#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA6	23460	genome.wustl.edu	37	17	67080498	67080498	+	Splice_Site	SNP	T	T	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr17:67080498T>C	ENST00000284425.2	-	34	4435		c.e34-2		ABCA6_ENST00000446604.2_Splice_Site	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6						transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					AAAACACAACTGCAATGTAGA	0.507																																						dbGAP											0													211.0	189.0	197.0					17																	67080498		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.4261-2A>G	17.37:g.67080498T>C			Q6NSH9|Q8N856|Q8WWZ6	Splice_Site	SNP	-	e33-2	ENST00000284425.2	37	c.4261-2	CCDS11683.1	17	.	.	.	.	.	.	.	.	.	.	T	12.41	1.930242	0.34096	.	.	ENSG00000154262	ENST00000284425;ENST00000446604	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3635	0.66789	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ABCA6	64592093	1.000000	0.71417	0.320000	0.25306	0.138000	0.21146	7.229000	0.78088	2.171000	0.68590	0.533000	0.62120	.	ABCA6	-	-	ENSG00000154262		0.507	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	HGNC	protein_coding	OTTHUMT00000450463.1	77	0.00	0	T	NM_080284	Intron	67080498	67080498	-1	no_errors	ENST00000284425	ensembl	human	known	69_37n	splice_site	70	26.32	25	SNP	1.000	C
ABCA7	10347	genome.wustl.edu	37	19	1061826	1061827	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr19:1061826_1061827delTT	ENST00000263094.6	+	41	5740_5741	c.5509_5510delTT	c.(5509-5511)tttfs	p.F1837fs	ABCA7_ENST00000435683.2_Frame_Shift_Del_p.F1699fs|ABCA7_ENST00000433129.1_Frame_Shift_Del_p.F1837fs	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1837	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACGTCCACGTTTCGCATGGTG	0.649																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.5509_5510delTT	19.37:g.1061826_1061827delTT	ENSP00000263094:p.Phe1837fs		Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Frame_Shift_Del	DEL	pfam_ABC_transporter-like,superfamily_GroES-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.F1837fs	ENST00000263094.6	37	c.5509_5510	CCDS12055.1	19																																																																																			ABCA7	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000064687		0.649	ABCA7-001	KNOWN	basic|CCDS	protein_coding	ABCA7	HGNC	protein_coding	OTTHUMT00000394993.1	46	0.00	0	TT	NM_019112		1061826	1061827	+1	no_errors	ENST00000263094	ensembl	human	known	69_37n	frame_shift_del	43	12.00	6	DEL	0.995:1.000	-
ABCC11	85320	genome.wustl.edu	37	16	48245083	48245083	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr16:48245083A>T	ENST00000394747.1	-	10	1733	c.1384T>A	c.(1384-1386)Ttc>Atc	p.F462I	ABCC11_ENST00000537808.1_Missense_Mutation_p.F462I|ABCC11_ENST00000356608.2_Missense_Mutation_p.F462I|ABCC11_ENST00000353782.5_Missense_Mutation_p.F462I|ABCC11_ENST00000394748.1_Missense_Mutation_p.F462I	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	462					organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	TGGACATAGAAAACAGGGCTC	0.473																																						dbGAP											0													91.0	97.0	95.0					16																	48245083		2201	4300	6501	-	-	-	SO:0001583	missense	0			AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.1384T>A	16.37:g.48245083A>T	ENSP00000378230:p.Phe462Ile		Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.F462I	ENST00000394747.1	37	c.1384	CCDS10732.1	16	.	.	.	.	.	.	.	.	.	.	A	10.09	1.256267	0.22965	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747;ENST00000537808	D;D;D;D;D	0.92495	-2.85;-2.75;-2.75;-2.75;-3.05	4.65	-3.84	0.04256	ABC transporter, transmembrane domain, type 1 (1);	2.370100	0.01687	N	0.026447	T	0.76709	0.4025	N	0.02539	-0.55	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.10450	0.005;0.0	T	0.67043	-0.5770	10	0.37606	T	0.19	2.0435	0.4065	0.00434	0.2533:0.1604:0.2876:0.2987	.	462;462	Q96J66-2;Q96J66	.;ABCCB_HUMAN	I	462	ENSP00000311326:F462I;ENSP00000349017:F462I;ENSP00000378231:F462I;ENSP00000378230:F462I;ENSP00000438530:F462I	ENSP00000311326:F462I	F	-	1	0	ABCC11	46802584	0.000000	0.05858	0.000000	0.03702	0.972000	0.66771	-0.300000	0.08243	-0.911000	0.03843	0.533000	0.62120	TTC	ABCC11	-	superfamily_ABC_transptrTM_dom_typ1	ENSG00000121270		0.473	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABCC11	HGNC	protein_coding	OTTHUMT00000429984.1	40	0.00	0	A	NM_032583		48245083	48245083	-1	no_errors	ENST00000356608	ensembl	human	known	69_37n	missense	16	50.00	16	SNP	0.000	T
ACAT1	38	genome.wustl.edu	37	11	108017053	108017053	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr11:108017053A>C	ENST00000265838.4	+	11	1221	c.1130A>C	c.(1129-1131)aAt>aCt	p.N377T		NM_000019.3	NP_000010.1	P24752	THIL_HUMAN	acetyl-CoA acetyltransferase 1	377					adipose tissue development (GO:0060612)|brain development (GO:0007420)|branched-chain amino acid catabolic process (GO:0009083)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular nitrogen compound metabolic process (GO:0034641)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|metanephric proximal convoluted tubule development (GO:0072229)|protein homooligomerization (GO:0051260)|response to hormone (GO:0009725)|response to organic cyclic compound (GO:0014070)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acetyl-CoA C-acetyltransferase activity (GO:0003985)|coenzyme binding (GO:0050662)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|prostate(2)	10		all_cancers(61;6.41e-10)|all_epithelial(67;2.83e-06)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;2.96e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.00108)|OV - Ovarian serous cystadenocarcinoma(223;0.192)	Sulfasalazine(DB00795)	GTGAATATCAATGGAGGAGCT	0.353																																						dbGAP											0													95.0	106.0	102.0					11																	108017053		2201	4298	6499	-	-	-	SO:0001583	missense	0			D90228	CCDS8339.1	11q22.3	2010-04-30	2010-04-30		ENSG00000075239	ENSG00000075239	2.3.1.9		93	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	607809	"""acetyl-Coenzyme A acetyltransferase 1"""	ACAT		1979337	Standard	NM_000019		Approved	THIL	uc001pjy.3	P24752	OTTHUMG00000166381	ENST00000265838.4:c.1130A>C	11.37:g.108017053A>C	ENSP00000265838:p.Asn377Thr		B2R6H1|G3XAB4|Q96FG8	Missense_Mutation	SNP	pfam_Thiolase_N,pfam_Thiolase_C,pfam_Ketoacyl_synth_N,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	p.N377T	ENST00000265838.4	37	c.1130	CCDS8339.1	11	.	.	.	.	.	.	.	.	.	.	A	18.52	3.641083	0.67244	.	.	ENSG00000075239	ENST00000265838	D	0.95137	-3.62	5.86	5.86	0.93980	Thiolase-like, subgroup (1);Thiolase-like (1);Thiolase, conserved site (1);Thiolase, C-terminal (1);	0.142335	0.64402	D	0.000008	D	0.97424	0.9157	M	0.90922	3.16	0.80722	D	1	P	0.41569	0.755	P	0.55615	0.78	D	0.97771	1.0226	10	0.56958	D	0.05	-17.2506	16.2644	0.82568	1.0:0.0:0.0:0.0	.	377	P24752	THIL_HUMAN	T	377	ENSP00000265838:N377T	ENSP00000265838:N377T	N	+	2	0	ACAT1	107522263	0.985000	0.35326	0.133000	0.22050	0.992000	0.81027	9.056000	0.93881	2.244000	0.73946	0.528000	0.53228	AAT	ACAT1	-	pfam_Thiolase_C,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	ENSG00000075239		0.353	ACAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAT1	HGNC	protein_coding	OTTHUMT00000389474.1	87	0.00	0	A	NM_000019		108017053	108017053	+1	no_errors	ENST00000265838	ensembl	human	known	69_37n	missense	28	28.21	11	SNP	0.998	C
ACSM4	341392	genome.wustl.edu	37	12	7473395	7473395	+	Silent	SNP	T	T	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr12:7473395T>G	ENST00000399422.4	+	6	1044	c.996T>G	c.(994-996)ctT>ctG	p.L332L		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	332					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						AAAAAGACCTTAAGAGGTACT	0.463																																						dbGAP											0													93.0	84.0	87.0					12																	7473395		1902	4113	6015	-	-	-	SO:0001819	synonymous_variant	0				CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.996T>G	12.37:g.7473395T>G			A8MTI6	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.L332	ENST00000399422.4	37	c.996	CCDS44825.1	12																																																																																			ACSM4	-	pfam_AMP-dep_Synth/Lig	ENSG00000215009		0.463	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ACSM4	HGNC	protein_coding	OTTHUMT00000337866.2	44	0.00	0	T	NM_001080454		7473395	7473395	+1	no_errors	ENST00000399422	ensembl	human	novel	69_37n	silent	14	82.50	66	SNP	0.983	G
ACTN2	88	genome.wustl.edu	37	1	236918429	236918429	+	Silent	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:236918429G>T	ENST00000366578.4	+	17	2251	c.2085G>T	c.(2083-2085)ctG>ctT	p.L695L	ACTN2_ENST00000546208.1_Silent_p.L189L|ACTN2_ENST00000542672.1_Silent_p.L695L	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	695					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TCGACAAGCTGGAGGGAGACC	0.532																																						dbGAP											0													201.0	193.0	196.0					1																	236918429		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.2085G>T	1.37:g.236918429G>T			B1ANE4|B2RCS5|Q86TF4|Q86TI8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,pfscan_CH-domain,pfscan_EF_HAND_2	p.L695	ENST00000366578.4	37	c.2085	CCDS1613.1	1																																																																																			ACTN2	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000077522		0.532	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACTN2	HGNC	protein_coding	OTTHUMT00000096628.1	20	0.00	0	G	NM_001103		236918429	236918429	+1	no_errors	ENST00000366578	ensembl	human	known	69_37n	silent	25	48.98	24	SNP	1.000	T
ADAM33	80332	genome.wustl.edu	37	20	3655440	3655440	+	Silent	SNP	G	G	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr20:3655440G>C	ENST00000356518.2	-	5	631	c.390C>G	c.(388-390)ctC>ctG	p.L130L	ADAM33_ENST00000350009.2_Silent_p.L130L|ADAM33_ENST00000466620.1_5'Flank|ADAM33_ENST00000379861.4_Silent_p.L130L	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	130					proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						AGCAGGTGCAGAGGACTACCC	0.632																																						dbGAP											0													43.0	46.0	45.0					20																	3655440		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.390C>G	20.37:g.3655440G>C			A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Silent	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.L130	ENST00000356518.2	37	c.390	CCDS13058.1	20																																																																																			ADAM33	-	pfam_Peptidase_M12B_N	ENSG00000149451		0.632	ADAM33-001	KNOWN	basic|CCDS	protein_coding	ADAM33	HGNC	protein_coding	OTTHUMT00000077763.2	31	0.00	0	G	NM_025220		3655440	3655440	-1	no_errors	ENST00000356518	ensembl	human	known	69_37n	silent	58	14.71	10	SNP	1.000	C
ADAMTSL3	57188	genome.wustl.edu	37	15	84568455	84568455	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr15:84568455G>C	ENST00000286744.5	+	15	1896	c.1672G>C	c.(1672-1674)Gag>Cag	p.E558Q	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.E558Q	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	558						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			AGAACTAGAAGAGACCAGAAT	0.363																																						dbGAP											0													141.0	113.0	122.0					15																	84568455		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.1672G>C	15.37:g.84568455G>C	ENSP00000286744:p.Glu558Gln		A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like,prints_Peptidase_M12B_ADAM-TS	p.E558Q	ENST00000286744.5	37	c.1672	CCDS10326.1	15	.	.	.	.	.	.	.	.	.	.	G	16.87	3.243172	0.58995	.	.	ENSG00000156218	ENST00000286744	T	0.65364	-0.15	5.25	3.29	0.37713	.	0.060673	0.64402	D	0.000006	T	0.68229	0.2978	L	0.32530	0.975	0.48452	D	0.99965	P;B	0.45594	0.862;0.314	P;B	0.61874	0.895;0.209	T	0.69053	-0.5247	10	0.59425	D	0.04	.	14.4816	0.67587	0.0:0.2804:0.7196:0.0	.	558;558	P82987-2;P82987	.;ATL3_HUMAN	Q	558	ENSP00000286744:E558Q	ENSP00000286744:E558Q	E	+	1	0	ADAMTSL3	82359459	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.571000	0.90752	0.541000	0.28827	0.637000	0.83480	GAG	ADAMTSL3	-	NULL	ENSG00000156218		0.363	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	HGNC	protein_coding	OTTHUMT00000304007.2	55	0.00	0	G	NM_207517		84568455	84568455	+1	no_errors	ENST00000286744	ensembl	human	known	69_37n	missense	12	74.47	35	SNP	1.000	C
ADCY2	108	genome.wustl.edu	37	5	7709446	7709446	+	Silent	SNP	A	A	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr5:7709446A>G	ENST00000338316.4	+	10	1613	c.1524A>G	c.(1522-1524)gcA>gcG	p.A508A	ADCY2_ENST00000537121.1_Silent_p.A328A|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	508					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						AGCCCTTTGCACACCTACATC	0.592																																						dbGAP											0													97.0	73.0	81.0					5																	7709446		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1524A>G	5.37:g.7709446A>G			B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.A508	ENST00000338316.4	37	c.1524	CCDS3872.2	5																																																																																			ADCY2	-	pfam_Adenylate_cyclase-like	ENSG00000078295		0.592	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	HGNC	protein_coding	OTTHUMT00000206930.2	36	0.00	0	A	NM_020546		7709446	7709446	+1	no_errors	ENST00000338316	ensembl	human	known	69_37n	silent	27	32.50	13	SNP	0.588	G
AHNAK2	113146	genome.wustl.edu	37	14	105412163	105412163	+	Missense_Mutation	SNP	C	C	G	rs201181175		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr14:105412163C>G	ENST00000333244.5	-	7	9744	c.9625G>C	c.(9625-9627)Gtg>Ctg	p.V3209L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3209						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGAGCTTCACGTCCACCTGG	0.607																																						dbGAP											0													108.0	70.0	83.0					14																	105412163		1920	3847	5767	-	-	-	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9625G>C	14.37:g.105412163C>G	ENSP00000353114:p.Val3209Leu		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.V3209L	ENST00000333244.5	37	c.9625	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	c	9.043	0.990179	0.18966	.	.	ENSG00000185567	ENST00000333244	T	0.01119	5.31	2.98	-2.26	0.06867	.	.	.	.	.	T	0.00906	0.0030	L	0.35723	1.085	0.09310	N	1	B	0.13594	0.008	B	0.12156	0.007	T	0.48875	-0.8996	9	0.22109	T	0.4	.	0.8864	0.01245	0.2903:0.3589:0.1435:0.2074	.	3209	Q8IVF2	AHNK2_HUMAN	L	3209	ENSP00000353114:V3209L	ENSP00000353114:V3209L	V	-	1	0	AHNAK2	104483208	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.193000	0.00564	-0.054000	0.13266	0.313000	0.20887	GTG	AHNAK2	-	NULL	ENSG00000185567		0.607	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	41	0.00	0	C	NM_138420		105412163	105412163	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	missense	4	42.86	3	SNP	0.000	G
ANK3	288	genome.wustl.edu	37	10	61831529	61831529	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr10:61831529G>C	ENST00000280772.2	-	37	9301	c.9110C>G	c.(9109-9111)cCt>cGt	p.P3037R	ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3037					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TTCCTCGAGAGGTGGGCATAA	0.428																																						dbGAP											0													81.0	90.0	87.0					10																	61831529		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.9110C>G	10.37:g.61831529G>C	ENSP00000280772:p.Pro3037Arg		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.P3037R	ENST00000280772.2	37	c.9110	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	G	13.69	2.311229	0.40895	.	.	ENSG00000151150	ENST00000280772	T	0.64260	-0.09	5.36	5.36	0.76844	.	0.379315	0.19217	N	0.119782	T	0.52549	0.1741	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45934	-0.9227	10	0.48119	T	0.1	.	19.0744	0.93154	0.0:0.0:1.0:0.0	.	3037	Q12955	ANK3_HUMAN	R	3037	ENSP00000280772:P3037R	ENSP00000280772:P3037R	P	-	2	0	ANK3	61501535	1.000000	0.71417	0.969000	0.41365	0.964000	0.63967	3.474000	0.53129	2.515000	0.84797	0.462000	0.41574	CCT	ANK3	-	NULL	ENSG00000151150		0.428	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	31	0.00	0	G	NM_020987		61831529	61831529	-1	no_errors	ENST00000280772	ensembl	human	known	69_37n	missense	15	42.31	11	SNP	0.934	C
ANKRD19P	138649	genome.wustl.edu	37	9	95599746	95599746	+	RNA	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr9:95599746C>T	ENST00000473204.1	+	0	1827							Q9H560	ANR19_HUMAN	ankyrin repeat domain 19, pseudogene							extracellular vesicular exosome (GO:0070062)											CCGCTGGAGGCCCCGGGGCCT	0.637																																						dbGAP											0																																										-	-	-			0			BC038951		9q22.32	2011-04-27	2011-04-27	2011-04-27	ENSG00000187984	ENSG00000187984			22567	pseudogene	pseudogene			"""ankyrin repeat domain 19"", ""ankyrin repeat domain 19 pseudogene"""	ANKRD19			Standard	NR_026868		Approved	FLJ36178	uc011lua.1	Q9H560	OTTHUMG00000020237		9.37:g.95599746C>T			A8K853|Q17RD3	RNA	SNP	-	NULL	ENST00000473204.1	37	NULL		9																																																																																			ANKRD19P	-	-	ENSG00000187984		0.637	ANKRD19P-004	KNOWN	basic	processed_transcript	ANKRD19P	HGNC	pseudogene	OTTHUMT00000053116.3	28	0.00	0	C	NR_026868		95599746	95599746	+1	no_errors	ENST00000464387	ensembl	human	known	69_37n	rna	22	29.03	9	SNP	0.252	T
AP4E1	23431	genome.wustl.edu	37	15	51233946	51233946	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr15:51233946C>T	ENST00000261842.5	+	10	1256	c.1150C>T	c.(1150-1152)Cat>Tat	p.H384Y	AP4E1_ENST00000560508.1_Missense_Mutation_p.H309Y	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	384					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		ATGTTTAGATCATCCTGATCC	0.338																																						dbGAP											0													113.0	106.0	109.0					15																	51233946		2196	4294	6490	-	-	-	SO:0001583	missense	0			AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.1150C>T	15.37:g.51233946C>T	ENSP00000261842:p.His384Tyr		A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Coatomer_bsu_C,superfamily_ARM-type_fold,pirsf_AP4_complex_esu	p.H384Y	ENST00000261842.5	37	c.1150	CCDS32240.1	15	.	.	.	.	.	.	.	.	.	.	C	25.7	4.663742	0.88251	.	.	ENSG00000081014	ENST00000261842	T	0.12984	2.63	5.96	5.96	0.96718	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.38108	0.1028	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.02081	-1.1217	10	0.87932	D	0	-18.1659	19.4101	0.94667	0.0:1.0:0.0:0.0	.	384	Q9UPM8	AP4E1_HUMAN	Y	384	ENSP00000261842:H384Y	ENSP00000261842:H384Y	H	+	1	0	AP4E1	49021238	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.832000	0.97577	0.655000	0.94253	CAT	AP4E1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP4_complex_esu	ENSG00000081014		0.338	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	AP4E1	HGNC	protein_coding	OTTHUMT00000418656.1	94	0.00	0	C			51233946	51233946	+1	no_errors	ENST00000261842	ensembl	human	known	69_37n	missense	18	66.67	36	SNP	1.000	T
ARAP2	116984	genome.wustl.edu	37	4	36130231	36130231	+	Silent	SNP	C	C	A	rs144887229	byFrequency	TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr4:36130231C>A	ENST00000303965.4	-	21	4053	c.3564G>T	c.(3562-3564)gtG>gtT	p.V1188V		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1188	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						AACTTTTCAACACAGCCGTCA	0.378																																						dbGAP											0													116.0	113.0	114.0					4																	36130231		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.3564G>T	4.37:g.36130231C>A			Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Silent	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_SAM_2,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,superfamily_ArfGAP,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.V1188	ENST00000303965.4	37	c.3564	CCDS3441.1	4																																																																																			ARAP2	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000047365		0.378	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP2	HGNC	protein_coding	OTTHUMT00000215074.2	77	0.00	0	C	NM_015230		36130231	36130231	-1	no_errors	ENST00000303965	ensembl	human	known	69_37n	silent	9	77.50	31	SNP	0.364	A
ARAP3	64411	genome.wustl.edu	37	5	141051281	141051281	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr5:141051281G>T	ENST00000239440.4	-	12	1775	c.1710C>A	c.(1708-1710)ttC>ttA	p.F570L	ARAP3_ENST00000508305.1_Missense_Mutation_p.F492L|ARAP3_ENST00000513878.1_Missense_Mutation_p.F232L	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	570	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						TCCCTGCCCAGAAGCGGTTGG	0.562																																						dbGAP											0													53.0	46.0	48.0					5																	141051281		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.1710C>A	5.37:g.141051281G>T	ENSP00000239440:p.Phe570Leu		B4DIT1|D3DQE3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ras-assoc,pfam_SAM_2,pfam_SAM_type1,superfamily_Rho_GTPase_activation_prot,superfamily_ArfGAP,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.F570L	ENST00000239440.4	37	c.1710	CCDS4266.1	5	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953221	0.73902	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	T;T;T	0.39997	1.05;1.05;1.05	3.44	3.44	0.39384	.	0.000000	0.85682	U	0.000000	T	0.53899	0.1825	L	0.53249	1.67	0.41225	D	0.986534	D;D;D	0.76494	0.988;0.998;0.999	P;D;D	0.83275	0.893;0.987;0.996	T	0.55360	-0.8153	10	0.59425	D	0.04	.	7.3715	0.26804	0.1775:0.0:0.8225:0.0	.	232;492;570	B4DIT1;G5E9Y3;Q8WWN8	.;.;ARAP3_HUMAN	L	492;570;232	ENSP00000421826:F492L;ENSP00000239440:F570L;ENSP00000421468:F232L	ENSP00000239440:F570L	F	-	3	2	ARAP3	141031465	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.239000	0.51360	1.754000	0.51921	0.563000	0.77884	TTC	ARAP3	-	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,pfscan_ArfGAP	ENSG00000120318		0.562	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP3	HGNC	protein_coding	OTTHUMT00000251805.1	32	0.00	0	G	NM_022481		141051281	141051281	-1	no_errors	ENST00000239440	ensembl	human	known	69_37n	missense	2	91.67	22	SNP	1.000	T
ASTN1	460	genome.wustl.edu	37	1	177001636	177001636	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:177001636G>A	ENST00000367654.3	-	3	1032	c.821C>T	c.(820-822)tCc>tTc	p.S274F	ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000424564.2_Missense_Mutation_p.S274F|ASTN1_ENST00000361833.2_Missense_Mutation_p.S274F|ASTN1_ENST00000367657.3_Missense_Mutation_p.S274F	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	274					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GCCCTGCAGGGAGTCGAGGGT	0.592																																						dbGAP											0													125.0	114.0	118.0					1																	177001636		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.821C>T	1.37:g.177001636G>A	ENSP00000356626:p.Ser274Phe		A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_EGF-like,smart_MACPF,pfscan_Fibronectin_type3	p.S274F	ENST00000367654.3	37	c.821		1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716305	0.89205	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.17054	2.3;2.71;2.72;2.3	5.53	5.53	0.82687	.	0.115660	0.64402	D	0.000008	T	0.34337	0.0894	L	0.32530	0.975	0.80722	D	1	D;D;D	0.76494	0.999;0.994;0.994	D;D;D	0.83275	0.996;0.989;0.989	T	0.06023	-1.0850	10	0.87932	D	0	-29.9545	19.0469	0.93025	0.0:0.0:1.0:0.0	.	274;274;274	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	F	274	ENSP00000356629:S274F;ENSP00000354536:S274F;ENSP00000356626:S274F;ENSP00000395041:S274F	ENSP00000354536:S274F	S	-	2	0	ASTN1	175268259	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.267000	0.95665	2.563000	0.86464	0.655000	0.94253	TCC	ASTN1	-	NULL	ENSG00000152092		0.592	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		39	0.00	0	G	NM_004319		177001636	177001636	-1	no_errors	ENST00000367654	ensembl	human	known	69_37n	missense	56	14.93	10	SNP	1.000	A
BAI3	577	genome.wustl.edu	37	6	70071303	70071303	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr6:70071303C>A	ENST00000370598.1	+	29	4959	c.4138C>A	c.(4138-4140)Cct>Act	p.P1380T	BAI3_ENST00000238918.8_Missense_Mutation_p.P586T|BAI3_ENST00000546190.1_Missense_Mutation_p.P344T	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1380					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GCCCTTTGAACCTCGCACAGC	0.423																																						dbGAP											0													116.0	121.0	119.0					6																	70071303		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.4138C>A	6.37:g.70071303C>A	ENSP00000359630:p.Pro1380Thr		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.P1380T	ENST00000370598.1	37	c.4138	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	C	22.2	4.251935	0.80135	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.05447	3.44;3.44;3.44	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.18800	0.0451	M	0.65975	2.015	0.80722	D	1	D;D	0.71674	0.998;0.988	D;P	0.76071	0.987;0.815	T	0.00277	-1.1854	10	0.59425	D	0.04	.	20.1141	0.97919	0.0:1.0:0.0:0.0	.	586;1380	B7Z356;O60242	.;BAI3_HUMAN	T	1380;586;344	ENSP00000359630:P1380T;ENSP00000238918:P586T;ENSP00000441821:P344T	ENSP00000238918:P586T	P	+	1	0	BAI3	70128024	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.487000	0.81328	2.766000	0.95052	0.650000	0.86243	CCT	BAI3	-	NULL	ENSG00000135298		0.423	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	46	0.00	0	C			70071303	70071303	+1	no_errors	ENST00000370598	ensembl	human	known	69_37n	missense	16	54.29	19	SNP	1.000	A
BIN2	51411	genome.wustl.edu	37	12	51685681	51685681	+	Silent	SNP	C	C	T	rs113931281	byFrequency	TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr12:51685681C>T	ENST00000267012.4	-	10	1270	c.1209G>A	c.(1207-1209)aaG>aaA	p.K403K	BIN2_ENST00000544402.1_Silent_p.K377K|BIN2_ENST00000452142.2_Silent_p.K371K|BIN2_ENST00000604560.1_Silent_p.K376K	NM_016293.2	NP_057377.2	Q9UBW5	BIN2_HUMAN	bridging integrator 2	403					cell chemotaxis (GO:0060326)|membrane tubulation (GO:0097320)|phagocytosis, engulfment (GO:0006911)|podosome assembly (GO:0071800)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|podosome (GO:0002102)	phospholipid binding (GO:0005543)			NS(2)|breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(3)	31						TAGAGGCTCTCTTCTTTGGTT	0.602																																						dbGAP											0													88.0	83.0	85.0					12																	51685681		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF146531	CCDS8811.1	12q13.13	2012-01-23			ENSG00000110934	ENSG00000110934			1053	protein-coding gene	gene with protein product		605936				10903846	Standard	XM_005268957		Approved	BRAP-1	uc001ryg.3	Q9UBW5		ENST00000267012.4:c.1209G>A	12.37:g.51685681C>T			Q86VV0|Q9NWK4|Q9UKN4	Silent	SNP	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom,prints_Amphiphysin	p.K403	ENST00000267012.4	37	c.1209	CCDS8811.1	12																																																																																			BIN2	-	NULL	ENSG00000110934		0.602	BIN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BIN2	HGNC	protein_coding	OTTHUMT00000469800.1	67	0.00	0	C			51685681	51685681	-1	no_errors	ENST00000267012	ensembl	human	known	69_37n	silent	19	62.75	32	SNP	0.002	T
BIRC6	57448	genome.wustl.edu	37	2	32654312	32654312	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr2:32654312T>C	ENST00000421745.2	+	11	3105	c.2971T>C	c.(2971-2973)Tct>Cct	p.S991P		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	991					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AATAGAACCATCTTCAGAAGG	0.333																																					Pancreas(94;175 1509 16028 18060 45422)	dbGAP											0													51.0	49.0	50.0					2																	32654312		2201	4290	6491	-	-	-	SO:0001583	missense	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.2971T>C	2.37:g.32654312T>C	ENSP00000393596:p.Ser991Pro		Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.S991P	ENST00000421745.2	37	c.2971	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	T	12.72	2.023641	0.35701	.	.	ENSG00000115760	ENST00000421745	T	0.75477	-0.94	4.91	0.677	0.17964	.	0.402904	0.24332	N	0.039443	T	0.55924	0.1951	N	0.25485	0.75	0.29077	N	0.882939	B	0.22604	0.072	B	0.20384	0.029	T	0.44283	-0.9338	10	0.33940	T	0.23	.	7.2062	0.25909	0.2515:0.0:0.1311:0.6174	.	991	Q9NR09	BIRC6_HUMAN	P	991	ENSP00000393596:S991P	ENSP00000393596:S991P	S	+	1	0	BIRC6	32507816	1.000000	0.71417	0.979000	0.43373	0.996000	0.88848	0.849000	0.27723	-0.065000	0.13021	0.460000	0.39030	TCT	BIRC6	-	NULL	ENSG00000115760		0.333	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	74	0.00	0	T	NM_016252		32654312	32654312	+1	no_errors	ENST00000421745	ensembl	human	known	69_37n	missense	55	16.67	11	SNP	0.980	C
BRSK2	9024	genome.wustl.edu	37	11	1464595	1464595	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr11:1464595G>T	ENST00000528841.1	+	7	979	c.595G>T	c.(595-597)Gtg>Ttg	p.V199L	BRSK2_ENST00000308230.5_Missense_Mutation_p.V199L|BRSK2_ENST00000528710.1_Missense_Mutation_p.V139L|BRSK2_ENST00000531197.1_Missense_Mutation_p.V199L|BRSK2_ENST00000544817.1_5'UTR|BRSK2_ENST00000308219.9_Missense_Mutation_p.V199L|BRSK2_ENST00000526678.1_Missense_Mutation_p.V199L|BRSK2_ENST00000382179.1_Missense_Mutation_p.V245L			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	199	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		GAAGGCGGACGTGTGGAGCTG	0.706																																						dbGAP											0													31.0	40.0	37.0					11																	1464595		2067	4191	6258	-	-	-	SO:0001583	missense	0			AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.595G>T	11.37:g.1464595G>T	ENSP00000432000:p.Val199Leu		B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V245L	ENST00000528841.1	37	c.733	CCDS58107.1	11	.	.	.	.	.	.	.	.	.	.	g	15.22	2.769111	0.49680	.	.	ENSG00000174672	ENST00000308219;ENST00000531197;ENST00000308230;ENST00000528841;ENST00000526678;ENST00000528710;ENST00000382179	T;T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64;1.64	3.55	3.55	0.40652	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.616212	0.14628	U	0.308013	T	0.32704	0.0838	L	0.60012	1.86	0.80722	D	1	B;B;B;B;B	0.33857	0.028;0.013;0.011;0.429;0.375	B;B;B;B;B	0.37833	0.037;0.02;0.037;0.259;0.202	T	0.28839	-1.0031	10	0.87932	D	0	.	9.2782	0.37711	0.1015:0.0:0.8985:0.0	.	199;245;199;199;199	Q8IWQ3-4;Q8IWQ3-5;Q8IWQ3-3;Q8IWQ3;Q8IWQ3-2	.;.;.;BRSK2_HUMAN;.	L	199;199;199;199;199;139;245	ENSP00000310697:V199L;ENSP00000431152:V199L;ENSP00000310805:V199L;ENSP00000432000:V199L;ENSP00000433370:V199L;ENSP00000433235:V139L;ENSP00000371614:V245L	ENSP00000310697:V199L	V	+	1	0	BRSK2	1421171	0.973000	0.33851	0.998000	0.56505	0.522000	0.34438	4.744000	0.62118	1.858000	0.53909	0.299000	0.19835	GTG	BRSK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000174672		0.706	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BRSK2	HGNC	protein_coding	OTTHUMT00000393033.1	11	0.00	0	G	NM_003957		1464595	1464595	+1	no_errors	ENST00000382179	ensembl	human	known	69_37n	missense	4	78.95	15	SNP	1.000	T
CCDC7	79741	genome.wustl.edu	37	10	33000568	33000568	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr10:33000568G>C	ENST00000375030.2	+	10	1042	c.424G>C	c.(424-426)Gaa>Caa	p.E142Q	C10orf68_ENST00000375028.3_Missense_Mutation_p.E110Q|C10orf68_ENST00000375025.4_Missense_Mutation_p.E134Q			Q9H943	CJ068_HUMAN		134										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						AGAATCAGGTGAAAATCCTAT	0.323																																						dbGAP											0													64.0	67.0	66.0					10																	33000568		2203	4298	6501	-	-	-	SO:0001583	missense	0																														ENST00000375030.2:c.424G>C	10.37:g.33000568G>C	ENSP00000364170:p.Glu142Gln		B0QZ71|Q08AN7|Q8N7T7	Missense_Mutation	SNP	NULL	p.E134Q	ENST00000375030.2	37	c.400		10	.	.	.	.	.	.	.	.	.	.	.	12.39	1.923049	0.33908	.	.	ENSG00000150076	ENST00000302316;ENST00000375030;ENST00000375028;ENST00000375025;ENST00000375037	T;T;T;T	0.32023	1.51;1.47;1.73;1.49	2.71	-0.248	0.13015	.	.	.	.	.	T	0.36853	0.0982	L	0.44542	1.39	0.09310	N	1	P;D;D;D	0.65815	0.914;0.995;0.985;0.995	P;P;P;P	0.61003	0.708;0.882;0.882;0.882	T	0.18366	-1.0339	9	0.62326	D	0.03	.	4.9915	0.14216	0.4641:0.0:0.5359:0.0	.	66;134;110;142	B4DX58;Q9H943;A2A3B4;A2A3D6	.;CJ068_HUMAN;.;.	Q	134;142;110;134;82	ENSP00000303710:E134Q;ENSP00000364170:E142Q;ENSP00000364168:E110Q;ENSP00000364165:E134Q	ENSP00000303710:E134Q	E	+	1	0	C10orf68	33040574	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.362000	0.07602	-0.065000	0.13021	0.460000	0.39030	GAA	C10orf68	-	NULL	ENSG00000150076		0.323	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	C10orf68	HGNC	protein_coding	OTTHUMT00000313999.2	44	0.00	0	G			33000568	33000568	+1	no_errors	ENST00000375025	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	0.001	C
KNSTRN	90417	genome.wustl.edu	37	15	40675104	40675104	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr15:40675104A>T	ENST00000249776.8	+	1	183	c.68A>T	c.(67-69)gAt>gTt	p.D23V	KNSTRN_ENST00000608100.1_5'Flank|KNSTRN_ENST00000448395.2_Missense_Mutation_p.D23V|KNSTRN_ENST00000416151.2_Missense_Mutation_p.D23V	NM_033286.3	NP_150628.3			kinetochore-localized astrin/SPAG5 binding protein																		ACAGAGTGCGATTCCCACCCA	0.572																																						dbGAP											0													42.0	46.0	45.0					15																	40675104		1884	4107	5991	-	-	-	SO:0001583	missense	0			AK027408	CCDS42021.1, CCDS45226.1, CCDS45227.1	15q15.1	2013-01-17	2012-12-04	2012-12-04	ENSG00000128944	ENSG00000128944			30767	protein-coding gene	gene with protein product	"""small kinetochore-associated protein"", ""kinetochore-localized astrin-binding protein"", ""TRAF4 associated factor 1"""	614718	"""chromosome 15 open reading frame 23"""	C15orf23		12477932	Standard	NM_033286		Approved	FLJ14502, SKAP, kinastrin, TRAF4AF1	uc001zll.3	Q9Y448	OTTHUMG00000172454	ENST00000249776.8:c.68A>T	15.37:g.40675104A>T	ENSP00000249776:p.Asp23Val			Missense_Mutation	SNP	NULL	p.D23V	ENST00000249776.8	37	c.68	CCDS42021.1	15	.	.	.	.	.	.	.	.	.	.	A	12.37	1.917493	0.33815	.	.	ENSG00000128944	ENST00000249776;ENST00000416151;ENST00000448395	T;T;T	0.21932	1.98;1.98;1.98	4.41	-0.19	0.13256	.	1.019890	0.07848	N	0.964123	T	0.09024	0.0223	N	0.08118	0	0.09310	N	1	B;B;B	0.10296	0.003;0.003;0.003	B;B;B	0.09377	0.002;0.004;0.004	T	0.34527	-0.9825	10	0.56958	D	0.05	-1.6767	0.638	0.00806	0.361:0.2504:0.234:0.1546	.	23;23;23	Q9Y448-2;Q9Y448-3;Q9Y448	.;.;T4AF1_HUMAN	V	23	ENSP00000249776:D23V;ENSP00000391233:D23V;ENSP00000393001:D23V	ENSP00000249776:D23V	D	+	2	0	C15orf23	38462396	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.164000	0.16542	0.072000	0.16694	0.533000	0.62120	GAT	C15orf23	-	NULL	ENSG00000128944		0.572	KNSTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf23	HGNC	protein_coding	OTTHUMT00000418636.1	21	0.00	0	A	NM_001142761		40675104	40675104	+1	no_errors	ENST00000249776	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	0.000	T
C2orf16	84226	genome.wustl.edu	37	2	27800889	27800889	+	Missense_Mutation	SNP	C	C	A	rs184667814		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr2:27800889C>A	ENST00000408964.2	+	1	1501	c.1450C>A	c.(1450-1452)Caa>Aaa	p.Q484K		NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	484						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					GCCACTAGATCAAGTCACAGA	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		20043	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													80.0	74.0	76.0					2																	27800889		1898	4120	6018	-	-	-	SO:0001583	missense	0			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.1450C>A	2.37:g.27800889C>A	ENSP00000386190:p.Gln484Lys		B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	NULL	p.Q484K	ENST00000408964.2	37	c.1450	CCDS42666.1	2	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	12.14	1.850113	0.32699	.	.	ENSG00000221843	ENST00000408964	T	0.05199	3.48	4.68	2.64	0.31445	.	.	.	.	.	T	0.05410	0.0143	L	0.29908	0.895	0.09310	N	1	B	0.28713	0.22	B	0.25614	0.062	T	0.34453	-0.9828	9	0.45353	T	0.12	.	9.01	0.36135	0.4294:0.5706:0.0:0.0	.	484	Q68DN1	CB016_HUMAN	K	484	ENSP00000386190:Q484K	ENSP00000386190:Q484K	Q	+	1	0	C2orf16	27654393	0.000000	0.05858	0.055000	0.19348	0.956000	0.61745	-0.718000	0.04980	1.134000	0.42165	0.563000	0.77884	CAA	C2orf16	-	NULL	ENSG00000221843		0.428	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf16	HGNC	protein_coding	OTTHUMT00000353292.1	37	0.00	0	C	NM_032266		27800889	27800889	+1	no_errors	ENST00000408964	ensembl	human	known	69_37n	missense	36	33.33	18	SNP	0.006	A
CAPN2	824	genome.wustl.edu	37	1	223934702	223934702	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:223934702C>G	ENST00000295006.5	+	5	873	c.564C>G	c.(562-564)atC>atG	p.I188M	CAPN2_ENST00000433674.2_Missense_Mutation_p.I110M	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	188	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)			breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		CTTGTAGGATCAACGGATGCT	0.527																																						dbGAP											0													100.0	96.0	98.0					1																	223934702		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.564C>G	1.37:g.223934702C>G	ENSP00000295006:p.Ile188Met		A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,prints_Calpain_cysteine_protease,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat	p.I188M	ENST00000295006.5	37	c.564	CCDS31035.1	1	.	.	.	.	.	.	.	.	.	.	C	11.27	1.590129	0.28357	.	.	ENSG00000162909	ENST00000433674;ENST00000434648;ENST00000295006;ENST00000366869	D;D;D	0.89343	-2.5;-2.5;-2.5	5.42	5.42	0.78866	Peptidase C2, calpain, catalytic domain (3);	0.526840	0.20721	N	0.086913	T	0.81903	0.4921	N	0.14661	0.345	0.47584	D	0.999463	B;B	0.18461	0.028;0.007	B;B	0.26969	0.047;0.075	T	0.78879	-0.2030	10	0.87932	D	0	.	13.8153	0.63287	0.0:0.7214:0.2786:0.0	.	110;188	B7ZA96;P17655	.;CAN2_HUMAN	M	110;110;188;217	ENSP00000413158:I110M;ENSP00000399949:I110M;ENSP00000295006:I188M	ENSP00000295006:I188M	I	+	3	3	CAPN2	222001325	1.000000	0.71417	1.000000	0.80357	0.122000	0.20287	2.142000	0.42177	2.528000	0.85240	0.563000	0.77884	ATC	CAPN2	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease,pfscan_Peptidase_C2_calpain_cat	ENSG00000162909		0.527	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN2	HGNC	protein_coding	OTTHUMT00000090973.1	37	0.00	0	C	NM_001748		223934702	223934702	+1	no_errors	ENST00000295006	ensembl	human	known	69_37n	missense	25	60.00	39	SNP	1.000	G
CASC1	55259	genome.wustl.edu	37	12	25311497	25311497	+	Splice_Site	SNP	T	T	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr12:25311497T>C	ENST00000320267.9	-	3	170	c.89A>G	c.(88-90)gAg>gGg	p.E30G	CASC1_ENST00000545133.1_Intron|CASC1_ENST00000395987.3_Splice_Site_p.E36G|CASC1_ENST00000354189.5_Splice_Site_p.E94G|CASC1_ENST00000395990.2_5'UTR|CASC1_ENST00000557684.1_5'UTR|CASC1_ENST00000537577.1_Intron	NM_001082973.1	NP_001076442	Q6TDU7	CASC1_HUMAN	cancer susceptibility candidate 1	30	Glu-rich.									breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(3)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)			ACGGGCTTCCTCTAAAGAACC	0.313																																						dbGAP											0													72.0	70.0	70.0					12																	25311497		2203	4297	6500	-	-	-	SO:0001630	splice_region_variant	0			AK093102	CCDS31759.2, CCDS41762.1, CCDS41763.1, CCDS55810.1, CCDS55811.1	12p12.1	2012-04-17			ENSG00000118307	ENSG00000118307		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 54"""					14583591	Standard	NM_018272		Approved	LAS1, FLJ10921, PPP1R54	uc001rgk.3	Q6TDU7	OTTHUMG00000150195	ENST00000320267.9:c.89-1A>G	12.37:g.25311497T>C			B4DNP2|F5H6T6|Q17RL2|Q4G171|Q5U5K5|Q9NV50	Missense_Mutation	SNP	pfam_Casc1_domain,prints_Casc1	p.E36G	ENST00000320267.9	37	c.107	CCDS41762.1	12	.	.	.	.	.	.	.	.	.	.	T	13.22	2.172488	0.38315	.	.	ENSG00000118307	ENST00000354189;ENST00000395987;ENST00000320267;ENST00000395992	T;T;T	0.48201	2.06;0.82;0.85	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.66237	0.2769	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.994;0.998	T	0.69465	-0.5138	10	0.66056	D	0.02	.	11.8582	0.52451	0.0:0.0:0.0:1.0	.	94;30;36	Q6TDU7-3;Q6TDU7;F8W8F9	.;CASC1_HUMAN;.	G	94;36;30;36	ENSP00000346126:E94G;ENSP00000379310:E36G;ENSP00000313141:E30G	ENSP00000313141:E30G	E	-	2	0	CASC1	25202764	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	2.879000	0.48522	2.051000	0.60960	0.467000	0.42956	GAG	CASC1	-	NULL	ENSG00000118307		0.313	CASC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASC1	HGNC	protein_coding	OTTHUMT00000316761.1	109	0.00	0	T	NM_018272	Missense_Mutation	25311497	25311497	-1	no_errors	ENST00000395987	ensembl	human	known	69_37n	missense	90	10.89	11	SNP	1.000	C
DRC7	84229	genome.wustl.edu	37	16	57741527	57741527	+	Missense_Mutation	SNP	C	C	G	rs200287537		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr16:57741527C>G	ENST00000360716.3	+	8	1235	c.1014C>G	c.(1012-1014)atC>atG	p.I338M	CCDC135_ENST00000394337.4_Missense_Mutation_p.I338M|CCDC135_ENST00000336825.8_Missense_Mutation_p.I273M			Q8IY82	CC135_HUMAN		338					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						TCCTGGGCATCGAAAGCCTGT	0.567													c|||	1	0.000199681	0.0	0.0014	5008	,	,		20931	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													83.0	66.0	72.0					16																	57741527		2196	4300	6496	-	-	-	SO:0001583	missense	0																														ENST00000360716.3:c.1014C>G	16.37:g.57741527C>G	ENSP00000353942:p.Ile338Met		A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	NULL	p.I338M	ENST00000360716.3	37	c.1014	CCDS10787.1	16	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	.	13.97	2.394440	0.42410	.	.	ENSG00000159625	ENST00000394337;ENST00000336825;ENST00000360716	T;T;T	0.76448	1.74;-1.02;1.74	5.03	-10.1	0.00402	.	0.202526	0.43416	D	0.000569	D	0.83207	0.5204	M	0.83953	2.67	0.26802	N	0.969186	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.84642	0.0696	10	0.72032	D	0.01	-22.0671	11.2317	0.48916	0.1549:0.1917:0.0:0.6534	.	273;338	Q8IY82-2;Q8IY82	.;CC135_HUMAN	M	338;273;338	ENSP00000377869:I338M;ENSP00000338938:I273M;ENSP00000353942:I338M	ENSP00000338938:I273M	I	+	3	3	CCDC135	56299028	0.000000	0.05858	0.190000	0.23270	0.889000	0.51656	-3.130000	0.00591	-2.841000	0.00335	-0.839000	0.03059	ATC	CCDC135	-	NULL	ENSG00000159625		0.567	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC135	HGNC	protein_coding	OTTHUMT00000433323.2	34	0.00	0	C			57741527	57741527	+1	no_errors	ENST00000360716	ensembl	human	known	69_37n	missense	24	33.33	12	SNP	0.008	G
CDC42BPG	55561	genome.wustl.edu	37	11	64606639	64606639	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr11:64606639C>A	ENST00000342711.5	-	7	741	c.742G>T	c.(742-744)Gag>Tag	p.E248*		NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						CCCTTGCCCTCCTCCATGGCC	0.597																																						dbGAP											0													125.0	115.0	118.0					11																	64606639		2201	4297	6498	-	-	-	SO:0001587	stop_gained	0			AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.742G>T	11.37:g.64606639C>A	ENSP00000345133:p.Glu248*			Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.E248*	ENST00000342711.5	37	c.742	CCDS31601.1	11	.	.	.	.	.	.	.	.	.	.	C	37	6.423625	0.97555	.	.	ENSG00000171219	ENST00000342711	.	.	.	5.27	5.27	0.74061	.	0.116778	0.37261	N	0.002174	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.7333	0.85440	0.0:1.0:0.0:0.0	.	.	.	.	X	248	.	ENSP00000345133:E248X	E	-	1	0	CDC42BPG	64363215	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.771000	0.85420	2.623000	0.88846	0.655000	0.94253	GAG	CDC42BPG	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000171219		0.597	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPG	HGNC	protein_coding	OTTHUMT00000105352.4	25	0.00	0	C	XM_290516		64606639	64606639	-1	no_errors	ENST00000342711	ensembl	human	known	69_37n	nonsense	14	54.84	17	SNP	1.000	A
CEACAM5	1048	genome.wustl.edu	37	19	42221424	42221424	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr19:42221424G>A	ENST00000221992.6	+	5	1123	c.1009G>A	c.(1009-1011)Gat>Aat	p.D337N	CEACAM5_ENST00000405816.1_Missense_Mutation_p.D337N|CEA_ENST00000598976.1_Intron|CEACAM5_ENST00000398599.4_Missense_Mutation_p.D336N	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	337	Ig-like 4.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		CCCCGTGGAGGATGAGGATGC	0.527																																						dbGAP											0													150.0	149.0	149.0					19																	42221424		2203	4300	6503	-	-	-	SO:0001583	missense	0			M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.1009G>A	19.37:g.42221424G>A	ENSP00000221992:p.Asp337Asn		H9KVA7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.D337N	ENST00000221992.6	37	c.1009	CCDS12584.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.357|0.357	-0.941582|-0.941582	0.02322|0.02322	.|.	.|.	ENSG00000105388|ENSG00000105388	ENST00000221992;ENST00000405816|ENST00000398599	T;T|.	0.66815|.	-0.23;-0.23|.	2.77|2.77	-5.55|-5.55	0.02536|0.02536	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	.|.	.|.	.|.	.|.	T|T	0.15089|0.15089	0.0364|0.0364	N|N	0.12663|0.12663	0.25|0.25	0.09310|0.09310	N|N	1|1	B;B|.	0.23442|.	0.085;0.019|.	B;B|.	0.31390|.	0.129;0.07|.	T|T	0.25502|0.25502	-1.0130|-1.0130	9|5	0.13853|.	T|.	0.58|.	.|.	4.757|4.757	0.13090|0.13090	0.5059:0.2806:0.2135:0.0|0.5059:0.2806:0.2135:0.0	.|.	337;337|.	P06731;Q53G30|.	CEAM5_HUMAN;.|.	N|E	337|332	ENSP00000221992:D337N;ENSP00000385072:D337N|.	ENSP00000221992:D337N|.	D|G	+|+	1|2	0|0	CEACAM5|CEACAM5	46913264|46913264	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-2.072000|-2.072000	0.01377|0.01377	-1.372000|-1.372000	0.02137|0.02137	-0.459000|-0.459000	0.05422|0.05422	GAT|GGA	CEACAM5	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000105388		0.527	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEACAM5	HGNC	protein_coding	OTTHUMT00000321132.2	81	0.00	0	G	NM_004363		42221424	42221424	+1	no_errors	ENST00000221992	ensembl	human	known	69_37n	missense	76	40.16	51	SNP	0.000	A
CHADL	150356	genome.wustl.edu	37	22	41635564	41635564	+	Silent	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr22:41635564G>A	ENST00000216241.9	-	2	121	c.69C>T	c.(67-69)gcC>gcT	p.A23A		NM_138481.1	NP_612490.1	Q6NUI6	CHADL_HUMAN	chondroadherin-like	23						proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(1)|skin(1)	4						GCCTAGCCGGGGCCAGCAGCA	0.667																																						dbGAP											0													21.0	29.0	27.0					22																	41635564		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BC012882	CCDS46715.1	22q13.2	2008-10-31			ENSG00000100399	ENSG00000100399			25165	protein-coding gene	gene with protein product						12477932	Standard	NM_138481		Approved	SLRR4B	uc003azq.4	Q6NUI6	OTTHUMG00000150936	ENST00000216241.9:c.69C>T	22.37:g.41635564G>A			Q05CY2|Q4G0S0|Q5JY13|Q86XY1|Q96E60	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.P21L	ENST00000216241.9	37	c.62	CCDS46715.1	22	.	.	.	.	.	.	.	.	.	.	G	9.810	1.182874	0.21870	.	.	ENSG00000100399	ENST00000417999	.	.	.	5.05	1.78	0.24846	.	.	.	.	.	T	0.52041	0.1710	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38908	-0.9639	4	.	.	.	.	5.3529	0.16045	0.1861:0.1791:0.6347:0.0	.	.	.	.	L	21	.	.	P	-	2	0	CHADL	39965510	0.000000	0.05858	0.789000	0.31954	0.030000	0.12068	-0.435000	0.06931	0.304000	0.22809	0.462000	0.41574	CCC	CHADL	-	NULL	ENSG00000100399		0.667	CHADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHADL	HGNC	protein_coding	OTTHUMT00000320597.1	8	0.00	0	G	NM_138481		41635564	41635564	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000417999	ensembl	human	known	69_37n	missense	7	65.00	13	SNP	0.982	A
CHD5	26038	genome.wustl.edu	37	1	6181593	6181593	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:6181593G>T	ENST00000262450.3	-	32	4839	c.4740C>A	c.(4738-4740)gaC>gaA	p.D1580E	CHD5_ENST00000378021.1_Missense_Mutation_p.D437E	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GTGCCCCGGGGTCTTTCTCAT	0.597																																						dbGAP											0													39.0	39.0	39.0					1																	6181593		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.4740C>A	1.37:g.6181593G>T	ENSP00000262450:p.Asp1580Glu		A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.D1580E	ENST00000262450.3	37	c.4740	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	g	0.122	-1.124271	0.01770	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000378021;ENST00000536802;ENST00000538279;ENST00000377999	D;T	0.89875	-2.58;2.36	4.94	3.0	0.34707	.	0.324438	0.27836	N	0.017654	T	0.70168	0.3193	N	0.04880	-0.145	0.21967	N	0.999448	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.56111	-0.8033	10	0.02654	T	1	-28.3303	7.8088	0.29219	0.0:0.5542:0.3515:0.0942	.	1580;437	Q8TDI0;Q5TG85	CHD5_HUMAN;.	E	1580;1096;437;988;988;437	ENSP00000262450:D1580E;ENSP00000367260:D437E	ENSP00000262450:D1580E	D	-	3	2	CHD5	6104180	0.073000	0.21202	0.869000	0.34112	0.109000	0.19521	-0.132000	0.10467	1.178000	0.42870	0.453000	0.30009	GAC	CHD5	-	NULL	ENSG00000116254		0.597	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	37	0.00	0	G	NM_015557		6181593	6181593	-1	no_errors	ENST00000262450	ensembl	human	known	69_37n	missense	7	72.41	21	SNP	0.648	T
CLOCK	9575	genome.wustl.edu	37	4	56345865	56345865	+	Splice_Site	SNP	C	C	A	rs191090203		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr4:56345865C>A	ENST00000309964.4	-	4	299	c.49G>T	c.(49-51)Gat>Tat	p.D17Y	CLOCK_ENST00000513440.1_Splice_Site_p.D17Y|CLOCK_ENST00000506923.1_5'UTR|CLOCK_ENST00000381322.1_Splice_Site_p.D17Y	NM_004898.3	NP_004889.1	O15516	CLOCK_HUMAN	clock circadian regulator	17					cellular response to ionizing radiation (GO:0071479)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA damage checkpoint (GO:0000077)|histone acetylation (GO:0016573)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription, DNA-templated (GO:0045892)|photoperiodism (GO:0009648)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|chromosome (GO:0005694)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone acetyltransferase activity (GO:0004402)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(8)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			CTACTGTCATCTCTAAAAGAA	0.338																																						dbGAP											0													89.0	87.0	88.0					4																	56345865		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF011568	CCDS3500.1	4q12	2012-12-07	2012-12-07		ENSG00000134852	ENSG00000134852		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	2082	protein-coding gene	gene with protein product		601851	"""clock (mouse) homolog"", ""clock homolog (mouse)"""			10198158	Standard	NM_001267843		Approved	KIAA0334, KAT13D, bHLHe8	uc003hba.2	O15516	OTTHUMG00000102141	ENST00000309964.4:c.48-1G>T	4.37:g.56345865C>A			A0AV01|A2I2N9|O14516|Q9UIT8	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,pfscan_HLH_DNA-bd,prints_Nuc_translocat	p.D17Y	ENST00000309964.4	37	c.49	CCDS3500.1	4	.	.	.	.	.	.	.	.	.	.	C	25.7	4.662078	0.88251	.	.	ENSG00000134852	ENST00000309964;ENST00000381322;ENST00000513440	T;T;T	0.06294	3.32;3.32;3.32	5.83	5.83	0.93111	.	1.491120	0.03165	N	0.169802	T	0.12433	0.0302	L	0.32530	0.975	0.58432	D	0.999999	P	0.52061	0.95	P	0.46758	0.526	T	0.08166	-1.0735	10	0.87932	D	0	.	14.2937	0.66298	0.0:0.9273:0.0:0.0727	.	17	O15516	CLOCK_HUMAN	Y	17	ENSP00000308741:D17Y;ENSP00000370723:D17Y;ENSP00000426983:D17Y	ENSP00000308741:D17Y	D	-	1	0	CLOCK	56040622	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.514000	0.60482	2.761000	0.94854	0.650000	0.86243	GAT	CLOCK	-	NULL	ENSG00000134852		0.338	CLOCK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CLOCK	HGNC	protein_coding	OTTHUMT00000361993.2	115	0.00	0	C	NM_004898	Missense_Mutation	56345865	56345865	-1	no_errors	ENST00000309964	ensembl	human	known	69_37n	missense	17	76.39	55	SNP	1.000	A
CMAS	55907	genome.wustl.edu	37	12	22214246	22214246	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr12:22214246G>T	ENST00000229329.2	+	6	950	c.820G>T	c.(820-822)Gaa>Taa	p.E274*		NM_018686.4	NP_061156.1	Q8NFW8	NEUA_HUMAN	cytidine monophosphate N-acetylneuraminic acid synthetase	274					lipopolysaccharide biosynthetic process (GO:0009103)|N-acetylneuraminate metabolic process (GO:0006054)	membrane (GO:0016020)|nucleus (GO:0005634)	N-acylneuraminate cytidylyltransferase activity (GO:0008781)	p.E274K(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24						GAAGCTTAAGGAAATAAAACT	0.343																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											105.0	111.0	109.0					12																	22214246		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF271388	CCDS8696.1	12p12.1	2008-08-04			ENSG00000111726	ENSG00000111726			18290	protein-coding gene	gene with protein product	"""CMP-Neu5Ac synthetase"""	603316				8889549, 7566098	Standard	NM_018686		Approved		uc001rfm.4	Q8NFW8	OTTHUMG00000169097	ENST00000229329.2:c.820G>T	12.37:g.22214246G>T	ENSP00000229329:p.Glu274*		Q96AX5|Q9NQZ0	Nonsense_Mutation	SNP	pfam_Cytidylyl_trans,superfamily_HAD-like_dom	p.E274*	ENST00000229329.2	37	c.820	CCDS8696.1	12	.	.	.	.	.	.	.	.	.	.	G	38	7.145270	0.98092	.	.	ENSG00000111726	ENST00000229329	.	.	.	5.97	5.97	0.96955	.	0.054903	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	-16.8083	20.4135	0.99023	0.0:0.0:1.0:0.0	.	.	.	.	X	274	.	ENSP00000229329:E274X	E	+	1	0	CMAS	22105513	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.821000	0.48065	2.835000	0.97688	0.591000	0.81541	GAA	CMAS	-	pfam_Cytidylyl_trans,superfamily_HAD-like_dom	ENSG00000111726		0.343	CMAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMAS	HGNC	protein_coding	OTTHUMT00000402235.1	63	0.00	0	G	NM_018686		22214246	22214246	+1	no_errors	ENST00000229329	ensembl	human	known	69_37n	nonsense	47	33.33	24	SNP	1.000	T
CNTNAP2	26047	genome.wustl.edu	37	7	146471394	146471394	+	Silent	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr7:146471394C>T	ENST00000361727.3	+	2	645	c.129C>T	c.(127-129)ctC>ctT	p.L43L		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	43	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TCTCTGGACTCCCCCATGTGG	0.443										HNSCC(39;0.1)																												dbGAP											0													71.0	70.0	70.0					7																	146471394		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.129C>T	7.37:g.146471394C>T			D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Silent	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,pfam_EGF-like_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.L43	ENST00000361727.3	37	c.129	CCDS5889.1	7																																																																																			CNTNAP2	-	superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000174469		0.443	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1	76	0.00	0	C			146471394	146471394	+1	no_errors	ENST00000361727	ensembl	human	known	69_37n	silent	20	33.33	10	SNP	0.593	T
COL22A1	169044	genome.wustl.edu	37	8	139890242	139890242	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr8:139890242G>T	ENST00000303045.6	-	3	855	c.409C>A	c.(409-411)Ccc>Acc	p.P137T	COL22A1_ENST00000435777.1_Missense_Mutation_p.P137T	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	137	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CGGTCCCTGGGGCGGCCGCCG	0.741										HNSCC(7;0.00092)																												dbGAP											0													8.0	11.0	10.0					8																	139890242		2142	4146	6288	-	-	-	SO:0001583	missense	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.409C>A	8.37:g.139890242G>T	ENSP00000303153:p.Pro137Thr		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.P137T	ENST00000303045.6	37	c.409	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	G	16.46	3.129918	0.56721	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.84070	-1.8;-1.8	5.2	5.2	0.72013	von Willebrand factor, type A (3);	0.137514	0.33180	U	0.005182	D	0.89591	0.6759	M	0.62266	1.93	0.58432	D	0.999996	D	0.76494	0.999	D	0.72338	0.977	D	0.89045	0.3451	9	.	.	.	.	17.7171	0.88341	0.0:0.0:1.0:0.0	.	137	Q8NFW1	COMA1_HUMAN	T	137	ENSP00000303153:P137T;ENSP00000387655:P137T	.	P	-	1	0	COL22A1	139959424	1.000000	0.71417	0.983000	0.44433	0.145000	0.21501	9.278000	0.95766	2.389000	0.81357	0.655000	0.94253	CCC	COL22A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000169436		0.741	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	15	0.00	0	G	XM_291257		139890242	139890242	-1	no_errors	ENST00000303045	ensembl	human	known	69_37n	missense	16	36.00	9	SNP	1.000	T
CPN2	1370	genome.wustl.edu	37	3	194063051	194063051	+	Silent	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr3:194063051G>A	ENST00000323830.3	-	2	470	c.381C>T	c.(379-381)acC>acT	p.T127T	CPN2_ENST00000429275.1_Silent_p.T127T	NM_001080513.2	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	127					protein stabilization (GO:0050821)|regulation of catalytic activity (GO:0050790)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(5)|prostate(1)	27	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		TGAAGTTGAGGGTGAGCTTGC	0.627																																						dbGAP											0													70.0	65.0	67.0					3																	194063051		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J05158	CCDS33920.1	3q29	2012-02-10	2007-02-23		ENSG00000178772	ENSG00000178772	3.4.17.3		2313	protein-coding gene	gene with protein product		603104	"""carboxypeptidase N, polypeptide 2, 83kD"""	ACBP		2378615, 9628828	Standard	XM_005269280		Approved		uc003fts.3	P22792	OTTHUMG00000156047	ENST00000323830.3:c.381C>T	3.37:g.194063051G>A			B2RPE7|Q86SU4|Q8N5V4	Silent	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.T127	ENST00000323830.3	37	c.381	CCDS33920.1	3																																																																																			CPN2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000178772		0.627	CPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPN2	HGNC	protein_coding	OTTHUMT00000342856.2	38	0.00	0	G	NM_001080513		194063051	194063051	-1	no_errors	ENST00000323830	ensembl	human	known	69_37n	silent	23	50.00	24	SNP	0.656	A
CTR9	9646	genome.wustl.edu	37	11	10792118	10792118	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr11:10792118G>A	ENST00000361367.2	+	18	2737	c.2311G>A	c.(2311-2313)Gat>Aat	p.D771N		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	771					cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		TGTCCTGAAAGATGAAAAAAG	0.368																																						dbGAP											0													114.0	118.0	116.0					11																	10792118		2201	4294	6495	-	-	-	SO:0001583	missense	0			D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.2311G>A	11.37:g.10792118G>A	ENSP00000355013:p.Asp771Asn		D3DQV8|Q15015	Missense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D771N	ENST00000361367.2	37	c.2311	CCDS7805.1	11	.	.	.	.	.	.	.	.	.	.	G	22.1	4.249759	0.80024	.	.	ENSG00000198730	ENST00000361367	T	0.46819	0.86	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.51890	0.1701	M	0.71581	2.175	0.80722	D	1	B	0.23185	0.081	B	0.15052	0.012	T	0.44112	-0.9349	10	0.38643	T	0.18	-34.9935	20.5407	0.99260	0.0:0.0:1.0:0.0	.	771	Q6PD62	CTR9_HUMAN	N	771	ENSP00000355013:D771N	ENSP00000355013:D771N	D	+	1	0	CTR9	10748694	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.865000	0.98341	0.655000	0.94253	GAT	CTR9	-	NULL	ENSG00000198730		0.368	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTR9	HGNC	protein_coding	OTTHUMT00000386215.1	80	0.00	0	G	NM_014633		10792118	10792118	+1	no_errors	ENST00000361367	ensembl	human	known	69_37n	missense	24	57.14	32	SNP	1.000	A
CYP26B1	56603	genome.wustl.edu	37	2	72360334	72360334	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr2:72360334G>T	ENST00000001146.2	-	5	1167	c.964C>A	c.(964-966)Ctg>Atg	p.L322M	CYP26B1_ENST00000412253.1_Missense_Mutation_p.L131M|CYP26B1_ENST00000546307.1_Missense_Mutation_p.L247M	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	322					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						TCATCCCGCAGCTTCTCCAGC	0.662																																						dbGAP											0													26.0	26.0	26.0					2																	72360334		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.964C>A	2.37:g.72360334G>T	ENSP00000001146:p.Leu322Met		B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_B,prints_Cyt_P450	p.L322M	ENST00000001146.2	37	c.964	CCDS1919.1	2	.	.	.	.	.	.	.	.	.	.	G	26.6	4.753113	0.89753	.	.	ENSG00000003137	ENST00000001146;ENST00000412253;ENST00000546307	T;T;T	0.77229	-1.08;-1.08;-1.08	5.64	3.71	0.42584	.	0.070457	0.64402	D	0.000016	D	0.85639	0.5743	M	0.78285	2.405	0.58432	D	0.999991	P;D;D	0.63046	0.898;0.983;0.992	P;D;D	0.70227	0.883;0.943;0.968	D	0.85733	0.1332	10	0.51188	T	0.08	-0.5912	10.0776	0.42370	0.0762:0.1383:0.7855:0.0	.	247;305;322	B7Z2K6;B7Z2P4;Q9NR63	.;.;CP26B_HUMAN	M	322;131;247	ENSP00000001146:L322M;ENSP00000401465:L131M;ENSP00000443304:L247M	ENSP00000001146:L322M	L	-	1	2	CYP26B1	72213842	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.276000	0.51646	1.522000	0.49001	0.650000	0.86243	CTG	CYP26B1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000003137		0.662	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP26B1	HGNC	protein_coding	OTTHUMT00000251969.1	12	0.00	0	G	NM_019885		72360334	72360334	-1	no_errors	ENST00000001146	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	1.000	T
DALRD3	55152	genome.wustl.edu	37	3	49054878	49054878	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr3:49054878G>A	ENST00000341949.4	-	4	793	c.787C>T	c.(787-789)Cac>Tac	p.H263Y	DALRD3_ENST00000395462.4_Missense_Mutation_p.H96Y|DALRD3_ENST00000440857.1_Missense_Mutation_p.H96Y|MIR425_ENST00000362162.1_RNA|DALRD3_ENST00000496568.1_5'Flank|DALRD3_ENST00000441576.2_Missense_Mutation_p.H263Y|DALRD3_ENST00000313778.5_Missense_Mutation_p.H96Y	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	263					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)			breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AGGCCTGGGTGGCTGTCCTCG	0.542																																						dbGAP											0													56.0	59.0	58.0					3																	49054878		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.787C>T	3.37:g.49054878G>A	ENSP00000344989:p.His263Tyr		Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Missense_Mutation	SNP	pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,smart_DALR_anticod-bd	p.H263Y	ENST00000341949.4	37	c.787	CCDS33754.1	3	.	.	.	.	.	.	.	.	.	.	g	1.145	-0.648405	0.03506	.	.	ENSG00000178149	ENST00000441576;ENST00000341949;ENST00000395462;ENST00000440857;ENST00000313778;ENST00000420952	T;T;T;T;T;T	0.44482	0.95;0.98;0.98;0.92;0.98;0.98	4.82	-7.11	0.01542	.	1.766790	0.02559	N	0.096559	T	0.21631	0.0521	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.0	T	0.15780	-1.0425	10	0.09843	T	0.71	-0.1457	4.6599	0.12637	0.1151:0.2065:0.4739:0.2045	.	263;96;263;263	B7Z727;C9JJG6;Q5D0E6-2;Q5D0E6	.;.;.;DALD3_HUMAN	Y	263;263;96;96;96;228	ENSP00000410623:H263Y;ENSP00000344989:H263Y;ENSP00000378846:H96Y;ENSP00000403770:H96Y;ENSP00000323265:H96Y;ENSP00000397385:H228Y	ENSP00000323265:H96Y	H	-	1	0	DALRD3	49029882	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	-0.739000	0.04866	-1.271000	0.02430	-1.122000	0.02009	CAC	DALRD3	-	NULL	ENSG00000178149		0.542	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DALRD3	HGNC	protein_coding	OTTHUMT00000345581.1	36	0.00	0	G	NM_018114		49054878	49054878	-1	no_errors	ENST00000341949	ensembl	human	known	69_37n	missense	21	38.24	13	SNP	0.000	A
DCUN1D1	54165	genome.wustl.edu	37	3	182665361	182665361	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr3:182665361C>T	ENST00000292782.4	-	5	733	c.580G>A	c.(580-582)Gac>Aac	p.D194N	DCUN1D1_ENST00000469954.1_Missense_Mutation_p.D179N	NM_020640.2	NP_065691.2	Q96GG9	DCNL1_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 1	194	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.					ubiquitin ligase complex (GO:0000151)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;2.54e-44)|Epithelial(37;4.71e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			TTCCATAAGTCTAAGAATTTA	0.259																																						dbGAP											0													47.0	51.0	49.0					3																	182665361		2198	4274	6472	-	-	-	SO:0001583	missense	0			AF292100, AK056335	CCDS3240.1	3q26.3	2013-06-10	2013-06-10		ENSG00000043093	ENSG00000043093			18184	protein-coding gene	gene with protein product	"""squamous cell carcinoma related oncogene"""	605905	"""DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)"""			10777668, 15988528	Standard	NM_020640		Approved	RP42, SCRO, DCUN1L1, Tes3, SCCRO	uc003fld.1	Q96GG9	OTTHUMG00000158314	ENST00000292782.4:c.580G>A	3.37:g.182665361C>T	ENSP00000292782:p.Asp194Asn		B2RB37|Q7L3G9|Q8TEX7|Q9H6M1|Q9HCT3	Missense_Mutation	SNP	pfam_PONY_dom,superfamily_UBA-like	p.D194N	ENST00000292782.4	37	c.580	CCDS3240.1	3	.	.	.	.	.	.	.	.	.	.	C	20.8	4.051111	0.75960	.	.	ENSG00000043093	ENST00000292782;ENST00000458486;ENST00000469954	.	.	.	5.34	5.34	0.76211	Domain of unknown function DUF298 (2);	0.045217	0.85682	D	0.000000	T	0.71013	0.3290	M	0.76938	2.355	0.80722	D	1	B	0.09022	0.002	B	0.16722	0.016	T	0.69723	-0.5068	9	0.62326	D	0.03	-22.042	19.0578	0.93072	0.0:1.0:0.0:0.0	.	194	Q96GG9	DCNL1_HUMAN	N	194;154;179	.	ENSP00000292782:D194N	D	-	1	0	DCUN1D1	184148055	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.391000	0.79828	2.482000	0.83794	0.551000	0.68910	GAC	DCUN1D1	-	pfam_PONY_dom	ENSG00000043093		0.259	DCUN1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCUN1D1	HGNC	protein_coding	OTTHUMT00000350658.1	57	0.00	0	C	NM_020640		182665361	182665361	-1	no_errors	ENST00000292782	ensembl	human	known	69_37n	missense	51	22.39	15	SNP	1.000	T
DNAJA4	55466	genome.wustl.edu	37	15	78566657	78566657	+	Silent	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr15:78566657C>T	ENST00000394852.3	+	4	727	c.537C>T	c.(535-537)atC>atT	p.I179I	DNAJA4_ENST00000394855.3_Silent_p.I208I|DNAJA4_ENST00000343789.3_Silent_p.I179I|DNAJA4_ENST00000446172.2_Silent_p.I152I	NM_001130182.1	NP_001123654.1	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4	179					negative regulation of inclusion body assembly (GO:0090084)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	8						CCGTGTGCATCGAGTGCAAGG	0.617																																						dbGAP											0													78.0	65.0	70.0					15																	78566657		2196	4293	6489	-	-	-	SO:0001819	synonymous_variant	0			AF116663	CCDS10299.2, CCDS45316.1, CCDS45317.1	15q24.1	2011-09-02			ENSG00000140403	ENSG00000140403		"""Heat shock proteins / DNAJ (HSP40)"""	14885	protein-coding gene	gene with protein product						11147971	Standard	NM_018602		Approved	PRO1472	uc002bdi.3	Q8WW22	OTTHUMG00000143733	ENST00000394852.3:c.537C>T	15.37:g.78566657C>T			E9PDM9|Q6AW87|Q8N5Z4|Q8N7P2	Silent	SNP	pfam_DnaJ_N,pfam_DnaJ_C,pfam_HSP_DnaJ_Cys-rich_dom,superfamily_DnaJ_N,superfamily_HSP40/DnaJ_pept-bd,superfamily_HSP_DnaJ_Cys-rich_dom,smart_DnaJ_N,pfscan_DnaJ_N,pfscan_HSP_DnaJ_Cys-rich_dom,prints_Hsp_DnaJ	p.I208	ENST00000394852.3	37	c.624	CCDS45316.1	15																																																																																			DNAJA4	-	pfam_HSP_DnaJ_Cys-rich_dom,superfamily_HSP40/DnaJ_pept-bd,superfamily_HSP_DnaJ_Cys-rich_dom,pfscan_HSP_DnaJ_Cys-rich_dom	ENSG00000140403		0.617	DNAJA4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJA4	HGNC	protein_coding	OTTHUMT00000289801.1	26	0.00	0	C	NM_018602		78566657	78566657	+1	no_errors	ENST00000394855	ensembl	human	known	69_37n	silent	7	73.08	19	SNP	0.000	T
DXO	1797	genome.wustl.edu	37	6	31937797	31937797	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr6:31937797C>T	ENST00000375349.3	-	7	1459	c.1048G>A	c.(1048-1050)Gtt>Att	p.V350I	STK19_ENST00000375331.2_5'Flank|DXO_ENST00000375356.3_Missense_Mutation_p.V350I|DXO_ENST00000478221.1_5'UTR|DXO_ENST00000337523.5_Missense_Mutation_p.V350I|STK19_ENST00000375333.2_5'Flank			O77932	DXO_HUMAN	decapping exoribonuclease	350					metabolic process (GO:0008152)|mRNA catabolic process (GO:0006402)|nuclear mRNA surveillance (GO:0071028)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA destabilization (GO:0050779)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|magnesium ion binding (GO:0000287)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA pyrophosphohydrolase activity (GO:0034353)										AAGAGATGAACGAGCCTGGGG	0.592																																						dbGAP											0													38.0	43.0	41.0					6																	31937797		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF059252	CCDS4732.1	6p21.3	2013-09-11	2013-09-11	2013-09-11	ENSG00000204348	ENSG00000204348			2992	protein-coding gene	gene with protein product		605996	"""DOM-3 (C. elegans) homolog Z"", ""dom-3 homolog Z (C. elegans)"""	DOM3Z		9799600, 23523372	Standard	NM_005510		Approved		uc003nyp.1	O77932	OTTHUMG00000031272	ENST00000375349.3:c.1048G>A	6.37:g.31937797C>T	ENSP00000364498:p.Val350Ile		A2CER3|B0UZ80|O15004|O78127|O78128|Q5ST60|Q6IPZ2|Q9NPK4	Missense_Mutation	SNP	pfam_RAI1	p.V350I	ENST00000375349.3	37	c.1048	CCDS4732.1	6	.	.	.	.	.	.	.	.	.	.	C	11.38	1.621993	0.28889	.	.	ENSG00000204348	ENST00000337523;ENST00000375349;ENST00000375356	T;T;T	0.50277	0.75;0.75;0.75	5.69	3.92	0.45320	.	0.281343	0.33005	N	0.005384	T	0.26846	0.0657	L	0.58810	1.83	0.47511	D	0.999443	B	0.11235	0.004	B	0.08055	0.003	T	0.08289	-1.0729	10	0.36615	T	0.2	-6.2886	12.1688	0.54146	0.0:0.8739:0.0:0.1261	.	350	O77932	DOM3Z_HUMAN	I	350	ENSP00000337759:V350I;ENSP00000364498:V350I;ENSP00000364505:V350I	ENSP00000337759:V350I	V	-	1	0	DOM3Z	32045776	0.964000	0.33143	0.551000	0.28230	0.304000	0.27724	2.134000	0.42102	0.753000	0.32945	0.655000	0.94253	GTT	DOM3Z	-	NULL	ENSG00000204348		0.592	DXO-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	DOM3Z	HGNC	protein_coding	OTTHUMT00000076592.3	16	0.00	0	C			31937797	31937797	-1	no_errors	ENST00000337523	ensembl	human	known	69_37n	missense	13	59.38	19	SNP	0.996	T
DPYSL5	56896	genome.wustl.edu	37	2	27165483	27165483	+	Silent	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr2:27165483G>A	ENST00000288699.6	+	11	1463	c.1305G>A	c.(1303-1305)gtG>gtA	p.V435V	DPYSL5_ENST00000401478.1_Silent_p.V435V	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	435					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCCACGGCGTGCCACTGGTCA	0.632											OREG0014510	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													57.0	52.0	54.0					2																	27165483		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.1305G>A	2.37:g.27165483G>A		792	Q8TCL6|Q9NQC4|Q9NRY9	Silent	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.V435	ENST00000288699.6	37	c.1305	CCDS1730.1	2																																																																																			DPYSL5	-	superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000157851		0.632	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYSL5	HGNC	protein_coding	OTTHUMT00000214187.2	12	0.00	0	G	NM_020134		27165483	27165483	+1	no_errors	ENST00000288699	ensembl	human	known	69_37n	silent	15	50.00	15	SNP	0.754	A
EFEMP2	30008	genome.wustl.edu	37	11	65638053	65638053	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr11:65638053C>G	ENST00000307998.6	-	5	674	c.444G>C	c.(442-444)caG>caC	p.Q148H	EFEMP2_ENST00000532648.1_5'Flank|EFEMP2_ENST00000528176.1_Missense_Mutation_p.Q148H	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2	148	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)		GGCAGGTGCACTGATAGGAGC	0.627																																						dbGAP											0													93.0	78.0	83.0					11																	65638053		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638		"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""			10601734, 10982184	Standard	NR_037718		Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000307998.6:c.444G>C	11.37:g.65638053C>G	ENSP00000309953:p.Gln148His		A8K7R4|B3KM31|B3KQT1|O75967	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,superfamily_TIL_dom,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,prints_Thrombomodulin	p.Q148H	ENST00000307998.6	37	c.444	CCDS8116.1	11	.	.	.	.	.	.	.	.	.	.	C	10.83	1.460828	0.26248	.	.	ENSG00000172638	ENST00000528176;ENST00000307998;ENST00000526624;ENST00000527378	D;D;D;D	0.92446	-2.25;-3.04;-3.04;-3.04	5.3	1.26	0.21427	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.336618	0.22025	N	0.065677	T	0.76758	0.4032	N	0.11341	0.13	0.35632	D	0.810272	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.64326	-0.6434	10	0.13108	T	0.6	.	1.8714	0.03209	0.1457:0.4199:0.2586:0.1758	.	148;148	E9PRU1;O95967	.;FBLN4_HUMAN	H	148	ENSP00000434151:Q148H;ENSP00000309953:Q148H;ENSP00000435419:Q148H;ENSP00000435963:Q148H	ENSP00000309953:Q148H	Q	-	3	2	EFEMP2	65394629	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.577000	0.23758	0.824000	0.34613	0.561000	0.74099	CAG	EFEMP2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000172638		0.627	EFEMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFEMP2	HGNC	protein_coding	OTTHUMT00000391047.4	26	0.00	0	C	NM_016938		65638053	65638053	-1	no_errors	ENST00000307998	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	1.000	G
ENKUR	219670	genome.wustl.edu	37	10	25284628	25284628	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr10:25284628C>T	ENST00000331161.4	-	3	613	c.394G>A	c.(394-396)Gac>Aac	p.D132N	ENKUR_ENST00000376363.1_Missense_Mutation_p.D132N	NM_145010.3	NP_659447.1	Q8TC29	ENKUR_HUMAN	enkurin, TRPC channel interacting protein	132						motile cilium (GO:0031514)				endometrium(2)|large_intestine(4)|lung(3)|skin(1)	10						TCATGCTTGTCTCCAGTTCTT	0.328																																						dbGAP											0													162.0	158.0	159.0					10																	25284628		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095021	CCDS7146.1, CCDS73075.1	10p12.31	2014-08-13	2009-04-28	2009-04-28	ENSG00000151023	ENSG00000151023			28388	protein-coding gene	gene with protein product		611025	"""chromosome 10 open reading frame 63"""	C10orf63		17217053, 15385169	Standard	NM_145010		Approved	MGC26778, enkurin, CFAP106	uc001isg.2	Q8TC29	OTTHUMG00000017827	ENST00000331161.4:c.394G>A	10.37:g.25284628C>T	ENSP00000331044:p.Asp132Asn		A8K8Y0|D3DRV2	Missense_Mutation	SNP	NULL	p.D132N	ENST00000331161.4	37	c.394	CCDS7146.1	10	.	.	.	.	.	.	.	.	.	.	C	16.50	3.140641	0.56936	.	.	ENSG00000151023	ENST00000331161;ENST00000376363	.	.	.	5.77	4.86	0.63082	.	0.127967	0.64402	D	0.000001	T	0.52191	0.1719	L	0.41710	1.295	0.49389	D	0.999783	B;B	0.24092	0.097;0.097	B;B	0.17098	0.017;0.017	T	0.46205	-0.9208	9	0.33141	T	0.24	-14.7637	14.2745	0.66170	0.0:0.9278:0.0:0.0722	.	132;132	Q5VV23;Q8TC29	.;ENKUR_HUMAN	N	132	.	ENSP00000331044:D132N	D	-	1	0	ENKUR	25324634	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.631000	0.46502	2.885000	0.99019	0.655000	0.94253	GAC	ENKUR	-	NULL	ENSG00000151023		0.328	ENKUR-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENKUR	HGNC	protein_coding	OTTHUMT00000047239.2	90	0.00	0	C	NM_145010		25284628	25284628	-1	no_errors	ENST00000331161	ensembl	human	known	69_37n	missense	82	29.06	34	SNP	1.000	T
EPS8L2	64787	genome.wustl.edu	37	11	726965	726965	+	Frame_Shift_Del	DEL	G	G	-	rs140464832	byFrequency	TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr11:726965delG	ENST00000533256.1	+	22	2507	c.2132delG	c.(2131-2133)aggfs	p.R711fs	EPS8L2_ENST00000526198.1_Frame_Shift_Del_p.R727fs|AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000530636.1_Frame_Shift_Del_p.R711fs|EPS8L2_ENST00000534449.1_Intron|EPS8L2_ENST00000318562.8_Frame_Shift_Del_p.R711fs			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	711					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AATCAGAGGAGGGGGGAGGAC	0.537																																						dbGAP											0													32.0	31.0	31.0					11																	726965		2202	4300	6502	-	-	-	SO:0001589	frameshift_variant	0			AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.2132delG	11.37:g.726965delG	ENSP00000435585:p.Arg711fs		B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Frame_Shift_Del	DEL	pfam_PTB,pfam_SH3_domain,pfam_PTyr_interaction_dom,pfam_SH3_2,superfamily_SH3_domain,superfamily_SAM/pointed,smart_PTyr_interaction_dom,smart_SH3_domain,pfscan_PTyr_interaction_dom,pfscan_SH3_domain	p.E713fs	ENST00000533256.1	37	c.2132	CCDS31328.1	11																																																																																			EPS8L2	-	NULL	ENSG00000177106		0.537	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	EPS8L2	HGNC	protein_coding	OTTHUMT00000382344.1	26	0.00	0	G	NM_022772		726965	726965	+1	no_errors	ENST00000318562	ensembl	human	known	69_37n	frame_shift_del	6	60.00	12	DEL	0.028	-
ESCO2	157570	genome.wustl.edu	37	8	27634128	27634128	+	Silent	SNP	G	G	C	rs373491890		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr8:27634128G>C	ENST00000305188.8	+	3	541	c.303G>C	c.(301-303)ctG>ctC	p.L101L	ESCO2_ENST00000397418.2_5'UTR|RNU6-1276P_ENST00000365372.1_RNA|ESCO2_ENST00000523910.1_3'UTR	NM_001017420.2	NP_001017420.1	Q56NI9	ESCO2_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 2	101					chromosome segregation (GO:0007059)|double-strand break repair (GO:0006302)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|protein localization to chromatin (GO:0071168)|regulation of DNA replication (GO:0006275)	chromatin (GO:0000785)|chromocenter (GO:0010369)|Golgi apparatus (GO:0005794)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|XY body (GO:0001741)	lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|KIRC - Kidney renal clear cell carcinoma(542;0.0955)|Kidney(114;0.115)|Colorectal(74;0.132)		AGAGAAAGCTGATAAAAGAGA	0.378									SC Phocomelia syndrome																													dbGAP											0													58.0	57.0	58.0					8																	27634128		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	SC-Pseudothalidomide s., incl.: Roberts s.	AF306679	CCDS34872.1	8p21.1	2013-05-02	2013-05-02		ENSG00000171320	ENSG00000171320			27230	protein-coding gene	gene with protein product		609353	"""Roberts syndrome"", ""establishment of cohesion 1 homolog 2 (S. cerevisiae)"""	RBS		15958495, 16775838, 15821733, 16380922	Standard	XR_247122		Approved	EFO2	uc003xgg.3	Q56NI9	OTTHUMG00000163901	ENST00000305188.8:c.303G>C	8.37:g.27634128G>C			B3KW59|Q49AP4	Silent	SNP	NULL	p.L101	ENST00000305188.8	37	c.303	CCDS34872.1	8																																																																																			ESCO2	-	NULL	ENSG00000171320		0.378	ESCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESCO2	HGNC	protein_coding	OTTHUMT00000376276.1	54	0.00	0	G	NM_001017420		27634128	27634128	+1	no_errors	ENST00000305188	ensembl	human	known	69_37n	silent	11	81.36	48	SNP	0.993	C
ESPL1	9700	genome.wustl.edu	37	12	53676930	53676930	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr12:53676930A>G	ENST00000257934.4	+	15	2900	c.2809A>G	c.(2809-2811)Ata>Gta	p.I937V	ESPL1_ENST00000552462.1_Missense_Mutation_p.I937V	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	937					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						GACACCTGAGATAGCTCTCAT	0.517																																					Colon(53;1069 1201 2587 5382)	dbGAP											0													103.0	97.0	99.0					12																	53676930		2203	4300	6503	-	-	-	SO:0001583	missense	0			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.2809A>G	12.37:g.53676930A>G	ENSP00000257934:p.Ile937Val			Missense_Mutation	SNP	pfam_Peptidase_C50	p.I937V	ENST00000257934.4	37	c.2809	CCDS8852.1	12	.	.	.	.	.	.	.	.	.	.	A	6.393	0.440551	0.12104	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.11385	2.78;2.78	5.23	2.92	0.33932	.	0.256381	0.43416	N	0.000576	T	0.10252	0.0251	L	0.57536	1.79	0.19945	N	0.999949	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.30909	-0.9962	10	0.24483	T	0.36	.	6.8954	0.24253	0.7923:0.0:0.2077:0.0	.	148;937	B4DRU1;Q14674	.;ESPL1_HUMAN	V	937;612;937	ENSP00000257934:I937V;ENSP00000449831:I937V	ENSP00000257934:I937V	I	+	1	0	ESPL1	51963197	0.998000	0.40836	0.581000	0.28614	0.860000	0.49131	2.202000	0.42743	0.466000	0.27193	-0.256000	0.11100	ATA	ESPL1	-	NULL	ENSG00000135476		0.517	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	HGNC	protein_coding	OTTHUMT00000406899.2	64	0.00	0	A	NM_012291		53676930	53676930	+1	no_errors	ENST00000257934	ensembl	human	known	69_37n	missense	12	75.00	36	SNP	0.998	G
ESPNP	284729	genome.wustl.edu	37	1	17017759	17017759	+	RNA	SNP	G	G	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:17017759G>C	ENST00000492551.1	-	0	1968					NR_026567.1				espin pseudogene																		CTCCAGGCGGGCATGCTGGCC	0.667																																						dbGAP											0																																										-	-	-			0			AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17017759G>C				RNA	SNP	-	NULL	ENST00000492551.1	37	NULL		1																																																																																			ESPNP	-	-	ENSG00000116219		0.667	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	HGNC	pseudogene	OTTHUMT00000326311.1	31	0.00	0	G			17017759	17017759	-1	no_errors	ENST00000492551	ensembl	human	known	69_37n	rna	7	68.18	15	SNP	1.000	C
ETV3	2117	genome.wustl.edu	37	1	157095097	157095097	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:157095097C>T	ENST00000368192.4	-	5	1139	c.1075G>A	c.(1075-1077)Gtt>Att	p.V359I		NM_001145312.1	NP_001138784.1	P41162	ETV3_HUMAN	ets variant 3	359					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	9	Hepatocellular(266;0.158)	Prostate(1639;0.174)				CTGCTCTCAACCCTCTCCCGG	0.567																																						dbGAP											0													44.0	43.0	43.0					1																	157095097		692	1591	2283	-	-	-	SO:0001583	missense	0			BC022868	CCDS1164.1, CCDS44250.1	1q21-q23	2008-09-12	2008-09-12		ENSG00000117036	ENSG00000117036			3492	protein-coding gene	gene with protein product		164873	"""ets variant gene 3, ETS family transcriptional repressor"", ""ets variant gene 3"""			8020980	Standard	NM_005240		Approved	PE-1	uc001fqr.2	P41162	OTTHUMG00000034298	ENST00000368192.4:c.1075G>A	1.37:g.157095097C>T	ENSP00000357175:p.Val359Ile		B4E3M7|Q8TAC8|Q9BX30	Missense_Mutation	SNP	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.V359I	ENST00000368192.4	37	c.1075	CCDS44250.1	1	.	.	.	.	.	.	.	.	.	.	C	9.516	1.107013	0.20714	.	.	ENSG00000117036	ENST00000368192	T	0.37752	1.18	4.11	3.16	0.36331	.	0.222920	0.22757	N	0.056005	T	0.10165	0.0249	L	0.29908	0.895	0.25419	N	0.988284	B	0.14012	0.009	B	0.15484	0.013	T	0.24440	-1.0160	10	0.17832	T	0.49	.	11.8288	0.52282	0.0:0.5161:0.4839:0.0	.	359	P41162	ETV3_HUMAN	I	359	ENSP00000357175:V359I	ENSP00000357175:V359I	V	-	1	0	ETV3	155361721	0.908000	0.30866	0.658000	0.29665	0.835000	0.47333	3.021000	0.49651	1.281000	0.44480	0.561000	0.74099	GTT	ETV3	-	NULL	ENSG00000117036		0.567	ETV3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV3	HGNC	protein_coding	OTTHUMT00000082843.2	29	0.00	0	C	NM_005240		157095097	157095097	-1	no_errors	ENST00000368192	ensembl	human	known	69_37n	missense	32	31.91	15	SNP	0.351	T
EVC2	132884	genome.wustl.edu	37	4	5624640	5624640	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr4:5624640G>A	ENST00000344408.5	-	14	2178	c.2125C>T	c.(2125-2127)Cag>Tag	p.Q709*	EVC2_ENST00000344938.1_Nonsense_Mutation_p.Q709*|EVC2_ENST00000310917.2_Nonsense_Mutation_p.Q629*	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	709					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						CTCCTCTTCTGGTGCAGGTAC	0.627																																						dbGAP											0													60.0	60.0	60.0					4																	5624640		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.2125C>T	4.37:g.5624640G>A	ENSP00000342144:p.Gln709*		Q86YT3|Q86YT4|Q8NG49	Nonsense_Mutation	SNP	pfam_EVC2-like	p.Q709*	ENST00000344408.5	37	c.2125	CCDS3382.2	4	.	.	.	.	.	.	.	.	.	.	G	42	9.727661	0.99249	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	.	.	.	5.12	4.26	0.50523	.	0.209202	0.39341	N	0.001389	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-18.5229	7.6228	0.28195	0.0828:0.0:0.7521:0.1651	.	.	.	.	X	709;629;709	.	ENSP00000311683:Q629X	Q	-	1	0	EVC2	5675541	0.968000	0.33430	0.467000	0.27180	0.004000	0.04260	3.593000	0.54001	1.110000	0.41699	0.462000	0.41574	CAG	EVC2	-	NULL	ENSG00000173040		0.627	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	HGNC	protein_coding	OTTHUMT00000289822.2	17	0.00	0	G	NM_147127		5624640	5624640	-1	no_errors	ENST00000344408	ensembl	human	known	69_37n	nonsense	7	36.36	4	SNP	0.838	A
F5	2153	genome.wustl.edu	37	1	169498986	169498986	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:169498986C>G	ENST00000367797.3	-	16	5480	c.5279G>C	c.(5278-5280)aGc>aCc	p.S1760T	F5_ENST00000367796.3_Missense_Mutation_p.S1765T	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1760	F5/8 type A 3.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	AGGCATGTTGCTGTCCTTATG	0.388																																						dbGAP											0													156.0	150.0	152.0					1																	169498986		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.5279G>C	1.37:g.169498986C>G	ENSP00000356771:p.Ser1760Thr		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.S1765T	ENST00000367797.3	37	c.5294	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	C	9.460	1.092897	0.20471	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.98567	-5.0;-5.0	5.32	4.4	0.53042	Cupredoxin (2);	0.306075	0.33916	N	0.004432	D	0.92247	0.7541	L	0.47016	1.485	0.20307	N	0.999917	B	0.19706	0.038	B	0.14023	0.01	D	0.87095	0.2175	9	0.20046	T	0.44	-7.5039	7.7502	0.28892	0.0:0.7124:0.1752:0.1124	.	1760	P12259	FA5_HUMAN	T	1760;1765	ENSP00000356771:S1760T;ENSP00000356770:S1765T	ENSP00000356770:S1765T	S	-	2	0	F5	167765610	0.006000	0.16342	0.953000	0.39169	0.982000	0.71751	0.091000	0.15046	1.210000	0.43336	0.557000	0.71058	AGC	F5	-	superfamily_Cupredoxin	ENSG00000198734		0.388	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	70	0.00	0	C	NM_000130		169498986	169498986	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	missense	117	14.60	20	SNP	0.991	G
FAM65A	79567	genome.wustl.edu	37	16	67580080	67580080	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr16:67580080C>T	ENST00000379312.3	+	21	3641	c.3520C>T	c.(3520-3522)Caa>Taa	p.Q1174*	FAM65A_ENST00000042381.4_Nonsense_Mutation_p.Q1170*|FAM65A_ENST00000540839.3_Nonsense_Mutation_p.Q1189*|FAM65A_ENST00000422602.2_Nonsense_Mutation_p.Q1190*|FAM65A_ENST00000428437.2_Nonsense_Mutation_p.Q1184*	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	1174						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		GTACCTCTGCCAAACTGACAC	0.612																																						dbGAP											0													61.0	62.0	61.0					16																	67580080		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.3520C>T	16.37:g.67580080C>T	ENSP00000368614:p.Gln1174*		B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Nonsense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_HR1_rho-bd	p.Q1190*	ENST00000379312.3	37	c.3568	CCDS54028.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	39|39	7.527307|7.527307	0.98339|0.98339	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000428437|ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	.|.	.|.	.|.	5.15|5.15	5.15|5.15	0.70609|0.70609	.|.	.|0.111281	.|0.64402	.|D	.|0.000005	T|.	0.75860|.	0.3907|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.78507|.	-0.2177|.	4|.	.|0.66056	.|D	.|0.02	-10.3924|-10.3924	16.1378|16.1378	0.81497|0.81497	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	L|X	1163|1174;1170;1190;1184	.|.	.|ENSP00000042381:Q1170X	P|Q	+|+	2|1	0|0	FAM65A|FAM65A	66137581|66137581	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.955000|0.955000	0.61496|0.61496	6.566000|6.566000	0.73978|0.73978	2.573000|2.573000	0.86826|0.86826	0.561000|0.561000	0.74099|0.74099	CCA|CAA	FAM65A	-	superfamily_ARM-type_fold	ENSG00000039523		0.612	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM65A	HGNC	protein_coding	OTTHUMT00000268866.3	29	0.00	0	C	NM_024519		67580080	67580080	+1	no_errors	ENST00000422602	ensembl	human	known	69_37n	nonsense	14	26.32	5	SNP	1.000	T
FAM65C	140876	genome.wustl.edu	37	20	49208921	49208921	+	Missense_Mutation	SNP	C	C	G	rs200503235	byFrequency	TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr20:49208921C>G	ENST00000327979.2	-	19	2936	c.2525G>C	c.(2524-2526)cGc>cCc	p.R842P	FAM65C_ENST00000535356.1_Missense_Mutation_p.R846P|FAM65C_ENST00000045083.2_Missense_Mutation_p.R842P|FAM65C_ENST00000462842.1_5'Flank			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	842										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ACCAGCCAGGCGAGCGCTGGC	0.652																																						dbGAP											0													38.0	42.0	41.0					20																	49208921		2019	4152	6171	-	-	-	SO:0001583	missense	0			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.2525G>C	20.37:g.49208921C>G	ENSP00000332663:p.Arg842Pro		Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_Chemokine_IL8-like_dom	p.R846P	ENST00000327979.2	37	c.2537	CCDS13431.2	20	.	.	.	.	.	.	.	.	.	.	C	11.24	1.580878	0.28180	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.78364	-1.17;-1.17;-1.17	4.81	3.85	0.44370	.	0.367740	0.23849	U	0.043977	T	0.76485	0.3994	M	0.63428	1.95	0.21386	N	0.999709	P;P	0.51537	0.5;0.946	B;P	0.47162	0.373;0.54	T	0.67268	-0.5713	10	0.38643	T	0.18	-16.7304	10.1179	0.42603	0.1548:0.696:0.1492:0.0	.	846;842	F5H0X2;Q96MK2	.;FA65C_HUMAN	P	842;842;846	ENSP00000332663:R842P;ENSP00000045083:R842P;ENSP00000439802:R846P	ENSP00000045083:R842P	R	-	2	0	FAM65C	48642328	0.993000	0.37304	0.602000	0.28890	0.107000	0.19398	1.569000	0.36428	0.988000	0.38734	0.462000	0.41574	CGC	FAM65C	-	superfamily_ARM-type_fold	ENSG00000042062		0.652	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM65C	HGNC	protein_coding	OTTHUMT00000257962.1	14	0.00	0	C			49208921	49208921	-1	no_errors	ENST00000535356	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	0.440	G
FAM65C	140876	genome.wustl.edu	37	20	49236530	49236530	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr20:49236530C>G	ENST00000327979.2	-	3	661	c.250G>C	c.(250-252)Ggc>Cgc	p.G84R	FAM65C_ENST00000535356.1_Missense_Mutation_p.G88R|FAM65C_ENST00000045083.2_Missense_Mutation_p.G84R			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	84										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TACTTGAGGCCTCTTTTCAAT	0.552																																						dbGAP											0													84.0	77.0	79.0					20																	49236530		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.250G>C	20.37:g.49236530C>G	ENSP00000332663:p.Gly84Arg		Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_Chemokine_IL8-like_dom	p.G88R	ENST00000327979.2	37	c.262	CCDS13431.2	20	.	.	.	.	.	.	.	.	.	.	C	21.4	4.142211	0.77775	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.02737	4.18;4.18;4.18	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.16428	0.0395	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00391	-1.1769	10	0.87932	D	0	-29.2877	14.4585	0.67433	0.0:1.0:0.0:0.0	.	88;84	F5H0X2;Q96MK2	.;FA65C_HUMAN	R	84;84;88	ENSP00000332663:G84R;ENSP00000045083:G84R;ENSP00000439802:G88R	ENSP00000045083:G84R	G	-	1	0	FAM65C	48669937	1.000000	0.71417	0.991000	0.47740	0.948000	0.59901	4.799000	0.62517	2.142000	0.66516	0.561000	0.74099	GGC	FAM65C	-	superfamily_Chemokine_IL8-like_dom	ENSG00000042062		0.552	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM65C	HGNC	protein_coding	OTTHUMT00000257962.1	36	0.00	0	C			49236530	49236530	-1	no_errors	ENST00000535356	ensembl	human	known	69_37n	missense	29	48.28	28	SNP	1.000	G
FASN	2194	genome.wustl.edu	37	17	80041432	80041432	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr17:80041432C>T	ENST00000306749.2	-	31	5520	c.5302G>A	c.(5302-5304)Gaa>Aaa	p.E1768K	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1768	Enoyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	TTGCCAATTTCCAGGAAGCGA	0.637																																					Colon(59;314 1043 11189 28578 32273)	dbGAP											0													52.0	50.0	51.0					17																	80041432		2199	4297	6496	-	-	-	SO:0001583	missense	0			U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.5302G>A	17.37:g.80041432C>T	ENSP00000304592:p.Glu1768Lys		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	pfam_Acyl_transferase,pfam_Ketoacyl_synth_N,pfam_Thioesterase,pfam_PKS_KR,pfam_DH_sc/Rdtase_SDR,pfam_Ketoacyl_synth_C,pfam_ADH_C,pfam_Acyl_carrier_prot-like,pfam_Methyltransf_12,pfam_Methyltransf_11,superfamily_Thiolase-like,superfamily_Acyl_Trfase/lysoPLipase,superfamily_GroES-like,superfamily_Acyl_carrier_prot-like,superfamily_Malonyl_transacylase_ACP-bd,smart_PKS_Beta-ketoAc_synthase_dom,smart_PKS_acyl_transferase,smart_PKS_dehydratase,smart_PKS_ER,smart_PKS/FAS_KR,smart_PKS_PP-bd,pfscan_Acyl_carrier_prot-like	p.E1768K	ENST00000306749.2	37	c.5302	CCDS11801.1	17	.	.	.	.	.	.	.	.	.	.	C	23.3	4.404666	0.83230	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.04360	3.64	4.77	4.77	0.60923	Alcohol dehydrogenase, C-terminal (1);Polyketide synthase, enoylreductase (1);NAD(P)-binding domain (1);	0.113843	0.64402	D	0.000017	T	0.38904	0.1058	H	0.98612	4.28	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.65689	-0.6107	10	0.87932	D	0	-24.1375	17.7642	0.88473	0.0:1.0:0.0:0.0	.	1768	P49327	FAS_HUMAN	K	1768;733	ENSP00000304592:E1768K	ENSP00000304592:E1768K	E	-	1	0	FASN	77634721	1.000000	0.71417	0.940000	0.37924	0.209000	0.24338	7.542000	0.82095	2.170000	0.68504	0.561000	0.74099	GAA	FASN	-	pfam_ADH_C,smart_PKS_ER	ENSG00000169710		0.637	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASN	HGNC	protein_coding	OTTHUMT00000442369.1	17	0.00	0	C	NM_004104		80041432	80041432	-1	no_errors	ENST00000306749	ensembl	human	known	69_37n	missense	33	43.10	25	SNP	1.000	T
FBXW7	55294	genome.wustl.edu	37	4	153247168	153247168	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr4:153247168T>C	ENST00000281708.4	-	10	2863	c.1634A>G	c.(1633-1635)tAt>tGt	p.Y545C	FBXW7_ENST00000603548.1_Missense_Mutation_p.Y545C|FBXW7_ENST00000603841.1_Missense_Mutation_p.Y545C|FBXW7_ENST00000263981.5_Missense_Mutation_p.Y465C|FBXW7_ENST00000393956.3_Missense_Mutation_p.Y369C|FBXW7_ENST00000296555.5_Missense_Mutation_p.Y427C	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	545					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.Y545C(3)|p.Y306C(1)|p.Y427C(1)|p.Y465C(1)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CTGTAATGAATAGACTCTATT	0.403			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	dbGAP		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	7	Substitution - Missense(6)|Unknown(1)	endometrium(5)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)											150.0	147.0	148.0					4																	153247168		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1634A>G	4.37:g.153247168T>C	ENSP00000281708:p.Tyr545Cys		B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y545C	ENST00000281708.4	37	c.1634	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	T	21.9	4.211124	0.79240	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.72	5.72	0.89469	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.60314	0.2259	L	0.49256	1.55	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.62609	-0.6818	10	0.87932	D	0	-20.3253	16.2962	0.82776	0.0:0.0:0.0:1.0	.	369;545;427;465	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	C	545;427;465;369	ENSP00000281708:Y545C;ENSP00000296555:Y427C;ENSP00000263981:Y465C;ENSP00000377528:Y369C	ENSP00000263981:Y465C	Y	-	2	0	FBXW7	153466618	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.997000	0.88414	2.304000	0.77564	0.528000	0.53228	TAT	FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000109670		0.403	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	62	0.00	0	T			153247168	153247168	-1	no_errors	ENST00000281708	ensembl	human	known	69_37n	missense	8	73.33	22	SNP	1.000	C
FER	2241	genome.wustl.edu	37	5	108516525	108516525	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr5:108516525A>G	ENST00000281092.4	+	18	2510	c.2126A>G	c.(2125-2127)gAg>gGg	p.E709G	FER_ENST00000438717.2_Missense_Mutation_p.E534G	NM_005246.2	NP_005237.2	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase	709	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|cell proliferation (GO:0008283)|cell-cell adhesion mediated by cadherin (GO:0044331)|cellular response to insulin stimulus (GO:0032869)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to reactive oxygen species (GO:0034614)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|diapedesis (GO:0050904)|extracellular matrix-cell signaling (GO:0035426)|Fc-epsilon receptor signaling pathway (GO:0038095)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular signal transduction (GO:0035556)|Kit signaling pathway (GO:0038109)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of mast cell activation involved in immune response (GO:0033007)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of fibroblast migration (GO:0010762)|regulation of lamellipodium assembly (GO:0010591)|regulation of protein phosphorylation (GO:0001932)|response to lipopolysaccharide (GO:0032496)|response to platelet-derived growth factor (GO:0036119)|substrate adhesion-dependent cell spreading (GO:0034446)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(2)|biliary_tract(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	32		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		TCTCGTCAAGAGGATGGTGGA	0.403																																					Colon(146;1051 1799 9836 27344 47401)	dbGAP											0													125.0	117.0	120.0					5																	108516525		2202	4300	6502	-	-	-	SO:0001583	missense	0			J03358	CCDS4098.1	5q21	2013-02-14	2008-02-07		ENSG00000151422	ENSG00000151422	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	3655	protein-coding gene	gene with protein product	"""phosphoprotein NCP94"", ""protein phosphatase 1, regulatory subunit 74"""	176942					Standard	NM_005246		Approved	TYK3, PPP1R74	uc003kop.1	P16591	OTTHUMG00000128751	ENST00000281092.4:c.2126A>G	5.37:g.108516525A>G	ENSP00000281092:p.Glu709Gly		B2RCR4|B4DSQ2|H2FLB8	Missense_Mutation	SNP	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_FCH,superfamily_Kinase-like_dom,smart_FCH,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FCH,pfscan_SH2,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.E709G	ENST00000281092.4	37	c.2126	CCDS4098.1	5	.	.	.	.	.	.	.	.	.	.	A	25.8	4.677546	0.88445	.	.	ENSG00000151422	ENST00000281092;ENST00000438717	D;D	0.82526	-1.62;-1.62	5.35	5.35	0.76521	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85150	0.5631	N	0.25094	0.71	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.86801	0.1992	10	0.54805	T	0.06	-18.654	15.3694	0.74551	1.0:0.0:0.0:0.0	.	709	P16591	FER_HUMAN	G	709;534	ENSP00000281092:E709G;ENSP00000394297:E534G	ENSP00000281092:E709G	E	+	2	0	FER	108544424	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.335000	0.96500	2.024000	0.59613	0.528000	0.53228	GAG	FER	-	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000151422		0.403	FER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER	HGNC	protein_coding	OTTHUMT00000250664.1	61	0.00	0	A	NM_005246		108516525	108516525	+1	no_errors	ENST00000281092	ensembl	human	known	69_37n	missense	33	43.10	25	SNP	1.000	G
FKBP15	23307	genome.wustl.edu	37	9	115931533	115931533	+	Silent	SNP	G	G	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr9:115931533G>C	ENST00000238256.3	-	26	3573	c.3456C>G	c.(3454-3456)ctC>ctG	p.L1152L		NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	1152					endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						GGCTGGGTCTGAGGGCTGCTC	0.547																																						dbGAP											0													69.0	74.0	73.0					9																	115931533		2124	4241	6365	-	-	-	SO:0001819	synonymous_variant	0			AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.3456C>G	9.37:g.115931533G>C			Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	Silent	SNP	pfam_PPIase_FKBP_dom,superfamily_Regulat_G_prot_signal_superfam,pfscan_PPIase_FKBP_dom	p.L1152	ENST00000238256.3	37	c.3456	CCDS48007.1	9																																																																																			FKBP15	-	NULL	ENSG00000119321		0.547	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP15	HGNC	protein_coding		62	0.00	0	G	NM_015258		115931533	115931533	-1	no_errors	ENST00000238256	ensembl	human	known	69_37n	silent	38	44.12	30	SNP	0.000	C
FRG1	2483	genome.wustl.edu	37	4	190873403	190873403	+	Missense_Mutation	SNP	G	G	A	rs200624002		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr4:190873403G>A	ENST00000226798.4	+	3	442	c.220G>A	c.(220-222)Gac>Aac	p.D74N	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	74					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		ACATGCACTCGACAATGGTCT	0.398																																						dbGAP											0													93.0	107.0	102.0					4																	190873403		2202	4297	6499	-	-	-	SO:0001583	missense	0			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.220G>A	4.37:g.190873403G>A	ENSP00000226798:p.Asp74Asn		A8K775	Missense_Mutation	SNP	pfam_FRG1,pfam_Fascin-domain,superfamily_Actin_cross-linking	p.D74N	ENST00000226798.4	37	c.220	CCDS34121.1	4	.	.	.	.	.	.	.	.	.	.	.	18.08	3.544963	0.65198	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.63417	1.87;-0.04	3.47	3.47	0.39725	Actin cross-linking (1);	0.000000	0.85682	D	0.000000	T	0.66587	0.2804	M	0.82823	2.61	0.80722	D	1	B	0.28512	0.214	B	0.34138	0.176	T	0.70784	-0.4778	10	0.46703	T	0.11	3.0E-4	13.3129	0.60390	0.0:0.0:1.0:0.0	.	74	Q14331	FRG1_HUMAN	N	74;11	ENSP00000226798:D74N;ENSP00000435943:D11N	ENSP00000226798:D74N	D	+	1	0	FRG1	191110397	1.000000	0.71417	0.995000	0.50966	0.969000	0.65631	9.012000	0.93624	2.238000	0.73509	0.539000	0.68188	GAC	FRG1	-	pfam_FRG1,pfam_Fascin-domain,superfamily_Actin_cross-linking	ENSG00000109536		0.398	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	FRG1	HGNC	protein_coding	OTTHUMT00000359622.4	38	0.00	0	G	NM_004477		190873403	190873403	+1	no_errors	ENST00000226798	ensembl	human	known	69_37n	missense	5	58.33	7	SNP	1.000	A
FRMPD2	143162	genome.wustl.edu	37	10	49386172	49386172	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr10:49386172G>A	ENST00000374201.3	-	22	3115	c.2813C>T	c.(2812-2814)cCa>cTa	p.P938L	FRMPD2_ENST00000305531.3_Missense_Mutation_p.P913L|FRMPD2_ENST00000463706.1_5'UTR|FRMPD2_ENST00000474573.1_5'Flank|FRMPD2_ENST00000407470.4_Missense_Mutation_p.P906L	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	938					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		TGGAGGTGATGGAGGACAAGA	0.423																																						dbGAP											0													2.0	2.0	2.0					10																	49386172		1783	3695	5478	-	-	-	SO:0001583	missense	0			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2813C>T	10.37:g.49386172G>A	ENSP00000363317:p.Pro938Leu		B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.P938L	ENST00000374201.3	37	c.2813	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	G	1.087	-0.665180	0.03428	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.37411	1.2;1.2;1.2	4.72	1.9	0.25705	PDZ/DHR/GLGF (1);	.	.	.	.	T	0.19406	0.0466	N	0.14661	0.345	0.09310	N	1	B;B;B	0.10296	0.0;0.003;0.0	B;B;B	0.15484	0.005;0.013;0.005	T	0.20207	-1.0282	9	0.40728	T	0.16	.	4.824	0.13407	0.2431:0.0:0.6077:0.1492	.	913;938;906	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	L	938;913;906	ENSP00000363317:P938L;ENSP00000307079:P913L;ENSP00000384339:P906L	ENSP00000307079:P913L	P	-	2	0	FRMPD2	49056178	0.526000	0.26298	0.005000	0.12908	0.001000	0.01503	1.148000	0.31614	0.239000	0.21243	-0.808000	0.03180	CCA	FRMPD2	-	superfamily_PDZ	ENSG00000170324		0.423	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	64	0.00	0	G	NM_152428		49386172	49386172	-1	no_errors	ENST00000374201	ensembl	human	known	69_37n	missense	29	44.23	23	SNP	0.001	A
GANAB	23193	genome.wustl.edu	37	11	62402465	62402465	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr11:62402465C>A	ENST00000356638.3	-	5	404	c.388G>T	c.(388-390)Gtc>Ttc	p.V130F	GANAB_ENST00000534779.1_Missense_Mutation_p.V16F|GANAB_ENST00000540933.1_Missense_Mutation_p.V33F|GANAB_ENST00000346178.4_Missense_Mutation_p.V130F|GANAB_ENST00000534422.1_5'UTR	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	130					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	CGACCAGAGACAGAAAGCCTG	0.463																																					Melanoma(23;1005 1074 15747 18937)	dbGAP											0													106.0	99.0	101.0					11																	62402465		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.388G>T	11.37:g.62402465C>A	ENSP00000349053:p.Val130Phe		A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd	p.V130F	ENST00000356638.3	37	c.388	CCDS8026.1	11	.	.	.	.	.	.	.	.	.	.	C	9.425	1.084027	0.20309	.	.	ENSG00000089597	ENST00000346178;ENST00000356638;ENST00000534779;ENST00000540933;ENST00000525994	D;D;D;D;T	0.89270	-2.15;-2.15;-2.49;-2.15;1.28	5.25	0.129	0.14739	Glycoside hydrolase-type carbohydrate-binding (1);	0.788490	0.11787	N	0.529628	D	0.86012	0.5831	L	0.61036	1.89	0.32782	N	0.502295	B;B;B;B	0.33135	0.399;0.399;0.005;0.019	B;B;B;B	0.37508	0.252;0.252;0.009;0.03	T	0.79524	-0.1768	10	0.24483	T	0.36	-10.1679	9.1638	0.37038	0.0:0.6125:0.0:0.3875	.	16;16;130;130	B4DIW2;E9PKU7;Q14697;Q14697-2	.;.;GANAB_HUMAN;.	F	130;130;16;33;16	ENSP00000340466:V130F;ENSP00000349053:V130F;ENSP00000435306:V16F;ENSP00000442962:V33F;ENSP00000434805:V16F	ENSP00000340466:V130F	V	-	1	0	GANAB	62159041	0.000000	0.05858	0.656000	0.29637	0.963000	0.63663	-0.412000	0.07132	-0.111000	0.12001	-0.140000	0.14226	GTC	GANAB	-	superfamily_Glyco_hydro-type_carb-bd	ENSG00000089597		0.463	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GANAB	HGNC	protein_coding	OTTHUMT00000395689.1	28	0.00	0	C	NM_198334		62402465	62402465	-1	no_errors	ENST00000346178	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	0.150	A
GCC1	79571	genome.wustl.edu	37	7	127222558	127222558	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr7:127222558G>A	ENST00000321407.2	-	2	2262	c.1838C>T	c.(1837-1839)tCt>tTt	p.S613F	GCC1_ENST00000497650.1_5'Flank	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	613					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						TGGCAGCCCAGAGGCCAAGGC	0.592																																						dbGAP											0													70.0	69.0	69.0					7																	127222558		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.1838C>T	7.37:g.127222558G>A	ENSP00000318821:p.Ser613Phe		Q9H6N7	Missense_Mutation	SNP	pfam_GRIP,superfamily_ARM-type_fold,smart_GRIP,pfscan_GRIP	p.S613F	ENST00000321407.2	37	c.1838	CCDS5796.1	7	.	.	.	.	.	.	.	.	.	.	G	11.52	1.662867	0.29515	.	.	ENSG00000179562	ENST00000321407	T	0.13420	2.59	5.24	3.4	0.38934	.	0.429791	0.24776	N	0.035683	T	0.13072	0.0317	L	0.46157	1.445	0.09310	N	1	B	0.23540	0.087	B	0.25614	0.062	T	0.22034	-1.0228	10	0.21014	T	0.42	-0.4673	12.3573	0.55182	0.0:0.3258:0.6742:0.0	.	613	Q96CN9	GCC1_HUMAN	F	613	ENSP00000318821:S613F	ENSP00000318821:S613F	S	-	2	0	GCC1	127009794	0.968000	0.33430	0.039000	0.18376	0.981000	0.71138	4.399000	0.59703	0.665000	0.31066	0.655000	0.94253	TCT	GCC1	-	NULL	ENSG00000179562		0.592	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC1	HGNC	protein_coding	OTTHUMT00000059911.3	29	0.00	0	G	NM_024523		127222558	127222558	-1	no_errors	ENST00000321407	ensembl	human	known	69_37n	missense	60	24.05	19	SNP	0.128	A
GJA5	2702	genome.wustl.edu	37	1	147230581	147230581	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:147230581C>T	ENST00000271348.2	-	2	927	c.766G>A	c.(766-768)Ggc>Agc	p.G256S	RP11-433J22.2_ENST00000428911.1_RNA|GJA5_ENST00000369237.1_Missense_Mutation_p.G256S	NM_005266.5	NP_005257.2	P36382	CXA5_HUMAN	gap junction protein, alpha 5, 40kDa	256					angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|atrial cardiac muscle cell action potential (GO:0086014)|atrial septum development (GO:0003283)|AV node cell to bundle of His cell communication by electrical coupling (GO:0086053)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|gap junction assembly (GO:0016264)|mitral valve development (GO:0003174)|outflow tract morphogenesis (GO:0003151)|pulmonary valve formation (GO:0003193)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|transmembrane transport (GO:0055085)|ventricular septum development (GO:0003281)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)	gap junction channel activity involved in AV node cell-bundle of His cell electrical coupling (GO:0086077)|gap junction channel activity involved in cardiac conduction electrical coupling (GO:0086075)|gap junction hemi-channel activity (GO:0055077)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	20	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			TGGACTATGCCCACAGAGGGG	0.547																																						dbGAP											0													65.0	70.0	69.0					1																	147230581		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS929.1	1q21.1	2008-02-05	2007-01-16		ENSG00000143140	ENSG00000265107		"""Ion channels / Gap junction proteins (connexins)"""	4279	protein-coding gene	gene with protein product	"""connexin 40"""	121013	"""gap junction protein, alpha 5, 40kD (connexin 40)"", ""gap junction protein, alpha 5, 40kDa (connexin 40)"""				Standard	NM_005266		Approved	CX40	uc001eps.1	P36382	OTTHUMG00000014020	ENST00000271348.2:c.766G>A	1.37:g.147230581C>T	ENSP00000271348:p.Gly256Ser		Q5T3B6|Q5U0N6	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin40	p.G256S	ENST00000271348.2	37	c.766	CCDS929.1	1	.	.	.	.	.	.	.	.	.	.	C	0.357	-0.941714	0.02322	.	.	ENSG00000143140	ENST00000271348;ENST00000369237	D;D	0.81996	-1.56;-1.56	5.68	1.7	0.24286	.	2.547360	0.01189	N	0.007267	T	0.49029	0.1533	N	0.13043	0.29	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40905	-0.9538	10	0.15952	T	0.53	.	9.0284	0.36243	0.0:0.6865:0.1113:0.2022	.	256	P36382	CXA5_HUMAN	S	256	ENSP00000271348:G256S;ENSP00000358240:G256S	ENSP00000271348:G256S	G	-	1	0	GJA5	145697205	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	-0.027000	0.12371	0.059000	0.16252	-1.305000	0.01319	GGC	GJA5	-	NULL	ENSG00000143140		0.547	GJA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA5	HGNC	protein_coding	OTTHUMT00000039422.2	56	0.00	0	C	NM_181703		147230581	147230581	-1	no_errors	ENST00000271348	ensembl	human	known	69_37n	missense	167	13.92	27	SNP	0.004	T
GPR142	350383	genome.wustl.edu	37	17	72368470	72368470	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr17:72368470G>T	ENST00000335666.4	+	4	1168	c.1120G>T	c.(1120-1122)Gtc>Ttc	p.V374F		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	374						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						GGCGCCCCGGGTCTTCGTCAT	0.657																																						dbGAP											0													114.0	97.0	103.0					17																	72368470		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.1120G>T	17.37:g.72368470G>T	ENSP00000335158:p.Val374Phe		A4CYJ8|Q86SL3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.V374F	ENST00000335666.4	37	c.1120	CCDS11698.1	17	.	.	.	.	.	.	.	.	.	.	G	9.101	1.004051	0.19199	.	.	ENSG00000257008	ENST00000335666	T	0.35421	1.31	4.62	2.4	0.29515	GPCR, rhodopsin-like superfamily (1);	0.403658	0.28307	N	0.015822	T	0.27663	0.0680	N	0.08118	0	0.09310	N	1	P;P	0.52692	0.837;0.955	P;P	0.54210	0.531;0.745	T	0.08472	-1.0720	10	0.51188	T	0.08	-9.0679	8.5993	0.33734	0.8396:0.0:0.1604:0.0	.	374;1336	Q7Z601;Q8NGB0	GP142_HUMAN;.	F	374	ENSP00000335158:V374F	ENSP00000335158:V374F	V	+	1	0	GPR142	69880065	0.336000	0.24757	0.001000	0.08648	0.910000	0.53928	4.199000	0.58426	0.379000	0.24794	-0.378000	0.06908	GTC	GPR142	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000257008		0.657	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR142	HGNC	protein_coding	OTTHUMT00000442545.1	31	0.00	0	G	NM_181790		72368470	72368470	+1	no_errors	ENST00000335666	ensembl	human	known	69_37n	missense	41	14.58	7	SNP	0.068	T
GPRIN2	9721	genome.wustl.edu	37	10	46998995	46998995	+	Missense_Mutation	SNP	C	C	G	rs4926045	byFrequency	TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr10:46998995C>G	ENST00000374317.1	+	3	388	c.115C>G	c.(115-117)Ctc>Gtc	p.L39V	GPRIN2_ENST00000374314.4_Missense_Mutation_p.L39V	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	39			L -> V (in dbSNP:rs4926045).							breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						GAGGCCAGAGCTCCGCAAGAC	0.711																																						dbGAP											0													33.0	43.0	40.0					10																	46998995		2202	4297	6499	-	-	-	SO:0001583	missense	0			BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.115C>G	10.37:g.46998995C>G	ENSP00000363436:p.Leu39Val		Q5SVF0	Missense_Mutation	SNP	NULL	p.L39V	ENST00000374317.1	37	c.115	CCDS31192.1	10	1012	0.4633699633699634	185	0.37601626016260165	176	0.4861878453038674	282	0.493006993006993	369	0.4868073878627968	C	13.49	2.252220	0.39797	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.07444	3.19;3.19	5.44	4.53	0.55603	.	0.364802	0.20240	N	0.096305	T	0.00012	0.0000	M	0.69823	2.125	0.29865	N	0.827312	P	0.46277	0.875	P	0.47376	0.545	T	0.38757	-0.9646	10	0.66056	D	0.02	-16.6038	10.5533	0.45101	0.0:0.9103:0.0:0.0897	rs4926045	39	O60269	GRIN2_HUMAN	V	39	ENSP00000363436:L39V;ENSP00000363433:L39V	ENSP00000363433:L39V	L	+	1	0	GPRIN2	46419001	1.000000	0.71417	0.734000	0.30879	0.281000	0.26958	1.663000	0.37429	1.447000	0.47661	0.655000	0.94253	CTC	GPRIN2	-	NULL	ENSG00000204175		0.711	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN2	HGNC	protein_coding	OTTHUMT00000047836.1	8	0.00	0	C	NM_014696		46998995	46998995	+1	no_errors	ENST00000374314	ensembl	human	known	69_37n	missense	8	33.33	4	SNP	0.989	G
GPRIN2	9721	genome.wustl.edu	37	10	46999030	46999030	+	Silent	SNP	C	C	T	rs4925989	byFrequency	TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr10:46999030C>T	ENST00000374317.1	+	3	423	c.150C>T	c.(148-150)gcC>gcT	p.A50A	GPRIN2_ENST00000374314.4_Silent_p.A50A	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	50										breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						TGTGGCAGGCCCAGCTGGGCG	0.697																																						dbGAP											0													29.0	37.0	35.0					10																	46999030		2199	4292	6491	-	-	-	SO:0001819	synonymous_variant	0			BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.150C>T	10.37:g.46999030C>T			Q5SVF0	Silent	SNP	NULL	p.A50	ENST00000374317.1	37	c.150	CCDS31192.1	10																																																																																			GPRIN2	-	NULL	ENSG00000204175		0.697	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN2	HGNC	protein_coding	OTTHUMT00000047836.1	8	0.00	0	C	NM_014696		46999030	46999030	+1	no_errors	ENST00000374314	ensembl	human	known	69_37n	silent	10	28.57	4	SNP	0.872	T
HCFC1	3054	genome.wustl.edu	37	X	153225483	153225483	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chrX:153225483G>T	ENST00000310441.7	-	8	2180	c.1214C>A	c.(1213-1215)aCg>aAg	p.T405K	HCFC1_ENST00000461098.1_5'UTR|HCFC1_ENST00000369984.4_Missense_Mutation_p.T405K|HCFC1_ENST00000354233.3_Intron	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	405	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGTAGCAGCCGTGGCAGGAAT	0.632																																						dbGAP											0													58.0	71.0	67.0					X																	153225483		2052	4170	6222	-	-	-	SO:0001583	missense	0				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.1214C>A	X.37:g.153225483G>T	ENSP00000309555:p.Thr405Lys		Q6P4G5	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.T405K	ENST00000310441.7	37	c.1214	CCDS44020.1	X	.	.	.	.	.	.	.	.	.	.	G	20.9	4.071698	0.76301	.	.	ENSG00000172534	ENST00000310441;ENST00000369984	T;T	0.64991	-0.13;-0.13	4.86	3.98	0.46160	Fibronectin, type III (1);Kelch-type beta propeller (1);	0.115504	0.64402	D	0.000016	T	0.60945	0.2308	N	0.14661	0.345	0.80722	D	1	D	0.63880	0.993	D	0.71184	0.972	T	0.62609	-0.6818	10	0.51188	T	0.08	.	9.7482	0.40459	0.0:0.2045:0.7955:0.0	.	405	P51610	HCFC1_HUMAN	K	405	ENSP00000309555:T405K;ENSP00000359001:T405K	ENSP00000309555:T405K	T	-	2	0	HCFC1	152878677	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	2.763000	0.47605	1.005000	0.39183	0.600000	0.82982	ACG	HCFC1	-	smart_Fibronectin_type3	ENSG00000172534		0.632	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC1	HGNC	protein_coding	OTTHUMT00000061099.4	73	0.00	0	G	NM_005334		153225483	153225483	-1	no_errors	ENST00000310441	ensembl	human	known	69_37n	missense	15	65.91	29	SNP	1.000	T
HCN3	57657	genome.wustl.edu	37	1	155255534	155255534	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:155255534G>C	ENST00000368358.3	+	6	1264	c.1256G>C	c.(1255-1257)tGt>tCt	p.C419S	HCN3_ENST00000496230.1_3'UTR	NM_020897.2	NP_065948.1	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 3	419					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			AACTTCACCTGTCGGGGCCTG	0.622																																						dbGAP											0													39.0	38.0	38.0					1																	155255534		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040968	CCDS1108.1	1q21.2	2011-07-05			ENSG00000143630	ENSG00000143630		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	19183	protein-coding gene	gene with protein product		609973				16382102	Standard	NM_020897		Approved	KIAA1535	uc001fjz.2	Q9P1Z3	OTTHUMG00000035872	ENST00000368358.3:c.1256G>C	1.37:g.155255534G>C	ENSP00000357342:p.Cys419Ser		D3DV90|Q4VX12|Q8N6W6|Q9BWQ2	Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_Ion_trans_dom,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.C419S	ENST00000368358.3	37	c.1256	CCDS1108.1	1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.652196	0.88056	.	.	ENSG00000143630	ENST00000368358	D	0.96587	-4.06	5.35	5.35	0.76521	Cyclic nucleotide-binding-like (1);	0.000000	0.56097	D	0.000028	D	0.97723	0.9253	M	0.84585	2.705	0.80722	D	1	D;P	0.89917	1.0;0.951	D;P	0.85130	0.997;0.872	D	0.96834	0.9613	10	0.19590	T	0.45	.	16.9185	0.86157	0.0:0.0:1.0:0.0	.	114;419	B7Z5R8;Q9P1Z3	.;HCN3_HUMAN	S	419	ENSP00000357342:C419S	ENSP00000357342:C419S	C	+	2	0	HCN3	153522158	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.807000	0.99171	2.667000	0.90743	0.561000	0.74099	TGT	HCN3	-	superfamily_cNMP-bd-like	ENSG00000143630		0.622	HCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN3	HGNC	protein_coding	OTTHUMT00000087388.1	17	0.00	0	G	NM_020897		155255534	155255534	+1	no_errors	ENST00000368358	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	1.000	C
IDE	3416	genome.wustl.edu	37	10	94274755	94274755	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr10:94274755C>G	ENST00000265986.6	-	5	762	c.706G>C	c.(706-708)Gat>Cat	p.D236H		NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	236					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	TGTCTTACATCAATGCCTTCT	0.358																																						dbGAP											0													186.0	192.0	190.0					10																	94274755		2203	4300	6503	-	-	-	SO:0001583	missense	0			M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.706G>C	10.37:g.94274755C>G	ENSP00000265986:p.Asp236His		B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	p.D236H	ENST00000265986.6	37	c.706	CCDS7421.1	10	.	.	.	.	.	.	.	.	.	.	C	28.3	4.909985	0.92107	.	.	ENSG00000119912	ENST00000265986;ENST00000436178	T	0.38077	1.16	6.06	6.06	0.98353	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.61400	0.2344	M	0.77616	2.38	0.80722	D	1	D	0.63046	0.992	P	0.59889	0.865	T	0.62746	-0.6789	10	0.87932	D	0	-23.897	20.6208	0.99490	0.0:1.0:0.0:0.0	.	236	P14735	IDE_HUMAN	H	236;222	ENSP00000265986:D236H	ENSP00000265986:D236H	D	-	1	0	IDE	94264735	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.768000	0.85345	2.882000	0.98803	0.655000	0.94253	GAT	IDE	-	superfamily_Metalloenz_metal-bd	ENSG00000119912		0.358	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDE	HGNC	protein_coding	OTTHUMT00000049393.1	75	0.00	0	C	NM_004969		94274755	94274755	-1	no_errors	ENST00000265986	ensembl	human	known	69_37n	missense	45	47.06	40	SNP	1.000	G
HSPA12A	259217	genome.wustl.edu	37	10	118439100	118439100	+	Silent	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr10:118439100C>T	ENST00000369209.3	-	10	1304	c.1200G>A	c.(1198-1200)ccG>ccA	p.P400P		NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	400						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		TGATGTTCAGCGGGTTAGTTC	0.512																																						dbGAP											0													124.0	124.0	124.0					10																	118439100		1950	4139	6089	-	-	-	SO:0001819	synonymous_variant	0			AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.1200G>A	10.37:g.118439100C>T				Silent	SNP	NULL	p.P400	ENST00000369209.3	37	c.1200	CCDS41569.1	10																																																																																			HSPA12A	-	NULL	ENSG00000165868		0.512	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA12A	HGNC	protein_coding	OTTHUMT00000050530.1	61	0.00	0	C	NM_025015		118439100	118439100	-1	no_errors	ENST00000369209	ensembl	human	known	69_37n	silent	35	53.95	41	SNP	0.001	T
IDS	3423	genome.wustl.edu	37	X	148568514	148568514	+	Silent	SNP	G	G	A	rs113993948		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chrX:148568514G>A	ENST00000340855.6	-	8	1331	c.1122C>T	c.(1120-1122)ggC>ggT	p.G374G	IDS_ENST00000541269.1_Silent_p.G163G|IDS_ENST00000490775.1_5'Flank|IDS_ENST00000537071.1_Intron|IDS_ENST00000422081.2_Silent_p.G163G	NM_000202.5|NM_001166550.1	NP_000193.1|NP_001160022.1	P22304	IDS_HUMAN	iduronate 2-sulfatase	374					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	lysosomal lumen (GO:0043202)	iduronate-2-sulfatase activity (GO:0004423)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(5)|large_intestine(2)|lung(8)|prostate(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					AAAGCTTCTCGCCTGCCTCCG	0.453																																						dbGAP											0													86.0	78.0	81.0					X																	148568514		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M58342	CCDS14685.1, CCDS14686.1	Xq27.3-q28	2012-10-02	2008-08-01		ENSG00000010404	ENSG00000010404	3.1.6.13		5389	protein-coding gene	gene with protein product	"""Hunter syndrome"""	300823		SIDS			Standard	NM_006123		Approved		uc011mxe.2	P22304	OTTHUMG00000022615	ENST00000340855.6:c.1122C>T	X.37:g.148568514G>A			D3DWT4|Q14604|Q9BRM3	Silent	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.G374	ENST00000340855.6	37	c.1122	CCDS14685.1	X																																																																																			IDS	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000010404		0.453	IDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDS	HGNC	protein_coding	OTTHUMT00000058677.3	31	0.00	0	G			148568514	148568514	-1	no_errors	ENST00000340855	ensembl	human	known	69_37n	silent	8	70.37	19	SNP	0.000	A
IFI30	10437	genome.wustl.edu	37	19	18286477	18286477	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr19:18286477G>C	ENST00000407280.3	+	4	628	c.453G>C	c.(451-453)gaG>gaC	p.E151D	PIK3R2_ENST00000593731.1_3'UTR	NM_006332.3	NP_006323.2	P13284	GILT_HUMAN	interferon, gamma-inducible protein 30	151					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of fibroblast proliferation (GO:0048147)|protein stabilization (GO:0050821)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	oxidoreductase activity, acting on a sulfur group of donors (GO:0016667)			endometrium(1)|kidney(2)|large_intestine(1)|stomach(1)	5						GCATGGAAGAGTTTGAGGACA	0.572																																						dbGAP											0													42.0	43.0	43.0					19																	18286477		2022	4196	6218	-	-	-	SO:0001583	missense	0			J03909	CCDS46015.1	19p13.1	2008-07-16				ENSG00000216490			5398	protein-coding gene	gene with protein product	"""gamma-interferon-inducible lysosomal thiol reductase"", ""interferon gamma-inducible protein 30 preproprotein"""	604664				3136170, 10639150	Standard	NM_006332		Approved	IFI-30, GILT, IP30, MGC32056	uc002nic.1	P13284		ENST00000407280.3:c.453G>C	19.37:g.18286477G>C	ENSP00000384886:p.Glu151Asp		Q76MF9|Q8NEI4|Q8WU77|Q9UL08	Missense_Mutation	SNP	pfam_Interferon-induced_GILT	p.E151D	ENST00000407280.3	37	c.453	CCDS46015.1	19	.	.	.	.	.	.	.	.	.	.	G	2.141	-0.396882	0.04899	.	.	ENSG00000216490	ENST00000407280	.	.	.	4.4	2.26	0.28386	.	.	.	.	.	T	0.39226	0.1070	L	0.34521	1.04	0.09310	N	1	D	0.64830	0.994	P	0.61592	0.891	T	0.14476	-1.0471	8	0.29301	T	0.29	-12.7198	6.3561	0.21402	0.3411:0.0:0.6589:0.0	.	151	P13284	GILT_HUMAN	D	151	.	ENSP00000384886:E151D	E	+	3	2	IFI30	18147477	0.611000	0.26992	0.214000	0.23707	0.005000	0.04900	0.855000	0.27805	0.466000	0.27193	0.561000	0.74099	GAG	IFI30	-	pfam_Interferon-induced_GILT	ENSG00000216490		0.572	IFI30-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IFI30	HGNC	protein_coding	OTTHUMT00000466396.3	24	0.00	0	G	NM_006332		18286477	18286477	+1	no_errors	ENST00000407280	ensembl	human	known	69_37n	missense	21	40.54	15	SNP	0.002	C
IGKV1D-42	28892	genome.wustl.edu	37	2	90229346	90229346	+	RNA	SNP	G	G	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr2:90229346G>C	ENST00000390278.2	+	0	186									immunoglobulin kappa variable 1D-42 (non-functional)																		CAGTAATTTAGCCTGGTATCT	0.488																																						dbGAP											0													83.0	87.0	86.0					2																	90229346		1896	4126	6022	-	-	-			0			X72816		2p11.2	2012-02-08	2008-09-09		ENSG00000211633	ENSG00000211633		"""Immunoglobulins / IGK locus"""	5757	other	immunoglobulin gene			"""immunoglobulin kappa variable 1D-42"""				Standard	NG_000833		Approved				OTTHUMG00000151573		2.37:g.90229346G>C				Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.A56P	ENST00000390278.2	37	c.166		2																																																																																			IGKV1D-42	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211633		0.488	IGKV1D-42-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV1D-42	HGNC	IG_V_gene	OTTHUMT00000323148.1	63	0.00	0	G	NG_000833		90229346	90229346	+1	no_stop_codon	ENST00000390278	ensembl	human	known	69_37n	missense	46	36.11	26	SNP	0.060	C
IGSF8	93185	genome.wustl.edu	37	1	160063683	160063683	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:160063683C>G	ENST00000368086.1	-	3	937	c.721G>C	c.(721-723)Ggg>Cgg	p.G241R	IGSF8_ENST00000314485.7_Missense_Mutation_p.G241R|IGSF8_ENST00000460351.1_5'UTR			Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	241	Ig-like C2-type 2.				cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|nervous system development (GO:0007399)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.G241R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(19)|pancreas(1)|prostate(1)|skin(1)	33	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CGAAGCTCCCCTGCAGCCAAT	0.642																																						dbGAP											1	Substitution - Missense(1)	lung(1)											71.0	63.0	66.0					1																	160063683		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF407274	CCDS1195.1	1q23.1	2013-01-11			ENSG00000162729	ENSG00000162729		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17813	protein-coding gene	gene with protein product		606644				11504738, 11673522	Standard	NM_001206665		Approved	CD81P3, EWI2, PGRL, CD316	uc009wtf.3	Q969P0	OTTHUMG00000024075	ENST00000368086.1:c.721G>C	1.37:g.160063683C>G	ENSP00000357065:p.Gly241Arg		Q8NG09|Q96DP4|Q9BTG9	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.G241R	ENST00000368086.1	37	c.721	CCDS1195.1	1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490759	0.64074	.	.	ENSG00000162729	ENST00000314485;ENST00000368086;ENST00000358475;ENST00000448417	T;T;T	0.25749	1.78;1.78;1.78	3.74	3.74	0.42951	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	T	0.19248	0.0462	M	0.64997	1.995	0.58432	D	0.999996	D	0.56521	0.976	P	0.45538	0.484	T	0.03473	-1.1033	10	0.62326	D	0.03	-20.9236	11.4872	0.50361	0.0:0.8162:0.1838:0.0	.	241	Q969P0	IGSF8_HUMAN	R	241	ENSP00000316664:G241R;ENSP00000357065:G241R;ENSP00000397464:G241R	ENSP00000316664:G241R	G	-	1	0	IGSF8	158330307	0.999000	0.42202	0.971000	0.41717	0.952000	0.60782	5.354000	0.66040	2.100000	0.63781	0.491000	0.48974	GGG	IGSF8	-	smart_Ig_sub	ENSG00000162729		0.642	IGSF8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF8	HGNC	protein_coding	OTTHUMT00000060636.1	30	0.00	0	C	NM_052868		160063683	160063683	-1	no_errors	ENST00000314485	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	0.990	G
IL27	246778	genome.wustl.edu	37	16	28515309	28515309	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr16:28515309G>T	ENST00000356897.1	-	2	116	c.94C>A	c.(94-96)Ccc>Acc	p.P32T		NM_145659.3	NP_663634.2	Q8TAD2	IL17D_HUMAN	interleukin 27	0					inflammatory response (GO:0006954)	extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	10						CTCCCTGGGGGCCTTGGGAAT	0.642																																						dbGAP											0													34.0	38.0	37.0					16																	28515309		2197	4300	6497	-	-	-	SO:0001583	missense	0			AY099296	CCDS10633.1	16p11	2011-07-21	2003-12-17	2003-12-19	ENSG00000197272	ENSG00000197272		"""Interleukins and interleukin receptors"""	19157	protein-coding gene	gene with protein product		608273	"""interleukin 30"""	IL30		12121660	Standard	NM_145659		Approved	IL-27, p28, IL27p28, IL-27A, IL27A, MGC71873	uc002dqc.3	Q8NEV9	OTTHUMG00000097023	ENST00000356897.1:c.94C>A	16.37:g.28515309G>T	ENSP00000349365:p.Pro32Thr		B1AM69	Missense_Mutation	SNP	superfamily_4_helix_cytokine-like_core	p.P32T	ENST00000356897.1	37	c.94	CCDS10633.1	16	.	.	.	.	.	.	.	.	.	.	G	14.80	2.643238	0.47153	.	.	ENSG00000197272	ENST00000356897	T	0.34472	1.36	4.38	0.971	0.19698	.	0.496409	0.17036	N	0.189513	T	0.19644	0.0472	N	0.24115	0.695	0.20764	N	0.999853	B	0.23937	0.094	B	0.24155	0.051	T	0.16158	-1.0412	10	0.59425	D	0.04	-5.6991	2.2792	0.04110	0.1127:0.2027:0.4936:0.1911	.	32	Q8NEV9	IL27A_HUMAN	T	32	ENSP00000349365:P32T	ENSP00000349365:P32T	P	-	1	0	IL27	28422810	0.877000	0.30153	0.673000	0.29887	0.935000	0.57460	0.787000	0.26858	0.282000	0.22254	-0.266000	0.10368	CCC	IL27	-	NULL	ENSG00000197272		0.642	IL27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL27	HGNC	protein_coding	OTTHUMT00000214114.1	24	0.00	0	G	NM_145659		28515309	28515309	-1	no_errors	ENST00000356897	ensembl	human	known	69_37n	missense	10	52.38	11	SNP	0.664	T
ITIH1	3697	genome.wustl.edu	37	3	52822258	52822258	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr3:52822258C>A	ENST00000273283.2	+	18	2040	c.2016C>A	c.(2014-2016)gaC>gaA	p.D672E	ITIH1_ENST00000542827.1_Splice_Site_p.P627T|ITIH1_ENST00000537050.1_Missense_Mutation_p.D384E|ITIH1_ENST00000405128.3_Missense_Mutation_p.D38E|ITIH1_ENST00000540715.1_Missense_Mutation_p.D530E	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	672	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		TGGACACAGACCCTCACTTCA	0.572																																						dbGAP											0													114.0	93.0	100.0					3																	52822258		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.2016C>A	3.37:g.52822258C>A	ENSP00000273283:p.Asp672Glu		A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,superfamily_PsdUridine_synth_cat_dom,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.D672E	ENST00000273283.2	37	c.2016	CCDS2864.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.83|18.83	3.707275|3.707275	0.68615|0.68615	.|.	.|.	ENSG00000055957|ENSG00000055957	ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133;ENST00000405128|ENST00000542827	T;T;T;T;T|T	0.34859|0.02345	3.85;3.82;3.54;3.14;1.34|4.33	5.39|5.39	-1.39|-1.39	0.08997|0.08997	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.12263|0.12263	0.0298|0.0298	M|M	0.89353|0.89353	3.025|3.025	0.35154|0.35154	D|D	0.770087|0.770087	D;D;P;D|.	0.89917|.	0.994;1.0;0.911;1.0|.	P;D;P;D|.	0.91635|.	0.88;0.999;0.609;0.999|.	T|T	0.12372|0.12372	-1.0550|-1.0550	10|7	0.59425|0.87932	D|D	0.04|0	-36.6614|-36.6614	10.8426|10.8426	0.46724|0.46724	0.0:0.2813:0.0:0.7187|0.0:0.2813:0.0:0.7187	.|.	530;38;273;672|.	F5H165;B5MCP1;Q9P1C5;P19827|.	.;.;.;ITIH1_HUMAN|.	E|T	672;530;384;225;38|627	ENSP00000273283:D672E;ENSP00000443973:D530E;ENSP00000443847:D384E;ENSP00000395836:D225E;ENSP00000384589:D38E|ENSP00000442584:P627T	ENSP00000273283:D672E|ENSP00000442584:P627T	D|P	+|+	3|1	2|0	ITIH1|ITIH1	52797298|52797298	0.746000|0.746000	0.28272|0.28272	0.978000|0.978000	0.43139|0.43139	0.829000|0.829000	0.46940|0.46940	-0.191000|-0.191000	0.09601|0.09601	-0.364000|-0.364000	0.08088|0.08088	-0.126000|-0.126000	0.14955|0.14955	GAC|CCC	ITIH1	-	NULL	ENSG00000055957		0.572	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH1	HGNC	protein_coding	OTTHUMT00000317522.1	59	0.00	0	C	NM_002215		52822258	52822258	+1	no_errors	ENST00000273283	ensembl	human	known	69_37n	missense	45	40.00	30	SNP	0.973	A
ITIH5	80760	genome.wustl.edu	37	10	7618855	7618855	+	Silent	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr10:7618855G>T	ENST00000256861.6	-	10	1617	c.1539C>A	c.(1537-1539)atC>atA	p.I513I	ITIH5_ENST00000397146.2_Silent_p.I513I|ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000298441.6_Silent_p.I299I|ITIH5_ENST00000446830.2_Silent_p.I295I|ITIH5_ENST00000397145.2_Silent_p.I513I	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	513					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TCCCCGCAATGATGATCTCCG	0.567																																						dbGAP											0													76.0	72.0	73.0					10																	7618855		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1539C>A	10.37:g.7618855G>T			Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.I513	ENST00000256861.6	37	c.1539		10																																																																																			ITIH5	-	NULL	ENSG00000123243		0.567	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	HGNC	protein_coding	OTTHUMT00000046688.1	51	0.00	0	G	NM_030569		7618855	7618855	-1	no_errors	ENST00000256861	ensembl	human	known	69_37n	silent	32	44.83	26	SNP	0.892	T
ITPR2	3709	genome.wustl.edu	37	12	26877590	26877590	+	Splice_Site	SNP	T	T	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr12:26877590T>A	ENST00000381340.3	-	4	781	c.365A>T	c.(364-366)cAa>cTa	p.Q122L	ITPR2_ENST00000242737.5_Splice_Site_p.Q122L	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	122	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	AATACTTACTTGTATAACATT	0.338																																						dbGAP											0													107.0	93.0	98.0					12																	26877590		1816	4081	5897	-	-	-	SO:0001630	splice_region_variant	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.366+1A>T	12.37:g.26877590T>A			O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.Q122L	ENST00000381340.3	37	c.365	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	T	25.6	4.659538	0.88154	.	.	ENSG00000123104	ENST00000381340;ENST00000242737	D;D	0.91631	-2.88;-2.88	4.86	4.86	0.63082	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);MIR motif (2);MIR (1);	0.057811	0.64402	D	0.000001	D	0.96062	0.8717	M	0.85777	2.775	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.80764	0.994;0.916	D	0.96247	0.9180	10	0.52906	T	0.07	.	14.6525	0.68808	0.0:0.0:0.0:1.0	.	122;122	Q14571-2;Q14571	.;ITPR2_HUMAN	L	122	ENSP00000370744:Q122L;ENSP00000242737:Q122L	ENSP00000242737:Q122L	Q	-	2	0	ITPR2	26768857	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.636000	0.83301	2.043000	0.60533	0.482000	0.46254	CAA	ITPR2	-	pfam_Ins145_P3_rcpt,superfamily_MIR,smart_MIR_motif,pfscan_MIR_motif	ENSG00000123104		0.338	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	169	0.00	0	T	NM_002223	Missense_Mutation	26877590	26877590	-1	no_errors	ENST00000381340	ensembl	human	known	69_37n	missense	48	60.98	75	SNP	1.000	A
JAKMIP1	152789	genome.wustl.edu	37	4	6055709	6055709	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr4:6055709A>C	ENST00000282924.5	-	13	2359	c.1874T>G	c.(1873-1875)tTc>tGc	p.F625C	JAKMIP1_ENST00000409831.1_Missense_Mutation_p.F625C|JAKMIP1_ENST00000409021.3_Intron|JAKMIP1_ENST00000409371.3_Intron|JAKMIP1_ENST00000410077.2_Missense_Mutation_p.F460C	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	625	Mediates interaction with TYK2 and GABBR1.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GCTTTACATGAATTTCAGTTT	0.348																																						dbGAP											0													164.0	163.0	163.0					4																	6055709		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.1874T>G	4.37:g.6055709A>C	ENSP00000282924:p.Phe625Cys		A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	NULL	p.F625C	ENST00000282924.5	37	c.1874	CCDS3385.1	4	.	.	.	.	.	.	.	.	.	.	A	12.14	1.849123	0.32699	.	.	ENSG00000152969	ENST00000429819;ENST00000282924;ENST00000409831;ENST00000410077	T;T;T	0.33438	1.84;1.84;1.41	5.51	5.51	0.81932	.	0.418959	0.22584	N	0.058166	T	0.27765	0.0683	N	0.03608	-0.345	0.31406	N	0.676082	D;D	0.55605	0.972;0.972	P;P	0.57468	0.821;0.821	T	0.38222	-0.9671	10	0.87932	D	0	.	13.398	0.60865	1.0:0.0:0.0:0.0	.	460;625	B4DHZ8;Q96N16	.;JKIP1_HUMAN	C	517;625;625;460	ENSP00000282924:F625C;ENSP00000386925:F625C;ENSP00000386745:F460C	ENSP00000282924:F625C	F	-	2	0	JAKMIP1	6106610	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	0.958000	0.29227	2.097000	0.63578	0.533000	0.62120	TTC	JAKMIP1	-	NULL	ENSG00000152969		0.348	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP1	HGNC	protein_coding	OTTHUMT00000246816.2	103	0.00	0	A	NM_144720		6055709	6055709	-1	no_errors	ENST00000282924	ensembl	human	known	69_37n	missense	49	43.02	37	SNP	1.000	C
KCNV1	27012	genome.wustl.edu	37	8	110980364	110980364	+	Missense_Mutation	SNP	C	C	T	rs267601723		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr8:110980364C>T	ENST00000524391.1	-	4	2488	c.1456G>A	c.(1456-1458)Gaa>Aaa	p.E486K	KCNV1_ENST00000297404.1_Missense_Mutation_p.E486K			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	486					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			CTTGCTCTTTCTCTGCCTTTC	0.373																																						dbGAP											0													78.0	74.0	76.0					8																	110980364		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.1456G>A	8.37:g.110980364C>T	ENSP00000435954:p.Glu486Lys		Q9UHJ4	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv8,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv4	p.E486K	ENST00000524391.1	37	c.1456	CCDS6314.1	8	.	.	.	.	.	.	.	.	.	.	C	31	5.078662	0.94050	.	.	ENSG00000164794	ENST00000524391;ENST00000297404;ENST00000545728	D;D	0.97553	-4.43;-4.43	5.52	5.52	0.82312	.	0.176234	0.48767	D	0.000169	D	0.96901	0.8988	N	0.24115	0.695	0.80722	D	1	D	0.63880	0.993	D	0.68192	0.956	D	0.97900	1.0302	10	0.59425	D	0.04	.	18.4284	0.90617	0.0:1.0:0.0:0.0	.	486	Q6PIU1	KCNV1_HUMAN	K	486;486;362	ENSP00000435954:E486K;ENSP00000297404:E486K	ENSP00000297404:E486K	E	-	1	0	KCNV1	111049540	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.316000	0.65815	2.573000	0.86826	0.563000	0.77884	GAA	KCNV1	-	NULL	ENSG00000164794		0.373	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNV1	HGNC	protein_coding	OTTHUMT00000385525.1	59	0.00	0	C	NM_014379		110980364	110980364	-1	no_errors	ENST00000297404	ensembl	human	known	69_37n	missense	123	16.89	25	SNP	1.000	T
KCNQ3	3786	genome.wustl.edu	37	8	133182580	133182580	+	Splice_Site	SNP	C	C	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr8:133182580C>A	ENST00000388996.4	-	8	1656		c.e8+1		KCNQ3_ENST00000519445.1_Splice_Site|KCNQ3_ENST00000521134.1_Splice_Site	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3						axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TCCCCACTTGCCTGAAGAAAG	0.537																																						dbGAP											0													56.0	53.0	54.0					8																	133182580		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1235+1G>T	8.37:g.133182580C>A			A2VCT8|B4DJY4|E7EQ89	Splice_Site	SNP	-	e8+1	ENST00000388996.4	37	c.1235+1	CCDS34943.1	8	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733208	0.89482	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0679	0.93119	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KCNQ3	133251762	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	7.223000	0.78033	2.752000	0.94435	0.467000	0.42956	.	KCNQ3	-	-	ENSG00000184156		0.537	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ3	HGNC	protein_coding	OTTHUMT00000268621.2	19	0.00	0	C	NM_004519	Intron	133182580	133182580	-1	no_errors	ENST00000388996	ensembl	human	known	69_37n	splice_site	26	29.73	11	SNP	1.000	A
KIAA0368	23392	genome.wustl.edu	37	9	114176865	114176865	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr9:114176865C>A	ENST00000338205.5	-	18	2050	c.1831G>T	c.(1831-1833)Gct>Tct	p.A611S	RNA5SP294_ENST00000411306.1_RNA|KIAA0368_ENST00000259335.4_Missense_Mutation_p.A789S			Q5VYK3	ECM29_HUMAN	KIAA0368	617					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						TGCATATCAGCCAAACTCTGA	0.542																																						dbGAP											0													124.0	117.0	119.0					9																	114176865		1969	4155	6124	-	-	-	SO:0001583	missense	0			AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.1831G>T	9.37:g.114176865C>A	ENSP00000339889:p.Ala611Ser		O15074|Q8WU82	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A789S	ENST00000338205.5	37	c.2365		9	.	.	.	.	.	.	.	.	.	.	C	10.73	1.431747	0.25813	.	.	ENSG00000136813	ENST00000338205;ENST00000259335;ENST00000543827	T	0.64085	-0.08	5.27	4.31	0.51392	Armadillo-like helical (1);Armadillo-type fold (1);	0.331184	0.32488	N	0.006026	T	0.53433	0.1796	L	0.51422	1.61	0.80722	D	1	B;B	0.14012	0.002;0.009	B;B	0.10450	0.002;0.005	T	0.49143	-0.8970	10	0.09084	T	0.74	-16.8443	15.6661	0.77230	0.0:0.8628:0.1372:0.0	.	617;86	Q5VYK3;B3KXF2	ECM29_HUMAN;.	S	611;789;86	ENSP00000259335:A789S	ENSP00000259335:A789S	A	-	1	0	KIAA0368	113216686	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.650000	0.46665	2.622000	0.88805	0.555000	0.69702	GCT	KIAA0368	-	superfamily_ARM-type_fold	ENSG00000136813		0.542	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	KIAA0368	HGNC	protein_coding	OTTHUMT00000053637.2	39	0.00	0	C	NM_014686		114176865	114176865	-1	no_errors	ENST00000259335	ensembl	human	known	69_37n	missense	22	40.54	15	SNP	1.000	A
KIAA0907	22889	genome.wustl.edu	37	1	155899583	155899583	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:155899583G>C	ENST00000368321.3	-	3	327	c.304C>G	c.(304-306)Ctg>Gtg	p.L102V	KIAA0907_ENST00000368319.3_Missense_Mutation_p.L102V|KIAA0907_ENST00000368320.3_Missense_Mutation_p.L102V|KIAA0907_ENST00000482337.1_5'UTR	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	102							RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			GCTACCACCAGGTCATCCTTG	0.413																																						dbGAP											0													160.0	144.0	149.0					1																	155899583		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.304C>G	1.37:g.155899583G>C	ENSP00000357304:p.Leu102Val		O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Missense_Mutation	SNP	NULL	p.L102V	ENST00000368321.3	37	c.304	CCDS30885.1	1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.412581	0.42817	.	.	ENSG00000132680	ENST00000368321;ENST00000368320;ENST00000368319	.	.	.	5.32	4.41	0.53225	.	0.000000	0.64402	D	0.000001	T	0.24812	0.0602	N	0.25332	0.735	0.54753	D	0.999984	B;P;B;P;B;B	0.43578	0.376;0.811;0.376;0.607;0.106;0.376	B;B;B;B;B;B	0.43623	0.084;0.425;0.058;0.12;0.143;0.188	T	0.06625	-1.0816	9	0.10902	T	0.67	-7.7714	13.9482	0.64099	0.0737:0.0:0.9263:0.0	.	102;102;102;102;102;102	D3DVA4;Q7Z7F0-4;A8K1I7;Q7Z7F0-3;Q7Z7F0-2;Q7Z7F0	.;.;.;.;.;K0907_HUMAN	V	102	.	ENSP00000357302:L102V	L	-	1	2	KIAA0907	154166207	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.410000	0.80065	1.477000	0.48234	0.563000	0.77884	CTG	KIAA0907	-	NULL	ENSG00000132680		0.413	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0907	HGNC	protein_coding	OTTHUMT00000039583.1	101	0.00	0	G	NM_014949		155899583	155899583	-1	no_errors	ENST00000368321	ensembl	human	known	69_37n	missense	118	16.31	23	SNP	1.000	C
LAMC1	3915	genome.wustl.edu	37	1	183083678	183083678	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:183083678A>G	ENST00000258341.4	+	5	1291	c.1034A>G	c.(1033-1035)aAt>aGt	p.N345S		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	345	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						TGTGATTGCAATGGTCGATCC	0.473																																						dbGAP											0													236.0	231.0	233.0					1																	183083678		2203	4300	6503	-	-	-	SO:0001583	missense	0			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.1034A>G	1.37:g.183083678A>G	ENSP00000258341:p.Asn345Ser		Q5VYE7	Missense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_Laminin_B_type_IV,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.N345S	ENST00000258341.4	37	c.1034	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	A	16.00	2.998828	0.54147	.	.	ENSG00000135862	ENST00000258341	T	0.63580	-0.05	5.4	3.05	0.35203	EGF-like, laminin (3);	0.045785	0.85682	N	0.000000	T	0.76849	0.4045	M	0.81341	2.54	0.80722	D	1	D	0.71674	0.998	D	0.87578	0.998	T	0.75918	-0.3148	10	0.72032	D	0.01	.	9.1473	0.36942	0.8455:0.0:0.1545:0.0	.	345	P11047	LAMC1_HUMAN	S	345	ENSP00000258341:N345S	ENSP00000258341:N345S	N	+	2	0	LAMC1	181350301	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	2.441000	0.44864	0.346000	0.23899	-0.250000	0.11733	AAT	LAMC1	-	pfam_EGF_laminin,smart_EGF-like,smart_EGF_laminin	ENSG00000135862		0.473	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	HGNC	protein_coding	OTTHUMT00000085954.2	46	0.00	0	A	NM_002293		183083678	183083678	+1	no_errors	ENST00000258341	ensembl	human	known	69_37n	missense	37	40.32	25	SNP	1.000	G
KIF26B	55083	genome.wustl.edu	37	1	245850803	245850803	+	Silent	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:245850803C>T	ENST00000407071.2	+	12	4958	c.4518C>T	c.(4516-4518)ttC>ttT	p.F1506F	KIF26B_ENST00000366518.4_Silent_p.F1125F	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1506					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CTGACAACTTCAGGAGGGTCG	0.642																																						dbGAP											0													29.0	35.0	33.0					1																	245850803		2125	4220	6345	-	-	-	SO:0001819	synonymous_variant	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.4518C>T	1.37:g.245850803C>T			Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.F1506	ENST00000407071.2	37	c.4518	CCDS44342.1	1																																																																																			KIF26B	-	NULL	ENSG00000162849		0.642	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	18	0.00	0	C	XM_371354		245850803	245850803	+1	no_errors	ENST00000407071	ensembl	human	known	69_37n	silent	31	27.91	12	SNP	0.521	T
LHCGR	3973	genome.wustl.edu	37	2	48915906	48915906	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr2:48915906C>G	ENST00000294954.7	-	11	1051	c.1030G>C	c.(1030-1032)Gct>Cct	p.A344P	LHCGR_ENST00000403273.1_Intron|LHCGR_ENST00000344775.3_Missense_Mutation_p.A282P|LHCGR_ENST00000401907.1_Intron|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000405626.1_Missense_Mutation_p.A317P	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	344					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	GGTTCAGGAGCACATCGGGGT	0.423																																						dbGAP											0													140.0	138.0	139.0					2																	48915906		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.1030G>C	2.37:g.48915906C>G	ENSP00000294954:p.Ala344Pro		Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_LSH_rcpt,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_TSH_rcpt	p.A344P	ENST00000294954.7	37	c.1030	CCDS1842.1	2	.	.	.	.	.	.	.	.	.	.	C	15.79	2.937594	0.52972	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626	D;D;D	0.86097	-2.07;-2.07;-2.07	5.91	4.1	0.47936	.	0.219434	0.48767	D	0.000177	T	0.81413	0.4817	M	0.72894	2.215	0.29695	N	0.840595	B	0.20550	0.046	B	0.15052	0.012	T	0.72721	-0.4208	9	.	.	.	.	7.7746	0.29030	0.0:0.6793:0.0:0.3207	.	344	P22888	LSHR_HUMAN	P	282;344;317	ENSP00000344301:A282P;ENSP00000294954:A344P;ENSP00000386033:A317P	.	A	-	1	0	LHCGR	48769410	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	1.638000	0.37165	0.801000	0.34066	0.655000	0.94253	GCT	LHCGR	-	prints_LSH_rcpt	ENSG00000138039		0.423	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHCGR	HGNC	protein_coding	OTTHUMT00000251364.4	72	0.00	0	C	NM_000233.3		48915906	48915906	-1	no_errors	ENST00000294954	ensembl	human	known	69_37n	missense	45	51.61	48	SNP	1.000	G
LBX2	85474	genome.wustl.edu	37	2	74725096	74725096	+	Silent	SNP	G	G	A	rs552425494		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr2:74725096G>A	ENST00000377566.4	-	2	733	c.555C>T	c.(553-555)tcC>tcT	p.S185S	AC005041.17_ENST00000479098.1_RNA|LBX2_ENST00000341396.2_3'UTR|LBX2_ENST00000550249.1_5'UTR|LBX2_ENST00000460508.3_Silent_p.S181S	NM_001282430.1	NP_001269359.1	Q6XYB7	LBX2_HUMAN	ladybird homeobox 2	185					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(1)	4						GGTGGGGCCGGGAGTCAGGGC	0.672																																						dbGAP											0													24.0	28.0	26.0					2																	74725096		2200	4300	6500	-	-	-	SO:0001819	synonymous_variant	0			AC005041	CCDS33228.1, CCDS62938.1	2p13.1	2014-05-06	2007-02-15		ENSG00000179528	ENSG00000179528		"""Homeoboxes / ANTP class : NKL subclass"""	15525	protein-coding gene	gene with protein product		607164	"""ladybird homeobox homolog 2 (Drosophila)"""			11386758	Standard	NM_001282430		Approved		uc002slw.3	Q6XYB7	OTTHUMG00000170595	ENST00000377566.4:c.555C>T	2.37:g.74725096G>A			Q7Z5Y8	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.S185	ENST00000377566.4	37	c.555		2																																																																																			LBX2	-	NULL	ENSG00000179528		0.672	LBX2-002	KNOWN	basic|appris_principal	protein_coding	LBX2	HGNC	protein_coding	OTTHUMT00000328490.1	23	0.00	0	G	NM_001009812		74725096	74725096	-1	no_errors	ENST00000377566	ensembl	human	known	69_37n	silent	25	19.35	6	SNP	0.007	A
LILRA2	11027	genome.wustl.edu	37	19	55087518	55087518	+	Silent	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr19:55087518C>T	ENST00000251377.3	+	7	1330	c.1197C>T	c.(1195-1197)ctC>ctT	p.L399L	LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000391737.1_Silent_p.L387L|LILRA2_ENST00000391738.3_Silent_p.L399L|LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000251376.3_Silent_p.L399L			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	399	Ig-like C2-type 4.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		ACAGCTCACTCAGCTCCAACC	0.592																																						dbGAP											0													120.0	103.0	109.0					19																	55087518		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.1197C>T	19.37:g.55087518C>T			O75020	Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	p.L399	ENST00000251377.3	37	c.1197	CCDS46179.1	19																																																																																			LILRA2	-	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt	ENSG00000239998		0.592	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LILRA2	HGNC	protein_coding	OTTHUMT00000140813.2	50	0.00	0	C			55087518	55087518	+1	no_errors	ENST00000251377	ensembl	human	known	69_37n	silent	28	51.72	30	SNP	0.000	T
LINGO2	158038	genome.wustl.edu	37	9	27950343	27950343	+	Silent	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr9:27950343G>A	ENST00000379992.2	-	6	776	c.327C>T	c.(325-327)tcC>tcT	p.S109S	LINGO2_ENST00000308675.3_Silent_p.S109S	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	109						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		TTAGGCGGAGGGAACGCAGGT	0.438																																						dbGAP											0													162.0	161.0	162.0					9																	27950343		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.327C>T	9.37:g.27950343G>A			A8K4K7|B2RPM5|Q6ZMD0	Silent	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S109	ENST00000379992.2	37	c.327	CCDS6524.1	9																																																																																			LINGO2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000174482		0.438	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO2	HGNC	protein_coding	OTTHUMT00000051978.2	68	0.00	0	G	NM_152570		27950343	27950343	-1	no_errors	ENST00000308675	ensembl	human	known	69_37n	silent	38	44.93	31	SNP	1.000	A
LRRC32	2615	genome.wustl.edu	37	11	76370691	76370691	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr11:76370691C>G	ENST00000407242.2	-	3	2188	c.1946G>C	c.(1945-1947)tGc>tCc	p.C649S	LRRC32_ENST00000404995.1_Missense_Mutation_p.C649S|RP11-672A2.4_ENST00000531511.1_lincRNA|LRRC32_ENST00000260061.5_Missense_Mutation_p.C649S|AP001189.4_ENST00000447519.1_RNA|LRRC32_ENST00000464145.1_Intron	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	649					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						GCGGACGCAGCAGCAGGCGGC	0.552																																						dbGAP											0													98.0	104.0	102.0					11																	76370691		2200	4292	6492	-	-	-	SO:0001583	missense	0			Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.1946G>C	11.37:g.76370691C>G	ENSP00000384126:p.Cys649Ser		Q86V06	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.C649S	ENST00000407242.2	37	c.1946	CCDS8245.1	11	.	.	.	.	.	.	.	.	.	.	C	14.00	2.404992	0.42613	.	.	ENSG00000137507	ENST00000260061;ENST00000407242;ENST00000404995	T;T;T	0.36340	1.26;1.26;1.26	4.59	3.67	0.42095	.	0.321308	0.30428	N	0.009657	T	0.36771	0.0979	L	0.29908	0.895	0.40109	D	0.976466	D	0.65815	0.995	P	0.56278	0.795	T	0.21280	-1.0250	10	0.59425	D	0.04	.	7.1912	0.25826	0.2722:0.641:0.0:0.0868	.	649	Q14392	LRC32_HUMAN	S	649	ENSP00000260061:C649S;ENSP00000384126:C649S;ENSP00000385766:C649S	ENSP00000260061:C649S	C	-	2	0	LRRC32	76048339	1.000000	0.71417	0.845000	0.33349	0.797000	0.45037	2.244000	0.43124	1.156000	0.42514	0.491000	0.48974	TGC	LRRC32	-	NULL	ENSG00000137507		0.552	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC32	HGNC	protein_coding	OTTHUMT00000257926.2	67	0.00	0	C	NM_005512		76370691	76370691	-1	no_errors	ENST00000260061	ensembl	human	known	69_37n	missense	30	40.38	21	SNP	0.918	G
LRRC37A3	374819	genome.wustl.edu	37	17	62865212	62865212	+	Splice_Site	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr17:62865212C>T	ENST00000584306.1	-	8	3509		c.e8+1		RN7SL404P_ENST00000582421.1_RNA|LRRC37A3_ENST00000339474.5_Splice_Site|LRRC37A3_ENST00000400877.3_Splice_Site|LRRC37A3_ENST00000319651.5_Splice_Site	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3							integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						ATAGTACTTACAGATATTTTA	0.284																																						dbGAP											0													71.0	89.0	83.0					17																	62865212		1505	2698	4203	-	-	-	SO:0001630	splice_region_variant	0			AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.2978+1G>A	17.37:g.62865212C>T			Q49A01|Q49A80|Q8NB33	Splice_Site	SNP	-	e6+1	ENST00000584306.1	37	c.2978+1	CCDS32708.1	17	.	.	.	.	.	.	.	.	.	.	c	9.932	1.215087	0.22373	.	.	ENSG00000176809	ENST00000339474;ENST00000400877;ENST00000319651	.	.	.	2.64	2.64	0.31445	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.7949	0.34874	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRRC37A3	60295674	1.000000	0.71417	1.000000	0.80357	0.495000	0.33615	3.190000	0.50973	1.482000	0.48325	0.205000	0.17691	.	LRRC37A3	-	-	ENSG00000176809		0.284	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37A3	HGNC	protein_coding	OTTHUMT00000445377.1	15	0.00	0	C	NM_199340	Intron	62865212	62865212	-1	no_errors	ENST00000319651	ensembl	human	known	69_37n	splice_site	1	93.33	14	SNP	1.000	T
LRRK1	79705	genome.wustl.edu	37	15	101555536	101555536	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr15:101555536A>G	ENST00000388948.3	+	12	1897	c.1538A>G	c.(1537-1539)gAa>gGa	p.E513G	LRRK1_ENST00000284395.5_Missense_Mutation_p.E510G	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCCAGAAATGAAGATGGACTG	0.507											OREG0023522	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													58.0	59.0	59.0					15																	101555536		2016	4208	6224	-	-	-	SO:0001583	missense	0			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.1538A>G	15.37:g.101555536A>G	ENSP00000373600:p.Glu513Gly	1359		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom	p.E513G	ENST00000388948.3	37	c.1538	CCDS42086.1	15	.	.	.	.	.	.	.	.	.	.	A	10.72	1.430899	0.25726	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.74002	-0.78;-0.8	5.43	5.43	0.79202	.	0.133576	0.48286	D	0.000189	T	0.59074	0.2167	N	0.14661	0.345	0.44995	D	0.998013	B	0.02656	0.0	B	0.04013	0.001	T	0.54788	-0.8241	10	0.31617	T	0.26	.	14.6505	0.68794	1.0:0.0:0.0:0.0	.	513	Q38SD2	LRRK1_HUMAN	G	513;510	ENSP00000373600:E513G;ENSP00000284395:E510G	ENSP00000284395:E510G	E	+	2	0	LRRK1	99373059	1.000000	0.71417	0.978000	0.43139	0.165000	0.22458	4.226000	0.58606	2.037000	0.60232	0.448000	0.29417	GAA	LRRK1	-	NULL	ENSG00000154237		0.507	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	HGNC	protein_coding	OTTHUMT00000384567.2	57	0.00	0	A	NM_024652		101555536	101555536	+1	no_errors	ENST00000388948	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	1.000	G
LSR	51599	genome.wustl.edu	37	19	35758116	35758116	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr19:35758116C>G	ENST00000361790.3	+	9	1552	c.1393C>G	c.(1393-1395)Ccc>Gcc	p.P465A	USF2_ENST00000222305.3_5'Flank|LSR_ENST00000354900.3_Missense_Mutation_p.P446A|AD000684.2_ENST00000602262.1_RNA|USF2_ENST00000379134.3_5'Flank|LSR_ENST00000427250.1_Missense_Mutation_p.P309A|LSR_ENST00000360798.3_Missense_Mutation_p.P397A|LSR_ENST00000602122.1_Missense_Mutation_p.P445A|USF2_ENST00000595068.1_5'Flank|USF2_ENST00000343550.5_5'Flank|LSR_ENST00000347609.4_Missense_Mutation_p.P407A|USF2_ENST00000594064.1_5'Flank	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	465					embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TGGCCACTCCCCCCGGAGTCC	0.751																																						dbGAP											0													10.0	14.0	12.0					19																	35758116		1958	4096	6054	-	-	-	SO:0001583	missense	0			AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.1393C>G	19.37:g.35758116C>G	ENSP00000354575:p.Pro465Ala		A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Missense_Mutation	SNP	pfam_LISCH7,smart_Ig_sub,pfscan_Ig-like	p.P465A	ENST00000361790.3	37	c.1393	CCDS12450.1	19	.	.	.	.	.	.	.	.	.	.	C	7.699	0.692754	0.15039	.	.	ENSG00000105699	ENST00000361790;ENST00000354900;ENST00000360798;ENST00000347609;ENST00000427250	T;T;T;T;T	0.63744	0.53;0.7;0.36;0.39;-0.06	4.55	4.55	0.56014	.	0.396245	0.26796	N	0.022460	T	0.49064	0.1535	L	0.36672	1.1	0.09310	N	1	B;P;B;B;B;B	0.37500	0.026;0.597;0.095;0.119;0.057;0.057	B;B;B;B;B;B	0.36092	0.004;0.217;0.061;0.02;0.027;0.027	T	0.38178	-0.9673	10	0.15066	T	0.55	-22.3849	13.2459	0.60024	0.0:1.0:0.0:0.0	.	403;407;445;397;446;465	Q9BT33;Q86X29-2;Q86X29-3;A6NDW3;E9PHD4;Q86X29	.;.;.;.;.;LSR_HUMAN	A	465;446;397;407;309	ENSP00000354575:P465A;ENSP00000346976:P446A;ENSP00000354034:P397A;ENSP00000262627:P407A;ENSP00000394479:P309A	ENSP00000262627:P407A	P	+	1	0	LSR	40449956	0.001000	0.12720	0.895000	0.35142	0.040000	0.13550	0.998000	0.29744	2.245000	0.73994	0.555000	0.69702	CCC	LSR	-	NULL	ENSG00000105699		0.751	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LSR	HGNC	protein_coding	OTTHUMT00000465513.2	13	0.00	0	C	NM_015925		35758116	35758116	+1	no_errors	ENST00000361790	ensembl	human	known	69_37n	missense	10	52.38	11	SNP	0.163	G
LYST	1130	genome.wustl.edu	37	1	235860498	235860498	+	Silent	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:235860498G>T	ENST00000389794.3	-	46	10623	c.10449C>A	c.(10447-10449)gtC>gtA	p.V3483V	LYST_ENST00000389793.2_Silent_p.V3483V|LYST_ENST00000473037.1_5'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3483					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GGCTGAAGCAGACCACAGGTA	0.473																																						dbGAP											0													68.0	73.0	71.0					1																	235860498		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.10449C>A	1.37:g.235860498G>T			O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V3483	ENST00000389794.3	37	c.10449	CCDS31062.1	1																																																																																			LYST	-	NULL	ENSG00000143669		0.473	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	56	0.00	0	G			235860498	235860498	-1	no_errors	ENST00000389793	ensembl	human	known	69_37n	silent	67	17.07	14	SNP	1.000	T
LZTFL1	54585	genome.wustl.edu	37	3	45872443	45872443	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr3:45872443C>G	ENST00000296135.6	-	7	736	c.562G>C	c.(562-564)Gca>Cca	p.A188P	LZTFL1_ENST00000536047.1_Missense_Mutation_p.A171P|LZTFL1_ENST00000539217.1_Missense_Mutation_p.A184P|LZTFL1_ENST00000490463.1_5'UTR	NM_001276378.1|NM_020347.2	NP_001263307.1|NP_065080.1	Q9NQ48	LZTL1_HUMAN	leucine zipper transcription factor-like 1	188	Interaction with BSS9.				establishment of protein localization to organelle (GO:0072594)	BBSome (GO:0034464)|cytoplasm (GO:0005737)	identical protein binding (GO:0042802)			endometrium(1)|large_intestine(2)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	8				BRCA - Breast invasive adenocarcinoma(193;0.00867)|KIRC - Kidney renal clear cell carcinoma(197;0.0177)|Kidney(197;0.0208)		TCTTGCAGTGCTTTTTCTAGT	0.308																																						dbGAP											0													152.0	147.0	149.0					3																	45872443		2201	4298	6499	-	-	-	SO:0001583	missense	0			AJ297351	CCDS2731.1, CCDS63608.1, CCDS63609.1	3p21.3	2014-01-28			ENSG00000163818	ENSG00000163818			6741	protein-coding gene	gene with protein product		606568				11352561, 22510444	Standard	NM_020347		Approved	BBS17	uc003cox.2	Q9NQ48	OTTHUMG00000133452	ENST00000296135.6:c.562G>C	3.37:g.45872443C>G	ENSP00000296135:p.Ala188Pro		B3KSI9|B4E0K7|Q8TC61|Q9NQ56	Missense_Mutation	SNP	NULL	p.A188P	ENST00000296135.6	37	c.562	CCDS2731.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.19|14.19	2.461921|2.461921	0.43736|0.43736	.|.	.|.	ENSG00000163818|ENSG00000163818	ENST00000296135;ENST00000536047;ENST00000539217|ENST00000440576	T;T;T|.	0.24908|.	1.83;1.83;1.83|.	5.78|5.78	2.99|2.99	0.34606|0.34606	.|.	0.308460|.	0.38959|.	N|.	0.001518|.	T|T	0.38268|0.38268	0.1034|0.1034	L|L	0.50333|0.50333	1.59|1.59	0.19300|0.19300	N|N	0.999979|0.999979	B|.	0.32010|.	0.351|.	B|.	0.33521|.	0.165|.	T|T	0.28744|0.28744	-1.0034|-1.0034	10|5	0.32370|.	T|.	0.25|.	-0.4303|-0.4303	4.5344|4.5344	0.12020|0.12020	0.1338:0.6124:0.1161:0.1377|0.1338:0.6124:0.1161:0.1377	.|.	188|.	Q9NQ48|.	LZTL1_HUMAN|.	P|T	188;171;184|123	ENSP00000296135:A188P;ENSP00000439522:A171P;ENSP00000441784:A184P|.	ENSP00000296135:A188P|.	A|S	-|-	1|2	0|0	LZTFL1|LZTFL1	45847447|45847447	0.983000|0.983000	0.35010|0.35010	0.001000|0.001000	0.08648|0.08648	0.990000|0.990000	0.78478|0.78478	2.149000|2.149000	0.42244|0.42244	0.346000|0.346000	0.23899|0.23899	0.655000|0.655000	0.94253|0.94253	GCA|AGC	LZTFL1	-	NULL	ENSG00000163818		0.308	LZTFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTFL1	HGNC	protein_coding	OTTHUMT00000257326.3	151	0.00	0	C	NM_020347		45872443	45872443	-1	no_errors	ENST00000296135	ensembl	human	known	69_37n	missense	31	74.80	95	SNP	0.108	G
MACF1	23499	genome.wustl.edu	37	1	39851426	39851426	+	Silent	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:39851426G>A	ENST00000372915.3	+	56	14271	c.14184G>A	c.(14182-14184)ttG>ttA	p.L4728L	MACF1_ENST00000361689.2_Silent_p.L2661L|MACF1_ENST00000539005.1_Silent_p.L2640L|MACF1_ENST00000317713.7_Silent_p.L2661L|MACF1_ENST00000564288.1_Silent_p.L4723L|MACF1_ENST00000545844.1_Silent_p.L2661L|MACF1_ENST00000289893.4_Silent_p.L3163L|MACF1_ENST00000567887.1_Silent_p.L4760L			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4728					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGCAGCAATTGGAAGAGACCA	0.512																																						dbGAP											0													92.0	87.0	88.0					1																	39851426		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.14184G>A	1.37:g.39851426G>A			B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_GAS2_dom,superfamily_GAS2_dom,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_EF_HAND_2	p.G1774R	ENST00000372915.3	37	c.5320		1	.	.	.	.	.	.	.	.	.	.	G	5.363	0.252310	0.10185	.	.	ENSG00000127603	ENST00000372925	.	.	.	6.06	0.778	0.18543	.	.	.	.	.	T	0.58395	0.2119	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52396	-0.8581	4	.	.	.	.	10.3507	0.43934	0.3359:0.0:0.6641:0.0	.	.	.	.	R	1774	.	.	G	+	1	0	MACF1	39624013	1.000000	0.71417	0.787000	0.31911	0.621000	0.37620	1.923000	0.40055	0.109000	0.17891	-0.982000	0.02568	GGA	MACF1	-	smart_Spectrin/alpha-actinin	ENSG00000127603		0.512	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	31	0.00	0	G	NM_033044		39851426	39851426	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000372925	ensembl	human	novel	69_37n	missense	35	20.45	9	SNP	1.000	A
MAN2B1	4125	genome.wustl.edu	37	19	12760800	12760800	+	Missense_Mutation	SNP	G	G	T	rs199700264		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr19:12760800G>T	ENST00000456935.2	-	18	2234	c.2194C>A	c.(2194-2196)Cgt>Agt	p.R732S	CTD-2192J16.22_ENST00000597692.1_5'Flank|MAN2B1_ENST00000221363.4_Missense_Mutation_p.R731S	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	732					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GTGTCAAAACGGCTGATGACC	0.592																																						dbGAP											0													217.0	195.0	202.0					19																	12760800		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.2194C>A	19.37:g.12760800G>T	ENSP00000395473:p.Arg732Ser		G5E928|O15330|Q16680|Q93094|Q9BW13	Missense_Mutation	SNP	pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_core,pfam_Glyco_hydro_38_cen_dom,superfamily_Glyco_hydro-type_carb-bd,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.R732S	ENST00000456935.2	37	c.2194	CCDS32919.1	19	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241563	0.58995	.	.	ENSG00000104774	ENST00000456935;ENST00000536796;ENST00000221363	D;D	0.86956	-2.19;-2.19	5.13	4.1	0.47936	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.47852	D	0.000207	D	0.93671	0.7978	M	0.93062	3.375	0.58432	D	0.99999	D;D	0.89917	0.987;1.0	P;D	0.75020	0.829;0.985	D	0.93477	0.6824	10	0.72032	D	0.01	-32.2179	7.9091	0.29780	0.1814:0.0:0.8186:0.0	.	731;732	G5E928;O00754	.;MA2B1_HUMAN	S	732;671;731	ENSP00000395473:R732S;ENSP00000221363:R731S	ENSP00000221363:R731S	R	-	1	0	MAN2B1	12621800	1.000000	0.71417	0.994000	0.49952	0.470000	0.32858	5.998000	0.70653	1.410000	0.46936	-0.263000	0.10527	CGT	MAN2B1	-	pfam_Glyco_hydro_38_C,superfamily_Glyco_hydro-type_carb-bd	ENSG00000104774		0.592	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAN2B1	HGNC	protein_coding	OTTHUMT00000344062.1	55	0.00	0	G			12760800	12760800	-1	no_errors	ENST00000456935	ensembl	human	known	69_37n	missense	51	40.70	35	SNP	0.997	T
MAPKAP1	79109	genome.wustl.edu	37	9	128246850	128246850	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr9:128246850T>C	ENST00000373498.1	-	8	1147	c.1079A>G	c.(1078-1080)gAc>gGc	p.D360G	MAPKAP1_ENST00000373497.5_Missense_Mutation_p.D73G|MAPKAP1_ENST00000265960.3_Missense_Mutation_p.D360G|MAPKAP1_ENST00000373511.2_Intron|MAPKAP1_ENST00000373503.3_Missense_Mutation_p.D168G|MAPKAP1_ENST00000394063.1_Missense_Mutation_p.D168G|MAPKAP1_ENST00000350766.3_Missense_Mutation_p.D324G			Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated protein 1	360					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of Ras protein signal transduction (GO:0046580)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein kinase binding (GO:0019901)|Ras GTPase binding (GO:0017016)			endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(3)	23						AAAAACCCCGTCTGCCCTTGA	0.423																																						dbGAP											0													144.0	125.0	131.0					9																	128246850		2203	4300	6503	-	-	-	SO:0001583	missense	0			M37191	CCDS6864.1, CCDS35139.1, CCDS35140.1, CCDS35141.1, CCDS48020.1	9q34.11	2008-02-05			ENSG00000119487	ENSG00000119487			18752	protein-coding gene	gene with protein product	"""stress-activated protein kinase-interacting 1"""	610558				15363842	Standard	NM_001006620		Approved	MGC2745, SIN1, MIP1	uc004bpv.3	Q9BPZ7	OTTHUMG00000020683	ENST00000373498.1:c.1079A>G	9.37:g.128246850T>C	ENSP00000362597:p.Asp360Gly		A8K1Z5|B1AMA4|B7Z309|Q00426|Q5JSV5|Q5JSV6|Q5JSV9|Q658R0|Q699U1|Q699U2|Q699U3|Q699U4|Q6GVJ0|Q6GVJ1|Q6GVJ2	Missense_Mutation	SNP	pfam_SIN1	p.D360G	ENST00000373498.1	37	c.1079	CCDS35140.1	9	.	.	.	.	.	.	.	.	.	.	T	18.90	3.720734	0.68959	.	.	ENSG00000119487	ENST00000350766;ENST00000373503;ENST00000373498;ENST00000265960;ENST00000394063;ENST00000373497;ENST00000420643	.	.	.	6.17	6.17	0.99709	.	0.042755	0.85682	D	0.000000	T	0.41305	0.1153	N	0.12182	0.205	0.54753	D	0.999984	B;B;B	0.30563	0.285;0.058;0.01	B;B;B	0.30251	0.113;0.076;0.033	T	0.32851	-0.9891	9	0.21540	T	0.41	-3.8857	16.8222	0.85835	0.0:0.0:0.0:1.0	.	73;324;360	B7Z5E5;Q9BPZ7-2;Q9BPZ7	.;.;SIN1_HUMAN	G	324;168;360;360;168;73;132	.	ENSP00000265960:D360G	D	-	2	0	MAPKAP1	127286671	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	GAC	MAPKAP1	-	pfam_SIN1	ENSG00000119487		0.423	MAPKAP1-009	KNOWN	basic|CCDS	protein_coding	MAPKAP1	HGNC	protein_coding	OTTHUMT00000054092.1	68	0.00	0	T			128246850	128246850	-1	no_errors	ENST00000265960	ensembl	human	known	69_37n	missense	29	57.35	39	SNP	1.000	C
MDGA1	266727	genome.wustl.edu	37	6	37620061	37620061	+	Silent	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr6:37620061G>A	ENST00000434837.3	-	7	2216	c.1038C>T	c.(1036-1038)aaC>aaT	p.N346N	MDGA1_ENST00000297153.7_Silent_p.N346N|MDGA1_ENST00000505425.1_Silent_p.N346N	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	346	Ig-like 4.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						CCAGCTGGATGTTCTCACTCT	0.562																																						dbGAP											0													45.0	51.0	49.0					6																	37620061		2167	4258	6425	-	-	-	SO:0001819	synonymous_variant	0			AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.1038C>T	6.37:g.37620061G>A			A6NHG0|Q8NBE3	Silent	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Ig-like	p.N346	ENST00000434837.3	37	c.1038	CCDS47417.1	6																																																																																			MDGA1	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000112139		0.562	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDGA1	HGNC	protein_coding	OTTHUMT00000040419.3	16	0.00	0	G			37620061	37620061	-1	no_errors	ENST00000297153	ensembl	human	known	69_37n	silent	12	52.00	13	SNP	1.000	A
MECOM	2122	genome.wustl.edu	37	3	168834507	168834507	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr3:168834507A>G	ENST00000464456.1	-	7	1789	c.589T>C	c.(589-591)Tat>Cat	p.Y197H	MECOM_ENST00000392736.3_Missense_Mutation_p.Y197H|MECOM_ENST00000468789.1_Missense_Mutation_p.Y197H|MECOM_ENST00000472280.1_Missense_Mutation_p.Y198H|MECOM_ENST00000494292.1_Missense_Mutation_p.Y385H|MECOM_ENST00000433243.2_Missense_Mutation_p.Y198H|MECOM_ENST00000264674.3_Missense_Mutation_p.Y262H|MECOM_ENST00000460814.1_Missense_Mutation_p.Y197H	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						AACTGAGTATAGGATTTATGG	0.398																																						dbGAP											0													334.0	279.0	297.0					3																	168834507		2203	4300	6503	-	-	-	SO:0001583	missense	0			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.589T>C	3.37:g.168834507A>G	ENSP00000419770:p.Tyr197His		Q13466|Q6FH90	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.Y385H	ENST00000464456.1	37	c.1153	CCDS54669.1	3	.	.	.	.	.	.	.	.	.	.	A	17.18	3.322800	0.60634	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243	T;T;T;T;T;T;T;T	0.61510	2.27;0.1;0.1;2.27;0.1;0.1;0.1;2.27	5.89	5.89	0.94794	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000026	T	0.76499	0.3996	M	0.76727	2.345	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.998;0.999;0.996;0.999	T	0.79334	-0.1846	10	0.87932	D	0	-13.4712	16.3123	0.82883	1.0:0.0:0.0:0.0	.	385;198;385;262;197	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	H	262;197;197;198;385;197;197;198	ENSP00000264674:Y262H;ENSP00000376493:Y197H;ENSP00000419770:Y197H;ENSP00000420048:Y198H;ENSP00000417899:Y385H;ENSP00000419995:Y197H;ENSP00000420466:Y197H;ENSP00000394302:Y198H	ENSP00000264674:Y262H	Y	-	1	0	MECOM	170317201	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.254000	0.74563	0.459000	0.35465	TAT	MECOM	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000085276		0.398	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	MECOM	HGNC	protein_coding	OTTHUMT00000351519.1	175	0.00	0	A	NM_005241, NM_004991		168834507	168834507	-1	no_errors	ENST00000494292	ensembl	human	known	69_37n	missense	139	42.32	102	SNP	1.000	G
MFI2	4241	genome.wustl.edu	37	3	196744075	196744075	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr3:196744075C>T	ENST00000296350.5	-	7	912	c.799G>A	c.(799-801)Gag>Aag	p.E267K		NM_005929.5	NP_005920.2	P08582	TRFM_HUMAN	antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5	267	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of plasminogen activation (GO:0010756)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ferric iron binding (GO:0008199)|iron ion binding (GO:0005506)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(1)	20	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		TGCCTCCACTCGGTGACATCG	0.672																																						dbGAP											0													21.0	21.0	21.0					3																	196744075		2200	4296	6496	-	-	-	SO:0001583	missense	0				CCDS3325.1, CCDS3326.1	3q28-q29	2012-10-02			ENSG00000163975	ENSG00000163975		"""CD molecules"""	7037	protein-coding gene	gene with protein product	"""melanotransferrin"", ""membrane-bound transferrin-like protein"""	155750					Standard	NM_033316		Approved	CD228, FLJ38863, MAP97, MGC4856, MTF1	uc003fxk.4	P08582	OTTHUMG00000155518	ENST00000296350.5:c.799G>A	3.37:g.196744075C>T	ENSP00000296350:p.Glu267Lys		Q9BQE2	Missense_Mutation	SNP	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	p.E267K	ENST00000296350.5	37	c.799	CCDS3325.1	3	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347208	0.61183	.	.	ENSG00000163975	ENST00000296350	T	0.15139	2.45	5.69	4.77	0.60923	.	0.153350	0.64402	D	0.000020	T	0.14356	0.0347	L	0.35487	1.065	0.80722	D	1	P	0.51653	0.947	B	0.41271	0.352	T	0.08534	-1.0717	10	0.16896	T	0.51	-41.0446	17.4455	0.87577	0.0:0.8653:0.1347:0.0	.	267	P08582	TRFM_HUMAN	K	267	ENSP00000296350:E267K	ENSP00000296350:E267K	E	-	1	0	MFI2	198228472	0.950000	0.32346	0.846000	0.33378	0.785000	0.44390	2.074000	0.41529	2.687000	0.91594	0.462000	0.41574	GAG	MFI2	-	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	ENSG00000163975		0.672	MFI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MFI2	HGNC	protein_coding	OTTHUMT00000340458.1	11	0.00	0	C			196744075	196744075	-1	no_errors	ENST00000296350	ensembl	human	known	69_37n	missense	7	53.33	8	SNP	0.860	T
MICALL1	85377	genome.wustl.edu	37	22	38308003	38308003	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr22:38308003G>C	ENST00000215957.6	+	2	317	c.191G>C	c.(190-192)cGt>cCt	p.R64P		NM_033386.3	NP_203744.1	Q8N3F8	MILK1_HUMAN	MICAL-like 1	64	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|neuron projection development (GO:0031175)|protein localization to endosome (GO:0036010)|protein targeting to membrane (GO:0006612)|receptor-mediated endocytosis (GO:0006898)|retrograde transport, endosome to plasma membrane (GO:1990126)|slow endocytic recycling (GO:0032458)	extrinsic component of membrane (GO:0019898)|late endosome (GO:0005770)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	24	Melanoma(58;0.045)					GAGAATAACCGTTTGGTAAGT	0.532																																						dbGAP											0													124.0	119.0	120.0					22																	38308003		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK000466	CCDS13961.1	22q13.1	2006-11-24			ENSG00000100139	ENSG00000100139			29804	protein-coding gene	gene with protein product	"""molecule interacting with Rab13"""					11258795, 12110185	Standard	NM_033386		Approved	MIRAB13, KIAA1668, MICAL-L1	uc003aui.3	Q8N3F8	OTTHUMG00000150670	ENST00000215957.6:c.191G>C	22.37:g.38308003G>C	ENSP00000215957:p.Arg64Pro		Q5TI16|Q7RTP5|Q8N3N8|Q9BVL9|Q9BY92|Q9UH43|Q9UH44|Q9UH45	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM	p.R64P	ENST00000215957.6	37	c.191	CCDS13961.1	22	.	.	.	.	.	.	.	.	.	.	G	18.06	3.540362	0.65085	.	.	ENSG00000100139	ENST00000215957	D	0.95205	-3.64	5.23	4.21	0.49690	Calponin homology domain (5);	0.766296	0.10650	N	0.650032	D	0.97368	0.9139	M	0.87038	2.855	0.80722	D	1	D	0.64830	0.994	D	0.66351	0.943	D	0.95477	0.8557	10	0.56958	D	0.05	.	14.0381	0.64658	0.0735:0.0:0.9265:0.0	.	64	Q8N3F8	MILK1_HUMAN	P	64	ENSP00000215957:R64P	ENSP00000215957:R64P	R	+	2	0	MICALL1	36637949	0.986000	0.35501	0.928000	0.36995	0.796000	0.44982	2.165000	0.42396	1.347000	0.45714	0.456000	0.33151	CGT	MICALL1	-	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000100139		0.532	MICALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICALL1	HGNC	protein_coding	OTTHUMT00000319545.4	89	0.00	0	G	NM_033386		38308003	38308003	+1	no_errors	ENST00000215957	ensembl	human	known	69_37n	missense	56	18.84	13	SNP	0.984	C
MS4A7	58475	genome.wustl.edu	37	11	60160252	60160252	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr11:60160252A>T	ENST00000300184.3	+	6	837	c.641A>T	c.(640-642)aAc>aTc	p.N214I	MS4A7_ENST00000534016.1_Missense_Mutation_p.N169I|MS4A14_ENST00000531787.1_Intron|MS4A7_ENST00000358246.1_Missense_Mutation_p.N169I|MS4A7_ENST00000530234.2_Intron	NM_021201.4|NM_206939.1	NP_067024.1|NP_996822.1	Q9GZW8	MS4A7_HUMAN	membrane-spanning 4-domains, subfamily A, member 7	214						integral component of membrane (GO:0016021)		p.N213_G216del(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(8)|ovary(1)|skin(1)	20						TACTCCAACAACCCTGGGGTG	0.468																																						dbGAP											1	Deletion - In frame(1)	central_nervous_system(1)											232.0	193.0	206.0					11																	60160252		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB026043	CCDS7985.1, CCDS7986.1	11q12	2008-03-25				ENSG00000166927			13378	protein-coding gene	gene with protein product		606502				11245982, 11401424	Standard	NM_021201		Approved	CD20L4, CFFM4, MS4A8	uc001npf.3	Q9GZW8		ENST00000300184.3:c.641A>T	11.37:g.60160252A>T	ENSP00000300184:p.Asn214Ile		A6NP53|Q6IAG8	Missense_Mutation	SNP	pfam_CD20-like	p.N214I	ENST00000300184.3	37	c.641	CCDS7985.1	11	.	.	.	.	.	.	.	.	.	.	A	17.32	3.360017	0.61403	.	.	ENSG00000166927	ENST00000300184;ENST00000358246;ENST00000534016;ENST00000530614;ENST00000530027	T;T;T;T;T	0.16073	3.21;2.52;2.52;2.37;2.81	3.63	-3.11	0.05299	.	2.189320	0.01961	N	0.043333	T	0.12689	0.0308	N	0.08118	0	0.09310	N	1	D;D	0.67145	0.993;0.996	P;P	0.57548	0.808;0.823	T	0.12192	-1.0557	10	0.17369	T	0.5	-1.0774	0.9068	0.01286	0.3269:0.1774:0.3231:0.1726	.	169;214	Q9GZW8-2;Q9GZW8	.;MS4A7_HUMAN	I	214;169;169;169;150	ENSP00000300184:N214I;ENSP00000350983:N169I;ENSP00000434637:N169I;ENSP00000433861:N169I;ENSP00000434819:N150I	ENSP00000300184:N214I	N	+	2	0	MS4A7	59916828	0.000000	0.05858	0.000000	0.03702	0.829000	0.46940	-0.205000	0.09411	-0.662000	0.05338	0.383000	0.25322	AAC	MS4A7	-	NULL	ENSG00000166927		0.468	MS4A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A7	HGNC	protein_coding	OTTHUMT00000394299.1	89	0.00	0	A			60160252	60160252	+1	no_errors	ENST00000300184	ensembl	human	known	69_37n	missense	87	18.52	20	SNP	0.000	T
MUC16	94025	genome.wustl.edu	37	19	8974096	8974096	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr19:8974096G>T	ENST00000397910.4	-	76	42778	c.42575C>A	c.(42574-42576)gCa>gAa	p.A14192E	MUC16_ENST00000380951.5_Missense_Mutation_p.A833E|MUC16_ENST00000596956.1_5'UTR	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	14223	SEA 14. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATTCTGGGGTGCATAGCCTGG	0.488																																						dbGAP											0													77.0	72.0	73.0					19																	8974096		1882	4127	6009	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.42575C>A	19.37:g.8974096G>T	ENSP00000381008:p.Ala14192Glu		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.A14192E	ENST00000397910.4	37	c.42575	CCDS54212.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.71|13.71	2.318632|2.318632	0.40996|0.40996	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000397910;ENST00000380951|ENST00000542240	T;T|.	0.31510|.	1.49;1.49|.	4.51|4.51	0.502|0.502	0.16932|0.16932	.|.	0.865991|.	0.09523|.	U|.	0.790687|.	T|T	0.50888|0.50888	0.1642|0.1642	M|M	0.78916|0.78916	2.43|2.43	.|.	.|.	.|.	B;D|.	0.63046|.	0.158;0.992|.	B;D|.	0.71656|.	0.058;0.974|.	T|T	0.55270|0.55270	-0.8167|-0.8167	9|4	0.48119|.	T|.	0.1|.	.|.	2.9042|2.9042	0.05715|0.05715	0.2912:0.0:0.5046:0.2042|0.2912:0.0:0.5046:0.2042	.|.	21837;14192|.	Q8WXI7;B5ME49|.	MUC16_HUMAN;.|.	E|N	14192;833|1015	ENSP00000381008:A14192E;ENSP00000370338:A833E|.	ENSP00000370338:A833E|.	A|H	-|-	2|1	0|0	MUC16|MUC16	8835096|8835096	0.059000|0.059000	0.20769|0.20769	0.005000|0.005000	0.12908|0.12908	0.003000|0.003000	0.03518|0.03518	0.406000|0.406000	0.21032|0.21032	0.081000|0.081000	0.16988|0.16988	-0.253000|-0.253000	0.11424|0.11424	GCA|CAC	MUC16	-	NULL	ENSG00000181143		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	78	0.00	0	G	NM_024690		8974096	8974096	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	93	16.22	18	SNP	0.006	T
MUC16	94025	genome.wustl.edu	37	19	9004897	9004897	+	Silent	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr19:9004897C>T	ENST00000397910.4	-	48	40124	c.39921G>A	c.(39919-39921)gaG>gaA	p.E13307E	MUC16_ENST00000380951.5_5'Flank	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13309					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATGATGGAGTCTCAGAGGTTT	0.493																																						dbGAP											0													57.0	56.0	56.0					19																	9004897		1941	4135	6076	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39921G>A	19.37:g.9004897C>T			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.E13307	ENST00000397910.4	37	c.39921	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	.	1.816	-0.473523	0.04445	.	.	ENSG00000181143	ENST00000542240	.	.	.	1.69	-0.775	0.10988	.	.	.	.	.	T	0.26122	0.0637	.	.	.	.	.	.	.	.	.	.	.	.	T	0.29731	-1.0002	3	.	.	.	-13.227	2.3509	0.04283	0.2924:0.5155:0.0:0.192	.	.	.	.	K	147	.	.	R	-	2	0	MUC16	8865897	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.128000	0.03247	-0.103000	0.12175	0.430000	0.28490	AGA	MUC16	-	NULL	ENSG00000181143		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	62	0.00	0	C	NM_024690		9004897	9004897	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	80	23.81	25	SNP	0.000	T
MUC17	140453	genome.wustl.edu	37	7	100696289	100696289	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr7:100696289T>A	ENST00000306151.4	+	10	13190	c.13126T>A	c.(13126-13128)Tgg>Agg	p.W4376R		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4376					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GGAAACTCACTGGTACAGTGG	0.612																																						dbGAP											0													83.0	75.0	78.0					7																	100696289		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.13126T>A	7.37:g.100696289T>A	ENSP00000302716:p.Trp4376Arg		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.W4376R	ENST00000306151.4	37	c.13126	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	T	8.599	0.886391	0.17540	.	.	ENSG00000169876	ENST00000306151	T	0.45668	0.89	5.52	5.52	0.82312	.	.	.	.	.	T	0.63628	0.2527	M	0.78049	2.395	0.32204	N	0.577422	D	0.64830	0.994	D	0.69654	0.965	T	0.73717	-0.3895	9	0.87932	D	0	.	12.0072	0.53265	0.0:0.0:0.0:1.0	.	4376	Q685J3	MUC17_HUMAN	R	4376	ENSP00000302716:W4376R	ENSP00000302716:W4376R	W	+	1	0	MUC17	100483009	1.000000	0.71417	1.000000	0.80357	0.339000	0.28857	3.304000	0.51866	2.097000	0.63578	0.528000	0.53228	TGG	MUC17	-	NULL	ENSG00000169876		0.612	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	32	0.00	0	T	NM_001040105		100696289	100696289	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	24	46.67	21	SNP	1.000	A
MYH10	4628	genome.wustl.edu	37	17	8390870	8390870	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr17:8390870G>A	ENST00000269243.4	-	34	4972	c.4834C>T	c.(4834-4836)Cgg>Tgg	p.R1612W	MYH10_ENST00000379980.4_Missense_Mutation_p.R1628W|MYH10_ENST00000360416.3_Missense_Mutation_p.R1643W|MYH10_ENST00000396239.1_Missense_Mutation_p.R1633W	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1612					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.R1612W(1)		breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						GCAAGCGCCCGCTGTTTCCTC	0.527																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											217.0	220.0	219.0					17																	8390870		2203	4300	6503	-	-	-	SO:0001583	missense	0			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.4834C>T	17.37:g.8390870G>A	ENSP00000269243:p.Arg1612Trp		B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1633W	ENST00000269243.4	37	c.4897	CCDS11144.1	17	.	.	.	.	.	.	.	.	.	.	G	20.5	4.004681	0.74932	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5	5.05	2.88	0.33553	Myosin tail (1);	0.000000	0.85682	D	0.000000	D	0.91811	0.7409	H	0.94222	3.51	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.94138	0.7394	10	0.87932	D	0	.	14.4148	0.67142	0.0:0.0:0.5988:0.4012	.	1621;1643;1612	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	W	1612;1643;1633;1628	ENSP00000269243:R1612W;ENSP00000353590:R1643W;ENSP00000379539:R1633W;ENSP00000369315:R1628W	ENSP00000269243:R1612W	R	-	1	2	MYH10	8331595	0.999000	0.42202	1.000000	0.80357	0.952000	0.60782	0.883000	0.28200	1.459000	0.47892	0.655000	0.94253	CGG	MYH10	-	pfam_Myosin_tail	ENSG00000133026		0.527	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2	74	0.00	0	G			8390870	8390870	-1	no_errors	ENST00000396239	ensembl	human	known	69_37n	missense	44	31.25	20	SNP	1.000	A
NAV3	89795	genome.wustl.edu	37	12	78591132	78591132	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr12:78591132T>C	ENST00000397909.2	+	35	6570	c.6397T>C	c.(6397-6399)Tct>Cct	p.S2133P	NAV3_ENST00000228327.6_Missense_Mutation_p.S2111P|NAV3_ENST00000536525.2_Missense_Mutation_p.S2111P|NAV3_ENST00000541270.1_5'Flank|NAV3_ENST00000266692.7_Missense_Mutation_p.S1934P			Q8IVL0	NAV3_HUMAN	neuron navigator 3	2133						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TCATGTGGGCTCTCTGAGTGA	0.333										HNSCC(70;0.22)																												dbGAP											0													123.0	111.0	115.0					12																	78591132		1825	4080	5905	-	-	-	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.6397T>C	12.37:g.78591132T>C	ENSP00000381007:p.Ser2133Pro		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.S2133P	ENST00000397909.2	37	c.6397		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.2|25.2	4.609780|4.609780	0.87258|0.87258	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000552895|ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788	.|T;T;T;T;T	.|0.36340	.|1.31;1.3;1.31;1.26;2.04	5.54|5.54	5.54|5.54	0.83059|0.83059	.|ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	.|0.000000	.|0.39146	.|U	.|0.001452	T|T	0.58323|0.58323	0.2114|0.2114	L|L	0.61387|0.61387	1.9|1.9	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;0.997;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.998;0.991;0.999;0.997	T|T	0.60156|0.60156	-0.7318|-0.7318	5|10	.|0.59425	.|D	.|0.04	-13.8557|-13.8557	15.9596|15.9596	0.79918|0.79918	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|2111;1934;2133;2111	.|E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2	.|.;.;NAV3_HUMAN;.	P|P	1005|2111;2133;2111;1934;725;733	.|ENSP00000446132:S2111P;ENSP00000381007:S2133P;ENSP00000228327:S2111P;ENSP00000266692:S1934P;ENSP00000448303:S733P	.|ENSP00000228327:S2111P	L|S	+|+	2|1	0|0	NAV3|NAV3	77115263|77115263	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.997000|7.997000	0.88414|0.88414	2.220000|2.220000	0.72140|0.72140	0.533000|0.533000	0.62120|0.62120	CTC|TCT	NAV3	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase	ENSG00000067798		0.333	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	93	0.00	0	T	NM_001024383		78591132	78591132	+1	no_errors	ENST00000397909	ensembl	human	known	69_37n	missense	22	62.71	37	SNP	1.000	C
NFKB1	4790	genome.wustl.edu	37	4	103500040	103500040	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr4:103500040C>T	ENST00000505458.1	+	8	848	c.571C>T	c.(571-573)Cgg>Tgg	p.R191W	NFKB1_ENST00000600343.1_Missense_Mutation_p.R11W|NFKB1_ENST00000394820.4_Missense_Mutation_p.R191W|NFKB1_ENST00000510638.1_3'UTR|NFKB1_ENST00000226574.4_Missense_Mutation_p.R192W			P19838	NFKB1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	191	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				apoptotic process (GO:0006915)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cytokine production (GO:0001818)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-12 biosynthetic process (GO:0045083)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|response to copper ion (GO:0046688)|response to oxidative stress (GO:0006979)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleic acid binding transcription factor activity (GO:0001071)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			biliary_tract(1)|breast(4)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Acetylsalicylic acid(DB00945)|Pranlukast(DB01411)|Thalidomide(DB01041)|Triflusal(DB08814)	GGCCCTAGATCGGGAAAAAGA	0.458																																						dbGAP											0													87.0	81.0	83.0					4																	103500040		2203	4300	6503	-	-	-	SO:0001583	missense	0			M58603	CCDS3657.1, CCDS54783.1	4q24	2013-01-10	2008-07-28		ENSG00000109320	ENSG00000109320		"""Ankyrin repeat domain containing"""	7794	protein-coding gene	gene with protein product		164011				1992489	Standard	NM_003998		Approved	KBF1, p105, NFKB-p50, p50, NF-kappaB, NFkappaB, NF-kB1	uc011cep.2	P19838	OTTHUMG00000161080	ENST00000505458.1:c.571C>T	4.37:g.103500040C>T	ENSP00000424790:p.Arg191Trp		A8K5Y5|B3KVE8|Q68D84|Q86V43|Q8N4X7|Q9NZC0	Missense_Mutation	SNP	pfam_RHD,pfam_Ankyrin_rpt,pfam_Death,superfamily_p53-like_TF_DNA-bd,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ig_E-set,superfamily_DEATH-like,smart_IPT_TIG_rcpt,smart_Ankyrin_rpt,smart_Death,prints_NF_Rel_dor,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_RHD	p.R192W	ENST00000505458.1	37	c.574	CCDS54783.1	4	.	.	.	.	.	.	.	.	.	.	C	18.06	3.539081	0.65085	.	.	ENSG00000109320	ENST00000226574;ENST00000394820;ENST00000505458	T;T;T	0.46451	0.87;0.87;0.87	5.51	-0.691	0.11305	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.448742	0.22284	N	0.062085	T	0.53498	0.1800	L	0.55990	1.75	0.20975	N	0.999813	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.75484	0.986;0.963;0.925	T	0.48833	-0.9000	10	0.72032	D	0.01	.	10.7145	0.46005	0.3464:0.4582:0.1954:0.0	.	11;191;192	B3KVE8;P19838;P19838-2	.;NFKB1_HUMAN;.	W	192;191;191	ENSP00000226574:R192W;ENSP00000378297:R191W;ENSP00000424790:R191W	ENSP00000226574:R192W	R	+	1	2	NFKB1	103719078	0.887000	0.30362	0.923000	0.36655	0.932000	0.56968	1.142000	0.31540	-0.048000	0.13401	0.585000	0.79938	CGG	NFKB1	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD	ENSG00000109320		0.458	NFKB1-003	KNOWN	alternative_5_UTR|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	NFKB1	HGNC	protein_coding	OTTHUMT00000363411.1	55	0.00	0	C			103500040	103500040	+1	no_errors	ENST00000226574	ensembl	human	known	69_37n	missense	17	72.13	44	SNP	0.071	T
NGF	4803	genome.wustl.edu	37	1	115829056	115829056	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:115829056G>A	ENST00000369512.2	-	3	529	c.361C>T	c.(361-363)Cgg>Tgg	p.R121W	RP4-663N10.1_ENST00000425449.1_RNA	NM_002506.2	NP_002497.2	P01138	NGF_HUMAN	nerve growth factor (beta polypeptide)	121					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|adult locomotory behavior (GO:0008344)|apoptotic signaling pathway (GO:0097190)|circadian rhythm (GO:0007623)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|nerve growth factor processing (GO:0032455)|neuron apoptotic process (GO:0051402)|neuron projection morphogenesis (GO:0048812)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axon extension (GO:0045773)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotrophin TRK receptor signaling pathway (GO:0051388)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|Ras protein signal transduction (GO:0007265)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of neurotransmitter secretion (GO:0046928)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to peptide hormone (GO:0043434)|response to radiation (GO:0009314)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)	nerve growth factor receptor binding (GO:0005163)|receptor signaling protein activity (GO:0005057)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	GATGATGACCGCTTGCTCCTG	0.587																																						dbGAP											0													64.0	55.0	58.0					1																	115829056		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS882.1	1p13.1	2014-09-17	2008-02-07	2008-02-07	ENSG00000134259	ENSG00000134259		"""Endogenous ligands"""	7808	protein-coding gene	gene with protein product		162030		NGFB			Standard	XM_006710663		Approved		uc001efu.1	P01138	OTTHUMG00000011880	ENST00000369512.2:c.361C>T	1.37:g.115829056G>A	ENSP00000358525:p.Arg121Trp		A1A4E5|Q6FHA0|Q96P60|Q9P2Q8|Q9UKL8	Missense_Mutation	SNP	pirsf_Nerve_growth_factor-like,pfam_Nerve_growth_factor-rel,smart_Nerve_growth_factor-rel,prints_Nerve_growth_factor-rel,prints_Nerve_growth_factor_bsu_mml,prints_Nerve_growth_factor_bsu,pfscan_Nerve_growth_factor-rel	p.R121W	ENST00000369512.2	37	c.361	CCDS882.1	1	.	.	.	.	.	.	.	.	.	.	G	16.33	3.093475	0.56075	.	.	ENSG00000134259	ENST00000369512	T	0.73897	-0.79	5.14	3.05	0.35203	.	0.000000	0.85682	D	0.000000	T	0.82056	0.4954	M	0.82823	2.61	0.53688	D	0.999971	D	0.89917	1.0	D	0.81914	0.995	D	0.84928	0.0858	10	0.87932	D	0	-19.7714	11.8627	0.52476	0.0:0.0:0.5642:0.4358	.	121	P01138	NGF_HUMAN	W	121	ENSP00000358525:R121W	ENSP00000358525:R121W	R	-	1	2	NGF	115630579	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	2.327000	0.43858	1.227000	0.43598	0.313000	0.20887	CGG	NGF	-	pirsf_Nerve_growth_factor-like	ENSG00000134259		0.587	NGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NGF	HGNC	protein_coding	OTTHUMT00000032832.1	40	0.00	0	G	NM_002506		115829056	115829056	-1	no_errors	ENST00000369512	ensembl	human	known	69_37n	missense	34	22.73	10	SNP	1.000	A
NLRP13	126204	genome.wustl.edu	37	19	56423120	56423120	+	Missense_Mutation	SNP	C	C	G	rs375060041		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr19:56423120C>G	ENST00000342929.3	-	5	2062	c.2063G>C	c.(2062-2064)aGg>aCg	p.R688T	NLRP13_ENST00000588751.1_Missense_Mutation_p.R688T	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	688							ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		AACAGAAAGCCTTAGCTTATT	0.393																																						dbGAP											0													91.0	98.0	95.0					19																	56423120		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.2063G>C	19.37:g.56423120C>G	ENSP00000343891:p.Arg688Thr		Q7RTR5	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.R688T	ENST00000342929.3	37	c.2063	CCDS33119.1	19	.	.	.	.	.	.	.	.	.	.	C	13.86	2.363727	0.41902	.	.	ENSG00000173572	ENST00000342929	D	0.89415	-2.51	1.82	1.82	0.25136	.	.	.	.	.	D	0.89849	0.6834	L	0.53671	1.685	0.22412	N	0.99912	D	0.60575	0.988	P	0.59056	0.851	T	0.79509	-0.1774	9	0.51188	T	0.08	.	7.1477	0.25593	0.0:1.0:0.0:0.0	.	688	Q86W25	NAL13_HUMAN	T	688	ENSP00000343891:R688T	ENSP00000343891:R688T	R	-	2	0	NLRP13	61114932	0.076000	0.21285	0.605000	0.28930	0.220000	0.24768	1.008000	0.29872	1.363000	0.46019	0.543000	0.68304	AGG	NLRP13	-	NULL	ENSG00000173572		0.393	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP13	HGNC	protein_coding	OTTHUMT00000396560.1	34	0.00	0	C	NM_176810		56423120	56423120	-1	no_errors	ENST00000342929	ensembl	human	known	69_37n	missense	10	54.55	12	SNP	0.615	G
NLRP14	338323	genome.wustl.edu	37	11	7063859	7063859	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr11:7063859C>G	ENST00000299481.4	+	4	948	c.602C>G	c.(601-603)gCa>gGa	p.A201G		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	201	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TTAGATTGGGCAGAGGGCAGT	0.458																																						dbGAP											0													101.0	103.0	102.0					11																	7063859		2201	4296	6497	-	-	-	SO:0001583	missense	0			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.602C>G	11.37:g.7063859C>G	ENSP00000299481:p.Ala201Gly		Q7RTR6	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.A201G	ENST00000299481.4	37	c.602	CCDS7776.1	11	.	.	.	.	.	.	.	.	.	.	C	22.1	4.243153	0.79912	.	.	ENSG00000158077	ENST00000299481	D	0.81499	-1.5	4.47	4.47	0.54385	NACHT nucleoside triphosphatase (1);	0.000000	0.41396	D	0.000885	D	0.87708	0.6245	M	0.63169	1.94	0.47511	D	0.999445	D	0.89917	1.0	D	0.91635	0.999	D	0.88733	0.3238	10	0.72032	D	0.01	.	15.034	0.71731	0.0:1.0:0.0:0.0	.	201	Q86W24	NAL14_HUMAN	G	201	ENSP00000299481:A201G	ENSP00000299481:A201G	A	+	2	0	NLRP14	7020435	0.969000	0.33509	0.970000	0.41538	0.997000	0.91878	2.222000	0.42926	2.513000	0.84729	0.650000	0.86243	GCA	NLRP14	-	pfscan_NACHT_NTPase	ENSG00000158077		0.458	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP14	HGNC	protein_coding	OTTHUMT00000384551.1	60	0.00	0	C	NM_176822		7063859	7063859	+1	no_errors	ENST00000299481	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	1.000	G
NSD1	64324	genome.wustl.edu	37	5	176562116	176562116	+	Silent	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr5:176562116C>T	ENST00000439151.2	+	2	57	c.12C>T	c.(10-12)acC>acT	p.T4T	NSD1_ENST00000511258.1_5'UTR|NSD1_ENST00000354179.4_5'UTR|NSD1_ENST00000347982.4_5'UTR|NSD1_ENST00000361032.4_Silent_p.T4T	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	4					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TGGATCAGACCTGTGAACTAC	0.468			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																												dbGAP		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0													89.0	93.0	92.0					5																	176562116		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.12C>T	5.37:g.176562116C>T			Q96PD8|Q96RN7	Silent	SNP	pfam_PWWP,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.T4	ENST00000439151.2	37	c.12	CCDS4412.1	5																																																																																			NSD1	-	NULL	ENSG00000165671		0.468	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2	26	0.00	0	C	NM_172349		176562116	176562116	+1	no_errors	ENST00000439151	ensembl	human	known	69_37n	silent	26	29.73	11	SNP	1.000	T
OR13G1	441933	genome.wustl.edu	37	1	247835593	247835593	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:247835593G>T	ENST00000359688.2	-	1	772	c.751C>A	c.(751-753)Cct>Act	p.P251T	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	251						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TAGATTACAGGAGAATAGTAA	0.453																																						dbGAP											0													149.0	130.0	136.0					1																	247835593		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.751C>A	1.37:g.247835593G>T	ENSP00000352717:p.Pro251Thr		B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.P251T	ENST00000359688.2	37	c.751	CCDS31094.1	1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.662590	0.00772	.	.	ENSG00000197437	ENST00000359688	T	0.00022	9.01	4.2	-0.227	0.13102	GPCR, rhodopsin-like superfamily (1);	0.164006	0.29093	N	0.013168	T	0.00039	0.0001	N	0.00465	-1.465	0.09310	N	1	B	0.11235	0.004	B	0.15052	0.012	T	0.40683	-0.9550	10	0.02654	T	1	-30.437	12.8193	0.57683	0.0:0.0:0.2826:0.7174	.	251	Q8NGZ3	O13G1_HUMAN	T	251	ENSP00000352717:P251T	ENSP00000352717:P251T	P	-	1	0	OR13G1	245902216	0.000000	0.05858	0.000000	0.03702	0.825000	0.46686	-0.964000	0.03833	-0.128000	0.11641	0.563000	0.77884	CCT	OR13G1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000197437		0.453	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13G1	HGNC	protein_coding	OTTHUMT00000096869.1	54	0.00	0	G	NM_001005487		247835593	247835593	-1	no_errors	ENST00000359688	ensembl	human	known	69_37n	missense	65	22.35	19	SNP	0.000	T
OR5D14	219436	genome.wustl.edu	37	11	55563515	55563515	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr11:55563515C>T	ENST00000335605.1	+	1	484	c.484C>T	c.(484-486)Ctt>Ttt	p.L162F		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				CTTGGTACTCCTTTGTTATGC	0.483																																						dbGAP											0													176.0	172.0	173.0					11																	55563515		2200	4296	6496	-	-	-	SO:0001583	missense	0			AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.484C>T	11.37:g.55563515C>T	ENSP00000334456:p.Leu162Phe		Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L162F	ENST00000335605.1	37	c.484	CCDS31508.1	11	.	.	.	.	.	.	.	.	.	.	c	3.962	-0.010053	0.07727	.	.	ENSG00000186113	ENST00000335605	T	0.00123	8.7	5.08	0.662	0.17880	GPCR, rhodopsin-like superfamily (1);	0.179416	0.27043	N	0.021217	T	0.00144	0.0004	L	0.46670	1.46	0.09310	N	1	B	0.17852	0.024	B	0.21151	0.033	T	0.41466	-0.9507	10	0.87932	D	0	-14.5667	4.8973	0.13757	0.4273:0.414:0.0:0.1587	.	162	Q8NGL3	OR5DE_HUMAN	F	162	ENSP00000334456:L162F	ENSP00000334456:L162F	L	+	1	0	OR5D14	55320091	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.624000	0.02038	0.142000	0.18901	-0.152000	0.13540	CTT	OR5D14	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186113		0.483	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D14	HGNC	protein_coding	OTTHUMT00000391513.1	87	0.00	0	C	NM_001004735		55563515	55563515	+1	no_errors	ENST00000335605	ensembl	human	known	69_37n	missense	67	23.86	21	SNP	0.000	T
OR6C3	254786	genome.wustl.edu	37	12	55725942	55725942	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr12:55725942T>A	ENST00000379667.1	+	1	458	c.458T>A	c.(457-459)aTt>aAt	p.I153N		NM_054104.1	NP_473445.1	Q9NZP0	OR6C3_HUMAN	olfactory receptor, family 6, subfamily C, member 3	153					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	11						TTTCTGACCATTTTCCCACCC	0.458																																						dbGAP											0													253.0	208.0	223.0					12																	55725942		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF179770	CCDS31819.1	12q13.2	2013-09-23			ENSG00000205329	ENSG00000205329		"""GPCR / Class A : Olfactory receptors"""	15437	protein-coding gene	gene with protein product							Standard	NM_054104		Approved	OST709	uc010spj.2	Q9NZP0	OTTHUMG00000169861	ENST00000379667.1:c.458T>A	12.37:g.55725942T>A	ENSP00000368989:p.Ile153Asn			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I153N	ENST00000379667.1	37	c.458	CCDS31819.1	12	.	.	.	.	.	.	.	.	.	.	T	13.83	2.355348	0.41700	.	.	ENSG00000205329	ENST00000379667	T	0.37058	1.22	5.18	5.18	0.71444	GPCR, rhodopsin-like superfamily (1);	0.440965	0.19065	N	0.123671	T	0.53850	0.1822	M	0.67517	2.055	0.09310	N	1	B	0.32939	0.391	P	0.52159	0.691	T	0.53500	-0.8430	10	0.87932	D	0	.	10.6335	0.45551	0.0:0.0772:0.0:0.9228	.	153	Q9NZP0	OR6C3_HUMAN	N	153	ENSP00000368989:I153N	ENSP00000368989:I153N	I	+	2	0	OR6C3	54012209	0.000000	0.05858	0.174000	0.22961	0.608000	0.37181	0.030000	0.13688	2.303000	0.77524	0.478000	0.44815	ATT	OR6C3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000205329		0.458	OR6C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C3	HGNC	protein_coding	OTTHUMT00000406309.1	88	0.00	0	T			55725942	55725942	+1	no_errors	ENST00000379667	ensembl	human	known	69_37n	missense	45	31.82	21	SNP	0.001	A
ORC2	4999	genome.wustl.edu	37	2	201776110	201776110	+	Splice_Site	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr2:201776110C>G	ENST00000234296.2	-	18	1897	c.1648G>C	c.(1648-1650)Gga>Cga	p.G550R		NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	550					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						CCATCAGTTCCCTGAAAGATT	0.328																																						dbGAP											0													65.0	66.0	66.0					2																	201776110		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0				CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.1648-1G>C	2.37:g.201776110C>G			Q13204|Q53TX5	Missense_Mutation	SNP	pfam_ORC2	p.G550R	ENST00000234296.2	37	c.1648	CCDS2334.1	2	.	.	.	.	.	.	.	.	.	.	C	22.2	4.256372	0.80246	.	.	ENSG00000115942	ENST00000234296	T	0.42900	0.96	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.65637	0.2710	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.67436	-0.5671	10	0.52906	T	0.07	-18.5162	14.0683	0.64844	0.0:0.9281:0.0:0.0719	.	550	Q13416	ORC2_HUMAN	R	550	ENSP00000234296:G550R	ENSP00000234296:G550R	G	-	1	0	ORC2	201484355	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.807000	0.69157	2.681000	0.91329	0.655000	0.94253	GGA	ORC2	-	pfam_ORC2	ENSG00000115942		0.328	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC2	HGNC	protein_coding	OTTHUMT00000256191.2	65	0.00	0	C	NM_006190	Missense_Mutation	201776110	201776110	-1	no_errors	ENST00000234296	ensembl	human	known	69_37n	missense	45	59.82	67	SNP	1.000	G
OSBPL5	114879	genome.wustl.edu	37	11	3147733	3147733	+	Silent	SNP	C	C	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr11:3147733C>A	ENST00000263650.7	-	3	348	c.189G>T	c.(187-189)ccG>ccT	p.P63P	OSBPL5_ENST00000542243.1_5'UTR|OSBPL5_ENST00000348039.5_Silent_p.P63P|OSBPL5_ENST00000389989.3_Silent_p.P63P|OSBPL5_ENST00000525498.1_Silent_p.P15P	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5	63					cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		AGCTTGGGGTCGGGGGCCCTT	0.657																																						dbGAP											0													46.0	41.0	43.0					11																	3147733		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.189G>T	11.37:g.3147733C>A			A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Silent	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P63	ENST00000263650.7	37	c.189	CCDS31344.1	11																																																																																			OSBPL5	-	NULL	ENSG00000021762		0.657	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL5	HGNC	protein_coding	OTTHUMT00000032332.2	28	0.00	0	C			3147733	3147733	-1	no_errors	ENST00000263650	ensembl	human	known	69_37n	silent	5	84.38	27	SNP	0.992	A
OVGP1	5016	genome.wustl.edu	37	1	111966173	111966173	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:111966173A>C	ENST00000369732.3	-	5	530	c.475T>G	c.(475-477)Tta>Gta	p.L159V	OVGP1_ENST00000540696.1_Missense_Mutation_p.L99V|OVGP1_ENST00000481495.1_5'Flank	NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	159					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		ACTTCAATTAAGAAGAGAAAA	0.438																																						dbGAP											0													61.0	61.0	61.0					1																	111966173		2203	4300	6503	-	-	-	SO:0001583	missense	0			U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.475T>G	1.37:g.111966173A>C	ENSP00000358747:p.Leu159Val		A0AV19|B9EGE1|Q15841	Missense_Mutation	SNP	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	p.L159V	ENST00000369732.3	37	c.475	CCDS834.1	1	.	.	.	.	.	.	.	.	.	.	A	14.57	2.575654	0.45902	.	.	ENSG00000085465	ENST00000369732;ENST00000369728;ENST00000540696	T;T	0.11063	2.81;3.12	4.54	2.26	0.28386	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.26774	0.0655	H	0.94658	3.565	0.39623	D	0.970069	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.992;0.992;0.998	T	0.06716	-1.0811	10	0.87932	D	0	-19.5173	5.5823	0.17256	0.7813:0.0:0.2187:0.0	.	159;159;223	B2RA77;Q12889;Q59HH5	.;OVGP1_HUMAN;.	V	159;223;99	ENSP00000358747:L159V;ENSP00000438449:L99V	ENSP00000358743:L223V	L	-	1	2	OVGP1	111767696	0.997000	0.39634	0.964000	0.40570	0.504000	0.33889	0.642000	0.24735	0.864000	0.35578	0.482000	0.46254	TTA	OVGP1	-	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	ENSG00000085465		0.438	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OVGP1	HGNC	protein_coding	OTTHUMT00000032461.1	30	0.00	0	A	NM_002557		111966173	111966173	-1	no_errors	ENST00000369732	ensembl	human	known	69_37n	missense	31	29.55	13	SNP	0.963	C
P2RX2	22953	genome.wustl.edu	37	12	133198288	133198288	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr12:133198288T>G	ENST00000389110.3	+	11	1183	c.1146T>G	c.(1144-1146)tgT>tgG	p.C382W	P2RX2_ENST00000351222.4_Missense_Mutation_p.C290W|P2RX2_ENST00000350048.5_Missense_Mutation_p.C358W|P2RX2_ENST00000449132.2_Intron|P2RX2_ENST00000352418.4_Missense_Mutation_p.C310W|P2RX2_ENST00000343948.4_Missense_Mutation_p.C408W|P2RX2_ENST00000348800.5_Intron	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	382					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		ACAAGGTGTGTACGCCGAGCC	0.592																																						dbGAP											0													68.0	68.0	68.0					12																	133198288		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.1146T>G	12.37:g.133198288T>G	ENSP00000373762:p.Cys382Trp		A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Missense_Mutation	SNP	pfam_P2X_purnocptor,prints_P2X2_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor	p.C408W	ENST00000389110.3	37	c.1224	CCDS31931.1	12	.	.	.	.	.	.	.	.	.	.	T	11.88	1.771169	0.31320	.	.	ENSG00000187848	ENST00000389110;ENST00000343948;ENST00000352418;ENST00000350048;ENST00000351222	T;T;T;T;T	0.05513	3.7;3.43;3.7;3.7;3.7	4.4	1.98	0.26296	.	0.732533	0.12618	N	0.453246	T	0.13628	0.0330	L	0.51422	1.61	0.58432	D	0.999998	B;D;B;B;B	0.65815	0.032;0.995;0.008;0.04;0.022	B;P;B;B;B	0.59546	0.014;0.859;0.009;0.034;0.026	T	0.05835	-1.0861	10	0.72032	D	0.01	-5.7296	6.2906	0.21057	0.0:0.4057:0.0:0.5943	.	290;310;358;408;382	Q9UBL9-5;Q9UBL9-6;Q9UBL9-3;Q9UBL9-4;Q9UBL9	.;.;.;.;P2RX2_HUMAN	W	382;408;310;358;290	ENSP00000373762:C382W;ENSP00000343339:C408W;ENSP00000341419:C310W;ENSP00000343904:C358W;ENSP00000344502:C290W	ENSP00000343339:C408W	C	+	3	2	P2RX2	131708361	0.908000	0.30866	0.392000	0.26245	0.426000	0.31534	1.275000	0.33144	0.232000	0.21100	0.379000	0.24179	TGT	P2RX2	-	NULL	ENSG00000187848		0.592	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	P2RX2	HGNC	protein_coding	OTTHUMT00000397542.1	31	0.00	0	T			133198288	133198288	+1	no_errors	ENST00000343948	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	0.672	G
PAQR8	85315	genome.wustl.edu	37	6	52268806	52268806	+	Silent	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr6:52268806C>G	ENST00000442253.2	+	2	969	c.795C>G	c.(793-795)ccC>ccG	p.P265P	PAQR8_ENST00000360726.3_Silent_p.P265P	NM_133367.4	NP_588608.1	Q8TEZ7	MPRB_HUMAN	progestin and adipoQ receptor family member VIII	265					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|response to steroid hormone (GO:0048545)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)	p.P265P(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(2)	17	Lung NSC(77;0.0875)					TCTCCTGCCCCGTGCCTGAGA	0.577																																						dbGAP											1	Substitution - coding silent(1)	kidney(1)											121.0	107.0	112.0					6																	52268806		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF347029	CCDS4941.1	6p12	2012-08-10	2005-05-20	2005-05-20	ENSG00000170915	ENSG00000170915			15708	protein-coding gene	gene with protein product		607780	"""chromosome 6 open reading frame 33"""	C6orf33		11676489, 12574519	Standard	NM_133367		Approved	LMPB1, MPRB	uc003pao.4	Q8TEZ7	OTTHUMG00000014846	ENST00000442253.2:c.795C>G	6.37:g.52268806C>G			B2RCF6|Q86WL0|Q8N6D3|Q9HD02	Silent	SNP	pfam_HlyIII-related,superfamily_C-type_lectin_fold	p.P265	ENST00000442253.2	37	c.795	CCDS4941.1	6																																																																																			PAQR8	-	pfam_HlyIII-related	ENSG00000170915		0.577	PAQR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR8	HGNC	protein_coding	OTTHUMT00000040903.2	46	0.00	0	C	NM_133367		52268806	52268806	+1	no_errors	ENST00000360726	ensembl	human	known	69_37n	silent	35	49.28	34	SNP	0.024	G
PC	5091	genome.wustl.edu	37	11	66620009	66620009	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr11:66620009A>C	ENST00000393958.2	-	14	1819	c.1726T>G	c.(1726-1728)Tca>Gca	p.S576A	PC_ENST00000529047.1_5'Flank|PC_ENST00000393955.2_Missense_Mutation_p.S576A|PC_ENST00000528224.1_5'Flank|PC_ENST00000393960.1_Missense_Mutation_p.S576A	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	576	Carboxyltransferase.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	GCCAGCAGTGACTGGTGGGCG	0.612																																						dbGAP											0													67.0	66.0	66.0					11																	66620009		2200	4295	6495	-	-	-	SO:0001583	missense	0			U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.1726T>G	11.37:g.66620009A>C	ENSP00000377530:p.Ser576Ala		B4DN00|Q16705	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_Carboxylase_cons_dom,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_PYR_CT,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pirsf_Pyruv_COase,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_PYR_CT,pfscan_Biotin_lipoyl,tigrfam_Pyruv_COase	p.S576A	ENST00000393958.2	37	c.1726	CCDS8152.1	11	.	.	.	.	.	.	.	.	.	.	A	24.3	4.518035	0.85495	.	.	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960	D;D;D	0.98381	-4.9;-4.9;-4.9	5.53	5.53	0.82687	Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (2);	0.066007	0.64402	D	0.000005	D	0.99327	0.9764	H	0.97540	4.025	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.98662	1.0684	10	0.87932	D	0	-10.5806	13.6436	0.62267	1.0:0.0:0.0:0.0	.	576	P11498	PYC_HUMAN	A	576	ENSP00000377527:S576A;ENSP00000377530:S576A;ENSP00000377532:S576A	ENSP00000377527:S576A	S	-	1	0	PC	66376585	1.000000	0.71417	0.992000	0.48379	0.596000	0.36781	6.895000	0.75660	2.107000	0.64212	0.533000	0.62120	TCA	PC	-	pfam_PYR_CT,pirsf_Pyruv_COase,pfscan_PYR_CT,tigrfam_Pyruv_COase	ENSG00000173599		0.612	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PC	HGNC	protein_coding	OTTHUMT00000393115.1	31	0.00	0	A	NM_001040716		66620009	66620009	-1	no_errors	ENST00000393958	ensembl	human	known	69_37n	missense	20	31.03	9	SNP	1.000	C
PCDHGB4	8641	genome.wustl.edu	37	5	140769218	140769218	+	Silent	SNP	A	A	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr5:140769218A>T	ENST00000519479.1	+	1	1767	c.1767A>T	c.(1765-1767)gtA>gtT	p.V589V	PCDHGA7_ENST00000518325.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	589	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACCAAGGTAGTGGCGGTGG	0.677																																						dbGAP											0													40.0	48.0	45.0					5																	140769218		2190	4293	6483	-	-	-	SO:0001819	synonymous_variant	0			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.1767A>T	5.37:g.140769218A>T			O15099|Q2M267|Q9UN64	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V589	ENST00000519479.1	37	c.1767	CCDS54928.1	5																																																																																			PCDHGB4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253953		0.677	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB4	HGNC	protein_coding	OTTHUMT00000374745.1	15	0.00	0	A	NM_003736		140769218	140769218	+1	no_errors	ENST00000519479	ensembl	human	known	69_37n	silent	3	85.71	18	SNP	1.000	T
PDXDC1	23042	genome.wustl.edu	37	16	15103550	15103550	+	Silent	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr16:15103550C>T	ENST00000396410.4	+	8	758	c.661C>T	c.(661-663)Ctg>Ttg	p.L221L	PDXDC1_ENST00000569715.1_Silent_p.L194L|PDXDC1_ENST00000535621.2_Silent_p.L221L|PDXDC1_ENST00000455313.2_Silent_p.L198L|MIR1972-1_ENST00000459337.1_RNA|PDXDC1_ENST00000450288.2_Silent_p.L193L|PDXDC1_ENST00000447912.2_Silent_p.L130L|PDXDC1_ENST00000563679.1_Silent_p.L239L|PDXDC1_ENST00000325823.7_Silent_p.L206L	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	221					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGTTGCCTTCCTGGAGAAACT	0.373																																						dbGAP											0													62.0	73.0	69.0					16																	15103550		2197	4298	6495	-	-	-	SO:0001819	synonymous_variant	0			AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.661C>T	16.37:g.15103550C>T			B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Silent	SNP	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase_major_dom	p.L221	ENST00000396410.4	37	c.661	CCDS32393.1	16																																																																																			PDXDC1	-	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000179889		0.373	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDXDC1	HGNC	protein_coding	OTTHUMT00000389065.2	116	0.00	0	C	NM_015027		15103550	15103550	+1	no_errors	ENST00000396410	ensembl	human	known	69_37n	silent	134	10.67	16	SNP	0.998	T
PHACTR3	116154	genome.wustl.edu	37	20	58349443	58349443	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr20:58349443G>C	ENST00000371015.1	+	7	1539	c.1072G>C	c.(1072-1074)Gaa>Caa	p.E358Q	PHACTR3_ENST00000355648.4_Missense_Mutation_p.E317Q|PHACTR3_ENST00000359926.3_Missense_Mutation_p.E355Q|PHACTR3_ENST00000395636.2_Missense_Mutation_p.E317Q|PHACTR3_ENST00000395639.4_Missense_Mutation_p.E247Q|PHACTR3_ENST00000361300.4_Missense_Mutation_p.E247Q|PHACTR3_ENST00000541461.1_Missense_Mutation_p.E317Q	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	358						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			TGCCGCTAAGGAATCTGAGGA	0.522																																						dbGAP											0													126.0	124.0	124.0					20																	58349443		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.1072G>C	20.37:g.58349443G>C	ENSP00000360054:p.Glu358Gln		B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.E358Q	ENST00000371015.1	37	c.1072	CCDS13480.1	20	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308676	0.60305	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.37752	1.5;1.5;1.18;1.53;1.53;1.53;1.18	5.06	5.06	0.68205	.	0.387803	0.30219	N	0.010123	T	0.46034	0.1372	M	0.71581	2.175	0.53005	D	0.999961	P;P;P	0.50156	0.515;0.726;0.932	B;P;P	0.46026	0.433;0.501;0.501	T	0.49021	-0.8982	10	0.42905	T	0.14	-9.5353	17.4155	0.87498	0.0:0.0:1.0:0.0	.	247;358;355	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	Q	355;358;247;317;317;317;247	ENSP00000353002:E355Q;ENSP00000360054:E358Q;ENSP00000379001:E247Q;ENSP00000442483:E317Q;ENSP00000347866:E317Q;ENSP00000378998:E317Q;ENSP00000354555:E247Q	ENSP00000347866:E317Q	E	+	1	0	PHACTR3	57782838	1.000000	0.71417	0.007000	0.13788	0.598000	0.36846	5.497000	0.66924	2.335000	0.79485	0.655000	0.94253	GAA	PHACTR3	-	NULL	ENSG00000087495		0.522	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHACTR3	HGNC	protein_coding	OTTHUMT00000079923.3	58	0.00	0	G	NM_080672		58349443	58349443	+1	no_errors	ENST00000371015	ensembl	human	known	69_37n	missense	76	27.62	29	SNP	0.989	C
PHF11	51131	genome.wustl.edu	37	13	50098309	50098309	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr13:50098309T>G	ENST00000378319.3	+	8	767	c.726T>G	c.(724-726)caT>caG	p.H242Q	PHF11_ENST00000357596.3_Missense_Mutation_p.H203Q|PHF11_ENST00000488958.1_Missense_Mutation_p.H203Q	NM_001040443.1	NP_001035533.1	Q9UIL8	PHF11_HUMAN	PHD finger protein 11	242					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			large_intestine(3)|lung(1)	4		Lung NSC(96;2.1e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.38e-09)		ACAAAGTTCATTCAATTCCAG	0.333																																						dbGAP											0													55.0	58.0	57.0					13																	50098309		2202	4297	6499	-	-	-	SO:0001583	missense	0			AB011031	CCDS31975.1, CCDS41887.1	13q14.11	2014-05-20			ENSG00000136147	ENSG00000136147		"""Zinc fingers, PHD-type"""	17024	protein-coding gene	gene with protein product	"""IgE responsiveness (atopic)"""	607796				10508479, 15057823	Standard	XM_005266417		Approved	NY-REN-34, BCAP, IGER	uc001vdb.3	Q9UIL8	OTTHUMG00000016916	ENST00000378319.3:c.726T>G	13.37:g.50098309T>G	ENSP00000367570:p.His242Gln		Q5W0A4|Q5W0A6|Q9Y5A2	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,smart_Znf_PHD	p.H242Q	ENST00000378319.3	37	c.726	CCDS31975.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	2.852|2.852	-0.238041|-0.238041	0.05944|0.05944	.|.	.|.	ENSG00000136147|ENSG00000136147	ENST00000378319;ENST00000357596;ENST00000488958|ENST00000426879	T;T;T|.	0.73789|.	-0.78;-0.74;-0.74|.	4.27|4.27	4.27|4.27	0.50696|0.50696	.|.	0.798836|.	0.11180|.	N|.	0.591097|.	T|T	0.39009|0.39009	0.1062|0.1062	L|L	0.43923|0.43923	1.385|1.385	0.09310|0.09310	N|N	1|1	B|.	0.26744|.	0.158|.	B|.	0.24006|.	0.05|.	T|T	0.23655|0.23655	-1.0182|-1.0182	10|5	0.41790|.	T|.	0.15|.	-0.0977|-0.0977	7.4523|7.4523	0.27246|0.27246	0.0:0.1076:0.0:0.8924|0.0:0.1076:0.0:0.8924	.|.	242|.	Q9UIL8|.	PHF11_HUMAN|.	Q|S	242;203;203|197	ENSP00000367570:H242Q;ENSP00000350209:H203Q;ENSP00000417539:H203Q|.	ENSP00000350209:H203Q|.	H|I	+|+	3|2	2|0	PHF11|PHF11	48996310|48996310	0.900000|0.900000	0.30661|0.30661	0.005000|0.005000	0.12908|0.12908	0.005000|0.005000	0.04900|0.04900	0.840000|0.840000	0.27600|0.27600	1.918000|1.918000	0.55548|0.55548	0.482000|0.482000	0.46254|0.46254	CAT|ATT	PHF11	-	NULL	ENSG00000136147		0.333	PHF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHF11	HGNC	protein_coding	OTTHUMT00000044915.1	34	0.00	0	T	NM_016119		50098309	50098309	+1	no_errors	ENST00000378319	ensembl	human	known	69_37n	missense	17	46.88	15	SNP	0.059	G
PLIN4	729359	genome.wustl.edu	37	19	4510826	4510826	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr19:4510826A>T	ENST00000301286.3	-	3	3103	c.3104T>A	c.(3103-3105)cTc>cAc	p.L1035H		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	1035						cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GAAGGTGCTGAGGCCAGTGTG	0.627																																						dbGAP											0													73.0	82.0	79.0					19																	4510826		2125	4248	6373	-	-	-	SO:0001583	missense	0			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.3104T>A	19.37:g.4510826A>T	ENSP00000301286:p.Leu1035His		A6NEI2	Missense_Mutation	SNP	pfam_Perilipin,superfamily_Ankyrin_rpt-contain_dom	p.L1035H	ENST00000301286.3	37	c.3104	CCDS45927.1	19	.	.	.	.	.	.	.	.	.	.	A	14.01	2.408363	0.42715	.	.	ENSG00000167676	ENST00000301286	T	0.13778	2.56	4.13	3.1	0.35709	.	1.484810	0.05107	U	0.488209	T	0.18509	0.0444	L	0.39245	1.2	0.09310	N	1	D	0.61697	0.99	P	0.48901	0.594	T	0.18304	-1.0341	10	0.72032	D	0.01	-3.1004	6.7996	0.23744	0.7921:0.0:0.0:0.2079	.	1035	Q96Q06	PLIN4_HUMAN	H	1035	ENSP00000301286:L1035H	ENSP00000301286:L1035H	L	-	2	0	PLIN4	4461826	0.007000	0.16637	0.000000	0.03702	0.049000	0.14656	1.948000	0.40303	0.445000	0.26639	0.409000	0.27619	CTC	PLIN4	-	NULL	ENSG00000167676		0.627	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLIN4	HGNC	protein_coding	OTTHUMT00000395095.1	57	0.00	0	A	XM_170901		4510826	4510826	-1	no_errors	ENST00000301286	ensembl	human	novel	69_37n	missense	6	80.00	28	SNP	0.000	T
PNPLA8	50640	genome.wustl.edu	37	7	108131874	108131874	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr7:108131874T>C	ENST00000422087.1	-	9	2069	c.1663A>G	c.(1663-1665)Aga>Gga	p.R555G	PNPLA8_ENST00000388728.5_Missense_Mutation_p.R555G|PNPLA8_ENST00000453144.1_Missense_Mutation_p.R455G|PNPLA8_ENST00000257694.8_Missense_Mutation_p.R555G|PNPLA8_ENST00000426128.2_Missense_Mutation_p.R555G|PNPLA8_ENST00000436062.1_Missense_Mutation_p.R555G	NM_015723.3	NP_056538.1	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8	555	Patatin.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|cell death (GO:0008219)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|linoleic acid metabolic process (GO:0043651)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylcholine catabolic process (GO:0034638)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylethanolamine catabolic process (GO:0046338)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)			breast(5)|endometrium(1)|kidney(3)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(3)	29						GTGGGGTTTCTTGCTGTTTCA	0.378																																						dbGAP											0													153.0	145.0	148.0					7																	108131874		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF217519	CCDS34733.1, CCDS59075.1, CCDS59508.1	7q31	2012-07-31			ENSG00000135241	ENSG00000135241		"""Patatin-like phospholipase domain containing"""	28900	protein-coding gene	gene with protein product		612123				10744668, 10833412, 16799181, 19029121	Standard	NM_015723		Approved	IPLA2G, IPLA2-2, iPLA2gamma	uc003vfj.2	Q9NP80	OTTHUMG00000154870	ENST00000422087.1:c.1663A>G	7.37:g.108131874T>C	ENSP00000410804:p.Arg555Gly		A4D0S1|C9JZI4|O95035|Q8N3I3|Q9H7T5|Q9NR17|Q9NUN2|Q9NZ79	Missense_Mutation	SNP	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_ARM-type_fold	p.R555G	ENST00000422087.1	37	c.1663	CCDS34733.1	7	.	.	.	.	.	.	.	.	.	.	T	15.57	2.873034	0.51695	.	.	ENSG00000135241	ENST00000426128;ENST00000257694;ENST00000388728;ENST00000422087;ENST00000453144;ENST00000436062;ENST00000453085	T;T;T;T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-1.3	5.66	5.66	0.87406	Acyl transferase/acyl hydrolase/lysophospholipase (1);Patatin/Phospholipase A2-related (1);	0.000000	0.85682	D	0.000000	T	0.77837	0.4190	L	0.33339	1.005	0.58432	D	0.999995	B	0.33807	0.426	B	0.43508	0.422	T	0.77892	-0.2418	10	0.49607	T	0.09	.	12.8832	0.58028	0.0:0.0:0.1444:0.8556	.	555	Q9NP80	PLPL8_HUMAN	G	555;555;555;555;455;555;455	ENSP00000394988:R555G;ENSP00000257694:R555G;ENSP00000373380:R555G;ENSP00000410804:R555G;ENSP00000387789:R455G;ENSP00000406779:R555G;ENSP00000402274:R455G	ENSP00000257694:R555G	R	-	1	2	PNPLA8	107919110	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.839000	0.55835	2.283000	0.76528	0.477000	0.44152	AGA	PNPLA8	-	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	ENSG00000135241		0.378	PNPLA8-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PNPLA8	HGNC	protein_coding	OTTHUMT00000337475.1	88	0.00	0	T	NM_015723		108131874	108131874	-1	no_errors	ENST00000257694	ensembl	human	known	69_37n	missense	154	12.99	23	SNP	1.000	C
PPRC1	23082	genome.wustl.edu	37	10	103909715	103909715	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr10:103909715G>A	ENST00000278070.2	+	14	4963	c.4924G>A	c.(4924-4926)Gta>Ata	p.V1642I	PPRC1_ENST00000413464.2_Missense_Mutation_p.V1378I|NOLC1_ENST00000488254.2_5'Flank|NOLC1_ENST00000605788.1_5'Flank|NOLC1_ENST00000405356.1_5'Flank|NOLC1_ENST00000603742.1_5'Flank|PPRC1_ENST00000370012.1_Missense_Mutation_p.V609I	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1642					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CCCAGCACCTGTAAAGAGCAA	0.468																																						dbGAP											0													151.0	162.0	158.0					10																	103909715		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.4924G>A	10.37:g.103909715G>A	ENSP00000278070:p.Val1642Ile		Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.V1642I	ENST00000278070.2	37	c.4924	CCDS7529.1	10	.	.	.	.	.	.	.	.	.	.	G	21.5	4.154507	0.78114	.	.	ENSG00000148840	ENST00000278070;ENST00000413464;ENST00000370012	T;T;T	0.34275	1.75;1.89;1.37	5.11	5.11	0.69529	.	0.123818	0.53938	D	0.000043	T	0.52500	0.1738	L	0.43152	1.355	0.24389	N	0.994754	D;D;P	0.71674	0.996;0.998;0.594	P;D;B	0.66084	0.874;0.941;0.365	T	0.46048	-0.9219	10	0.56958	D	0.05	.	18.7337	0.91746	0.0:0.0:1.0:0.0	.	1378;1520;1642	E7EVG6;Q5VV67-2;Q5VV67	.;.;PPRC1_HUMAN	I	1642;1378;609	ENSP00000278070:V1642I;ENSP00000399743:V1378I;ENSP00000359029:V609I	ENSP00000278070:V1642I	V	+	1	0	PPRC1	103899705	0.971000	0.33674	1.000000	0.80357	0.998000	0.95712	1.579000	0.36536	2.655000	0.90218	0.561000	0.74099	GTA	PPRC1	-	NULL	ENSG00000148840		0.468	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPRC1	HGNC	protein_coding	OTTHUMT00000050021.1	49	0.00	0	G	NM_015062		103909715	103909715	+1	no_errors	ENST00000278070	ensembl	human	known	69_37n	missense	36	34.55	19	SNP	1.000	A
PRPF4	9128	genome.wustl.edu	37	9	116053191	116053191	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr9:116053191A>C	ENST00000374198.4	+	13	1372	c.1270A>C	c.(1270-1272)Acc>Ccc	p.T424P	PRPF4_ENST00000374199.4_Missense_Mutation_p.T423P	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	O43172	PRP4_HUMAN	pre-mRNA processing factor 4	424					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)				NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	23						TCACATTGCAACCGGCAGTGG	0.478																																						dbGAP											0													121.0	106.0	111.0					9																	116053191		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001687	CCDS6791.1, CCDS59142.1	9q31-q33	2013-10-03	2013-10-03		ENSG00000136875	ENSG00000136875		"""WD repeat domain containing"""	17349	protein-coding gene	gene with protein product	"""PRP4/STK/WD splicing factor"", ""U4/U6 small nuclear ribonucleoprotein Prp4"""	607795	"""PRP4 pre-mRNA processing factor 4 homolog (yeast)"""			9257651, 9404889	Standard	NM_004697		Approved	Prp4p, HPRP4, HPRP4P, PRP4, SNRNP60	uc004bgx.3	O43172	OTTHUMG00000020517	ENST00000374198.4:c.1270A>C	9.37:g.116053191A>C	ENSP00000363313:p.Thr424Pro		O43445|O43864|Q5T1M8|Q96DG2|Q96IK4	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_PRP4,superfamily_WD40_repeat_dom,smart_SFM,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T424P	ENST00000374198.4	37	c.1270	CCDS6791.1	9	.	.	.	.	.	.	.	.	.	.	A	14.48	2.548474	0.45383	.	.	ENSG00000136875	ENST00000374199;ENST00000374198	T;T	0.68181	-0.31;-0.31	5.75	4.61	0.57282	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.86260	0.5890	H	0.97051	3.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.87899	0.2689	10	0.87932	D	0	.	9.5244	0.39156	0.9208:0.0:0.0792:0.0	.	439;424	Q59EL4;O43172	.;PRP4_HUMAN	P	423;424	ENSP00000363315:T423P;ENSP00000363313:T424P	ENSP00000363313:T424P	T	+	1	0	PRPF4	115093012	1.000000	0.71417	0.988000	0.46212	0.272000	0.26649	5.541000	0.67212	1.011000	0.39340	0.533000	0.62120	ACC	PRPF4	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	ENSG00000136875		0.478	PRPF4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRPF4	HGNC	protein_coding	OTTHUMT00000053708.2	62	0.00	0	A	NM_004697		116053191	116053191	+1	no_errors	ENST00000374198	ensembl	human	known	69_37n	missense	53	37.65	32	SNP	1.000	C
PSMA5	5686	genome.wustl.edu	37	1	109957929	109957929	+	Silent	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:109957929C>T	ENST00000271308.4	-	3	173	c.153G>A	c.(151-153)gaG>gaA	p.E51E	PSMA5_ENST00000538610.1_5'UTR|PSMA5_ENST00000490870.1_5'UTR	NM_002790.3	NP_002781.2	P28066	PSA5_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 5	51					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			kidney(1)|large_intestine(2)|lung(2)	5		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.045)|Colorectal(144;0.116)|Epithelial(280;0.187)|all cancers(265;0.196)|LUSC - Lung squamous cell carcinoma(189;0.235)		TAATTCTCTTCTCCACAGCTA	0.438																																						dbGAP											0													161.0	139.0	147.0					1																	109957929		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X61970	CCDS799.1, CCDS55619.1	1p13	2008-02-05			ENSG00000143106	ENSG00000143106		"""Proteasome (prosome, macropain) subunits"""	9534	protein-coding gene	gene with protein product		176844				1888762	Standard	NM_002790		Approved	ZETA	uc001dxn.3	P28066	OTTHUMG00000012001	ENST00000271308.4:c.153G>A	1.37:g.109957929C>T			B2R8F6|B4E2V4|Q3T1C1|Q6IBF7	Silent	SNP	pfam_Proteasome_sua/b,pfam_Proteasome_asu_N,smart_Proteasome_asu_N	p.E51	ENST00000271308.4	37	c.153	CCDS799.1	1																																																																																			PSMA5	-	pfam_Proteasome_sua/b	ENSG00000143106		0.438	PSMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMA5	HGNC	protein_coding	OTTHUMT00000033192.2	50	0.00	0	C	NM_002790		109957929	109957929	-1	no_errors	ENST00000271308	ensembl	human	known	69_37n	silent	43	33.85	22	SNP	1.000	T
PSMD4	5710	genome.wustl.edu	37	1	151227268	151227268	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:151227268G>C	ENST00000368884.3	+	1	90	c.10G>C	c.(10-12)Gaa>Caa	p.E4Q	PSMD4_ENST00000368881.4_Missense_Mutation_p.E4Q	NM_002810.2	NP_002801.1	P55036	PSMD4_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 4	4					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, base subcomplex (GO:0008540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(7)	11	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GATGGTGTTGGAAAGCACTAT	0.642																																						dbGAP											0													108.0	83.0	91.0					1																	151227268		2201	4297	6498	-	-	-	SO:0001583	missense	0			U51007	CCDS991.1	1q21.2	2008-05-22			ENSG00000159352	ENSG00000159352		"""Proteasome (prosome, macropain) subunits"""	9561	protein-coding gene	gene with protein product		601648				8641424	Standard	XM_005245354		Approved	S5A, AF-1, AF, Rpn10	uc001exl.3	P55036	OTTHUMG00000012349	ENST00000368884.3:c.10G>C	1.37:g.151227268G>C	ENSP00000357879:p.Glu4Gln		D3DV16|Q5VWC5|Q9NS92	Missense_Mutation	SNP	pfam_Ubiquitin-int_motif,pfam_Ssl1-like,smart_VWF_A,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_VWF_A	p.E4Q	ENST00000368884.3	37	c.10	CCDS991.1	1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.471708	0.84533	.	.	ENSG00000159352	ENST00000368884;ENST00000368881	.	.	.	4.93	4.93	0.64822	von Willebrand factor, type A (1);	0.000000	0.64402	D	0.000001	T	0.63082	0.2481	M	0.91663	3.23	0.58432	D	0.999998	P;P	0.43607	0.812;0.63	B;B	0.37508	0.252;0.252	T	0.76160	-0.3061	9	0.66056	D	0.02	-18.405	17.9273	0.88987	0.0:0.0:1.0:0.0	.	4;4	Q5VWC4;P55036	.;PSMD4_HUMAN	Q	4	.	ENSP00000357876:E4Q	E	+	1	0	PSMD4	149493892	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.736000	0.84948	2.558000	0.86282	0.551000	0.68910	GAA	PSMD4	-	smart_VWF_A	ENSG00000159352		0.642	PSMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD4	HGNC	protein_coding	OTTHUMT00000034409.3	78	0.00	0	G	NM_002810		151227268	151227268	+1	no_errors	ENST00000368884	ensembl	human	known	69_37n	missense	87	58.29	123	SNP	1.000	C
PSME3	10197	genome.wustl.edu	37	17	40993571	40993571	+	Silent	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr17:40993571C>T	ENST00000590720.1	+	11	974	c.741C>T	c.(739-741)agC>agT	p.S247S	PSME3_ENST00000592169.1_Silent_p.S191S|PSME3_ENST00000293362.3_Silent_p.S260S|PSME3_ENST00000545225.1_Silent_p.S186S|PSME3_ENST00000541124.1_3'UTR|PSME3_ENST00000441946.2_Silent_p.S258S			P61289	PSME3_HUMAN	proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)	247					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)			NS(1)|cervix(1)|large_intestine(3)|lung(1)	6		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		GGCCCCGGAGCAGCAATGCAG	0.512																																						dbGAP											0													59.0	58.0	59.0					17																	40993571		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U11292	CCDS11442.1, CCDS45689.1, CCDS59290.1	17q12-q21	2004-02-17				ENSG00000131467		"""Proteasome (prosome, macropain) subunits"""	9570	protein-coding gene	gene with protein product		605129				7951316	Standard	NM_005789		Approved	Ki, PA28-gamma, REG-GAMMA, PA28G	uc002ibq.4	P61289		ENST00000590720.1:c.741C>T	17.37:g.40993571C>T			A8K9A3|O35563|P97373|Q12920|Q13172|Q9BQD9	Silent	SNP	pfam_Proteasome_activ_REG_bsu,pfam_Proteasome_activ_REG_asu,superfamily_Proteasome_activ_REG_asu/bsu	p.S260	ENST00000590720.1	37	c.780	CCDS45689.1	17																																																																																			PSME3	-	pfam_Proteasome_activ_REG_bsu,superfamily_Proteasome_activ_REG_asu/bsu	ENSG00000131467		0.512	PSME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME3	HGNC	protein_coding	OTTHUMT00000452430.1	32	0.00	0	C	NM_176863		40993571	40993571	+1	no_errors	ENST00000293362	ensembl	human	known	69_37n	silent	27	50.00	27	SNP	1.000	T
PTPRN	5798	genome.wustl.edu	37	2	220155281	220155281	+	Silent	SNP	C	C	A	rs375833864	byFrequency	TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr2:220155281C>A	ENST00000295718.2	-	22	3087	c.2847G>T	c.(2845-2847)cgG>cgT	p.R949R	PTPRN_ENST00000409251.3_Silent_p.R920R|PTPRN_ENST00000423636.2_Silent_p.R859R|PTPRN_ENST00000497977.1_5'UTR	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	949	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		CAAGGCCAGGCCGCTGGTCAC	0.637																																						dbGAP											0													54.0	41.0	45.0					2																	220155281		2053	4021	6074	-	-	-	SO:0001819	synonymous_variant	0				CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.2847G>T	2.37:g.220155281C>A			B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.R949	ENST00000295718.2	37	c.2847	CCDS2440.1	2																																																																																			PTPRN	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	ENSG00000054356		0.637	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRN	HGNC	protein_coding	OTTHUMT00000256819.2	43	0.00	0	C			220155281	220155281	-1	no_errors	ENST00000295718	ensembl	human	known	69_37n	silent	5	93.42	71	SNP	0.998	A
RAD23A	5886	genome.wustl.edu	37	19	13059325	13059325	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr19:13059325C>G	ENST00000586534.1	+	4	492	c.431C>G	c.(430-432)tCa>tGa	p.S144*	RAD23A_ENST00000316856.3_Nonsense_Mutation_p.S144*|RAD23A_ENST00000541222.1_Intron|RAD23A_ENST00000592268.1_Nonsense_Mutation_p.S144*|RAD23A_ENST00000588826.2_3'UTR			P54725	RD23A_HUMAN	RAD23 homolog A (S. cerevisiae)	144					nucleotide-excision repair (GO:0006289)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)|ubiquitin-specific protease binding (GO:1990381)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12						GTTCCCTCTTCAGGTAGCAGC	0.627								Nucleotide excision repair (NER)																														dbGAP											0													101.0	94.0	96.0					19																	13059325		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS12289.1, CCDS59357.1, CCDS59358.1	19p13.2	2008-07-17	2001-11-28			ENSG00000179262			9812	protein-coding gene	gene with protein product	"""RAD23, yeast homolog, A"""	600061	"""RAD23 (S. cerevisiae) homolog A"""			7851894	Standard	NM_005053		Approved	HHR23A, MGC111083	uc002mvw.2	P54725		ENST00000586534.1:c.431C>G	19.37:g.13059325C>G	ENSP00000467024:p.Ser144*		K7ESE3|Q59EU8|Q5M7Z1	Nonsense_Mutation	SNP	pfam_XPC-bd,pfam_UBA/transl_elong_EF1B_N,pfam_Ubiquitin,pfam_SUMO,superfamily_XPC-bd,superfamily_UBA-like,smart_Ubiquitin,smart_UBA/transl_elong_EF1B_N_euk,smart_STI1_HS-bd,prints_Rad23,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup,tigrfam_Rad23	p.S144*	ENST00000586534.1	37	c.431	CCDS12289.1	19	.	.	.	.	.	.	.	.	.	.	C	35	5.468321	0.96274	.	.	ENSG00000179262	ENST00000316856	.	.	.	4.27	4.27	0.50696	.	0.463760	0.19799	N	0.105798	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-34.822	13.6344	0.62215	0.0:1.0:0.0:0.0	.	.	.	.	X	144	.	ENSP00000321365:S144X	S	+	2	0	RAD23A	12920325	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.368000	0.59505	1.937000	0.56155	0.650000	0.86243	TCA	RAD23A	-	tigrfam_Rad23	ENSG00000179262		0.627	RAD23A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAD23A	HGNC	protein_coding	OTTHUMT00000452752.1	49	0.00	0	C	NM_005053		13059325	13059325	+1	no_errors	ENST00000586534	ensembl	human	known	69_37n	nonsense	33	47.62	30	SNP	1.000	G
RASSF4	83937	genome.wustl.edu	37	10	45487443	45487443	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr10:45487443A>T	ENST00000340258.5	+	10	1011	c.898A>T	c.(898-900)Acc>Tcc	p.T300S	RASSF4_ENST00000374417.2_3'UTR|RASSF4_ENST00000472561.1_3'UTR|RASSF4_ENST00000334940.6_Missense_Mutation_p.T309S	NM_032023.3	NP_114412.2	Q8WYP3	RIN2_HUMAN	Ras association (RalGDS/AF-6) domain family member 4	0					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						AATCAAACTGACCATGAAGTA	0.448																																						dbGAP											0													78.0	79.0	79.0					10																	45487443		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032593	CCDS7208.1	10q11.1	2008-02-22	2008-02-22		ENSG00000107551	ENSG00000107551			20793	protein-coding gene	gene with protein product		610559					Standard	NM_032023		Approved	AD037, MGC44914	uc001jbo.3	Q9H2L5	OTTHUMG00000018060	ENST00000340258.5:c.898A>T	10.37:g.45487443A>T	ENSP00000339692:p.Thr300Ser		Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SARAH	p.T309S	ENST00000340258.5	37	c.925	CCDS7208.1	10	.	.	.	.	.	.	.	.	.	.	A	26.9	4.783855	0.90282	.	.	ENSG00000107551	ENST00000334940;ENST00000340258;ENST00000374411	T;T	0.14022	2.54;2.55	5.91	5.91	0.95273	SARAH (1);	0.000000	0.85682	D	0.000000	T	0.33990	0.0882	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.991;0.994	T	0.01702	-1.1292	10	0.34782	T	0.22	-32.6653	14.3033	0.66368	1.0:0.0:0.0:0.0	.	309;391;300	Q9H2L5-2;Q59FL4;Q9H2L5	.;.;RASF4_HUMAN	S	309;300;391	ENSP00000334543:T309S;ENSP00000339692:T300S	ENSP00000334543:T309S	T	+	1	0	RASSF4	44807449	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.877000	0.69675	2.266000	0.75297	0.533000	0.62120	ACC	RASSF4	-	pfscan_SARAH	ENSG00000107551		0.448	RASSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF4	HGNC	protein_coding	OTTHUMT00000047745.2	56	0.00	0	A	NM_032023		45487443	45487443	+1	no_errors	ENST00000334940	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	1.000	T
RBM15B	29890	genome.wustl.edu	37	3	51430822	51430824	+	In_Frame_Del	DEL	CCA	CCA	-	rs147738916	byFrequency	TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	CCA	CCA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr3:51430822_51430824delCCA	ENST00000323686.4	+	1	2092_2094	c.1992_1994delCCA	c.(1990-1995)ggccac>ggc	p.H670del		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	670	His-rich.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AGGAACGGGGCCACCACCACCAC	0.635																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.1992_1994delCCA	3.37:g.51430831_51430833delCCA	ENSP00000313890:p.His670del		A4QPG7|Q6QE19|Q9BV96	In_Frame_Del	DEL	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.H668in_frame_del	ENST00000323686.4	37	c.1992_1994	CCDS33764.1	3																																																																																			RBM15B	-	NULL	ENSG00000179837		0.635	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM15B	HGNC	protein_coding	OTTHUMT00000346489.1	13	0.00	0	CCA	NM_013286		51430822	51430824	+1	no_errors	ENST00000323686	ensembl	human	novel	69_37n	in_frame_del	12	14.29	2	DEL	1.000:1.000:0.998	-
RIMBP2	23504	genome.wustl.edu	37	12	130898669	130898669	+	Splice_Site	SNP	C	C	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr12:130898669C>A	ENST00000261655.4	-	14	2816		c.e14+1			NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2						negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CCATCCCGCACCTTGATGATC	0.582																																						dbGAP											0													84.0	85.0	85.0					12																	130898669		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2652+1G>T	12.37:g.130898669C>A			Q96ID2	Splice_Site	SNP	-	e12+1	ENST00000261655.4	37	c.2652+1	CCDS31925.1	12	.	.	.	.	.	.	.	.	.	.	C	21.2	4.119173	0.77323	.	.	ENSG00000060709	ENST00000261655;ENST00000536632	.	.	.	4.31	4.31	0.51392	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1345	0.86735	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RIMBP2	129464622	1.000000	0.71417	0.999000	0.59377	0.956000	0.61745	7.697000	0.84279	2.080000	0.62538	0.650000	0.86243	.	RIMBP2	-	-	ENSG00000060709		0.582	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	20	0.00	0	C	NM_015347	Intron	130898669	130898669	-1	no_errors	ENST00000261655	ensembl	human	known	69_37n	splice_site	24	57.14	32	SNP	1.000	A
RIN3	79890	genome.wustl.edu	37	14	93022208	93022208	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr14:93022208C>G	ENST00000216487.7	+	2	316	c.157C>G	c.(157-159)Ctg>Gtg	p.L53V		NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	53					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				CATCAGCATCCTGGAGAAGCT	0.607																																						dbGAP											0													60.0	58.0	59.0					14																	93022208		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		ENST00000216487.7:c.157C>G	14.37:g.93022208C>G	ENSP00000216487:p.Leu53Val		Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	Missense_Mutation	SNP	pfam_VPS9,smart_SH2,smart_VPS9_subgr,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.L53V	ENST00000216487.7	37	c.157	CCDS32144.1	14	.	.	.	.	.	.	.	.	.	.	C	14.10	2.436102	0.43224	.	.	ENSG00000100599	ENST00000216487;ENST00000428147	T	0.11712	2.75	5.32	3.5	0.40072	.	0.000000	0.56097	D	0.000025	T	0.27134	0.0665	M	0.63843	1.955	0.80722	D	1	D	0.63880	0.993	D	0.76071	0.987	T	0.00473	-1.1718	10	0.51188	T	0.08	-19.0369	10.7985	0.46474	0.0:0.8814:0.0:0.1186	.	53	Q8TB24	RIN3_HUMAN	V	53	ENSP00000216487:L53V	ENSP00000216487:L53V	L	+	1	2	RIN3	92091961	0.998000	0.40836	1.000000	0.80357	0.848000	0.48234	1.362000	0.34148	0.733000	0.32492	0.655000	0.94253	CTG	RIN3	-	NULL	ENSG00000100599		0.607	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN3	HGNC	protein_coding	OTTHUMT00000412269.1	48	0.00	0	C			93022208	93022208	+1	no_errors	ENST00000216487	ensembl	human	known	69_37n	missense	13	56.67	17	SNP	1.000	G
RPA3	6119	genome.wustl.edu	37	7	7676652	7676652	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr7:7676652T>A	ENST00000223129.4	-	8	1516	c.345A>T	c.(343-345)ttA>ttT	p.L115F	RPA3_ENST00000396682.2_Missense_Mutation_p.L115F|RPA3_ENST00000401447.1_Missense_Mutation_p.L76F|RPA3_ENST00000406109.1_Missense_Mutation_p.L76F	NM_002947.3	NP_002938.1	P35244	RFA3_HUMAN	replication protein A3, 14kDa	115					base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of cell proliferation (GO:0042127)|regulation of mitotic cell cycle (GO:0007346)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.202)		GCACAATCCCTAAAGGATAAA	0.338								Direct reversal of damage;Nucleotide excision repair (NER)																													Colon(148;376 1816 25359 26011 31717)	dbGAP											0													111.0	115.0	114.0					7																	7676652		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS5356.1	7p21.3	2013-09-23	2002-08-29		ENSG00000106399	ENSG00000106399			10291	protein-coding gene	gene with protein product		179837	"""replication protein A3 (14kD)"""			8454588	Standard	NM_002947		Approved	REPA3	uc003sri.3	P35244	OTTHUMG00000023748	ENST00000223129.4:c.345A>T	7.37:g.7676652T>A	ENSP00000223129:p.Leu115Phe		Q549U6	Missense_Mutation	SNP	pfam_Rep_factor-A_3,superfamily_NA-bd_OB-fold-like	p.L115F	ENST00000223129.4	37	c.345	CCDS5356.1	7	.	.	.	.	.	.	.	.	.	.	T	2.352	-0.348637	0.05208	.	.	ENSG00000106399	ENST00000223129;ENST00000406109;ENST00000396682;ENST00000401447	.	.	.	4.66	1.26	0.21427	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.225469	0.45867	N	0.000324	T	0.13628	0.0330	N	0.13235	0.315	0.24009	N	0.996188	B	0.02656	0.0	B	0.04013	0.001	T	0.14200	-1.0481	9	0.09084	T	0.74	-21.7137	1.3263	0.02126	0.2808:0.3953:0.17:0.1539	.	115	P35244	RFA3_HUMAN	F	115;76;115;76	.	ENSP00000223129:L115F	L	-	3	2	RPA3	7643177	0.997000	0.39634	0.975000	0.42487	0.575000	0.36095	0.536000	0.23129	0.547000	0.28938	0.459000	0.35465	TTA	RPA3	-	superfamily_NA-bd_OB-fold-like	ENSG00000106399		0.338	RPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA3	HGNC	protein_coding	OTTHUMT00000324778.2	68	0.00	0	T	NM_002947		7676652	7676652	-1	no_errors	ENST00000223129	ensembl	human	known	69_37n	missense	11	73.81	31	SNP	0.992	A
RPE65	6121	genome.wustl.edu	37	1	68903958	68903958	+	Missense_Mutation	SNP	C	C	T	rs562037932		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:68903958C>T	ENST00000262340.5	-	10	1093	c.1040G>A	c.(1039-1041)cGt>cAt	p.R347H		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	347					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)			central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						CCAGTTCTCACGTAAATTGGC	0.348													C|||	1	0.000199681	0.0	0.0	5008	,	,		17690	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													71.0	73.0	73.0					1																	68903958		2203	4300	6503	-	-	-	SO:0001583	missense	0			U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.1040G>A	1.37:g.68903958C>T	ENSP00000262340:p.Arg347His		A8K1L0|Q5T9U3	Missense_Mutation	SNP	pfam_Carotenoid_Oase	p.R347H	ENST00000262340.5	37	c.1040	CCDS643.1	1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.652338	0.88056	.	.	ENSG00000116745	ENST00000262340	D	0.95069	-3.6	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.94473	0.8221	M	0.82323	2.585	0.80722	D	1	D	0.54772	0.968	B	0.43916	0.436	D	0.94740	0.7918	10	0.59425	D	0.04	-18.592	19.8379	0.96666	0.0:1.0:0.0:0.0	.	347	Q16518	RPE65_HUMAN	H	347	ENSP00000262340:R347H	ENSP00000262340:R347H	R	-	2	0	RPE65	68676546	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.572000	0.60886	2.695000	0.91970	0.591000	0.81541	CGT	RPE65	-	pfam_Carotenoid_Oase	ENSG00000116745		0.348	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPE65	HGNC	protein_coding	OTTHUMT00000025509.1	57	0.00	0	C	NM_000329		68903958	68903958	-1	no_errors	ENST00000262340	ensembl	human	known	69_37n	missense	50	30.56	22	SNP	1.000	T
RTL1	388015	genome.wustl.edu	37	14	101350433	101350433	+	Silent	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr14:101350433G>A	ENST00000534062.1	-	1	751	c.693C>T	c.(691-693)ttC>ttT	p.F231F	MIR433_ENST00000384837.1_RNA|MIR432_ENST00000606207.1_RNA|MIR431_ENST00000385266.1_RNA|MIR127_ENST00000384876.1_RNA|MIR136_ENST00000385207.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	231					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GGTCGTTATAGAACATTCTTG	0.522																																						dbGAP											0													120.0	102.0	108.0					14																	101350433		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.693C>T	14.37:g.101350433G>A			E9PKS8	Silent	SNP	pfam_Retrotrans_gag,superfamily_Peptidase_aspartic	p.F231	ENST00000534062.1	37	c.693	CCDS53910.1	14																																																																																			RTL1	-	NULL	ENSG00000254656		0.522	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	46	0.00	0	G	NM_001134888		101350433	101350433	-1	no_errors	ENST00000534062	ensembl	human	known	69_37n	silent	34	29.17	14	SNP	0.192	A
RUFY2	55680	genome.wustl.edu	37	10	70153888	70153888	+	Silent	SNP	T	T	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr10:70153888T>A	ENST00000602465.1	-	6	628	c.528A>T	c.(526-528)ggA>ggT	p.G176G	RUFY2_ENST00000388768.2_Silent_p.G211G|RUFY2_ENST00000472394.2_5'UTR|RUFY2_ENST00000399200.2_Silent_p.G142G|RUFY2_ENST00000454950.2_Silent_p.G118G|RUFY2_ENST00000342616.4_Silent_p.G176G			Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain containing 2	225	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)	20						AATCAATCACTCCAACCTGAA	0.244																																						dbGAP											0													20.0	19.0	19.0					10																	70153888		1745	4025	5770	-	-	-	SO:0001819	synonymous_variant	0			AF461266	CCDS41534.1, CCDS44414.1, CCDS60544.1	10q22.2	2007-01-29			ENSG00000204130	ENSG00000204130		"""Zinc fingers, FYVE domain containing"""	19761	protein-coding gene	gene with protein product		610328				11877430	Standard	NM_001042417		Approved	RABIP4R, FLJ10063, KIAA1537, ZFYVE13	uc001job.3	Q8WXA3	OTTHUMG00000018353	ENST00000602465.1:c.528A>T	10.37:g.70153888T>A			B3KXB2|B4DFR0|Q5TC48|Q8IW33|Q96P51|Q9P1Z1	Missense_Mutation	SNP	pfam_Run,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Run,smart_Znf_FYVE,pfscan_Run,pfscan_Znf_FYVE-rel	p.E190V	ENST00000602465.1	37	c.569		10																																																																																			RUFY2	-	NULL	ENSG00000204130		0.244	RUFY2-010	KNOWN	basic|appris_principal	protein_coding	RUFY2	HGNC	protein_coding	OTTHUMT00000467567.1	65	0.00	0	T	NM_017987		70153888	70153888	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000466493	ensembl	human	known	69_37n	missense	28	26.32	10	SNP	1.000	A
RXFP2	122042	genome.wustl.edu	37	13	32340136	32340136	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr13:32340136T>G	ENST00000298386.2	+	5	540	c.469T>G	c.(469-471)Ttc>Gtc	p.F157V	RXFP2_ENST00000380314.1_Missense_Mutation_p.F157V	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	157					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)			cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		AGATAAAGTTTTCATCAAATA	0.303																																						dbGAP											0													53.0	52.0	52.0					13																	32340136		2199	4297	6496	-	-	-	SO:0001583	missense	0			AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.469T>G	13.37:g.32340136T>G	ENSP00000298386:p.Phe157Val		B1ALE9|Q3KU23	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_Leu-rich_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_LDrepeatLR_classA_rpt,pfscan_GPCR_Rhodpsn_supfam,prints_Relaxin_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Gphrmn_rcpt	p.F157V	ENST00000298386.2	37	c.469	CCDS9342.1	13	.	.	.	.	.	.	.	.	.	.	T	20.3	3.963165	0.74016	.	.	ENSG00000133105	ENST00000380314;ENST00000298386	T;T	0.06608	4.06;3.28	4.77	4.77	0.60923	.	0.049573	0.85682	D	0.000000	T	0.32704	0.0838	M	0.93283	3.4	0.53005	D	0.999968	D;D	0.89917	1.0;0.999	D;D	0.78314	0.991;0.985	T	0.39461	-0.9613	10	0.66056	D	0.02	.	12.5576	0.56263	0.0:0.0:0.0:1.0	.	157;157	Q3KU23;Q8WXD0	.;RXFP2_HUMAN	V	157	ENSP00000369670:F157V;ENSP00000298386:F157V	ENSP00000298386:F157V	F	+	1	0	RXFP2	31238136	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.232000	0.58645	1.912000	0.55364	0.533000	0.62120	TTC	RXFP2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000133105		0.303	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RXFP2	HGNC	protein_coding	OTTHUMT00000044399.1	48	0.00	0	T	NM_130806		32340136	32340136	+1	no_errors	ENST00000298386	ensembl	human	known	69_37n	missense	19	51.28	20	SNP	1.000	G
SDCBP2	27111	genome.wustl.edu	37	20	1299057	1299057	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr20:1299057A>G	ENST00000360779.3	-	4	303	c.130T>C	c.(130-132)Tac>Cac	p.Y44H	SDCBP2_ENST00000381812.1_Missense_Mutation_p.Y44H|SDCBP2_ENST00000339987.3_Missense_Mutation_p.Y44H	NM_080489.4	NP_536737.3	Q9H190	SDCB2_HUMAN	syndecan binding protein (syntenin) 2	44					intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	7						AAGTTTGGGTACAAAACTGAT	0.463																																						dbGAP											0													63.0	63.0	63.0					20																	1299057		1874	4106	5980	-	-	-	SO:0001583	missense	0			AF131809	CCDS13013.1, CCDS42848.1	20p13	2008-07-02			ENSG00000125775	ENSG00000125775			15756	protein-coding gene	gene with protein product						11152476	Standard	NM_080489		Approved	ST-2, SITAC18	uc021vzn.1	Q9H190	OTTHUMG00000031661	ENST00000360779.3:c.130T>C	20.37:g.1299057A>G	ENSP00000354013:p.Tyr44His		O95892|Q5W0X1|Q9BZ42|Q9H567|Q9NRY8	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.Y44H	ENST00000360779.3	37	c.130	CCDS42848.1	20	.	.	.	.	.	.	.	.	.	.	A	20.6	4.024522	0.75390	.	.	ENSG00000125775	ENST00000381812;ENST00000360779;ENST00000339987	T;T;T	0.36699	1.24;1.24;1.24	4.82	4.82	0.62117	.	0.000000	0.64402	D	0.000001	T	0.59797	0.2220	M	0.81497	2.545	0.52099	D	0.99994	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.94	T	0.64896	-0.6299	10	0.87932	D	0	-24.3068	10.7034	0.45942	1.0:0.0:0.0:0.0	.	44;44	B4DKI5;Q9H190	.;SDCB2_HUMAN	H	44	ENSP00000371233:Y44H;ENSP00000354013:Y44H;ENSP00000342935:Y44H	ENSP00000342935:Y44H	Y	-	1	0	SDCBP2	1247057	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.493000	0.66899	2.021000	0.59480	0.533000	0.62120	TAC	SDCBP2	-	NULL	ENSG00000125775		0.463	SDCBP2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SDCBP2	HGNC	protein_coding	OTTHUMT00000077513.2	38	0.00	0	A	NM_080489		1299057	1299057	-1	no_errors	ENST00000339987	ensembl	human	known	69_37n	missense	43	18.87	10	SNP	1.000	G
SERHL2	253190	genome.wustl.edu	37	22	42962330	42962330	+	Missense_Mutation	SNP	C	C	A	rs200238208		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr22:42962330C>A	ENST00000327678.5	+	9	736	c.634C>A	c.(634-636)Cag>Aag	p.Q212K	SERHL2_ENST00000407614.4_Missense_Mutation_p.Q32K|RRP7B_ENST00000357802.2_RNA|SERHL2_ENST00000340239.4_Intron|SERHL2_ENST00000335879.5_Missense_Mutation_p.Q148K|RNU6-513P_ENST00000516104.1_RNA|RN7SKP80_ENST00000365188.1_RNA	NM_014509.3	NP_055324.2	Q9NQF3	SERHL_HUMAN	serine hydrolase-like 2	0							hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|lung(3)|skin(1)|stomach(1)	8						GAACAGAGACCAGAGGCTCGC	0.582																																						dbGAP											0													92.0	92.0	92.0					22																	42962330		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS14037.1, CCDS63498.1	22q13	2005-08-09			ENSG00000183569	ENSG00000183569			29446	protein-coding gene	gene with protein product							Standard	NM_014509		Approved		uc003bcr.3	Q9H4I8	OTTHUMG00000150892	ENST00000327678.5:c.634C>A	22.37:g.42962330C>A	ENSP00000331376:p.Gln212Lys		Q5JZ95|Q9UH21	Missense_Mutation	SNP	pfam_AB_hydrolase_1,prints_AB_hydrolase_1	p.Q212K	ENST00000327678.5	37	c.634	CCDS14037.1	22	.	.	.	.	.	.	.	.	.	.	C	5.246	0.230934	0.09969	.	.	ENSG00000183569	ENST00000327678;ENST00000356720;ENST00000407614;ENST00000335879	T;T;T	0.13901	2.55;2.55;2.55	4.2	3.18	0.36537	.	0.587019	0.16270	N	0.221823	T	0.09905	0.0243	L	0.39898	1.24	0.58432	D	0.999996	B;B;B	0.23490	0.086;0.005;0.012	B;B;B	0.21917	0.023;0.037;0.009	T	0.10776	-1.0615	10	0.13108	T	0.6	-4.4144	7.0545	0.25091	0.3452:0.4871:0.1677:0.0	.	229;148;212	B4DHQ4;Q9H4I8-2;Q9H4I8	.;.;SEHL2_HUMAN	K	212;32;32;148	ENSP00000331376:Q212K;ENSP00000385691:Q32K;ENSP00000336578:Q148K	ENSP00000331376:Q212K	Q	+	1	0	SERHL2	41292274	0.855000	0.29742	0.814000	0.32528	0.091000	0.18340	0.519000	0.22862	0.979000	0.38497	-0.268000	0.10319	CAG	SERHL2	-	NULL	ENSG00000183569		0.582	SERHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERHL2	HGNC	protein_coding	OTTHUMT00000320454.1	39	0.00	0	C	NM_014509		42962330	42962330	+1	no_errors	ENST00000327678	ensembl	human	known	69_37n	missense	9	70.00	21	SNP	0.761	A
SERPINE1	5054	genome.wustl.edu	37	7	100777023	100777023	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr7:100777023C>G	ENST00000223095.4	+	5	905	c.748C>G	c.(748-750)Ccc>Gcc	p.P250A	SERPINE1_ENST00000445463.2_Missense_Mutation_p.P235A	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	250					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	CCTGGAACTGCCCTACCACGG	0.547																																						dbGAP											0													204.0	168.0	180.0					7																	100777023		2203	4300	6503	-	-	-	SO:0001583	missense	0			M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.748C>G	7.37:g.100777023C>G	ENSP00000223095:p.Pro250Ala		B7Z4S0|F8WD53	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.P250A	ENST00000223095.4	37	c.748	CCDS5711.1	7	.	.	.	.	.	.	.	.	.	.	C	23.0	4.361205	0.82353	.	.	ENSG00000106366	ENST00000223095;ENST00000445463;ENST00000536888	D;D	0.88664	-2.41;-2.41	5.67	5.67	0.87782	Serpin domain (3);	0.000000	0.85682	D	0.000000	D	0.95385	0.8502	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95763	0.8802	10	0.72032	D	0.01	.	17.2567	0.87059	0.0:1.0:0.0:0.0	.	235;250	F8WD53;P05121	.;PAI1_HUMAN	A	250;235;27	ENSP00000223095:P250A;ENSP00000396766:P235A	ENSP00000223095:P250A	P	+	1	0	SERPINE1	100563743	1.000000	0.71417	0.999000	0.59377	0.649000	0.38597	6.285000	0.72658	2.666000	0.90696	0.561000	0.74099	CCC	SERPINE1	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000106366		0.547	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINE1	HGNC	protein_coding	OTTHUMT00000347458.1	50	0.00	0	C	NM_000602		100777023	100777023	+1	no_errors	ENST00000223095	ensembl	human	known	69_37n	missense	41	42.25	30	SNP	1.000	G
SI	6476	genome.wustl.edu	37	3	164733798	164733798	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr3:164733798T>A	ENST00000264382.3	-	32	3892	c.3830A>T	c.(3829-3831)gAc>gTc	p.D1277V		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1277	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	CTGAGGAAGGTCCTGGAATGC	0.378										HNSCC(35;0.089)																												dbGAP											0													182.0	193.0	189.0					3																	164733798		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3830A>T	3.37:g.164733798T>A	ENSP00000264382:p.Asp1277Val		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.D1277V	ENST00000264382.3	37	c.3830	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	T	9.711	1.156953	0.21454	.	.	ENSG00000090402	ENST00000264382	D	0.95690	-3.78	5.05	1.24	0.21308	Glycoside hydrolase, superfamily (1);	0.896444	0.09761	N	0.759225	D	0.96188	0.8757	M	0.87682	2.9	0.09310	N	1	B	0.27229	0.172	B	0.42593	0.392	D	0.92037	0.5638	10	0.72032	D	0.01	.	5.1261	0.14886	0.0:0.3037:0.1574:0.5389	.	1277	P14410	SUIS_HUMAN	V	1277	ENSP00000264382:D1277V	ENSP00000264382:D1277V	D	-	2	0	SI	166216492	0.204000	0.23447	0.001000	0.08648	0.039000	0.13416	1.360000	0.34125	0.393000	0.25203	0.482000	0.46254	GAC	SI	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000090402		0.378	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	85	0.00	0	T	NM_001041		164733798	164733798	-1	no_errors	ENST00000264382	ensembl	human	known	69_37n	missense	75	36.36	44	SNP	0.002	A
SIN3B	23309	genome.wustl.edu	37	19	16964996	16964996	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr19:16964996C>G	ENST00000248054.5	+	8	1003	c.982C>G	c.(982-984)Ctc>Gtc	p.L328V	SIN3B_ENST00000596802.1_Missense_Mutation_p.L328V|SIN3B_ENST00000379803.1_Missense_Mutation_p.L328V					SIN3 transcription regulator family member B											endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						TGAAAACTTCCTCCGCTGCAT	0.612																																						dbGAP											0													61.0	57.0	58.0					19																	16964996		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.982C>G	19.37:g.16964996C>G	ENSP00000248054:p.Leu328Val			Missense_Mutation	SNP	pfam_PAH,pfam_HDAC_interact,superfamily_PAH,smart_HDAC_interact	p.L328V	ENST00000248054.5	37	c.982		19	.	.	.	.	.	.	.	.	.	.	C	22.4	4.279577	0.80692	.	.	ENSG00000127511	ENST00000379803;ENST00000248054	T;T	0.75589	-0.95;-0.53	5.09	5.09	0.68999	.	0.064390	0.64402	D	0.000007	D	0.89795	0.6818	M	0.93420	3.415	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.998	D	0.92232	0.5793	10	0.62326	D	0.03	-3.002	17.4651	0.87630	0.0:1.0:0.0:0.0	.	328;328;328	O75182-2;O75182;O75182-3	.;SIN3B_HUMAN;.	V	328	ENSP00000369131:L328V;ENSP00000248054:L328V	ENSP00000248054:L328V	L	+	1	0	SIN3B	16825996	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.865000	0.56033	2.360000	0.80028	0.561000	0.74099	CTC	SIN3B	-	pfam_PAH,superfamily_PAH	ENSG00000127511		0.612	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	SIN3B	HGNC	protein_coding	OTTHUMT00000462846.1	33	0.00	0	C	NM_015260		16964996	16964996	+1	no_errors	ENST00000379803	ensembl	human	known	69_37n	missense	34	40.35	23	SNP	1.000	G
SLC12A8	84561	genome.wustl.edu	37	3	124829135	124829135	+	Silent	SNP	C	C	G	rs373589614		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr3:124829135C>G	ENST00000393469.4	-	8	1006	c.957G>C	c.(955-957)tcG>tcC	p.S319S	SLC12A8_ENST00000423114.2_Silent_p.S348S|SLC12A8_ENST00000430155.2_Silent_p.S120S|SLC12A8_ENST00000314584.7_Silent_p.S72S|SLC12A8_ENST00000465475.1_5'UTR|SLC12A8_ENST00000469902.1_Silent_p.S319S	NM_001195483.1	NP_001182412	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	319				S -> P (in Ref. 1; AAM73657). {ECO:0000305}.	potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(12)	16						AAGCCAGGGACGAGATGTATA	0.547																																						dbGAP											0													91.0	100.0	97.0					3																	124829135		1940	4144	6084	-	-	-	SO:0001819	synonymous_variant	0				CCDS43143.1	3q21.2	2013-07-18	2013-07-18		ENSG00000221955	ENSG00000221955		"""Solute carriers"""	15595	protein-coding gene	gene with protein product	"""solute carrier family 12 (sodium/potassium/chloride transporters), member 8"", ""cation-chloride cotransporter 9"""	611316				11863360	Standard	NM_024628		Approved	CCC9	uc003ehv.4	A0AV02	OTTHUMG00000159483	ENST00000393469.4:c.957G>C	3.37:g.124829135C>G			C9JJJ2|Q68D04|Q6I9Z2|Q6P4C0|Q7Z3A6|Q86WK0|Q8NFX9|Q8WUI3|Q96RF9|Q9H5P9	Silent	SNP	pfam_AA-permease_dom,superfamily_ABC_transptrTM_dom_typ1	p.S348	ENST00000393469.4	37	c.1044	CCDS43143.1	3																																																																																			SLC12A8	-	pfam_AA-permease_dom	ENSG00000221955		0.547	SLC12A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A8	HGNC	protein_coding	OTTHUMT00000355711.4	31	0.00	0	C	NM_024628		124829135	124829135	-1	no_errors	ENST00000423114	ensembl	human	known	69_37n	silent	38	33.33	19	SNP	0.370	G
SMG1	23049	genome.wustl.edu	37	16	18841257	18841257	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr16:18841257delT	ENST00000446231.2	-	53	9536	c.9124delA	c.(9124-9126)acafs	p.T3042fs	SMG1_ENST00000389467.3_Frame_Shift_Del_p.T3042fs			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	3042					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CCTGACAATGTTTTAGAAAAG	0.368																																						dbGAP											0													35.0	31.0	32.0					16																	18841257		1828	4086	5914	-	-	-	SO:0001589	frameshift_variant	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.9124delA	16.37:g.18841257delT	ENSP00000402515:p.Thr3042fs		O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Frame_Shift_Del	DEL	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.T3042fs	ENST00000446231.2	37	c.9124	CCDS45430.1	16																																																																																			SMG1	-	NULL	ENSG00000157106		0.368	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	36	0.00	0	T	NM_015092		18841257	18841257	-1	no_errors	ENST00000389467	ensembl	human	known	69_37n	frame_shift_del	17	43.33	13	DEL	1.000	-
SP100	6672	genome.wustl.edu	37	2	231334496	231334496	+	Intron	DEL	A	A	-	rs372197214		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr2:231334496delA	ENST00000264052.5	+	15	1700				SP100_ENST00000409341.1_Intron|SP100_ENST00000427101.2_Intron|SP100_ENST00000341950.4_Frame_Shift_Del_p.L450fs|SP100_ENST00000409112.1_Intron|SP100_ENST00000409897.1_Intron|SP100_ENST00000409824.1_Intron|SP100_ENST00000340126.4_Intron	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen						cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TCCCAAAGTTAAAAAAAAAAA	0.363																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.1346-234A>-	2.37:g.231334496delA			B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Frame_Shift_Del	DEL	pfam_Sp100	p.K453fs	ENST00000264052.5	37	c.1350	CCDS2477.1	2																																																																																			SP100	-	NULL	ENSG00000067066		0.363	SP100-001	KNOWN	basic|CCDS	protein_coding	SP100	HGNC	protein_coding	OTTHUMT00000256914.2	8	0.00	0	A	NM_003113		231334496	231334496	+1	no_errors	ENST00000341950	ensembl	human	known	69_37n	frame_shift_del	12	14.29	2	DEL	0.007	-
SSC5D	284297	genome.wustl.edu	37	19	56029455	56029455	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr19:56029455C>A	ENST00000389623.6	+	14	3835	c.3812C>A	c.(3811-3813)cCc>cAc	p.P1271H		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1271	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						accatgcagcccaccacgatg	0.632																																						dbGAP											0													621.0	625.0	624.0					19																	56029455		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3812C>A	19.37:g.56029455C>A	ENSP00000374274:p.Pro1271His		B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.P1271H	ENST00000389623.6	37	c.3812	CCDS46196.1	19	.	.	.	.	.	.	.	.	.	.	-	10.44	1.350268	0.24512	.	.	ENSG00000179954	ENST00000389623	T	0.02015	4.5	2.78	-0.151	0.13411	.	.	.	.	.	T	0.01800	0.0057	N	0.14661	0.345	0.09310	N	1	D	0.67145	0.996	P	0.46172	0.506	T	0.50508	-0.8820	9	0.87932	D	0	.	4.107	0.10041	0.0:0.4952:0.0:0.5048	.	1271	A1L4H1	SRCRL_HUMAN	H	1271	ENSP00000374274:P1271H	ENSP00000374274:P1271H	P	+	2	0	SSC5D	60721267	0.001000	0.12720	0.002000	0.10522	0.133000	0.20885	0.992000	0.29667	0.267000	0.21916	0.282000	0.19409	CCC	SSC5D	-	NULL	ENSG00000179954		0.632	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSC5D	HGNC	protein_coding	OTTHUMT00000453345.2	191	0.00	0	C	XM_001718392		56029455	56029455	+1	no_errors	ENST00000389623	ensembl	human	known	69_37n	missense	141	19.43	34	SNP	0.001	A
STK31	56164	genome.wustl.edu	37	7	23809335	23809335	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr7:23809335C>G	ENST00000355870.3	+	13	1792	c.1673C>G	c.(1672-1674)aCt>aGt	p.T558S	STK31_ENST00000405627.3_3'UTR|STK31_ENST00000354639.3_Missense_Mutation_p.T535S|STK31_ENST00000428484.1_Missense_Mutation_p.T535S|STK31_ENST00000433467.2_Missense_Mutation_p.T558S	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	558						acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						CTAGAGAAGACTGAGTCAAGT	0.388																																						dbGAP											0													201.0	197.0	198.0					7																	23809335		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.1673C>G	7.37:g.23809335C>G	ENSP00000348132:p.Thr558Ser		B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	pfam_Tudor,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Tudor,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Tudor,pfscan_Prot_kinase_cat_dom	p.T558S	ENST00000355870.3	37	c.1673	CCDS5386.1	7	.	.	.	.	.	.	.	.	.	.	C	13.19	2.163057	0.38217	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.69175	-0.38;1.35;-0.38;-0.38	5.27	4.27	0.50696	.	0.441438	0.24276	N	0.039950	T	0.57446	0.2054	L	0.54323	1.7	0.24137	N	0.995743	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.49588	-0.8924	10	0.48119	T	0.1	-2.8494	7.2049	0.25901	0.0:0.7736:0.0:0.2264	.	558;558	B4DZ06;Q9BXU1	.;STK31_HUMAN	S	558;558;535;535	ENSP00000348132:T558S;ENSP00000411852:T558S;ENSP00000346660:T535S;ENSP00000406146:T535S	ENSP00000346660:T535S	T	+	2	0	STK31	23775860	0.979000	0.34478	0.999000	0.59377	0.995000	0.86356	0.828000	0.27435	2.477000	0.83638	0.655000	0.94253	ACT	STK31	-	NULL	ENSG00000196335		0.388	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK31	HGNC	protein_coding	OTTHUMT00000214036.2	63	0.00	0	C	NM_031414		23809335	23809335	+1	no_errors	ENST00000355870	ensembl	human	known	69_37n	missense	10	78.72	37	SNP	0.998	G
STXBP5	134957	genome.wustl.edu	37	6	147636833	147636833	+	Silent	SNP	A	A	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr6:147636833A>C	ENST00000321680.6	+	15	1585	c.1585A>C	c.(1585-1587)Aga>Cga	p.R529R	STXBP5_ENST00000367481.3_Silent_p.R529R|STXBP5_ENST00000367480.3_Silent_p.R529R|STXBP5_ENST00000179882.6_Silent_p.R200R	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	529					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		CATTATTTATAGATTCAGCAA	0.373																																						dbGAP											0													152.0	148.0	149.0					6																	147636833		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.1585A>C	6.37:g.147636833A>C			Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Silent	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin,prints_Lethal2_giant	p.R529	ENST00000321680.6	37	c.1585	CCDS47499.1	6																																																																																			STXBP5	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000164506		0.373	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STXBP5	HGNC	protein_coding	OTTHUMT00000042606.1	64	0.00	0	A			147636833	147636833	+1	no_errors	ENST00000321680	ensembl	human	known	69_37n	silent	25	35.90	14	SNP	1.000	C
TIMP4	7079	genome.wustl.edu	37	3	12203643	12203643	+	5'Flank	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr3:12203643C>T	ENST00000287814.4	-	0	0				SYN2_ENST00000432424.2_RNA	NM_003256.3	NP_003247.1	Q99727	TIMP4_HUMAN	TIMP metallopeptidase inhibitor 4						central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|ovulation cycle (GO:0042698)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)	extracellular space (GO:0005615)|sarcomere (GO:0030017)	metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11						GCAACAACTACAAGGCTTACA	0.498																																					Melanoma(199;1446 2144 30617 38794 51714)	dbGAP											0													75.0	78.0	77.0					3																	12203643		2172	4291	6463	-	-	-	SO:0001631	upstream_gene_variant	0			U76456	CCDS2608.1	3p25	2005-10-31	2005-08-08		ENSG00000157150	ENSG00000157150			11823	protein-coding gene	gene with protein product		601915	"""tissue inhibitor of metalloproteinase 4"""			8939999, 9693046	Standard	NM_003256		Approved		uc003bwo.3	Q99727	OTTHUMG00000129763		3.37:g.12203643C>T	Exception_encountered		B2R7K6	Missense_Mutation	SNP	NULL	p.T332I	ENST00000287814.4	37	c.995	CCDS2608.1	3																																																																																			SYN2	-	NULL	ENSG00000157152		0.498	TIMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYN2	HGNC	protein_coding	OTTHUMT00000251978.1	35	0.00	0	C	NM_003256		12203643	12203643	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000426379	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	1.000	T
SYNE2	23224	genome.wustl.edu	37	14	64608066	64608066	+	Nonsense_Mutation	SNP	C	C	G	rs149790950	byFrequency	TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr14:64608066C>G	ENST00000344113.4	+	81	15196	c.14984C>G	c.(14983-14985)tCa>tGa	p.S4995*	SYNE2_ENST00000554584.1_Nonsense_Mutation_p.S4912*|SYNE2_ENST00000555002.1_Nonsense_Mutation_p.S1629*|SYNE2_ENST00000358025.3_Nonsense_Mutation_p.S4995*|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000357395.3_Nonsense_Mutation_p.S1380*|SYNE2_ENST00000394768.2_Nonsense_Mutation_p.S1380*	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4995					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TAGGAGTTTTCAAAAGAAGTT	0.348																																						dbGAP											0													44.0	44.0	44.0					14																	64608066		2199	4299	6498	-	-	-	SO:0001587	stop_gained	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.14984C>G	14.37:g.64608066C>G	ENSP00000341781:p.Ser4995*		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Nonsense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.S4995*	ENST00000344113.4	37	c.14984	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	C	56	26.873420	0.99970	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	.	.	.	5.59	4.7	0.59300	.	0.656385	0.13211	N	0.405166	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	15.1332	0.72542	0.0:0.9314:0.0:0.0686	.	.	.	.	X	4995;1380;4995;4912;4918;1629;1380	.	ENSP00000261678:S4918X	S	+	2	0	SYNE2	63677819	0.997000	0.39634	0.988000	0.46212	0.991000	0.79684	4.509000	0.60448	1.506000	0.48736	0.644000	0.83932	TCA	SYNE2	-	smart_Spectrin/alpha-actinin	ENSG00000054654		0.348	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	35	0.00	0	C	NM_182914		64608066	64608066	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	nonsense	18	52.63	20	SNP	1.000	G
SYNPO2	171024	genome.wustl.edu	37	4	119951302	119951302	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr4:119951302C>A	ENST00000429713.2	+	4	1554	c.1372C>A	c.(1372-1374)Caa>Aaa	p.Q458K	SYNPO2_ENST00000434046.2_Missense_Mutation_p.Q458K|SYNPO2_ENST00000307142.4_Missense_Mutation_p.Q458K|SYNPO2_ENST00000448416.2_Intron	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	458						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CGACAACACACAAGTTGTGAA	0.463																																						dbGAP											0													155.0	153.0	153.0					4																	119951302		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.1372C>A	4.37:g.119951302C>A	ENSP00000395143:p.Gln458Lys		B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.Q458K	ENST00000429713.2	37	c.1372	CCDS47129.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.231|6.231	0.410764|0.410764	0.11812|0.11812	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000307142;ENST00000429713;ENST00000434046|ENST00000504178	T;T;T|T	0.07688|0.10477	3.17;3.18;3.17|2.87	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.667620|.	0.14296|.	N|.	0.328598|.	T|T	0.11879|0.11879	0.0289|0.0289	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	0.999991|0.999991	B;B;B;B|.	0.17667|.	0.013;0.023;0.013;0.013|.	B;B;B;B|.	0.15052|.	0.003;0.012;0.003;0.003|.	T|T	0.30446|0.30446	-0.9978|-0.9978	10|6	0.07813|.	T|.	0.8|.	-1.1218|-1.1218	15.2192|15.2192	0.73296|0.73296	0.1493:0.8507:0.0:0.0|0.1493:0.8507:0.0:0.0	.|.	458;458;458;458|.	B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6|.	.;.;.;SYNP2_HUMAN|.	K|K	458|409	ENSP00000306015:Q458K;ENSP00000395143:Q458K;ENSP00000390965:Q458K|ENSP00000425496:T409K	ENSP00000306015:Q458K|.	Q|T	+|+	1|2	0|0	SYNPO2|SYNPO2	120170750|120170750	0.765000|0.765000	0.28485|0.28485	0.127000|0.127000	0.21898|0.21898	0.064000|0.064000	0.16182|0.16182	2.372000|2.372000	0.44257|0.44257	2.596000|2.596000	0.87737|0.87737	0.563000|0.563000	0.77884|0.77884	CAA|ACA	SYNPO2	-	NULL	ENSG00000172403		0.463	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	SYNPO2	HGNC	protein_coding	OTTHUMT00000364020.1	69	0.00	0	C			119951302	119951302	+1	no_errors	ENST00000307142	ensembl	human	known	69_37n	missense	100	13.04	15	SNP	0.010	A
SYNPR	132204	genome.wustl.edu	37	3	63466633	63466633	+	Splice_Site	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr3:63466633G>A	ENST00000295894.5	+	2	518		c.e2+1		SYNPR_ENST00000465156.1_Splice_Site|SYNPR_ENST00000478744.1_Splice_Site|SYNPR_ENST00000479198.1_Splice_Site|SYNPR-AS1_ENST00000488201.1_RNA|SYNPR_ENST00000460711.1_Splice_Site|SYNPR_ENST00000478300.1_Splice_Site	NM_144642.4	NP_653243.1	Q8TBG9	SYNPR_HUMAN	synaptoporin							cell junction (GO:0030054)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)	transporter activity (GO:0005215)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	8				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)		ACCCATTCAGGTAGGGAATGG	0.498																																					NSCLC(29;1052 1116 20025 32519)	dbGAP											0													143.0	144.0	144.0					3																	63466633		1973	4158	6131	-	-	-	SO:0001630	splice_region_variant	0			AF411860	CCDS46859.1, CCDS46860.1	3p14.3	2011-07-28			ENSG00000163630	ENSG00000163630			16507	protein-coding gene	gene with protein product						8034131, 12974474	Standard	NM_144642		Approved	MGC26651, SPO	uc003dlp.3	Q8TBG9	OTTHUMG00000158699	ENST00000295894.5:c.149+1G>A	3.37:g.63466633G>A			B2R675|G5E9W4	Splice_Site	SNP	-	e3+1	ENST00000295894.5	37	c.209+1	CCDS46860.1	3	.	.	.	.	.	.	.	.	.	.	G	21.9	4.211350	0.79240	.	.	ENSG00000163630	ENST00000478300;ENST00000295894;ENST00000479198;ENST00000460711;ENST00000465156	.	.	.	4.74	4.74	0.60224	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0849	0.86609	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SYNPR	63441673	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	9.420000	0.97426	2.343000	0.79666	0.557000	0.71058	.	SYNPR	-	-	ENSG00000163630		0.498	SYNPR-004	KNOWN	basic|CCDS	protein_coding	SYNPR	HGNC	protein_coding	OTTHUMT00000351787.1	51	0.00	0	G		Intron	63466633	63466633	+1	no_errors	ENST00000478300	ensembl	human	known	69_37n	splice_site	20	39.39	13	SNP	1.000	A
TBC1D13	54662	genome.wustl.edu	37	9	131553046	131553046	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr9:131553046T>C	ENST00000372648.5	+	3	280	c.130T>C	c.(130-132)Tgc>Cgc	p.C44R	TBC1D13_ENST00000223865.8_Missense_Mutation_p.C44R|TBC1D13_ENST00000539497.1_Intron|TBC1D13_ENST00000466056.1_3'UTR	NM_018201.3	NP_060671.3	Q9NVG8	TBC13_HUMAN	TBC1 domain family, member 13	44	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	6						GCGGTGCCTCTGCTGGAAGGT	0.647																																						dbGAP											0													93.0	98.0	96.0					9																	131553046		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001605	CCDS6911.1, CCDS69677.1	9q34.13	2013-07-09			ENSG00000107021	ENSG00000107021			25571	protein-coding gene	gene with protein product						22762500	Standard	XM_005252060		Approved	FLJ10743	uc010myj.3	Q9NVG8	OTTHUMG00000020760	ENST00000372648.5:c.130T>C	9.37:g.131553046T>C	ENSP00000361731:p.Cys44Arg		A7E2E7|B3KW04|B9EGJ8|Q5T270|Q5T271	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.C44R	ENST00000372648.5	37	c.130	CCDS6911.1	9	.	.	.	.	.	.	.	.	.	.	T	22.4	4.285106	0.80803	.	.	ENSG00000107021	ENST00000372648;ENST00000223865	T;T	0.04119	3.7;3.7	4.97	4.97	0.65823	Rab-GAP/TBC domain (3);	0.000000	0.85682	D	0.000000	T	0.17959	0.0431	M	0.62088	1.915	0.80722	D	1	D;D	0.69078	0.997;0.993	D;D	0.74674	0.984;0.926	T	0.00241	-1.1886	10	0.66056	D	0.02	-20.9948	13.8418	0.63444	0.0:0.0:0.0:1.0	.	44;44	Q9NVG8-2;Q9NVG8	.;TBC13_HUMAN	R	44	ENSP00000361731:C44R;ENSP00000223865:C44R	ENSP00000223865:C44R	C	+	1	0	TBC1D13	130592867	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.882000	0.75589	1.874000	0.54306	0.379000	0.24179	TGC	TBC1D13	-	superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000107021		0.647	TBC1D13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D13	HGNC	protein_coding	OTTHUMT00000054496.1	37	0.00	0	T	NM_018201		131553046	131553046	+1	no_errors	ENST00000372648	ensembl	human	known	69_37n	missense	9	79.07	34	SNP	1.000	C
TBC1D20	128637	genome.wustl.edu	37	20	420924	420924	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr20:420924G>T	ENST00000354200.4	-	6	883	c.736C>A	c.(736-738)Cac>Aac	p.H246N	TBC1D20_ENST00000461188.1_5'UTR	NM_144628.2	NP_653229.1	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20	246	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				acrosome assembly (GO:0001675)|cargo loading into COPII-coated vesicle (GO:0090110)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|lens fiber cell morphogenesis (GO:0070309)|lipid particle organization (GO:0034389)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|seminiferous tubule development (GO:0072520)|virion assembly (GO:0019068)	endoplasmic reticulum membrane (GO:0005789)|integral component of Golgi membrane (GO:0030173)|nuclear membrane (GO:0031965)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(17;0.228)|Breast(17;0.231)				ATCAGTGGGTGGCAGGCCAGG	0.562																																						dbGAP											0													83.0	66.0	72.0					20																	420924		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055573	CCDS13002.1	20p13	2013-07-10	2005-01-05	2005-01-05	ENSG00000125875	ENSG00000125875			16133	protein-coding gene	gene with protein product		611663	"""chromosome 20 open reading frame 140"""	C20orf140		17901050	Standard	XM_005260661		Approved	dJ852M4.2	uc002wds.3	Q96BZ9	OTTHUMG00000031637	ENST00000354200.4:c.736C>A	20.37:g.420924G>T	ENSP00000346139:p.His246Asn		A8K6I3|B9A6M1|Q5JWQ7|Q6ZSY8|Q96NE1|Q9BYM7|Q9H140	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.H246N	ENST00000354200.4	37	c.736	CCDS13002.1	20	.	.	.	.	.	.	.	.	.	.	G	15.73	2.918668	0.52546	.	.	ENSG00000125875	ENST00000354200;ENST00000246077	T	0.21191	2.02	5.65	5.65	0.86999	Rab-GAP/TBC domain (4);	0.103825	0.64402	D	0.000001	T	0.24392	0.0591	L	0.58810	1.83	0.80722	D	1	P	0.35844	0.524	B	0.38378	0.272	T	0.02491	-1.1151	10	0.09590	T	0.72	-28.9868	17.2512	0.87043	0.0:0.0:1.0:0.0	.	246	Q96BZ9	TBC20_HUMAN	N	246;271	ENSP00000346139:H246N	ENSP00000246077:H271N	H	-	1	0	TBC1D20	368924	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.419000	0.97397	2.824000	0.97209	0.655000	0.94253	CAC	TBC1D20	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000125875		0.562	TBC1D20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D20	HGNC	protein_coding	OTTHUMT00000251397.2	40	0.00	0	G	NM_144628		420924	420924	-1	no_errors	ENST00000354200	ensembl	human	known	69_37n	missense	40	14.89	7	SNP	1.000	T
TCEB1	6921	genome.wustl.edu	37	8	74859004	74859004	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr8:74859004G>A	ENST00000522337.1	-	5	519	c.200C>T	c.(199-201)tCa>tTa	p.S67L	TCEB1_ENST00000519487.1_Missense_Mutation_p.S67L|TCEB1_ENST00000520210.1_Missense_Mutation_p.S51L|TCEB1_ENST00000284811.8_Missense_Mutation_p.S67L|TCEB1_ENST00000520242.1_Missense_Mutation_p.S67L|TCEB1_ENST00000523815.1_Missense_Mutation_p.S67L|TCEB1_ENST00000602840.1_Intron|TCEB1_ENST00000518127.1_Missense_Mutation_p.S67L			Q15369	ELOC_HUMAN	transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)	67					cellular response to hypoxia (GO:0071456)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)				endometrium(2)|kidney(3)|lung(1)|prostate(1)	7	Breast(64;0.0311)		Epithelial(68;0.0136)|all cancers(69;0.0431)|BRCA - Breast invasive adenocarcinoma(89;0.0499)			TAGCACATGTGAAGGTATCTC	0.393																																						dbGAP											0													95.0	79.0	85.0					8																	74859004		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34587	CCDS34910.1, CCDS56539.1	8q13.3	2010-04-21	2002-08-29		ENSG00000154582	ENSG00000154582			11617	protein-coding gene	gene with protein product		600788	"""transcription elongation factor B (SIII), polypeptide 1 (15kD, elongin C)"""			7821821, 7660122	Standard	NM_005648		Approved	SIII	uc003xzx.2	Q15369	OTTHUMG00000164501	ENST00000522337.1:c.200C>T	8.37:g.74859004G>A	ENSP00000429906:p.Ser67Leu		E5RGD9|Q567Q6	Missense_Mutation	SNP	pfam_Skp1_comp_POZ,superfamily_BTB/POZ_fold,smart_Skp1_comp	p.S67L	ENST00000522337.1	37	c.200	CCDS34910.1	8	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743519	0.69418	.	.	ENSG00000154582	ENST00000518127;ENST00000520210;ENST00000520242;ENST00000519487;ENST00000284811;ENST00000522337;ENST00000523815;ENST00000519082	T;T;T;T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43	5.66	5.66	0.87406	BTB/POZ fold (2);SKP1 component, POZ (1);	0.000000	0.44688	D	0.000425	T	0.69842	0.3156	H	0.94222	3.51	0.80722	D	1	B	0.09022	0.002	B	0.25506	0.061	T	0.72218	-0.4357	10	0.72032	D	0.01	-2.5615	19.7525	0.96273	0.0:0.0:1.0:0.0	.	67	Q15369	ELOC_HUMAN	L	67;51;67;67;67;67;67;67	ENSP00000428334:S67L;ENSP00000430224:S51L;ENSP00000428171:S67L;ENSP00000429596:S67L;ENSP00000284811:S67L;ENSP00000429906:S67L;ENSP00000428074:S67L;ENSP00000429789:S67L	ENSP00000284811:S67L	S	-	2	0	TCEB1	75021558	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.103000	0.94232	2.669000	0.90835	0.591000	0.81541	TCA	TCEB1	-	pfam_Skp1_comp_POZ,superfamily_BTB/POZ_fold,smart_Skp1_comp	ENSG00000154582		0.393	TCEB1-010	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	TCEB1	HGNC	protein_coding	OTTHUMT00000379020.1	64	0.00	0	G	NM_005648		74859004	74859004	-1	no_errors	ENST00000520242	ensembl	human	known	69_37n	missense	50	67.74	105	SNP	1.000	A
TCP10	6953	genome.wustl.edu	37	6	167789534	167789534	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr6:167789534T>A	ENST00000397829.4	-	6	775	c.608A>T	c.(607-609)aAc>aTc	p.N203I	TCP10_ENST00000366827.2_Missense_Mutation_p.N203I	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10	230						cytosol (GO:0005829)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		GCCACCGGAGTTTTGCGGACT	0.617																																						dbGAP											0													41.0	43.0	42.0					6																	167789534		1965	4173	6138	-	-	-	SO:0001583	missense	0			U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.608A>T	6.37:g.167789534T>A	ENSP00000380929:p.Asn203Ile		Q5JR60|Q6P4F4	Missense_Mutation	SNP	NULL	p.N203I	ENST00000397829.4	37	c.608	CCDS43527.1	6	.	.	.	.	.	.	.	.	.	.	T	11.16	1.555656	0.27739	.	.	ENSG00000203690	ENST00000366827;ENST00000397829	T;T	0.17370	2.28;2.28	1.65	0.463	0.16700	.	.	.	.	.	T	0.03390	0.0098	L	0.34521	1.04	0.09310	N	1	D;D	0.53462	0.96;0.96	B;B	0.38156	0.266;0.266	T	0.32428	-0.9907	9	0.66056	D	0.02	.	3.0896	0.06289	0.0:0.2771:0.0:0.7229	.	230;230	Q12799;Q12799-2	TCP10_HUMAN;.	I	203	ENSP00000355792:N203I;ENSP00000380929:N203I	ENSP00000355792:N203I	N	-	2	0	TCP10	167709524	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	0.161000	0.16481	0.130000	0.18549	0.254000	0.18369	AAC	TCP10	-	NULL	ENSG00000203690		0.617	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCP10	HGNC	protein_coding	OTTHUMT00000365570.1	57	0.00	0	T	NM_004610		167789534	167789534	-1	no_errors	ENST00000397829	ensembl	human	known	69_37n	missense	5	84.85	28	SNP	0.000	A
TGM2	7052	genome.wustl.edu	37	20	36759526	36759526	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr20:36759526C>A	ENST00000361475.2	-	12	2055	c.1882G>T	c.(1882-1884)Ggc>Tgc	p.G628C	TGM2_ENST00000536724.1_Missense_Mutation_p.G568C|TGM2_ENST00000536701.1_Missense_Mutation_p.G547C	NM_004613.2|NM_198951.1	NP_004604.2|NP_945189.1	P21980	TGM2_HUMAN	transglutaminase 2	628					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|branching involved in salivary gland morphogenesis (GO:0060445)|isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein homooligomerization (GO:0051260)|salivary gland cavitation (GO:0060662)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			endometrium(2)|large_intestine(11)|liver(1)|lung(7)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	TCAGTCAGGCCGGCCCCCTCC	0.642																																						dbGAP											0													68.0	63.0	65.0					20																	36759526		2203	4300	6503	-	-	-	SO:0001583	missense	0			M98478	CCDS13302.1	20q12	2013-05-02	2013-05-02		ENSG00000198959	ENSG00000198959	2.3.2.13	"""Transglutaminases"""	11778	protein-coding gene	gene with protein product	"""C polypeptide, protein-glutamine-gamma-glutamyltransferase"""	190196	"""transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7912692, 11390390	Standard	NM_004613		Approved	TGC	uc002xhr.3	P21980	OTTHUMG00000032437	ENST00000361475.2:c.1882G>T	20.37:g.36759526C>A	ENSP00000355330:p.Gly628Cys		E1P5V9|Q16436|Q6B838|Q9BTN7|Q9UH35	Missense_Mutation	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.G628C	ENST00000361475.2	37	c.1882	CCDS13302.1	20	.	.	.	.	.	.	.	.	.	.	C	14.78	2.636334	0.47049	.	.	ENSG00000198959	ENST00000361475;ENST00000536701;ENST00000536724	D;D;D	0.85629	-2.01;-2.01;-2.01	4.96	4.96	0.65561	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.113799	0.64402	D	0.000011	D	0.93743	0.8000	M	0.89840	3.065	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.95058	0.8193	10	0.87932	D	0	-52.9105	17.208	0.86923	0.0:1.0:0.0:0.0	.	568;547;568;628;34	F5H6P0;B4DIT7;B4DTN7;P21980;Q6DKH2	.;.;.;TGM2_HUMAN;.	C	628;547;568	ENSP00000355330:G628C;ENSP00000444701:G547C;ENSP00000437479:G568C	ENSP00000355330:G628C	G	-	1	0	TGM2	36192940	1.000000	0.71417	0.896000	0.35187	0.023000	0.10783	4.568000	0.60857	2.289000	0.77006	0.561000	0.74099	GGC	TGM2	-	pfam_Transglutaminase_C,superfamily_Transglutaminase_C	ENSG00000198959		0.642	TGM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM2	HGNC	protein_coding	OTTHUMT00000079151.2	40	0.00	0	C	NM_198951		36759526	36759526	-1	no_errors	ENST00000361475	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	0.997	A
THBS1	7057	genome.wustl.edu	37	15	39884927	39884927	+	Silent	SNP	T	T	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr15:39884927T>C	ENST00000260356.5	+	17	2856	c.2691T>C	c.(2689-2691)gaT>gaC	p.D897D	CTD-2033D15.1_ENST00000560769.1_RNA	NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	897					activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		GTGACCACGATGATGACAACG	0.527																																						dbGAP											0													159.0	112.0	128.0					15																	39884927		2200	4297	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.2691T>C	15.37:g.39884927T>C			A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Silent	SNP	pfam_Thrombospondin_C,pfam_Thrombospondin_1_rpt,pfam_VWF_C,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Thrombospondin_1_rpt,smart_Laminin_G,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.D897	ENST00000260356.5	37	c.2691	CCDS32194.1	15																																																																																			THBS1	-	pfam_Thrombospondin_3-like_rpt	ENSG00000137801		0.527	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS1	HGNC	protein_coding	OTTHUMT00000257831.2	55	0.00	0	T	NM_003246		39884927	39884927	+1	no_errors	ENST00000260356	ensembl	human	known	69_37n	silent	18	56.10	23	SNP	0.981	C
TM2D2	83877	genome.wustl.edu	37	8	38852899	38852899	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr8:38852899C>G	ENST00000456397.2	-	2	346	c.253G>C	c.(253-255)Gac>Cac	p.D85H	TM2D2_ENST00000397070.2_Missense_Mutation_p.D42H|ADAM9_ENST00000466936.1_5'Flank|ADAM9_ENST00000487273.2_5'Flank|TM2D2_ENST00000412303.1_Missense_Mutation_p.D42H|TM2D2_ENST00000456845.2_Missense_Mutation_p.D42H|ADAM9_ENST00000481513.1_5'Flank|TM2D2_ENST00000522434.1_5'UTR	NM_078473.2	NP_510882.1	Q9BX73	TM2D2_HUMAN	TM2 domain containing 2	85						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6		all_lung(54;0.00338)|Lung NSC(58;0.0133)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			TCCACTGGGTCTTCACATTCT	0.403																																						dbGAP											0													178.0	163.0	168.0					8																	38852899		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF353991	CCDS6111.1, CCDS43733.1	8p11.23	2005-08-09				ENSG00000169490			24127	protein-coding gene	gene with protein product		610081				11278849	Standard	XM_005273657		Approved	BLP1	uc003xmk.3	Q9BX73		ENST00000456397.2:c.253G>C	8.37:g.38852899C>G	ENSP00000416050:p.Asp85His		B2RBK4|D3DSX8|Q8N0X9	Missense_Mutation	SNP	pfam_TM2	p.D85H	ENST00000456397.2	37	c.253	CCDS6111.1	8	.	.	.	.	.	.	.	.	.	.	C	29.9	5.046672	0.93740	.	.	ENSG00000169490	ENST00000456845;ENST00000456397;ENST00000412303;ENST00000397070;ENST00000522142;ENST00000517872;ENST00000520152	.	.	.	5.76	5.76	0.90799	.	0.188456	0.56097	D	0.000036	T	0.76828	0.4042	M	0.67397	2.05	0.80722	D	1	D;P	0.61697	0.99;0.708	P;B	0.60473	0.875;0.351	T	0.77273	-0.2649	9	0.59425	D	0.04	-14.7072	19.571	0.95419	0.0:1.0:0.0:0.0	.	42;85	Q9BX73-2;Q9BX73	.;TM2D2_HUMAN	H	42;85;42;42;42;42;42	.	ENSP00000380260:D42H	D	-	1	0	TM2D2	38972056	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.933000	0.63484	2.713000	0.92767	0.655000	0.94253	GAC	TM2D2	-	NULL	ENSG00000169490		0.403	TM2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM2D2	HGNC	protein_coding	OTTHUMT00000377280.1	68	0.00	0	C	NM_031940		38852899	38852899	-1	no_errors	ENST00000456397	ensembl	human	known	69_37n	missense	104	11.11	13	SNP	1.000	G
TMEM145	284339	genome.wustl.edu	37	19	42821924	42821924	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr19:42821924C>G	ENST00000301204.3	+	12	1005	c.964C>G	c.(964-966)Ctg>Gtg	p.L322V	TMEM145_ENST00000598766.1_Missense_Mutation_p.L346V	NM_173633.2	NP_775904.2	Q8NBT3	TM145_HUMAN	transmembrane protein 145	322					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	27		Prostate(69;0.00682)				GCTCATTGGACTGCAGGTGGC	0.572																																						dbGAP											0													154.0	120.0	132.0					19																	42821924		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075286	CCDS12603.1	19q13.2	2008-02-05				ENSG00000167619			26912	protein-coding gene	gene with protein product							Standard	NM_173633		Approved	FLJ90805	uc002otk.1	Q8NBT3		ENST00000301204.3:c.964C>G	19.37:g.42821924C>G	ENSP00000301204:p.Leu322Val			Missense_Mutation	SNP	pfam_Rhodopsin-like_GPCR_TM_domain	p.L322V	ENST00000301204.3	37	c.964	CCDS12603.1	19	.	.	.	.	.	.	.	.	.	.	C	24.8	4.569356	0.86439	.	.	ENSG00000167619	ENST00000301204	T	0.52057	0.68	4.45	4.45	0.53987	Rhodopsin-like GPCR transmembrane domain (1);	0.111002	0.34879	N	0.003602	T	0.55800	0.1943	M	0.81802	2.56	0.50467	D	0.999873	D	0.53312	0.959	P	0.50590	0.645	T	0.57745	-0.7758	10	0.36615	T	0.2	-17.2612	8.757	0.34652	0.0:0.8946:0.0:0.1054	.	322	Q8NBT3	TM145_HUMAN	V	322	ENSP00000301204:L322V	ENSP00000301204:L322V	L	+	1	2	TMEM145	47513764	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.612000	0.61169	2.198000	0.70561	0.591000	0.81541	CTG	TMEM145	-	pfam_Rhodopsin-like_GPCR_TM_domain	ENSG00000167619		0.572	TMEM145-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM145	HGNC	protein_coding	OTTHUMT00000463737.1	67	0.00	0	C	NM_173633		42821924	42821924	+1	no_errors	ENST00000301204	ensembl	human	known	69_37n	missense	68	42.37	50	SNP	1.000	G
TMEM151B	441151	genome.wustl.edu	37	6	44241130	44241130	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr6:44241130C>T	ENST00000451188.2	+	2	740	c.463C>T	c.(463-465)Cgc>Tgc	p.R155C	TMEM151B_ENST00000438774.2_Missense_Mutation_p.R155C|RP11-444E17.6_ENST00000505802.1_Missense_Mutation_p.P67L	NM_001137560.1	NP_001131032.1	Q8IW70	T151B_HUMAN	transmembrane protein 151B	155						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)	6						ACGTGTGGGCCGCATGCAGCA	0.617																																						dbGAP											0													111.0	92.0	98.0					6																	44241130		692	1591	2283	-	-	-	SO:0001583	missense	0			AK126839	CCDS47437.1	6p21.1	2009-04-17	2007-10-25	2007-10-25	ENSG00000178233	ENSG00000178233			21315	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 137"", ""transmembrane protein 193"""	C6orf137, TMEM193			Standard	NM_001137560		Approved	bA444E17.5	uc003oxh.2	Q8IW70	OTTHUMG00000014765	ENST00000451188.2:c.463C>T	6.37:g.44241130C>T	ENSP00000393161:p.Arg155Cys		Q5T9V7	Missense_Mutation	SNP	NULL	p.R155C	ENST00000451188.2	37	c.463	CCDS47437.1	6	.	.	.	.	.	.	.	.	.	.	C	26.0	4.695641	0.88830	.	.	ENSG00000178233	ENST00000451188;ENST00000438774;ENST00000430110	.	.	.	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	T	0.73659	0.3615	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	0.998;1.0	P;D	0.74023	0.782;0.982	T	0.77627	-0.2517	9	0.87932	D	0	.	13.696	0.62580	0.1546:0.8454:0.0:0.0	.	155;155	Q8IW70;Q8IW70-2	T151B_HUMAN;.	C	155	.	ENSP00000410997:R155C	R	+	1	0	TMEM151B	44349108	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.514000	0.60482	2.443000	0.82685	0.442000	0.29010	CGC	TMEM151B	-	NULL	ENSG00000178233		0.617	TMEM151B-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TMEM151B	HGNC	protein_coding	OTTHUMT00000040740.2	25	0.00	0	C	NM_001039704		44241130	44241130	+1	no_errors	ENST00000451188	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	1.000	T
TNIK	23043	genome.wustl.edu	37	3	170875269	170875269	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr3:170875269G>C	ENST00000436636.2	-	12	1545	c.1201C>G	c.(1201-1203)Cag>Gag	p.Q401E	TNIK_ENST00000475336.1_Missense_Mutation_p.Q401E|TNIK_ENST00000341852.6_Missense_Mutation_p.Q401E|TNIK_ENST00000460047.1_Missense_Mutation_p.Q401E|TNIK_ENST00000488470.1_Missense_Mutation_p.Q401E|TNIK_ENST00000369326.5_Missense_Mutation_p.Q401E|TNIK_ENST00000284483.8_Missense_Mutation_p.Q401E|TNIK_ENST00000470834.1_Missense_Mutation_p.Q401E|TNIK_ENST00000357327.5_Missense_Mutation_p.Q401E|TNIK_ENST00000538048.1_Missense_Mutation_p.Q401E	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	401	Mediates interaction with NEDD4.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			cgccgcctctgctctttctgc	0.647																																						dbGAP											0													12.0	16.0	14.0					3																	170875269		2079	4210	6289	-	-	-	SO:0001583	missense	0			AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.1201C>G	3.37:g.170875269G>C	ENSP00000399511:p.Gln401Glu		A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.Q401E	ENST00000436636.2	37	c.1201	CCDS46956.1	3	.	.	.	.	.	.	.	.	.	.	G	15.21	2.766860	0.49574	.	.	ENSG00000154310	ENST00000436636;ENST00000369326;ENST00000538048;ENST00000341852;ENST00000284483;ENST00000475336;ENST00000357327;ENST00000460047;ENST00000488470;ENST00000470834	T;T;T;T;T;T;T;T;T;T	0.40756	3.76;1.03;1.03;1.02;4.37;1.03;1.03;3.74;3.74;1.03	5.61	5.61	0.85477	.	0.058411	0.64402	N	0.000001	T	0.54515	0.1863	L	0.42487	1.325	0.80722	D	1	P;P;P;P;P;P;P;P	0.43578	0.811;0.811;0.811;0.811;0.811;0.811;0.811;0.713	P;P;P;P;P;P;P;P	0.57960	0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.68	T	0.32134	-0.9918	10	0.20046	T	0.44	.	19.625	0.95674	0.0:0.0:1.0:0.0	.	401;401;401;401;401;401;401;401	Q9UKE5-8;Q9UKE5-6;Q9UKE5-7;Q9UKE5-5;Q9UKE5-4;Q9UKE5-2;Q9UKE5-3;Q9UKE5	.;.;.;.;.;.;.;TNIK_HUMAN	E	401	ENSP00000399511:Q401E;ENSP00000358332:Q401E;ENSP00000443278:Q401E;ENSP00000345352:Q401E;ENSP00000284483:Q401E;ENSP00000418156:Q401E;ENSP00000349880:Q401E;ENSP00000418916:Q401E;ENSP00000418378:Q401E;ENSP00000419990:Q401E	ENSP00000284483:Q401E	Q	-	1	0	TNIK	172357963	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	9.869000	0.99810	2.646000	0.89796	0.555000	0.69702	CAG	TNIK	-	NULL	ENSG00000154310		0.647	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNIK	HGNC	protein_coding	OTTHUMT00000352973.2	13	0.00	0	G	XM_039796		170875269	170875269	-1	no_errors	ENST00000436636	ensembl	human	known	69_37n	missense	23	39.47	15	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7579359	7579360	+	Frame_Shift_Ins	INS	-	-	GA	rs587781371|rs587780066		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr17:7579359_7579360insGA	ENST00000269305.4	-	4	516_517	c.327_328insTC	c.(325-330)ttccgtfs	p.R110fs	TP53_ENST00000455263.2_Frame_Shift_Ins_p.R110fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.R110fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.R110fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.R110fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Frame_Shift_Ins_p.R110fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	110	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in a sporadic cancer; somatic mutation).|R -> H (in sporadic cancers; somatic mutation).|R -> L (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation).|R -> P (in sporadic cancers; somatic mutation; dbSNP:rs11540654). {ECO:0000269|PubMed:17224074}.|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R110fs*13(9)|p.0?(8)|p.R110C(7)|p.G59fs*23(3)|p.G108_F109delGF(2)|p.F109_R110delFR(2)|p.V73fs*9(1)|p.F109_R110insXX(1)|p.G105_T125del21(1)|p.R110fs*18(1)|p.F109F(1)|p.Y107fs*44(1)|p.R110fs*39(1)|p.Y103_G112>C(1)|p.R110S(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y107fs*38(1)|p.Y103_L111>L(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AAGCCCAGACGGAAACCGTAGC	0.609		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	44	Deletion - Frameshift(17)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Complex - deletion inframe(2)|Insertion - In frame(1)|Substitution - coding silent(1)	breast(12)|upper_aerodigestive_tract(5)|bone(4)|large_intestine(3)|lung(3)|NS(3)|prostate(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|liver(2)|skin(2)|stomach(1)|salivary_gland(1)|oesophagus(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.326_327dupTC	17.37:g.7579360_7579361dupGA	ENSP00000269305:p.Arg110fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R109fs	ENST00000269305.4	37	c.328_327	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.609	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	23	0.00	0	-	NM_000546		7579359	7579360	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_ins	14	61.11	22	INS	0.028:0.864	GA
TTC24	164118	genome.wustl.edu	37	1	156551191	156551191	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr1:156551191G>A	ENST00000368237.3	+	1	35	c.35G>A	c.(34-36)aGg>aAg	p.R12K	TTC24_ENST00000368236.3_Missense_Mutation_p.R12K			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	12										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTGCCCCGGAGGCCAGAACCT	0.567																																						dbGAP											0													38.0	38.0	38.0					1																	156551191		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.35G>A	1.37:g.156551191G>A	ENSP00000357220:p.Arg12Lys		Q5T3H7	Missense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R12K	ENST00000368237.3	37	c.35	CCDS53379.1	1	.	.	.	.	.	.	.	.	.	.	G	9.302	1.053354	0.19907	.	.	ENSG00000187862	ENST00000368236;ENST00000368237	T;T	0.23552	1.9;1.9	4.02	1.74	0.24563	.	0.345496	0.20977	N	0.082296	T	0.03305	0.0096	N	0.19112	0.55	0.09310	N	1	.	.	.	.	.	.	T	0.41734	-0.9492	8	0.07482	T	0.82	-3.1121	4.7856	0.13223	0.6447:0.0:0.3552:0.0	.	.	.	.	K	12	ENSP00000357219:R12K;ENSP00000357220:R12K	ENSP00000357219:R12K	R	+	2	0	TTC24	154817815	0.629000	0.27146	0.172000	0.22920	0.083000	0.17756	0.992000	0.29667	0.713000	0.32060	-0.379000	0.06801	AGG	TTC24	-	NULL	ENSG00000187862		0.567	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	TTC24	HGNC	protein_coding	OTTHUMT00000158547.1	36	0.00	0	G	XM_089384		156551191	156551191	+1	no_errors	ENST00000368236	ensembl	human	known	69_37n	missense	26	39.53	17	SNP	0.193	A
TTN	7273	genome.wustl.edu	37	2	179614480	179614480	+	Intron	SNP	A	A	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr2:179614480A>T	ENST00000591111.1	-	45	10585				TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000360870.5_Nonsense_Mutation_p.L4216*			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTAATATATAATTGGTGGCT	0.368																																						dbGAP											0													45.0	50.0	48.0					2																	179614480		2183	4286	6469	-	-	-	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+3370T>A	2.37:g.179614480A>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L4216*	ENST00000591111.1	37	c.12647		2	.	.	.	.	.	.	.	.	.	.	A	53	20.667605	0.99933	.	.	ENSG00000155657	ENST00000360870	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.2108	0.82158	1.0:0.0:0.0:0.0	.	.	.	.	X	4216	.	ENSP00000354117:L4216X	L	-	2	0	TTN	179322725	1.000000	0.71417	0.264000	0.24511	0.011000	0.07611	8.502000	0.90505	2.232000	0.73038	0.533000	0.62120	TTA	TTN	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.368	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	29	0.00	0	A	NM_133378		179614480	179614480	-1	no_errors	ENST00000360870	ensembl	human	known	69_37n	nonsense	5	58.33	7	SNP	0.935	T
UBE2R2	54926	genome.wustl.edu	37	9	33900241	33900241	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr9:33900241G>A	ENST00000263228.3	+	3	525	c.334G>A	c.(334-336)Gaa>Aaa	p.E112K		NM_017811.3	NP_060281.2	Q712K3	UB2R2_HUMAN	ubiquitin-conjugating enzyme E2R 2	112					protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			LUSC - Lung squamous cell carcinoma(29;0.0176)	GBM - Glioblastoma multiforme(74;0.188)		ACTGCCTTCTGAAAGGTGGAA	0.378																																						dbGAP											0													150.0	141.0	144.0					9																	33900241		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000426	CCDS6546.1	9p11.2	2008-02-05			ENSG00000107341	ENSG00000107341		"""Ubiquitin-conjugating enzymes E2"""	19907	protein-coding gene	gene with protein product		612506				12037680	Standard	XM_005251496		Approved	UBC3B, CDC34B, FLJ20419, MGC10481	uc003ztm.3	Q712K3	OTTHUMG00000019797	ENST00000263228.3:c.334G>A	9.37:g.33900241G>A	ENSP00000263228:p.Glu112Lys		D3DRL5|Q9NX64	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.E112K	ENST00000263228.3	37	c.334	CCDS6546.1	9	.	.	.	.	.	.	.	.	.	.	G	36	5.822987	0.96989	.	.	ENSG00000107341	ENST00000263228	T	0.38722	1.12	5.61	5.61	0.85477	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.63733	0.2536	L	0.58969	1.84	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64980	-0.6279	10	0.87932	D	0	-15.3349	19.217	0.93782	0.0:0.0:1.0:0.0	.	112	Q712K3	UB2R2_HUMAN	K	112	ENSP00000263228:E112K	ENSP00000263228:E112K	E	+	1	0	UBE2R2	33890241	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.262000	0.95591	2.634000	0.89283	0.557000	0.71058	GAA	UBE2R2	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000107341		0.378	UBE2R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2R2	HGNC	protein_coding	OTTHUMT00000052118.1	82	0.00	0	G	NM_017811		33900241	33900241	+1	no_errors	ENST00000263228	ensembl	human	known	69_37n	missense	52	53.91	62	SNP	1.000	A
UBE3D	90025	genome.wustl.edu	37	6	83728709	83728709	+	Silent	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr6:83728709G>A	ENST00000369747.3	-	8	1115	c.993C>T	c.(991-993)atC>atT	p.I331I		NM_198920.1	NP_944602.1	Q7Z6J8	UBE3D_HUMAN	ubiquitin protein ligase E3D	331					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)										TCCTGCTTTTGATGCATGGCT	0.353																																						dbGAP											0													113.0	112.0	112.0					6																	83728709		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL137544	CCDS34491.1	6q15	2012-02-24	2012-02-24	2012-02-24	ENSG00000118420	ENSG00000118420			21381	protein-coding gene	gene with protein product	"""UBCH10 binding protein with a hect-like domain"""	612495	"""chromosome 6 open reading frame 157"", ""ubiquitin-conjugating enzyme E2C binding protein"""	C6orf157, UBE2CBP		15749827	Standard	NM_198920		Approved	DKFZp434A1520, H10BH, YJR141W	uc003pjp.2	Q7Z6J8	OTTHUMG00000015108	ENST00000369747.3:c.993C>T	6.37:g.83728709G>A			B4DP63|Q5T4W2|Q6IPR4|Q75UG0|Q9NT42	Silent	SNP	pfam_UBQ-conj_enz_E2-bd_prot	p.I331	ENST00000369747.3	37	c.993	CCDS34491.1	6																																																																																			UBE3D	-	pfam_UBQ-conj_enz_E2-bd_prot	ENSG00000118420		0.353	UBE3D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3D	HGNC	protein_coding	OTTHUMT00000041347.7	80	0.00	0	G	NM_198920		83728709	83728709	-1	no_errors	ENST00000369747	ensembl	human	known	69_37n	silent	60	31.82	28	SNP	1.000	A
UGT1A4	54657	genome.wustl.edu	37	2	234627956	234627956	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr2:234627956T>C	ENST00000373409.3	+	1	533	c.490T>C	c.(490-492)Tac>Cac	p.Y164H	UGT1A6_ENST00000305139.6_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000608381.1_Intron	NM_007120.2	NP_009051.1	P22310	UD14_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A4	164					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	26		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	Asenapine(DB06216)|Clozapine(DB00363)|Ezogabine(DB04953)|Lamotrigine(DB00555)|Midazolam(DB00683)|Paricalcitol(DB00910)|Tamoxifen(DB00675)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)	GCTGGCTAAGTACCTGTCGAT	0.468																																					Melanoma(99;1011 1962 13201 26492)	dbGAP											0													181.0	178.0	179.0					2																	234627956		2203	4300	6503	-	-	-	SO:0001583	missense	0			M84128	CCDS33405.1	2q37.1	2014-01-10	2005-07-20		ENSG00000244474	ENSG00000244474		"""UDP glucuronosyltransferases"""	12536	other	complex locus constituent		606429	"""UDP glycosyltransferase 1 family, polypeptide A4"""			9295054, 1339448	Standard	NM_007120		Approved	HUG-BR2, UGT1D	uc002vux.3	P22310	OTTHUMG00000059119	ENST00000373409.3:c.490T>C	2.37:g.234627956T>C	ENSP00000362508:p.Tyr164His		B2R937|B8K288|Q5DT00	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.Y164H	ENST00000373409.3	37	c.490	CCDS33405.1	2	.	.	.	.	.	.	.	.	.	.	T	8.229	0.804261	0.16467	.	.	ENSG00000244474	ENST00000373409	T	0.62105	0.05	4.31	1.72	0.24424	.	.	.	.	.	T	0.68165	0.2971	L	0.42744	1.35	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.54833	-0.8234	9	0.37606	T	0.19	.	8.146	0.31113	0.0:0.3536:0.0:0.6464	.	164;164	B8K288;P22310	.;UD14_HUMAN	H	164	ENSP00000362508:Y164H	ENSP00000362508:Y164H	Y	+	1	0	UGT1A4	234292695	0.000000	0.05858	0.012000	0.15200	0.019000	0.09904	0.504000	0.22626	0.478000	0.27488	0.402000	0.26972	TAC	UGT1A4	-	pfam_UDP_glucos_trans	ENSG00000244474		0.468	UGT1A4-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	UGT1A4	HGNC	protein_coding	OTTHUMT00000130984.1	97	0.00	0	T	NM_007120		234627956	234627956	+1	no_errors	ENST00000373409	ensembl	human	known	69_37n	missense	17	88.11	126	SNP	0.000	C
UNC45A	55898	genome.wustl.edu	37	15	91493734	91493734	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr15:91493734A>G	ENST00000418476.2	+	17	2232	c.2192A>G	c.(2191-2193)tAt>tGt	p.Y731C	UNC45A_ENST00000394275.2_Missense_Mutation_p.Y716C|AC068831.6_ENST00000553321.1_RNA	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	731					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			TTGCAGATCTATGAGGTGGTC	0.622																																						dbGAP											0													57.0	49.0	52.0					15																	91493734		2198	4298	6496	-	-	-	SO:0001583	missense	0				CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.2192A>G	15.37:g.91493734A>G	ENSP00000407487:p.Tyr731Cys		A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Missense_Mutation	SNP	pfam_UNC-45/Ring3,superfamily_ARM-type_fold,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Y731C	ENST00000418476.2	37	c.2192	CCDS10367.1	15	.	.	.	.	.	.	.	.	.	.	A	22.7	4.323388	0.81580	.	.	ENSG00000140553	ENST00000394275;ENST00000418476	T;T	0.48201	0.82;0.82	5.41	5.41	0.78517	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67988	0.2952	M	0.74546	2.27	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.995	T	0.70135	-0.4955	10	0.49607	T	0.09	-12.3586	14.3607	0.66768	1.0:0.0:0.0:0.0	.	731;716	Q9H3U1;A8K6F7	UN45A_HUMAN;.	C	716;731	ENSP00000377816:Y716C;ENSP00000407487:Y731C	ENSP00000377816:Y716C	Y	+	2	0	UNC45A	89294738	1.000000	0.71417	0.967000	0.41034	0.928000	0.56348	9.043000	0.93799	2.061000	0.61500	0.529000	0.55759	TAT	UNC45A	-	superfamily_ARM-type_fold	ENSG00000140553		0.622	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UNC45A	HGNC	protein_coding	OTTHUMT00000280406.2	26	0.00	0	A	NM_018671		91493734	91493734	+1	no_errors	ENST00000418476	ensembl	human	known	69_37n	missense	5	81.48	22	SNP	1.000	G
USP34	9736	genome.wustl.edu	37	2	61515816	61515816	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr2:61515816G>A	ENST00000398571.2	-	34	4821	c.4745C>T	c.(4744-4746)aCa>aTa	p.T1582I		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1582					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.T1582delT(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CTTTACCTCTGTTAATCGTGG	0.363																																						dbGAP											1	Deletion - In frame(1)	prostate(1)											104.0	98.0	100.0					2																	61515816		1870	4110	5980	-	-	-	SO:0001583	missense	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.4745C>T	2.37:g.61515816G>A	ENSP00000381577:p.Thr1582Ile		A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.T1582I	ENST00000398571.2	37	c.4745	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	G	23.2	4.382567	0.82792	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.03635	3.86	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.11879	0.0289	L	0.36672	1.1	0.80722	D	1	D	0.65815	0.995	D	0.70487	0.969	T	0.02713	-1.1120	10	0.72032	D	0.01	.	17.0407	0.86488	0.0:0.0:1.0:0.0	.	1582	Q70CQ2	UBP34_HUMAN	I	1430;1430;1582	ENSP00000381577:T1582I	ENSP00000263989:T1430I	T	-	2	0	USP34	61369320	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.869000	0.99810	2.254000	0.74563	0.591000	0.81541	ACA	USP34	-	NULL	ENSG00000115464		0.363	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	54	0.00	0	G			61515816	61515816	-1	no_errors	ENST00000398571	ensembl	human	known	69_37n	missense	52	27.78	20	SNP	1.000	A
VGLL2	245806	genome.wustl.edu	37	6	117589357	117589357	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr6:117589357T>C	ENST00000326274.5	+	2	284	c.94T>C	c.(94-96)Tat>Cat	p.Y32H	VGLL2_ENST00000352536.3_Missense_Mutation_p.Y32H	NM_182645.3	NP_872586.1	Q8N8G2	VGLL2_HUMAN	vestigial-like family member 2	32					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			central_nervous_system(1)|kidney(1)|lung(3)	5				GBM - Glioblastoma multiforme(226;0.0254)|all cancers(137;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.0757)		ACTAGCCTATTATTCCAAAAT	0.468																																						dbGAP											0													132.0	160.0	151.0					6																	117589357		2202	4300	6502	-	-	-	SO:0001583	missense	0			AY056583	CCDS5114.1, CCDS5115.1	6q22.31	2014-03-03	2014-03-03		ENSG00000170162	ENSG00000170162			20232	protein-coding gene	gene with protein product		609979	"""vestigial like 2 (Drosophila)"""			12376544	Standard	NM_153453		Approved		uc003pxn.3	Q8N8G2	OTTHUMG00000015451	ENST00000326274.5:c.94T>C	6.37:g.117589357T>C	ENSP00000320957:p.Tyr32His		Q8WWX1	Missense_Mutation	SNP	pfam_Vg_Tdu	p.Y32H	ENST00000326274.5	37	c.94	CCDS5115.1	6	.	.	.	.	.	.	.	.	.	.	T	23.7	4.451417	0.84209	.	.	ENSG00000170162	ENST00000352536;ENST00000326274	T	0.50001	0.76	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.49201	0.1543	L	0.32530	0.975	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.83275	0.994;0.996	T	0.56183	-0.8021	10	0.72032	D	0.01	-7.4557	14.5734	0.68229	0.0:0.0:0.0:1.0	.	32;32	Q8N8G2-2;Q8N8G2	.;VGLL2_HUMAN	H	32	ENSP00000320957:Y32H	ENSP00000320957:Y32H	Y	+	1	0	VGLL2	117696050	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.410000	0.80065	2.036000	0.60181	0.459000	0.35465	TAT	VGLL2	-	NULL	ENSG00000170162		0.468	VGLL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VGLL2	HGNC	protein_coding	OTTHUMT00000041975.2	17	0.00	0	T	NM_153453		117589357	117589357	+1	no_errors	ENST00000326274	ensembl	human	known	69_37n	missense	2	84.62	11	SNP	1.000	C
VTI1B	10490	genome.wustl.edu	37	14	68126640	68126640	+	Splice_Site	SNP	C	C	G			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr14:68126640C>G	ENST00000554659.1	-	3	516		c.e3-1		5S_rRNA_ENST00000607639.1_RNA|RP11-1012A1.4_ENST00000553306.1_Splice_Site|RP11-1012A1.4_ENST00000554493.1_Splice_Site	NM_006370.2	NP_006361.1	Q9UEU0	VTI1B_HUMAN	vesicle transport through interaction with t-SNAREs 1B						cell proliferation (GO:0008283)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNARE binding (GO:0000149)			endometrium(1)|large_intestine(2)|stomach(1)|upper_aerodigestive_tract(1)	5				all cancers(60;0.000344)|OV - Ovarian serous cystadenocarcinoma(108;0.00212)|BRCA - Breast invasive adenocarcinoma(234;0.00941)		TCTCTGCCAGCTGGGAAGGCA	0.463																																						dbGAP											0													48.0	41.0	43.0					14																	68126640		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF060902	CCDS9786.1	14q23.3	2012-12-10	2012-12-10		ENSG00000100568	ENSG00000100568			17793	protein-coding gene	gene with protein product		603207	"""vesicle transport through interaction with t-SNAREs homolog 1B (yeast)"""			9636656, 9446565	Standard	NM_006370		Approved	VTI2	uc001xjt.3	Q9UEU0	OTTHUMG00000171251	ENST00000554659.1:c.175-1G>C	14.37:g.68126640C>G			O43547|Q96J28	Splice_Site	SNP	-	e3-1	ENST00000554659.1	37	c.175-1	CCDS9786.1	14	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158561	0.78114	.	.	ENSG00000100568;ENSG00000258466	ENST00000554659;ENST00000557564	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1137	0.93330	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VTI1B;RP11-1012A1.4	67196393	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.946000	0.75953	2.826000	0.97356	0.563000	0.77884	.	VTI1B	-	-	ENSG00000100568		0.463	VTI1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VTI1B	HGNC	protein_coding	OTTHUMT00000412558.2	41	0.00	0	C		Intron	68126640	68126640	-1	no_errors	ENST00000554659	ensembl	human	known	69_37n	splice_site	26	35.00	14	SNP	1.000	G
ALG3	10195	genome.wustl.edu	37	3	183959139	183959139	+	IGR	SNP	G	G	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr3:183959139G>T	ENST00000397676.3	-	0	1528				ALG3_ENST00000463495.1_5'Flank|EIF2B5_ENST00000444495.1_Intron|VWA5B2_ENST00000273794.5_Missense_Mutation_p.D825Y|MIR1224_ENST00000408193.1_RNA|VWA5B2_ENST00000426955.2_Missense_Mutation_p.D1043Y	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTGTAGCCCTGACCCGGGCCA	0.692																																						dbGAP											0													38.0	48.0	45.0					3																	183959139		692	1591	2283	-	-	-	SO:0001628	intergenic_variant	0			BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823		3.37:g.183959139G>T			A8JZZ6|Q9BT71	Missense_Mutation	SNP	NULL	p.D1043Y	ENST00000397676.3	37	c.3127	CCDS46968.1	3	.	.	.	.	.	.	.	.	.	.	G	11.56	1.675622	0.29783	.	.	ENSG00000145198	ENST00000426955;ENST00000273794	T;T	0.19105	2.86;2.17	4.51	-3.45	0.04781	.	1.476590	0.04284	N	0.344343	T	0.09247	0.0228	N	0.08118	0	0.09310	N	1	B;B;B	0.26400	0.148;0.063;0.063	B;B;B	0.24541	0.054;0.023;0.037	T	0.21552	-1.0242	10	0.56958	D	0.05	0.0776	1.493	0.02461	0.475:0.1461:0.2325:0.1464	.	825;1043;1054	E9PF42;B9EGN7;Q8N398	.;.;VW5B2_HUMAN	Y	1043;825	ENSP00000398688:D1043Y;ENSP00000273794:D825Y	ENSP00000273794:D825Y	D	+	1	0	VWA5B2	185441833	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.591000	0.05753	-0.777000	0.04572	0.462000	0.41574	GAC	VWA5B2	-	NULL	ENSG00000145198		0.692	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA5B2	HGNC	protein_coding	OTTHUMT00000346033.1	15	0.00	0	G	NM_005787		183959139	183959139	+1	no_errors	ENST00000426955	ensembl	human	known	69_37n	missense	29	29.27	12	SNP	0.003	T
WRAP53	55135	genome.wustl.edu	37	17	7592245	7592245	+	Silent	SNP	C	C	T			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr17:7592245C>T	ENST00000316024.5	+	1	2627	c.279C>T	c.(277-279)atC>atT	p.I93I	TP53_ENST00000455263.2_5'Flank|TP53_ENST00000269305.4_5'Flank|RP11-199F11.2_ENST00000571370.1_RNA|TP53_ENST00000445888.2_5'Flank|TP53_ENST00000420246.2_5'Flank|WRAP53_ENST00000431639.2_Silent_p.I93I|WRAP53_ENST00000534050.1_Silent_p.I93I|WRAP53_ENST00000457584.2_Silent_p.I93I|WRAP53_ENST00000396463.2_Silent_p.I93I			Q9BUR4	WAP53_HUMAN	WD repeat containing, antisense to TP53	93					positive regulation of telomerase activity (GO:0051973)|telomere formation via telomerase (GO:0032203)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(2)	18						GTCCTCGAATCGAGGAGCAAG	0.537																																						dbGAP											0													92.0	107.0	102.0					17																	7592245		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001247, DQ431240	CCDS11119.1	17p13.1	2014-09-17	2009-02-16	2009-02-16	ENSG00000141499	ENSG00000141499		"""WD repeat domain containing"""	25522	protein-coding gene	gene with protein product	"""telomerase cajal body protein 1"", ""WD-encoding RNA antisense to p53"""	612661	"""WD repeat domain 79"""	WDR79		19179534, 19250907, 19571673, 19342896, 20494116, 21441950	Standard	NM_018081		Approved	FLJ10385, TCAB1	uc010vuh.2	Q9BUR4	OTTHUMG00000134323	ENST00000316024.5:c.279C>T	17.37:g.7592245C>T			B3KPR9|D3DTQ4|Q08ET9|Q9NW09	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I93	ENST00000316024.5	37	c.279	CCDS11119.1	17																																																																																			WRAP53	-	NULL	ENSG00000141499		0.537	WRAP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRAP53	HGNC	protein_coding	OTTHUMT00000259385.2	27	0.00	0	C	NM_018081		7592245	7592245	+1	no_errors	ENST00000316024	ensembl	human	known	69_37n	silent	33	17.50	7	SNP	0.001	T
WFIKKN2	124857	genome.wustl.edu	37	17	48917309	48917309	+	Silent	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr17:48917309G>A	ENST00000311378.4	+	2	1188	c.660G>A	c.(658-660)tcG>tcA	p.S220S	WFIKKN2_ENST00000426127.1_Silent_p.S127S|RP11-506D12.5_ENST00000572491.2_RNA	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	220	Ig-like C2-type.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			TGCACCAGTCGGTCACCATGG	0.637																																						dbGAP											0													82.0	80.0	81.0					17																	48917309		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.660G>A	17.37:g.48917309G>A			Q6UXZ9	Silent	SNP	pfam_Prot_inh_Kunz-m,pfam_Ig_I-set,pfam_Netrin_module_non-TIMP,pfam_Whey_acidic_protein_4-diS_core,pfam_Kazal-type_dom,pfam_Ig_V-set,superfamily_TIMP-like_OB-fold,superfamily_Prot_inh_Kunz-m,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_Ig_sub,smart_Ig_sub2,smart_Prot_inh_Kunz-m,pfscan_Netrin_domain,pfscan_Prot_inh_Kunz-m,pfscan_Ig-like,prints_Prot_inh_Kunz-m	p.S220	ENST00000311378.4	37	c.660	CCDS11575.1	17																																																																																			WFIKKN2	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000173714		0.637	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFIKKN2	HGNC	protein_coding	OTTHUMT00000368358.1	37	0.00	0	G	NM_175575		48917309	48917309	+1	no_errors	ENST00000311378	ensembl	human	known	69_37n	silent	71	24.47	23	SNP	0.003	A
XPO5	57510	genome.wustl.edu	37	6	43535019	43535020	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr6:43535019_43535020insC	ENST00000265351.7	-	7	930_931	c.720_721insG	c.(718-723)atgagtfs	p.S241fs		NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	241			S -> N (in dbSNP:rs34324334).		gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			GTGATGTGACTCATAGACACCC	0.455																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.721dupG	6.37:g.43535020_43535020dupC	ENSP00000265351:p.Ser241fs		Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Frame_Shift_Ins	INS	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold,smart_Importin-beta_N	p.S240fs	ENST00000265351.7	37	c.721_720	CCDS47430.1	6																																																																																			XPO5	-	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	ENSG00000124571		0.455	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO5	HGNC	protein_coding	OTTHUMT00000040657.2	49	0.00	0	-	NM_020750		43535019	43535020	-1	no_errors	ENST00000265351	ensembl	human	known	69_37n	frame_shift_ins	35	31.37	16	INS	0.998:1.000	C
XPO5	57510	genome.wustl.edu	37	6	43535023	43535025	+	In_Frame_Del	DEL	AGA	AGA	-	rs377671235		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	AGA	AGA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr6:43535023_43535025delAGA	ENST00000265351.7	-	7	925_927	c.715_717delTCT	c.(715-717)tctdel	p.S239del		NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	239					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			TGTGACTCATAGACACCCAGTCA	0.453																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.715_717delTCT	6.37:g.43535023_43535025delAGA	ENSP00000265351:p.Ser239del		Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	In_Frame_Del	DEL	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold,smart_Importin-beta_N	p.S239in_frame_del	ENST00000265351.7	37	c.717_715	CCDS47430.1	6																																																																																			XPO5	-	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	ENSG00000124571		0.453	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO5	HGNC	protein_coding	OTTHUMT00000040657.2	47	0.00	0	AGA	NM_020750		43535023	43535025	-1	no_errors	ENST00000265351	ensembl	human	known	69_37n	in_frame_del	34	32.00	16	DEL	0.304:0.952:0.935	-
ZNF280B	140883	genome.wustl.edu	37	22	22842463	22842463	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr22:22842463G>A	ENST00000406426.1	-	4	2003	c.1261C>T	c.(1261-1263)Cat>Tat	p.H421Y	ZNF280B_ENST00000360412.2_Missense_Mutation_p.H421Y			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	421					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		GTTCTAAAATGTGTTTCTACA	0.413																																						dbGAP											0													126.0	118.0	121.0					22																	22842463		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.1261C>T	22.37:g.22842463G>A	ENSP00000385998:p.His421Tyr			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H421Y	ENST00000406426.1	37	c.1261	CCDS13799.1	22	.	.	.	.	.	.	.	.	.	.	G	21.8	4.204750	0.79127	.	.	ENSG00000198477	ENST00000406426;ENST00000360412	T;T	0.59772	0.24;0.24	4.85	4.85	0.62838	Zinc finger, C2H2-like (1);	.	.	.	.	T	0.81327	0.4799	M	0.93062	3.375	0.50632	D	0.999887	D	0.76494	0.999	D	0.85130	0.997	D	0.85748	0.1341	9	0.87932	D	0	-14.9079	15.8711	0.79119	0.0:0.0:1.0:0.0	.	421	Q86YH2	Z280B_HUMAN	Y	421	ENSP00000385998:H421Y;ENSP00000353586:H421Y	ENSP00000353586:H421Y	H	-	1	0	ZNF280B	21172463	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	8.584000	0.90798	2.689000	0.91719	0.655000	0.94253	CAT	ZNF280B	-	smart_Znf_C2H2-like	ENSG00000198477		0.413	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF280B	HGNC	protein_coding	OTTHUMT00000321170.2	69	0.00	0	G	NM_080764		22842463	22842463	-1	no_errors	ENST00000360412	ensembl	human	known	69_37n	missense	26	45.83	22	SNP	1.000	A
ZNF608	57507	genome.wustl.edu	37	5	124080554	124080556	+	In_Frame_Del	DEL	CTT	CTT	-	rs150743730		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	CTT	CTT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr5:124080554_124080556delCTT	ENST00000306315.5	-	1	562_564	c.127_129delAAG	c.(127-129)aagdel	p.K43del	ZNF608_ENST00000504926.1_5'Flank	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	43							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TCTGTCTGTCCTTCTCCAAATCA	0.458																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.127_129delAAG	5.37:g.124080554_124080556delCTT	ENSP00000307746:p.Lys43del		A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	In_Frame_Del	DEL	NULL	p.K43in_frame_del	ENST00000306315.5	37	c.129_127	CCDS34219.1	5																																																																																			ZNF608	-	NULL	ENSG00000168916		0.458	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	HGNC	protein_coding	OTTHUMT00000371300.1	73	0.00	0	CTT	XM_114432		124080554	124080556	-1	no_errors	ENST00000306315	ensembl	human	known	69_37n	in_frame_del	23	72.82	75	DEL	1.000:1.000:1.000	-
ZNF705A	440077	genome.wustl.edu	37	12	8328517	8328517	+	Missense_Mutation	SNP	C	C	A	rs375681214		TCGA-AR-A256-01A-11D-A167-09	TCGA-AR-A256-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ea43434b-197e-48ac-ae2e-46bc7f3776de	09f34836-fc9a-4ff4-a0c9-fd93259e32f3	g.chr12:8328517C>A	ENST00000359286.4	+	4	386	c.297C>A	c.(295-297)gaC>gaA	p.D99E		NM_001004328.2|NM_001278713.1	NP_001004328.1|NP_001265642.1	Q6ZN79	Z705A_HUMAN	zinc finger protein 705A	99					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(3)|stomach(4)	18				Kidney(36;0.0877)		CCAGAAAAGACGCATCCACCA	0.343																																						dbGAP											0													77.0	73.0	75.0					12																	8328517		2202	4282	6484	-	-	-	SO:0001583	missense	0			AK131339	CCDS31737.1	12p13.31	2014-02-12	2005-09-22		ENSG00000196946	ENSG00000196946		"""Zinc fingers, C2H2-type"", ""-"""	32281	protein-coding gene	gene with protein product							Standard	NM_001004328		Approved	FLJ16353	uc001qud.1	Q6ZN79	OTTHUMG00000168635	ENST00000359286.4:c.297C>A	12.37:g.8328517C>A	ENSP00000352233:p.Asp99Glu			Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D99E	ENST00000359286.4	37	c.297	CCDS31737.1	12	.	.	.	.	.	.	.	.	.	.	.	6.544	0.468646	0.12461	.	.	ENSG00000196946	ENST00000396570;ENST00000359286	T;T	0.07114	3.22;3.22	1.07	-1.0	0.10196	.	.	.	.	.	T	0.02047	0.0064	N	0.03608	-0.345	0.09310	N	1	B	0.31968	0.349	B	0.23852	0.049	T	0.36553	-0.9743	9	0.02654	T	1	.	2.277	0.04104	0.235:0.3964:0.0:0.3687	.	99	Q6ZN79	Z705A_HUMAN	E	99	ENSP00000379816:D99E;ENSP00000352233:D99E	ENSP00000352233:D99E	D	+	3	2	ZNF705A	8219784	0.034000	0.19679	0.001000	0.08648	0.001000	0.01503	-0.291000	0.08343	-0.537000	0.06290	-1.116000	0.02052	GAC	ZNF705A	-	NULL	ENSG00000196946		0.343	ZNF705A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF705A	HGNC	protein_coding	OTTHUMT00000400449.1	176	0.00	0	C	NM_001004328		8328517	8328517	+1	no_errors	ENST00000359286	ensembl	human	known	69_37n	missense	111	26.49	40	SNP	0.028	A
