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.928	11.8549	0.52431	0.0:0.0:0.7002:0.2998	.	.	.	.	X	442	.	ENSP00000216129:R442X	R	-	1	2	TTLL12	41899682	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	3.637000	0.54324	2.352000	0.79861	0.591000	0.81541	CGA	TTLL12	-	pfam_Tub_tyr_ligase	ENSG00000100304		0.677	TTLL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL12	HGNC	protein_coding	OTTHUMT00000319611.1	40	0.00	0	G	NM_015140		43569738	43569738	-1	no_errors	ENST00000216129	ensembl	human	known	69_37n	nonsense	16	30.43	7	SNP	1.000	A
WDR19	57728	genome.wustl.edu	37	4	39247000	39247000	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chr4:39247000G>T	ENST00000399820.3	+	24	2811	c.2657G>T	c.(2656-2658)gGt>gTt	p.G886V	WDR19_ENST00000288634.7_Missense_Mutation_p.G726V	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	886					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						GCAAAAGTTGGTGATCTTCTG	0.423																																						dbGAP											0													82.0	81.0	81.0					4																	39247000		1884	4113	5997	-	-	-	SO:0001583	missense	0			AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.2657G>T	4.37:g.39247000G>T	ENSP00000382717:p.Gly886Val		B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.G886V	ENST00000399820.3	37	c.2657	CCDS47042.1	4	.	.	.	.	.	.	.	.	.	.	G	23.7	4.446402	0.84101	.	.	ENSG00000157796	ENST00000399820;ENST00000288634	T;T	0.73469	-0.75;-0.75	5.73	5.73	0.89815	Tetratricopeptide-like helical (1);	0.045134	0.85682	D	0.000000	D	0.86331	0.5907	M	0.84683	2.71	0.80722	D	1	D	0.62365	0.991	D	0.64877	0.93	T	0.82617	-0.0369	10	0.14252	T	0.57	-22.0432	19.8966	0.96963	0.0:0.0:1.0:0.0	.	886	Q8NEZ3	WDR19_HUMAN	V	886;726	ENSP00000382717:G886V;ENSP00000288634:G726V	ENSP00000288634:G726V	G	+	2	0	WDR19	38923395	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.721000	0.74728	2.700000	0.92200	0.655000	0.94253	GGT	WDR19	-	NULL	ENSG00000157796		0.423	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR19	HGNC	protein_coding	OTTHUMT00000360689.1	175	0.00	0	G			39247000	39247000	+1	no_errors	ENST00000399820	ensembl	human	known	69_37n	missense	65	26.97	24	SNP	1.000	T
YIPF6	286451	genome.wustl.edu	37	X	67718953	67718953	+	Silent	SNP	G	G	A			TCGA-AN-A0FK-01A-11W-A050-09	TCGA-AN-A0FK-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a765959e-b234-427d-aade-855d6d4981d9	779c84bb-5769-4fca-ad11-fd743808c144	g.chrX:67718953G>A	ENST00000462683.1	+	1	789	c.45G>A	c.(43-45)tcG>tcA	p.S15S	YIPF6_ENST00000470730.1_3'UTR|YIPF6_ENST00000374622.2_Silent_p.S15S	NM_173834.3	NP_776195.2	Q96EC8	YIPF6_HUMAN	Yip1 domain family, member 6	15					intestinal epithelial cell development (GO:0060576)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(1)	7						GGACAGCATCGCCCAGGCCCC	0.662																																						dbGAP											0													31.0	30.0	30.0					X																	67718953		2183	4279	6462	-	-	-	SO:0001819	synonymous_variant	0			BC012469	CCDS14389.1, CCDS56604.1	Xq13.1	2008-02-05			ENSG00000181704	ENSG00000181704		"""Yip1 domain family"""	28304	protein-coding gene	gene with protein product						12477932	Standard	NM_173834		Approved	MGC21416, FinGER6	uc004dwz.3	Q96EC8	OTTHUMG00000021745	ENST00000462683.1:c.45G>A	X.37:g.67718953G>A			B4E1U7|G5E997|Q5JP08	Silent	SNP	pfam_Yip1	p.S15	ENST00000462683.1	37	c.45	CCDS14389.1	X																																																																																			YIPF6	-	NULL	ENSG00000181704		0.662	YIPF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YIPF6	HGNC	protein_coding	OTTHUMT00000057016.1	201	0.00	0	G	NM_173834		67718953	67718953	+1	no_errors	ENST00000462683	ensembl	human	known	69_37n	silent	223	18.61	51	SNP	0.030	A
