#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACOT11	26027	genome.wustl.edu	37	1	55059671	55059671	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr1:55059671A>G	ENST00000371316.3	+	5	512	c.430A>G	c.(430-432)Aag>Gag	p.K144E	ACOT11_ENST00000481208.1_3'UTR|ACOT11_ENST00000343744.2_Missense_Mutation_p.K144E	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	144	Acyl coenzyme A hydrolase 1.				fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)	p.K144*(1)		NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						GAATGTGTGCAAGGCCTTGGC	0.607																																					Ovarian(148;1440 1861 22015 32453 51933)	dbGAP											1	Substitution - Nonsense(1)	ovary(1)											91.0	84.0	87.0					1																	55059671		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.430A>G	1.37:g.55059671A>G	ENSP00000360366:p.Lys144Glu		B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Missense_Mutation	SNP	pfam_START_lipid-bd,pfam_Thioestr_supf,smart_START_lipid-bd,pfscan_START_lipid-bd	p.K144E	ENST00000371316.3	37	c.430	CCDS592.1	1	.	.	.	.	.	.	.	.	.	.	A	11.16	1.556369	0.27827	.	.	ENSG00000162390	ENST00000343744;ENST00000371316	T;T	0.39406	1.08;1.08	5.05	5.05	0.67936	.	0.200555	0.52532	D	0.000063	T	0.15392	0.0371	N	0.02213	-0.635	0.37679	D	0.923414	B;B	0.15141	0.012;0.005	B;B	0.18263	0.009;0.021	T	0.19451	-1.0305	10	0.02654	T	1	-15.7356	9.361	0.38195	0.92:0.0:0.08:0.0	.	144;144	Q8WXI4;Q8WXI4-2	ACO11_HUMAN;.	E	144	ENSP00000340260:K144E;ENSP00000360366:K144E	ENSP00000340260:K144E	K	+	1	0	ACOT11	54832259	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.582000	0.60957	1.895000	0.54865	0.459000	0.35465	AAG	ACOT11	-	NULL	ENSG00000162390		0.607	ACOT11-001	KNOWN	basic|CCDS	protein_coding	ACOT11	HGNC	protein_coding	OTTHUMT00000027356.1	10	0.00	0	A	NM_015547		55059671	55059671	+1	no_errors	ENST00000371316	ensembl	human	known	69_37n	missense	20	33.33	10	SNP	1.000	G
ATHL1	80162	genome.wustl.edu	37	11	293153	293153	+	Intron	SNP	G	G	T			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr11:293153G>T	ENST00000409548.2	+	8	1385				ATHL1_ENST00000409479.1_Missense_Mutation_p.V448L|ATHL1_ENST00000409655.1_Intron	NM_025092.4	NP_079368.3	Q32M88	ATHL1_HUMAN	ATH1, acid trehalase-like 1 (yeast)						carbohydrate metabolic process (GO:0005975)		hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|skin(3)	17		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.38e-28)|Epithelial(43;3.25e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		TCTTGGACTTGTGTGTCCAGG	0.572																																						dbGAP											0													258.0	222.0	234.0					11																	293153		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AK090428	CCDS31322.2	11p15.5	2005-10-27			ENSG00000142102	ENSG00000142102			26210	protein-coding gene	gene with protein product							Standard	NM_025092		Approved	FLJ22635	uc010qvu.2	Q32M88	OTTHUMG00000153218	ENST00000409548.2:c.1271-10G>T	11.37:g.293153G>T			Q658X8|Q8TEG9|Q9H635	Missense_Mutation	SNP	pfam_Glyco_hydro_65_M,superfamily_6-hairpin_glycosidase-like	p.V448L	ENST00000409548.2	37	c.1342	CCDS31322.2	11	.	.	.	.	.	.	.	.	.	.	G	10.94	1.492038	0.26774	.	.	ENSG00000142102	ENST00000409479	.	.	.	2.59	-2.65	0.06095	.	.	.	.	.	T	0.22399	0.0540	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21109	-1.0255	7	0.23891	T	0.37	.	6.76	0.23536	0.2569:0.1475:0.5957:0.0	.	448	E7EMA9	.	L	448	.	ENSP00000387099:V448L	V	+	1	0	ATHL1	283153	0.000000	0.05858	0.012000	0.15200	0.245000	0.25701	-2.790000	0.00767	-0.607000	0.05738	0.549000	0.68633	GTG	ATHL1	-	superfamily_6-hairpin_glycosidase-like	ENSG00000142102		0.572	ATHL1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATHL1	HGNC	protein_coding	OTTHUMT00000330164.3	35	0.00	0	G	NM_025092		293153	293153	+1	no_errors	ENST00000409479	ensembl	human	novel	69_37n	missense	14	58.82	20	SNP	0.000	T
ATG2A	23130	genome.wustl.edu	37	11	64665325	64665325	+	Silent	SNP	C	C	T			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr11:64665325C>T	ENST00000377264.3	-	35	5092	c.4980G>A	c.(4978-4980)caG>caA	p.Q1660Q	ATG2A_ENST00000421419.2_Silent_p.Q1662Q	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1660					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						AGTAGATGGGCTGCTGGTCAG	0.677																																						dbGAP											0													26.0	31.0	29.0					11																	64665325		2199	4289	6488	-	-	-	SO:0001819	synonymous_variant	0				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.4980G>A	11.37:g.64665325C>T			O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.A1464T	ENST00000377264.3	37	c.4390	CCDS31602.1	11	.	.	.	.	.	.	.	.	.	.	C	2.949	-0.217174	0.06101	.	.	ENSG00000110046	ENST00000418259	.	.	.	4.38	3.46	0.39613	.	.	.	.	.	T	0.58250	0.2109	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54616	-0.8267	4	.	.	.	.	8.3492	0.32292	0.0:0.8915:0.0:0.1085	.	.	.	.	T	1464	.	.	A	-	1	0	ATG2A	64421901	1.000000	0.71417	1.000000	0.80357	0.451000	0.32288	0.777000	0.26718	1.196000	0.43129	0.561000	0.74099	GCC	ATG2A	-	NULL	ENSG00000110046		0.677	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATG2A	HGNC	protein_coding	OTTHUMT00000143224.1	9	0.00	0	C	NM_015104		64665325	64665325	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000418259	ensembl	human	novel	69_37n	missense	4	55.56	5	SNP	1.000	T
BMP15	9210	genome.wustl.edu	37	X	50659109	50659109	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chrX:50659109G>C	ENST00000252677.3	+	2	681	c.681G>C	c.(679-681)ttG>ttC	p.L227F		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	227					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					CTTCATCCTTGGACATTGCCT	0.443																																						dbGAP											0													146.0	115.0	126.0					X																	50659109		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.681G>C	X.37:g.50659109G>C	ENSP00000252677:p.Leu227Phe		Q17RM6|Q5JST1|Q9UMS1	Missense_Mutation	SNP	pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu	p.L227F	ENST00000252677.3	37	c.681	CCDS14334.1	X	.	.	.	.	.	.	.	.	.	.	g	8.058	0.767544	0.15983	.	.	ENSG00000130385	ENST00000252677	T	0.81330	-1.48	5.43	0.112	0.14623	.	1.080390	0.07020	N	0.826701	T	0.78761	0.4334	M	0.67953	2.075	0.09310	N	1	P	0.51933	0.949	P	0.46479	0.518	T	0.65467	-0.6161	10	0.49607	T	0.09	.	3.8145	0.08809	0.0825:0.3272:0.3593:0.2309	.	227	O95972	BMP15_HUMAN	F	227	ENSP00000252677:L227F	ENSP00000252677:L227F	L	+	3	2	BMP15	50675849	0.251000	0.23961	0.102000	0.21198	0.005000	0.04900	0.098000	0.15189	0.118000	0.18165	-0.301000	0.09380	TTG	BMP15	-	NULL	ENSG00000130385		0.443	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP15	HGNC	protein_coding	OTTHUMT00000056572.1	75	0.00	0	G	NM_005448		50659109	50659109	+1	no_errors	ENST00000252677	ensembl	human	known	69_37n	missense	64	40.19	43	SNP	0.004	C
CASP8AP2	9994	genome.wustl.edu	37	6	90564540	90564540	+	RNA	SNP	C	C	T			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr6:90564540C>T	ENST00000551025.1	+	0	1566									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TTTTAGACAGCGCTTCCAAAT	0.348																																					Colon(187;1656 2025 17045 31481 39901)	dbGAP											0													58.0	53.0	54.0					6																	90564540		1831	4081	5912	-	-	-			0			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90564540C>T				RNA	SNP	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			CASP8AP2	-	-	ENSG00000118412		0.348	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript		133	0.00	0	C	NM_001137667		90564540	90564540	+1	no_errors	ENST00000237177	ensembl	human	known	69_37n	rna	119	26.99	44	SNP	0.000	T
CCDC144A	9720	genome.wustl.edu	37	17	16638032	16638032	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr17:16638032A>T	ENST00000360524.8	+	12	2523	c.2447A>T	c.(2446-2448)gAt>gTt	p.D816V	CCDC144A_ENST00000443444.2_Missense_Mutation_p.D816V|CCDC144A_ENST00000399273.1_Missense_Mutation_p.D816V|CCDC144A_ENST00000456009.1_Missense_Mutation_p.D536V|RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.D816V	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	816																	AAAGAAAAGGATCTCTTTCAT	0.308																																						dbGAP											0													17.0	15.0	16.0					17																	16638032		1824	4071	5895	-	-	-	SO:0001583	missense	0			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.2447A>T	17.37:g.16638032A>T	ENSP00000353717:p.Asp816Val		O60311|Q6ZU57	Missense_Mutation	SNP	pfam_DUF3496	p.D816V	ENST00000360524.8	37	c.2447	CCDS45621.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	8.724|8.724	0.915033|0.915033	0.17907|0.17907	.|.	.|.	ENSG00000170160|ENSG00000170160	ENST00000399273;ENST00000443444;ENST00000360524;ENST00000456009|ENST00000360495;ENST00000328495	T;T;T;T|T	0.02631|0.09630	4.22;4.23;4.23;4.23|2.96	2.08|2.08	2.08|2.08	0.27032|0.27032	.|.	.|.	.|.	.|.	.|.	T|T	0.15478|0.15478	0.0373|0.0373	L|L	0.54965|0.54965	1.715|1.715	0.42200|0.42200	D|D	0.991764|0.991764	P;P|.	0.49358|.	0.923;0.737|.	P;P|.	0.55871|.	0.786;0.473|.	T|T	0.04294|0.04294	-1.0962|-1.0962	9|6	0.87932|.	D|.	0|.	.|.	7.774|7.774	0.29026|0.29026	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	536;816|.	A2RUR9-3;A2RUR9|.	.;C144A_HUMAN|.	V|F	816;816;816;536|712;300	ENSP00000382215:D816V;ENSP00000439262:D816V;ENSP00000353717:D816V;ENSP00000394201:D536V|ENSP00000353685:I712F	ENSP00000353717:D816V|.	D|I	+|+	2|1	0|0	CCDC144A|CCDC144A	16578757|16578757	0.995000|0.995000	0.38212|0.38212	0.630000|0.630000	0.29268|0.29268	0.020000|0.020000	0.10135|0.10135	2.042000|2.042000	0.41222|0.41222	0.952000|0.952000	0.37798|0.37798	0.324000|0.324000	0.21423|0.21423	GAT|ATC	CCDC144A	-	NULL	ENSG00000170160		0.308	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC144A	HGNC	protein_coding	OTTHUMT00000444093.1	63	0.00	0	A			16638032	16638032	+1	no_errors	ENST00000360524	ensembl	human	known	69_37n	missense	20	62.26	33	SNP	1.000	T
CCDC168	643677	genome.wustl.edu	37	13	103386196	103386196	+	Silent	SNP	C	C	T			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr13:103386196C>T	ENST00000322527.2	-	1	2963	c.2964G>A	c.(2962-2964)gtG>gtA	p.V988V		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	988																	CTGGGCGGGGCACATACTGTT	0.453																																						dbGAP											0													59.0	56.0	57.0					13																	103386196		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.2964G>A	13.37:g.103386196C>T			Q8N800	Silent	SNP	NULL	p.V988	ENST00000322527.2	37	c.2964		13																																																																																			CCDC168	-	NULL	ENSG00000175820		0.453	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		56	0.00	0	C	NM_001146197		103386196	103386196	-1	no_errors	ENST00000322527	ensembl	human	known	69_37n	silent	27	28.95	11	SNP	0.000	T
COL24A1	255631	genome.wustl.edu	37	1	86430711	86430711	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr1:86430711G>A	ENST00000370571.2	-	23	2864	c.2498C>T	c.(2497-2499)cCa>cTa	p.P833L	COL24A1_ENST00000436319.1_Missense_Mutation_p.P833L	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	833	Collagen-like 5.			GYAGEPGPEGLKGEVGDQGNIG -> ITVFATLYSFLTGRS RRSRKYW (in Ref. 5; BAD92923). {ECO:0000305}.	extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		TTCTGGTCCTGGTTCACCTGC	0.313																																						dbGAP											0													120.0	111.0	114.0					1																	86430711		1832	4074	5906	-	-	-	SO:0001583	missense	0			AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.2498C>T	1.37:g.86430711G>A	ENSP00000359603:p.Pro833Leu		C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_Fib_collagen_C	p.P833L	ENST00000370571.2	37	c.2498	CCDS41353.1	1	.	.	.	.	.	.	.	.	.	.	G	11.24	1.579175	0.28180	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	D;D	0.96685	-4.09;-4.09	5.55	4.62	0.57501	.	0.217515	0.23474	N	0.047787	D	0.94182	0.8133	M	0.81614	2.55	0.58432	D	0.999999	B	0.18013	0.025	B	0.30943	0.122	D	0.92436	0.5958	10	0.37606	T	0.19	.	13.2098	0.59817	0.0:0.0:0.8298:0.1701	.	833	Q17RW2	COOA1_HUMAN	L	833	ENSP00000359603:P833L;ENSP00000392531:P833L	ENSP00000359603:P833L	P	-	2	0	COL24A1	86203299	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.310000	0.59141	1.309000	0.44985	0.561000	0.74099	CCA	COL24A1	-	pfam_Collagen	ENSG00000171502		0.313	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL24A1	HGNC	protein_coding	OTTHUMT00000029335.4	228	0.43	1	G	NM_152890		86430711	86430711	-1	no_errors	ENST00000370571	ensembl	human	known	69_37n	missense	155	37.94	96	SNP	1.000	A
CENPF	1063	genome.wustl.edu	37	1	214818057	214818057	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr1:214818057T>C	ENST00000366955.3	+	13	5312	c.5144T>C	c.(5143-5145)gTg>gCg	p.V1715A		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1811					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		ACTGGTGCAGTGAAACCCACA	0.448																																					Colon(80;575 1284 11000 14801 43496)	dbGAP											0													61.0	61.0	61.0					1																	214818057		2203	4300	6503	-	-	-	SO:0001583	missense	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.5144T>C	1.37:g.214818057T>C	ENSP00000355922:p.Val1715Ala		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_Centromere_CenpF_Rb-prot-bd	p.V1715A	ENST00000366955.3	37	c.5144	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	T	8.377	0.836604	0.16891	.	.	ENSG00000117724	ENST00000366955	T	0.03413	3.94	5.04	-3.06	0.05379	.	0.716007	0.11505	N	0.557325	T	0.02888	0.0086	L	0.41236	1.265	0.09310	N	1	B	0.14438	0.01	B	0.10450	0.005	T	0.49173	-0.8967	10	0.08837	T	0.75	.	8.8592	0.35247	0.0:0.5583:0.145:0.2966	.	1811	P49454	CENPF_HUMAN	A	1715	ENSP00000355922:V1715A	ENSP00000355922:V1715A	V	+	2	0	CENPF	212884680	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.032000	0.13732	-0.789000	0.04498	-0.387000	0.06579	GTG	CENPF	-	NULL	ENSG00000117724		0.448	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1	62	0.00	0	T	NM_016343		214818057	214818057	+1	no_errors	ENST00000366955	ensembl	human	known	69_37n	missense	66	24.14	21	SNP	0.000	C
DIAPH2	1730	genome.wustl.edu	37	X	95993750	95993751	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chrX:95993750_95993751insA	ENST00000324765.8	+	3	678_679	c.331_332insA	c.(331-333)gaafs	p.E111fs	DIAPH2_ENST00000373054.4_Frame_Shift_Ins_p.E100fs|DIAPH2_ENST00000355827.4_Frame_Shift_Ins_p.E111fs|DIAPH2_ENST00000373049.4_Frame_Shift_Ins_p.E111fs|DIAPH2_ENST00000373061.3_Frame_Shift_Ins_p.E111fs			O60879	DIAP2_HUMAN	diaphanous-related formin 2	111	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						GGATCTCTTTGAAAAAATGATG	0.361																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.337dupA	X.37:g.95993756_95993756dupA	ENSP00000321348:p.Glu111fs		A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Frame_Shift_Ins	INS	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,pfam_Drf_DAD,superfamily_ARM-type_fold,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	p.M113fs	ENST00000324765.8	37	c.331_332	CCDS14467.1	X																																																																																			DIAPH2	-	pfam_Drf_GTPase-bd,superfamily_ARM-type_fold	ENSG00000147202		0.361	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH2	HGNC	protein_coding	OTTHUMT00000058871.2	174	0.00	0	-	NM_006729, NM_007309		95993750	95993751	+1	no_errors	ENST00000324765	ensembl	human	known	69_37n	frame_shift_ins	129	22.75	38	INS	1.000:1.000	A
DNAH3	55567	genome.wustl.edu	37	16	20996971	20996971	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr16:20996971C>T	ENST00000261383.3	-	48	7092	c.7093G>A	c.(7093-7095)Gat>Aat	p.D2365N	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2365					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TTGAAATAATCTCCAAAGAAG	0.428																																						dbGAP											0													113.0	109.0	110.0					16																	20996971		2201	4300	6501	-	-	-	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.7093G>A	16.37:g.20996971C>T	ENSP00000261383:p.Asp2365Asn		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.D2365N	ENST00000261383.3	37	c.7093	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	16.19	3.053777	0.55218	.	.	ENSG00000158486	ENST00000261383	T	0.26518	1.73	4.79	4.79	0.61399	.	0.000000	0.64402	D	0.000001	T	0.45696	0.1355	M	0.83118	2.625	0.80722	D	1	D	0.62365	0.991	P	0.51415	0.669	T	0.52117	-0.8618	10	0.41790	T	0.15	.	18.2085	0.89863	0.0:1.0:0.0:0.0	.	2365	Q8TD57	DYH3_HUMAN	N	2365	ENSP00000261383:D2365N	ENSP00000261383:D2365N	D	-	1	0	DNAH3	20904472	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.741000	0.84997	2.381000	0.81170	0.655000	0.94253	GAT	DNAH3	-	NULL	ENSG00000158486		0.428	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	53	0.00	0	C	NM_017539		20996971	20996971	-1	no_errors	ENST00000261383	ensembl	human	known	69_37n	missense	35	39.66	23	SNP	1.000	T
DOCK10	55619	genome.wustl.edu	37	2	225651833	225651833	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr2:225651833T>C	ENST00000258390.7	-	50	5628	c.5561A>G	c.(5560-5562)tAc>tGc	p.Y1854C	DOCK10_ENST00000409592.3_Missense_Mutation_p.Y1848C	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1854	DHR-2.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ATGAATGTCGTAGTAGAGATC	0.398																																						dbGAP											0													123.0	116.0	118.0					2																	225651833		1870	4111	5981	-	-	-	SO:0001583	missense	0			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.5561A>G	2.37:g.225651833T>C	ENSP00000258390:p.Tyr1854Cys		B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Y1854C	ENST00000258390.7	37	c.5561	CCDS46528.1	2	.	.	.	.	.	.	.	.	.	.	T	23.6	4.441082	0.83993	.	.	ENSG00000135905	ENST00000409592;ENST00000258390;ENST00000373702	T;T	0.18960	2.18;2.18	5.99	5.99	0.97316	.	0.115762	0.64402	D	0.000010	T	0.33000	0.0848	L	0.36672	1.1	0.54753	D	0.999988	D;D;D;P	0.69078	0.979;0.997;0.963;0.943	P;P;P;P	0.57283	0.723;0.817;0.775;0.662	T	0.02214	-1.1194	10	0.59425	D	0.04	.	16.4943	0.84223	0.0:0.0:0.0:1.0	.	1854;675;1848;516	Q96BY6;B4DF07;B3FL70;B4DEY4	DOC10_HUMAN;.;.;.	C	1848;1854;359	ENSP00000386694:Y1848C;ENSP00000258390:Y1854C	ENSP00000258390:Y1854C	Y	-	2	0	DOCK10	225360077	1.000000	0.71417	0.948000	0.38648	0.928000	0.56348	7.698000	0.84413	2.291000	0.77112	0.533000	0.62120	TAC	DOCK10	-	superfamily_ARM-type_fold	ENSG00000135905		0.398	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	HGNC	protein_coding	OTTHUMT00000331246.1	88	0.00	0	T			225651833	225651833	-1	no_errors	ENST00000258390	ensembl	human	known	69_37n	missense	80	35.94	46	SNP	0.999	C
DSG1	1828	genome.wustl.edu	37	18	28926019	28926019	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr18:28926019G>C	ENST00000257192.4	+	14	2170	c.1958G>C	c.(1957-1959)gGa>gCa	p.G653A	DSG1_ENST00000462981.2_Missense_Mutation_p.G12A|RP11-534N16.1_ENST00000578119.1_RNA|RP11-534N16.1_ENST00000581856.1_RNA|RNU6-167P_ENST00000384292.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA	NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	653					apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			AGAATGACAGGATTTGAACTA	0.353																																						dbGAP											0													86.0	86.0	86.0					18																	28926019		2203	4300	6503	-	-	-	SO:0001583	missense	0			X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.1958G>C	18.37:g.28926019G>C	ENSP00000257192:p.Gly653Ala		B7Z845	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Desmoglein,prints_Cadherin,prints_Desmo_cadherin,pfscan_Cadherin	p.G653A	ENST00000257192.4	37	c.1958	CCDS11896.1	18	.	.	.	.	.	.	.	.	.	.	G	10.24	1.294824	0.23564	.	.	ENSG00000134760	ENST00000257192	T	0.72835	-0.69	5.95	5.08	0.68730	Cadherin, cytoplasmic domain (1);	0.000000	0.64402	D	0.000002	T	0.69405	0.3107	L	0.31752	0.955	0.32779	N	0.50278	P	0.52692	0.955	P	0.51701	0.677	T	0.78548	-0.2162	10	0.62326	D	0.03	.	14.8071	0.69965	0.0:0.1433:0.8567:0.0	.	653	Q02413	DSG1_HUMAN	A	653	ENSP00000257192:G653A	ENSP00000257192:G653A	G	+	2	0	DSG1	27180017	1.000000	0.71417	1.000000	0.80357	0.465000	0.32709	4.136000	0.58004	1.528000	0.49103	0.609000	0.83330	GGA	DSG1	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000134760		0.353	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG1	HGNC	protein_coding	OTTHUMT00000254947.1	209	0.00	0	G	NM_001942		28926019	28926019	+1	no_errors	ENST00000257192	ensembl	human	known	69_37n	missense	142	38.03	89	SNP	1.000	C
EGFR	1956	genome.wustl.edu	37	7	55221773	55221773	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr7:55221773A>G	ENST00000275493.2	+	7	994	c.817A>G	c.(817-819)Acc>Gcc	p.T273A	EGFR_ENST00000420316.2_Missense_Mutation_p.T273A|EGFR_ENST00000455089.1_Missense_Mutation_p.T228A|EGFR_ENST00000344576.2_Missense_Mutation_p.T273A|EGFR_ENST00000442591.1_Missense_Mutation_p.T273A|EGFR_ENST00000454757.2_Missense_Mutation_p.T220A|EGFR_ENST00000342916.3_Missense_Mutation_p.T273A	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	273			Missing (variant EGFR vIII; found in a lung cancer sample; somatic mutation; induces lung cancer when exogenously expressed). {ECO:0000269|PubMed:16672372}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	CTACAACCCCACCACGTACCA	0.587		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																												dbGAP	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	0													205.0	161.0	176.0					7																	55221773		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.817A>G	7.37:g.55221773A>G	ENSP00000275493:p.Thr273Ala		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.T273A	ENST00000275493.2	37	c.817	CCDS5514.1	7	.	.	.	.	.	.	.	.	.	.	A	11.63	1.696518	0.30142	.	.	ENSG00000146648	ENST00000455089;ENST00000342916;ENST00000395504;ENST00000344576;ENST00000420316;ENST00000275493;ENST00000442591;ENST00000454757;ENST00000533450	T;T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	5.94	5.94	0.96194	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);	0.093702	0.64402	D	0.000001	T	0.47783	0.1464	L	0.37750	1.13	0.36942	D	0.892449	B;B;B;B;B	0.17852	0.002;0.001;0.007;0.006;0.024	B;B;B;B;B	0.18871	0.002;0.007;0.023;0.004;0.013	T	0.48864	-0.8997	10	0.10636	T	0.68	.	9.6762	0.40043	0.9225:0.0:0.0775:0.0	.	228;273;273;273;273	Q504U8;P00533;P00533-3;P00533-4;P00533-2	.;EGFR_HUMAN;.;.;.	A	228;273;143;273;273;273;273;220;67	ENSP00000415559:T228A;ENSP00000342376:T273A;ENSP00000345973:T273A;ENSP00000413843:T273A;ENSP00000275493:T273A;ENSP00000410031:T273A;ENSP00000395243:T220A	ENSP00000275493:T273A	T	+	1	0	EGFR	55189267	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	5.430000	0.66501	2.272000	0.75746	0.460000	0.39030	ACC	EGFR	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Furin-like_Cys-rich_dom,superfamily_Growth_fac_rcpt	ENSG00000146648		0.587	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGFR	HGNC	protein_coding	OTTHUMT00000251456.2	46	0.00	0	A	NM_005228		55221773	55221773	+1	no_errors	ENST00000275493	ensembl	human	known	69_37n	missense	42	32.26	20	SNP	1.000	G
ERBB4	2066	genome.wustl.edu	37	2	212289007	212289007	+	Silent	SNP	C	C	T			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr2:212289007C>T	ENST00000342788.4	-	23	3049	c.2739G>A	c.(2737-2739)ctG>ctA	p.L913L	ERBB4_ENST00000402597.1_Silent_p.L903L|ERBB4_ENST00000436443.1_Silent_p.L913L	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	913	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CAAAGGTCATCAGTTCCCATA	0.378										TSP Lung(8;0.080)																												dbGAP											0													89.0	84.0	86.0					2																	212289007		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.2739G>A	2.37:g.212289007C>T			B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Silent	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L913	ENST00000342788.4	37	c.2739	CCDS2394.1	2																																																																																			ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000178568		0.378	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1	177	0.00	0	C	NM_001042599		212289007	212289007	-1	no_errors	ENST00000342788	ensembl	human	known	69_37n	silent	126	33.33	63	SNP	0.998	T
FAM73A	374986	genome.wustl.edu	37	1	78338700	78338701	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr1:78338700_78338701insT	ENST00000370791.3	+	15	1607_1608	c.1575_1576insT	c.(1576-1578)tttfs	p.F526fs	FAM73A_ENST00000443751.2_Frame_Shift_Ins_p.F489fs	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	526						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		TCCCAGATGGATTTTTTGCCCA	0.381																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.1581dupT	1.37:g.78338706_78338706dupT	ENSP00000359827:p.Phe526fs		Q6MZG0	Frame_Shift_Ins	INS	pfam_DUF2217	p.A527fs	ENST00000370791.3	37	c.1575_1576	CCDS681.1	1																																																																																			FAM73A	-	pfam_DUF2217	ENSG00000180488		0.381	FAM73A-001	KNOWN	basic|CCDS	protein_coding	FAM73A	HGNC	protein_coding	OTTHUMT00000026931.1	346	0.00	0	-	NM_198549		78338700	78338701	+1	no_errors	ENST00000370791	ensembl	human	known	69_37n	frame_shift_ins	318	27.89	123	INS	1.000:1.000	T
GLI3	2737	genome.wustl.edu	37	7	42084998	42084998	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr7:42084998G>A	ENST00000395925.3	-	6	895	c.811C>T	c.(811-813)Ctt>Ttt	p.L271F	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	271					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						ATAGCATGAAGATATTCCATG	0.502									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																													dbGAP											0													127.0	140.0	136.0					7																	42084998		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.811C>T	7.37:g.42084998G>A	ENSP00000379258:p.Leu271Phe		A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L271F	ENST00000395925.3	37	c.811	CCDS5465.1	7	.	.	.	.	.	.	.	.	.	.	G	18.28	3.590229	0.66105	.	.	ENSG00000106571	ENST00000395925	T	0.70282	-0.47	5.58	5.58	0.84498	.	0.058788	0.64402	D	0.000001	T	0.70561	0.3238	L	0.58428	1.81	0.80722	D	1	B	0.17268	0.021	B	0.17722	0.019	T	0.66416	-0.5929	10	0.52906	T	0.07	.	19.5837	0.95482	0.0:0.0:1.0:0.0	.	271	P10071	GLI3_HUMAN	F	271	ENSP00000379258:L271F	ENSP00000379258:L271F	L	-	1	0	GLI3	42051523	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	6.377000	0.73145	2.630000	0.89119	0.655000	0.94253	CTT	GLI3	-	NULL	ENSG00000106571		0.502	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI3	HGNC	protein_coding	OTTHUMT00000250806.3	16	0.00	0	G	NM_000168		42084998	42084998	-1	no_errors	ENST00000395925	ensembl	human	known	69_37n	missense	55	32.93	27	SNP	1.000	A
GLI3	2737	genome.wustl.edu	37	7	42085091	42085091	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr7:42085091G>A	ENST00000395925.3	-	6	802	c.718C>T	c.(718-720)Cag>Tag	p.Q240*	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	240					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						AGGGCCATCTGATGATAGTAT	0.537									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																													dbGAP											0													63.0	68.0	67.0					7																	42085091		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.718C>T	7.37:g.42085091G>A	ENSP00000379258:p.Gln240*		A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q240*	ENST00000395925.3	37	c.718	CCDS5465.1	7	.	.	.	.	.	.	.	.	.	.	G	37	6.413778	0.97546	.	.	ENSG00000106571	ENST00000395925	.	.	.	5.58	5.58	0.84498	.	0.051230	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.5837	0.95482	0.0:0.0:1.0:0.0	.	.	.	.	X	240	.	ENSP00000379258:Q240X	Q	-	1	0	GLI3	42051616	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	9.464000	0.97655	2.630000	0.89119	0.655000	0.94253	CAG	GLI3	-	NULL	ENSG00000106571		0.537	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI3	HGNC	protein_coding	OTTHUMT00000250806.3	20	0.00	0	G	NM_000168		42085091	42085091	-1	no_errors	ENST00000395925	ensembl	human	known	69_37n	nonsense	51	38.55	32	SNP	1.000	A
INTS4L2	644619	genome.wustl.edu	37	7	65159983	65159983	+	RNA	SNP	A	A	G	rs2949280	byFrequency	TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr7:65159983A>G	ENST00000430126.2	+	0	1153							Q2T9F4	IN4L2_HUMAN	integrator complex subunit 4-like 2																		TTGCTTAGTTACCAGGTAGAA	0.428																																						dbGAP											0																																										-	-	-			0			BC111554		7q11.21	2013-03-26			ENSG00000232270	ENSG00000273024			22351	other	unknown							Standard	NR_027392		Approved	MGC133166	uc003tue.2	Q2T9F4	OTTHUMG00000156558		7.37:g.65159983A>G				RNA	SNP	-	NULL	ENST00000430126.2	37	NULL		7																																																																																			INTS4L2	-	-	ENSG00000232270		0.428	INTS4L2-002	KNOWN	basic	processed_transcript	INTS4L2	HGNC	pseudogene	OTTHUMT00000345545.2	18	0.00	0	A	NR_027392		65159983	65159983	+1	no_errors	ENST00000430126	ensembl	human	known	69_37n	rna	14	30.00	6	SNP	1.000	G
KCNJ12	3768	genome.wustl.edu	37	17	21319007	21319007	+	Missense_Mutation	SNP	G	G	A	rs1657740	byFrequency	TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr17:21319007G>A	ENST00000583088.1	+	3	1248	c.353G>A	c.(352-354)cGg>cAg	p.R118Q	KCNJ12_ENST00000331718.5_Missense_Mutation_p.R118Q	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	118			R -> Q (in dbSNP:rs1657740).		muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	GCTGAGGGCCGGGGCCGCACA	0.647										Prostate(3;0.18)			.|||	2495	0.498203	0.4939	0.5	5008	,	,		37148	0.5		0.5	False		,,,				2504	0.499					dbGAP											0																																										-	-	-	SO:0001583	missense	0			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.353G>A	17.37:g.21319007G>A	ENSP00000463778:p.Arg118Gln		O43401|Q15756|Q8NG63	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir2.2	p.R118Q	ENST00000583088.1	37	c.353	CCDS11219.1	17	.	.	.	.	.	.	.	.	.	.	G	5.809	0.333536	0.11013	.	.	ENSG00000184185	ENST00000331718	D	0.93604	-3.25	5.23	-2.04	0.07343	Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.674797	0.14613	N	0.308893	T	0.78413	0.4279	N	0.03608	-0.345	0.09310	N	1	B	0.28584	0.216	B	0.29862	0.108	T	0.71328	-0.4626	10	0.13853	T	0.58	.	5.7265	0.18017	0.4852:0.256:0.2588:0.0	rs1657740	118	Q14500	IRK12_HUMAN	Q	118	ENSP00000328150:R118Q	ENSP00000328150:R118Q	R	+	2	0	KCNJ12	21259600	0.491000	0.26019	0.034000	0.17996	0.632000	0.37999	1.199000	0.32235	-0.020000	0.14032	0.591000	0.81541	CGG	KCNJ12	-	pfam_K_chnl_inward-rec_Kir_Cr2,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2	ENSG00000184185		0.647	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ12	HGNC	protein_coding	OTTHUMT00000255060.2	11	0.00	0	G	NM_021012		21319007	21319007	+1	no_errors	ENST00000331718	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	0.000	A
KIAA0430	9665	genome.wustl.edu	37	16	15718667	15718667	+	Silent	SNP	C	C	T			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr16:15718667C>T	ENST00000396368.3	-	10	2435	c.2229G>A	c.(2227-2229)agG>agA	p.R743R	KIAA0430_ENST00000602337.1_Silent_p.R740R|KIAA0430_ENST00000344181.3_Silent_p.R421R|KIAA0430_ENST00000551742.1_Silent_p.R742R|KIAA0430_ENST00000540441.2_Silent_p.R600R|KIAA0430_ENST00000548025.1_Silent_p.R740R	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	743					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						GACTGACTTGCCTGGATGCAA	0.453																																						dbGAP											0													112.0	117.0	115.0					16																	15718667		1961	4161	6122	-	-	-	SO:0001819	synonymous_variant	0			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.2229G>A	16.37:g.15718667C>T			A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Silent	SNP	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.R743	ENST00000396368.3	37	c.2229	CCDS10562.2	16																																																																																			KIAA0430	-	NULL	ENSG00000166783		0.453	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	HGNC	protein_coding	OTTHUMT00000252131.2	71	0.00	0	C	NM_014647		15718667	15718667	-1	no_errors	ENST00000396368	ensembl	human	known	69_37n	silent	70	26.32	25	SNP	1.000	T
RIC1	57589	genome.wustl.edu	37	9	5774097	5774097	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr9:5774097G>C	ENST00000414202.2	+	26	4314	c.4123G>C	c.(4123-4125)Gag>Cag	p.E1375Q	KIAA1432_ENST00000418622.3_Missense_Mutation_p.E1296Q|KIAA1432_ENST00000449720.2_Missense_Mutation_p.E1259Q	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		CCCCCGGGCAGAGGAGAGCAG	0.557																																						dbGAP											0													64.0	62.0	63.0					9																	5774097		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000414202.2:c.4123G>C	9.37:g.5774097G>C	ENSP00000416696:p.Glu1375Gln			Missense_Mutation	SNP	pfam_Ribosome_control_1,superfamily_WD40_repeat_dom	p.E1296Q	ENST00000414202.2	37	c.3886	CCDS34982.2	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.63|16.63	3.177477|3.177477	0.57692|0.57692	.|.	.|.	ENSG00000107036|ENSG00000107036	ENST00000414202;ENST00000418622;ENST00000449720|ENST00000545641	.|.	.|.	.|.	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75503|0.75503	0.3858|0.3858	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	D;D|.	0.67145|.	0.996;0.996|.	P;P|.	0.60012|.	0.867;0.867|.	T|T	0.72673|0.72673	-0.4222|-0.4222	9|5	0.20519|.	T|.	0.43|.	-18.257|-18.257	19.816|19.816	0.96568|0.96568	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1259;1375|.	B7ZM67;Q4ADV7|.	.;RIC1_HUMAN|.	Q|T	1375;1296;1259|1266	.|.	ENSP00000416696:E1375Q|.	E|R	+|+	1|2	0|0	KIAA1432|KIAA1432	5764097|5764097	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.713000|0.713000	0.41058|0.41058	6.857000|6.857000	0.75455|0.75455	2.689000|2.689000	0.91719|0.91719	0.462000|0.462000	0.41574|0.41574	GAG|AGA	KIAA1432	-	NULL	ENSG00000107036		0.557	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1432	HGNC	protein_coding	OTTHUMT00000051636.3	38	0.00	0	G			5774097	5774097	+1	no_errors	ENST00000418622	ensembl	human	known	69_37n	missense	39	27.78	15	SNP	1.000	C
KIAA1045	23349	genome.wustl.edu	37	9	34978067	34978067	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr9:34978067C>T	ENST00000242315.3	+	8	1244	c.1162C>T	c.(1162-1164)Cgc>Tgc	p.R388C	KIAA1045_ENST00000544237.1_Missense_Mutation_p.R388C|KIAA1045_ENST00000476115.2_3'UTR	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	388							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			CCTGGCTGCTCGCCCCAACAG	0.542																																						dbGAP											0													128.0	131.0	130.0					9																	34978067		2059	4182	6241	-	-	-	SO:0001583	missense	0			AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.1162C>T	9.37:g.34978067C>T	ENSP00000242315:p.Arg388Cys		B7Z253|Q58FE9|Q5T662	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.R388C	ENST00000242315.3	37	c.1162	CCDS43796.1	9	.	.	.	.	.	.	.	.	.	.	C	26.3	4.723933	0.89298	.	.	ENSG00000122733	ENST00000544237;ENST00000242315	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.68081	0.2962	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71041	-0.4707	9	0.87932	D	0	.	16.0591	0.80826	0.0:1.0:0.0:0.0	.	388	Q9UPV7	K1045_HUMAN	C	388	.	ENSP00000242315:R388C	R	+	1	0	KIAA1045	34968067	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.426000	0.59882	2.550000	0.86006	0.643000	0.83706	CGC	KIAA1045	-	NULL	ENSG00000122733		0.542	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1045	HGNC	protein_coding	OTTHUMT00000052256.2	33	0.00	0	C	XM_048592		34978067	34978067	+1	no_errors	ENST00000242315	ensembl	human	known	69_37n	missense	29	42.00	21	SNP	1.000	T
KIF2B	84643	genome.wustl.edu	37	17	51900732	51900732	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr17:51900732C>T	ENST00000268919.4	+	1	494	c.338C>T	c.(337-339)aCg>aTg	p.T113M		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	113					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T113M(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						CGTACCGCCACGAAATGGGTT	0.592																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											76.0	82.0	80.0					17																	51900732		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.338C>T	17.37:g.51900732C>T	ENSP00000268919:p.Thr113Met		Q96MA2|Q9BXG6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.T113M	ENST00000268919.4	37	c.338	CCDS32685.1	17	.	.	.	.	.	.	.	.	.	.	C	2.969	-0.212944	0.06140	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.74315	-0.83	5.11	4.14	0.48551	.	0.928117	0.08888	N	0.878962	T	0.62270	0.2414	L	0.42245	1.32	0.09310	N	1	P	0.37731	0.607	B	0.26416	0.069	T	0.49808	-0.8900	10	0.30078	T	0.28	.	9.5255	0.39162	0.0:0.9047:0.0:0.0953	.	113	Q8N4N8	KIF2B_HUMAN	M	113;36	ENSP00000268919:T113M	ENSP00000268919:T113M	T	+	2	0	KIF2B	49255731	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	0.167000	0.16602	1.504000	0.48704	0.655000	0.94253	ACG	KIF2B	-	NULL	ENSG00000141200		0.592	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2B	HGNC	protein_coding	OTTHUMT00000438854.1	21	0.00	0	C	NM_032559		51900732	51900732	+1	no_errors	ENST00000268919	ensembl	human	known	69_37n	missense	14	42.31	11	SNP	0.003	T
MCMBP	79892	genome.wustl.edu	37	10	121591004	121591005	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr10:121591004_121591005delCA	ENST00000360003.3	-	16	2079_2080	c.1910_1911delTG	c.(1909-1911)gtgfs	p.V637fs	MCMBP_ENST00000466047.1_5'UTR|MCMBP_ENST00000369077.3_Frame_Shift_Del_p.V635fs	NM_001256378.1|NM_001256379.1|NM_024834.3	NP_001243307.1|NP_001243308.1|NP_079110.1	Q9BTE3	MCMBP_HUMAN	minichromosome maintenance complex binding protein	637					DNA-dependent DNA replication (GO:0006261)|mitotic nuclear division (GO:0007067)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(2)|skin(2)	21						CATTTCCATTCACACATTTTTG	0.386																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC007219	CCDS7617.1, CCDS58099.1	10q26.13	2013-10-11	2011-01-05	2011-01-05	ENSG00000197771	ENSG00000197771			25782	protein-coding gene	gene with protein product		610909	"""chromosome 10 open reading frame 119"""	C10orf119		17296731	Standard	NM_024834		Approved	FLJ13081, MCM-BP	uc001ler.3	Q9BTE3	OTTHUMG00000019159	ENST00000360003.3:c.1910_1911delTG	10.37:g.121591008_121591009delCA	ENSP00000353098:p.Val637fs		B3KSP7|Q6IA56|Q9BVT9|Q9H916	Frame_Shift_Del	DEL	pfam_MCM_complex-bd	p.V637fs	ENST00000360003.3	37	c.1911_1910	CCDS7617.1	10																																																																																			MCMBP	-	NULL	ENSG00000197771		0.386	MCMBP-002	KNOWN	basic|CCDS	protein_coding	MCMBP	HGNC	protein_coding	OTTHUMT00000050684.1	124	0.00	0	CA	NM_024834		121591004	121591005	-1	no_errors	ENST00000360003	ensembl	human	known	69_37n	frame_shift_del	120	20.39	31	DEL	0.991:1.000	-
MTAP	4507	genome.wustl.edu	37	9	21818104	21818104	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr9:21818104G>A	ENST00000460874.2	+	4	526	c.301G>A	c.(301-303)Gag>Aag	p.E101K	RP11-145E5.5_ENST00000404796.2_Missense_Mutation_p.E84K|MTAP_ENST00000380172.4_Missense_Mutation_p.E84K|MTAP_ENST00000427788.2_3'UTR|MTAP_ENST00000580900.1_Missense_Mutation_p.E84K					methylthioadenosine phosphorylase									p.0(1)|p.0?(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|lung(3)|pancreas(1)	10		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)		TTTGAAGGAAGAGGGCTGTAC	0.483																																						dbGAP											2	Whole gene deletion(2)	lung(2)											126.0	99.0	108.0					9																	21818104		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB062485	CCDS6509.1	9p21	2013-05-29			ENSG00000099810	ENSG00000099810	2.4.2.28		7413	protein-coding gene	gene with protein product	"""S-methyl-5'-thioadenosine phosphorylase"""	156540				11126361	Standard	NM_002451		Approved	MSAP, c86fus	uc003zph.3	Q13126	OTTHUMG00000019690	ENST00000460874.2:c.301G>A	9.37:g.21818104G>A	ENSP00000461932:p.Glu101Lys			Missense_Mutation	SNP	pfam_Nucleoside_phosphorylase_d,tigrfam_MeThioAdo_phosphorylase	p.E84K	ENST00000460874.2	37	c.250		9	.	.	.	.	.	.	.	.	.	.	G	22.9	4.352488	0.82132	.	.	ENSG00000099810	ENST00000380172	D	0.86956	-2.19	5.1	5.1	0.69264	Purine phosphorylase, family 2, conserved site (1);Nucleoside phosphorylase domain (1);	0.197208	0.52532	D	0.000065	D	0.88142	0.6357	L	0.53249	1.67	0.80722	D	1	P;P;P	0.40660	0.706;0.726;0.548	P;B;B	0.45681	0.49;0.297;0.14	D	0.89413	0.3704	10	0.72032	D	0.01	-8.8819	17.6248	0.88091	0.0:0.0:1.0:0.0	.	101;84;84	B4DUC8;F2Z2F3;Q13126	.;.;MTAP_HUMAN	K	84	ENSP00000369519:E84K	ENSP00000369519:E84K	E	+	1	0	MTAP	21808104	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.311000	0.78958	2.530000	0.85305	0.557000	0.71058	GAG	MTAP	-	pfam_Nucleoside_phosphorylase_d,tigrfam_MeThioAdo_phosphorylase	ENSG00000099810		0.483	MTAP-003	PUTATIVE	basic|exp_conf	protein_coding	MTAP	HGNC	protein_coding	OTTHUMT00000051929.2	43	0.00	0	G	NM_002451		21818104	21818104	+1	no_errors	ENST00000380172	ensembl	human	known	69_37n	missense	44	39.73	29	SNP	1.000	A
MTOR	2475	genome.wustl.edu	37	1	11317205	11317205	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr1:11317205C>A	ENST00000361445.4	-	4	365	c.289G>T	c.(289-291)Gaa>Taa	p.E97*		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	97	Interaction with NBN.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.E97K(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TTCCCACCTTCCACTCCTATG	0.512																																						dbGAP											1	Substitution - Missense(1)	central_nervous_system(1)											59.0	50.0	53.0					1																	11317205		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.289G>T	1.37:g.11317205C>A	ENSP00000354558:p.Glu97*		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Nonsense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_FKBP_rapamycin-assoc_FKBP12-bd,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_FKBP_rapamycin-assoc_FKBP12-bd,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E97*	ENST00000361445.4	37	c.289	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	38	6.898217	0.97920	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-3.9413	19.0345	0.92971	0.0:1.0:0.0:0.0	.	.	.	.	X	97	.	ENSP00000354558:E97X	E	-	1	0	MTOR	11239792	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.452000	0.80683	2.497000	0.84241	0.650000	0.86243	GAA	MTOR	-	superfamily_ARM-type_fold	ENSG00000198793		0.512	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	29	0.00	0	C	NM_004958		11317205	11317205	-1	no_errors	ENST00000361445	ensembl	human	known	69_37n	nonsense	31	34.04	16	SNP	1.000	A
MUC20	200958	genome.wustl.edu	37	3	195452689	195452689	+	Silent	SNP	C	C	T	rs141077164	byFrequency	TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr3:195452689C>T	ENST00000447234.2	+	2	1341	c.1215C>T	c.(1213-1215)gaC>gaT	p.D405D	MUC20_ENST00000445522.2_Silent_p.D370D|MUC20_ENST00000436408.1_Silent_p.D405D|MUC20_ENST00000320736.6_Silent_p.D234D	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	405					activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CGGGATCTGACGTCACTCTCC	0.582																																						dbGAP											0													6.0	4.0	5.0					3																	195452689		1717	3830	5547	-	-	-	SO:0001819	synonymous_variant	0			AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1215C>T	3.37:g.195452689C>T			Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Silent	SNP	NULL	p.D405	ENST00000447234.2	37	c.1215		3																																																																																			MUC20	-	NULL	ENSG00000176945		0.582	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	MUC20	HGNC	protein_coding	OTTHUMT00000341835.1	9	0.00	0	C	NM_152673		195452689	195452689	+1	no_errors	ENST00000447234	ensembl	human	known	69_37n	silent	6	57.14	8	SNP	0.000	T
MUC4	4585	genome.wustl.edu	37	3	195507020	195507020	+	Missense_Mutation	SNP	C	C	G	rs201940326	byFrequency	TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr3:195507020C>G	ENST00000463781.3	-	2	11890	c.11431G>C	c.(11431-11433)Gtc>Ctc	p.V3811L	MUC4_ENST00000475231.1_Missense_Mutation_p.V3811L|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGCTGGTGACAGGAAGAGGG	0.597																																						dbGAP											0													8.0	7.0	7.0					3																	195507020		646	1527	2173	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11431G>C	3.37:g.195507020C>G	ENSP00000417498:p.Val3811Leu		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.V3811L	ENST00000463781.3	37	c.11431	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	c	3.766	-0.048585	0.07407	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31769	1.5;1.48	.	.	.	.	.	.	.	.	T	0.12902	0.0313	N	0.19112	0.55	0.09310	N	0.999991	P	0.37985	0.613	B	0.22601	0.04	T	0.16453	-1.0402	7	.	.	.	.	5.844	0.18652	0.0:0.9991:0.0:9.0E-4	.	3683	E7ESK3	.	L	3811	ENSP00000417498:V3811L;ENSP00000420243:V3811L	.	V	-	1	0	MUC4	196991799	0.000000	0.05858	0.028000	0.17463	0.028000	0.11728	-0.086000	0.11233	0.064000	0.16427	0.064000	0.15345	GTC	MUC4	-	NULL	ENSG00000145113		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	39	0.00	0	C	NM_018406		195507020	195507020	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	93	10.48	11	SNP	0.834	G
NECAB1	64168	genome.wustl.edu	37	8	91937790	91937790	+	Silent	SNP	G	G	A			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr8:91937790G>A	ENST00000417640.2	+	7	859	c.522G>A	c.(520-522)ctG>ctA	p.L174L		NM_022351.4	NP_071746.1	Q8N987	NECA1_HUMAN	N-terminal EF-hand calcium binding protein 1	174						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)	12			BRCA - Breast invasive adenocarcinoma(11;0.0499)			CAGAAGTCCTGTCGATTCAAT	0.483																																						dbGAP											0													61.0	67.0	65.0					8																	91937790		1977	4156	6133	-	-	-	SO:0001819	synonymous_variant	0			AF414126	CCDS47889.1	8q21.3	2013-01-10	2007-12-06	2007-12-06	ENSG00000123119	ENSG00000123119		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	20983	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 1"""	EFCBP1			Standard	NM_022351		Approved		uc011lgg.2	Q8N987	OTTHUMG00000164009	ENST00000417640.2:c.522G>A	8.37:g.91937790G>A			Q6NUS7|Q96AZ7|Q9HBW8	Silent	SNP	pfam_Antibiotic_mOase,superfamily_Dimeric_a/b-barrel,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.L174	ENST00000417640.2	37	c.522	CCDS47889.1	8																																																																																			NECAB1	-	NULL	ENSG00000123119		0.483	NECAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NECAB1	HGNC	protein_coding	OTTHUMT00000376728.1	42	0.00	0	G	NM_022351		91937790	91937790	+1	no_errors	ENST00000417640	ensembl	human	known	69_37n	silent	37	63.00	63	SNP	0.998	A
OR1L4	254973	genome.wustl.edu	37	9	125486770	125486770	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr9:125486770T>C	ENST00000259466.1	+	1	502	c.502T>C	c.(502-504)Tct>Cct	p.S168P		NM_001005235.1	NP_001005235.1	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L, member 4	168						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(3)|lung(13)|prostate(1)|skin(1)	20						GTCTCGCTTGTCTTTCTGTGC	0.493																																						dbGAP											0													174.0	160.0	165.0					9																	125486770		2203	4295	6498	-	-	-	SO:0001583	missense	0				CCDS35129.1	9q33.2	2013-09-20			ENSG00000136939	ENSG00000136939		"""GPCR / Class A : Olfactory receptors"""	8216	protein-coding gene	gene with protein product				OR1L5			Standard	NM_001005235		Approved	OR9-E	uc004bmu.1	Q8NGR5	OTTHUMG00000020620	ENST00000259466.1:c.502T>C	9.37:g.125486770T>C	ENSP00000259466:p.Ser168Pro		Q6IFN0|Q96R81	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S168P	ENST00000259466.1	37	c.502	CCDS35129.1	9	.	.	.	.	.	.	.	.	.	.	.	13.44	2.238828	0.39598	.	.	ENSG00000136939	ENST00000259466	T	0.00036	8.86	4.01	4.01	0.46588	GPCR, rhodopsin-like superfamily (1);	0.123815	0.37219	N	0.002190	T	0.00210	0.0006	L	0.27975	0.815	0.32311	N	0.563662	P	0.52463	0.953	P	0.54401	0.751	T	0.74490	-0.3648	10	0.62326	D	0.03	-12.7608	12.0998	0.53776	0.0:0.0:0.0:1.0	.	168	Q8NGR5	OR1L4_HUMAN	P	168	ENSP00000259466:S168P	ENSP00000259466:S168P	S	+	1	0	OR1L4	124526591	0.003000	0.15002	0.996000	0.52242	0.504000	0.33889	0.369000	0.20416	1.690000	0.51089	0.248000	0.18094	TCT	OR1L4	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000136939		0.493	OR1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1L4	HGNC	protein_coding	OTTHUMT00000053951.1	69	0.00	0	T			125486770	125486770	+1	no_errors	ENST00000259466	ensembl	human	known	69_37n	missense	67	39.09	43	SNP	0.972	C
PTEN	5728	genome.wustl.edu	37	10	89653842	89653842	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr10:89653842delG	ENST00000371953.3	+	2	1497	c.140delG	c.(139-141)aggfs	p.R47fs		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	47	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.		R -> G (in CWS1). {ECO:0000269|PubMed:11494117}.		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(8)|p.Y27fs*1(2)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GGCGTATACAGGAACAATATT	0.289		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												dbGAP	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	47	Whole gene deletion(37)|Unknown(8)|Deletion - Frameshift(2)	prostate(14)|central_nervous_system(8)|skin(8)|haematopoietic_and_lymphoid_tissue(4)|lung(4)|ovary(3)|breast(2)|soft_tissue(1)|urinary_tract(1)|NS(1)|kidney(1)											112.0	112.0	112.0					10																	89653842		2203	4296	6499	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.140delG	10.37:g.89653842delG	ENSP00000361021:p.Arg47fs		B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.N48fs	ENST00000371953.3	37	c.140	CCDS31238.1	10																																																																																			PTEN	-	smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Phosphatase_tensin-typ	ENSG00000171862		0.289	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	293	0.00	0	G	NM_000314		89653842	89653842	+1	no_errors	ENST00000371953	ensembl	human	known	69_37n	frame_shift_del	120	47.26	112	DEL	1.000	-
WDR60	55112	genome.wustl.edu	37	7	158716295	158716295	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr7:158716295T>C	ENST00000407559.3	+	17	2286	c.2128T>C	c.(2128-2130)Ttt>Ctt	p.F710L		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	710					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		TTTGAAAGCATTTTTACTGTT	0.478																																						dbGAP											0													138.0	141.0	140.0					7																	158716295		2175	4282	6457	-	-	-	SO:0001583	missense	0				CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.2128T>C	7.37:g.158716295T>C	ENSP00000384290:p.Phe710Leu		Q9NW58	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.F710L	ENST00000407559.3	37	c.2128	CCDS47757.1	7	.	.	.	.	.	.	.	.	.	.	T	9.682	1.149632	0.21288	.	.	ENSG00000126870	ENST00000407559	T	0.65178	-0.14	5.19	3.99	0.46301	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.373144	0.24671	N	0.036552	T	0.45034	0.1322	L	0.43152	1.355	0.27522	N	0.951375	B;B	0.18610	0.029;0.004	B;B	0.15484	0.013;0.001	T	0.20874	-1.0262	10	0.10902	T	0.67	-8.4942	4.6097	0.12397	0.2708:0.0:0.145:0.5842	.	193;710	A4D230;Q8WVS4	.;WDR60_HUMAN	L	710	ENSP00000384290:F710L	ENSP00000384290:F710L	F	+	1	0	WDR60	158409056	0.993000	0.37304	0.927000	0.36925	0.172000	0.22775	3.707000	0.54838	1.950000	0.56595	0.533000	0.62120	TTT	WDR60	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000126870		0.478	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR60	HGNC	protein_coding	OTTHUMT00000322668.1	74	0.00	0	T	NM_018051		158716295	158716295	+1	no_errors	ENST00000407559	ensembl	human	known	69_37n	missense	69	31.68	32	SNP	0.978	C
ZNF131	7690	genome.wustl.edu	37	5	43161509	43161509	+	Missense_Mutation	SNP	T	T	C	rs529551154		TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr5:43161509T>C	ENST00000399534.1	+	5	574	c.530T>C	c.(529-531)aTt>aCt	p.I177T	ZNF131_ENST00000509156.1_Missense_Mutation_p.I177T|ZNF131_ENST00000509634.1_Missense_Mutation_p.I177T|ZNF131_ENST00000306938.4_Missense_Mutation_p.I177T|ZNF131_ENST00000505606.2_Missense_Mutation_p.I177T|ZNF131_ENST00000509931.1_Intron			P52739	ZN131_HUMAN	zinc finger protein 131	177					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	17						GAAGGCACCATTGAAGTGGAA	0.433													T|||	1	0.000199681	0.0	0.0	5008	,	,		20873	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													106.0	96.0	99.0					5																	43161509		1930	4138	6068	-	-	-	SO:0001583	missense	0			U09410	CCDS43313.1	5p12	2013-01-09	2006-06-13		ENSG00000172262	ENSG00000172262		"""Zinc fingers, C2H2-type"", ""-"", ""BTB/POZ domain containing"""	12915	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 35"""	604073	"""zinc finger protein 131 (clone pHZ-10)"""				Standard	XM_005248359		Approved	ZBTB35, pHZ-10	uc003jnk.3	P52739	OTTHUMG00000162223	ENST00000399534.1:c.530T>C	5.37:g.43161509T>C	ENSP00000382450:p.Ile177Thr		B4DRL3|Q6PIF0	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.I177T	ENST00000399534.1	37	c.530		5	.	.	.	.	.	.	.	.	.	.	T	12.32	1.901847	0.33535	.	.	ENSG00000172262	ENST00000515326;ENST00000509156;ENST00000306938;ENST00000399534;ENST00000505606;ENST00000509634	T;T;T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83;-0.83;-0.83	5.42	4.27	0.50696	.	0.049108	0.85682	D	0.000000	T	0.54464	0.1860	N	0.17082	0.46	0.46725	D	0.999179	B;B	0.21753	0.051;0.06	B;B	0.17722	0.01;0.019	T	0.50154	-0.8861	10	0.21014	T	0.42	-10.5974	8.885	0.35398	0.0:0.1436:0.0:0.8564	.	177;177	P52739;P52739-2	ZN131_HUMAN;.	T	177	ENSP00000422079:I177T;ENSP00000426504:I177T;ENSP00000305804:I177T;ENSP00000382450:I177T;ENSP00000423945:I177T;ENSP00000421246:I177T	ENSP00000305804:I177T	I	+	2	0	ZNF131	43197266	1.000000	0.71417	0.955000	0.39395	0.983000	0.72400	4.684000	0.61686	2.058000	0.61347	0.528000	0.53228	ATT	ZNF131	-	NULL	ENSG00000172262		0.433	ZNF131-201	KNOWN	basic|appris_principal	protein_coding	ZNF131	HGNC	protein_coding	OTTHUMT00000367982.1	107	0.00	0	T	NM_003432		43161509	43161509	+1	no_errors	ENST00000399534	ensembl	human	known	69_37n	missense	85	33.33	43	SNP	1.000	C
ZNF329	79673	genome.wustl.edu	37	19	58639594	58639594	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr19:58639594G>A	ENST00000598312.1	-	4	1510	c.1277C>T	c.(1276-1278)cCc>cTc	p.P426L	ZNF329_ENST00000358067.4_Missense_Mutation_p.P426L	NM_024620.3	NP_078896.3	Q86UD4	ZN329_HUMAN	zinc finger protein 329	426					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|large_intestine(10)|lung(5)|skin(3)|urinary_tract(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		GCAGCCATAGGGCTTCTCGCC	0.478																																						dbGAP											0													73.0	64.0	67.0					19																	58639594		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022648	CCDS12972.1	19q13.43	2013-01-08				ENSG00000181894		"""Zinc fingers, C2H2-type"""	14209	protein-coding gene	gene with protein product							Standard	XM_006723381		Approved	FLJ12586	uc002qrn.3	Q86UD4		ENST00000598312.1:c.1277C>T	19.37:g.58639594G>A	ENSP00000470008:p.Pro426Leu		B3KR32|Q9H9R7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P426L	ENST00000598312.1	37	c.1277	CCDS12972.1	19	.	.	.	.	.	.	.	.	.	.	G	19.11	3.763247	0.69763	.	.	ENSG00000181894	ENST00000358067;ENST00000500161	T;T	0.17054	2.3;2.3	4.31	4.31	0.51392	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41605	D	0.000846	T	0.37945	0.1022	L	0.56199	1.76	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.13045	-1.0524	10	0.72032	D	0.01	-11.7891	16.7502	0.85483	0.0:0.0:1.0:0.0	.	426	Q86UD4	ZN329_HUMAN	L	426	ENSP00000350773:P426L;ENSP00000439527:P426L	ENSP00000350773:P426L	P	-	2	0	ZNF329	63331406	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.191000	0.65110	2.691000	0.91804	0.655000	0.94253	CCC	ZNF329	-	pfscan_Znf_C2H2	ENSG00000181894		0.478	ZNF329-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF329	HGNC	protein_coding	OTTHUMT00000466724.1	44	0.00	0	G	NM_024620		58639594	58639594	-1	no_errors	ENST00000358067	ensembl	human	known	69_37n	missense	54	55.74	68	SNP	1.000	A
ZNF705G	100131980	genome.wustl.edu	37	8	7217220	7217220	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A12G-01A-11D-A10M-09	TCGA-AO-A12G-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5b9d3741-2aa3-489b-93e6-3b5376b80d48	8da3bacc-e61b-431b-a25f-d70d4c8dbe23	g.chr8:7217220C>A	ENST00000400156.4	-	6	520	c.239G>T	c.(238-240)aGg>aTg	p.R80M	ZNF705G_ENST00000400078.2_Missense_Mutation_p.R80M			A8MUZ8	Z705G_HUMAN	zinc finger protein 705G	80					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(9)	9						GGCACTTTCCCTGTCTGAAAT	0.348																																						dbGAP											0													159.0	170.0	167.0					8																	7217220		674	1591	2265	-	-	-	SO:0001583	missense	0				CCDS47773.1	8p23.1	2013-01-08			ENSG00000215372	ENSG00000215372		"""Zinc fingers, C2H2-type"", ""-"""	37134	protein-coding gene	gene with protein product							Standard	NM_001164457		Approved		uc022are.1	A8MUZ8	OTTHUMG00000165384	ENST00000400156.4:c.239G>T	8.37:g.7217220C>A	ENSP00000383020:p.Arg80Met			Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R80M	ENST00000400156.4	37	c.239		8	.	.	.	.	.	.	.	.	.	.	C	7.702	0.693355	0.15039	.	.	ENSG00000215372	ENST00000400156;ENST00000400078	T;T	0.08546	3.08;3.08	0.861	-0.0906	0.13664	.	.	.	.	.	T	0.05227	0.0139	N	0.24115	0.695	0.23030	N	0.998403	.	.	.	.	.	.	T	0.41070	-0.9529	7	0.33940	T	0.23	.	2.3774	0.04346	0.2762:0.5052:0.0:0.2185	.	.	.	.	M	80	ENSP00000383020:R80M;ENSP00000445477:R80M	ENSP00000445477:R80M	R	-	2	0	ZNF705G	7204630	0.002000	0.14202	0.224000	0.23877	0.191000	0.23601	0.373000	0.20484	-0.169000	0.10834	-1.109000	0.02080	AGG	ZNF705G	-	NULL	ENSG00000215372		0.348	ZNF705G-001	KNOWN	basic|appris_principal	protein_coding	ZNF705G	HGNC	protein_coding	OTTHUMT00000383776.1	452	0.00	0	C	XM_001720517		7217220	7217220	-1	no_errors	ENST00000400078	ensembl	human	known	69_37n	missense	178	51.23	187	SNP	0.890	A
