#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AARSD1	80755	genome.wustl.edu	37	17	41113324	41113324	+	Silent	SNP	C	C	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr17:41113324C>G	ENST00000427569.2	-	3	251	c.216G>C	c.(214-216)gtG>gtC	p.V72V	PTGES3L-AARSD1_ENST00000409399.1_Silent_p.V246V|PTGES3L-AARSD1_ENST00000360221.4_Silent_p.V185V|PTGES3L-AARSD1_ENST00000421990.2_Silent_p.V246V|PTGES3L-AARSD1_ENST00000409103.1_Silent_p.V155V|AARSD1_ENST00000416949.1_5'UTR	NM_001261434.1	NP_001248363.1	Q9BTE6	AASD1_HUMAN	alanyl-tRNA synthetase domain containing 1	72					alanyl-tRNA aminoacylation (GO:0006419)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	alanine-tRNA ligase activity (GO:0004813)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|Ser-tRNA(Ala) hydrolase activity (GO:0002196)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|skin(1)	17		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		CACGGCGAGTCACTCTCAGCA	0.527																																						dbGAP											0													141.0	112.0	122.0					17																	41113324		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC004172	CCDS11447.1, CCDS45691.1, CCDS58552.1	17q21.31	2012-10-05			ENSG00000266967	ENSG00000266967			28417	protein-coding gene	gene with protein product		613212					Standard	NM_001261434		Approved	MGC2744		Q9BTE6	OTTHUMG00000153515	ENST00000427569.2:c.216G>C	17.37:g.41113324C>G			B4DI73	Missense_Mutation	SNP	pfam_Ala-tRNA-synth_IIc_N,superfamily_HSP20-like_chaperone	p.D175H	ENST00000427569.2	37	c.523	CCDS58552.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.249|7.249	0.602748|0.602748	0.13939|0.13939	.|.	.|.	ENSG00000108825|ENSG00000108825	ENST00000452752|ENST00000441280;ENST00000430739	.|.	.|.	.|.	4.18|4.18	3.22|3.22	0.36961|0.36961	.|.	.|.	.|.	.|.	.|.	T|.	0.29321|.	0.0730|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.29882|.	-0.9997|.	3|.	.|.	.|.	.|.	-18.5295|-18.5295	1.6021|1.6021	0.02676|0.02676	0.1524:0.422:0.2401:0.1855|0.1524:0.422:0.2401:0.1855	.|.	.|.	.|.	.|.	H|S	175|78	.|.	.|.	D|X	-|-	1|2	0|2	AARSD1|AARSD1	38366850|38366850	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.806000|0.806000	0.45545|0.45545	0.555000|0.555000	0.23422|0.23422	0.975000|0.975000	0.38392|0.38392	0.542000|0.542000	0.68232|0.68232	GAC|TGA	AARSD1	-	pfam_Ala-tRNA-synth_IIc_N	ENSG00000108825		0.527	AARSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AARSD1	HGNC	protein_coding	OTTHUMT00000467729.1	116	0.00	0	C	NM_001261434		41113324	41113324	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000452752	ensembl	human	putative	69_37n	missense	87	10.31	10	SNP	1.000	G
ABCA12	26154	genome.wustl.edu	37	2	215831626	215831626	+	Silent	SNP	G	G	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr2:215831626G>A	ENST00000272895.7	-	39	6049	c.5830C>T	c.(5830-5832)Ctg>Ttg	p.L1944L	ABCA12_ENST00000389661.4_Silent_p.L1626L	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1944					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AAATTATTCAGGCTGTTGAGG	0.378																																					Ovarian(66;664 1488 5121 34295)	dbGAP											0													188.0	167.0	174.0					2																	215831626		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.5830C>T	2.37:g.215831626G>A			Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L1944	ENST00000272895.7	37	c.5830	CCDS33372.1	2																																																																																			ABCA12	-	NULL	ENSG00000144452		0.378	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	262	0.00	0	G	NM_173076		215831626	215831626	-1	no_errors	ENST00000272895	ensembl	human	known	69_37n	silent	190	16.67	38	SNP	1.000	A
ABCA13	154664	genome.wustl.edu	37	7	48349591	48349591	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr7:48349591G>T	ENST00000435803.1	+	24	9393	c.9369G>T	c.(9367-9369)caG>caT	p.Q3123H		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3123					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						AGTGTGATCAGGAAATCCTTC	0.473																																						dbGAP											0													128.0	123.0	125.0					7																	48349591		1934	4154	6088	-	-	-	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.9369G>T	7.37:g.48349591G>T	ENSP00000411096:p.Gln3123His		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Q3123H	ENST00000435803.1	37	c.9369	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	G	9.865	1.197269	0.22037	.	.	ENSG00000179869	ENST00000435803	D	0.85861	-2.04	5.59	-6.82	0.01698	.	3.220880	0.01435	N	0.014884	T	0.72374	0.3452	N	0.19112	0.55	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.61038	-0.7143	10	0.62326	D	0.03	.	5.5406	0.17036	0.628:0.0914:0.1876:0.0929	.	825;3123	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	H	3123	ENSP00000411096:Q3123H	ENSP00000411096:Q3123H	Q	+	3	2	ABCA13	48320137	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.749000	0.04813	-2.203000	0.00744	-1.961000	0.00478	CAG	ABCA13	-	NULL	ENSG00000179869		0.473	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	199	0.00	0	G	NM_152701		48349591	48349591	+1	no_errors	ENST00000435803	ensembl	human	known	69_37n	missense	177	14.42	30	SNP	0.000	T
ACTN2	88	genome.wustl.edu	37	1	236925894	236925894	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr1:236925894C>A	ENST00000366578.4	+	21	2826	c.2660C>A	c.(2659-2661)gCa>gAa	p.A887E	ACTN2_ENST00000546208.1_Missense_Mutation_p.A381E|ACTN2_ENST00000542672.1_Missense_Mutation_p.A887E	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	887					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TTCTCTTCCGCACTCTACGGG	0.547																																						dbGAP											0													57.0	47.0	51.0					1																	236925894		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.2660C>A	1.37:g.236925894C>A	ENSP00000355537:p.Ala887Glu		B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,pfscan_CH-domain,pfscan_EF_HAND_2	p.A887E	ENST00000366578.4	37	c.2660	CCDS1613.1	1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.970580	0.74246	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000546208;ENST00000545611	T;T;T	0.44482	0.92;0.92;0.92	5.43	5.43	0.79202	EF-hand, Ca insensitive (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.72875	0.3515	M	0.90595	3.13	0.80722	D	1	D;P;D;D	0.76494	0.999;0.89;0.999;0.991	D;P;D;D	0.91635	0.999;0.733;0.999;0.993	T	0.78460	-0.2195	10	0.87932	D	0	.	19.6166	0.95636	0.0:1.0:0.0:0.0	.	672;887;657;887	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	E	887;887;381;656	ENSP00000443495:A887E;ENSP00000355537:A887E;ENSP00000438384:A381E	ENSP00000355537:A887E	A	+	2	0	ACTN2	234992517	1.000000	0.71417	0.303000	0.25071	0.147000	0.21601	7.672000	0.83956	2.721000	0.93114	0.655000	0.94253	GCA	ACTN2	-	pfam_EF-hand_Ca_insen	ENSG00000077522		0.547	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACTN2	HGNC	protein_coding	OTTHUMT00000096628.1	53	0.00	0	C	NM_001103		236925894	236925894	+1	no_errors	ENST00000366578	ensembl	human	known	69_37n	missense	68	24.44	22	SNP	1.000	A
ACTN4	81	genome.wustl.edu	37	19	39205151	39205151	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr19:39205151delA	ENST00000252699.2	+	9	938	c.862delA	c.(862-864)aacfs	p.N288fs	ACTN4_ENST00000390009.3_Frame_Shift_Del_p.N69fs|ACTN4_ENST00000424234.2_Intron	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	288					actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GCTGGCTGTCAACCAAGAGAA	0.617																																					Colon(168;199 1940 10254 46213 46384)	dbGAP											0													94.0	76.0	82.0					19																	39205151		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.862delA	19.37:g.39205151delA	ENSP00000252699:p.Asn288fs		A4K467|D6PXK4|O76048	Frame_Shift_Del	DEL	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,pfscan_CH-domain,pfscan_EF_HAND_2	p.N288fs	ENST00000252699.2	37	c.862	CCDS12518.1	19																																																																																			ACTN4	-	NULL	ENSG00000130402		0.617	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	HGNC	protein_coding	OTTHUMT00000268091.1	54	0.00	0	A			39205151	39205151	+1	no_errors	ENST00000252699	ensembl	human	known	69_37n	frame_shift_del	59	13.24	9	DEL	1.000	-
ANKK1	255239	genome.wustl.edu	37	11	113269799	113269799	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr11:113269799G>A	ENST00000303941.3	+	8	1202	c.1108G>A	c.(1108-1110)Gtg>Atg	p.V370M		NM_178510.1	NP_848605.1	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	370							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|stomach(1)	29		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		CCACTTCCTGGTGGCCCAGGG	0.612																																						dbGAP											0													34.0	36.0	36.0					11																	113269799		2018	4182	6200	-	-	-	SO:0001583	missense	0			AJ541797	CCDS44734.1	11q23.2	2013-01-10			ENSG00000170209	ENSG00000170209		"""Ankyrin repeat domain containing"""	21027	protein-coding gene	gene with protein product		608774				15146457	Standard	NM_178510		Approved	X-kinase	uc001pny.3	Q8NFD2	OTTHUMG00000167715	ENST00000303941.3:c.1108G>A	11.37:g.113269799G>A	ENSP00000306678:p.Val370Met			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V370M	ENST00000303941.3	37	c.1108	CCDS44734.1	11	.	.	.	.	.	.	.	.	.	.	G	12.09	1.834653	0.32421	.	.	ENSG00000170209	ENST00000303941	T	0.67171	-0.25	4.69	3.77	0.43336	Ankyrin repeat-containing domain (4);	0.116735	0.36268	N	0.002682	T	0.79323	0.4426	M	0.66378	2.025	0.42668	D	0.993503	D	0.89917	1.0	D	0.85130	0.997	T	0.81611	-0.0854	10	0.62326	D	0.03	-27.1612	14.1495	0.65373	0.0:0.1507:0.8493:0.0	.	370	Q8NFD2	ANKK1_HUMAN	M	370	ENSP00000306678:V370M	ENSP00000306678:V370M	V	+	1	0	ANKK1	112775009	1.000000	0.71417	0.999000	0.59377	0.030000	0.12068	0.718000	0.25866	1.161000	0.42604	0.455000	0.32223	GTG	ANKK1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000170209		0.612	ANKK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKK1	HGNC	protein_coding	OTTHUMT00000395830.1	73	0.00	0	G	NM_178510		113269799	113269799	+1	no_errors	ENST00000303941	ensembl	human	known	69_37n	missense	60	18.92	14	SNP	1.000	A
ARHGAP40	343578	genome.wustl.edu	37	20	37267927	37267927	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr20:37267927G>T	ENST00000373345.4	+	9	1186	c.1018G>T	c.(1018-1020)Gtt>Ttt	p.V340F		NM_001164431.1	NP_001157903.1	Q5TG30	RHG40_HUMAN	Rho GTPase activating protein 40	340	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)	1						CTGGGACGAGGTTCATCACAA	0.567																																						dbGAP											0													121.0	111.0	114.0					20																	37267927		692	1591	2283	-	-	-	SO:0001583	missense	0			AL035419		20q11.23	2011-06-29	2010-04-14	2010-04-14	ENSG00000124143	ENSG00000124143		"""Rho GTPase activating proteins"""	16226	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 95"""	C20orf95			Standard	NM_001164431		Approved	dJ1100H13.4	uc021wdn.1	Q5TG30	OTTHUMG00000032453	ENST00000373345.4:c.1018G>T	20.37:g.37267927G>T	ENSP00000362442:p.Val340Phe			Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.V340F	ENST00000373345.4	37	c.1018		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.38|18.38	3.611122|3.611122	0.66558|0.66558	.|.	.|.	ENSG00000124143|ENSG00000124143	ENST00000243967|ENST00000373345	.|T	.|0.42131	.|0.98	4.55|4.55	3.58|3.58	0.41010|0.41010	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.51669|0.51669	0.1688|0.1688	M|M	0.67397|0.67397	2.05|2.05	0.45015|0.45015	D|D	0.998036|0.998036	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.47983|0.47983	-0.9074|-0.9074	5|8	.|0.36615	.|T	.|0.2	.|.	11.7077|11.7077	0.51607|0.51607	0.0:0.0:0.8218:0.1781|0.0:0.0:0.8218:0.1781	.|.	.|.	.|.	.|.	V|F	280|340	.|ENSP00000362442:V340F	.|ENSP00000362442:V340F	G|V	+|+	2|1	0|0	ARHGAP40|ARHGAP40	36701341|36701341	1.000000|1.000000	0.71417|0.71417	0.349000|0.349000	0.25694|0.25694	0.678000|0.678000	0.39670|0.39670	5.832000|5.832000	0.69337|0.69337	0.903000|0.903000	0.36546|0.36546	0.563000|0.563000	0.77884|0.77884	GGT|GTT	ARHGAP40	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000124143		0.567	ARHGAP40-201	KNOWN	basic|appris_principal	protein_coding	ARHGAP40	HGNC	protein_coding		181	0.55	1	G	XM_293123		37267927	37267927	+1	no_errors	ENST00000373345	ensembl	human	known	69_37n	missense	145	34.09	75	SNP	1.000	T
ATM	472	genome.wustl.edu	37	11	108106472	108106472	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr11:108106472delT	ENST00000452508.2	+	6	596	c.407delT	c.(406-408)attfs	p.I136fs	ATM_ENST00000278616.4_Frame_Shift_Del_p.I136fs			Q13315	ATM_HUMAN	ATM serine/threonine kinase	136					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AATGGTGCTATTTACGGAGCT	0.333			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												dbGAP	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													189.0	189.0	189.0					11																	108106472		2201	4298	6499	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.407delT	11.37:g.108106472delT	ENSP00000388058:p.Ile136fs		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Frame_Shift_Del	DEL	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.Y137fs	ENST00000452508.2	37	c.407	CCDS31669.1	11																																																																																			ATM	-	pfam_TAN	ENSG00000149311		0.333	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	302	0.00	0	T	NM_000051		108106472	108106472	+1	no_errors	ENST00000278616	ensembl	human	known	69_37n	frame_shift_del	189	11.16	24	DEL	0.013	-
ATXN7L1	222255	genome.wustl.edu	37	7	105254792	105254792	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr7:105254792C>G	ENST00000419735.3	-	10	2034	c.1989G>C	c.(1987-1989)caG>caC	p.Q663H	ATXN7L1_ENST00000388807.4_Missense_Mutation_p.Q323H|ATXN7L1_ENST00000477775.1_Missense_Mutation_p.Q539H	NM_020725.1	NP_065776.1	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1	663	Ser-rich.									endometrium(1)|large_intestine(4)|lung(5)	10						AGAGGGATGTCTGCAaggaag	0.517																																						dbGAP											0													176.0	137.0	149.0					7																	105254792		692	1591	2283	-	-	-	SO:0001583	missense	0			AB033044	CCDS34727.1, CCDS47682.1, CCDS47683.1	7q22.1	2007-11-13			ENSG00000146776	ENSG00000146776			22210	protein-coding gene	gene with protein product			"""ataxin 7-like 4"""	ATXN7L4		15115762	Standard	NM_152749		Approved	KIAA1218, MGC33190	uc003vde.2	Q9ULK2	OTTHUMG00000157521	ENST00000419735.3:c.1989G>C	7.37:g.105254792C>G	ENSP00000410759:p.Gln663His		A4D0Q2|B4DTS1|Q8N2T0	Missense_Mutation	SNP	pfam_SCA7_dom	p.Q663H	ENST00000419735.3	37	c.1989	CCDS47682.1	7	.	.	.	.	.	.	.	.	.	.	C	15.53	2.862095	0.51482	.	.	ENSG00000146776	ENST00000419735;ENST00000477775;ENST00000484475;ENST00000388807;ENST00000472195	T;T;T;T;T	0.20069	2.43;2.43;2.1;2.1;2.45	5.59	4.66	0.58398	.	0.270975	0.31963	N	0.006785	T	0.17365	0.0417	N	0.22421	0.69	0.36101	D	0.844162	P;P;P	0.52692	0.826;0.955;0.61	B;P;B	0.47251	0.259;0.542;0.191	T	0.04855	-1.0922	10	0.09590	T	0.72	.	15.2792	0.73767	0.1407:0.8593:0.0:0.0	.	549;539;663	A4D0Q3;Q9ULK2-3;Q9ULK2	.;.;AT7L1_HUMAN	H	663;539;364;323;539	ENSP00000410759:Q663H;ENSP00000418476:Q539H;ENSP00000418900:Q364H;ENSP00000373459:Q323H;ENSP00000419566:Q539H	ENSP00000373459:Q323H	Q	-	3	2	ATXN7L1	105042028	1.000000	0.71417	0.787000	0.31911	0.826000	0.46750	3.700000	0.54786	2.625000	0.88918	0.655000	0.94253	CAG	ATXN7L1	-	NULL	ENSG00000146776		0.517	ATXN7L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN7L1	HGNC	protein_coding	OTTHUMT00000349037.2	358	0.00	0	C			105254792	105254792	-1	no_errors	ENST00000419735	ensembl	human	known	69_37n	missense	243	16.49	48	SNP	1.000	G
BABAM1	29086	genome.wustl.edu	37	19	17379746	17379746	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr19:17379746G>T	ENST00000359435.4	+	2	324	c.131G>T	c.(130-132)aGc>aTc	p.S44I	BABAM1_ENST00000598188.1_Missense_Mutation_p.S44I|CTD-2278I10.6_ENST00000596542.1_5'UTR|BABAM1_ENST00000595632.1_Missense_Mutation_p.S44I|BABAM1_ENST00000448635.2_3'UTR|BABAM1_ENST00000447614.2_Missense_Mutation_p.S44I|BABAM1_ENST00000601043.1_Missense_Mutation_p.S44I	NM_001033549.1	NP_001028721.1	Q9NWV8	BABA1_HUMAN	BRISC and BRCA1 A complex member 1	44					chromatin modification (GO:0016568)|double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5						GCACAGGCCAGCGTGGGCAGC	0.682																																						dbGAP											0													8.0	14.0	12.0					19																	17379746		1988	4145	6133	-	-	-	SO:0001583	missense	0			AK000578	CCDS46012.1, CCDS74310.1	19p13.11	2011-02-21	2011-02-21	2011-01-31	ENSG00000105393	ENSG00000105393			25008	protein-coding gene	gene with protein product	"""Mediator of Rap80 Interactions and Targeting 40 kD"", ""new component of the BRCA1 A complex"""	612766	"""chromosome 19 open reading frame 62"""	C19orf62		11042152	Standard	NM_001288756		Approved	FLJ20571, HSPC142, NBA1, MERIT40	uc002nfv.3	Q9NWV8		ENST00000359435.4:c.131G>T	19.37:g.17379746G>T	ENSP00000352408:p.Ser44Ile		A8MQT0|B4DRY9|B4DVR1|Q6FIA0|Q9P018	Missense_Mutation	SNP	NULL	p.S44I	ENST00000359435.4	37	c.131	CCDS46012.1	19	.	.	.	.	.	.	.	.	.	.	G	12.52	1.963184	0.34659	.	.	ENSG00000105393	ENST00000359435;ENST00000447614;ENST00000448635	.	.	.	5.08	0.472	0.16758	.	0.249259	0.40908	D	0.000983	T	0.22859	0.0552	L	0.36672	1.1	0.23528	N	0.99748	B;B	0.32526	0.374;0.062	B;B	0.29267	0.1;0.071	T	0.11817	-1.0572	9	0.54805	T	0.06	-3.0372	6.6682	0.23054	0.2065:0.1353:0.6583:0.0	.	44;44	Q9NWV8-3;Q9NWV8	.;BABA1_HUMAN	I	44	.	ENSP00000352408:S44I	S	+	2	0	BABAM1	17240746	0.965000	0.33210	0.105000	0.21289	0.117000	0.20001	1.831000	0.39141	0.043000	0.15746	-0.175000	0.13238	AGC	BABAM1	-	NULL	ENSG00000105393		0.682	BABAM1-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	BABAM1	HGNC	protein_coding	OTTHUMT00000463471.1	33	0.00	0	G	NM_014173		17379746	17379746	+1	no_errors	ENST00000359435	ensembl	human	known	69_37n	missense	20	45.95	17	SNP	0.326	T
BCL11A	53335	genome.wustl.edu	37	2	60689460	60689460	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr2:60689460C>G	ENST00000335712.6	-	4	814	c.587G>C	c.(586-588)aGa>aCa	p.R196T	BCL11A_ENST00000538214.1_Missense_Mutation_p.R162T|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000358510.4_Missense_Mutation_p.R162T|BCL11A_ENST00000359629.5_Missense_Mutation_p.R196T|BCL11A_ENST00000356842.4_Missense_Mutation_p.R196T|BCL11A_ENST00000537768.1_Missense_Mutation_p.R44T	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	196	Required for nuclear body formation and for SUMO1 recruitment. {ECO:0000250}.				B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			TAAGTAGATTCTTAATCCATG	0.512			T	IGH@	B-CLL																																	dbGAP		Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	0													98.0	97.0	97.0					2																	60689460		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.587G>C	2.37:g.60689460C>G	ENSP00000338774:p.Arg196Thr		D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R196T	ENST00000335712.6	37	c.587	CCDS1862.1	2	.	.	.	.	.	.	.	.	.	.	C	27.7	4.851633	0.91355	.	.	ENSG00000119866	ENST00000356842;ENST00000359629;ENST00000378117;ENST00000538214;ENST00000537768;ENST00000335712;ENST00000358510	T;T;T;T;T;T	0.61742	2.76;0.08;3.04;0.08;0.08;2.99	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.77075	0.4077	M	0.72118	2.19	0.37143	D	0.90178	D;D;D;D;D;D	0.89917	0.999;0.967;0.981;1.0;0.996;1.0	D;P;D;D;D;D	0.91635	0.999;0.879;0.943;0.999;0.99;0.999	T	0.79754	-0.1670	10	0.59425	D	0.04	-2.0884	20.0332	0.97547	0.0:1.0:0.0:0.0	.	162;44;162;196;196;196	F5H2Y4;B4DT16;Q9H165-6;Q9H165;Q9H165-3;D9YZV9	.;.;.;BC11A_HUMAN;.;.	T	196;196;232;162;44;196;162	ENSP00000349300:R196T;ENSP00000352648:R196T;ENSP00000438303:R162T;ENSP00000443712:R44T;ENSP00000338774:R196T;ENSP00000351307:R162T	ENSP00000338774:R196T	R	-	2	0	BCL11A	60542964	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.747000	0.85070	2.749000	0.94314	0.491000	0.48974	AGA	BCL11A	-	NULL	ENSG00000119866		0.512	BCL11A-001	KNOWN	basic|CCDS	protein_coding	BCL11A	HGNC	protein_coding	OTTHUMT00000251579.2	97	0.00	0	C	NM_022893		60689460	60689460	-1	no_errors	ENST00000335712	ensembl	human	known	69_37n	missense	72	25.00	24	SNP	1.000	G
C12orf36	283422	genome.wustl.edu	37	12	13529254	13529254	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr12:13529254T>C	ENST00000318426.2	-	2	303	c.86A>G	c.(85-87)gAc>gGc	p.D29G	C12orf36_ENST00000531049.1_5'UTR|C12orf36_ENST00000532841.1_Missense_Mutation_p.D29G|C12orf36_ENST00000527705.2_Missense_Mutation_p.D29G|C12orf36_ENST00000539026.1_Missense_Mutation_p.D29G					chromosome 12 open reading frame 36											lung(3)|skin(3)	6				BRCA - Breast invasive adenocarcinoma(232;0.198)		gcatgaagtgtcttcatcagg	0.473																																						dbGAP											0													96.0	94.0	95.0					12																	13529254		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091129		12p13.1	2012-08-14			ENSG00000180861	ENSG00000180861			26598	protein-coding gene	gene with protein product							Standard	NR_036555		Approved	FLJ33810	uc001rbs.2	Q495D7	OTTHUMG00000167562	ENST00000318426.2:c.86A>G	12.37:g.13529254T>C	ENSP00000443007:p.Asp29Gly			Missense_Mutation	SNP	NULL	p.D29G	ENST00000318426.2	37	c.86		12	.	.	.	.	.	.	.	.	.	.	T	5.670	0.308260	0.10733	.	.	ENSG00000180861	ENST00000318426;ENST00000527705;ENST00000539026;ENST00000532841	T;T;T;T	0.59772	1.46;1.46;0.35;0.24	2.58	2.58	0.30949	.	.	.	.	.	T	0.68550	0.3013	.	.	.	0.09310	N	1	D	0.76494	0.999	D	0.65684	0.937	T	0.54997	-0.8209	8	0.87932	D	0	.	7.0546	0.25091	0.0:0.0:0.0:1.0	.	29	Q495D7	CL036_HUMAN	G	29	ENSP00000443007:D29G;ENSP00000443346:D29G;ENSP00000445251:D29G;ENSP00000440159:D29G	ENSP00000443007:D29G	D	-	2	0	C12orf36	13420521	0.005000	0.15991	0.008000	0.14137	0.013000	0.08279	1.263000	0.33004	1.434000	0.47414	0.379000	0.24179	GAC	C12orf36	-	NULL	ENSG00000180861		0.473	C12orf36-001	KNOWN	basic|appris_candidate_longest	protein_coding	C12orf36	HGNC	protein_coding	OTTHUMT00000395025.2	155	0.00	0	T	NM_182558		13529254	13529254	-1	no_errors	ENST00000318426	ensembl	human	known	69_37n	missense	172	11.79	23	SNP	0.009	C
ATP11AUN	400165	genome.wustl.edu	37	13	113333794	113333794	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr13:113333794A>G	ENST00000356049.1	+	2	859	c.101A>G	c.(100-102)aAg>aGg	p.K34R		NM_207440.1	NP_997323.1	Q6ZP68	ATPUN_HUMAN		34										breast(1)|lung(2)|ovary(1)|prostate(1)	5	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)		all cancers(43;0.201)			TCTTCCCTGAAGATGGACCCG	0.607																																						dbGAP											0													40.0	41.0	41.0					13																	113333794		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000356049.1:c.101A>G	13.37:g.113333794A>G	ENSP00000348337:p.Lys34Arg			Missense_Mutation	SNP	NULL	p.K34R	ENST00000356049.1	37	c.101	CCDS9526.1	13	.	.	.	.	.	.	.	.	.	.	A	8.878	0.950896	0.18431	.	.	ENSG00000197595	ENST00000356049	.	.	.	1.23	0.0102	0.14082	.	.	.	.	.	T	0.08802	0.0218	N	0.08118	0	0.09310	N	1	P	0.44344	0.833	B	0.32022	0.139	T	0.19451	-1.0305	8	0.87932	D	0	.	2.9219	0.05772	0.6982:0.0:0.3018:0.0	.	34	Q6ZP68	CM035_HUMAN	R	34	.	ENSP00000348337:K34R	K	+	2	0	C13orf35	112381795	0.001000	0.12720	0.001000	0.08648	0.005000	0.04900	0.542000	0.23222	-0.013000	0.14199	0.379000	0.24179	AAG	C13orf35	-	NULL	ENSG00000197595		0.607	C13orf35-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	C13orf35	HGNC	protein_coding	OTTHUMT00000126522.2	37	0.00	0	A			113333794	113333794	+1	no_errors	ENST00000356049	ensembl	human	putative	69_37n	missense	57	20.83	15	SNP	0.001	G
CACNA1S	779	genome.wustl.edu	37	1	201079345	201079345	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr1:201079345C>A	ENST00000362061.3	-	2	431	c.205G>T	c.(205-207)Gcc>Tcc	p.A69S	CACNA1S_ENST00000367338.3_Missense_Mutation_p.A69S	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	69			A -> G (in dbSNP:rs12406479).		axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGGTACACGGCCAGGGCCACA	0.582																																						dbGAP											0													164.0	128.0	140.0					1																	201079345		2203	4300	6503	-	-	-	SO:0001583	missense	0			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.205G>T	1.37:g.201079345C>A	ENSP00000355192:p.Ala69Ser		A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_VDCC_L_a1ssu	p.A69S	ENST00000362061.3	37	c.205	CCDS1407.1	1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.969546	0.92855	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	T;T	0.74421	-0.84;-0.84	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.88089	0.6343	M	0.87827	2.91	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.90395	0.4398	10	0.87932	D	0	.	17.9499	0.89050	0.0:1.0:0.0:0.0	.	69	Q13698	CAC1S_HUMAN	S	69	ENSP00000355192:A69S;ENSP00000356307:A69S	ENSP00000355192:A69S	A	-	1	0	CACNA1S	199345968	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	7.400000	0.79949	2.388000	0.81334	0.561000	0.74099	GCC	CACNA1S	-	NULL	ENSG00000081248		0.582	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	HGNC	protein_coding	OTTHUMT00000087049.1	114	0.00	0	C	NM_000069		201079345	201079345	-1	no_errors	ENST00000362061	ensembl	human	known	69_37n	missense	139	31.19	63	SNP	1.000	A
CCDC126	90693	genome.wustl.edu	37	7	23682551	23682551	+	Splice_Site	SNP	G	G	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr7:23682551G>A	ENST00000307471.3	+	4	697	c.240G>A	c.(238-240)gcG>gcA	p.A80A	CCDC126_ENST00000410069.1_Splice_Site_p.A80A|CCDC126_ENST00000409765.1_Splice_Site_p.A80A	NM_138771.3	NP_620126.2	Q96EE4	CC126_HUMAN	coiled-coil domain containing 126	80					protein N-linked glycosylation (GO:0006487)	extracellular region (GO:0005576)|membrane (GO:0016020)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(3)|kidney(1)|large_intestine(1)|ovary(1)|skin(1)	7						TTCCCCTAGCGGATCTGAAAA	0.368																																						dbGAP											0													79.0	80.0	80.0					7																	23682551		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC012427	CCDS5384.1	7p15.3	2006-08-15			ENSG00000169193	ENSG00000169193			22398	protein-coding gene	gene with protein product						12477932	Standard	NM_138771		Approved	FLJ23031	uc003swl.3	Q96EE4	OTTHUMG00000128461	ENST00000307471.3:c.239-1G>A	7.37:g.23682551G>A			A8K1J6|Q6UWP1|Q75MQ6	Silent	SNP	NULL	p.A80	ENST00000307471.3	37	c.240	CCDS5384.1	7																																																																																			CCDC126	-	NULL	ENSG00000169193		0.368	CCDC126-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC126	HGNC	protein_coding	OTTHUMT00000250259.1	148	0.00	0	G	NM_138771	Silent	23682551	23682551	+1	no_errors	ENST00000307471	ensembl	human	known	69_37n	silent	78	30.97	35	SNP	1.000	A
CSMD1	64478	genome.wustl.edu	37	8	3000129	3000129	+	Silent	SNP	T	T	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr8:3000129T>G	ENST00000520002.1	-	42	6657	c.6102A>C	c.(6100-6102)ggA>ggC	p.G2034G	CSMD1_ENST00000400186.3_Silent_p.G2034G|CSMD1_ENST00000602723.1_Silent_p.G2034G|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000542608.1_Silent_p.G2033G|CSMD1_ENST00000539096.1_Silent_p.G2033G|CSMD1_ENST00000602557.1_Silent_p.G2034G|CSMD1_ENST00000537824.1_Silent_p.G2033G			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2034	CUB 12. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGTGGTAAGGTCCATTTTGAA	0.438																																						dbGAP											0													146.0	149.0	148.0					8																	3000129		1902	4110	6012	-	-	-	SO:0001819	synonymous_variant	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6102A>C	8.37:g.3000129T>G			Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,smart_CUB,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.T1514P	ENST00000520002.1	37	c.4540		8	.	.	.	.	.	.	.	.	.	.	T	0.404	-0.917033	0.02415	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.24	-10.5	0.00291	.	.	.	.	.	T	0.54447	0.1859	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74931	-0.3496	4	.	.	.	.	11.4686	0.50254	0.0642:0.2881:0.5309:0.1168	.	.	.	.	P	1514	.	.	T	-	1	0	CSMD1	2987536	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	-2.493000	0.00972	-5.421000	0.00015	-0.435000	0.05868	ACC	CSMD1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000183117		0.438	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	245	0.41	1	T	NM_033225		3000129	3000129	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000335551	ensembl	human	novel	69_37n	missense	145	19.89	36	SNP	0.001	G
CWF19L1	55280	genome.wustl.edu	37	10	102003460	102003460	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr10:102003460T>C	ENST00000354105.4	-	10	1125	c.1039A>G	c.(1039-1041)Aca>Gca	p.T347A	CWF19L1_ENST00000370379.1_Missense_Mutation_p.T102A|CWF19L1_ENST00000478047.1_Intron	NM_018294.4	NP_060764.3	Q69YN2	C19L1_HUMAN	CWF19-like 1, cell cycle control (S. pombe)	347							catalytic activity (GO:0003824)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|stomach(2)	17		Colorectal(252;0.117)		Epithelial(162;3.78e-10)|all cancers(201;3.1e-08)		CTCACATGTGTGCCGATGTTG	0.408																																						dbGAP											0													239.0	232.0	234.0					10																	102003460		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001860	CCDS7489.1	10q24.31	2008-11-24			ENSG00000095485	ENSG00000095485			25613	protein-coding gene	gene with protein product						14702039	Standard	NM_018294		Approved	FLJ10998	uc001kqq.1	Q69YN2	OTTHUMG00000018901	ENST00000354105.4:c.1039A>G	10.37:g.102003460T>C	ENSP00000326411:p.Thr347Ala		B4DHX1|D3DR66|Q5W0I3|Q96HC3|Q9H865|Q9NV13	Missense_Mutation	SNP	pfam_Cwf19-like_C_dom-1,pfam_Cwf19-like_C_dom-2,superfamily_HIT-like	p.T347A	ENST00000354105.4	37	c.1039	CCDS7489.1	10	.	.	.	.	.	.	.	.	.	.	T	13.64	2.297335	0.40694	.	.	ENSG00000095485	ENST00000354105;ENST00000370379	T;T	0.24151	2.26;1.87	5.77	4.62	0.57501	Histidine triad motif (1);Histidine triad-like motif (1);Cwf19-like, C-terminal domain-1 (1);	0.149974	0.64402	D	0.000012	T	0.20820	0.0501	L	0.56199	1.76	0.42803	D	0.993936	B;P;B	0.43826	0.05;0.818;0.367	B;B;B	0.40702	0.061;0.311;0.338	T	0.08513	-1.0718	10	0.13470	T	0.59	-11.7379	6.0933	0.20007	0.0:0.0816:0.1655:0.7529	.	51;210;347	Q69YN2-2;Q69YN2-3;Q69YN2	.;.;C19L1_HUMAN	A	347;102	ENSP00000326411:T347A;ENSP00000359405:T102A	ENSP00000326411:T347A	T	-	1	0	CWF19L1	101993450	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	3.736000	0.55052	0.990000	0.38787	0.533000	0.62120	ACA	CWF19L1	-	pfam_Cwf19-like_C_dom-1,superfamily_HIT-like	ENSG00000095485		0.408	CWF19L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CWF19L1	HGNC	protein_coding		176	0.00	0	T	NM_018294		102003460	102003460	-1	no_errors	ENST00000354105	ensembl	human	known	69_37n	missense	123	11.43	16	SNP	1.000	C
DAXX	1616	genome.wustl.edu	37	6	33288193	33288193	+	Silent	SNP	A	A	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr6:33288193A>G	ENST00000374542.5	-	4	1419	c.1215T>C	c.(1213-1215)tcT>tcC	p.S405S	ZBTB22_ENST00000418724.1_5'Flank|DAXX_ENST00000414083.2_Silent_p.S330S|DAXX_ENST00000266000.6_Silent_p.S405S|DAXX_ENST00000477162.1_5'UTR|ZBTB22_ENST00000431845.2_5'Flank	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	405	Interaction with histone H3.3.|Necessary for interaction with USP7.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						GGGTGTCTGCAGAGTGGGAAG	0.542			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																	dbGAP		Rec	yes		6	6p21.3	1616	death-domain associated protein		E	0													109.0	104.0	105.0					6																	33288193		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.1215T>C	6.37:g.33288193A>G			B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Silent	SNP	pfam_Daxx	p.S405	ENST00000374542.5	37	c.1215	CCDS4776.1	6																																																																																			DAXX	-	pfam_Daxx	ENSG00000204209		0.542	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAXX	HGNC	protein_coding	OTTHUMT00000076403.1	74	0.00	0	A			33288193	33288193	-1	no_errors	ENST00000266000	ensembl	human	known	69_37n	silent	74	16.85	15	SNP	0.003	G
DDX3X	1654	genome.wustl.edu	37	X	41204455	41204455	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chrX:41204455G>A	ENST00000399959.2	+	11	1903	c.1048G>A	c.(1048-1050)Gat>Aat	p.D350N	DDX3X_ENST00000542215.1_3'UTR|DDX3X_ENST00000457138.2_Missense_Mutation_p.D334N|DDX3X_ENST00000478993.1_3'UTR|RN7SL15P_ENST00000582825.1_RNA|DDX3X_ENST00000441189.2_Intron	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	350	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Interaction with GSK3B.|Necessary for interaction with XPO1.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						AGATGAAGCTGATCGGATGTT	0.408										HNSCC(61;0.18)																												dbGAP											0													150.0	138.0	142.0					X																	41204455		2123	4266	6389	-	-	-	SO:0001583	missense	0			U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1048G>A	X.37:g.41204455G>A	ENSP00000382840:p.Asp350Asn		A8K538|B4E3E8|O15536	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.D350N	ENST00000399959.2	37	c.1048	CCDS43931.1	X	.	.	.	.	.	.	.	.	.	.	g	34	5.397543	0.96009	.	.	ENSG00000215301	ENST00000399959;ENST00000457138	T;T	0.07444	3.19;3.19	5.5	5.5	0.81552	RNA helicase, ATP-dependent, DEAD-box, conserved site (1);DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.089674	0.85682	D	0.000000	T	0.47875	0.1469	H	0.98155	4.16	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.998;0.997;0.997	T	0.69621	-0.5096	10	0.87932	D	0	-4.9626	18.5127	0.90923	0.0:0.0:1.0:0.0	.	350;334;362;350	B4DLU5;B4E3E8;Q59GX6;O00571	.;.;.;DDX3X_HUMAN	N	350;334	ENSP00000382840:D350N;ENSP00000392494:D334N	ENSP00000382840:D350N	D	+	1	0	DDX3X	41089399	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	9.807000	0.99171	2.313000	0.78055	0.597000	0.82753	GAT	DDX3X	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000215301		0.408	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX3X	HGNC	protein_coding	OTTHUMT00000056253.1	243	0.00	0	G	NM_024005		41204455	41204455	+1	no_errors	ENST00000399959	ensembl	human	known	69_37n	missense	182	15.35	33	SNP	1.000	A
DGAT2L6	347516	genome.wustl.edu	37	X	69424916	69424916	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chrX:69424916A>G	ENST00000333026.3	+	7	1074	c.974A>G	c.(973-975)gAa>gGa	p.E325G		NM_198512.1	NP_940914.1	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	325					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(1)	12						CACAAAGTTGAATATGGCCTC	0.493																																						dbGAP											0													84.0	66.0	72.0					X																	69424916		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK129500	CCDS14397.1	Xq13.1	2008-02-05			ENSG00000184210	ENSG00000184210			23250	protein-coding gene	gene with protein product		300926				15671038	Standard	NM_198512		Approved	DC3, FLJ25989	uc004dxx.1	Q6ZPD8	OTTHUMG00000021774	ENST00000333026.3:c.974A>G	X.37:g.69424916A>G	ENSP00000328036:p.Glu325Gly		Q6IEE2	Missense_Mutation	SNP	pfam_DAGAT	p.E325G	ENST00000333026.3	37	c.974	CCDS14397.1	X	.	.	.	.	.	.	.	.	.	.	A	12.71	2.018188	0.35606	.	.	ENSG00000184210	ENST00000333026	T	0.14144	2.53	4.74	3.53	0.40419	.	0.583513	0.16922	N	0.194055	T	0.12817	0.0311	L	0.43923	1.385	0.28976	N	0.888961	B	0.24317	0.101	B	0.29942	0.109	T	0.07481	-1.0770	10	0.41790	T	0.15	-19.4262	7.875	0.29589	0.8962:0.0:0.1038:0.0	.	325	Q6ZPD8	DG2L6_HUMAN	G	325	ENSP00000328036:E325G	ENSP00000328036:E325G	E	+	2	0	DGAT2L6	69341641	0.156000	0.22821	0.956000	0.39512	0.570000	0.35934	3.386000	0.52492	1.763000	0.52060	0.486000	0.48141	GAA	DGAT2L6	-	pfam_DAGAT	ENSG00000184210		0.493	DGAT2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGAT2L6	HGNC	protein_coding	OTTHUMT00000057067.1	106	0.00	0	A	NM_198512		69424916	69424916	+1	no_errors	ENST00000333026	ensembl	human	known	69_37n	missense	62	11.43	8	SNP	0.810	G
DPYS	1807	genome.wustl.edu	37	8	105441860	105441860	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr8:105441860T>C	ENST00000351513.2	-	5	995	c.863A>G	c.(862-864)gAa>gGa	p.E288G		NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	288					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			ATGGTGCCATTCTTTATTCCA	0.483																																						dbGAP											0													151.0	119.0	129.0					8																	105441860		2203	4300	6503	-	-	-	SO:0001583	missense	0			D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.863A>G	8.37:g.105441860T>C	ENSP00000276651:p.Glu288Gly			Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.E288G	ENST00000351513.2	37	c.863	CCDS6302.1	8	.	.	.	.	.	.	.	.	.	.	T	17.63	3.436162	0.62955	.	.	ENSG00000147647	ENST00000351513	D	0.90788	-2.73	5.86	4.67	0.58626	Amidohydrolase 1 (1);	0.259655	0.42682	D	0.000663	T	0.80757	0.4684	N	0.04880	-0.145	0.35369	D	0.788873	B	0.02656	0.0	B	0.04013	0.001	T	0.78884	-0.2028	10	0.66056	D	0.02	-13.4548	13.0134	0.58743	0.0:0.0:0.1347:0.8653	.	288	Q14117	DPYS_HUMAN	G	288	ENSP00000276651:E288G	ENSP00000276651:E288G	E	-	2	0	DPYS	105511036	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	8.040000	0.89188	0.995000	0.38917	0.528000	0.53228	GAA	DPYS	-	pfam_Amidohydro_1,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000147647		0.483	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYS	HGNC	protein_coding	OTTHUMT00000380814.1	110	0.00	0	T	NM_001385		105441860	105441860	-1	no_errors	ENST00000351513	ensembl	human	known	69_37n	missense	111	28.85	45	SNP	1.000	C
EIF4A3	9775	genome.wustl.edu	37	17	78112938	78112938	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr17:78112938C>A	ENST00000269349.3	-	7	831	c.610G>T	c.(610-612)Gta>Tta	p.V204L		NM_014740.3	NP_055555.1	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A3	204	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cytokine-mediated signaling pathway (GO:0019221)|embryonic cranial skeleton morphogenesis (GO:0048701)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|mRNA binding (GO:0003729)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			TACCTGTATACATCGTAAATC	0.537																																						dbGAP											0													138.0	105.0	116.0					17																	78112938		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004386	CCDS11767.1	17q25.3	2010-02-10	2010-02-10	2006-11-27		ENSG00000141543		"""DEAD-boxes"""	18683	protein-coding gene	gene with protein product		608546	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 48"", ""eukaryotic translation initiation factor 4A, isoform 3"""	DDX48		10623621, 14730019	Standard	NM_014740		Approved	KIAA0111, EIF4AIII	uc002jxs.3	P38919		ENST00000269349.3:c.610G>T	17.37:g.78112938C>A	ENSP00000269349:p.Val204Leu		Q15033|Q6IBQ2|Q96A18	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.V204L	ENST00000269349.3	37	c.610	CCDS11767.1	17	.	.	.	.	.	.	.	.	.	.	C	13.82	2.349989	0.41599	.	.	ENSG00000141543	ENST00000269349	T	0.13538	2.58	5.52	4.55	0.56014	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.09730	0.0239	N	0.04705	-0.18	0.80722	D	1	B	0.15930	0.015	B	0.33799	0.17	T	0.18999	-1.0319	10	0.72032	D	0.01	-36.3786	11.9867	0.53151	0.0:0.9149:0.0:0.0851	.	204	P38919	IF4A3_HUMAN	L	204	ENSP00000269349:V204L	ENSP00000269349:V204L	V	-	1	0	EIF4A3	75727533	1.000000	0.71417	0.659000	0.29680	0.129000	0.20672	7.373000	0.79623	1.326000	0.45319	0.655000	0.94253	GTA	EIF4A3	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000141543		0.537	EIF4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A3	HGNC	protein_coding	OTTHUMT00000437446.1	118	0.00	0	C	NM_014740		78112938	78112938	-1	no_errors	ENST00000269349	ensembl	human	known	69_37n	missense	164	13.61	26	SNP	0.999	A
ELF3	1999	genome.wustl.edu	37	1	201984385	201984385	+	Silent	SNP	C	C	G	rs146061191		TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr1:201984385C>G	ENST00000359651.3	+	8	4242	c.1050C>G	c.(1048-1050)ctC>ctG	p.L350L	ELF3_ENST00000367283.3_Silent_p.L350L|RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000367284.5_Silent_p.L350L					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						GCCGGCGACTCGTCTACAAGT	0.552																																						dbGAP											0													85.0	86.0	86.0					1																	201984385		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.1050C>G	1.37:g.201984385C>G				Silent	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pfscan_Ets,prints_Ets	p.L350	ENST00000359651.3	37	c.1050	CCDS1419.1	1																																																																																			ELF3	-	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	ENSG00000163435		0.552	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ELF3	HGNC	protein_coding	OTTHUMT00000087360.1	103	0.00	0	C	NM_004433		201984385	201984385	+1	no_errors	ENST00000359651	ensembl	human	known	69_37n	silent	85	33.07	42	SNP	0.273	G
ENAM	10117	genome.wustl.edu	37	4	71500244	71500244	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr4:71500244C>A	ENST00000396073.3	+	6	711	c.430C>A	c.(430-432)Cat>Aat	p.H144N		NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	144					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			GCAGCCATCACATAATCAACC	0.483																																						dbGAP											0													98.0	102.0	100.0					4																	71500244		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.430C>A	4.37:g.71500244C>A	ENSP00000379383:p.His144Asn		Q17RI5|Q9H3D1	Missense_Mutation	SNP	NULL	p.H144N	ENST00000396073.3	37	c.430	CCDS3544.2	4	.	.	.	.	.	.	.	.	.	.	C	4.304	0.055775	0.08291	.	.	ENSG00000132464	ENST00000396073	T	0.40756	1.02	5.29	-4.45	0.03546	.	1.857900	0.02776	N	0.120311	T	0.18551	0.0445	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19257	-1.0311	10	0.25106	T	0.35	4.1851	9.9392	0.41570	0.6337:0.1596:0.2067:0.0	.	144	Q9NRM1	ENAM_HUMAN	N	144	ENSP00000379383:H144N	ENSP00000379383:H144N	H	+	1	0	ENAM	71719108	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.202000	0.09451	-0.393000	0.07739	0.460000	0.39030	CAT	ENAM	-	NULL	ENSG00000132464		0.483	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENAM	HGNC	protein_coding	OTTHUMT00000252166.3	143	0.00	0	C	NM_031889		71500244	71500244	+1	no_errors	ENST00000396073	ensembl	human	known	69_37n	missense	55	34.52	29	SNP	0.000	A
FAM115A	9747	genome.wustl.edu	37	7	143573445	143573445	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr7:143573445G>C	ENST00000479870.1	-	2	465	c.257C>G	c.(256-258)tCt>tGt	p.S86C	FAM115A_ENST00000392900.3_Intron|FAM115A_ENST00000355951.2_Missense_Mutation_p.S86C	NM_001206938.1|NM_001206941.1|NM_014719.2	NP_001193867.1|NP_001193870.1|NP_055534	Q9Y4C2	F115A_HUMAN	family with sequence similarity 115, member A	86										NS(1)|endometrium(1)|lung(5)	7	Melanoma(164;0.0903)					CCCAGGGGAAGAGCAAAGCCA	0.592																																						dbGAP											0													52.0	49.0	50.0					7																	143573445		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018281	CCDS5886.1, CCDS56514.1	7q35	2011-05-03	2006-03-23	2006-03-23	ENSG00000198420	ENSG00000198420			22201	protein-coding gene	gene with protein product						9872452	Standard	NM_014719		Approved	KIAA0738	uc003wdo.2	Q9Y4C2	OTTHUMG00000157773	ENST00000479870.1:c.257C>G	7.37:g.143573445G>C	ENSP00000419235:p.Ser86Cys		A8K6E0|Q75KM8|Q75KM9|Q7L665|Q9BW63	Missense_Mutation	SNP	NULL	p.S86C	ENST00000479870.1	37	c.257	CCDS5886.1	7	.	.	.	.	.	.	.	.	.	.	G	19.76	3.886586	0.72410	.	.	ENSG00000198420	ENST00000479870;ENST00000355951;ENST00000460532;ENST00000491908;ENST00000478172	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	4.01	4.01	0.46588	.	0.377447	0.26800	N	0.022433	T	0.41811	0.1175	N	0.22421	0.69	0.36411	D	0.86375	D	0.53885	0.963	P	0.53146	0.719	T	0.54689	-0.8256	10	0.72032	D	0.01	-16.182	14.4166	0.67155	0.0:0.0:1.0:0.0	.	86	Q9Y4C2	F115A_HUMAN	C	86	ENSP00000419235:S86C;ENSP00000348220:S86C;ENSP00000420607:S86C;ENSP00000417600:S86C;ENSP00000419622:S86C	ENSP00000348220:S86C	S	-	2	0	FAM115A	143204378	0.621000	0.27077	0.805000	0.32314	0.989000	0.77384	3.624000	0.54231	2.526000	0.85167	0.585000	0.79938	TCT	FAM115A	-	NULL	ENSG00000198420		0.592	FAM115A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM115A	HGNC	protein_coding	OTTHUMT00000349583.1	36	0.00	0	G	NM_014719		143573445	143573445	-1	no_errors	ENST00000479870	ensembl	human	known	69_37n	missense	46	17.86	10	SNP	0.861	C
FLG	2312	genome.wustl.edu	37	1	152275739	152275739	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr1:152275739C>A	ENST00000368799.1	-	3	11658	c.11623G>T	c.(11623-11625)Gac>Tac	p.D3875Y	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3875	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCTCAGAGTCCTCTGGGTAT	0.587									Ichthyosis																													dbGAP											0													132.0	136.0	135.0					1																	152275739		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11623G>T	1.37:g.152275739C>A	ENSP00000357789:p.Asp3875Tyr		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.D3875Y	ENST00000368799.1	37	c.11623	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	9.064	0.995126	0.19043	.	.	ENSG00000143631	ENST00000368799	T	0.02552	4.25	2.9	1.96	0.26148	.	.	.	.	.	T	0.02688	0.0081	L	0.57536	1.79	0.09310	N	1	D	0.54964	0.969	P	0.53912	0.737	T	0.46119	-0.9214	9	0.62326	D	0.03	.	5.133	0.14921	0.0:0.8305:0.0:0.1695	.	3875	P20930	FILA_HUMAN	Y	3875	ENSP00000357789:D3875Y	ENSP00000357789:D3875Y	D	-	1	0	FLG	150542363	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	0.154000	0.16343	1.605000	0.50152	0.552000	0.68991	GAC	FLG	-	NULL	ENSG00000143631		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	236	0.00	0	C	NM_002016		152275739	152275739	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	328	15.46	60	SNP	0.001	A
FOLH1	2346	genome.wustl.edu	37	11	49175795	49175795	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr11:49175795A>C	ENST00000256999.2	-	16	2133	c.1873T>G	c.(1873-1875)Tac>Gac	p.Y625D	FOLH1_ENST00000533034.1_Missense_Mutation_p.Y610D|FOLH1_ENST00000343844.4_Missense_Mutation_p.Y317D|FOLH1_ENST00000340334.7_Missense_Mutation_p.Y610D|FOLH1_ENST00000356696.3_Missense_Mutation_p.Y625D	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	625					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GATACACTGTATGTCTTCATT	0.333																																						dbGAP											0													148.0	133.0	138.0					11																	49175795		2201	4298	6499	-	-	-	SO:0001583	missense	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.1873T>G	11.37:g.49175795A>C	ENSP00000256999:p.Tyr625Asp		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.Y625D	ENST00000256999.2	37	c.1873	CCDS7946.1	11	.	.	.	.	.	.	.	.	.	.	A	10.14	1.268868	0.23136	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000343844;ENST00000533034	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	3.62	3.62	0.41486	Transferrin receptor-like, dimerisation domain (2);	0.000000	0.51477	D	0.000087	T	0.37183	0.0994	N	0.22421	0.69	0.58432	D	0.999997	D;D;B;B;D	0.89917	0.987;0.991;0.356;0.125;1.0	P;P;B;B;D	0.97110	0.848;0.762;0.185;0.009;1.0	T	0.09684	-1.0663	10	0.37606	T	0.19	.	10.4714	0.44640	1.0:0.0:0.0:0.0	.	610;610;625;625;40	Q04609-9;Q04609-7;Q04609-8;Q04609;Q04609-3	.;.;.;FOLH1_HUMAN;.	D	625;625;610;317;610	ENSP00000256999:Y625D;ENSP00000349129:Y625D;ENSP00000344131:Y610D;ENSP00000344086:Y317D;ENSP00000431463:Y610D	ENSP00000256999:Y625D	Y	-	1	0	FOLH1	49132371	1.000000	0.71417	0.110000	0.21437	0.829000	0.46940	5.354000	0.66040	1.660000	0.50760	0.332000	0.21555	TAC	FOLH1	-	superfamily_TFR-like_dimer_dom	ENSG00000086205		0.333	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	269	0.37	1	A	NM_004476		49175795	49175795	-1	no_errors	ENST00000256999	ensembl	human	known	69_37n	missense	173	13.43	27	SNP	0.885	C
FRMPD2	143162	genome.wustl.edu	37	10	49452893	49452893	+	Splice_Site	SNP	C	C	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr10:49452893C>G	ENST00000374201.3	-	4	612		c.e4-1		FRMPD2_ENST00000407470.4_Intron|FRMPD2_ENST00000305531.3_Intron	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2						tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		AGACATGCATCTGCCCAAAAG	0.418																																						dbGAP											0													116.0	101.0	106.0					10																	49452893		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.310-1G>C	10.37:g.49452893C>G			B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Splice_Site	SNP	-	e4-1	ENST00000374201.3	37	c.310-1	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	C	16.27	3.076775	0.55753	.	.	ENSG00000170324	ENST00000374201	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0177	0.64533	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FRMPD2	49122899	1.000000	0.71417	0.929000	0.37066	0.830000	0.47004	4.775000	0.62346	2.379000	0.81126	0.467000	0.42956	.	FRMPD2	-	-	ENSG00000170324		0.418	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	91	0.00	0	C	NM_152428	Intron	49452893	49452893	-1	no_errors	ENST00000374201	ensembl	human	known	69_37n	splice_site	62	24.39	20	SNP	0.964	G
GATM	2628	genome.wustl.edu	37	15	45658607	45658607	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr15:45658607T>A	ENST00000396659.3	-	5	1114	c.775A>T	c.(775-777)Att>Ttt	p.I259F	GATM_ENST00000558336.1_Missense_Mutation_p.I259F	NM_001482.2	NP_001473.1	P50440	GATM_HUMAN	glycine amidinotransferase (L-arginine:glycine amidinotransferase)	259					cellular nitrogen compound metabolic process (GO:0034641)|creatine biosynthetic process (GO:0006601)|creatine metabolic process (GO:0006600)|embryo development (GO:0009790)|response to mercury ion (GO:0046689)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	glycine amidinotransferase activity (GO:0015068)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines (GO:0016813)			biliary_tract(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	15		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Glycine(DB00145)|L-Ornithine(DB00129)	CCAGCTCGAATGAAGTCAGCA	0.413																																						dbGAP											0													74.0	70.0	72.0					15																	45658607		2198	4298	6496	-	-	-	SO:0001583	missense	0			S68805	CCDS10122.1	15q15.1	2007-12-06			ENSG00000171766	ENSG00000171766	2.1.4.1		4175	protein-coding gene	gene with protein product		602360				8313955	Standard	NM_001482		Approved	AGAT	uc001zvc.3	P50440	OTTHUMG00000131427	ENST00000396659.3:c.775A>T	15.37:g.45658607T>A	ENSP00000379895:p.Ile259Phe		B4DH99|B4DPI3|Q53EQ4	Missense_Mutation	SNP	NULL	p.I259F	ENST00000396659.3	37	c.775	CCDS10122.1	15	.	.	.	.	.	.	.	.	.	.	T	23.7	4.448358	0.84101	.	.	ENSG00000171766	ENST00000396659	T	0.55413	0.52	5.61	5.61	0.85477	.	0.043680	0.85682	D	0.000000	T	0.58366	0.2117	M	0.68952	2.095	0.80722	D	1	D;P	0.53462	0.96;0.945	B;P	0.47827	0.422;0.558	T	0.62765	-0.6785	10	0.52906	T	0.07	-14.856	13.7457	0.62874	0.0:0.0:0.0:1.0	.	259;259	P50440-3;P50440	.;GATM_HUMAN	F	259	ENSP00000379895:I259F	ENSP00000379895:I259F	I	-	1	0	GATM	43445899	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.409000	0.80053	2.126000	0.65437	0.533000	0.62120	ATT	GATM	-	NULL	ENSG00000171766		0.413	GATM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATM	HGNC	protein_coding	OTTHUMT00000254220.2	126	0.00	0	T	NM_001482		45658607	45658607	-1	no_errors	ENST00000396659	ensembl	human	known	69_37n	missense	74	15.91	14	SNP	1.000	A
HFM1	164045	genome.wustl.edu	37	1	91784682	91784682	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr1:91784682T>A	ENST00000370425.3	-	25	2863	c.2765A>T	c.(2764-2766)aAa>aTa	p.K922I	HFM1_ENST00000370424.3_Missense_Mutation_p.K601I|HFM1_ENST00000462405.1_5'UTR|HFM1_ENST00000294696.5_Missense_Mutation_p.K154I	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	922	SEC63.				resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TTCCCAAAGTTTACACCTAAA	0.343																																						dbGAP											0													70.0	72.0	71.0					1																	91784682		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.2765A>T	1.37:g.91784682T>A	ENSP00000359454:p.Lys922Ile		B1B0B6|Q8N9Q0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K922I	ENST00000370425.3	37	c.2765	CCDS30769.2	1	.	.	.	.	.	.	.	.	.	.	T	19.74	3.883738	0.72410	.	.	ENSG00000162669	ENST00000370425;ENST00000294696;ENST00000370424;ENST00000370421	T;T;T	0.62105	0.05;0.05;0.05	5.14	5.14	0.70334	Sec63 domain (2);	0.000000	0.64402	U	0.000002	T	0.73273	0.3566	M	0.84683	2.71	0.34444	D	0.699915	D;D	0.89917	0.997;1.0	D;D	0.80764	0.975;0.994	T	0.79892	-0.1611	10	0.87932	D	0	.	9.6455	0.39865	0.0:0.127:0.0:0.873	.	601;922	A6NGI5;A2PYH4	.;HFM1_HUMAN	I	922;154;601;606	ENSP00000359454:K922I;ENSP00000294696:K154I;ENSP00000359453:K601I	ENSP00000294696:K154I	K	-	2	0	HFM1	91557270	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.766000	0.38491	2.065000	0.61736	0.528000	0.53228	AAA	HFM1	-	pfam_Sec63-dom,smart_Sec63-dom	ENSG00000162669		0.343	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HFM1	HGNC	protein_coding	OTTHUMT00000316716.2	116	0.00	0	T	NM_001017975		91784682	91784682	-1	no_errors	ENST00000370425	ensembl	human	known	69_37n	missense	107	13.71	17	SNP	1.000	A
HNRNPH3	3189	genome.wustl.edu	37	10	70097706	70097706	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr10:70097706G>C	ENST00000265866.7	+	3	369	c.204G>C	c.(202-204)gaG>gaC	p.E68D	HNRNPH3_ENST00000441000.2_Intron|HNRNPH3_ENST00000469172.1_3'UTR|HNRNPH3_ENST00000354695.5_Missense_Mutation_p.E68D	NM_012207.2|NM_021644.3	NP_036339.1|NP_067676.2	P31942	HNRH3_HUMAN	heterogeneous nuclear ribonucleoprotein H3 (2H9)	68	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				epithelial cell differentiation (GO:0030855)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)	11						CTTCAAAGGAGATAGCAGAAA	0.478																																						dbGAP											0													127.0	129.0	129.0					10																	70097706		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7278.1, CCDS7279.1	10q22	2013-02-12		2008-04-18	ENSG00000096746	ENSG00000096746		"""RNA binding motif (RRM) containing"""	5043	protein-coding gene	gene with protein product		602324		HNRPH3		8999868	Standard	NM_021644		Approved	2H9	uc001jnw.4	P31942	OTTHUMG00000018349	ENST00000265866.7:c.204G>C	10.37:g.70097706G>C	ENSP00000265866:p.Glu68Asp		A8K682|B3KRE1|Q9BSX1|Q9NP53|Q9NP96|Q9NPA7|Q9NPI4|Q9UFU4|Q9Y4J5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E68D	ENST00000265866.7	37	c.204	CCDS7278.1	10	.	.	.	.	.	.	.	.	.	.	G	15.25	2.776890	0.49786	.	.	ENSG00000096746	ENST00000265866;ENST00000354695	T;T	0.10477	2.87;2.87	6.06	6.06	0.98353	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.23846	0.0577	N	0.26130	0.795	0.80722	D	1	D;D	0.63046	0.99;0.992	D;D	0.74348	0.971;0.983	T	0.00534	-1.1684	10	0.39692	T	0.17	.	20.6397	0.99537	0.0:0.0:1.0:0.0	.	68;68	P31942-2;P31942	.;HNRH3_HUMAN	D	68	ENSP00000265866:E68D;ENSP00000346726:E68D	ENSP00000265866:E68D	E	+	3	2	HNRNPH3	69767712	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.719000	0.68462	2.880000	0.98712	0.650000	0.86243	GAG	HNRNPH3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000096746		0.478	HNRNPH3-012	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPH3	HGNC	protein_coding	OTTHUMT00000090165.1	254	0.00	0	G			70097706	70097706	+1	no_errors	ENST00000265866	ensembl	human	known	69_37n	missense	221	11.55	29	SNP	1.000	C
HOXB8	3218	genome.wustl.edu	37	17	46690618	46690618	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr17:46690618C>A	ENST00000239144.4	-	2	912	c.678G>T	c.(676-678)gaG>gaT	p.E226D	HOXB8_ENST00000576562.1_Missense_Mutation_p.E225D|HOXB7_ENST00000567101.2_Intron|HOXB7_ENST00000239165.7_5'Flank	NM_024016.3	NP_076921.1	P17481	HXB8_HUMAN	homeobox B8	226					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|dorsal spinal cord development (GO:0021516)|embryonic skeletal system morphogenesis (GO:0048704)|grooming behavior (GO:0007625)|negative regulation of myeloid cell differentiation (GO:0045638)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(8)|urinary_tract(2)	11						CTGGGGCCCGCTCCAGCTTCT	0.632																																						dbGAP											0													77.0	80.0	79.0					17																	46690618		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11533.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120068	ENSG00000120068		"""Homeoboxes / ANTP class : HOXL subclass"""	5119	protein-coding gene	gene with protein product		142963	"""homeo box B8"""	HOX2, HOX2D		1973146, 1358459	Standard	XM_005257286		Approved		uc002inw.3	P17481	OTTHUMG00000159904	ENST00000239144.4:c.678G>T	17.37:g.46690618C>A	ENSP00000239144:p.Glu226Asp		Q9H1I2	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_Homeobox_metazoa,prints_HTH_motif,pfscan_Homeodomain	p.E226D	ENST00000239144.4	37	c.678	CCDS11533.1	17	.	.	.	.	.	.	.	.	.	.	C	16.49	3.139069	0.56936	.	.	ENSG00000120068	ENST00000239144	D	0.90261	-2.64	3.04	2.06	0.26882	.	0.447690	0.14675	U	0.305069	D	0.87838	0.6278	N	0.19112	0.55	0.44555	D	0.997516	D	0.58970	0.984	D	0.65443	0.935	T	0.82772	-0.0292	10	0.24483	T	0.36	.	5.5635	0.17157	0.0:0.724:0.0:0.276	.	226	P17481	HXB8_HUMAN	D	226	ENSP00000239144:E226D	ENSP00000239144:E226D	E	-	3	2	HOXB8	44045617	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	1.040000	0.30278	1.734000	0.51633	0.479000	0.44913	GAG	HOXB8	-	NULL	ENSG00000120068		0.632	HOXB8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HOXB8	HGNC	protein_coding	OTTHUMT00000358092.3	138	0.00	0	C			46690618	46690618	-1	no_errors	ENST00000239144	ensembl	human	known	69_37n	missense	87	16.35	17	SNP	1.000	A
IGF2BP3	10643	genome.wustl.edu	37	7	23352363	23352363	+	Silent	SNP	A	A	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr7:23352363A>G	ENST00000258729.3	-	14	1988	c.1632T>C	c.(1630-1632)taT>taC	p.Y544Y		NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	544	KH 4. {ECO:0000255|PROSITE- ProRule:PRU00117}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						CCTGGCAAGCATAGAAGTGAC	0.428																																						dbGAP											0													58.0	50.0	53.0					7																	23352363		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.1632T>C	7.37:g.23352363A>G			A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Silent	SNP	pfam_KH_dom_type_1,pfam_RRM_dom,smart_RRM_dom,smart_KH_dom,pfscan_KH_dom_type_1,pfscan_RRM_dom	p.Y544	ENST00000258729.3	37	c.1632	CCDS5382.1	7																																																																																			IGF2BP3	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000136231		0.428	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2BP3	HGNC	protein_coding	OTTHUMT00000250243.2	124	0.00	0	A	NM_006547		23352363	23352363	-1	no_errors	ENST00000258729	ensembl	human	known	69_37n	silent	94	15.18	17	SNP	1.000	G
IL18R1	8809	genome.wustl.edu	37	2	102988435	102988435	+	Silent	SNP	T	T	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr2:102988435T>C	ENST00000409599.1	+	5	681	c.325T>C	c.(325-327)Tta>Cta	p.L109L	IL18R1_ENST00000334376.3_Silent_p.L109L|IL18R1_ENST00000233957.1_Silent_p.L109L			Q13478	IL18R_HUMAN	interleukin 18 receptor 1	109	Ig-like C2-type 1.				immune response (GO:0006955)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|signal transduction (GO:0007165)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-18 receptor activity (GO:0042008)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						GAAATGGAAATTAAATGTCAT	0.289																																						dbGAP											0													27.0	27.0	27.0					2																	102988435		2194	4285	6479	-	-	-	SO:0001819	synonymous_variant	0			U43672	CCDS2060.1	2q12	2013-01-29			ENSG00000115604	ENSG00000115604		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5988	protein-coding gene	gene with protein product		604494				8626725, 10191101	Standard	NM_003855		Approved	IL1RRP, IL-1Rrp, CD218a	uc010fiy.3	Q13478	OTTHUMG00000130780	ENST00000409599.1:c.325T>C	2.37:g.102988435T>C			B2R9Y5|Q52LC9	Silent	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1,prints_IL1_rcpt_I/II	p.L109	ENST00000409599.1	37	c.325	CCDS2060.1	2																																																																																			IL18R1	-	smart_Ig_sub	ENSG00000115604		0.289	IL18R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL18R1	HGNC	protein_coding	OTTHUMT00000253294.2	44	0.00	0	T	NM_003855		102988435	102988435	+1	no_errors	ENST00000233957	ensembl	human	known	69_37n	silent	34	19.05	8	SNP	0.024	C
IL6ST	3572	genome.wustl.edu	37	5	55237028	55237028	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr5:55237028C>G	ENST00000381298.2	-	17	2951	c.2639G>C	c.(2638-2640)gGt>gCt	p.G880A	IL6ST_ENST00000536319.1_3'UTR|IL6ST_ENST00000381287.4_3'UTR|CTD-2031P19.5_ENST00000576302.1_RNA|IL6ST_ENST00000381294.3_Missense_Mutation_p.G819A|IL6ST_ENST00000502326.3_Missense_Mutation_p.G880A|IL6ST_ENST00000336909.5_Missense_Mutation_p.G880A	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	880					ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				TCCCTCAGTACCTGGACCAAA	0.438			O		hepatocellular ca																																	dbGAP		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	0													109.0	103.0	105.0					5																	55237028		2203	4300	6503	-	-	-	SO:0001583	missense	0			M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.2639G>C	5.37:g.55237028C>G	ENSP00000370698:p.Gly880Ala		A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,pfam_IL6_recept-bd,pfam_Growth/epo_recpt_lig-bind,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.G880A	ENST00000381298.2	37	c.2639	CCDS3971.1	5	.	.	.	.	.	.	.	.	.	.	C	9.996	1.232176	0.22626	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294	T;T;T	0.37058	1.51;1.51;1.22	5.73	0.865	0.19074	.	1.372380	0.03886	N	0.277914	T	0.35158	0.0922	M	0.64997	1.995	0.09310	N	1	B;B;B	0.24882	0.113;0.113;0.113	B;B;B	0.23419	0.046;0.046;0.046	T	0.19128	-1.0315	10	0.41790	T	0.15	.	3.7109	0.08420	0.1175:0.5783:0.1135:0.1907	.	880;819;880	Q17RA0;Q5FC04;P40189	.;.;IL6RB_HUMAN	A	880;880;819	ENSP00000370698:G880A;ENSP00000338799:G880A;ENSP00000370694:G819A	ENSP00000338799:G880A	G	-	2	0	IL6ST	55272785	0.000000	0.05858	0.001000	0.08648	0.799000	0.45148	0.072000	0.14617	-0.061000	0.13110	-0.262000	0.10625	GGT	IL6ST	-	NULL	ENSG00000134352		0.438	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	IL6ST	HGNC	protein_coding	OTTHUMT00000214146.3	76	0.00	0	C	NM_002184		55237028	55237028	-1	no_errors	ENST00000336909	ensembl	human	known	69_37n	missense	50	10.71	6	SNP	0.000	G
IQGAP2	10788	genome.wustl.edu	37	5	75993917	75993917	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr5:75993917C>T	ENST00000274364.6	+	33	4609	c.4312C>T	c.(4312-4314)Caa>Taa	p.Q1438*	CTD-2384B11.2_ENST00000507514.1_RNA|IQGAP2_ENST00000379730.3_Nonsense_Mutation_p.Q940*|IQGAP2_ENST00000502745.1_Nonsense_Mutation_p.Q934*|IQGAP2_ENST00000396234.3_Nonsense_Mutation_p.Q934*	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1438					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		TTATGAAGAGCAAATCAATTA	0.323																																						dbGAP											0													75.0	74.0	74.0					5																	75993917		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.4312C>T	5.37:g.75993917C>T	ENSP00000274364:p.Gln1438*		A8K4V1|B7Z8A4|J3KR91	Nonsense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_Rsp5_WWP,pfscan_RasGAP	p.Q1438*	ENST00000274364.6	37	c.4312	CCDS34188.1	5	.	.	.	.	.	.	.	.	.	.	C	42	9.707092	0.99244	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000505766;ENST00000396234;ENST00000502745	.	.	.	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-20.368	19.8623	0.96787	0.0:1.0:0.0:0.0	.	.	.	.	X	1438;940;1388;934;934	.	ENSP00000274364:Q1438X	Q	+	1	0	IQGAP2	76029673	1.000000	0.71417	0.960000	0.40013	0.942000	0.58702	7.587000	0.82613	2.769000	0.95229	0.650000	0.86243	CAA	IQGAP2	-	pfam_RasGAP_C	ENSG00000145703		0.323	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP2	HGNC	protein_coding	OTTHUMT00000368877.1	88	0.00	0	C	NM_006633		75993917	75993917	+1	no_errors	ENST00000274364	ensembl	human	known	69_37n	nonsense	46	29.23	19	SNP	1.000	T
KAT6B	23522	genome.wustl.edu	37	10	76788498	76788498	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr10:76788498A>T	ENST00000287239.4	+	18	4405	c.3916A>T	c.(3916-3918)Agg>Tgg	p.R1306W	KAT6B_ENST00000372724.1_Missense_Mutation_p.R1014W|KAT6B_ENST00000372714.1_Missense_Mutation_p.R1014W|KAT6B_ENST00000372725.1_Missense_Mutation_p.R1014W|KAT6B_ENST00000372711.1_Missense_Mutation_p.R1123W	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1306					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										CAGTCCCATCAGGATTGAGGA	0.517																																						dbGAP											0													78.0	75.0	76.0					10																	76788498		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.3916A>T	10.37:g.76788498A>T	ENSP00000287239:p.Arg1306Trp		O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,pfam_Histone_H1/H5,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.R1306W	ENST00000287239.4	37	c.3916	CCDS7345.1	10	.	.	.	.	.	.	.	.	.	.	A	3.407	-0.121057	0.06838	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	T;T;T;T;T	0.77877	-1.12;-1.12;-1.13;-1.12;-1.13	4.67	-0.17	0.13335	.	0.833683	0.10192	N	0.704528	T	0.62441	0.2428	N	0.14661	0.345	0.09310	N	1	P;B;P	0.47191	0.891;0.188;0.566	B;B;B	0.42653	0.394;0.208;0.145	T	0.55003	-0.8208	10	0.66056	D	0.02	-0.006	9.7161	0.40276	0.1622:0.0:0.8378:0.0	.	1123;1014;1306	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	W	1014;1014;1306;1014;1123	ENSP00000361810:R1014W;ENSP00000361809:R1014W;ENSP00000287239:R1306W;ENSP00000361799:R1014W;ENSP00000361796:R1123W	ENSP00000287239:R1306W	R	+	1	2	KAT6B	76458504	0.004000	0.15560	0.006000	0.13384	0.508000	0.34012	0.835000	0.27531	-0.046000	0.13446	-0.366000	0.07423	AGG	KAT6B	-	NULL	ENSG00000156650		0.517	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6B	HGNC	protein_coding	OTTHUMT00000048771.1	66	0.00	0	A	NM_012330		76788498	76788498	+1	no_errors	ENST00000287239	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	0.002	T
KCNQ3	3786	genome.wustl.edu	37	8	133150245	133150245	+	Silent	SNP	G	G	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr8:133150245G>C	ENST00000388996.4	-	12	2007	c.1587C>G	c.(1585-1587)ctC>ctG	p.L529L	KCNQ3_ENST00000519445.1_Silent_p.L529L|KCNQ3_ENST00000521134.1_Silent_p.L409L	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	529					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TTTTTTTATAGAGACGGAATT	0.458																																						dbGAP											0													93.0	91.0	92.0					8																	133150245		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1587C>G	8.37:g.133150245G>C			A2VCT8|B4DJY4|E7EQ89	Silent	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCNQ3,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.L529	ENST00000388996.4	37	c.1587	CCDS34943.1	8																																																																																			KCNQ3	-	pfam_K_chnl_volt-dep_KCNQ_C	ENSG00000184156		0.458	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ3	HGNC	protein_coding	OTTHUMT00000268621.2	63	0.00	0	G	NM_004519		133150245	133150245	-1	no_errors	ENST00000388996	ensembl	human	known	69_37n	silent	37	60.64	57	SNP	1.000	C
LAMB2	3913	genome.wustl.edu	37	3	49162717	49162717	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr3:49162717G>C	ENST00000418109.1	-	20	2853	c.2689C>G	c.(2689-2691)Cgt>Ggt	p.R897G	LAMB2_ENST00000464891.1_5'UTR|LAMB2_ENST00000305544.4_Missense_Mutation_p.R897G	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	897	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GTGTGATCACGGCAGCCCAGG	0.592																																						dbGAP											0													139.0	134.0	136.0					3																	49162717		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.2689C>G	3.37:g.49162717G>C	ENSP00000388325:p.Arg897Gly		Q16321	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.R897G	ENST00000418109.1	37	c.2689	CCDS2789.1	3	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369613	0.82463	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.62941	-0.01;-0.01	5.98	5.98	0.97165	EGF-like, laminin (4);	0.000000	0.85682	D	0.000000	T	0.77505	0.4140	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69866	-0.5029	10	0.21540	T	0.41	.	20.4561	0.99145	0.0:0.0:1.0:0.0	.	897	P55268	LAMB2_HUMAN	G	897	ENSP00000388325:R897G;ENSP00000307156:R897G	ENSP00000307156:R897G	R	-	1	0	LAMB2	49137721	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.395000	0.79876	2.847000	0.97988	0.591000	0.81541	CGT	LAMB2	-	pfam_EGF_laminin,smart_EGF_laminin,smart_EGF-like,pfscan_EGF_laminin	ENSG00000172037		0.592	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB2	HGNC	protein_coding	OTTHUMT00000345939.1	37	0.00	0	G	NM_002292		49162717	49162717	-1	no_errors	ENST00000305544	ensembl	human	known	69_37n	missense	29	27.50	11	SNP	1.000	C
LPHN2	23266	genome.wustl.edu	37	1	82416781	82416781	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr1:82416781C>A	ENST00000370728.1	+	10	2217	c.1572C>A	c.(1570-1572)caC>caA	p.H524Q	LPHN2_ENST00000370730.1_Missense_Mutation_p.H524Q|LPHN2_ENST00000370721.1_Missense_Mutation_p.H462Q|LPHN2_ENST00000335786.5_Missense_Mutation_p.H524Q|LPHN2_ENST00000370715.1_Missense_Mutation_p.H524Q|LPHN2_ENST00000359929.3_Missense_Mutation_p.H524Q|LPHN2_ENST00000271029.4_Missense_Mutation_p.H524Q|LPHN2_ENST00000394879.1_Missense_Mutation_p.H524Q|LPHN2_ENST00000370717.2_Missense_Mutation_p.H524Q|LPHN2_ENST00000319517.6_Missense_Mutation_p.H524Q|LPHN2_ENST00000370713.1_Missense_Mutation_p.H524Q|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370725.1_Missense_Mutation_p.H524Q|LPHN2_ENST00000370723.1_Missense_Mutation_p.H524Q|LPHN2_ENST00000370727.1_Missense_Mutation_p.H524Q			O95490	LPHN2_HUMAN	latrophilin 2	524					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		GTACCTCACACTGGGTGAATC	0.418																																						dbGAP											0													107.0	103.0	104.0					1																	82416781		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.1572C>A	1.37:g.82416781C>A	ENSP00000359763:p.His524Gln		A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.H524Q	ENST00000370728.1	37	c.1572		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.43|10.43	1.348391|1.348391	0.24426|0.24426	.|.	.|.	ENSG00000117114|ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786|ENST00000449420	T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.68181|.	-0.29;-0.31;-0.3;-0.24;-0.25;-0.2;-0.25;-0.26;-0.24;-0.25;-0.25;-0.2;-0.24;-0.3|.	5.96|5.96	5.06|5.06	0.68205|0.68205	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.63414|0.63414	0.2509|0.2509	M|M	0.65975|0.65975	2.015|2.015	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D|.	0.76494|.	0.991;0.999;0.997|.	P;D;P|.	0.67725|.	0.844;0.953;0.844|.	T|T	0.64968|0.64968	-0.6282|-0.6282	10|5	0.19147|.	T|.	0.46|.	.|.	15.1602|15.1602	0.72778|0.72778	0.0:0.9327:0.0:0.0673|0.0:0.9327:0.0:0.0673	.|.	524;524;524|.	O95490-3;O95490-4;O95490-2|.	.;.;.|.	Q|N	462;524;524;524;524;524;524;524;524;524;524;524;524;524|392	ENSP00000359756:H462Q;ENSP00000359763:H524Q;ENSP00000359765:H524Q;ENSP00000359762:H524Q;ENSP00000359760:H524Q;ENSP00000359758:H524Q;ENSP00000353006:H524Q;ENSP00000359750:H524Q;ENSP00000359748:H524Q;ENSP00000322270:H524Q;ENSP00000359752:H524Q;ENSP00000378344:H524Q;ENSP00000271029:H524Q;ENSP00000337306:H524Q|.	ENSP00000271029:H524Q|.	H|T	+|+	3|2	2|0	LPHN2|LPHN2	82189369|82189369	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	3.929000|3.929000	0.56514|0.56514	1.541000|1.541000	0.49316|0.49316	-0.142000|-0.142000	0.14014|0.14014	CAC|ACT	LPHN2	-	smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom	ENSG00000117114		0.418	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	HGNC	protein_coding	OTTHUMT00000027188.1	96	0.00	0	C	NM_012302		82416781	82416781	+1	no_errors	ENST00000370717	ensembl	human	known	69_37n	missense	101	17.89	22	SNP	1.000	A
LTBP2	4053	genome.wustl.edu	37	14	74972814	74972814	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr14:74972814A>C	ENST00000261978.4	-	28	4500	c.4114T>G	c.(4114-4116)Tgt>Ggt	p.C1372G	LTBP2_ENST00000556690.1_Missense_Mutation_p.C1328G	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1372	Cys-rich.|EGF-like 16; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TCACTGGCACAGAGGCACAGG	0.622																																						dbGAP											0													100.0	95.0	97.0					14																	74972814		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.4114T>G	14.37:g.74972814A>C	ENSP00000261978:p.Cys1372Gly		Q99907|Q9NS51	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,pfam_EGF-like_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.C1372G	ENST00000261978.4	37	c.4114	CCDS9831.1	14	.	.	.	.	.	.	.	.	.	.	A	25.4	4.638335	0.87760	.	.	ENSG00000119681	ENST00000261978;ENST00000556690	D;D	0.99436	-5.74;-5.9	4.82	4.82	0.62117	EGF-like calcium-binding (2);	0.308416	0.23402	N	0.048569	D	0.99638	0.9867	H	0.97214	3.96	0.46981	D	0.999278	P	0.52463	0.953	P	0.58454	0.839	D	0.97636	1.0145	10	0.87932	D	0	.	14.6009	0.68441	1.0:0.0:0.0:0.0	.	1372	Q14767	LTBP2_HUMAN	G	1372;1328	ENSP00000261978:C1372G;ENSP00000451477:C1328G	ENSP00000261978:C1372G	C	-	1	0	LTBP2	74042567	1.000000	0.71417	0.992000	0.48379	0.858000	0.48976	9.131000	0.94446	2.026000	0.59711	0.454000	0.30748	TGT	LTBP2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like	ENSG00000119681		0.622	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP2	HGNC	protein_coding	OTTHUMT00000413595.1	45	0.00	0	A	NM_000428		74972814	74972814	-1	no_errors	ENST00000261978	ensembl	human	known	69_37n	missense	34	33.33	17	SNP	1.000	C
MAP3K10	4294	genome.wustl.edu	37	19	40720993	40720993	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr19:40720993C>G	ENST00000253055.3	+	10	2947	c.2659C>G	c.(2659-2661)Cct>Gct	p.P887A		NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	887					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						TGCCCCGAGACCTCGGCCGGC	0.726																																						dbGAP											0													8.0	11.0	10.0					19																	40720993		2166	4249	6415	-	-	-	SO:0001583	missense	0			X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.2659C>G	19.37:g.40720993C>G	ENSP00000253055:p.Pro887Ala		Q12761|Q14871	Missense_Mutation	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom	p.P887A	ENST00000253055.3	37	c.2659	CCDS12549.1	19	.	.	.	.	.	.	.	.	.	.	C	16.85	3.237481	0.58886	.	.	ENSG00000130758	ENST00000253055	D	0.81908	-1.55	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	D	0.89487	0.6729	M	0.68317	2.08	0.58432	D	0.999991	D	0.76494	0.999	D	0.80764	0.994	D	0.90289	0.4321	10	0.62326	D	0.03	.	14.8414	0.70226	0.0:1.0:0.0:0.0	.	887	Q02779	M3K10_HUMAN	A	887	ENSP00000253055:P887A	ENSP00000253055:P887A	P	+	1	0	MAP3K10	45412833	1.000000	0.71417	1.000000	0.80357	0.265000	0.26407	7.253000	0.78320	2.361000	0.80049	0.462000	0.41574	CCT	MAP3K10	-	pirsf_MAPKKK9/10/11	ENSG00000130758		0.726	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K10	HGNC	protein_coding	OTTHUMT00000462552.1	15	0.00	0	C	NM_002446		40720993	40720993	+1	no_errors	ENST00000253055	ensembl	human	known	69_37n	missense	5	44.44	4	SNP	1.000	G
MEIS1	4211	genome.wustl.edu	37	2	66664937	66664937	+	Silent	SNP	G	G	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr2:66664937G>A	ENST00000272369.9	+	2	538	c.81G>A	c.(79-81)ccG>ccA	p.P27P	MEIS1_ENST00000488550.1_Silent_p.P27P|MEIS1_ENST00000398506.2_Silent_p.P25P|MEIS1-AS2_ENST00000439433.1_RNA|MEIS1_ENST00000407092.2_Silent_p.P27P|MEIS1_ENST00000444274.2_5'Flank|MEIS1_ENST00000560281.2_Silent_p.P27P|MEIS1_ENST00000495021.2_5'Flank|MEIS1-AS1_ENST00000454595.1_RNA	NM_002398.2	NP_002389.1	O00470	MEIS1_HUMAN	Meis homeobox 1	27					angiogenesis (GO:0001525)|definitive hemopoiesis (GO:0060216)|lens morphogenesis in camera-type eye (GO:0002089)|megakaryocyte development (GO:0035855)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron differentiation (GO:0045665)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	24						ATGGGGACCCGCATGCAGCCA	0.592																																						dbGAP											0													43.0	47.0	46.0					2																	66664937		2075	4214	6289	-	-	-	SO:0001819	synonymous_variant	0				CCDS46309.1	2p14	2011-06-20	2007-02-15		ENSG00000143995	ENSG00000143995		"""Homeoboxes / TALE class"""	7000	protein-coding gene	gene with protein product		601739	"""Meis1 (mouse) homolog"", ""Meis1, myeloid ecotropic viral integration site 1 homolog (mouse)"""			7565694	Standard	NM_002398		Approved		uc002sdu.3	O00470	OTTHUMG00000150714	ENST00000272369.9:c.81G>A	2.37:g.66664937G>A			A8MV50	Silent	SNP	pfam_Homeodomain,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.P27	ENST00000272369.9	37	c.81	CCDS46309.1	2																																																																																			MEIS1	-	NULL	ENSG00000143995		0.592	MEIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEIS1	HGNC	protein_coding	OTTHUMT00000319725.4	69	0.00	0	G	NM_002398		66664937	66664937	+1	no_errors	ENST00000407092	ensembl	human	known	69_37n	silent	50	15.25	9	SNP	1.000	A
MGAT3	4248	genome.wustl.edu	37	22	39884853	39884853	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr22:39884853C>G	ENST00000341184.6	+	2	1716	c.1501C>G	c.(1501-1503)Ccc>Gcc	p.P501A		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	501					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					GCTGGACAACCCCTACCAGGA	0.677																																						dbGAP											0													27.0	31.0	30.0					22																	39884853		2197	4298	6495	-	-	-	SO:0001583	missense	0			D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.1501C>G	22.37:g.39884853C>G	ENSP00000345270:p.Pro501Ala		A6NGD0|Q14CK5|Q6IC49|Q9UH32	Missense_Mutation	SNP	pfam_Glyco_trans_17	p.P501A	ENST00000341184.6	37	c.1501	CCDS13994.2	22	.	.	.	.	.	.	.	.	.	.	C	23.5	4.424567	0.83667	.	.	ENSG00000128268	ENST00000341184	.	.	.	5.83	5.83	0.93111	.	0.061264	0.64402	D	0.000003	T	0.75910	0.3914	L	0.53249	1.67	0.58432	D	0.999995	D	0.89917	1.0	D	0.87578	0.998	T	0.68595	-0.5367	9	0.22109	T	0.4	.	20.1184	0.97949	0.0:1.0:0.0:0.0	.	501	Q09327	MGAT3_HUMAN	A	501	.	ENSP00000345270:P501A	P	+	1	0	MGAT3	38214799	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.326000	0.79133	2.775000	0.95449	0.650000	0.86243	CCC	MGAT3	-	pfam_Glyco_trans_17	ENSG00000128268		0.677	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT3	HGNC	protein_coding	OTTHUMT00000075039.2	26	0.00	0	C	NM_002409		39884853	39884853	+1	no_errors	ENST00000341184	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	1.000	G
MYH13	8735	genome.wustl.edu	37	17	10243510	10243510	+	Silent	SNP	A	A	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr17:10243510A>T	ENST00000418404.3	-	17	2176	c.2013T>A	c.(2011-2013)ccT>ccA	p.P671P	MYH13_ENST00000252172.4_Silent_p.P671P|RP11-401O9.3_ENST00000577743.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	671	Actin-binding. {ECO:0000250}.|Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						GTACAAAGTGAGGGTGGGTGC	0.428																																						dbGAP											0													102.0	102.0	102.0					17																	10243510		1921	4148	6069	-	-	-	SO:0001819	synonymous_variant	0			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.2013T>A	17.37:g.10243510A>T			O95252|Q9P0U8	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.P671	ENST00000418404.3	37	c.2013	CCDS45613.1	17																																																																																			MYH13	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000006788		0.428	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	214	0.00	0	A	NM_003802		10243510	10243510	-1	no_errors	ENST00000252172	ensembl	human	known	69_37n	silent	168	11.11	21	SNP	1.000	T
MYO1F	4542	genome.wustl.edu	37	19	8620576	8620576	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr19:8620576G>T	ENST00000338257.8	-	2	375	c.108C>A	c.(106-108)aaC>aaA	p.N36K		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	36	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						GCTTCCGGAGGTTGGCGGCAA	0.612																																						dbGAP											0													99.0	105.0	103.0					19																	8620576		2043	4178	6221	-	-	-	SO:0001583	missense	0			X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.108C>A	19.37:g.8620576G>T	ENSP00000344871:p.Asn36Lys		Q8WWN7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_SH3_domain,prints_Myosin_head_motor_dom,prints_SH3_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_SH3_domain	p.N36K	ENST00000338257.8	37	c.108	CCDS42494.1	19	.	.	.	.	.	.	.	.	.	.	G	13.96	2.391608	0.42410	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.89343	-2.5	3.81	2.03	0.26663	Myosin head, motor domain (2);	0.113418	0.56097	N	0.000022	D	0.95695	0.8600	H	0.97940	4.11	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.93793	0.7094	10	0.87932	D	0	.	7.3132	0.26485	0.282:0.0:0.718:0.0	.	36;36;36	B4DVP3;B0I1T1;O00160	.;.;MYO1F_HUMAN	K	81;36	ENSP00000344871:N36K	ENSP00000304899:N81K	N	-	3	2	MYO1F	8526576	1.000000	0.71417	0.998000	0.56505	0.155000	0.21991	4.539000	0.60657	0.551000	0.29008	0.462000	0.41574	AAC	MYO1F	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000142347		0.612	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1F	HGNC	protein_coding	OTTHUMT00000342716.2	108	0.00	0	G			8620576	8620576	-1	no_errors	ENST00000338257	ensembl	human	known	69_37n	missense	122	14.69	21	SNP	1.000	T
NCCRP1	342897	genome.wustl.edu	37	19	39691392	39691392	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr19:39691392A>G	ENST00000339852.4	+	6	846	c.824A>G	c.(823-825)gAg>gGg	p.E275G		NM_001001414.1	NP_001001414.1	Q6ZVX7	FBX50_HUMAN	non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)	275					positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	10						CAGCTCCGGGAGTGACTGGCT	0.617																																					Melanoma(107;1207 1556 14956 29427 52130)	dbGAP											0													110.0	112.0	112.0					19																	39691392		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123941, BC067874	CCDS12529.1	19q13.2	2013-07-31	2008-11-19		ENSG00000188505	ENSG00000188505			33739	protein-coding gene	gene with protein product		615901					Standard	NM_001001414		Approved	LOC342897, NCCRP-1, FBXO50	uc002okq.1	Q6ZVX7		ENST00000339852.4:c.824A>G	19.37:g.39691392A>G	ENSP00000342137:p.Glu275Gly		Q6NVV5	Missense_Mutation	SNP	pfam_F-box-assoc_dom,superfamily_Galactose-bd-like,pfscan_F-box-assoc_dom	p.E275G	ENST00000339852.4	37	c.824	CCDS12529.1	19	.	.	.	.	.	.	.	.	.	.	A	18.58	3.653646	0.67472	.	.	ENSG00000188505	ENST00000339852	T	0.39229	1.09	4.96	4.96	0.65561	.	0.735154	0.13297	N	0.398539	T	0.31513	0.0799	L	0.36672	1.1	0.32909	D	0.514261	P	0.37781	0.608	B	0.27500	0.08	T	0.49523	-0.8931	10	0.66056	D	0.02	.	12.5783	0.56375	1.0:0.0:0.0:0.0	.	275	Q6ZVX7	NCRP1_HUMAN	G	275	ENSP00000342137:E275G	ENSP00000342137:E275G	E	+	2	0	NCCRP1	44383232	1.000000	0.71417	0.999000	0.59377	0.519000	0.34347	3.059000	0.49947	1.879000	0.54435	0.397000	0.26171	GAG	NCCRP1	-	NULL	ENSG00000188505		0.617	NCCRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCCRP1	HGNC	protein_coding	OTTHUMT00000463829.1	35	0.00	0	A	NM_001001414		39691392	39691392	+1	no_errors	ENST00000339852	ensembl	human	known	69_37n	missense	25	24.24	8	SNP	0.976	G
NR0B2	8431	genome.wustl.edu	37	1	27238463	27238463	+	Missense_Mutation	SNP	C	C	T	rs200475847		TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr1:27238463C>T	ENST00000254227.3	-	2	672	c.647G>A	c.(646-648)cGt>cAt	p.R216H		NM_021969.2	NP_068804.1	Q15466	NR0B2_HUMAN	nuclear receptor subfamily 0, group B, member 2	216	Ligand-binding. {ECO:0000250}.		R -> H (no effect on repressor activity; dbSNP:rs200475847). {ECO:0000269|PubMed:11136233}.		cholesterol metabolic process (GO:0008203)|gene expression (GO:0010467)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)			NS(1)|large_intestine(1)|lung(3)	5		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.01e-51)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		GAGGAGGACACGGGTCAGGCG	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		20599	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													127.0	127.0	127.0					1																	27238463		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044316	CCDS291.1	1p36.1	2013-01-16			ENSG00000131910	ENSG00000131910		"""Nuclear hormone receptors"""	7961	protein-coding gene	gene with protein product		604630				9603951	Standard	NM_021969		Approved	SHP	uc001bnf.3	Q15466	OTTHUMG00000004231	ENST00000254227.3:c.647G>A	1.37:g.27238463C>T	ENSP00000254227:p.Arg216His		F1D8P5|Q5QP36	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	p.R216H	ENST00000254227.3	37	c.647	CCDS291.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	16.66	3.183980	0.57800	.	.	ENSG00000131910	ENST00000254227	D	0.96940	-4.18	6.04	2.15	0.27550	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.240693	0.41500	N	0.000879	D	0.94535	0.8240	M	0.81179	2.53	0.36549	D	0.871739	P	0.47962	0.903	B	0.41510	0.359	D	0.92118	0.5701	10	0.72032	D	0.01	-9.4887	5.4792	0.16713	0.1237:0.5387:0.0:0.3376	.	216	Q15466	NR0B2_HUMAN	H	216	ENSP00000254227:R216H	ENSP00000254227:R216H	R	-	2	0	NR0B2	27111050	0.056000	0.20664	0.188000	0.23233	0.922000	0.55478	0.050000	0.14120	0.157000	0.19338	0.561000	0.74099	CGT	NR0B2	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	ENSG00000131910		0.622	NR0B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR0B2	HGNC	protein_coding	OTTHUMT00000012185.1	132	0.00	0	C			27238463	27238463	-1	no_errors	ENST00000254227	ensembl	human	known	69_37n	missense	93	20.51	24	SNP	0.529	T
OR2T11	127077	genome.wustl.edu	37	1	248789657	248789657	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr1:248789657A>G	ENST00000330803.2	-	1	834	c.773T>C	c.(772-774)cTg>cCg	p.L258P		NM_001001964.1	NP_001001964.1	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T, member 11 (gene/pseudogene)	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(5)|lung(20)|skin(2)	28	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGACTGGGGCAGCACGTATGT	0.517																																						dbGAP											0													75.0	69.0	71.0					1																	248789657		2047	4233	6280	-	-	-	SO:0001583	missense	0			BK004476	CCDS31122.1	1q44	2013-10-10	2013-10-10		ENSG00000183130	ENSG00000183130		"""GPCR / Class A : Olfactory receptors"""	19574	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 11"""				Standard	NM_001001964		Approved	OR2T11Q	uc001ier.1	Q8NH01	OTTHUMG00000040384	ENST00000330803.2:c.773T>C	1.37:g.248789657A>G	ENSP00000328934:p.Leu258Pro		Q6IEY6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L258P	ENST00000330803.2	37	c.773	CCDS31122.1	1	.	.	.	.	.	.	.	.	.	.	.	12.51	1.960577	0.34565	.	.	ENSG00000183130	ENST00000330803	T	0.38401	1.14	4.24	1.7	0.24286	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33199	N	0.005171	T	0.49762	0.1576	M	0.69463	2.115	0.09310	N	0.999994	D	0.76494	0.999	D	0.79108	0.992	T	0.23940	-1.0174	10	0.39692	T	0.17	.	6.3362	0.21296	0.5572:0.2982:0.0:0.1447	.	258	Q8NH01	O2T11_HUMAN	P	258	ENSP00000328934:L258P	ENSP00000328934:L258P	L	-	2	0	OR2T11	246856280	0.000000	0.05858	0.020000	0.16555	0.752000	0.42762	-0.118000	0.10692	0.644000	0.30656	0.533000	0.62120	CTG	OR2T11	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000183130		0.517	OR2T11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T11	HGNC	protein_coding	OTTHUMT00000097134.1	61	0.00	0	A	NM_001001964		248789657	248789657	-1	no_errors	ENST00000330803	ensembl	human	known	69_37n	missense	111	10.48	13	SNP	0.026	G
OR4K13	390433	genome.wustl.edu	37	14	20502724	20502724	+	Missense_Mutation	SNP	T	T	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr14:20502724T>G	ENST00000315693.2	-	1	195	c.194A>C	c.(193-195)aAc>aCc	p.N65T	AL359218.1_ENST00000580563.1_RNA	NM_001004714.1	NP_001004714.1	Q8NH42	OR4KD_HUMAN	olfactory receptor, family 4, subfamily K, member 13	65						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)	24	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		GCAGGAGAGGTTGCTAAGCAG	0.453																																						dbGAP											0													113.0	103.0	106.0					14																	20502724		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32028.1	14q11.2	2013-09-23			ENSG00000176253	ENSG00000176253		"""GPCR / Class A : Olfactory receptors"""	15351	protein-coding gene	gene with protein product							Standard	NM_001004714		Approved		uc010tkz.2	Q8NH42	OTTHUMG00000170781	ENST00000315693.2:c.194A>C	14.37:g.20502724T>G	ENSP00000319322:p.Asn65Thr		Q6IF13	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.N65T	ENST00000315693.2	37	c.194	CCDS32028.1	14	.	.	.	.	.	.	.	.	.	.	.	14.55	2.567902	0.45798	.	.	ENSG00000176253	ENST00000315693	T	0.12984	2.63	3.75	2.59	0.31030	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41500	U	0.000873	T	0.34629	0.0904	M	0.90759	3.145	0.09310	N	1	D	0.55172	0.97	P	0.58873	0.847	T	0.17806	-1.0357	10	0.87932	D	0	.	7.0722	0.25185	0.0:0.1135:0.0:0.8865	.	65	Q8NH42	OR4KD_HUMAN	T	65	ENSP00000319322:N65T	ENSP00000319322:N65T	N	-	2	0	OR4K13	19572564	0.151000	0.22747	0.001000	0.08648	0.001000	0.01503	2.274000	0.43390	0.513000	0.28278	0.438000	0.28831	AAC	OR4K13	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176253		0.453	OR4K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K13	HGNC	protein_coding	OTTHUMT00000410344.1	133	0.00	0	T			20502724	20502724	-1	no_errors	ENST00000315693	ensembl	human	known	69_37n	missense	92	16.36	18	SNP	0.072	G
OR52R1	119695	genome.wustl.edu	37	11	4825512	4825512	+	Silent	SNP	C	C	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr11:4825512C>T	ENST00000356069.2	-	1	98	c.99G>A	c.(97-99)ccG>ccA	p.P33P	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron|OR52R1_ENST00000380382.1_Silent_p.P112P	NM_001005177.3	NP_001005177.3	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R, member 1	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|prostate(1)|skin(3)	29		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGCACAGAACGGAAAGGCAA	0.512																																						dbGAP											0													94.0	84.0	87.0					11																	4825512		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			BK004282	CCDS31360.1, CCDS31360.2	11p15.4	2012-08-09			ENSG00000176937	ENSG00000176937		"""GPCR / Class A : Olfactory receptors"""	15235	protein-coding gene	gene with protein product							Standard	NM_001005177		Approved		uc021qcs.1	Q8NGF1	OTTHUMG00000066510	ENST00000356069.2:c.99G>A	11.37:g.4825512C>T			Q6IFI0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.P112	ENST00000356069.2	37	c.336	CCDS31360.2	11																																																																																			OR52R1	-	prints_7TM_GPCR_Rhodpsn	ENSG00000176937		0.512	OR52R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52R1	HGNC	protein_coding	OTTHUMT00000142183.1	121	0.00	0	C	NM_001005177		4825512	4825512	-1	no_errors	ENST00000380382	ensembl	human	known	69_37n	silent	89	29.37	37	SNP	0.034	T
OTUD7A	161725	genome.wustl.edu	37	15	31776741	31776741	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr15:31776741C>T	ENST00000307050.4	-	11	1629	c.1537G>A	c.(1537-1539)Gtg>Atg	p.V513M	OTUD7A_ENST00000382902.1_Missense_Mutation_p.V520M	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	513					protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		TTGTTGGCCACGGAGTCGGCG	0.597																																						dbGAP											0													85.0	67.0	73.0					15																	31776741		2200	4300	6500	-	-	-	SO:0001583	missense	0			AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.1537G>A	15.37:g.31776741C>T	ENSP00000305926:p.Val513Met		Q8IWK5	Missense_Mutation	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.V520M	ENST00000307050.4	37	c.1558	CCDS10026.1	15	.	.	.	.	.	.	.	.	.	.	C	22.5	4.292129	0.80914	.	.	ENSG00000169918	ENST00000307050;ENST00000382902	T;T	0.57907	0.38;0.37	4.88	4.88	0.63580	.	0.118397	0.56097	D	0.000024	T	0.73426	0.3585	M	0.75264	2.295	0.46749	D	0.999188	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	T	0.77792	-0.2455	10	0.87932	D	0	-33.1536	18.0667	0.89392	0.0:1.0:0.0:0.0	.	520;513	Q8TE49-2;Q8TE49	.;OTU7A_HUMAN	M	513;520	ENSP00000305926:V513M;ENSP00000372358:V520M	ENSP00000305926:V513M	V	-	1	0	OTUD7A	29564033	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.082000	0.76851	2.241000	0.73720	0.650000	0.86243	GTG	OTUD7A	-	NULL	ENSG00000169918		0.597	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7A	HGNC	protein_coding	OTTHUMT00000251393.2	113	0.00	0	C	NM_130901		31776741	31776741	-1	no_errors	ENST00000382902	ensembl	human	known	69_37n	missense	85	13.27	13	SNP	1.000	T
PHLDB1	23187	genome.wustl.edu	37	11	118516531	118516531	+	Silent	SNP	C	C	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr11:118516531C>A	ENST00000361417.2	+	18	3906	c.3495C>A	c.(3493-3495)ctC>ctA	p.L1165L	PHLDB1_ENST00000524713.1_Silent_p.L308L|PHLDB1_ENST00000356063.5_Silent_p.L1118L|PHLDB1_ENST00000534672.1_3'UTR|PHLDB1_ENST00000527898.1_Silent_p.L216L	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	1165										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		AGAACCGGCTCATGGAGTCGA	0.592																																						dbGAP											0													180.0	156.0	164.0					11																	118516531		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.3495C>A	11.37:g.118516531C>A			B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Silent	SNP	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L1165	ENST00000361417.2	37	c.3495	CCDS8401.1	11																																																																																			PHLDB1	-	NULL	ENSG00000019144		0.592	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	HGNC	protein_coding	OTTHUMT00000389279.1	171	0.00	0	C	NM_015157		118516531	118516531	+1	no_errors	ENST00000361417	ensembl	human	known	69_37n	silent	168	11.11	21	SNP	1.000	A
PRAMEF2	65122	genome.wustl.edu	37	1	12919596	12919596	+	Silent	SNP	C	C	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr1:12919596C>T	ENST00000240189.2	+	3	423	c.336C>T	c.(334-336)ttC>ttT	p.F112F		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	112					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATGAGAATTTCTGGGCCAGAT	0.557																																						dbGAP											0													102.0	124.0	117.0					1																	12919596		2201	4293	6494	-	-	-	SO:0001819	synonymous_variant	0				CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.336C>T	1.37:g.12919596C>T				Silent	SNP	NULL	p.F112	ENST00000240189.2	37	c.336	CCDS149.1	1																																																																																			PRAMEF2	-	NULL	ENSG00000120952		0.557	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF2	HGNC	protein_coding	OTTHUMT00000005517.1	176	0.00	0	C	NM_023014		12919596	12919596	+1	no_errors	ENST00000240189	ensembl	human	known	69_37n	silent	81	37.21	48	SNP	0.062	T
PROSC	11212	genome.wustl.edu	37	8	37635577	37635577	+	Silent	SNP	C	C	T	rs202115195	byFrequency	TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr8:37635577C>T	ENST00000328195.3	+	8	850	c.783C>T	c.(781-783)tgC>tgT	p.C261C		NM_007198.3	NP_009129.1	O94903	PROSC_HUMAN	proline synthetase co-transcribed homolog (bacterial)	261					alpha-amino acid metabolic process (GO:1901605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)	pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)	7		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)		L-Proline(DB00172)	CGGACAAGTGCGCAGCAGACG	0.493													C|||	2	0.000399361	0.0	0.0	5008	,	,		18880	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													69.0	70.0	70.0					8																	37635577		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018566	CCDS6096.1	8p11.2	2008-01-07	2001-12-04		ENSG00000147471	ENSG00000147471			9457	protein-coding gene	gene with protein product		604436	"""proline synthetase co-transcribed (bacterial homolog)"""				Standard	NM_007198		Approved		uc003xkh.3	O94903	OTTHUMG00000164024	ENST00000328195.3:c.783C>T	8.37:g.37635577C>T			Q6FI94	Missense_Mutation	SNP	pfam_Ala_racemase_N,pirsf_UPF0001,tigrfam_UPF0001	p.A230V	ENST00000328195.3	37	c.689	CCDS6096.1	8	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	5.043	0.193652	0.09599	.	.	ENSG00000147471	ENST00000521494	.	.	.	5.54	-3.97	0.04094	.	.	.	.	.	T	0.26557	0.0649	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26395	-1.0104	4	.	.	.	-19.4422	5.7092	0.17925	0.2121:0.308:0.0:0.48	.	.	.	.	V	230	.	.	A	+	2	0	PROSC	37754735	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.670000	0.01956	-1.399000	0.02063	-0.751000	0.03497	GCG	PROSC	-	NULL	ENSG00000147471		0.493	PROSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSC	HGNC	protein_coding	OTTHUMT00000376796.1	80	0.00	0	C	NM_007198		37635577	37635577	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000521494	ensembl	human	putative	69_37n	missense	57	17.39	12	SNP	0.000	T
PTPRZ1	5803	genome.wustl.edu	37	7	121652195	121652195	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr7:121652195C>T	ENST00000393386.2	+	12	3506	c.3095C>T	c.(3094-3096)tCt>tTt	p.S1032F	PTPRZ1_ENST00000449182.1_Intron|PTPRZ1_ENST00000483028.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1032					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TATACAACATCTGTGTTTGGT	0.368																																						dbGAP											0													91.0	92.0	92.0					7																	121652195		2203	4300	6503	-	-	-	SO:0001583	missense	0			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.3095C>T	7.37:g.121652195C>T	ENSP00000377047:p.Ser1032Phe		A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a	p.S1032F	ENST00000393386.2	37	c.3095	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	C	16.17	3.046177	0.55110	.	.	ENSG00000106278	ENST00000393386	T	0.55234	0.53	5.47	5.47	0.80525	.	0.344873	0.29028	N	0.013367	T	0.67534	0.2903	M	0.67953	2.075	0.80722	D	1	D	0.71674	0.998	D	0.64042	0.921	T	0.70421	-0.4876	10	0.87932	D	0	.	12.6435	0.56721	0.0:0.9242:0.0:0.0758	.	1032	P23471	PTPRZ_HUMAN	F	1032	ENSP00000377047:S1032F	ENSP00000377047:S1032F	S	+	2	0	PTPRZ1	121439431	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	3.069000	0.50026	2.562000	0.86427	0.650000	0.86243	TCT	PTPRZ1	-	NULL	ENSG00000106278		0.368	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	117	0.00	0	C	NM_002851		121652195	121652195	+1	no_errors	ENST00000393386	ensembl	human	known	69_37n	missense	46	24.59	15	SNP	1.000	T
REM1	28954	genome.wustl.edu	37	20	30070112	30070112	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr20:30070112C>G	ENST00000201979.2	+	4	739	c.446C>G	c.(445-447)tCa>tGa	p.S149*		NM_014012.4	NP_054731.2	O75628	REM1_HUMAN	RAS (RAD and GEM)-like GTP-binding 1	149					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			kidney(3)|large_intestine(3)|lung(14)|pancreas(2)|upper_aerodigestive_tract(1)	23	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			AGCCAGGAGTCATGCCTGCAG	0.597																																						dbGAP											0													73.0	69.0	71.0					20																	30070112		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF152863	CCDS13181.1	20q11.21	2014-05-09	2004-04-14	2004-04-16	ENSG00000088320	ENSG00000088320			15922	protein-coding gene	gene with protein product	"""GTPase GES"""	610388	"""RAS (RAD and GEM)-like GTP-binding"""	REM		10831614, 14623965	Standard	NM_014012		Approved	GES	uc002wwa.3	O75628	OTTHUMG00000032168	ENST00000201979.2:c.446C>G	20.37:g.30070112C>G	ENSP00000201979:p.Ser149*		E1P5L1|Q5TZR7|Q5TZR8|Q9NP57	Nonsense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Fe2_transport_prot_B_N,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,pirsf_Small_GTPase_GEM/REM/Rad,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.S149*	ENST00000201979.2	37	c.446	CCDS13181.1	20	.	.	.	.	.	.	.	.	.	.	C	21.1	4.091350	0.76756	.	.	ENSG00000088320	ENST00000201979	.	.	.	4.82	0.0264	0.14150	.	1.236210	0.05702	N	0.594313	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	.	1.4788	0.02432	0.3671:0.3644:0.1225:0.146	.	.	.	.	X	149	.	ENSP00000201979:S149X	S	+	2	0	REM1	29533773	0.001000	0.12720	0.079000	0.20413	0.482000	0.33219	0.840000	0.27600	0.168000	0.19655	0.655000	0.94253	TCA	REM1	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Fe2_transport_prot_B_N,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,pirsf_Small_GTPase_GEM/REM/Rad,tigrfam_Small_GTP-bd_dom	ENSG00000088320		0.597	REM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REM1	HGNC	protein_coding	OTTHUMT00000078508.2	51	0.00	0	C	NM_014012		30070112	30070112	+1	no_errors	ENST00000201979	ensembl	human	known	69_37n	nonsense	53	10.17	6	SNP	0.000	G
RBPJL	11317	genome.wustl.edu	37	20	43936867	43936867	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr20:43936867G>T	ENST00000343694.3	+	2	179	c.107G>T	c.(106-108)cGg>cTg	p.R36L	MATN4_ENST00000372754.1_5'Flank|RBPJL_ENST00000372741.3_Missense_Mutation_p.R36L|MATN4_ENST00000537548.1_5'UTR|MATN4_ENST00000372751.4_5'UTR|MATN4_ENST00000353917.5_5'UTR|MATN4_ENST00000342716.4_5'UTR|RBPJL_ENST00000372743.1_Missense_Mutation_p.R36L|MATN4_ENST00000360607.6_5'UTR|MATN4_ENST00000372756.1_5'Flank	NM_001281448.1|NM_001281449.1|NM_014276.2	NP_001268377.1|NP_001268378.1|NP_055091.2	Q9UBG7	RBPJL_HUMAN	recombination signal binding protein for immunoglobulin kappa J region-like	36					positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Myeloproliferative disorder(115;0.0122)				GCCGACAGGCGGAGCCTCCCG	0.647																																						dbGAP											0													47.0	51.0	50.0					20																	43936867		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB024964	CCDS13349.1, CCDS63283.1, CCDS63284.1	20q13.12	2013-10-18	2007-02-26	2007-02-26	ENSG00000124232	ENSG00000124232			13761	protein-coding gene	gene with protein product			"""recombining binding protein suppressor of hairless (Drosophila)-like"""	RBPSUHL		9929984	Standard	NM_014276		Approved	RBP-L, SUH, SUHL	uc002xns.3	Q9UBG7	OTTHUMG00000033055	ENST00000343694.3:c.107G>T	20.37:g.43936867G>T	ENSP00000341243:p.Arg36Leu		O95723|Q5QPU9|Q5QPV0|Q9ULV9	Missense_Mutation	SNP	pfam_Beta-trefoil_DNA-bd_dom,pfam_LAG1_DNA-bd,superfamily_Beta-trefoil_DNA-bd_dom,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set	p.R36L	ENST00000343694.3	37	c.107	CCDS13349.1	20	.	.	.	.	.	.	.	.	.	.	G	13.59	2.283245	0.40394	.	.	ENSG00000124232	ENST00000372743;ENST00000372741;ENST00000343694	T;T;T	0.58652	1.17;0.32;1.17	4.19	-2.04	0.07343	.	1.212720	0.06149	N	0.673750	T	0.26702	0.0653	N	0.08118	0	0.23198	N	0.998136	B;B	0.23891	0.093;0.039	B;B	0.21151	0.033;0.012	T	0.15925	-1.0420	10	0.07325	T	0.83	-14.6857	1.3569	0.02184	0.2044:0.331:0.3069:0.1576	.	36;36	Q5QPV1;Q9UBG7	.;RBPJL_HUMAN	L	36	ENSP00000361828:R36L;ENSP00000361826:R36L;ENSP00000341243:R36L	ENSP00000341243:R36L	R	+	2	0	RBPJL	43370281	0.346000	0.24844	0.977000	0.42913	0.785000	0.44390	-0.251000	0.08818	-0.099000	0.12263	-0.448000	0.05591	CGG	RBPJL	-	NULL	ENSG00000124232		0.647	RBPJL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBPJL	HGNC	protein_coding	OTTHUMT00000080391.1	65	0.00	0	G	NM_014276		43936867	43936867	+1	no_errors	ENST00000343694	ensembl	human	known	69_37n	missense	41	24.07	13	SNP	0.882	T
RNF13	11342	genome.wustl.edu	37	3	149619889	149619889	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr3:149619889C>T	ENST00000344229.3	+	7	1142	c.440C>T	c.(439-441)tCt>tTt	p.S147F	RNF13_ENST00000392894.3_Missense_Mutation_p.S147F|RNF13_ENST00000361785.6_Missense_Mutation_p.S28F	NM_007282.4	NP_009213.1	O43567	RNF13_HUMAN	ring finger protein 13	147	PA.				protein autoubiquitination (GO:0051865)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	11		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GACATTCCATCTGTCTTTATT	0.264																																						dbGAP											0													54.0	57.0	56.0					3																	149619889		2189	4261	6450	-	-	-	SO:0001583	missense	0			AF037204	CCDS3146.1	3q25.1	2013-01-09			ENSG00000082996	ENSG00000082996		"""RING-type (C3HC4) zinc fingers"""	10057	protein-coding gene	gene with protein product		609247					Standard	NM_183381		Approved	RZF	uc003exp.4	O43567	OTTHUMG00000150338	ENST00000344229.3:c.440C>T	3.37:g.149619889C>T	ENSP00000341361:p.Ser147Phe		A6NC87|B3KR12|Q05D66|Q6IBJ9	Missense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.S147F	ENST00000344229.3	37	c.440	CCDS3146.1	3	.	.	.	.	.	.	.	.	.	.	C	27.6	4.850576	0.91277	.	.	ENSG00000082996	ENST00000392894;ENST00000344229;ENST00000491086;ENST00000467977;ENST00000543506;ENST00000459632;ENST00000466795;ENST00000361785;ENST00000482083	T;T;T;T;T;T;T;T	0.27557	3.24;3.24;2.29;1.66;3.24;3.24;2.2;2.3	5.69	5.69	0.88448	Protease-associated domain, PA (1);	0.000000	0.85682	D	0.000000	T	0.69169	0.3081	H	0.94385	3.53	0.80722	D	1	D;D	0.89917	1.0;0.976	D;D	0.85130	0.997;0.948	T	0.77869	-0.2427	10	0.72032	D	0.01	-22.1516	19.801	0.96507	0.0:1.0:0.0:0.0	.	28;147	B3KR12;O43567	.;RNF13_HUMAN	F	147;147;28;28;147;147;147;28;28	ENSP00000376628:S147F;ENSP00000341361:S147F;ENSP00000420667:S28F;ENSP00000418308:S28F;ENSP00000419069:S147F;ENSP00000417655:S147F;ENSP00000355268:S28F;ENSP00000418863:S28F	ENSP00000341361:S147F	S	+	2	0	RNF13	151102579	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.369000	0.79578	2.666000	0.90696	0.563000	0.77884	TCT	RNF13	-	pfam_Protease-assoc_domain	ENSG00000082996		0.264	RNF13-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF13	HGNC	protein_coding	OTTHUMT00000356876.1	80	0.00	0	C	NM_183384		149619889	149619889	+1	no_errors	ENST00000344229	ensembl	human	known	69_37n	missense	50	15.25	9	SNP	1.000	T
RNF169	254225	genome.wustl.edu	37	11	74546847	74546847	+	Missense_Mutation	SNP	G	G	A	rs561891285		TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr11:74546847G>A	ENST00000299563.4	+	6	1212	c.1199G>A	c.(1198-1200)cGt>cAt	p.R400H		NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169	400					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						CCTGATGGCCGTGTGCTAAGT	0.498													G|||	1	0.000199681	0.0	0.0	5008	,	,		20024	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													152.0	157.0	155.0					11																	74546847		2008	4186	6194	-	-	-	SO:0001583	missense	0			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516	ENST00000299563.4:c.1199G>A	11.37:g.74546847G>A	ENSP00000299563:p.Arg400His		Q6N015	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.R400H	ENST00000299563.4	37	c.1199	CCDS41691.1	11	.	.	.	.	.	.	.	.	.	.	G	22.6	4.314956	0.81358	.	.	ENSG00000166439	ENST00000299563	T	0.60797	0.16	5.99	5.99	0.97316	.	0.050987	0.85682	D	0.000000	T	0.74359	0.3706	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.76727	-0.2853	10	0.87932	D	0	-21.7865	11.2648	0.49104	0.0823:0.0:0.9177:0.0	.	400	Q8NCN4	RN169_HUMAN	H	400	ENSP00000299563:R400H	ENSP00000299563:R400H	R	+	2	0	RNF169	74224495	1.000000	0.71417	0.985000	0.45067	0.999000	0.98932	5.232000	0.65332	2.847000	0.97988	0.655000	0.94253	CGT	RNF169	-	NULL	ENSG00000166439		0.498	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF169	HGNC	protein_coding	OTTHUMT00000384741.1	97	0.00	0	G	XM_495886		74546847	74546847	+1	no_errors	ENST00000299563	ensembl	human	known	69_37n	missense	78	22.00	22	SNP	0.997	A
RSPH1	89765	genome.wustl.edu	37	21	43906485	43906485	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr21:43906485G>C	ENST00000291536.3	-	4	528	c.361C>G	c.(361-363)Caa>Gaa	p.Q121E	RSPH1_ENST00000398352.3_Missense_Mutation_p.Q83E	NM_080860.2	NP_543136.1	Q8WYR4	RSPH1_HUMAN	radial spoke head 1 homolog (Chlamydomonas)	121					axoneme assembly (GO:0035082)|meiotic nuclear division (GO:0007126)	cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleus (GO:0005634)				large_intestine(7)|lung(2)|ovary(1)|prostate(1)|stomach(1)	12						CCGAACCTTTGATGAGCAAAC	0.433																																					Esophageal Squamous(23;63 706 6286 10288 12913)	dbGAP											0													189.0	163.0	172.0					21																	43906485		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006536	CCDS13688.1, CCDS68210.1	21q22.3	2014-02-03	2007-06-25	2007-06-25	ENSG00000160188	ENSG00000160188			12371	protein-coding gene	gene with protein product	"""meichroacidin"""	609314	"""testis specific A2 homolog (mouse)"""	TSGA2		9403069, 9578619, 17451891	Standard	XM_005261208		Approved	FLJ32753, RSP44, RSPH10A, CILD24	uc002zbg.3	Q8WYR4	OTTHUMG00000086804	ENST00000291536.3:c.361C>G	21.37:g.43906485G>C	ENSP00000291536:p.Gln121Glu		A8MWV0|B2RBN9|Q3MJA1	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.Q121E	ENST00000291536.3	37	c.361	CCDS13688.1	21	.	.	.	.	.	.	.	.	.	.	G	10.11	1.259754	0.23051	.	.	ENSG00000160188	ENST00000291536;ENST00000398352	T;T	0.56444	0.46;0.46	5.39	5.39	0.77823	.	0.373912	0.30809	N	0.008835	T	0.48114	0.1482	L	0.38692	1.165	0.39215	D	0.963384	P	0.43542	0.81	P	0.49085	0.6	T	0.37979	-0.9682	10	0.05959	T	0.93	.	14.3041	0.66373	0.0:0.0:0.8158:0.1842	.	121	Q8WYR4	RSPH1_HUMAN	E	121;83	ENSP00000291536:Q121E;ENSP00000381395:Q83E	ENSP00000291536:Q121E	Q	-	1	0	RSPH1	42779554	1.000000	0.71417	1.000000	0.80357	0.139000	0.21198	1.651000	0.37302	2.704000	0.92352	0.555000	0.69702	CAA	RSPH1	-	pfam_MORN,smart_MORN	ENSG00000160188		0.433	RSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH1	HGNC	protein_coding	OTTHUMT00000195379.1	159	0.00	0	G			43906485	43906485	-1	no_errors	ENST00000291536	ensembl	human	known	69_37n	missense	138	12.10	19	SNP	1.000	C
SCN2A	6326	genome.wustl.edu	37	2	166201296	166201296	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr2:166201296T>A	ENST00000375437.2	+	16	3084	c.2794T>A	c.(2794-2796)Ttc>Atc	p.F932I	SCN2A_ENST00000375427.2_Missense_Mutation_p.F932I|SCN2A_ENST00000283256.6_Missense_Mutation_p.F932I|SCN2A_ENST00000357398.3_Missense_Mutation_p.F932I	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	932					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTTCCACTCCTTCCTGATCGT	0.498																																						dbGAP											0													257.0	225.0	236.0					2																	166201296		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.2794T>A	2.37:g.166201296T>A	ENSP00000364586:p.Phe932Ile		A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.F932I	ENST00000375437.2	37	c.2794	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	T	33	5.212558	0.95069	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.98876	-5.2;-5.2;-5.2;-5.2	5.21	5.21	0.72293	Ion transport (1);	0.000000	0.64402	D	0.000003	D	0.98915	0.9632	M	0.70108	2.13	0.58432	D	0.999998	D;D	0.89917	1.0;0.996	D;D	0.91635	0.999;0.998	D	0.99871	1.1096	10	0.87932	D	0	.	15.1186	0.72423	0.0:0.0:0.0:1.0	.	932;932	Q99250-2;Q99250	.;SCN2A_HUMAN	I	932	ENSP00000364586:F932I;ENSP00000349973:F932I;ENSP00000283256:F932I;ENSP00000364576:F932I	ENSP00000283256:F932I	F	+	1	0	SCN2A	165909542	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.918000	0.87506	1.970000	0.57323	0.528000	0.53228	TTC	SCN2A	-	pfam_Ion_trans_dom	ENSG00000136531		0.498	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	315	0.00	0	T	NM_021007		166201296	166201296	+1	no_errors	ENST00000283256	ensembl	human	known	69_37n	missense	276	18.82	64	SNP	1.000	A
SH3BP1	23616	genome.wustl.edu	37	22	38044419	38044419	+	Missense_Mutation	SNP	G	G	T	rs551887648		TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr22:38044419G>T	ENST00000357436.4	+	14	1606	c.1293G>T	c.(1291-1293)ttG>ttT	p.L431F	SH3BP1_ENST00000599616.1_Missense_Mutation_p.L367F|SH3BP1_ENST00000442465.2_Missense_Mutation_p.L431F|SH3BP1_ENST00000336738.5_Missense_Mutation_p.L431F|Z83844.1_ENST00000456099.1_RNA	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	431	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					GACCCAACTTGCTGTGGCCAC	0.587																																						dbGAP											0													49.0	38.0	42.0					22																	38044419		2195	4291	6486	-	-	-	SO:0001583	missense	0				CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.1293G>T	22.37:g.38044419G>T	ENSP00000350018:p.Leu431Phe		Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_BAR_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.L431F	ENST00000357436.4	37	c.1293	CCDS13952.2	22	.	.	.	.	.	.	.	.	.	.	G	16.64	3.179399	0.57800	.	.	ENSG00000100092	ENST00000357436;ENST00000336738;ENST00000442465;ENST00000397014	T;T;T	0.22539	1.95;1.95;1.95	5.24	3.09	0.35607	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.47455	D	0.000235	T	0.49881	0.1583	M	0.91406	3.205	0.46927	D	0.99925	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;1.0;0.995;1.0;1.0	T	0.51919	-0.8644	10	0.87932	D	0	.	7.9349	0.29925	0.0737:0.0:0.6423:0.284	.	431;345;367;431;345	F5GZA8;E7EUD3;Q6ZT62;Q9Y3L3;Q6ZTJ5	.;.;.;3BP1_HUMAN;.	F	431;431;431;345	ENSP00000350018:L431F;ENSP00000337213:L431F;ENSP00000395126:L431F	ENSP00000337213:L431F	L	+	3	2	SH3BP1	36374365	1.000000	0.71417	1.000000	0.80357	0.558000	0.35554	2.036000	0.41165	0.560000	0.29169	-0.208000	0.12717	TTG	SH3BP1	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000100092		0.587	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP1	HGNC	protein_coding	OTTHUMT00000075884.4	79	0.00	0	G	NM_018957		38044419	38044419	+1	no_errors	ENST00000357436	ensembl	human	known	69_37n	missense	93	19.13	22	SNP	1.000	T
SIPA1L2	57568	genome.wustl.edu	37	1	232581367	232581367	+	Silent	SNP	G	G	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr1:232581367G>A	ENST00000366630.1	-	10	3619	c.3261C>T	c.(3259-3261)ccC>ccT	p.P1087P	SIPA1L2_ENST00000262861.4_Silent_p.P1087P|SIPA1L2_ENST00000308942.4_Silent_p.P161P			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	1087					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GCAGCCGGTCGGGCGTGCCGG	0.657																																						dbGAP											0													24.0	32.0	29.0					1																	232581367		1961	4120	6081	-	-	-	SO:0001819	synonymous_variant	0			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.3261C>T	1.37:g.232581367G>A			Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Silent	SNP	pfam_DUF3401,pfam_Rap_GAP,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.P1087	ENST00000366630.1	37	c.3261	CCDS41474.1	1																																																																																			SIPA1L2	-	NULL	ENSG00000116991		0.657	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	HGNC	protein_coding	OTTHUMT00000092318.1	40	0.00	0	G	XM_045839		232581367	232581367	-1	no_errors	ENST00000262861	ensembl	human	known	69_37n	silent	72	21.74	20	SNP	0.797	A
SLC12A5	57468	genome.wustl.edu	37	20	44676722	44676722	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr20:44676722G>C	ENST00000454036.2	+	16	2128	c.2079G>C	c.(2077-2079)tgG>tgC	p.W693C	SLC12A5_ENST00000243964.3_Missense_Mutation_p.W670C	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	693					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCAAGAACTGGAGGTTAGTGG	0.592																																						dbGAP											0													62.0	45.0	51.0					20																	44676722		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.2079G>C	20.37:g.44676722G>C	ENSP00000387694:p.Trp693Cys		A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	pfam_AA-permease_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.W693C	ENST00000454036.2	37	c.2079	CCDS46610.1	20	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785864	0.70337	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	D;D	0.98876	-5.2;-5.2	3.82	3.82	0.43975	Amino acid permease domain (1);	0.294989	0.34802	N	0.003664	D	0.99426	0.9797	H	0.97659	4.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.98134	1.0432	10	0.87932	D	0	.	14.448	0.67364	0.0:0.0:1.0:0.0	.	693;670	Q9H2X9;Q9H2X9-2	S12A5_HUMAN;.	C	693;670	ENSP00000387694:W693C;ENSP00000243964:W670C	ENSP00000243964:W670C	W	+	3	0	SLC12A5	44110129	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	9.425000	0.97467	1.934000	0.56057	0.455000	0.32223	TGG	SLC12A5	-	pfam_AA-permease_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000124140		0.592	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	HGNC	protein_coding	OTTHUMT00000471538.1	93	0.00	0	G			44676722	44676722	+1	no_errors	ENST00000454036	ensembl	human	known	69_37n	missense	104	14.05	17	SNP	1.000	C
SLC22A3	6581	genome.wustl.edu	37	6	160858230	160858230	+	Silent	SNP	G	G	A	rs574015405		TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr6:160858230G>A	ENST00000275300.2	+	7	1427	c.1275G>A	c.(1273-1275)gcG>gcA	p.A425A	SLC22A3_ENST00000392145.1_Silent_p.A425A	NM_021977.3	NP_068812.1	O75751	S22A3_HUMAN	solute carrier family 22 (organic cation transporter), member 3	425					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|histamine uptake (GO:0051615)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|regulation of appetite (GO:0032098)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine transmembrane transporter activity (GO:0005329)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|toxin transporter activity (GO:0019534)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)	Adefovir Dipivoxil(DB00718)|Amphetamine(DB00182)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Colchicine(DB01394)|Desipramine(DB01151)|Dopamine(DB00988)|Estradiol(DB00783)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imipramine(DB00458)|Irinotecan(DB00762)|Lamivudine(DB00709)|Melphalan(DB01042)|Metformin(DB00331)|Methamphetamine(DB01577)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Phenoxybenzamine(DB00925)|Prazosin(DB00457)|Procainamide(DB01035)|Progesterone(DB00396)|Testosterone(DB00624)|Vincristine(DB00541)	TTGTCACTGCGTTCTTACCAG	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		17736	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													102.0	105.0	104.0					6																	160858230		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF078749	CCDS5277.1	6q25.3	2013-07-18	2013-07-18		ENSG00000146477	ENSG00000146477		"""Solute carriers"""	10967	protein-coding gene	gene with protein product		604842	"""solute carrier family 22 (extraneuronal monoamine transporter), member 3"""			9632645, 9933568	Standard	NM_021977		Approved	OCT3, EMT	uc003qti.4	O75751	OTTHUMG00000015953	ENST00000275300.2:c.1275G>A	6.37:g.160858230G>A			Q5SYN6|Q9UP02	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.A425	ENST00000275300.2	37	c.1275	CCDS5277.1	6																																																																																			SLC22A3	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000146477		0.493	SLC22A3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC22A3	HGNC	protein_coding	OTTHUMT00000042953.1	67	0.00	0	G	NM_021977		160858230	160858230	+1	no_errors	ENST00000392145	ensembl	human	known	69_37n	silent	57	16.18	11	SNP	0.997	A
SMEK1	55671	genome.wustl.edu	37	14	91948389	91948389	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr14:91948389G>A	ENST00000554943.1	-	4	561	c.446C>T	c.(445-447)tCa>tTa	p.S149L	SMEK1_ENST00000337238.4_Missense_Mutation_p.S149L|SMEK1_ENST00000555462.1_Intron|SMEK1_ENST00000428424.2_Intron|SMEK1_ENST00000554684.1_Missense_Mutation_p.S149L			Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1 (Dictyostelium)	149					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				NS(1)|endometrium(1)|kidney(1)|liver(1)|lung(1)|stomach(1)	6		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		AGGTAAAGATGATGCCACAAG	0.408																																						dbGAP											0													116.0	115.0	115.0					14																	91948389		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000714	CCDS9895.1, CCDS61532.1	14q32.12	2008-09-15	2006-10-12	2006-10-12		ENSG00000100796			20219	protein-coding gene	gene with protein product		610351	"""KIAA2010"""	KIAA2010		16085932, 18487071	Standard	XM_005267842		Approved	FLJ20707, MSTP033, FLFL1, smk-1, smk1	uc001xzm.3	Q6IN85		ENST00000554943.1:c.446C>T	14.37:g.91948389G>A	ENSP00000450883:p.Ser149Leu		Q69YK6|Q86U23|Q86YI7|Q8IVG1|Q9H3F1|Q9H7U8|Q9NV01|Q9NWP1	Missense_Mutation	SNP	pfam_DUF625,superfamily_ARM-type_fold	p.S149L	ENST00000554943.1	37	c.446		14	.	.	.	.	.	.	.	.	.	.	G	28.4	4.914166	0.92178	.	.	ENSG00000100796	ENST00000554684;ENST00000337238;ENST00000554943;ENST00000554390;ENST00000557018	T;T;T;T	0.46451	0.87;0.87;0.87;0.88	6.07	5.18	0.71444	.	0.052156	0.85682	N	0.000000	T	0.52008	0.1708	M	0.78285	2.405	0.80722	D	1	P;P;B	0.52316	0.952;0.945;0.291	B;P;B	0.47402	0.436;0.546;0.2	T	0.54596	-0.8270	10	0.29301	T	0.29	-4.8501	15.7799	0.78252	0.0657:0.0:0.9343:0.0	.	149;149;149	G3V5Z3;Q6IN85;Q6IN85-2	.;P4R3A_HUMAN;.	L	149	ENSP00000450864:S149L;ENSP00000337125:S149L;ENSP00000450883:S149L;ENSP00000452596:S149L	ENSP00000337125:S149L	S	-	2	0	SMEK1	91018142	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	1.550000	0.49438	0.655000	0.94253	TCA	SMEK1	-	NULL	ENSG00000100796		0.408	SMEK1-007	KNOWN	basic	protein_coding	SMEK1	HGNC	protein_coding	OTTHUMT00000411665.1	104	0.00	0	G	NM_032560		91948389	91948389	-1	no_errors	ENST00000554943	ensembl	human	known	69_37n	missense	56	22.22	16	SNP	1.000	A
SPECC1	92521	genome.wustl.edu	37	17	20156897	20156897	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr17:20156897C>T	ENST00000261503.5	+	10	2729	c.2678C>T	c.(2677-2679)tCa>tTa	p.S893L	SPECC1_ENST00000395527.4_Missense_Mutation_p.S893L|SPECC1_ENST00000395530.2_Missense_Mutation_p.S812L|SPECC1_ENST00000536879.1_Missense_Mutation_p.S233L|AC004702.2_ENST00000580225.1_lincRNA	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	893					cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		CTTCCCCTCTCAGGTAAATTA	0.448																																						dbGAP											0													80.0	66.0	71.0					17																	20156897		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.2678C>T	17.37:g.20156897C>T	ENSP00000261503:p.Ser893Leu		B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Nonsense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain	p.Q398*	ENST00000261503.5	37	c.1192	CCDS32590.1	17	.	.	.	.	.	.	.	.	.	.	C	12.66	2.004499	0.35320	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000536879;ENST00000395527	T;T	0.48522	0.81;0.81	4.68	4.68	0.58851	.	0.714120	0.13520	N	0.381725	T	0.40448	0.1117	L	0.44542	1.39	0.39875	D	0.973556	B;P;B	0.34615	0.011;0.459;0.128	B;B;B	0.33254	0.007;0.16;0.079	T	0.25363	-1.0134	10	0.27785	T	0.31	-8.8363	13.2978	0.60307	0.0:1.0:0.0:0.0	.	893;812;893	A8MV89;Q5M775-4;Q5M775	.;.;CYTSB_HUMAN	L	893;893;233;812	ENSP00000261503:S893L;ENSP00000438294:S233L	ENSP00000261503:S893L	S	+	2	0	SPECC1	20097489	0.997000	0.39634	0.999000	0.59377	0.346000	0.29079	3.786000	0.55431	2.593000	0.87608	0.650000	0.86243	TCA	SPECC1	-	NULL	ENSG00000128487		0.448	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	SPECC1	HGNC	protein_coding	OTTHUMT00000441206.1	96	0.00	0	C	NM_152904		20156897	20156897	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000581399	ensembl	human	putative	69_37n	nonsense	61	34.41	32	SNP	0.999	T
SUPT5H	6829	genome.wustl.edu	37	19	39957372	39957372	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr19:39957372G>T	ENST00000599117.1	+	14	1391	c.1024G>T	c.(1024-1026)Gct>Tct	p.A342S	SUPT5H_ENST00000432763.2_Missense_Mutation_p.A342S|SUPT5H_ENST00000598725.1_Missense_Mutation_p.A342S|SUPT5H_ENST00000359191.6_Missense_Mutation_p.A338S|SUPT5H_ENST00000402194.2_Missense_Mutation_p.A338S			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	342	Interaction with RNA polymerase II.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GCTGTTTGATGCTGAGAAGAT	0.592																																						dbGAP											0													87.0	87.0	87.0					19																	39957372		2203	4300	6503	-	-	-	SO:0001583	missense	0			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.1024G>T	19.37:g.39957372G>T	ENSP00000470252:p.Ala342Ser		O43279|Q59G52|Q99639	Missense_Mutation	SNP	pfam_TF_Spt5_NGN-domain,pfam_KOW,pfam_Spt5_N,superfamily_Translation_prot_SH3-like,smart_Transcrpt_antiterm_NusG_N,smart_KOW,pirsf_TF_Spt5	p.A342S	ENST00000599117.1	37	c.1024	CCDS12536.1	19	.	.	.	.	.	.	.	.	.	.	G	20.6	4.009516	0.75046	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.52125	0.1715	N	0.24115	0.695	0.80722	D	1	B;B	0.25206	0.12;0.073	B;B	0.29176	0.099;0.046	T	0.42882	-0.9425	8	.	.	.	-14.4677	19.1994	0.93704	0.0:0.0:1.0:0.0	.	338;342	O00267-2;O00267	.;SPT5H_HUMAN	S	342;338;320;342	.	.	A	+	1	0	SUPT5H	44649212	1.000000	0.71417	0.978000	0.43139	0.989000	0.77384	9.593000	0.98250	2.837000	0.97791	0.655000	0.94253	GCT	SUPT5H	-	pirsf_TF_Spt5	ENSG00000196235		0.592	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT5H	HGNC	protein_coding	OTTHUMT00000464918.1	90	0.00	0	G	NM_003169		39957372	39957372	+1	no_errors	ENST00000359191	ensembl	human	known	69_37n	missense	49	26.87	18	SNP	1.000	T
STRN4	29888	genome.wustl.edu	37	19	47242077	47242077	+	Silent	SNP	C	C	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr19:47242077C>T	ENST00000263280.6	-	2	400	c.351G>A	c.(349-351)cgG>cgA	p.R117R	STRN4_ENST00000539396.1_5'UTR|Y_RNA_ENST00000410682.1_RNA|STRN4_ENST00000391910.3_Silent_p.R117R	NM_001039877.1|NM_013403.2	NP_001034966.1|NP_037535.2	Q9NRL3	STRN4_HUMAN	striatin, calmodulin binding protein 4	117						cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000563)|all cancers(93;0.00138)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.035)		GCATCTTGATCCGCCGCACCA	0.587																																						dbGAP											0													208.0	174.0	185.0					19																	47242077		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF212940	CCDS12690.1, CCDS42581.1	19q13.32	2013-01-10			ENSG00000090372	ENSG00000090372		"""WD repeat domain containing"""	15721	protein-coding gene	gene with protein product		614767				10748158	Standard	XM_006723171		Approved	zinedin, ZIN	uc002pfm.3	Q9NRL3		ENST00000263280.6:c.351G>A	19.37:g.47242077C>T			A0A024R0V2|B4DQH7|F8VYA6|Q8NE53	Silent	SNP	pfam_WD40_repeat,pfam_Striatin_N,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R117	ENST00000263280.6	37	c.351	CCDS12690.1	19																																																																																			STRN4	-	pfam_Striatin_N	ENSG00000090372		0.587	STRN4-001	KNOWN	NMD_exception|basic|appris_candidate|CCDS	protein_coding	STRN4	HGNC	protein_coding	OTTHUMT00000466607.2	205	0.48	1	C			47242077	47242077	-1	no_errors	ENST00000391910	ensembl	human	known	69_37n	silent	157	10.29	18	SNP	1.000	T
SYDE2	84144	genome.wustl.edu	37	1	85624636	85624636	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr1:85624636T>C	ENST00000341460.5	-	7	3431	c.3382A>G	c.(3382-3384)Aaa>Gaa	p.K1128E		NM_032184.1	NP_115560.1	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2 (C. elegans)	1128					activation of Rho GTPase activity (GO:0032862)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	20				all cancers(265;0.0126)|Epithelial(280;0.0336)		CCATCCATTTTGCTATAATTT	0.348																																						dbGAP											0													100.0	92.0	95.0					1																	85624636		1840	4095	5935	-	-	-	SO:0001583	missense	0			AL834286	CCDS44169.1	1p22.3	2008-02-05		2005-08-09	ENSG00000097096	ENSG00000097096			25841	protein-coding gene	gene with protein product							Standard	NM_032184		Approved	FLJ13815	uc009wcm.3	Q5VT97	OTTHUMG00000009956	ENST00000341460.5:c.3382A>G	1.37:g.85624636T>C	ENSP00000340594:p.Lys1128Glu		Q5VT96|Q8NDB8|Q9H8A6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.K1128E	ENST00000341460.5	37	c.3382	CCDS44169.1	1	.	.	.	.	.	.	.	.	.	.	T	9.877	1.200542	0.22121	.	.	ENSG00000097096	ENST00000341460	T	0.07567	3.18	6.17	5.06	0.68205	.	0.375302	0.32753	N	0.005681	T	0.04588	0.0125	M	0.68317	2.08	0.09310	N	1	B	0.24533	0.105	B	0.18263	0.021	T	0.10382	-1.0632	10	0.52906	T	0.07	.	10.6827	0.45823	0.0:0.1238:0.0:0.8762	.	1128	Q5VT97	SYDE2_HUMAN	E	1128	ENSP00000340594:K1128E	ENSP00000340594:K1128E	K	-	1	0	SYDE2	85397224	0.998000	0.40836	0.567000	0.28434	0.682000	0.39822	2.454000	0.44979	2.371000	0.80710	0.533000	0.62120	AAA	SYDE2	-	NULL	ENSG00000097096		0.348	SYDE2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYDE2	HGNC	protein_coding	OTTHUMT00000127989.2	239	0.00	0	T			85624636	85624636	-1	no_errors	ENST00000341460	ensembl	human	known	69_37n	missense	180	11.33	23	SNP	0.080	C
SYT3	84258	genome.wustl.edu	37	19	51132591	51132591	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr19:51132591delG	ENST00000338916.4	-	4	1874	c.1241delC	c.(1240-1242)cctfs	p.P414fs	SYT3_ENST00000593901.1_Frame_Shift_Del_p.P414fs|SYT3_ENST00000600079.1_Frame_Shift_Del_p.P414fs|SYT3_ENST00000544769.1_Frame_Shift_Del_p.P414fs	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	414					calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		CGGGCGGTCAGGGGGCTGCTC	0.667																																						dbGAP											0													25.0	27.0	26.0					19																	51132591		2202	4299	6501	-	-	-	SO:0001589	frameshift_variant	0			AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.1241delC	19.37:g.51132591delG	ENSP00000340914:p.Pro414fs		Q8N5Z1|Q8N640	Frame_Shift_Del	DEL	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin,prints_C2_dom	p.P414fs	ENST00000338916.4	37	c.1241	CCDS12798.1	19																																																																																			SYT3	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	ENSG00000213023		0.667	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SYT3	HGNC	protein_coding	OTTHUMT00000464910.1	36	0.00	0	G	NM_032298		51132591	51132591	-1	no_errors	ENST00000338916	ensembl	human	known	69_37n	frame_shift_del	20	16.00	4	DEL	1.000	-
SYT9	143425	genome.wustl.edu	37	11	7334807	7334807	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr11:7334807A>G	ENST00000318881.6	+	3	916	c.679A>G	c.(679-681)Att>Gtt	p.I227V	SYT9_ENST00000396716.2_Missense_Mutation_p.I195V	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	227	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		ACTGAACTTCATTTTAAAATA	0.408																																						dbGAP											0													130.0	133.0	132.0					11																	7334807		2201	4296	6497	-	-	-	SO:0001583	missense	0			AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.679A>G	11.37:g.7334807A>G	ENSP00000324419:p.Ile227Val			Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin,prints_C2_dom	p.I227V	ENST00000318881.6	37	c.679	CCDS7778.1	11	.	.	.	.	.	.	.	.	.	.	A	12.33	1.904657	0.33628	.	.	ENSG00000170743	ENST00000396716;ENST00000318881	T;T	0.07444	3.19;3.19	5.87	5.87	0.94306	C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.000000	0.64402	D	0.000001	T	0.05547	0.0146	N	0.04880	-0.145	0.46678	D	0.999157	B	0.02656	0.0	B	0.08055	0.003	T	0.38585	-0.9654	10	0.62326	D	0.03	.	14.5226	0.67863	1.0:0.0:0.0:0.0	.	227	Q86SS6	SYT9_HUMAN	V	195;227	ENSP00000379944:I195V;ENSP00000324419:I227V	ENSP00000324419:I227V	I	+	1	0	SYT9	7291383	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.526000	0.81920	2.371000	0.80710	0.533000	0.62120	ATT	SYT9	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,prints_Synaptotagmin	ENSG00000170743		0.408	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT9	HGNC	protein_coding	OTTHUMT00000384483.1	184	0.00	0	A	NM_175733		7334807	7334807	+1	no_errors	ENST00000318881	ensembl	human	known	69_37n	missense	112	30.86	50	SNP	1.000	G
TEX14	56155	genome.wustl.edu	37	17	56688647	56688647	+	Silent	SNP	C	C	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr17:56688647C>T	ENST00000240361.8	-	10	1162	c.1077G>A	c.(1075-1077)caG>caA	p.Q359Q	TEX14_ENST00000349033.5_Silent_p.Q353Q|TEX14_ENST00000389934.3_Silent_p.Q353Q			Q8IWB6	TEX14_HUMAN	testis expressed 14	359	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CATCAGATATCTGGAGCAGCA	0.537																																						dbGAP											0													119.0	106.0	110.0					17																	56688647		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.1077G>A	17.37:g.56688647C>T			A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom	p.Q359	ENST00000240361.8	37	c.1077	CCDS56042.1	17																																																																																			TEX14	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000121101		0.537	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX14	HGNC	protein_coding	OTTHUMT00000445446.1	74	0.00	0	C			56688647	56688647	-1	no_errors	ENST00000240361	ensembl	human	known	69_37n	silent	52	11.86	7	SNP	0.944	T
TMEM38A	79041	genome.wustl.edu	37	19	16793232	16793232	+	Splice_Site	SNP	G	G	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr19:16793232G>T	ENST00000187762.2	+	4	558	c.467G>T	c.(466-468)gGt>gTt	p.G156V		NM_024074.1	NP_076979.1	Q9H6F2	TM38A_HUMAN	transmembrane protein 38A	156						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)	15						TGTCCTGTAGGTTCTGGTGTC	0.542																																						dbGAP											0													144.0	118.0	127.0					19																	16793232		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK025981	CCDS12349.1	19p13.11	2013-05-23				ENSG00000072954			28462	protein-coding gene	gene with protein product		611235				17611541	Standard	NM_024074		Approved	MGC3169, TRIC-A	uc002nes.3	Q9H6F2		ENST00000187762.2:c.467-1G>T	19.37:g.16793232G>T			A8K9P9	Missense_Mutation	SNP	pfam_TRIC_channel	p.G156V	ENST00000187762.2	37	c.467	CCDS12349.1	19	.	.	.	.	.	.	.	.	.	.	g	18.96	3.733982	0.69189	.	.	ENSG00000072954	ENST00000187762	.	.	.	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.83769	0.5326	M	0.84511	2.7	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85634	0.1272	8	.	.	.	.	17.6802	0.88240	0.0:0.0:1.0:0.0	.	156	Q9H6F2	TM38A_HUMAN	V	156	.	.	G	+	2	0	TMEM38A	16654232	1.000000	0.71417	0.975000	0.42487	0.257000	0.26127	9.513000	0.98010	2.392000	0.81423	0.655000	0.94253	GGT	TMEM38A	-	pfam_TRIC_channel	ENSG00000072954		0.542	TMEM38A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM38A	HGNC	protein_coding	OTTHUMT00000462841.1	134	0.00	0	G	NM_024074	Missense_Mutation	16793232	16793232	+1	no_errors	ENST00000187762	ensembl	human	known	69_37n	missense	128	24.26	41	SNP	1.000	T
TMEM63B	55362	genome.wustl.edu	37	6	44119646	44119646	+	Silent	SNP	C	C	T	rs574040377		TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr6:44119646C>T	ENST00000259746.9	+	19	1920	c.1737C>T	c.(1735-1737)atC>atT	p.I579I	TMEM63B_ENST00000323267.6_Silent_p.I579I			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	579					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			CAGCCTTTATCGGCAACGCCA	0.647											OREG0017465	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													113.0	81.0	92.0					6																	44119646		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.1737C>T	6.37:g.44119646C>T		921	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Missense_Mutation	SNP	pfam_DUF221	p.R395W	ENST00000259746.9	37	c.1183	CCDS34461.1	6	.	.	.	.	.	.	.	.	.	.	C	11.47	1.648179	0.29336	.	.	ENSG00000137216	ENST00000371893	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	T	0.55417	0.1919	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53954	-0.8365	4	.	.	.	.	12.9255	0.58258	0.0:0.9192:0.0:0.0808	.	.	.	.	L	508	.	.	S	+	2	0	TMEM63B	44227624	0.992000	0.36948	1.000000	0.80357	0.996000	0.88848	0.383000	0.20651	2.618000	0.88619	0.460000	0.39030	TCG	TMEM63B	-	pfam_DUF221	ENSG00000137216		0.647	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63B	HGNC	protein_coding	OTTHUMT00000040712.2	39	0.00	0	C	XM_166410		44119646	44119646	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000533121	ensembl	human	known	69_37n	missense	55	27.63	21	SNP	1.000	T
TNN	63923	genome.wustl.edu	37	1	175067625	175067625	+	Silent	SNP	C	C	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr1:175067625C>T	ENST00000239462.4	+	9	2126	c.2013C>T	c.(2011-2013)agC>agT	p.S671S		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	671	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		AGGAGCAGAGCAGCACAGTCC	0.637																																						dbGAP											0													105.0	95.0	98.0					1																	175067625		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2013C>T	1.37:g.175067625C>T			B9EGP3|Q5R360	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_Fibronectin_type3	p.S671	ENST00000239462.4	37	c.2013	CCDS30943.1	1																																																																																			TNN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000120332		0.637	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNN	HGNC	protein_coding	OTTHUMT00000084422.1	93	0.00	0	C	XM_040527		175067625	175067625	+1	no_errors	ENST00000239462	ensembl	human	known	69_37n	silent	88	27.42	34	SNP	0.139	T
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	65	0.00	0	C	NM_000546		7578406	7578406	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	34	40.35	23	SNP	1.000	T
TP53I3	9540	genome.wustl.edu	37	2	24303814	24303814	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr2:24303814C>T	ENST00000238721.4	-	3	1348	c.494G>A	c.(493-495)gGa>gAa	p.G165E	TP53I3_ENST00000407482.1_Missense_Mutation_p.G165E|TP53I3_ENST00000417886.1_5'UTR|FAM228B_ENST00000461972.1_3'UTR|TP53I3_ENST00000313482.4_Missense_Mutation_p.G165E|TP53I3_ENST00000335934.4_Missense_Mutation_p.G165E	NM_004881.4	NP_004872.2	Q53FA7	QORX_HUMAN	tumor protein p53 inducible protein 3	165					NADP metabolic process (GO:0006739)	extracellular vesicular exosome (GO:0070062)	NADPH binding (GO:0070402)|NADPH:quinone reductase activity (GO:0003960)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(2)|lung(3)|urinary_tract(2)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGAATAGCTCCAGCCATCCG	0.493																																						dbGAP											0													174.0	180.0	178.0					2																	24303814		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF010309	CCDS1708.1, CCDS56112.1	2p23.3	2009-06-12			ENSG00000115129	ENSG00000115129			19373	protein-coding gene	gene with protein product		605171				11919562, 10840161, 19349281	Standard	NM_004881		Approved	PIG3	uc002rez.2	Q53FA7	OTTHUMG00000090817	ENST00000238721.4:c.494G>A	2.37:g.24303814C>T	ENSP00000238721:p.Gly165Glu		D6W533|O14679|O14685|Q38G78|Q6JLE7|Q9BWB8	Missense_Mutation	SNP	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER,tigrfam_Quinone_OxRdtase_PIG3	p.G165E	ENST00000238721.4	37	c.494	CCDS1708.1	2	.	.	.	.	.	.	.	.	.	.	C	9.244	1.038962	0.19669	.	.	ENSG00000115129	ENST00000335934;ENST00000238721;ENST00000313482;ENST00000407482;ENST00000413037	T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51	5.14	3.35	0.38373	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.179002	0.47852	D	0.000201	T	0.68384	0.2995	M	0.91459	3.21	0.09310	N	1	D;P;D	0.57571	0.98;0.9;0.957	P;P;P	0.53722	0.733;0.527;0.585	T	0.64347	-0.6429	10	0.87932	D	0	-28.4193	8.8787	0.35360	0.0:0.7411:0.0:0.2589	.	76;165;165	B4DMQ7;Q53FA7;Q53FA7-2	.;QORX_HUMAN;.	E	165;165;165;165;160	ENSP00000337834:G165E;ENSP00000238721:G165E;ENSP00000322298:G165E;ENSP00000384414:G165E;ENSP00000389620:G160E	ENSP00000238721:G165E	G	-	2	0	TP53I3	24157318	0.584000	0.26766	0.008000	0.14137	0.005000	0.04900	3.200000	0.51051	0.688000	0.31529	-0.291000	0.09656	GGA	TP53I3	-	pfam_ADH_C,smart_PKS_ER,tigrfam_Quinone_OxRdtase_PIG3	ENSG00000115129		0.493	TP53I3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53I3	HGNC	protein_coding	OTTHUMT00000207618.2	123	0.00	0	C	NM_004881		24303814	24303814	-1	no_errors	ENST00000238721	ensembl	human	known	69_37n	missense	119	11.19	15	SNP	0.061	T
TRAM2	9697	genome.wustl.edu	37	6	52370475	52370475	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr6:52370475G>C	ENST00000182527.3	-	9	796	c.797C>G	c.(796-798)gCc>gGc	p.A266G	EFHC1_ENST00000433625.2_Intron	NM_012288.3	NP_036420.1	Q15035	TRAM2_HUMAN	translocation associated membrane protein 2	266	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				collagen biosynthetic process (GO:0032964)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(1)|lung(7)|prostate(1)|skin(1)	13	Lung NSC(77;0.109)					AAAGCCAATGGCCAGCACGGC	0.532																																						dbGAP											0													108.0	106.0	107.0					6																	52370475		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31762	CCDS34477.1	6p21.1-p12	2008-02-05			ENSG00000065308	ENSG00000065308			16855	protein-coding gene	gene with protein product		608485				7584044, 10594243	Standard	NM_012288		Approved	KIAA0057	uc003paq.3	Q15035	OTTHUMG00000014850	ENST00000182527.3:c.797C>G	6.37:g.52370475G>C	ENSP00000182527:p.Ala266Gly		A8K6T6	Missense_Mutation	SNP	pfam_TRAM1,pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	p.A266G	ENST00000182527.3	37	c.797	CCDS34477.1	6	.	.	.	.	.	.	.	.	.	.	G	19.66	3.868533	0.72065	.	.	ENSG00000065308	ENST00000182527	.	.	.	5.44	5.44	0.79542	TRAM/LAG1/CLN8 homology domain (3);	0.298035	0.41712	D	0.000828	T	0.34424	0.0897	L	0.44542	1.39	0.45097	D	0.998113	B	0.31459	0.324	B	0.31442	0.13	T	0.32824	-0.9892	9	0.40728	T	0.16	.	10.4129	0.44305	0.1197:0.0:0.8803:0.0	.	266	Q15035	TRAM2_HUMAN	G	266	.	ENSP00000182527:A266G	A	-	2	0	TRAM2	52478434	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.302000	0.65733	2.576000	0.86940	0.561000	0.74099	GCC	TRAM2	-	pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	ENSG00000065308		0.532	TRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAM2	HGNC	protein_coding	OTTHUMT00000040910.1	103	0.00	0	G	NM_012288		52370475	52370475	-1	no_errors	ENST00000182527	ensembl	human	known	69_37n	missense	80	44.44	64	SNP	1.000	C
USP6	9098	genome.wustl.edu	37	17	5036239	5036239	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr17:5036239G>T	ENST00000574788.1	+	13	2460	c.230G>T	c.(229-231)tGg>tTg	p.W77L	USP6_ENST00000572429.1_3'UTR|USP6_ENST00000332776.4_Missense_Mutation_p.W77L|USP6_ENST00000304328.5_5'UTR|USP6_ENST00000250066.6_Missense_Mutation_p.W77L			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	77					cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						ACGAGCAAGTGGATGGAAATG	0.532			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																	dbGAP		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0													168.0	189.0	182.0					17																	5036239		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.230G>T	17.37:g.5036239G>T	ENSP00000460380:p.Trp77Leu		Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Peptidase_C19	p.W77L	ENST00000574788.1	37	c.230	CCDS11069.2	17	.	.	.	.	.	.	.	.	.	.	G	11.70	1.715504	0.30413	.	.	ENSG00000129204	ENST00000332776;ENST00000250066	T;T	0.31510	1.49;1.49	0.0465	0.0465	0.14256	Rab-GAP/TBC domain (1);	0.102480	0.64402	D	0.000002	T	0.47040	0.1424	M	0.89534	3.04	0.80722	D	1	P;P	0.48350	0.909;0.909	P;P	0.50440	0.641;0.641	T	0.56589	-0.7954	9	0.87932	D	0	.	.	.	.	.	77;77	B9A6N0;P35125	.;UBP6_HUMAN	L	77	ENSP00000328010:W77L;ENSP00000250066:W77L	ENSP00000250066:W77L	W	+	2	0	USP6	4976963	1.000000	0.71417	0.011000	0.14972	0.011000	0.07611	1.666000	0.37460	0.132000	0.18615	0.134000	0.15878	TGG	USP6	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000129204		0.532	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP6	HGNC	protein_coding	OTTHUMT00000438990.1	248	0.40	1	G	NM_004505		5036239	5036239	+1	no_errors	ENST00000250066	ensembl	human	known	69_37n	missense	219	13.78	35	SNP	1.000	T
VPS13B	157680	genome.wustl.edu	37	8	100866232	100866232	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr8:100866232G>C	ENST00000358544.2	+	56	10801	c.10690G>C	c.(10690-10692)Ggt>Cgt	p.G3564R	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.G3539R	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3564					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CCTCTCCGGGGGTAAACAGGT	0.498																																					Colon(161;2205 2542 7338 31318)	dbGAP											0													85.0	85.0	85.0					8																	100866232		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.10690G>C	8.37:g.100866232G>C	ENSP00000351346:p.Gly3564Arg		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.G3564R	ENST00000358544.2	37	c.10690	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.567414	0.00895	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.69040	-0.37;-0.37	5.41	3.51	0.40186	.	0.804670	0.10901	N	0.621569	T	0.47266	0.1436	N	0.25485	0.75	0.09310	N	1	B;B	0.26258	0.145;0.09	B;B	0.28232	0.087;0.063	T	0.36311	-0.9753	10	0.11794	T	0.64	.	3.5267	0.07761	0.1177:0.2186:0.5201:0.1436	.	3539;3564	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	R	3539;3564	ENSP00000349685:G3539R;ENSP00000351346:G3564R	ENSP00000349685:G3539R	G	+	1	0	VPS13B	100935408	0.000000	0.05858	0.001000	0.08648	0.030000	0.12068	0.755000	0.26405	1.209000	0.43321	0.650000	0.86243	GGT	VPS13B	-	NULL	ENSG00000132549		0.498	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	72	0.00	0	G	NM_184042		100866232	100866232	+1	no_errors	ENST00000358544	ensembl	human	known	69_37n	missense	69	20.69	18	SNP	0.000	C
WDR81	124997	genome.wustl.edu	37	17	1630415	1630415	+	Missense_Mutation	SNP	T	T	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr17:1630415T>G	ENST00000409644.1	+	1	2162	c.2162T>G	c.(2161-2163)cTt>cGt	p.L721R	WDR81_ENST00000437219.2_Intron|WDR81_ENST00000309182.5_Intron|WDR81_ENST00000446363.1_Intron|WDR81_ENST00000419248.1_Intron|RP11-961A15.1_ENST00000576540.1_RNA	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	721					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		AGGATTCTTCTTCCCGAGGGC	0.617																																						dbGAP											0													28.0	33.0	31.0					17																	1630415		692	1589	2281	-	-	-	SO:0001583	missense	0			AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.2162T>G	17.37:g.1630415T>G	ENSP00000386609:p.Leu721Arg		B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Kinase-like_dom,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L721R	ENST00000409644.1	37	c.2162	CCDS54062.1	17	.	.	.	.	.	.	.	.	.	.	T	14.83	2.653863	0.47362	.	.	ENSG00000167716	ENST00000409644	T	0.67523	-0.27	5.5	5.5	0.81552	.	.	.	.	.	T	0.79100	0.4389	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.81953	-0.0697	6	0.87932	D	0	.	15.5991	0.76611	0.0:0.0:0.0:1.0	.	.	.	.	R	721	ENSP00000386609:L721R	ENSP00000386609:L721R	L	+	2	0	WDR81	1577165	1.000000	0.71417	0.993000	0.49108	0.365000	0.29674	7.920000	0.87521	2.085000	0.62840	0.459000	0.35465	CTT	WDR81	-	NULL	ENSG00000167716		0.617	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR81	HGNC	protein_coding	OTTHUMT00000333118.2	22	0.00	0	T	NM_152348		1630415	1630415	+1	no_errors	ENST00000409644	ensembl	human	known	69_37n	missense	22	25.81	8	SNP	1.000	G
ZFHX4	79776	genome.wustl.edu	37	8	77761274	77761274	+	Silent	SNP	G	G	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr8:77761274G>C	ENST00000521891.2	+	7	4003	c.3555G>C	c.(3553-3555)ggG>ggC	p.G1185G	ZFHX4_ENST00000518282.1_Silent_p.G1159G|ZFHX4_ENST00000050961.6_Silent_p.G1140G|ZFHX4_ENST00000455469.2_Silent_p.G1140G	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1140					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GTGTGGCAGGGGGTACCCAGC	0.388										HNSCC(33;0.089)																												dbGAP											0													33.0	35.0	35.0					8																	77761274		1810	4047	5857	-	-	-	SO:0001819	synonymous_variant	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.3555G>C	8.37:g.77761274G>C			G3V138|Q18PS0|Q6ZN20	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.G1185	ENST00000521891.2	37	c.3555	CCDS47878.2	8																																																																																			ZFHX4	-	NULL	ENSG00000091656		0.388	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	65	0.00	0	G	NM_024721		77761274	77761274	+1	no_errors	ENST00000521891	ensembl	human	known	69_37n	silent	92	11.54	12	SNP	0.991	C
ZNF365	22891	genome.wustl.edu	37	10	64136169	64136169	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr10:64136169C>A	ENST00000395254.3	+	2	497	c.217C>A	c.(217-219)Cta>Ata	p.L73I	ZNF365_ENST00000410046.3_Missense_Mutation_p.L73I|ZNF365_ENST00000395255.3_Missense_Mutation_p.L73I|ZNF365_ENST00000466727.1_Intron	NM_014951.2	NP_055766.2	Q70YC4	TALAN_HUMAN	zinc finger protein 365	0										breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					AGACACAGACCTAGTCACTTC	0.468																																						dbGAP											0													98.0	94.0	96.0					10																	64136169		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000395254.3:c.217C>A	10.37:g.64136169C>A	ENSP00000378674:p.Leu73Ile			Missense_Mutation	SNP	NULL	p.L73I	ENST00000395254.3	37	c.217	CCDS31209.1	10	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756390	0.89843	.	.	ENSG00000138311	ENST00000395254;ENST00000395255;ENST00000410046	T;T;T	0.35789	1.29;1.29;1.29	5.4	5.4	0.78164	.	0.222611	0.30519	N	0.009456	T	0.59622	0.2207	M	0.75264	2.295	0.80722	D	1	D;D;D;D	0.71674	0.996;0.995;0.995;0.998	P;P;P;P	0.60609	0.851;0.793;0.793;0.877	T	0.63642	-0.6591	10	0.72032	D	0.01	.	19.1753	0.93601	0.0:1.0:0.0:0.0	.	73;73;73;88	Q70YC5-3;Q70YC5-2;Q70YC5;Q70YC5-4	.;.;ZN365_HUMAN;.	I	73	ENSP00000378674:L73I;ENSP00000378675:L73I;ENSP00000387091:L73I	ENSP00000378674:L73I	L	+	1	2	ZNF365	63806175	0.004000	0.15560	0.986000	0.45419	0.978000	0.69477	0.340000	0.19892	2.535000	0.85469	0.555000	0.69702	CTA	ZNF365	-	NULL	ENSG00000138311		0.468	ZNF365-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF365	HGNC	protein_coding	OTTHUMT00000048238.2	148	0.00	0	C	NM_014951		64136169	64136169	+1	no_errors	ENST00000410046	ensembl	human	known	69_37n	missense	121	19.33	29	SNP	1.000	A
ZNF460	10794	genome.wustl.edu	37	19	57803047	57803047	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr19:57803047G>C	ENST00000360338.3	+	3	1460	c.1138G>C	c.(1138-1140)Gtc>Ctc	p.V380L	ZNF460_ENST00000537645.1_Missense_Mutation_p.V339L	NM_006635.3	NP_006626.3	Q14592	ZN460_HUMAN	zinc finger protein 460	380					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TTCCACCTATGTCCTGCATGA	0.478																																						dbGAP											0													84.0	85.0	85.0					19																	57803047		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78931	CCDS12949.1	19q13.4	2013-01-08				ENSG00000197714		"""Zinc fingers, C2H2-type"", ""-"""	21628	protein-coding gene	gene with protein product		604755	"""zinc finger protein 272"""	ZNF272		15004467	Standard	NM_006635		Approved	HZF8	uc002qog.2	Q14592		ENST00000360338.3:c.1138G>C	19.37:g.57803047G>C	ENSP00000353491:p.Val380Leu		A4FU64|B4DNX9|Q2VPC7|Q6VSF8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V380L	ENST00000360338.3	37	c.1138	CCDS12949.1	19	.	.	.	.	.	.	.	.	.	.	G	1.076	-0.668485	0.03403	.	.	ENSG00000197714	ENST00000537645;ENST00000360338	T;T	0.22336	3.18;1.96	1.68	0.618	0.17624	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11024	0.0269	N	0.16233	0.39	0.09310	N	1	B	0.21688	0.059	B	0.17098	0.017	T	0.30268	-0.9984	9	0.36615	T	0.2	.	5.0551	0.14529	0.6391:0.0:0.3609:0.0	.	380	Q14592	ZN460_HUMAN	L	339;380	ENSP00000446167:V339L;ENSP00000353491:V380L	ENSP00000353491:V380L	V	+	1	0	ZNF460	62494859	0.000000	0.05858	0.018000	0.16275	0.008000	0.06430	-1.854000	0.01664	0.123000	0.18342	-0.312000	0.09012	GTC	ZNF460	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197714		0.478	ZNF460-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF460	HGNC	protein_coding	OTTHUMT00000465727.1	182	0.00	0	G	NM_006635		57803047	57803047	+1	no_errors	ENST00000360338	ensembl	human	known	69_37n	missense	109	19.85	27	SNP	0.037	C
ZP2	7783	genome.wustl.edu	37	16	21209118	21209118	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A129-01A-21D-A10M-09	TCGA-AO-A129-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cdf43c25-3ba7-4073-a92d-4a97f651f4a8	c60ba4ed-706e-4e4b-bfcc-8ec36ff0fbd8	g.chr16:21209118C>G	ENST00000574002.1	-	19	2546	c.2064G>C	c.(2062-2064)agG>agC	p.R688S	ZP2_ENST00000574091.1_Missense_Mutation_p.R679S|AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000219593.4_Missense_Mutation_p.R688S			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	688					binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		CTGTTTCACTCCTACTCTTCT	0.463																																						dbGAP											0													209.0	170.0	183.0					16																	21209118		2200	4300	6500	-	-	-	SO:0001583	missense	0			M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.2064G>C	16.37:g.21209118C>G	ENSP00000460971:p.Arg688Ser		B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.R688S	ENST00000574002.1	37	c.2064	CCDS10596.1	16	.	.	.	.	.	.	.	.	.	.	C	0.721	-0.783697	0.02907	.	.	ENSG00000103310	ENST00000219593	T	0.75367	-0.93	2.99	-0.223	0.13118	.	7.172440	0.00166	N	0.000000	T	0.53222	0.1783	N	0.08118	0	0.09310	N	1	B;B	0.22604	0.072;0.026	B;B	0.16289	0.015;0.015	T	0.46456	-0.9190	10	0.54805	T	0.06	23.2527	2.5767	0.04808	0.2301:0.5007:0.0:0.2692	.	679;688	Q4VAP1;Q05996	.;ZP2_HUMAN	S	688	ENSP00000219593:R688S	ENSP00000219593:R688S	R	-	3	2	ZP2	21116619	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.083000	0.03397	0.007000	0.14760	0.561000	0.74099	AGG	ZP2	-	NULL	ENSG00000103310		0.463	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZP2	HGNC	protein_coding	OTTHUMT00000207365.2	328	0.30	1	C			21209118	21209118	-1	no_errors	ENST00000219593	ensembl	human	known	69_37n	missense	317	12.43	45	SNP	0.000	G
