#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
BAG2	9532	genome.wustl.edu	37	6	57048818	57048818	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr6:57048818C>T	ENST00000370693.5	+	3	838	c.466C>T	c.(466-468)Caa>Taa	p.Q156*	BAG2_ENST00000545080.1_Nonsense_Mutation_p.Q123*	NM_004282.3	NP_004273.1	O95816	BAG2_HUMAN	BCL2-associated athanogene 2	156	BAG. {ECO:0000255|PROSITE- ProRule:PRU00369}.				protein folding (GO:0006457)|protein metabolic process (GO:0019538)		identical protein binding (GO:0042802)			endometrium(1)|large_intestine(1)	2	Lung NSC(77;0.126)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TCAGAAGTTTCAATCCATAGT	0.393																																						dbGAP											0													96.0	93.0	94.0					6																	57048818		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF095192	CCDS4961.1	6p12.3-p11.2	2008-02-05			ENSG00000112208	ENSG00000112208			938	protein-coding gene	gene with protein product		603882				9873016	Standard	NM_004282		Approved		uc003pdr.3	O95816	OTTHUMG00000014919	ENST00000370693.5:c.466C>T	6.37:g.57048818C>T	ENSP00000359727:p.Gln156*		B4DXE2|Q08AS9|Q6FID0	Nonsense_Mutation	SNP	pfam_BAG_domain,smart_BAG_domain,pfscan_BAG_domain	p.Q156*	ENST00000370693.5	37	c.466	CCDS4961.1	6	.	.	.	.	.	.	.	.	.	.	C	37	6.418987	0.97550	.	.	ENSG00000112208	ENST00000370693;ENST00000438730;ENST00000545080	.	.	.	6.06	6.06	0.98353	.	0.046744	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-26.5683	20.6244	0.99512	0.0:1.0:0.0:0.0	.	.	.	.	X	156;105;123	.	ENSP00000359727:Q156X	Q	+	1	0	BAG2	57156777	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.818000	0.86416	2.879000	0.98667	0.650000	0.86243	CAA	BAG2	-	pfam_BAG_domain,smart_BAG_domain,pfscan_BAG_domain	ENSG00000112208		0.393	BAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAG2	HGNC	protein_coding	OTTHUMT00000041044.2	39	0.00	0	C			57048818	57048818	+1	no_errors	ENST00000370693	ensembl	human	known	69_37n	nonsense	45	10.00	5	SNP	1.000	T
CARD11	84433	genome.wustl.edu	37	7	2962378	2962378	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr7:2962378C>T	ENST00000396946.4	-	17	2562	c.2159G>A	c.(2158-2160)cGa>cAa	p.R720Q		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	720	PDZ.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CCTCTCGCCTCGGATGCAGCC	0.612			Mis		DLBCL																																	dbGAP		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	0													116.0	78.0	91.0					7																	2962378		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.2159G>A	7.37:g.2962378C>T	ENSP00000380150:p.Arg720Gln		A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,superfamily_PDZ,pfscan_CARD	p.R720Q	ENST00000396946.4	37	c.2159	CCDS5336.2	7	.	.	.	.	.	.	.	.	.	.	C	5.434	0.265205	0.10294	.	.	ENSG00000198286	ENST00000396946;ENST00000355508	T;T	0.29655	1.56;2.56	5.14	-1.53	0.08611	PDZ/DHR/GLGF (2);	0.568751	0.17436	N	0.174297	T	0.15782	0.0380	N	0.14661	0.345	0.09310	N	1	B	0.14012	0.009	B	0.11329	0.006	T	0.23691	-1.0181	10	0.23891	T	0.37	-1.2932	12.0837	0.53686	0.0:0.5078:0.0:0.4922	.	720	Q9BXL7	CAR11_HUMAN	Q	720;191	ENSP00000380150:R720Q;ENSP00000347695:R191Q	ENSP00000347695:R191Q	R	-	2	0	CARD11	2928904	0.287000	0.24315	0.065000	0.19835	0.822000	0.46500	0.091000	0.15046	-0.168000	0.10853	0.555000	0.69702	CGA	CARD11	-	superfamily_PDZ	ENSG00000198286		0.612	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD11	HGNC	protein_coding	OTTHUMT00000059344.4	29	0.00	0	C	NM_032415		2962378	2962378	-1	no_errors	ENST00000396946	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	0.027	T
CHRNA10	57053	genome.wustl.edu	37	11	3691096	3691096	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr11:3691096C>T	ENST00000250699.2	-	2	208	c.137G>A	c.(136-138)aGa>aAa	p.R46K	CHRNA10_ENST00000534359.1_5'UTR|CHRNA10_ENST00000493827.2_5'UTR	NM_020402.2	NP_065135.2	Q9GZZ6	ACH10_HUMAN	cholinergic receptor, nicotinic, alpha 10 (neuronal)	46					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell proliferation (GO:0042127)|synaptic transmission, cholinergic (GO:0007271)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perikaryon (GO:0043204)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|lung(3)|ovary(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	Chloroprocaine(DB01161)|Galantamine(DB00674)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Succinylcholine(DB00202)|Trimethaphan(DB01116)	TGCCACAGGTCTCAGGGCACT	0.577																																					Melanoma(153;17 1869 2949 7120 36888)	dbGAP											0													202.0	152.0	169.0					11																	3691096		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF199235	CCDS7745.1	11p15.5	2012-02-11	2012-02-07		ENSG00000129749	ENSG00000129749		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	13800	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 10 (neuronal)"""	606372	"""cholinergic receptor, nicotinic, alpha polypeptide 10"""				Standard	NM_020402		Approved		uc001lyf.3	Q9GZZ6	OTTHUMG00000011844	ENST00000250699.2:c.137G>A	11.37:g.3691096C>T	ENSP00000250699:p.Arg46Lys			Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.R46K	ENST00000250699.2	37	c.137	CCDS7745.1	11	.	.	.	.	.	.	.	.	.	.	C	27.5	4.833620	0.91036	.	.	ENSG00000129749	ENST00000250699	D	0.82526	-1.62	5.67	5.67	0.87782	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.64402	D	0.000015	D	0.93736	0.7998	H	0.94964	3.605	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95025	0.8164	10	0.87932	D	0	.	17.2665	0.87088	0.0:1.0:0.0:0.0	.	46	Q9GZZ6	ACH10_HUMAN	K	46	ENSP00000250699:R46K	ENSP00000250699:R46K	R	-	2	0	CHRNA10	3647672	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.779000	0.68948	2.688000	0.91661	0.655000	0.94253	AGA	CHRNA10	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000129749		0.577	CHRNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA10	HGNC	protein_coding	OTTHUMT00000032763.2	59	0.00	0	C			3691096	3691096	-1	no_errors	ENST00000250699	ensembl	human	known	69_37n	missense	85	13.27	13	SNP	1.000	T
DPP8	54878	genome.wustl.edu	37	15	65766607	65766607	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr15:65766607G>C	ENST00000341861.5	-	12	3104	c.1524C>G	c.(1522-1524)atC>atG	p.I508M	DPP8_ENST00000339244.5_Intron|DPP8_ENST00000300141.6_Missense_Mutation_p.I492M|DPP8_ENST00000321118.7_Missense_Mutation_p.I508M|DPP8_ENST00000559233.1_Missense_Mutation_p.I508M|DPP8_ENST00000321147.6_Missense_Mutation_p.I508M|DPP8_ENST00000358939.4_Missense_Mutation_p.I492M	NM_197960.2	NP_932064.1	Q6V1X1	DPP8_HUMAN	dipeptidyl-peptidase 8	508					immune response (GO:0006955)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(2)|endometrium(3)|large_intestine(11)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TCTCCTCTTTGATAGGACACT	0.328																																						dbGAP											0													92.0	84.0	87.0					15																	65766607		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF221634	CCDS10207.1, CCDS10208.1, CCDS10209.1, CCDS10210.1	15q22	2008-07-18	2006-01-12		ENSG00000074603	ENSG00000074603			16490	protein-coding gene	gene with protein product	"""dipeptidyl peptidase VIII"", ""dipeptidyl peptidase IV-related protein-1"", ""prolyl dipeptidase DPP8"""	606819	"""dipeptidylpeptidase 8"""			11012666	Standard	XM_005254500		Approved	DP8, DPRP1, MSTP141, FLJ14920, FLJ20283, MGC26191	uc002aox.3	Q6V1X1	OTTHUMG00000133150	ENST00000341861.5:c.1524C>G	15.37:g.65766607G>C	ENSP00000339208:p.Ile508Met		Q7Z4C8|Q7Z4D3|Q7Z4E1|Q8IWG7|Q8NEM5|Q96JX1|Q9HBM2|Q9HBM3|Q9HBM4|Q9HBM5|Q9NXF4	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_X-Pro-like_dom	p.I508M	ENST00000341861.5	37	c.1524	CCDS10207.1	15	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810158	0.50421	.	.	ENSG00000074603	ENST00000341861;ENST00000358939;ENST00000300141;ENST00000321147;ENST00000321118;ENST00000395652	T;T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57;1.57	5.22	3.34	0.38264	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.394220	0.23250	N	0.050259	T	0.29556	0.0737	L	0.61387	1.9	0.80722	D	1	B;B;B;B	0.31859	0.015;0.343;0.053;0.019	B;B;B;B	0.34779	0.038;0.189;0.06;0.063	T	0.10847	-1.0612	10	0.87932	D	0	-15.3981	5.0721	0.14611	0.2285:0.0:0.6257:0.1458	.	492;492;508;508	Q6V1X1-3;Q6V1X1-4;Q6V1X1-2;Q6V1X1	.;.;.;DPP8_HUMAN	M	508;492;492;508;508;508	ENSP00000339208:I508M;ENSP00000351817:I492M;ENSP00000300141:I492M;ENSP00000318111:I508M;ENSP00000316373:I508M;ENSP00000379013:I508M	ENSP00000300141:I492M	I	-	3	3	DPP8	63553660	1.000000	0.71417	0.991000	0.47740	0.995000	0.86356	2.283000	0.43470	0.587000	0.29643	0.585000	0.79938	ATC	DPP8	-	pfam_Peptidase_S9B	ENSG00000074603		0.328	DPP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DPP8	HGNC	protein_coding	OTTHUMT00000256847.1	30	0.00	0	G	NM_017743		65766607	65766607	-1	no_errors	ENST00000341861	ensembl	human	known	69_37n	missense	48	12.73	7	SNP	0.998	C
KRTAP4-4	84616	genome.wustl.edu	37	17	39316500	39316500	+	Silent	SNP	G	G	A			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr17:39316500G>A	ENST00000390661.3	-	1	483	c.444C>T	c.(442-444)ccC>ccT	p.P148P		NM_032524.1	NP_115913.1	Q9BYR3	KRA44_HUMAN	keratin associated protein 4-4	148	26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].					keratin filament (GO:0045095)				kidney(1)|large_intestine(1)|lung(5)	7		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			CACAGCAGCTGGGGCGGCAGC	0.642																																						dbGAP											0													39.0	47.0	44.0					17																	39316500		2195	4298	6493	-	-	-	SO:0001819	synonymous_variant	0			AJ406936	CCDS11383.1	17q21.2	2013-06-25			ENSG00000171396	ENSG00000171396		"""Keratin associated proteins"""	16928	protein-coding gene	gene with protein product			"""keratin associated protein 4-13"""	KRTAP4-13		11279113	Standard	NM_032524		Approved	KAP4.4, KAP4.13	uc002hwc.3	Q9BYR3	OTTHUMG00000133428	ENST00000390661.3:c.444C>T	17.37:g.39316500G>A			Q9BYU7	Silent	SNP	NULL	p.P148	ENST00000390661.3	37	c.444	CCDS11383.1	17																																																																																			KRTAP4-4	-	NULL	ENSG00000171396		0.642	KRTAP4-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-4	HGNC	protein_coding	OTTHUMT00000257291.1	49	0.00	0	G			39316500	39316500	-1	no_errors	ENST00000390661	ensembl	human	known	69_37n	silent	67	11.84	9	SNP	0.986	A
MIER2	54531	genome.wustl.edu	37	19	336103	336103	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr19:336103G>T	ENST00000264819.4	-	2	90	c.80C>A	c.(79-81)cCg>cAg	p.P27Q	MIER2_ENST00000592722.1_5'UTR	NM_017550.1	NP_060020.1	Q8N344	MIER2_HUMAN	mesoderm induction early response 1, family member 2	27					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(4)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCAAGCCCGGCTCCCCTGG	0.652																																						dbGAP											0													96.0	73.0	81.0					19																	336103		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033019	CCDS32855.1	19p13.3	2008-02-05	2006-04-20	2006-04-20		ENSG00000105556			29210	protein-coding gene	gene with protein product			"""KIAA1193"""	KIAA1193		10574462	Standard	NM_017550		Approved		uc002lok.1	Q8N344		ENST00000264819.4:c.80C>A	19.37:g.336103G>T	ENSP00000264819:p.Pro27Gln		Q9ULM7	Missense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.P27Q	ENST00000264819.4	37	c.80	CCDS32855.1	19	.	.	.	.	.	.	.	.	.	.	G	19.38	3.817005	0.70912	.	.	ENSG00000105556	ENST00000264819	T	0.15139	2.45	5.68	4.63	0.57726	.	0.351077	0.20444	N	0.092222	T	0.38692	0.1050	M	0.69823	2.125	0.34530	D	0.709066	D	0.76494	0.999	D	0.63033	0.91	T	0.57148	-0.7861	10	0.87932	D	0	-12.517	13.9869	0.64341	0.0:0.1515:0.8485:0.0	.	27	Q8N344	MIER2_HUMAN	Q	27	ENSP00000264819:P27Q	ENSP00000264819:P27Q	P	-	2	0	MIER2	287103	1.000000	0.71417	0.076000	0.20297	0.984000	0.73092	3.922000	0.56462	1.373000	0.46208	0.561000	0.74099	CCG	MIER2	-	NULL	ENSG00000105556		0.652	MIER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIER2	HGNC	protein_coding	OTTHUMT00000451784.1	36	0.00	0	G	XM_041843		336103	336103	-1	no_errors	ENST00000264819	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	0.879	T
MYH4	4622	genome.wustl.edu	37	17	10366488	10366488	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr17:10366488G>A	ENST00000255381.2	-	10	933	c.823C>T	c.(823-825)Cga>Tga	p.R275*	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	275	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						AAAGTAACTCGGGACTTCTCT	0.353																																						dbGAP											0													76.0	78.0	77.0					17																	10366488		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.823C>T	17.37:g.10366488G>A	ENSP00000255381:p.Arg275*			Nonsense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R275*	ENST00000255381.2	37	c.823	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	G	34	5.353656	0.95830	.	.	ENSG00000141048	ENST00000255381	.	.	.	5.37	-0.0246	0.13938	.	0.000000	0.35320	U	0.003296	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.5683	0.76313	0.0:0.0:0.2102:0.7898	.	.	.	.	X	275	.	ENSP00000255381:R275X	R	-	1	2	MYH4	10307213	0.139000	0.22563	0.530000	0.27963	0.997000	0.91878	0.358000	0.20216	0.248000	0.21435	0.650000	0.86243	CGA	MYH4	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000264424		0.353	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	HGNC	protein_coding	OTTHUMT00000252731.1	48	0.00	0	G	NM_017533		10366488	10366488	-1	no_errors	ENST00000255381	ensembl	human	known	69_37n	nonsense	37	15.91	7	SNP	0.146	A
MYOZ1	58529	genome.wustl.edu	37	10	75391782	75391782	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr10:75391782T>A	ENST00000359322.4	-	6	1170	c.806A>T	c.(805-807)aAt>aTt	p.N269I	RP11-464F9.22_ENST00000609434.1_lincRNA	NM_021245.3	NP_067068.1			myozenin 1											central_nervous_system(1)|large_intestine(5)|lung(2)|ovary(2)|skin(2)	12	Prostate(51;0.0112)					AGGGGTTCGATTGAAAGAAGG	0.532																																						dbGAP											0													105.0	104.0	105.0					10																	75391782		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF240633	CCDS7330.1	10q22.1	2008-07-03	2002-01-10	2002-01-11	ENSG00000177791	ENSG00000177791			13752	protein-coding gene	gene with protein product	"""calsarcin-2"""	605603	"""myozenin"""	MYOZ		11171996, 10984498	Standard	NM_021245		Approved	FATZ, CS-2	uc001jur.4	Q9NP98	OTTHUMG00000018466	ENST00000359322.4:c.806A>T	10.37:g.75391782T>A	ENSP00000352272:p.Asn269Ile			Missense_Mutation	SNP	pfam_Calsarcin-bd	p.N269I	ENST00000359322.4	37	c.806	CCDS7330.1	10	.	.	.	.	.	.	.	.	.	.	T	26.9	4.786160	0.90282	.	.	ENSG00000177791	ENST00000359322	T	0.79845	-1.31	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.90817	0.7116	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92054	0.5651	10	0.87932	D	0	-16.5206	16.6093	0.84858	0.0:0.0:0.0:1.0	.	269	Q9NP98	MYOZ1_HUMAN	I	269	ENSP00000352272:N269I	ENSP00000352272:N269I	N	-	2	0	MYOZ1	75061788	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.676000	0.84012	2.324000	0.78689	0.533000	0.62120	AAT	MYOZ1	-	pfam_Calsarcin-bd	ENSG00000177791		0.532	MYOZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOZ1	HGNC	protein_coding	OTTHUMT00000048654.1	55	0.00	0	T			75391782	75391782	-1	no_errors	ENST00000359322	ensembl	human	known	69_37n	missense	85	13.27	13	SNP	1.000	A
NBPF10	100132406	genome.wustl.edu	37	1	145323666	145323666	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr1:145323666A>G	ENST00000342960.5	+	27	3538	c.3503A>G	c.(3502-3504)gAc>gGc	p.D1168G	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	755						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.D1168G(2)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ATTAAAAAGGACGAAGAAGAG	0.468																																						dbGAP											2	Substitution - Missense(2)	endometrium(1)|kidney(1)																																								-	-	-	SO:0001583	missense	0			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.3503A>G	1.37:g.145323666A>G	ENSP00000345684:p.Asp1168Gly		Q5RHC0|Q9NWN6	Missense_Mutation	SNP	pfam_NBPF_dom	p.D1168G	ENST00000342960.5	37	c.3503	CCDS53355.1	1	.	.	.	.	.	.	.	.	.	.	.	8.978	0.974738	0.18736	.	.	ENSG00000163386	ENST00000342960	T	0.03524	3.9	.	.	.	.	.	.	.	.	T	0.02380	0.0073	L	0.60455	1.87	0.09310	N	1	.	.	.	.	.	.	T	0.42965	-0.9420	5	0.45353	T	0.12	.	.	.	.	.	.	.	.	G	1168	ENSP00000345684:D1168G	ENSP00000345684:D1168G	D	+	2	0	NBPF10	144035023	0.002000	0.14202	0.003000	0.11579	0.095000	0.18619	-0.338000	0.07842	0.386000	0.24997	0.128000	0.15822	GAC	NBPF10	-	NULL	ENSG00000163386		0.468	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NBPF10	HGNC	protein_coding		62	0.00	0	A	NM_001039703		145323666	145323666	+1	no_errors	ENST00000342960	ensembl	human	known	69_37n	missense	63	12.50	9	SNP	0.004	G
NPAP1	23742	genome.wustl.edu	37	15	24922101	24922101	+	Missense_Mutation	SNP	G	G	C	rs143596937		TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr15:24922101G>C	ENST00000329468.2	+	1	1561	c.1087G>C	c.(1087-1089)Gag>Cag	p.E363Q		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	363	Pro-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											CCTGTCTGTTGAGGGAGACCT	0.527																																						dbGAP											0													55.0	49.0	51.0					15																	24922101		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.1087G>C	15.37:g.24922101G>C	ENSP00000333735:p.Glu363Gln			Missense_Mutation	SNP	NULL	p.E363Q	ENST00000329468.2	37	c.1087	CCDS10015.1	15	.	.	.	.	.	.	.	.	.	.	.	12.51	1.958887	0.34565	.	.	ENSG00000185823	ENST00000329468	T	0.13089	2.62	1.93	1.93	0.25924	.	0.905525	0.09087	N	0.850475	T	0.17534	0.0421	L	0.29908	0.895	0.09310	N	1	D	0.61697	0.99	P	0.59115	0.852	T	0.26608	-1.0098	10	0.19147	T	0.46	.	7.3461	0.26664	0.0:0.0:1.0:0.0	.	363	Q9NZP6	CO002_HUMAN	Q	363	ENSP00000333735:E363Q	ENSP00000333735:E363Q	E	+	1	0	C15orf2	22473194	0.002000	0.14202	0.001000	0.08648	0.059000	0.15707	1.655000	0.37345	1.386000	0.46466	0.313000	0.20887	GAG	NPAP1	-	NULL	ENSG00000185823		0.527	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1	28	0.00	0	G	NM_018958		24922101	24922101	+1	no_errors	ENST00000329468	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	0.001	C
OR6K6	128371	genome.wustl.edu	37	1	158725034	158725034	+	Silent	SNP	G	G	A			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr1:158725034G>A	ENST00000368144.2	+	1	525	c.429G>A	c.(427-429)ctG>ctA	p.L143L		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					GCTGTGTCCTGACAGCAATGG	0.483																																						dbGAP											0													90.0	81.0	84.0					1																	158725034		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.429G>A	1.37:g.158725034G>A			B9EIM8|Q5VUU9|Q6IFR4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L143	ENST00000368144.2	37	c.429	CCDS30904.1	1																																																																																			OR6K6	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000180433		0.483	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6K6	HGNC	protein_coding	OTTHUMT00000059065.2	31	0.00	0	G	NM_001005184		158725034	158725034	+1	no_errors	ENST00000368144	ensembl	human	known	69_37n	silent	43	14.00	7	SNP	1.000	A
PCDHB2	56133	genome.wustl.edu	37	5	140476634	140476634	+	Missense_Mutation	SNP	G	G	A	rs267600411		TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr5:140476634G>A	ENST00000194155.4	+	1	2408	c.2260G>A	c.(2260-2262)Gag>Aag	p.E754K		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	754					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTACCAGTACGAGGTGTGTCT	0.627																																						dbGAP											0													33.0	35.0	34.0					5																	140476634		2152	4254	6406	-	-	-	SO:0001583	missense	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.2260G>A	5.37:g.140476634G>A	ENSP00000194155:p.Glu754Lys		Q4KMU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E754K	ENST00000194155.4	37	c.2260	CCDS4244.1	5	.	.	.	.	.	.	.	.	.	.	G	13.36	2.214599	0.39102	.	.	ENSG00000112852	ENST00000194155	T	0.14766	2.48	4.58	3.69	0.42338	.	.	.	.	.	T	0.16300	0.0392	M	0.81179	2.53	0.39111	D	0.961472	P	0.41214	0.742	B	0.34138	0.176	T	0.05632	-1.0873	9	0.59425	D	0.04	.	8.3954	0.32553	0.0841:0.1573:0.7586:0.0	.	754	Q9Y5E7	PCDB2_HUMAN	K	754	ENSP00000194155:E754K	ENSP00000194155:E754K	E	+	1	0	PCDHB2	140456818	0.960000	0.32886	0.968000	0.41197	0.059000	0.15707	1.952000	0.40343	1.022000	0.39626	0.650000	0.86243	GAG	PCDHB2	-	NULL	ENSG00000112852		0.627	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2	62	0.00	0	G	NM_018936		140476634	140476634	+1	no_errors	ENST00000194155	ensembl	human	known	69_37n	missense	65	10.96	8	SNP	0.998	A
PLAC1	10761	genome.wustl.edu	37	X	133700448	133700448	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chrX:133700448G>C	ENST00000359237.4	-	3	550	c.265C>G	c.(265-267)Cag>Gag	p.Q89E	PLAC1_ENST00000476971.1_5'UTR	NM_021796.3	NP_068568.1			placenta-specific 1											large_intestine(4)|lung(1)|pancreas(1)	6	Acute lymphoblastic leukemia(192;0.000127)					ACCATGTCCTGAGAGACAGCT	0.532																																						dbGAP											0													224.0	186.0	199.0					X																	133700448		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF234654	CCDS14642.1	Xq26.3	2013-10-14			ENSG00000170965	ENSG00000170965			9044	protein-coding gene	gene with protein product	"""cancer/testis antigen 92"""	300296				10995572	Standard	NM_021796		Approved	CT92, OOSP2L	uc004exo.1	Q9HBJ0	OTTHUMG00000022457	ENST00000359237.4:c.265C>G	X.37:g.133700448G>C	ENSP00000352173:p.Gln89Glu			Missense_Mutation	SNP	NULL	p.Q89E	ENST00000359237.4	37	c.265	CCDS14642.1	X	.	.	.	.	.	.	.	.	.	.	G	0.025	-1.384656	0.01194	.	.	ENSG00000170965	ENST00000359237	T	0.81415	-1.49	4.54	-0.765	0.11023	.	0.729163	0.11283	N	0.580118	T	0.64527	0.2606	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.45775	-0.9238	10	0.07644	T	0.81	-1.5487	9.1276	0.36826	0.0974:0.6069:0.2956:0.0	.	89	Q9HBJ0	PLAC1_HUMAN	E	89	ENSP00000352173:Q89E	ENSP00000352173:Q89E	Q	-	1	0	PLAC1	133528114	0.036000	0.19791	0.000000	0.03702	0.007000	0.05969	0.051000	0.14141	-0.276000	0.09206	0.600000	0.82982	CAG	PLAC1	-	NULL	ENSG00000170965		0.532	PLAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAC1	HGNC	protein_coding	OTTHUMT00000058375.1	67	0.00	0	G	NM_021796		133700448	133700448	-1	no_errors	ENST00000359237	ensembl	human	known	69_37n	missense	81	10.99	10	SNP	0.000	C
PPM1F	9647	genome.wustl.edu	37	22	22277806	22277806	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr22:22277806C>T	ENST00000263212.5	-	8	1129	c.1024G>A	c.(1024-1026)Gat>Aat	p.D342N	PPM1F_ENST00000407142.1_Missense_Mutation_p.D174N|PPM1F_ENST00000538191.1_Missense_Mutation_p.D238N	NM_014634.3	NP_055449.1	P49593	PPM1F_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1F	342					cellular response to drug (GO:0035690)|histone dephosphorylation (GO:0016576)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of stress fiber assembly (GO:0051496)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	calmodulin-dependent protein phosphatase activity (GO:0033192)|metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	12	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		GAAGCTGCATCGGCCTCCCCA	0.632																																						dbGAP											0													42.0	46.0	45.0					22																	22277806		2203	4300	6503	-	-	-	SO:0001583	missense	0			D13640	CCDS13796.1	22q11.22	2012-04-17	2010-03-05		ENSG00000100034	ENSG00000100034	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19388	protein-coding gene	gene with protein product	"""partner of PIX 2"", ""Ca(2+)/calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1F (PP2C domain containing)"""			11864573, 11559703	Standard	NM_014634		Approved	FEM-2, KIAA0015, POPX2, CaMKPase, CAMKP	uc002zvp.2	P49593	OTTHUMG00000150835	ENST00000263212.5:c.1024G>A	22.37:g.22277806C>T	ENSP00000263212:p.Asp342Asn		A8K6G3|B7Z2C3|Q96PM2	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.D342N	ENST00000263212.5	37	c.1024	CCDS13796.1	22	.	.	.	.	.	.	.	.	.	.	C	35	5.468701	0.96274	.	.	ENSG00000100034	ENST00000263212;ENST00000407142;ENST00000406981;ENST00000538191	T;T;T	0.20881	2.04;2.04;2.04	5.23	5.23	0.72850	Protein phosphatase 2C-like (5);	0.047508	0.85682	D	0.000000	T	0.53530	0.1802	M	0.84585	2.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.992;0.997	T	0.59773	-0.7391	10	0.87932	D	0	-20.1094	18.9912	0.92793	0.0:1.0:0.0:0.0	.	238;342	B7Z2C3;P49593	.;PPM1F_HUMAN	N	342;174;174;238	ENSP00000263212:D342N;ENSP00000384930:D174N;ENSP00000439915:D238N	ENSP00000263212:D342N	D	-	1	0	PPM1F	20607806	1.000000	0.71417	0.694000	0.30210	0.572000	0.35998	7.369000	0.79578	2.721000	0.93114	0.655000	0.94253	GAT	PPM1F	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000100034		0.632	PPM1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1F	HGNC	protein_coding	OTTHUMT00000320267.2	22	0.00	0	C	NM_014634		22277806	22277806	-1	no_errors	ENST00000263212	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.998	T
RRAGD	58528	genome.wustl.edu	37	6	90097118	90097118	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr6:90097118G>A	ENST00000369415.4	-	2	616	c.340C>T	c.(340-342)Cag>Tag	p.Q114*	RRAGD_ENST00000492783.1_5'UTR|RRAGD_ENST00000359203.3_Intron	NM_021244.4	NP_067067.1			Ras-related GTP binding D											breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(2)	15		all_cancers(76;7.01e-07)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00139)		BRCA - Breast invasive adenocarcinoma(108;0.0144)		TCCCAAATCTGAAAATTGACA	0.418																																						dbGAP											0													135.0	146.0	142.0					6																	90097118		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF272036	CCDS5022.1	6q15-q16	2008-02-05			ENSG00000025039	ENSG00000025039			19903	protein-coding gene	gene with protein product		608268				11073942	Standard	NM_021244		Approved	DKFZP761H171, bA11D8.2.1	uc003pnd.4	Q9NQL2	OTTHUMG00000015200	ENST00000369415.4:c.340C>T	6.37:g.90097118G>A	ENSP00000358423:p.Gln114*			Nonsense_Mutation	SNP	pfam_Gtr1_RagA,pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su	p.Q114*	ENST00000369415.4	37	c.340	CCDS5022.1	6	.	.	.	.	.	.	.	.	.	.	G	39	7.397482	0.98258	.	.	ENSG00000025039	ENST00000369415	.	.	.	5.47	5.47	0.80525	.	0.107041	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-14.4557	19.3349	0.94312	0.0:0.0:1.0:0.0	.	.	.	.	X	114	.	ENSP00000358423:Q114X	Q	-	1	0	RRAGD	90153837	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.583000	0.87209	0.655000	0.94253	CAG	RRAGD	-	pfam_Gtr1_RagA,pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su	ENSG00000025039		0.418	RRAGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRAGD	HGNC	protein_coding	OTTHUMT00000041484.1	46	0.00	0	G	NM_021244		90097118	90097118	-1	no_errors	ENST00000369415	ensembl	human	known	69_37n	nonsense	40	11.11	5	SNP	1.000	A
SEC23B	10483	genome.wustl.edu	37	20	18526630	18526630	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr20:18526630G>C	ENST00000336714.3	+	15	2128	c.1696G>C	c.(1696-1698)Gac>Cac	p.D566H	AL121893.1_ENST00000578930.1_RNA|SEC23B_ENST00000262544.2_Missense_Mutation_p.D566H|SEC23B_ENST00000377465.1_Missense_Mutation_p.D566H|SEC23B_ENST00000377475.3_Missense_Mutation_p.D566H	NM_006363.4|NM_032985.4|NM_032986.3	NP_006354.2|NP_116780.1|NP_116781.1	Q15437	SC23B_HUMAN	Sec23 homolog B (S. cerevisiae)	566					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	32						TAACAAAGAAGACCCCACTTC	0.299																																						dbGAP											0													139.0	152.0	148.0					20																	18526630		2203	4300	6503	-	-	-	SO:0001583	missense	0			X97065	CCDS13137.1	20p11.23	2010-02-09	2001-11-28		ENSG00000101310	ENSG00000101310			10702	protein-coding gene	gene with protein product		610512	"""Sec23 (S. cerevisiae) homolog B"", ""congenital dyserythropoietic anemia, type II"""	CDAN2		8898360, 10329445, 19621418	Standard	NM_032985		Approved	CDA-II, CDAII, HEMPAS	uc002wrb.2	Q15437	OTTHUMG00000031976	ENST00000336714.3:c.1696G>C	20.37:g.18526630G>C	ENSP00000338844:p.Asp566His		D3DW33|Q503A9|Q5W183|Q9BS15|Q9BSI2|Q9H1D7	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Gelsolin_dom,pfam_Znf_Sec23_Sec24,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.D566H	ENST00000336714.3	37	c.1696	CCDS13137.1	20	.	.	.	.	.	.	.	.	.	.	G	27.4	4.823656	0.90873	.	.	ENSG00000101310	ENST00000336714;ENST00000262544;ENST00000377475;ENST00000377465;ENST00000422877	D;D;D;D;D	0.95272	-3.66;-3.66;-3.66;-3.66;-3.66	5.44	5.44	0.79542	Sec23/Sec24, helical domain (2);	0.000000	0.85682	D	0.000000	D	0.97873	0.9301	M	0.92604	3.325	0.80722	D	1	D;D	0.69078	0.997;0.988	D;D	0.68943	0.961;0.934	D	0.98487	1.0608	10	0.87932	D	0	-23.389	18.4355	0.90645	0.0:0.0:1.0:0.0	.	548;566	B4DJW8;Q15437	.;SC23B_HUMAN	H	566;566;566;566;74	ENSP00000338844:D566H;ENSP00000262544:D566H;ENSP00000366695:D566H;ENSP00000366685:D566H;ENSP00000409882:D74H	ENSP00000262544:D566H	D	+	1	0	SEC23B	18474630	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.623000	0.98386	2.828000	0.97474	0.655000	0.94253	GAC	SEC23B	-	pfam_Sec23/24_helical_dom,superfamily_Sec23/24_helical_dom	ENSG00000101310		0.299	SEC23B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEC23B	HGNC	protein_coding	OTTHUMT00000078184.5	80	0.00	0	G			18526630	18526630	+1	no_errors	ENST00000262544	ensembl	human	known	69_37n	missense	86	10.42	10	SNP	1.000	C
SLC12A6	9990	genome.wustl.edu	37	15	34553129	34553129	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr15:34553129C>T	ENST00000354181.3	-	4	901	c.409G>A	c.(409-411)Gag>Aag	p.E137K	SLC12A6_ENST00000558589.1_Missense_Mutation_p.E128K|SLC12A6_ENST00000397702.2_Missense_Mutation_p.E78K|SLC12A6_ENST00000458406.2_Missense_Mutation_p.E78K|SLC12A6_ENST00000560611.1_Missense_Mutation_p.E137K|SLC12A6_ENST00000290209.5_Missense_Mutation_p.E86K|SLC12A6_ENST00000558667.1_Missense_Mutation_p.E137K|SLC12A6_ENST00000560164.1_5'UTR|SLC12A6_ENST00000397707.2_Missense_Mutation_p.E122K|SLC12A6_ENST00000451844.2_5'UTR			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	137					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)	p.E128Q(1)|p.E86Q(1)		central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	AATATTACCTCAAAGAGTGCC	0.333																																						dbGAP											2	Substitution - Missense(2)	lung(2)											57.0	61.0	59.0					15																	34553129		2199	4297	6496	-	-	-	SO:0001583	missense	0			AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.409G>A	15.37:g.34553129C>T	ENSP00000346112:p.Glu137Lys		A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	pfam_AA-permease_dom,pfam_K/Cl_cotranspt_1/3,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.E128K	ENST00000354181.3	37	c.382	CCDS58352.1	15	.	.	.	.	.	.	.	.	.	.	C	21.5	4.161886	0.78226	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406	D;D;D;D	0.84873	-1.86;-1.91;-1.84;-1.84	4.78	4.78	0.61160	.	0.161390	0.44483	D	0.000460	D	0.83820	0.5337	L	0.51422	1.61	0.80722	D	1	P;P;B	0.51147	0.63;0.942;0.021	B;P;B	0.44897	0.396;0.463;0.086	D	0.85502	0.1192	10	0.51188	T	0.08	.	16.7314	0.85436	0.0:1.0:0.0:0.0	.	122;137;86	Q9UHW9-3;Q9UHW9;A0AV76	.;S12A6_HUMAN;.	K	86;122;128;78;78	ENSP00000290209:E86K;ENSP00000380819:E122K;ENSP00000380814:E78K;ENSP00000387725:E78K	ENSP00000290209:E86K	E	-	1	0	SLC12A6	32340421	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.059000	0.76684	2.478000	0.83669	0.563000	0.77884	GAG	SLC12A6	-	prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	ENSG00000140199		0.333	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SLC12A6	HGNC	protein_coding	OTTHUMT00000417991.1	37	0.00	0	C	NM_005135		34553129	34553129	-1	no_errors	ENST00000558589	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	1.000	T
STK33	65975	genome.wustl.edu	37	11	8496364	8496364	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr11:8496364C>T	ENST00000447869.1	-	1	1007	c.89G>A	c.(88-90)aGc>aAc	p.S30N	STK33_ENST00000358872.3_Intron|STK33_ENST00000534493.1_Splice_Site|STK33_ENST00000396672.1_Missense_Mutation_p.S30N|STK33_ENST00000315204.1_Missense_Mutation_p.S30N|STK33_ENST00000396673.1_Missense_Mutation_p.S30N			Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	30					protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|skin(3)	23				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		CCTTGTTTTGCTGGAACATAC	0.383																																						dbGAP											0													144.0	145.0	145.0					11																	8496364		2201	4296	6497	-	-	-	SO:0001583	missense	0			AJ303380	CCDS7789.1, CCDS73253.1, CCDS73254.1	11p15.3	2010-03-10			ENSG00000130413	ENSG00000130413			14568	protein-coding gene	gene with protein product		607670				11738831	Standard	NM_030906		Approved		uc001mgj.1	Q9BYT3	OTTHUMG00000140275	ENST00000447869.1:c.89G>A	11.37:g.8496364C>T	ENSP00000416750:p.Ser30Asn		Q658S6|Q8NEF5	Splice_Site	SNP	-	e1-1	ENST00000447869.1	37	c.1-1	CCDS7789.1	11	.	.	.	.	.	.	.	.	.	.	C	5.828	0.337086	0.11013	.	.	ENSG00000130413	ENST00000447869;ENST00000315204;ENST00000396672;ENST00000396673;ENST00000457885;ENST00000431279;ENST00000454443	T;T;T;T;T;T	0.70164	-0.44;-0.44;-0.44;-0.46;1.56;0.92	4.0	3.06	0.35304	.	0.684221	0.13335	N	0.395649	T	0.44095	0.1277	N	0.08118	0	0.09310	N	1	B	0.23128	0.08	B	0.17433	0.018	T	0.36359	-0.9751	10	0.56958	D	0.05	.	7.9877	0.30222	0.0:0.8835:0.0:0.1165	.	30	Q9BYT3	STK33_HUMAN	N	30	ENSP00000416750:S30N;ENSP00000320754:S30N;ENSP00000379905:S30N;ENSP00000379906:S30N;ENSP00000403599:S30N;ENSP00000397569:S30N	ENSP00000320754:S30N	S	-	2	0	STK33	8452940	0.014000	0.17966	0.005000	0.12908	0.007000	0.05969	0.677000	0.25262	0.988000	0.38734	0.563000	0.77884	AGC	STK33	-	-	ENSG00000130413		0.383	STK33-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STK33	HGNC	protein_coding	OTTHUMT00000276819.2	56	0.00	0	C	NM_030906		8496364	8496364	-1	no_errors	ENST00000534493	ensembl	human	putative	69_37n	splice_site	64	17.95	14	SNP	0.008	T
TRPM1	4308	genome.wustl.edu	37	15	31339418	31339418	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr15:31339418C>T	ENST00000256552.6	-	15	1807	c.1660G>A	c.(1660-1662)Gac>Aac	p.D554N	TRPM1_ENST00000397795.2_Missense_Mutation_p.D532N|TRPM1_ENST00000542188.1_Missense_Mutation_p.D571N	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		AGCCCGATGTCTATGAGGCTG	0.512																																						dbGAP											0													89.0	90.0	90.0					15																	31339418		1998	4171	6169	-	-	-	SO:0001583	missense	0			AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.1660G>A	15.37:g.31339418C>T	ENSP00000256552:p.Asp554Asn			Missense_Mutation	SNP	pfam_Ion_trans_dom	p.D571N	ENST00000256552.6	37	c.1711	CCDS58346.1	15	.	.	.	.	.	.	.	.	.	.	C	36	5.729567	0.96856	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.55760	0.51;0.5;0.52	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.69548	0.3123	L	0.50333	1.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	T	0.71170	-0.4671	10	0.72032	D	0.01	-38.4784	19.3598	0.94432	0.0:1.0:0.0:0.0	.	526;532	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	N	532;571;554;532	ENSP00000380897:D532N;ENSP00000437849:D571N;ENSP00000256552:D554N	ENSP00000256552:D554N	D	-	1	0	TRPM1	29126710	1.000000	0.71417	0.974000	0.42286	0.974000	0.67602	7.761000	0.85260	2.562000	0.86427	0.637000	0.83480	GAC	TRPM1	-	NULL	ENSG00000134160		0.512	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	TRPM1	HGNC	protein_coding	OTTHUMT00000417166.2	35	0.00	0	C	NM_002420		31339418	31339418	-1	no_errors	ENST00000542188	ensembl	human	known	69_37n	missense	49	19.67	12	SNP	1.000	T
WBSCR17	64409	genome.wustl.edu	37	7	70885903	70885903	+	Silent	SNP	G	G	T	rs138385323		TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr7:70885903G>T	ENST00000333538.5	+	5	1408	c.774G>T	c.(772-774)ccG>ccT	p.P258P	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	258	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.P258P(1)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				GGGCTGAGCCGGTTCTATCCC	0.512																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)											181.0	170.0	174.0					7																	70885903		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.774G>T	7.37:g.70885903G>T			Q8NFV9|Q9NTA8	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.P258	ENST00000333538.5	37	c.774	CCDS5540.1	7																																																																																			WBSCR17	-	pfam_Glyco_trans_2	ENSG00000185274		0.512	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR17	HGNC	protein_coding	OTTHUMT00000252006.1	41	0.00	0	G	NM_022479		70885903	70885903	+1	no_errors	ENST00000333538	ensembl	human	known	69_37n	silent	47	11.32	6	SNP	0.086	T
ZNF648	127665	genome.wustl.edu	37	1	182026630	182026630	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr1:182026630C>A	ENST00000339948.3	-	2	723	c.516G>T	c.(514-516)aaG>aaT	p.K172N		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	172					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						CACAGAGATACTTTCCATTGC	0.572																																					NSCLC(71;908 1374 5429 20458 35642)	dbGAP											0													72.0	74.0	73.0					1																	182026630		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.516G>T	1.37:g.182026630C>A	ENSP00000344129:p.Lys172Asn		B2RP16	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K172N	ENST00000339948.3	37	c.516	CCDS30952.1	1	.	.	.	.	.	.	.	.	.	.	C	9.162	1.018897	0.19355	.	.	ENSG00000179930	ENST00000339948	T	0.06849	3.25	2.49	-2.15	0.07102	.	.	.	.	.	T	0.03348	0.0097	N	0.08118	0	0.09310	N	1	B	0.29432	0.244	B	0.19946	0.027	T	0.38693	-0.9649	9	0.66056	D	0.02	.	4.0185	0.09655	0.0:0.3705:0.3724:0.257	.	172	Q5T619	ZN648_HUMAN	N	172	ENSP00000344129:K172N	ENSP00000344129:K172N	K	-	3	2	ZNF648	180293253	0.000000	0.05858	0.000000	0.03702	0.133000	0.20885	-2.524000	0.00948	-0.534000	0.06315	0.655000	0.94253	AAG	ZNF648	-	NULL	ENSG00000179930		0.572	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF648	HGNC	protein_coding	OTTHUMT00000090794.1	43	0.00	0	C	XM_060597		182026630	182026630	-1	no_errors	ENST00000339948	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.000	A
ZNF66	7617	genome.wustl.edu	37	19	20989209	20989209	+	Missense_Mutation	SNP	G	G	A	rs62621368	byFrequency	TCGA-AR-A2LH-01A-31D-A18P-09	TCGA-AR-A2LH-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	681045b0-3975-4e0f-acdd-3a5e74c3cb8f	a7502dd8-c6dd-4105-b73a-7eaae335746b	g.chr19:20989209G>A	ENST00000344519.8	+	4	826	c.803G>A	c.(802-804)cGc>cAc	p.R268H	AC010329.1_ENST00000582722.1_RNA|ZNF66_ENST00000425625.1_Missense_Mutation_p.R314H			Q6ZN08	ZNF66_HUMAN	zinc finger protein 66	268					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GCCTTTAAGCGCTCCTCTATC	0.398													.|||	179	0.0357428	0.0083	0.0447	5008	,	,		20801	0.002		0.0875	False		,,,				2504	0.0481					dbGAP											0																																										-	-	-	SO:0001583	missense	0			M88375		19p12	2013-03-06	2013-03-06	2013-03-06	ENSG00000160229	ENSG00000160229			13135	other	unknown			"""zinc finger protein 66, pseudogene"""	ZNF66P		1505991	Standard	NG_023377		Approved	FLJ16537	uc002npe.3	Q6ZN08	OTTHUMG00000167735	ENST00000344519.8:c.803G>A	19.37:g.20989209G>A	ENSP00000461425:p.Arg268His		I3L4P5|Q15939	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R314H	ENST00000344519.8	37	c.941		19																																																																																			ZNF66P	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160229		0.398	ZNF66-001	KNOWN	basic|appris_principal	protein_coding	ZNF66P	HGNC	protein_coding	OTTHUMT00000395955.2	8	0.00	0	G	NG_023377		20989209	20989209	+1	no_errors	ENST00000425625	ensembl	human	known	69_37n	missense	11	47.62	10	SNP	0.000	A
