#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AHNAK2	113146	genome.wustl.edu	37	14	105416976	105416976	+	Silent	SNP	G	G	A			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr14:105416976G>A	ENST00000333244.5	-	7	4931	c.4812C>T	c.(4810-4812)gaC>gaT	p.D1604D	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1604						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGCCTTTCAGGTCCAGCTTGG	0.587																																						dbGAP											0													97.0	111.0	106.0					14																	105416976		1809	4025	5834	-	-	-	SO:0001819	synonymous_variant	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.4812C>T	14.37:g.105416976G>A			Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D1604	ENST00000333244.5	37	c.4812	CCDS45177.1	14																																																																																			AHNAK2	-	NULL	ENSG00000185567		0.587	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	88	0.00	0	G	NM_138420		105416976	105416976	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	silent	73	21.51	20	SNP	0.013	A
AKAP9	10142	genome.wustl.edu	37	7	91643582	91643582	+	Silent	SNP	A	A	G			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr7:91643582A>G	ENST00000359028.2	+	11	3813	c.3588A>G	c.(3586-3588)ttA>ttG	p.L1196L	AKAP9_ENST00000358100.2_Silent_p.L1196L|AKAP9_ENST00000356239.3_Silent_p.L1184L			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1196					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GAAAGCCTTTACATCTGCTCA	0.313			T	BRAF	papillary thyroid																																	dbGAP		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													94.0	92.0	93.0					7																	91643582		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.3588A>G	7.37:g.91643582A>G			A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Silent	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB-like	p.L1196	ENST00000359028.2	37	c.3588		7																																																																																			AKAP9	-	NULL	ENSG00000127914		0.313	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		86	0.00	0	A	NM_005751		91643582	91643582	+1	no_errors	ENST00000359028	ensembl	human	known	69_37n	silent	75	16.67	15	SNP	0.092	G
ATP6V1B2	526	genome.wustl.edu	37	8	20074770	20074770	+	Silent	SNP	T	T	C			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr8:20074770T>C	ENST00000276390.2	+	12	1241	c.1201T>C	c.(1201-1203)Tta>Cta	p.L401L		NM_001693.3	NP_001684.2	P21281	VATB2_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2	401					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|ruffle (GO:0001726)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			endometrium(1)|kidney(2)|lung(5)|prostate(1)	9				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)	Gallium nitrate(DB05260)	ACTATCACGGTTAATGAAGTC	0.378																																					Pancreas(119;1230 1726 3901 4036 31644)	dbGAP											0													205.0	176.0	186.0					8																	20074770		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L35249	CCDS6014.1	8p21.3	2010-04-21	2006-01-13	2002-05-10	ENSG00000147416	ENSG00000147416	3.6.3.14	"""ATPases / V-type"""	854	protein-coding gene	gene with protein product		606939	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), beta polypeptide, 56/58kD, isoform 2"", ""ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2"""	VPP3, ATP6B2		2145275, 14580332	Standard	NM_001693		Approved	VATB, Vma2, HO57	uc003wzp.3	P21281	OTTHUMG00000131073	ENST00000276390.2:c.1201T>C	8.37:g.20074770T>C			B2R5Z3|D3DSQ5|Q14544|Q15859|Q96IR0	Silent	SNP	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,pfam_ATPase_F1/V1/A1-cplx_a/bsu_N,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,tigrfam_ATPase_V1-cplx_bsu	p.L401	ENST00000276390.2	37	c.1201	CCDS6014.1	8																																																																																			ATP6V1B2	-	tigrfam_ATPase_V1-cplx_bsu	ENSG00000147416		0.378	ATP6V1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1B2	HGNC	protein_coding	OTTHUMT00000253732.1	80	0.00	0	T	NM_001693		20074770	20074770	+1	no_errors	ENST00000276390	ensembl	human	known	69_37n	silent	34	24.44	11	SNP	0.998	C
BTBD19	149478	genome.wustl.edu	37	1	45275937	45275937	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr1:45275937T>A	ENST00000450269.1	+	2	478	c.139T>A	c.(139-141)Tgc>Agc	p.C47S	TCTEX1D4_ENST00000372200.1_5'Flank|BTBD19_ENST00000409335.2_Missense_Mutation_p.C47S|BTBD19_ENST00000453418.1_Missense_Mutation_p.C47S	NM_001136537.1	NP_001130009.1	C9JJ37	BTBDJ_HUMAN	BTB (POZ) domain containing 19	47	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									breast(1)|endometrium(1)	2						TGCCCATCGGTGCTTGTTGGC	0.602																																						dbGAP											0													79.0	68.0	71.0					1																	45275937		692	1591	2283	-	-	-	SO:0001583	missense	0					1p34.1	2013-01-08			ENSG00000222009	ENSG00000222009		"""BTB/POZ domain containing"""	27145	protein-coding gene	gene with protein product							Standard	NM_001136537		Approved		uc010ole.1	C9JJ37	OTTHUMG00000008493	ENST00000450269.1:c.139T>A	1.37:g.45275937T>A	ENSP00000395461:p.Cys47Ser		B4E384|B7ZC36|B7ZC37	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.C47S	ENST00000450269.1	37	c.139		1	.	.	.	.	.	.	.	.	.	.	T	18.07	3.540899	0.65085	.	.	ENSG00000222009	ENST00000450269;ENST00000453418;ENST00000409335	T;T;T	0.66280	-0.2;-0.2;-0.2	5.1	5.1	0.69264	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	T	0.70237	0.3201	L	0.39633	1.23	0.37925	D	0.931819	D	0.76494	0.999	D	0.85130	0.997	T	0.70644	-0.4815	9	0.28530	T	0.3	-1.9633	14.091	0.64990	0.0:0.0:0.0:1.0	.	47	C9JJ37	BTBDJ_HUMAN	S	47	ENSP00000395461:C47S;ENSP00000405193:C47S;ENSP00000386506:C47S	ENSP00000386506:C47S	C	+	1	0	BTBD19	45048524	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.741000	0.68638	1.911000	0.55334	0.459000	0.35465	TGC	BTBD19	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000222009		0.602	BTBD19-201	KNOWN	basic|appris_principal	protein_coding	BTBD19	HGNC	protein_coding		45	0.00	0	T	NM_001136537		45275937	45275937	+1	no_errors	ENST00000450269	ensembl	human	known	69_37n	missense	36	17.39	8	SNP	1.000	A
CBL	867	genome.wustl.edu	37	11	119103255	119103255	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr11:119103255T>C	ENST00000264033.4	+	2	669	c.293T>C	c.(292-294)aTc>aCc	p.I98T		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	98	4H.|Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|Sufficient for interaction with EPHB1.				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		CTCCGTACTATCTTGTCAAGA	0.433			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																													dbGAP		"""Dom, Rec"""	yes		11	11q23.3	867	Cas-Br-M (murine) ecotropic retroviral transforming		L	0													103.0	98.0	99.0					11																	119103255		2199	4295	6494	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.293T>C	11.37:g.119103255T>C	ENSP00000264033:p.Ile98Thr		A3KMP8	Missense_Mutation	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/transl_elong_EF1B_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.I98T	ENST00000264033.4	37	c.293	CCDS8418.1	11	.	.	.	.	.	.	.	.	.	.	T	17.73	3.462658	0.63513	.	.	ENSG00000110395	ENST00000264033	T	0.80738	-1.41	5.91	5.91	0.95273	Adaptor protein Cbl, N-terminal helical (3);Adaptor protein Cbl, PTB domain (1);	0.140307	0.64402	D	0.000005	D	0.88952	0.6577	M	0.84846	2.72	0.80722	D	1	B	0.26318	0.146	P	0.45610	0.487	D	0.88428	0.3033	10	0.87932	D	0	-37.0585	16.3433	0.83110	0.0:0.0:0.0:1.0	.	98	P22681	CBL_HUMAN	T	98	ENSP00000264033:I98T	ENSP00000264033:I98T	I	+	2	0	CBL	118608465	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.974000	0.88039	2.254000	0.74563	0.533000	0.62120	ATC	CBL	-	pfam_Adaptor_Cbl_N_hlx,superfamily_Adaptor_Cbl_N_hlx	ENSG00000110395		0.433	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBL	HGNC	protein_coding	OTTHUMT00000388219.4	49	0.00	0	T	NM_005188		119103255	119103255	+1	no_errors	ENST00000264033	ensembl	human	known	69_37n	missense	37	15.91	7	SNP	1.000	C
CHL1	10752	genome.wustl.edu	37	3	447268	447268	+	Silent	SNP	C	C	T	rs529988946	byFrequency	TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr3:447268C>T	ENST00000256509.2	+	28	4191	c.3549C>T	c.(3547-3549)taC>taT	p.Y1183Y	CHL1_ENST00000397491.2_Silent_p.Y1167Y	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TAGTCGAATACGGAGAGGGAG	0.453													C|||	2	0.000399361	0.0	0.0	5008	,	,		18426	0.0		0.0	False		,,,				2504	0.002					dbGAP											0													121.0	114.0	117.0					3																	447268		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.3549C>T	3.37:g.447268C>T			Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.T317	ENST00000256509.2	37	c.950	CCDS2556.1	3																																																																																			CHL1	-	NULL	ENSG00000134121		0.453	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHL1	HGNC	protein_coding	OTTHUMT00000207155.2	48	0.00	0	C	NM_006614		447268	447268	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000445697	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	0.959	T
COL5A1	1289	genome.wustl.edu	37	9	137707822	137707822	+	Silent	SNP	A	A	G			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr9:137707822A>G	ENST00000371817.3	+	52	4524	c.4110A>G	c.(4108-4110)gaA>gaG	p.E1370E		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1370	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		ATGATGGTGAACCCGGGCAGA	0.552																																						dbGAP											0													148.0	134.0	139.0					9																	137707822		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.4110A>G	9.37:g.137707822A>G			Q15094|Q5SUX4	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Laminin_G,smart_Fib_collagen_C	p.E1370	ENST00000371817.3	37	c.4110	CCDS6982.1	9																																																																																			COL5A1	-	NULL	ENSG00000130635		0.552	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A1	HGNC	protein_coding	OTTHUMT00000054954.2	66	0.00	0	A	NM_000093		137707822	137707822	+1	no_errors	ENST00000371817	ensembl	human	known	69_37n	silent	56	14.93	10	SNP	0.400	G
CROCCP2	84809	genome.wustl.edu	37	1	16950470	16950470	+	lincRNA	SNP	C	C	T	rs12144467	byFrequency	TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr1:16950470C>T	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											AACAGGCTGCCCTCCAGGGCT	0.662																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16950470C>T			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.662	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	23	0.00	0	C	NR_026752.1		16950470	16950470	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	31	16.22	6	SNP	0.996	T
FLRT2	23768	genome.wustl.edu	37	14	86088323	86088323	+	Silent	SNP	C	C	T			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr14:86088323C>T	ENST00000330753.4	+	2	1232	c.465C>T	c.(463-465)ttC>ttT	p.F155F	FLRT2_ENST00000554746.1_Silent_p.F155F	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	155					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		ACGGGGCCTTCCGGGAGGCTA	0.527																																						dbGAP											0													46.0	49.0	48.0					14																	86088323		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.465C>T	14.37:g.86088323C>T			A0AV84|B7ZLP3	Silent	SNP	pfam_Leu-rich_rpt,pfam_Fibronectin_type3,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.F155	ENST00000330753.4	37	c.465	CCDS9877.1	14																																																																																			FLRT2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000185070		0.527	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	HGNC	protein_coding	OTTHUMT00000413193.1	28	0.00	0	C			86088323	86088323	+1	no_errors	ENST00000330753	ensembl	human	known	69_37n	silent	30	14.29	5	SNP	1.000	T
MROH7	374977	genome.wustl.edu	37	1	55166925	55166925	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr1:55166925G>A	ENST00000421030.2	+	19	3500	c.3215G>A	c.(3214-3216)cGg>cAg	p.R1072Q	MROH7_ENST00000454855.2_Missense_Mutation_p.R590Q|MROH7_ENST00000409996.1_Missense_Mutation_p.R640Q|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.R1072Q	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	1072						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											TTCAAGGGGCGGGACCAGAAG	0.597																																						dbGAP											0													69.0	75.0	73.0					1																	55166925		2122	4240	6362	-	-	-	SO:0001583	missense	0			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.3215G>A	1.37:g.55166925G>A	ENSP00000396622:p.Arg1072Gln		A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R1072Q	ENST00000421030.2	37	c.3215	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	G	2.341	-0.351168	0.05173	.	.	ENSG00000184313	ENST00000421030;ENST00000414867;ENST00000409996;ENST00000454855;ENST00000371287	T;T;T;T	0.33216	1.42;1.42;1.42;1.42	4.79	3.67	0.42095	Armadillo-like helical (1);Armadillo-type fold (1);	0.265359	0.27031	N	0.021264	T	0.06142	0.0159	N	0.00162	-1.95	0.22511	N	0.999037	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.30765	-0.9967	10	0.20046	T	0.44	-7.1121	6.3894	0.21579	0.8869:0.0:0.1131:0.0	.	1072;1072	Q68CQ1;Q68CQ1-9	HEAT8_HUMAN;.	Q	1072;1101;640;590;141	ENSP00000396622:R1072Q;ENSP00000387048:R640Q;ENSP00000401130:R590Q;ENSP00000360336:R141Q	ENSP00000360336:R141Q	R	+	2	0	HEATR8	54939513	1.000000	0.71417	1.000000	0.80357	0.555000	0.35460	1.843000	0.39259	0.876000	0.35872	0.313000	0.20887	CGG	HEATR8	-	superfamily_ARM-type_fold	ENSG00000184313		0.597	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR8	HGNC	protein_coding	OTTHUMT00000346978.1	42	0.00	0	G	NM_198547		55166925	55166925	+1	no_errors	ENST00000421030	ensembl	human	known	69_37n	missense	56	15.15	10	SNP	1.000	A
ICOSLG	23308	genome.wustl.edu	37	21	45651313	45651313	+	Nonsense_Mutation	SNP	C	C	A	rs182215758		TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr21:45651313C>A	ENST00000407780.3	-	5	839	c.712G>T	c.(712-714)Gag>Tag	p.E238*	ICOSLG_ENST00000400379.3_Nonsense_Mutation_p.E238*|ICOSLG_ENST00000344330.4_Nonsense_Mutation_p.E238*|ICOSLG_ENST00000400377.3_Nonsense_Mutation_p.E121*	NM_001283052.1	NP_001269981.1	O75144	ICOSL_HUMAN	inducible T-cell co-stimulator ligand	238					B cell activation (GO:0042113)|defense response (GO:0006952)|hyperosmotic response (GO:0006972)|positive regulation of activated T cell proliferation (GO:0042104)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(2)|lung(1)|stomach(1)|urinary_tract(1)	5				Colorectal(79;0.0163)|READ - Rectum adenocarcinoma(84;0.0772)		TTGTCTCTCTCTCCGATGTCA	0.478																																						dbGAP											0													127.0	131.0	130.0					21																	45651313		2056	4185	6241	-	-	-	SO:0001587	stop_gained	0			AB014553	CCDS42952.1, CCDS63377.1, CCDS63379.1	21q22.3	2014-01-30		2005-01-12	ENSG00000160223	ENSG00000160223		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Endogenous ligands"""	17087	protein-coding gene	gene with protein product	"""B7-related protein 1"", ""B7 homologue 2"", ""B7 homolog 2"""	605717		ICOSL		9734811, 11007762	Standard	NM_001283050		Approved	KIAA0653, GL50, B7-H2, B7RP-1, B7H2, B7RP1, ICOS-L, CD275	uc002zee.3	O75144	OTTHUMG00000086920	ENST00000407780.3:c.712G>T	21.37:g.45651313C>A	ENSP00000384432:p.Glu238*		A8MUZ1|Q9HD18|Q9NRQ1	Nonsense_Mutation	SNP	pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like	p.E238*	ENST00000407780.3	37	c.712	CCDS42952.1	21	.	.	.	.	.	.	.	.	.	.	C	15.62	2.887103	0.52014	.	.	ENSG00000160223	ENST00000344330;ENST00000407780;ENST00000400379;ENST00000400377	.	.	.	2.04	-0.475	0.12104	.	1.730500	0.02941	N	0.140511	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	1.5678	0.02608	0.3003:0.204:0.0:0.4958	.	.	.	.	X	238;238;238;121	.	ENSP00000339477:E238X	E	-	1	0	ICOSLG	44475741	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.268000	0.02836	-0.119000	0.11830	-0.302000	0.09304	GAG	ICOSLG	-	NULL	ENSG00000160223		0.478	ICOSLG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ICOSLG	HGNC	protein_coding	OTTHUMT00000195838.1	74	0.00	0	C	NM_015259		45651313	45651313	-1	no_errors	ENST00000344330	ensembl	human	known	69_37n	nonsense	44	37.14	26	SNP	0.000	A
IL3RA	3563	genome.wustl.edu	37	X	1475125	1475125	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chrX:1475125C>G	ENST00000331035.4	+	7	977	c.628C>G	c.(628-630)Cca>Gca	p.P210A	IL3RA_ENST00000381469.2_Missense_Mutation_p.P132A	NM_001267713.1|NM_002183.3	NP_001254642.1|NP_002174.1	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha (low affinity)	210					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-3 receptor activity (GO:0004912)			lung(1)|skin(2)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	GATATTAACTCCACCCAACAT	0.333																																						dbGAP											0													183.0	175.0	178.0					X																	1475125		2203	4296	6499	-	-	-	SO:0001583	missense	0			M74782	CCDS14113.1, CCDS59158.1	Xp22.3 and Yp13.3	2008-07-21			ENSG00000185291	ENSG00000185291		"""Pseudoautosomal regions / PAR1"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6012	protein-coding gene	gene with protein product		308385, 430000				1833064	Standard	NM_002183		Approved	CD123	uc004cps.3	P26951	OTTHUMG00000021059	ENST00000331035.4:c.628C>G	X.37:g.1475125C>G	ENSP00000327890:p.Pro210Ala		A8K3F3|B9VI81|Q5HYQ7|Q5HYQ8|Q9UEH7	Missense_Mutation	SNP	pfam_IL6_recept-bd,superfamily_Fibronectin_type3	p.P210A	ENST00000331035.4	37	c.628	CCDS14113.1	X	.	.	.	.	.	.	.	.	.	.	.	8.614	0.889819	0.17540	.	.	ENSG00000185291	ENST00000331035;ENST00000432757;ENST00000381469	D;T;D	0.97620	-4.46;-0.1;-4.46	0.852	-0.344	0.12628	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.56097	U	0.000035	D	0.96759	0.8942	L	0.57536	1.79	0.09310	N	1	P;D	0.89917	0.873;1.0	P;D	0.87578	0.519;0.998	D	0.90938	0.4795	10	0.59425	D	0.04	-3.7789	4.4599	0.11661	0.0:0.5829:0.4171:0.0	.	131;210	P26951-2;P26951	.;IL3RA_HUMAN	A	210;132;132	ENSP00000327890:P210A;ENSP00000414867:P132A;ENSP00000370878:P132A	ENSP00000327890:P210A	P	+	1	0	IL3RA	1435125	0.000000	0.05858	0.028000	0.17463	0.402000	0.30811	-0.367000	0.07553	-0.126000	0.11682	0.115000	0.15696	CCA	IL3RA	-	superfamily_Fibronectin_type3	ENSG00000185291		0.333	IL3RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL3RA	HGNC	protein_coding	OTTHUMT00000055600.3	54	0.00	0	C			1475125	1475125	+1	no_errors	ENST00000331035	ensembl	human	known	69_37n	missense	48	23.81	15	SNP	0.027	G
IL4R	3566	genome.wustl.edu	37	16	27375135	27375135	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr16:27375135A>G	ENST00000395762.2	+	11	2721	c.2462A>G	c.(2461-2463)tAc>tGc	p.Y821C	IL4R_ENST00000543915.2_Missense_Mutation_p.Y821C|IL4R_ENST00000380922.3_Missense_Mutation_p.Y806C|IL4R_ENST00000170630.2_Missense_Mutation_p.Y821C	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	821					defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						GGACCCACATACATGAGGGTC	0.532																																						dbGAP											0													116.0	113.0	114.0					16																	27375135		2197	4300	6497	-	-	-	SO:0001583	missense	0			X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.2462A>G	16.37:g.27375135A>G	ENSP00000379111:p.Tyr821Cys		B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Missense_Mutation	SNP	pfam_IL4Ra_N,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.Y821C	ENST00000395762.2	37	c.2462	CCDS10629.1	16	.	.	.	.	.	.	.	.	.	.	A	6.470	0.454817	0.12283	.	.	ENSG00000077238	ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	T;T;T;T	0.08807	3.06;3.06;3.05;3.06	4.48	-2.61	0.06171	.	1.662980	0.03921	N	0.283611	T	0.01835	0.0058	N	0.00347	-1.61	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.40289	-0.9571	10	0.16896	T	0.51	-23.9777	3.1767	0.06571	0.3585:0.0:0.3428:0.2987	.	806;821;821	B4E076;B9EGC0;P24394	.;.;IL4RA_HUMAN	C	821;821;806;821	ENSP00000379111:Y821C;ENSP00000441667:Y821C;ENSP00000370309:Y806C;ENSP00000170630:Y821C	ENSP00000170630:Y821C	Y	+	2	0	IL4R	27282636	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.137000	0.15995	-0.252000	0.09528	-0.799000	0.03217	TAC	IL4R	-	NULL	ENSG00000077238		0.532	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL4R	HGNC	protein_coding	OTTHUMT00000214104.4	26	0.00	0	A			27375135	27375135	+1	no_errors	ENST00000170630	ensembl	human	known	69_37n	missense	9	37.50	6	SNP	0.000	G
JPH4	84502	genome.wustl.edu	37	14	24040436	24040436	+	Frame_Shift_Del	DEL	C	C	-	rs144738828		TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr14:24040436delC	ENST00000397118.3	-	6	2406	c.1504delG	c.(1504-1506)gcafs	p.A502fs	JPH4_ENST00000544177.1_Frame_Shift_Del_p.A167fs|JPH4_ENST00000356300.4_Frame_Shift_Del_p.A502fs	NM_032452.2	NP_115828.2	Q96JJ6	JPH4_HUMAN	junctophilin 4	502					calcium ion transport into cytosol (GO:0060402)|learning (GO:0007612)|neuromuscular process controlling balance (GO:0050885)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic plasticity (GO:0048167)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)		p.A502fs*12(2)|p.A502fs*8(1)		endometrium(1)|large_intestine(2)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		TGTGCGCCTGCCCCCCCCCAC	0.687																																						dbGAP											3	Insertion - Frameshift(2)|Deletion - Frameshift(1)	ovary(1)|lung(1)|pancreas(1)											75.0	82.0	80.0					14																	24040436		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			AB058734	CCDS9603.1	14q11	2004-05-28	2004-05-28	2004-05-28	ENSG00000092051	ENSG00000092051			20156	protein-coding gene	gene with protein product			"""junctophilin like 1"""	JPHL1		11347906	Standard	NM_032452		Approved	KIAA1831	uc001wkr.2	Q96JJ6	OTTHUMG00000028769	ENST00000397118.3:c.1504delG	14.37:g.24040436delC	ENSP00000380307:p.Ala502fs		D3DS53|Q8ND44|Q96DQ0	Frame_Shift_Del	DEL	pfam_MORN,smart_MORN,pirsf_Junctophilin	p.A502fs	ENST00000397118.3	37	c.1504	CCDS9603.1	14																																																																																			JPH4	-	pirsf_Junctophilin	ENSG00000092051		0.687	JPH4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	JPH4	HGNC	protein_coding	OTTHUMT00000413853.1	15	0.00	0	C	NM_032452		24040436	24040436	-1	no_errors	ENST00000356300	ensembl	human	known	69_37n	frame_shift_del	15	16.67	3	DEL	0.057	-
KIAA1109	84162	genome.wustl.edu	37	4	123202768	123202768	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr4:123202768T>A	ENST00000264501.4	+	52	9249	c.8876T>A	c.(8875-8877)gTt>gAt	p.V2959D	KIAA1109_ENST00000455637.1_Missense_Mutation_p.V2959D|KIAA1109_ENST00000388738.3_Missense_Mutation_p.V2959D			Q2LD37	K1109_HUMAN	KIAA1109	2959					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CAAACTCCTGTTGAAACAAAT	0.378																																						dbGAP											0													100.0	95.0	96.0					4																	123202768		1816	4080	5896	-	-	-	SO:0001583	missense	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.8876T>A	4.37:g.123202768T>A	ENSP00000264501:p.Val2959Asp		Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Nonsense_Mutation	SNP	NULL	p.C916*	ENST00000264501.4	37	c.2748	CCDS43267.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.36|16.36	3.101543|3.101543	0.56183|0.56183	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000419325|ENST00000264501;ENST00000388738;ENST00000455637	.|T;T;T	.|0.25749	.|2.37;2.37;1.78	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	.|0.539313	.|0.17440	.|N	.|0.174146	.|T	.|0.33962	.|0.0881	L|L	0.46157|0.46157	1.445|1.445	0.58432|0.58432	D|D	0.999997|0.999997	.|B;B	.|0.32781	.|0.384;0.265	.|B;B	.|0.43018	.|0.405;0.229	.|T	.|0.06643	.|-1.0815	.|10	.|0.36615	.|T	.|0.2	.|.	15.5364|15.5364	0.76007|0.76007	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|2959;2959	.|Q2LD37-6;Q2LD37	.|.;K1109_HUMAN	X|D	916|2959	.|ENSP00000264501:V2959D;ENSP00000373390:V2959D;ENSP00000389925:V2959D	.|ENSP00000264501:V2959D	C|V	+|+	3|2	2|0	KIAA1109|KIAA1109	123422218|123422218	1.000000|1.000000	0.71417|0.71417	0.976000|0.976000	0.42696|0.42696	0.991000|0.991000	0.79684|0.79684	7.896000|7.896000	0.87350|0.87350	2.079000|2.079000	0.62486|0.62486	0.482000|0.482000	0.46254|0.46254	TGT|GTT	KIAA1109	-	NULL	ENSG00000138688		0.378	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	57	0.00	0	T	NM_020797		123202768	123202768	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000419325	ensembl	human	putative	69_37n	nonsense	39	25.00	13	SNP	0.999	A
KIAA1109	84162	genome.wustl.edu	37	4	123271039	123271039	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr4:123271039G>C	ENST00000264501.4	+	80	14032	c.13659G>C	c.(13657-13659)aaG>aaC	p.K4553N	KIAA1109_ENST00000388738.3_Missense_Mutation_p.K4553N			Q2LD37	K1109_HUMAN	KIAA1109	4553					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						GAGATTTGAAGTGGGATATTT	0.343																																						dbGAP											0													198.0	186.0	189.0					4																	123271039		1820	4085	5905	-	-	-	SO:0001583	missense	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.13659G>C	4.37:g.123271039G>C	ENSP00000264501:p.Lys4553Asn		Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.K4553N	ENST00000264501.4	37	c.13659	CCDS43267.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.856|2.856	-0.237283|-0.237283	0.05944|0.05944	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707;ENST00000431755|ENST00000306802	T;T;T|.	0.46063|.	0.88;0.88;0.88|.	5.85|5.85	3.15|3.15	0.36227|0.36227	Fragile site-associated protein, C-terminal (1);|.	0.110788|.	0.64402|.	D|.	0.000007|.	T|T	0.29817|0.29817	0.0745|0.0745	N|N	0.03608|0.03608	-0.345|-0.345	0.80722|0.80722	D|D	1|1	B;B|.	0.27625|.	0.065;0.183|.	B;B|.	0.31946|.	0.059;0.138|.	T|T	0.05852|0.05852	-1.0860|-1.0860	10|5	0.21014|.	T|.	0.42|.	.|.	11.1528|11.1528	0.48469|0.48469	0.2692:0.0:0.7308:0.0|0.2692:0.0:0.7308:0.0	.|.	4552;4553|.	Q2LD37-4;Q2LD37|.	.;K1109_HUMAN|.	N|T	4553;4553;1222;154|929	ENSP00000264501:K4553N;ENSP00000373390:K4553N;ENSP00000410874:K1222N|.	ENSP00000264501:K4553N|.	K|S	+|+	3|2	2|0	KIAA1109|KIAA1109	123490489|123490489	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.859000|3.859000	0.55987|0.55987	0.800000|0.800000	0.34041|0.34041	0.563000|0.563000	0.77884|0.77884	AAG|AGT	KIAA1109	-	pfam_Fragile_site-assoc_C	ENSG00000138688		0.343	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	62	0.00	0	G	NM_020797		123271039	123271039	+1	no_errors	ENST00000264501	ensembl	human	known	69_37n	missense	48	12.73	7	SNP	1.000	C
KIF4A	24137	genome.wustl.edu	37	X	69639610	69639610	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chrX:69639610G>A	ENST00000374403.3	+	30	3554	c.3472G>A	c.(3472-3474)Gtc>Atc	p.V1158I		NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	1158	Globular.|Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						CTTTAATCCCGTCTGTGCCAC	0.517																																						dbGAP											0													84.0	78.0	80.0					X																	69639610		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.3472G>A	X.37:g.69639610G>A	ENSP00000363524:p.Val1158Ile		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.V1158I	ENST00000374403.3	37	c.3472	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	G	9.527	1.109881	0.20714	.	.	ENSG00000090889	ENST00000374403;ENST00000544650	T	0.52526	0.66	5.2	4.33	0.51752	.	0.116241	0.38326	N	0.001731	T	0.26882	0.0658	N	0.17474	0.49	0.80722	D	1	B	0.18166	0.026	B	0.11329	0.006	T	0.06917	-1.0800	9	.	.	.	.	6.6563	0.22988	0.0977:0.1744:0.7279:0.0	.	1158	O95239	KIF4A_HUMAN	I	1158;460	ENSP00000363524:V1158I	.	V	+	1	0	KIF4A	69556335	0.994000	0.37717	0.978000	0.43139	0.389000	0.30415	2.062000	0.41413	1.149000	0.42402	0.600000	0.82982	GTC	KIF4A	-	NULL	ENSG00000090889		0.517	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	42	0.00	0	G	NM_012310		69639610	69639610	+1	no_errors	ENST00000374403	ensembl	human	known	69_37n	missense	50	15.25	9	SNP	0.976	A
LRRC37A6P	387646	genome.wustl.edu	37	10	27540072	27540072	+	lincRNA	SNP	C	C	A			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr10:27540072C>A	ENST00000574842.1	+	0	2004				LRRC37A6P_ENST00000284414.4_RNA																							ACAATATCAGCAATGCTCCAA	0.393																																						dbGAP											0																																										-	-	-			0																															10.37:g.27540072C>A				RNA	SNP	-	NULL	ENST00000574842.1	37	NULL		10																																																																																			LRRC37A6P	-	-	ENSG00000230445		0.393	RP11-85G18.6-001	KNOWN	basic	lincRNA	LRRC37A6P	HGNC	lincRNA	OTTHUMT00000436904.1	10	0.00	0	C			27540072	27540072	-1	no_errors	ENST00000574795	ensembl	human	known	69_37n	rna	13	23.53	4	SNP	0.018	A
MASP1	5648	genome.wustl.edu	37	3	186961340	186961340	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr3:186961340G>C	ENST00000337774.5	-	9	1549	c.1160C>G	c.(1159-1161)aCc>aGc	p.T387S	MASP1_ENST00000296280.6_Missense_Mutation_p.T387S|MASP1_ENST00000495249.1_Intron|MASP1_ENST00000392472.2_Missense_Mutation_p.T274S	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	387	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		CTTGTATGTGGTGAGGTTGTT	0.493																																						dbGAP											0													252.0	228.0	236.0					3																	186961340		2203	4300	6503	-	-	-	SO:0001583	missense	0			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1160C>G	3.37:g.186961340G>C	ENSP00000336792:p.Thr387Ser		A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_EGF-like_Ca-bd,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_CUB,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6	p.T387S	ENST00000337774.5	37	c.1160	CCDS33907.1	3	.	.	.	.	.	.	.	.	.	.	G	23.3	4.400661	0.83120	.	.	ENSG00000127241	ENST00000337774;ENST00000296280;ENST00000392472;ENST00000541896	T;T;T	0.65916	-0.18;-0.18;-0.18	5.56	5.56	0.83823	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.78874	0.4352	M	0.71206	2.165	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.99	D;D;P	0.78314	0.991;0.982;0.9	T	0.78244	-0.2279	10	0.46703	T	0.11	.	18.507	0.90901	0.0:0.0:1.0:0.0	.	274;387;387	P48740-4;P48740-2;P48740	.;.;MASP1_HUMAN	S	387;387;274;274	ENSP00000336792:T387S;ENSP00000296280:T387S;ENSP00000376264:T274S	ENSP00000296280:T387S	T	-	2	0	MASP1	188444034	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.014000	0.76380	2.622000	0.88805	0.561000	0.74099	ACC	MASP1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000127241		0.493	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	HGNC	protein_coding	OTTHUMT00000344262.1	107	0.00	0	G	NM_001879		186961340	186961340	-1	no_errors	ENST00000296280	ensembl	human	known	69_37n	missense	78	13.33	12	SNP	1.000	C
KMT2C	58508	genome.wustl.edu	37	7	151945451	151945451	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr7:151945451C>A	ENST00000262189.6	-	14	2286	c.2068G>T	c.(2068-2070)Gaa>Taa	p.E690*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.E690*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	690					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GTGACAGATTCCATGACTAAT	0.428																																						dbGAP											0													72.0	68.0	69.0					7																	151945451		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2068G>T	7.37:g.151945451C>A	ENSP00000262189:p.Glu690*		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E690*	ENST00000262189.6	37	c.2068	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	C	39	7.371271	0.98241	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	4.86	3.02	0.34903	.	0.794972	0.10569	N	0.659339	.	.	.	.	.	.	0.30209	N	0.797923	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	10.5021	0.44813	0.0:0.7926:0.1343:0.0731	.	.	.	.	X	690	.	ENSP00000262189:E690X	E	-	1	0	MLL3	151576384	0.327000	0.24678	0.002000	0.10522	0.002000	0.02628	1.707000	0.37888	0.730000	0.32425	0.650000	0.86243	GAA	MLL3	-	NULL	ENSG00000055609		0.428	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	79	0.00	0	C			151945451	151945451	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	nonsense	69	28.12	27	SNP	0.069	A
MTMR8	55613	genome.wustl.edu	37	X	63490847	63490847	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chrX:63490847C>T	ENST00000374852.3	-	13	1655	c.1588G>A	c.(1588-1590)Gat>Aat	p.D530N	MTMR8_ENST00000453546.1_Intron	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	530						nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.0?(2)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						TCATGCACATCTGTCTCCAGC	0.478																																						dbGAP											2	Whole gene deletion(2)	ovary(1)|large_intestine(1)											121.0	100.0	107.0					X																	63490847		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.1588G>A	X.37:g.63490847C>T	ENSP00000363985:p.Asp530Asn		Q5JT99|Q9NXP6	Missense_Mutation	SNP	pfam_Myotub-related,smart_Tyr_Pase_cat	p.D530N	ENST00000374852.3	37	c.1588	CCDS14379.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.69|10.69	1.421906|1.421906	0.25639|0.25639	.|.	.|.	ENSG00000102043|ENSG00000102043	ENST00000374852;ENST00000247400|ENST00000442913	D|.	0.94184|.	-3.37|.	3.75|3.75	1.87|1.87	0.25490|0.25490	.|.	0.314036|.	0.20770|.	U|.	0.086009|.	T|T	0.18467|0.18467	0.0443|0.0443	N|N	0.12746|0.12746	0.255|0.255	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.06405|.	0.002|.	T|T	0.24404|0.24404	-1.0161|-1.0161	10|5	0.22109|.	T|.	0.4|.	.|.	5.3298|5.3298	0.15926|0.15926	0.0:0.6106:0.0:0.3894|0.0:0.6106:0.0:0.3894	.|.	530|.	Q96EF0|.	MTMR8_HUMAN|.	N|K	530;416|333	ENSP00000363985:D530N|.	ENSP00000247400:D416N|.	D|R	-|-	1|2	0|0	MTMR8|MTMR8	63407572|63407572	0.009000|0.009000	0.17119|0.17119	0.008000|0.008000	0.14137|0.14137	0.989000|0.989000	0.77384|0.77384	0.350000|0.350000	0.20079|0.20079	0.523000|0.523000	0.28482|0.28482	0.594000|0.594000	0.82650|0.82650	GAT|AGA	MTMR8	-	NULL	ENSG00000102043		0.478	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR8	HGNC	protein_coding	OTTHUMT00000056949.2	75	0.00	0	C	NM_017677		63490847	63490847	-1	no_errors	ENST00000374852	ensembl	human	known	69_37n	missense	62	16.22	12	SNP	0.011	T
MUC16	94025	genome.wustl.edu	37	19	9073430	9073430	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr19:9073430C>G	ENST00000397910.4	-	3	14219	c.14016G>C	c.(14014-14016)atG>atC	p.M4672I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4674	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TAGATATTGTCATGGGAGGAG	0.458																																						dbGAP											0													151.0	142.0	145.0					19																	9073430		1901	4132	6033	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.14016G>C	19.37:g.9073430C>G	ENSP00000381008:p.Met4672Ile		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.M4672I	ENST00000397910.4	37	c.14016	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	5.910	0.352067	0.11182	.	.	ENSG00000181143	ENST00000397910	T	0.02085	4.46	1.6	-3.2	0.05156	.	.	.	.	.	T	0.01421	0.0046	N	0.14661	0.345	.	.	.	B	0.10296	0.003	B	0.06405	0.002	T	0.45483	-0.9258	8	0.87932	D	0	.	3.6096	0.08055	0.0:0.3954:0.2021:0.4025	.	4672	B5ME49	.	I	4672	ENSP00000381008:M4672I	ENSP00000381008:M4672I	M	-	3	0	MUC16	8934430	0.000000	0.05858	0.000000	0.03702	0.511000	0.34104	0.011000	0.13264	-1.274000	0.02421	0.313000	0.20887	ATG	MUC16	-	NULL	ENSG00000181143		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	67	0.00	0	C	NM_024690		9073430	9073430	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	42	41.67	30	SNP	0.000	G
NDUFA4	4697	genome.wustl.edu	37	7	10978513	10978514	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr7:10978513_10978514insG	ENST00000339600.5	-	2	250_251	c.52_53insC	c.(52-54)ctcfs	p.L18fs	RP5-855F16.1_ENST00000604183.1_lincRNA|NDUFA4_ENST00000492822.1_5'Flank	NM_002489.3	NP_002480.1	O00483	NDUA4_HUMAN	NDUFA4, mitochondrial complex associated	18					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrial respiratory chain complex IV (GO:0005751)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|protein complex binding (GO:0032403)			large_intestine(2)|lung(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.177)		AAATACAAAGAGGGGGATCAAC	0.366																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U94586	CCDS5357.1	7p21.3	2014-07-30	2014-07-30		ENSG00000189043	ENSG00000189043			7687	protein-coding gene	gene with protein product	"""complex I 9kDa subunit"", ""NADH-ubiquinone oxidoreductase MLRQ subunit"""	603833	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4 (9kD, MLRQ)"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa"""			9352085	Standard	NM_002489		Approved	MLRQ, CI-9k	uc003srx.2	O00483	OTTHUMG00000023880	ENST00000339600.5:c.53dupC	7.37:g.10978518_10978518dupG	ENSP00000339720:p.Leu18fs		A4D109|Q6FHN5	Frame_Shift_Ins	INS	NULL	p.L18fs	ENST00000339600.5	37	c.53_52	CCDS5357.1	7																																																																																			NDUFA4	-	NULL	ENSG00000189043		0.366	NDUFA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFA4	HGNC	protein_coding	OTTHUMT00000207507.3	41	0.00	0	-	NM_002489		10978513	10978514	-1	no_errors	ENST00000339600	ensembl	human	known	69_37n	frame_shift_ins	33	15.38	6	INS	0.961:0.958	G
PCDHB11	56125	genome.wustl.edu	37	5	140581057	140581057	+	Silent	SNP	G	G	A			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr5:140581057G>A	ENST00000354757.3	+	1	1710	c.1710G>A	c.(1708-1710)gcG>gcA	p.A570A	PCDHB11_ENST00000536699.1_Silent_p.A205A	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	570	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACGGCTCCGCGCCCTGCACCG	0.716																																						dbGAP											0													4.0	5.0	5.0					5																	140581057		1486	3415	4901	-	-	-	SO:0001819	synonymous_variant	0			AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.1710G>A	5.37:g.140581057G>A			B4DSF7|Q2M223	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A570	ENST00000354757.3	37	c.1710	CCDS4253.1	5																																																																																			PCDHB11	-	superfamily_Cadherin-like	ENSG00000197479		0.716	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB11	HGNC	protein_coding	OTTHUMT00000251813.1	23	0.00	0	G	NM_018931		140581057	140581057	+1	no_errors	ENST00000354757	ensembl	human	known	69_37n	silent	8	30.77	4	SNP	0.001	A
PDC	5132	genome.wustl.edu	37	1	186413472	186413472	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr1:186413472A>G	ENST00000391997.2	-	4	467	c.380T>C	c.(379-381)aTt>aCt	p.I127T	PDC_ENST00000456239.2_Missense_Mutation_p.I75T|PDC_ENST00000497198.1_Missense_Mutation_p.I75T|PDC_ENST00000340129.5_Missense_Mutation_p.I127T	NM_002597.4	NP_002588.3	P20941	PHOS_HUMAN	phosducin	127	Thioredoxin fold. {ECO:0000250}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of catalytic activity (GO:0043086)|phototransduction (GO:0007602)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	phospholipase inhibitor activity (GO:0004859)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)	7		Breast(1374;1.53e-05)		KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.0129)		TTCCTTTTCAATTGTTTCTAG	0.403																																						dbGAP											0													178.0	183.0	181.0					1																	186413472		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF076464	CCDS1370.1, CCDS41447.1	1q25.2	2013-01-08			ENSG00000116703	ENSG00000116703			8759	protein-coding gene	gene with protein product		171490				8288249	Standard	NM_022576		Approved	MEKA	uc001gsa.4	P20941	OTTHUMG00000035575	ENST00000391997.2:c.380T>C	1.37:g.186413472A>G	ENSP00000375855:p.Ile127Thr		Q14816|Q9UP22|Q9UP23	Missense_Mutation	SNP	pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold,prints_Phosducin	p.I127T	ENST00000391997.2	37	c.380	CCDS1370.1	1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.099327	0.76983	.	.	ENSG00000116703	ENST00000391997;ENST00000497198;ENST00000456239;ENST00000340129	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	5.58	5.58	0.84498	Phosducin, thioredoxin-like domain (1);Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.75997	0.3926	M	0.88640	2.97	0.58432	D	0.999998	D	0.63046	0.992	D	0.66497	0.944	T	0.81527	-0.0892	10	0.87932	D	0	-11.7895	15.7563	0.78030	1.0:0.0:0.0:0.0	.	127	P20941	PHOS_HUMAN	T	127;75;75;127	ENSP00000375855:I127T;ENSP00000422775:I75T;ENSP00000411564:I75T;ENSP00000342033:I127T	ENSP00000342033:I127T	I	-	2	0	PDC	184680095	1.000000	0.71417	0.999000	0.59377	0.898000	0.52572	8.832000	0.92079	2.111000	0.64477	0.533000	0.62120	ATT	PDC	-	pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold,prints_Phosducin	ENSG00000116703		0.403	PDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDC	HGNC	protein_coding	OTTHUMT00000086347.2	45	0.00	0	A	NM_022577		186413472	186413472	-1	no_errors	ENST00000340129	ensembl	human	known	69_37n	missense	40	36.51	23	SNP	1.000	G
PDCD6	10016	genome.wustl.edu	37	5	272863	272863	+	Missense_Mutation	SNP	G	G	A	rs549592074		TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr5:272863G>A	ENST00000264933.4	+	2	239	c.139G>A	c.(139-141)Gag>Aag	p.E47K	PDCD6_ENST00000507528.1_Missense_Mutation_p.E47K|CTD-2083E4.6_ENST00000512642.1_RNA|PDCD6_ENST00000505221.1_Missense_Mutation_p.E47K|PDCD6_ENST00000509581.1_Missense_Mutation_p.E47K	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	47	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			ATCAGACACCGAGCTTCAGCA	0.502																																						dbGAP											0													25.0	30.0	28.0					5																	272863		2189	4294	6483	-	-	-	SO:0001583	missense	0			AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.139G>A	5.37:g.272863G>A	ENSP00000264933:p.Glu47Lys		B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.E47K	ENST00000264933.4	37	c.139	CCDS3854.1	5	.	.	.	.	.	.	.	.	.	.	g	16.60	3.169099	0.57584	.	.	ENSG00000249915	ENST00000264933;ENST00000505221;ENST00000507528;ENST00000509581;ENST00000507473	T;T;T;T;T	0.51817	0.69;2.31;0.69;2.31;2.17	4.34	3.47	0.39725	EF-hand-like domain (1);	.	.	.	.	T	0.76111	0.3942	H	0.97491	4.015	0.80722	D	1	P;D;D	0.89917	0.93;1.0;1.0	B;D;D	0.97110	0.406;1.0;0.997	T	0.79337	-0.1845	9	0.87932	D	0	.	7.975	0.30149	0.1126:0.0:0.8874:0.0	.	79;47;47	B4DHG2;Q2YDC2;O75340	.;.;PDCD6_HUMAN	K	47;47;47;47;13	ENSP00000264933:E47K;ENSP00000422085:E47K;ENSP00000423815:E47K;ENSP00000422691:E47K;ENSP00000425370:E13K	ENSP00000264933:E47K	E	+	1	0	PDCD6	325863	1.000000	0.71417	0.989000	0.46669	0.090000	0.18270	5.472000	0.66768	1.048000	0.40298	0.457000	0.33378	GAG	PDCD6	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000249915		0.502	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDCD6	HGNC	protein_coding	OTTHUMT00000206609.2	67	0.00	0	G	NM_013232		272863	272863	+1	no_errors	ENST00000264933	ensembl	human	known	69_37n	missense	32	25.58	11	SNP	0.989	A
PELI2	57161	genome.wustl.edu	37	14	56763462	56763462	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr14:56763462C>T	ENST00000267460.4	+	6	1127	c.841C>T	c.(841-843)Cgg>Tgg	p.R281W		NM_021255.2	NP_067078.1	Q9HAT8	PELI2_HUMAN	pellino E3 ubiquitin protein ligase family member 2	281					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein phosphorylation (GO:0001934)|protein ubiquitination (GO:0016567)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)	ligase activity (GO:0016874)			kidney(6)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	22						TAACGCCGCCCGGCCTCAGTG	0.582																																						dbGAP											0													43.0	46.0	45.0					14																	56763462		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF302502	CCDS9726.1	14q21	2012-02-23	2012-02-23		ENSG00000139946	ENSG00000139946		"""Pellino homologs"""	8828	protein-coding gene	gene with protein product		614798	"""pellino (Drosophila) homolog 2"", ""pellino homolog 2 (Drosophila)"""			11306823, 12860405	Standard	XM_006720211		Approved		uc001xch.3	Q9HAT8	OTTHUMG00000152336	ENST00000267460.4:c.841C>T	14.37:g.56763462C>T	ENSP00000267460:p.Arg281Trp		B2RDY5	Missense_Mutation	SNP	pfam_Pellino	p.R281W	ENST00000267460.4	37	c.841	CCDS9726.1	14	.	.	.	.	.	.	.	.	.	.	C	19.96	3.922738	0.73213	.	.	ENSG00000139946	ENST00000267460	T	0.55413	0.52	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.75384	0.3842	M	0.87269	2.87	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.79704	-0.1692	10	0.87932	D	0	-28.749	13.7621	0.62973	0.2809:0.7191:0.0:0.0	.	281	Q9HAT8	PELI2_HUMAN	W	281	ENSP00000267460:R281W	ENSP00000267460:R281W	R	+	1	2	PELI2	55833215	0.998000	0.40836	0.779000	0.31741	0.986000	0.74619	3.910000	0.56371	2.557000	0.86248	0.555000	0.69702	CGG	PELI2	-	pfam_Pellino	ENSG00000139946		0.582	PELI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PELI2	HGNC	protein_coding	OTTHUMT00000276925.1	29	0.00	0	C			56763462	56763462	+1	no_errors	ENST00000267460	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	0.998	T
PIK3CA	5290	genome.wustl.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)											56.0	56.0	56.0					3																	178936082		1809	4069	5878	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E542K	ENST00000263967.3	37	c.1624	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	74	0.00	0	G			178936082	178936082	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	33	47.62	30	SNP	1.000	A
PNPT1	87178	genome.wustl.edu	37	2	55894154	55894154	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr2:55894154G>A	ENST00000447944.2	-	13	1234	c.1148C>T	c.(1147-1149)tCa>tTa	p.S383L		NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	383					cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			AAATAATGCTGATCCATGAAG	0.303																																						dbGAP											0													102.0	98.0	99.0					2																	55894154		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.1148C>T	2.37:g.55894154G>A	ENSP00000400646:p.Ser383Leu		Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	Missense_Mutation	SNP	pfam_ExoRNase_PH_dom1,pfam_ExoRNase_PH_dom2,pfam_PNPase_PH_RNA-bd_bac/org-type,pfam_KH_dom_type_1,pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ExoRNase_PH_dom2,superfamily_PNPase_PH_RNA-bd_bac/org-type,superfamily_NA-bd_OB-fold-like,smart_KH_dom,smart_RNA-binding_domain_S1,pirsf_PNPase,pfscan_KH_dom_type_1,pfscan_Rbsml_prot_S1_RNA-bd_dom,tigrfam_PNPase	p.S383L	ENST00000447944.2	37	c.1148	CCDS1856.1	2	.	.	.	.	.	.	.	.	.	.	G	34	5.331664	0.95733	.	.	ENSG00000138035	ENST00000447944	T	0.77620	-1.11	5.56	5.56	0.83823	Ribosomal protein S5 domain 2-type fold (1);Exoribonuclease, phosphorolytic domain 1 (1);	0.000000	0.85682	D	0.000000	D	0.92980	0.7766	H	0.97918	4.105	0.80722	D	1	D	0.69078	0.997	D	0.71656	0.974	D	0.95013	0.8153	10	0.87932	D	0	-15.898	19.9542	0.97213	0.0:0.0:1.0:0.0	.	383	Q8TCS8	PNPT1_HUMAN	L	383	ENSP00000400646:S383L	ENSP00000386075:S383L	S	-	2	0	PNPT1	55747658	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.527000	0.98044	2.788000	0.95919	0.586000	0.80456	TCA	PNPT1	-	pfam_ExoRNase_PH_dom1,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_PNPase,tigrfam_PNPase	ENSG00000138035		0.303	PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNPT1	HGNC	protein_coding	OTTHUMT00000251481.2	87	0.00	0	G	NM_033109		55894154	55894154	-1	no_errors	ENST00000415374	ensembl	human	known	69_37n	missense	69	12.66	10	SNP	1.000	A
RALB	5899	genome.wustl.edu	37	2	121043616	121043616	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr2:121043616C>T	ENST00000272519.5	+	3	551	c.281C>T	c.(280-282)tCa>tTa	p.S94L	RALB_ENST00000420510.1_Missense_Mutation_p.S94L|RALB_ENST00000470417.1_Intron|RALB_ENST00000474855.2_Missense_Mutation_p.S116L|RALB_ENST00000404963.3_Missense_Mutation_p.S115L	NM_002881.2	NP_002872.1	P11234	RALB_HUMAN	v-ral simian leukemia viral oncogene homolog B	94					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|regulation of exocyst assembly (GO:0001928)|regulation of exocyst localization (GO:0060178)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(3)|large_intestine(3)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(154;0.122)				CTTGTGTTCTCAATCACAGAA	0.448																																						dbGAP											0													115.0	106.0	109.0					2																	121043616		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2131.1	2q14.2	2014-05-09	2013-07-09		ENSG00000144118	ENSG00000144118			9840	protein-coding gene	gene with protein product	"""ras related GTP binding protein B"""	179551					Standard	NM_002881		Approved		uc002tmk.3	P11234	OTTHUMG00000131435	ENST00000272519.5:c.281C>T	2.37:g.121043616C>T	ENSP00000272519:p.Ser94Leu		B4E040|Q53T32|Q6ZS74	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_SRP_receptor_beta_su,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.S116L	ENST00000272519.5	37	c.347	CCDS2131.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.469118	0.96274	.	.	ENSG00000144118	ENST00000447591;ENST00000474855;ENST00000272519;ENST00000420510;ENST00000404963;ENST00000412383;ENST00000449649	T;D;D;D;D;D;T	0.81499	-0.69;-1.5;-1.5;-1.5;-1.5;-1.5;-0.69	5.95	5.95	0.96441	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.93429	0.7904	H	0.95645	3.7	0.80722	D	1	D;D;D	0.89917	1.0;0.996;0.999	D;D;D	0.87578	0.998;0.959;0.994	D	0.94427	0.7646	10	0.87932	D	0	.	20.3789	0.98926	0.0:1.0:0.0:0.0	.	116;115;94	B4E040;Q6ZS74;P11234	.;.;RALB_HUMAN	L	116;116;94;94;115;94;94	ENSP00000402866:S116L;ENSP00000438764:S116L;ENSP00000272519:S94L;ENSP00000414224:S94L;ENSP00000384328:S115L;ENSP00000398162:S94L;ENSP00000407062:S94L	ENSP00000272519:S94L	S	+	2	0	RALB	120760086	1.000000	0.71417	0.992000	0.48379	0.866000	0.49608	7.708000	0.84633	2.826000	0.97356	0.563000	0.77884	TCA	RALB	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_SRP_receptor_beta_su,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000144118		0.448	RALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RALB	HGNC	protein_coding	OTTHUMT00000254232.3	57	0.00	0	C	NM_002881		121043616	121043616	+1	no_errors	ENST00000474855	ensembl	human	known	69_37n	missense	62	17.11	13	SNP	1.000	T
RELN	5649	genome.wustl.edu	37	7	103206817	103206817	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr7:103206817C>T	ENST00000428762.1	-	33	4949	c.4790G>A	c.(4789-4791)gGa>gAa	p.G1597E	RELN_ENST00000424685.2_Missense_Mutation_p.G1597E|RELN_ENST00000343529.5_Missense_Mutation_p.G1597E	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1597					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GTCATTCATTCCTATAAGAAC	0.383																																					NSCLC(146;835 1944 15585 22231 52158)	dbGAP											0													91.0	89.0	90.0					7																	103206817		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4790G>A	7.37:g.103206817C>T	ENSP00000392423:p.Gly1597Glu		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom,pfscan_Reeler_dom	p.G1597E	ENST00000428762.1	37	c.4790	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	26.5	4.745560	0.89663	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.42513	0.97;1.67;0.97	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.69682	0.3138	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.70260	-0.4921	10	0.66056	D	0.02	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	1597;1597	P78509-2;P78509	.;RELN_HUMAN	E	1597	ENSP00000392423:G1597E;ENSP00000345694:G1597E;ENSP00000388446:G1597E	ENSP00000345694:G1597E	G	-	2	0	RELN	102994053	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.280000	0.78610	2.894000	0.99253	0.655000	0.94253	GGA	RELN	-	NULL	ENSG00000189056		0.383	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	58	0.00	0	C	NM_005045		103206817	103206817	-1	no_errors	ENST00000424685	ensembl	human	known	69_37n	missense	54	16.92	11	SNP	1.000	T
RHBDL3	162494	genome.wustl.edu	37	17	30648095	30648095	+	Silent	SNP	C	C	T			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr17:30648095C>T	ENST00000269051.4	+	9	1076	c.1062C>T	c.(1060-1062)ggC>ggT	p.G354G	RHBDL3_ENST00000536287.1_Silent_p.G256G|RHBDL3_ENST00000538145.1_Silent_p.G346G	NM_138328.2	NP_612201.1	P58872	RHBL3_HUMAN	rhomboid, veinlet-like 3 (Drosophila)	354						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(1)	16		Breast(31;0.116)|Ovarian(249;0.182)				TCACCCTGGGCGTGGTGGTCC	0.632																																						dbGAP											0													199.0	163.0	175.0					17																	30648095		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ313480	CCDS32613.1	17q11.2	2013-01-10				ENSG00000141314		"""EF-hand domain containing"""	16502	protein-coding gene	gene with protein product			"""rhomboid, veinlet-like 4 (Drosophila)"""	RHBDL4		11900977	Standard	XM_006721733		Approved	VRHO	uc002hhe.1	P58872		ENST00000269051.4:c.1062C>T	17.37:g.30648095C>T			A6NMH1|Q495Y4|Q495Y5|Q495Y6	Missense_Mutation	SNP	pfam_Peptidase_S54_rhomboid_dom,pfscan_EF_HAND_2	p.R321C	ENST00000269051.4	37	c.961	CCDS32613.1	17	.	.	.	.	.	.	.	.	.	.	c	13.56	2.273562	0.40194	.	.	ENSG00000141314	ENST00000431505	T	0.71222	-0.55	5.81	-5.08	0.02929	.	.	.	.	.	T	0.50939	0.1645	.	.	.	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.40403	-0.9565	8	0.72032	D	0.01	.	3.1592	0.06515	0.1131:0.1367:0.2243:0.5259	.	321	E9PD28	.	C	321	ENSP00000394849:R321C	ENSP00000394849:R321C	R	+	1	0	RHBDL3	27672208	0.013000	0.17824	0.994000	0.49952	0.995000	0.86356	-1.127000	0.03251	-0.177000	0.10690	-0.229000	0.12294	CGT	RHBDL3	-	NULL	ENSG00000141314		0.632	RHBDL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RHBDL3	HGNC	protein_coding	OTTHUMT00000447120.1	83	0.00	0	C	NM_138328		30648095	30648095	+1	no_stop_codon	ENST00000431505	ensembl	human	putative	69_37n	missense	63	16.00	12	SNP	0.932	T
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037896	10037896	+	RNA	SNP	C	C	T			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chrY:10037896C>T	ENST00000515896.1	+	0	133									RNA, 5.8S ribosomal pseudogene 6																		CCTCCCAGGGCTATGCCTGTC	0.577																																						dbGAP											0																																										-	-	-			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037896C>T				RNA	SNP	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.577	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA		10	0.00	0	C			10037896	10037896	+1	no_errors	ENST00000515896	ensembl	human	known	69_37n	rna	9	40.00	6	SNP	1.000	T
TMEM241	85019	genome.wustl.edu	37	18	20936610	20936610	+	Silent	SNP	G	G	A			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr18:20936610G>A	ENST00000383233.3	-	12	671	c.619C>T	c.(619-621)Ctg>Ttg	p.L207L	TMEM241_ENST00000450466.2_Silent_p.L86L|TMEM241_ENST00000542162.1_3'UTR	NM_032933.4	NP_116322.3	Q24JQ0	TM241_HUMAN	transmembrane protein 241	207						integral component of membrane (GO:0016021)											GGGAAGTCCAGGACGCTGAAG	0.517																																						dbGAP											0													87.0	91.0	90.0					18																	20936610		2064	4206	6270	-	-	-	SO:0001819	synonymous_variant	0			BC082984	CCDS11876.2	18q11.2	2011-11-25	2011-11-25	2011-11-25	ENSG00000134490	ENSG00000134490			31723	protein-coding gene	gene with protein product		615430	"""chromosome 18 open reading frame 45"""	C18orf45		12477932	Standard	NM_032933		Approved	MGC11386, FLJ44259	uc002kuf.3	Q24JQ0	OTTHUMG00000131771	ENST00000383233.3:c.619C>T	18.37:g.20936610G>A			I0J130|Q6ZTS7|Q6ZW41	Silent	SNP	NULL	p.L207	ENST00000383233.3	37	c.619	CCDS11876.2	18	.	.	.	.	.	.	.	.	.	.	G	8.409	0.843642	0.16963	.	.	ENSG00000134490	ENST00000497608	.	.	.	5.35	3.56	0.40772	.	.	.	.	.	T	0.55577	0.1929	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50110	-0.8866	4	.	.	.	-6.6028	6.8484	0.24000	0.0879:0.0:0.7398:0.1723	.	.	.	.	L	206	.	.	P	-	2	0	C18orf45	19190608	1.000000	0.71417	0.965000	0.40720	0.961000	0.63080	1.408000	0.34668	0.819000	0.34492	0.655000	0.94253	CCT	TMEM241	-	NULL	ENSG00000134490		0.517	TMEM241-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM241	HGNC	protein_coding	OTTHUMT00000254702.3	44	0.00	0	G	NM_032933		20936610	20936610	-1	no_errors	ENST00000383233	ensembl	human	known	69_37n	silent	14	54.84	17	SNP	0.988	A
TP53	7157	genome.wustl.edu	37	17	7577096	7577096	+	Missense_Mutation	SNP	T	T	A	rs587781525		TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr17:7577096T>A	ENST00000269305.4	-	8	1031	c.842A>T	c.(841-843)gAc>gTc	p.D281V	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.D281V|TP53_ENST00000359597.4_Missense_Mutation_p.D281V|TP53_ENST00000445888.2_Missense_Mutation_p.D281V|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.D281V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	281	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		D -> A (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|D -> G (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|D -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> Y (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.D281G(10)|p.0?(8)|p.D281V(5)|p.?(2)|p.D281fs*63(2)|p.R280_D281delRD(2)|p.D281A(2)|p.D281>AGPY(2)|p.A276_R283delACPGRDRR(1)|p.D281R(1)|p.C275fs*20(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGTGCGCCGGTCTCTCCCAGG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	44	Substitution - Missense(18)|Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(4)|Unknown(2)|Complex - frameshift(2)|Complex - insertion inframe(2)	haematopoietic_and_lymphoid_tissue(8)|upper_aerodigestive_tract(7)|breast(5)|lung(5)|ovary(4)|bone(4)|large_intestine(3)|central_nervous_system(3)|stomach(2)|urinary_tract(2)|oesophagus(1)	GRCh37	CM004343|CM056068	TP53	M							82.0	70.0	74.0					17																	7577096		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.842A>T	17.37:g.7577096T>A	ENSP00000269305:p.Asp281Val		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.D281V	ENST00000269305.4	37	c.842	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	27.0	4.794528	0.90453	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99872	-7.37;-7.37;-7.37;-7.37;-7.37;-7.37	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99876	0.9941	M	0.92649	3.33	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.998;0.991	D;D;D;D	0.97110	0.99;1.0;0.99;0.99	D	0.96385	0.9284	10	0.87932	D	0	-25.6697	12.9367	0.58319	0.0:0.0:0.0:1.0	.	281;281;281;281	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	V	281;281;281;281;281;270;149	ENSP00000352610:D281V;ENSP00000269305:D281V;ENSP00000398846:D281V;ENSP00000391127:D281V;ENSP00000391478:D281V;ENSP00000425104:D149V	ENSP00000269305:D281V	D	-	2	0	TP53	7517821	1.000000	0.71417	0.993000	0.49108	0.970000	0.65996	7.802000	0.85969	2.154000	0.67381	0.379000	0.24179	GAC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	63	0.00	0	T	NM_000546		7577096	7577096	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	13	53.57	15	SNP	1.000	A
TYR	7299	genome.wustl.edu	37	11	88911832	88911832	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr11:88911832C>A	ENST00000263321.5	+	1	1213	c.711C>A	c.(709-711)gaC>gaA	p.D237E	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	237					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	CATATTGGGACTGGCGGGATG	0.473																																						dbGAP											0													104.0	96.0	98.0					11																	88911832		2201	4299	6500	-	-	-	SO:0001583	missense	0			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.711C>A	11.37:g.88911832C>A	ENSP00000263321:p.Asp237Glu		Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.D237E	ENST00000263321.5	37	c.711	CCDS8284.1	11	.	.	.	.	.	.	.	.	.	.	C	19.92	3.915737	0.73098	.	.	ENSG00000077498	ENST00000263321	D	0.99507	-6.04	6.07	-2.68	0.06041	Tyrosinase (2);Uncharacterised domain, di-copper centre (2);	0.000000	0.85682	D	0.000000	D	0.99450	0.9805	M	0.91090	3.175	0.51233	D	0.999919	D	0.89917	1.0	D	0.91635	0.999	D	0.99845	1.1065	9	.	.	.	.	12.5188	0.56048	0.0:0.517:0.0:0.483	.	237	P14679	TYRO_HUMAN	E	237	ENSP00000263321:D237E	.	D	+	3	2	TYR	88551480	0.752000	0.28338	0.983000	0.44433	0.991000	0.79684	-0.056000	0.11787	-0.452000	0.07087	-0.150000	0.13652	GAC	TYR	-	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	ENSG00000077498		0.473	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYR	HGNC	protein_coding	OTTHUMT00000394045.2	50	0.00	0	C	NM_000372		88911832	88911832	+1	no_errors	ENST00000263321	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	0.999	A
UBA1	7317	genome.wustl.edu	37	X	47061807	47061807	+	Silent	SNP	C	C	T			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chrX:47061807C>T	ENST00000335972.6	+	10	1143	c.960C>T	c.(958-960)ttC>ttT	p.F320F	INE1_ENST00000456273.1_RNA|UBA1_ENST00000377351.4_Silent_p.F320F	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	320	2 approximate repeats.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TGACGGACTTCGCCAAGTTTT	0.597																																						dbGAP											0													79.0	61.0	67.0					X																	47061807		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.960C>T	X.37:g.47061807C>T			Q5JRR8|Q96E13	Silent	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.F320	ENST00000335972.6	37	c.960	CCDS14275.1	X																																																																																			UBA1	-	superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1	ENSG00000130985		0.597	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA1	HGNC	protein_coding	OTTHUMT00000056389.1	69	0.00	0	C	NM_003334		47061807	47061807	+1	no_errors	ENST00000335972	ensembl	human	known	69_37n	silent	40	14.89	7	SNP	0.938	T
UPRT	139596	genome.wustl.edu	37	X	74519659	74519659	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chrX:74519659G>A	ENST00000373383.4	+	5	819	c.652G>A	c.(652-654)Gcc>Acc	p.A218T	UPRT_ENST00000373379.1_Missense_Mutation_p.A218T|UPRT_ENST00000530743.1_Missense_Mutation_p.A82T	NM_145052.3	NP_659489.1	Q96BW1	UPP_HUMAN	uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)	218					female pregnancy (GO:0007565)|lactation (GO:0007595)|response to insulin (GO:0032868)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(4)|lung(4)	18						GACACAAAGAGCCAAAGTATA	0.428																																						dbGAP											0													136.0	122.0	126.0					X																	74519659		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015116	CCDS14429.1	Xq13.3	2009-01-14			ENSG00000094841	ENSG00000094841			28334	protein-coding gene	gene with protein product		300656				12477932	Standard	NM_145052		Approved	DKFZp781E1243, MGC23937, FUR1, RP11-311P8.3	uc004ecb.2	Q96BW1	OTTHUMG00000021864	ENST00000373383.4:c.652G>A	X.37:g.74519659G>A	ENSP00000362481:p.Ala218Thr		Q5JRL1|Q5JRL3|Q68DN0|Q96MW2	Missense_Mutation	SNP	pfam_PRibTrfase	p.A218T	ENST00000373383.4	37	c.652	CCDS14429.1	X	.	.	.	.	.	.	.	.	.	.	G	34	5.388395	0.95988	.	.	ENSG00000094841	ENST00000373383;ENST00000373379;ENST00000530743	D;D;D	0.91740	-2.9;-2.9;-2.9	5.69	5.69	0.88448	Phosphoribosyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.94785	0.8316	M	0.81942	2.565	0.80722	D	1	P;P	0.41546	0.754;0.754	P;P	0.49829	0.623;0.623	D	0.95254	0.8362	10	0.87932	D	0	-3.8416	17.6126	0.88058	0.0:0.0:1.0:0.0	.	218;218	A8KAF9;Q96BW1	.;UPP_HUMAN	T	218;218;82	ENSP00000362481:A218T;ENSP00000362477:A218T;ENSP00000434037:A82T	ENSP00000362477:A218T	A	+	1	0	UPRT	74436384	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.460000	0.97641	2.376000	0.81061	0.544000	0.68410	GCC	UPRT	-	pfam_PRibTrfase	ENSG00000094841		0.428	UPRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPRT	HGNC	protein_coding	OTTHUMT00000057278.1	55	0.00	0	G	NM_145052		74519659	74519659	+1	no_errors	ENST00000373383	ensembl	human	known	69_37n	missense	39	29.09	16	SNP	1.000	A
WDR46	9277	genome.wustl.edu	37	6	33255278	33255278	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr6:33255278G>C	ENST00000374617.4	-	8	1089	c.733C>G	c.(733-735)Ctc>Gtc	p.L245V	PFDN6_ENST00000374610.2_5'Flank|PFDN6_ENST00000374606.5_5'Flank|PFDN6_ENST00000395131.1_5'Flank|PFDN6_ENST00000463584.1_5'Flank|WDR46_ENST00000477718.1_5'UTR|PFDN6_ENST00000374607.1_5'Flank	NM_001164267.1|NM_005452.5	NP_001157739.1|NP_005443.3	O15213	WDR46_HUMAN	WD repeat domain 46	245							poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	20						TCAGAATGGAGAAACCTGGGG	0.522																																						dbGAP											0													61.0	65.0	64.0					6																	33255278		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z97184	CCDS4772.1	6p21.3	2013-01-09	2005-05-31	2005-05-31	ENSG00000227057	ENSG00000227057		"""WD repeat domain containing"""	13923	protein-coding gene	gene with protein product		611440	"""chromosome 6 open reading frame 11"""	C6orf11		9545376, 9521053	Standard	NM_005452		Approved	BING4, UTP7	uc003ods.3	O15213	OTTHUMG00000031192	ENST00000374617.4:c.733C>G	6.37:g.33255278G>C	ENSP00000363746:p.Leu245Val		A6NDP5|Q5HYZ0|Q5STK5|Q5STR3	Missense_Mutation	SNP	pfam_BING4_C_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L245V	ENST00000374617.4	37	c.733	CCDS4772.1	6	.	.	.	.	.	.	.	.	.	.	G	14.07	2.425224	0.43020	.	.	ENSG00000227057	ENST00000374617;ENST00000444176	T;T	0.18174	4.97;2.23	4.42	1.61	0.23674	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.64402	D	0.000001	T	0.34687	0.0906	M	0.93375	3.41	0.54753	D	0.999982	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.24693	-1.0153	10	0.66056	D	0.02	-16.7377	6.7322	0.23388	0.3937:0.0:0.6063:0.0	.	191;245	B4DP15;O15213	.;WDR46_HUMAN	V	245;172	ENSP00000363746:L245V;ENSP00000405568:L172V	ENSP00000363746:L245V	L	-	1	0	WDR46	33363256	1.000000	0.71417	0.987000	0.45799	0.520000	0.34377	2.938000	0.48987	0.496000	0.27904	0.549000	0.68633	CTC	WDR46	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000227057		0.522	WDR46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR46	HGNC	protein_coding	OTTHUMT00000076382.2	34	0.00	0	G	NM_005452		33255278	33255278	-1	no_errors	ENST00000374617	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	C
ZNF578	147660	genome.wustl.edu	37	19	53005128	53005128	+	Silent	SNP	G	G	A			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr19:53005128G>A	ENST00000421239.2	+	4	274	c.30G>A	c.(28-30)agG>agA	p.R10R		NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	10					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		CTCAGAAGAGGAAAGGAAAGG	0.403																																						dbGAP											0													131.0	132.0	132.0					19																	53005128		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.30G>A	19.37:g.53005128G>A			B4DR51|I3L1Y6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R10	ENST00000421239.2	37	c.30	CCDS54310.1	19																																																																																			ZNF578	-	NULL	ENSG00000258405		0.403	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF578	HGNC	protein_coding	OTTHUMT00000344298.3	138	0.00	0	G	NM_152472		53005128	53005128	+1	no_errors	ENST00000421239	ensembl	human	known	69_37n	silent	65	18.75	15	SNP	0.105	A
ZNF648	127665	genome.wustl.edu	37	1	182025773	182025773	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr1:182025773G>A	ENST00000339948.3	-	2	1580	c.1373C>T	c.(1372-1374)gCg>gTg	p.A458V		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	458					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						CGAGGGCTGCGCGAAGGCCAC	0.662																																					NSCLC(71;908 1374 5429 20458 35642)	dbGAP											0													35.0	33.0	33.0					1																	182025773		2199	4300	6499	-	-	-	SO:0001583	missense	0			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.1373C>T	1.37:g.182025773G>A	ENSP00000344129:p.Ala458Val		B2RP16	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A458V	ENST00000339948.3	37	c.1373	CCDS30952.1	1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.303590	0.40795	.	.	ENSG00000179930	ENST00000339948	T	0.17854	2.25	2.77	1.79	0.24919	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12689	0.0308	L	0.39326	1.205	0.32881	D	0.510567	B	0.28055	0.199	B	0.23150	0.044	T	0.11891	-1.0569	9	0.49607	T	0.09	.	7.1829	0.25782	0.0:0.0:0.5171:0.4829	.	458	Q5T619	ZN648_HUMAN	V	458	ENSP00000344129:A458V	ENSP00000344129:A458V	A	-	2	0	ZNF648	180292396	0.000000	0.05858	0.999000	0.59377	0.984000	0.73092	-0.168000	0.09925	0.661000	0.30985	0.655000	0.94253	GCG	ZNF648	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000179930		0.662	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF648	HGNC	protein_coding	OTTHUMT00000090794.1	31	0.00	0	G	XM_060597		182025773	182025773	-1	no_errors	ENST00000339948	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	0.985	A
ZNF699	374879	genome.wustl.edu	37	19	9408556	9408556	+	Splice_Site	SNP	C	C	A			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr19:9408556C>A	ENST00000591998.1	-	4	514	c.286G>T	c.(286-288)Ggt>Tgt	p.G96C	ZNF699_ENST00000308650.3_Splice_Site_p.G96C			Q32M78	ZN699_HUMAN	zinc finger protein 699	96					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GGGTTCTTGCCTTCCCGGTGC	0.438																																						dbGAP											0													101.0	98.0	99.0					19																	9408556		1850	4088	5938	-	-	-	SO:0001630	splice_region_variant	0			BC109268	CCDS42495.1	19p13.2	2013-01-08				ENSG00000196110		"""Zinc fingers, C2H2-type"", ""-"""	24750	protein-coding gene	gene with protein product	hangover homolog (Drosophila)	609571				16940975	Standard	NM_198535		Approved	FLJ38144, hang	uc002mlc.1	Q32M78		ENST00000591998.1:c.286+1G>T	19.37:g.9408556C>A			Q8N9A1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G96C	ENST00000591998.1	37	c.286	CCDS42495.1	19	.	.	.	.	.	.	.	.	.	.	C	13.96	2.391630	0.42410	.	.	ENSG00000196110	ENST00000308650	T	0.08008	3.14	3.47	2.44	0.29823	.	.	.	.	.	T	0.08626	0.0214	L	0.34521	1.04	0.26886	N	0.967423	D	0.54047	0.964	P	0.47626	0.552	T	0.23762	-1.0179	8	.	.	.	.	6.588	0.22632	0.0:0.8703:0.0:0.1297	.	96	Q32M78	ZN699_HUMAN	C	96	ENSP00000311596:G96C	.	G	-	1	0	ZNF699	9269556	0.122000	0.22280	0.960000	0.40013	0.418000	0.31294	0.658000	0.24979	1.031000	0.39867	0.650000	0.86243	GGT	ZNF699	-	NULL	ENSG00000196110		0.438	ZNF699-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF699	HGNC	protein_coding	OTTHUMT00000449010.1	56	0.00	0	C	NM_198535	Missense_Mutation	9408556	9408556	-1	no_errors	ENST00000308650	ensembl	human	known	69_37n	missense	70	11.39	9	SNP	0.991	A
ZNF880	400713	genome.wustl.edu	37	19	52888293	52888293	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr19:52888293C>G	ENST00000422689.2	+	4	1475	c.1460C>G	c.(1459-1461)aCt>aGt	p.T487S		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	487					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						AGAATCCATACTGGAGAGAAA	0.398																																						dbGAP											0													72.0	64.0	66.0					19																	52888293		692	1591	2283	-	-	-	SO:0001583	missense	0			BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1460C>G	19.37:g.52888293C>G	ENSP00000406318:p.Thr487Ser		B4DNA6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T487S	ENST00000422689.2	37	c.1460	CCDS46164.1	19	.	.	.	.	.	.	.	.	.	.	C	3.614	-0.078938	0.07141	.	.	ENSG00000221923	ENST00000422689	T	0.24151	1.87	1.93	0.832	0.18867	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17152	0.0412	N	0.20483	0.58	0.20563	N	0.999886	B	0.33266	0.404	B	0.39617	0.305	T	0.33777	-0.9855	8	.	.	.	.	7.2124	0.25941	0.0:0.8461:0.0:0.1539	.	487	Q6PDB4	ZN880_HUMAN	S	487	ENSP00000406318:T487S	.	T	+	2	0	ZNF880	57580105	0.028000	0.19301	0.585000	0.28666	0.026000	0.11368	1.499000	0.35671	0.133000	0.18654	0.551000	0.68910	ACT	ZNF880	-	pfscan_Znf_C2H2	ENSG00000221923		0.398	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF880	HGNC	protein_coding	OTTHUMT00000397374.1	67	0.00	0	C	NM_001145434		52888293	52888293	+1	no_errors	ENST00000422689	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	1.000	G
ZNF814	730051	genome.wustl.edu	37	19	58385256	58385256	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A24S-01A-11D-A167-09	TCGA-AR-A24S-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	aad32a56-5b98-433e-bb6e-48e09a027db6	1385c890-fc86-404f-96f9-90d1bd595b10	g.chr19:58385256A>G	ENST00000435989.2	-	3	1736	c.1502T>C	c.(1501-1503)tTc>tCc	p.F501S	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	501					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						CTTTTGACTGAAAGATTTCCC	0.443																																						dbGAP											0													114.0	89.0	96.0					19																	58385256		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.1502T>C	19.37:g.58385256A>G	ENSP00000410545:p.Phe501Ser		A6NF35	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F501S	ENST00000435989.2	37	c.1502	CCDS46212.1	19	.	.	.	.	.	.	.	.	.	.	.	16.36	3.101895	0.56183	.	.	ENSG00000204514	ENST00000435989;ENST00000376205	T	0.44482	0.92	2.61	2.61	0.31194	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.66117	0.2757	M	0.87827	2.91	0.21782	N	0.999546	D	0.89917	1.0	D	0.87578	0.998	T	0.54132	-0.8339	9	0.87932	D	0	.	9.8493	0.41046	1.0:0.0:0.0:0.0	.	501	B7Z6K7	ZN814_HUMAN	S	501;335	ENSP00000410545:F501S	ENSP00000365378:F335S	F	-	2	0	ZNF814	63077068	0.989000	0.36119	0.004000	0.12327	0.111000	0.19643	3.450000	0.52957	1.220000	0.43490	0.254000	0.18369	TTC	ZNF814	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204514		0.443	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF814	HGNC	protein_coding	OTTHUMT00000466976.1	89	0.00	0	A	XM_001725708		58385256	58385256	-1	no_errors	ENST00000435989	ensembl	human	known	69_37n	missense	52	20.00	13	SNP	0.482	G
