#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AIDA	64853	genome.wustl.edu	37	1	222843570	222843570	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr1:222843570G>C	ENST00000340020.6	-	9	935	c.729C>G	c.(727-729)ttC>ttG	p.F243L	AIDA_ENST00000474863.1_5'UTR|AIDA_ENST00000355727.2_Missense_Mutation_p.F161L|AIDA_ENST00000541237.1_Missense_Mutation_p.F219L	NM_022831.2	NP_073742.2	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated	243					dorsal/ventral pattern formation (GO:0009953)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|regulation of protein homodimerization activity (GO:0043496)	cytoplasm (GO:0005737)				kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10						TGTAGTGTTTGAATTCAAAGA	0.358																																						dbGAP											0													50.0	49.0	49.0					1																	222843570		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC043142	CCDS1533.1	1q41	2008-05-22	2008-05-22	2008-05-22	ENSG00000186063	ENSG00000186063			25761	protein-coding gene	gene with protein product	"""axin interaction partner and dorsalization antagonist"""	612375	"""chromosome 1 open reading frame 80"""	C1orf80		8619474, 9110174, 17681137	Standard	NM_022831		Approved	FLJ12806	uc001hnn.3	Q96BJ3	OTTHUMG00000037653	ENST00000340020.6:c.729C>G	1.37:g.222843570G>C	ENSP00000339161:p.Phe243Leu		A8K1F0|Q49A81|Q5JRA4|Q658P1|Q9H9E8	Missense_Mutation	SNP	pfam_AIDA,superfamily_AIDA_N	p.F243L	ENST00000340020.6	37	c.729	CCDS1533.1	1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.745519	0.49151	.	.	ENSG00000186063	ENST00000340020;ENST00000355727;ENST00000541237	.	.	.	5.9	3.98	0.46160	.	0.000000	0.85682	D	0.000000	T	0.62962	0.2471	L	0.36672	1.1	0.58432	D	0.999998	D;D	0.63880	0.992;0.993	D;D	0.71870	0.957;0.975	T	0.60500	-0.7251	9	0.45353	T	0.12	.	9.313	0.37917	0.2409:0.0:0.7591:0.0	.	219;243	F5H715;Q96BJ3	.;AIDA_HUMAN	L	243;161;219	.	ENSP00000339161:F243L	F	-	3	2	AIDA	220910193	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.163000	0.50763	0.758000	0.33059	0.655000	0.94253	TTC	AIDA	-	pfam_AIDA	ENSG00000186063		0.358	AIDA-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AIDA	HGNC	protein_coding	OTTHUMT00000091818.1	277	0.00	0	G	NM_022831		222843570	222843570	-1	no_errors	ENST00000340020	ensembl	human	known	69_37n	missense	353	14.25	59	SNP	1.000	C
C3	718	genome.wustl.edu	37	19	6697369	6697369	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr19:6697369A>C	ENST00000245907.6	-	21	2874	c.2782T>G	c.(2782-2784)Tcc>Gcc	p.S928A		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	928					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	ACCTTCAGGGACTTCCTGACA	0.547																																						dbGAP											0													85.0	70.0	75.0					19																	6697369		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.2782T>G	19.37:g.6697369A>C	ENSP00000245907:p.Ser928Ala		A7E236	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A-macroglobulin_rcpt-bd,pfam_Macroglobln_a2,pfam_Netrin_module_non-TIMP,pfam_A2M_N_2,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain,prints_Anaphylatoxn	p.S928A	ENST00000245907.6	37	c.2782	CCDS32883.1	19	.	.	.	.	.	.	.	.	.	.	A	0.979	-0.697539	0.03279	.	.	ENSG00000125730	ENST00000245907	T	0.33438	1.41	5.96	0.128	0.14733	.	0.880476	0.10146	N	0.710225	T	0.12433	0.0302	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.36065	-0.9763	10	0.12766	T	0.61	.	4.4047	0.11404	0.1171:0.0642:0.3437:0.475	.	928	P01024	CO3_HUMAN	A	928	ENSP00000245907:S928A	ENSP00000245907:S928A	S	-	1	0	C3	6648369	1.000000	0.71417	0.153000	0.22517	0.211000	0.24417	1.339000	0.33885	-0.366000	0.08064	-1.161000	0.01788	TCC	C3	-	NULL	ENSG00000125730		0.547	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3	HGNC	protein_coding	OTTHUMT00000317636.2	65	0.00	0	A	NM_000064		6697369	6697369	-1	no_errors	ENST00000245907	ensembl	human	known	69_37n	missense	50	20.63	13	SNP	0.067	C
CRNN	49860	genome.wustl.edu	37	1	152382164	152382164	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr1:152382164G>T	ENST00000271835.3	-	3	1456	c.1394C>A	c.(1393-1395)tCc>tAc	p.S465Y	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	465					response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGTGCTGAGGAAACACTGGT	0.547																																						dbGAP											0													183.0	141.0	155.0					1																	152382164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.1394C>A	1.37:g.152382164G>T	ENSP00000271835:p.Ser465Tyr		B2RE60|Q8N613	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.S465Y	ENST00000271835.3	37	c.1394	CCDS1010.1	1	.	.	.	.	.	.	.	.	.	.	G	10.65	1.408939	0.25378	.	.	ENSG00000143536	ENST00000271835	T	0.05382	3.45	4.5	3.54	0.40534	.	0.597826	0.15134	N	0.278693	T	0.02156	0.0067	L	0.40543	1.245	0.09310	N	1	P	0.41265	0.744	B	0.33521	0.165	T	0.39722	-0.9600	10	0.56958	D	0.05	.	9.7989	0.40753	0.0:0.0:0.7961:0.2039	.	465	Q9UBG3	CRNN_HUMAN	Y	465	ENSP00000271835:S465Y	ENSP00000271835:S465Y	S	-	2	0	CRNN	150648788	0.011000	0.17503	0.008000	0.14137	0.069000	0.16628	1.959000	0.40412	2.306000	0.77630	0.650000	0.86243	TCC	CRNN	-	NULL	ENSG00000143536		0.547	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRNN	HGNC	protein_coding	OTTHUMT00000034503.1	142	0.00	0	G	NM_016190		152382164	152382164	-1	no_errors	ENST00000271835	ensembl	human	known	69_37n	missense	261	14.98	46	SNP	0.002	T
CYFIP2	26999	genome.wustl.edu	37	5	156760407	156760407	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr5:156760407G>T	ENST00000521420.1	+	20	2351	c.2260G>T	c.(2260-2262)Gac>Tac	p.D754Y	CYFIP2_ENST00000318218.6_Missense_Mutation_p.D805Y|CYFIP2_ENST00000541131.1_Missense_Mutation_p.D705Y|CYFIP2_ENST00000442283.2_Missense_Mutation_p.D65Y|CYFIP2_ENST00000377576.3_Missense_Mutation_p.D780Y|CYFIP2_ENST00000522463.1_Missense_Mutation_p.D584Y|CYFIP2_ENST00000435847.2_Missense_Mutation_p.D479Y|CYFIP2_ENST00000347377.6_Missense_Mutation_p.D780Y					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TAAATCCTTGGACCAAGCTAT	0.473																																						dbGAP											0													244.0	242.0	243.0					5																	156760407		1969	4170	6139	-	-	-	SO:0001583	missense	0			AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.2260G>T	5.37:g.156760407G>T	ENSP00000430904:p.Asp754Tyr			Missense_Mutation	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.D805Y	ENST00000521420.1	37	c.2413		5	.	.	.	.	.	.	.	.	.	.	G	31	5.092429	0.94149	.	.	ENSG00000055163	ENST00000318218;ENST00000442283;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T;T;T;T;T;T;T;T	0.26518	1.73;1.73;1.73;1.73;1.73;1.73;1.73;1.73	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.54515	0.1863	M	0.78049	2.395	0.80722	D	1	D;D;D;D;D;P	0.67145	0.988;0.995;0.995;0.963;0.996;0.948	P;D;D;P;D;P	0.66351	0.896;0.943;0.926;0.807;0.923;0.761	T	0.55704	-0.8099	10	0.87932	D	0	-43.4809	20.2985	0.98592	0.0:0.0:1.0:0.0	.	644;584;754;780;780;805	A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;.;CYFP2_HUMAN	Y	805;65;584;754;780;780;705;479	ENSP00000325817:D805Y;ENSP00000390948:D65Y;ENSP00000428009:D584Y;ENSP00000430904:D754Y;ENSP00000313567:D780Y;ENSP00000366799:D780Y;ENSP00000444645:D705Y;ENSP00000403793:D479Y	ENSP00000325817:D805Y	D	+	1	0	CYFIP2	156692985	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.814000	0.99346	2.793000	0.96121	0.655000	0.94253	GAC	CYFIP2	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000055163		0.473	CYFIP2-001	NOVEL	basic	protein_coding	CYFIP2	HGNC	protein_coding	OTTHUMT00000373710.1	216	0.00	0	G	NM_001037332		156760407	156760407	+1	no_errors	ENST00000318218	ensembl	human	known	69_37n	missense	226	23.39	69	SNP	1.000	T
DNM3	26052	genome.wustl.edu	37	1	172277938	172277938	+	Missense_Mutation	SNP	G	G	A	rs560306268		TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr1:172277938G>A	ENST00000355305.5	+	17	2027	c.1870G>A	c.(1870-1872)Gca>Aca	p.A624T	DNM3_ENST00000520906.1_Missense_Mutation_p.A614T|DNM3_ENST00000367731.1_Missense_Mutation_p.A614T|DNM3_ENST00000358155.4_Missense_Mutation_p.A614T			Q9UQ16	DYN3_HUMAN	dynamin 3	624					endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CAGCTGGAAGGCATCTCTACT	0.358																																						dbGAP											0													65.0	64.0	65.0					1																	172277938		1858	4112	5970	-	-	-	SO:0001583	missense	0			AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.1870G>A	1.37:g.172277938G>A	ENSP00000347457:p.Ala624Thr		A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin	p.A614T	ENST00000355305.5	37	c.1840		1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867620	0.51588	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000355305;ENST00000367731;ENST00000520906	T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95	5.65	4.74	0.60224	.	0.066715	0.64402	D	0.000011	D	0.82829	0.5122	M	0.88775	2.98	0.58432	D	0.999993	P;P;P	0.46912	0.859;0.886;0.886	P;P;P	0.58820	0.846;0.774;0.824	D	0.85997	0.1492	10	0.62326	D	0.03	.	13.4906	0.61393	0.076:0.0:0.924:0.0	.	614;614;614	E5RHK8;Q9UQ16-2;Q9UQ16-3	.;.;.	T	624;614;624;614;614	ENSP00000350876:A614T;ENSP00000347457:A624T;ENSP00000356705:A614T;ENSP00000429701:A614T	ENSP00000347457:A624T	A	+	1	0	DNM3	170544561	1.000000	0.71417	0.978000	0.43139	0.373000	0.29922	6.974000	0.76122	1.388000	0.46506	0.655000	0.94253	GCA	DNM3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000197959		0.358	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	DNM3	HGNC	protein_coding	OTTHUMT00000084531.1	132	0.00	0	G	NM_015569		172277938	172277938	+1	no_errors	ENST00000358155	ensembl	human	known	69_37n	missense	111	35.84	62	SNP	1.000	A
FAM86B2	653333	genome.wustl.edu	37	8	12283473	12283473	+	Silent	SNP	C	C	T			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr8:12283473C>T	ENST00000262365.4	-	8	917	c.918G>A	c.(916-918)gcG>gcA	p.A306A	AC087203.1_ENST00000580058.1_RNA|FAM86B2_ENST00000393715.3_Missense_Mutation_p.G126R|FAM86B2_ENST00000309608.5_3'UTR|FAM86B2_ENST00000351291.4_Silent_p.A272A	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	306										endometrium(1)|kidney(2)	3						GATGAGCTTCCGCTTCCCATC	0.527																																						dbGAP											0													2.0	2.0	2.0					8																	12283473		521	1081	1602	-	-	-	SO:0001819	synonymous_variant	0				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.918G>A	8.37:g.12283473C>T				Missense_Mutation	SNP	NULL	p.G126R	ENST00000262365.4	37	c.376	CCDS59092.1	8	.	.	.	.	.	.	.	.	.	.	-	0.010	-1.795600	0.00617	.	.	ENSG00000145002	ENST00000393715	T	0.34072	1.38	2.22	-4.44	0.03557	.	.	.	.	.	T	0.12263	0.0298	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.29181	-1.0020	5	0.07175	T	0.84	.	4.0137	0.09634	0.0:0.4192:0.2034:0.3774	.	.	.	.	R	126	ENSP00000377318:G126R	ENSP00000377318:G126R	G	-	1	0	FAM86B2	12327844	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-4.923000	0.00169	-1.939000	0.01044	-1.565000	0.00878	GGA	FAM86B2	-	NULL	ENSG00000145002		0.527	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86B2	HGNC	protein_coding		11	0.00	0	C	XM_928336		12283473	12283473	-1	no_errors	ENST00000393715	ensembl	human	known	69_37n	missense	1	66.67	2	SNP	0.000	T
GATA3	2625	genome.wustl.edu	37	10	8115874	8115875	+	Frame_Shift_Ins	INS	-	-	G	rs144824106		TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr10:8115874_8115875insG	ENST00000346208.3	+	6	1675_1676	c.1220_1221insG	c.(1219-1224)tcgcccfs	p.P408fs	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Frame_Shift_Ins_p.P409fs			P23771	GATA3_HUMAN	GATA binding protein 3	408					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.P409fs*>37(6)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						AGCCACATCTCGCCCTTCAGCC	0.604			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	6	Insertion - Frameshift(6)	breast(6)																																								-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1221dupG	10.37:g.8115875_8115875dupG	ENSP00000341619:p.Pro408fs		Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Ins	INS	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.P409fs	ENST00000346208.3	37	c.1223_1224	CCDS7083.1	10																																																																																			GATA3	-	pirsf_TF_GATA-1/2/3	ENSG00000107485		0.604	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	96	0.00	0	-	NM_001002295		8115874	8115875	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_ins	104	16.80	21	INS	0.903:0.359	G
GOLGA2	2801	genome.wustl.edu	37	9	131038206	131038206	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr9:131038206G>A	ENST00000421699.2	-	1	62	c.50C>T	c.(49-51)aCc>aTc	p.T17I	SWI5_ENST00000495313.1_Intron|SWI5_ENST00000418976.1_5'Flank|SWI5_ENST00000419867.2_5'Flank|SWI5_ENST00000320188.5_5'Flank|GOLGA2_ENST00000609374.1_Missense_Mutation_p.T5I|SWI5_ENST00000608796.1_5'Flank|GOLGA2_ENST00000490628.1_Missense_Mutation_p.T17I	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	17					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						GCTCTGTCGGGTTTCTTCCGA	0.677																																						dbGAP											0													15.0	14.0	14.0					9																	131038206		2196	4293	6489	-	-	-	SO:0001583	missense	0			L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.50C>T	9.37:g.131038206G>A	ENSP00000416097:p.Thr17Ile		Q6GRM9|Q9BRB0|Q9NYF9	Missense_Mutation	SNP	superfamily_CofA_tubulin-bd	p.T17I	ENST00000421699.2	37	c.50	CCDS6896.2	9	.	.	.	.	.	.	.	.	.	.	G	11.48	1.651809	0.29336	.	.	ENSG00000167110	ENST00000421699;ENST00000450617	T;T	0.25579	1.79;1.79	4.9	2.01	0.26516	.	0.293440	0.34580	N	0.003841	T	0.35451	0.0932	M	0.82323	2.585	0.80722	D	1	P	0.50066	0.931	P	0.49192	0.602	T	0.11767	-1.0574	10	0.72032	D	0.01	.	5.1992	0.15254	0.0816:0.4269:0.365:0.1266	.	17	Q08379	GOGA2_HUMAN	I	17	ENSP00000416097:T17I;ENSP00000409271:T17I	ENSP00000416097:T17I	T	-	2	0	GOLGA2	130078027	1.000000	0.71417	0.979000	0.43373	0.078000	0.17371	0.884000	0.28214	0.250000	0.21479	-0.175000	0.13238	ACC	GOLGA2	-	NULL	ENSG00000167110		0.677	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA2	HGNC	protein_coding	OTTHUMT00000054358.2	35	0.00	0	G	NM_004486		131038206	131038206	-1	no_errors	ENST00000421699	ensembl	human	known	69_37n	missense	37	31.48	17	SNP	1.000	A
GPR143	4935	genome.wustl.edu	37	X	9707633	9707633	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chrX:9707633C>T	ENST00000467482.1	-	8	1158	c.1012G>A	c.(1012-1014)Gag>Aag	p.E338K	GPR143_ENST00000487206.1_5'UTR|GPR143_ENST00000380929.2_Missense_Mutation_p.E358K			P51810	GP143_HUMAN	G protein-coupled receptor 143	338					calcium-mediated signaling using intracellular calcium source (GO:0035584)|eye pigment biosynthetic process (GO:0006726)|G-protein coupled receptor signaling pathway (GO:0007186)|melanosome localization (GO:0032400)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|neuropeptide signaling pathway (GO:0007218)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of calcium-mediated signaling (GO:0050848)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|G-protein coupled receptor activity (GO:0004930)|L-DOPA binding (GO:0072544)|L-DOPA receptor activity (GO:0035643)|tyrosine binding (GO:0072545)			endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Hepatocellular(5;0.000888)				TGAGCCCCCTCAGCAGCCGAG	0.582																																						dbGAP											0													51.0	44.0	46.0					X																	9707633		2203	4299	6502	-	-	-	SO:0001583	missense	0			Z48804	CCDS14134.1, CCDS14134.2	Xp22.3	2013-09-27	2003-12-01		ENSG00000101850	ENSG00000101850		"""GPCR / Unclassified : 7TM orphan receptors"""	20145	protein-coding gene	gene with protein product	"""ocular albinism 1"""	300808	"""ocular albinism 1 (Nettleship-Falls)"""	OA1		7647783, 10471510	Standard	NM_000273		Approved		uc004cst.2	P51810	OTTHUMG00000021118	ENST00000467482.1:c.1012G>A	X.37:g.9707633C>T	ENSP00000417161:p.Glu338Lys		Q6NTI7	Missense_Mutation	SNP	pfam_Ocular_alb1,pfam_GPCR_2_secretin-like,prints_Ocular_alb1	p.E358K	ENST00000467482.1	37	c.1072	CCDS14134.2	X	.	.	.	.	.	.	.	.	.	.	c	15.29	2.788781	0.49997	.	.	ENSG00000101850	ENST00000467482;ENST00000380929	D;D	0.99369	-5.78;-5.78	5.01	4.14	0.48551	.	0.430897	0.26700	N	0.022943	D	0.98182	0.9399	M	0.68952	2.095	0.09310	N	0.999997	P	0.35551	0.509	B	0.38106	0.265	D	0.93967	0.7246	10	0.23302	T	0.38	-1.6034	13.6288	0.62183	0.0:0.8468:0.1532:0.0	.	338	P51810	GP143_HUMAN	K	338;358	ENSP00000417161:E338K;ENSP00000370316:E358K	ENSP00000370316:E358K	E	-	1	0	GPR143	9667633	0.962000	0.33011	0.009000	0.14445	0.017000	0.09413	2.652000	0.46682	1.004000	0.39156	0.597000	0.82753	GAG	GPR143	-	pfam_Ocular_alb1	ENSG00000101850		0.582	GPR143-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR143	HGNC	protein_coding	OTTHUMT00000055714.2	98	0.00	0	C	NM_000273		9707633	9707633	-1	no_errors	ENST00000380929	ensembl	human	known	69_37n	missense	88	12.00	12	SNP	0.311	T
KDM4A	9682	genome.wustl.edu	37	1	44126037	44126037	+	Missense_Mutation	SNP	A	A	G	rs570986178		TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr1:44126037A>G	ENST00000372396.3	+	4	517	c.383A>G	c.(382-384)aAt>aGt	p.N128S	KDM4A_ENST00000463151.1_3'UTR	NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A	128					cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						cttacattcaatcctccaatc	0.393																																						dbGAP											0													79.0	74.0	76.0					1																	44126037		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.383A>G	1.37:g.44126037A>G	ENSP00000361473:p.Asn128Ser		Q5VVB1	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.N128S	ENST00000372396.3	37	c.383	CCDS491.1	1	.	.	.	.	.	.	.	.	.	.	A	13.07	2.128705	0.37533	.	.	ENSG00000066135	ENST00000372396	T	0.28255	1.62	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.23133	0.0559	L	0.43554	1.36	0.49582	D	0.999805	P;B	0.47545	0.897;0.027	B;B	0.35727	0.209;0.015	T	0.07849	-1.0751	10	0.09338	T	0.73	-12.2443	16.5764	0.84681	1.0:0.0:0.0:0.0	.	128;128	B4DT38;O75164	.;KDM4A_HUMAN	S	128	ENSP00000361473:N128S	ENSP00000361473:N128S	N	+	2	0	KDM4A	43898624	0.996000	0.38824	1.000000	0.80357	0.977000	0.68977	3.665000	0.54532	2.371000	0.80710	0.533000	0.62120	AAT	KDM4A	-	NULL	ENSG00000066135		0.393	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4A	HGNC	protein_coding	OTTHUMT00000019960.1	293	0.00	0	A	NM_014663		44126037	44126037	+1	no_errors	ENST00000372396	ensembl	human	known	69_37n	missense	242	20.13	61	SNP	1.000	G
KIAA1033	23325	genome.wustl.edu	37	12	105521054	105521054	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr12:105521054C>G	ENST00000332180.5	+	13	1273	c.1186C>G	c.(1186-1188)Caa>Gaa	p.Q396E		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						ACAGAAAGCTCAATCACTTAC	0.303																																						dbGAP											0													70.0	70.0	70.0					12																	105521054		1802	4065	5867	-	-	-	SO:0001583	missense	0			AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.1186C>G	12.37:g.105521054C>G	ENSP00000328062:p.Gln396Glu			Missense_Mutation	SNP	NULL	p.Q396E	ENST00000332180.5	37	c.1186	CCDS41826.1	12	.	.	.	.	.	.	.	.	.	.	C	17.14	3.313772	0.60414	.	.	ENSG00000136051	ENST00000332180	T	0.31769	1.48	5.52	5.52	0.82312	.	0.053133	0.85682	D	0.000000	T	0.36580	0.0972	L	0.58669	1.825	0.80722	D	1	P;P	0.37500	0.597;0.597	B;B	0.40285	0.325;0.325	T	0.06373	-1.0830	10	0.19590	T	0.45	.	19.4129	0.94683	0.0:1.0:0.0:0.0	.	396;396	B7ZKT9;Q2M389	.;WASH7_HUMAN	E	396	ENSP00000328062:Q396E	ENSP00000328062:Q396E	Q	+	1	0	KIAA1033	104045184	1.000000	0.71417	0.992000	0.48379	0.960000	0.62799	7.553000	0.82203	2.585000	0.87301	0.655000	0.94253	CAA	KIAA1033	-	NULL	ENSG00000136051		0.303	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1033	HGNC	protein_coding	OTTHUMT00000406138.4	218	0.00	0	C	NM_015275		105521054	105521054	+1	no_errors	ENST00000332180	ensembl	human	known	69_37n	missense	177	14.49	30	SNP	1.000	G
KRTAP24-1	643803	genome.wustl.edu	37	21	31655201	31655201	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr21:31655201G>A	ENST00000340345.4	-	1	75	c.50C>T	c.(49-51)aCc>aTc	p.T17I		NM_001085455.1	NP_001078924.1	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	17						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|large_intestine(3)|lung(7)|urinary_tract(3)	14						GTATGATGTGGTACTGCAGAC	0.493																																						dbGAP											0													48.0	49.0	49.0					21																	31655201		2013	4186	6199	-	-	-	SO:0001583	missense	0			AB096935	CCDS42915.1	21q22.11	2007-11-23			ENSG00000188694	ENSG00000188694		"""Keratin associated proteins"""	33902	protein-coding gene	gene with protein product							Standard	NM_001085455		Approved	KAP24.1	uc002ynv.3	Q3LI83	OTTHUMG00000125483	ENST00000340345.4:c.50C>T	21.37:g.31655201G>A	ENSP00000339238:p.Thr17Ile		Q1XDX0	Missense_Mutation	SNP	pfam_PMG	p.T17I	ENST00000340345.4	37	c.50	CCDS42915.1	21	.	.	.	.	.	.	.	.	.	.	G	3.068	-0.191684	0.06299	.	.	ENSG00000188694	ENST00000340345	T	0.03441	3.93	4.69	1.88	0.25563	.	1.092770	0.07062	N	0.833817	T	0.03136	0.0092	N	0.22421	0.69	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.44787	-0.9305	10	0.45353	T	0.12	0.0	4.3234	0.11029	0.241:0.2793:0.4797:0.0	.	17	Q3LI83	KR241_HUMAN	I	17	ENSP00000339238:T17I	ENSP00000339238:T17I	T	-	2	0	KRTAP24-1	30577072	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.314000	0.08092	0.683000	0.31428	-0.249000	0.11873	ACC	KRTAP24-1	-	pfam_PMG	ENSG00000188694		0.493	KRTAP24-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP24-1	HGNC	protein_coding	OTTHUMT00000246806.2	40	0.00	0	G	NM_001085455		31655201	31655201	-1	no_errors	ENST00000340345	ensembl	human	known	69_37n	missense	50	13.56	8	SNP	0.000	A
MAGEH1	28986	genome.wustl.edu	37	X	55478908	55478908	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chrX:55478908C>A	ENST00000342972.1	+	1	371	c.101C>A	c.(100-102)cCt>cAt	p.P34H	hsa-mir-4536-2_ENST00000583537.1_RNA	NM_014061.3	NP_054780.2	Q9H213	MAGH1_HUMAN	melanoma antigen family H, 1	34	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				apoptotic process (GO:0006915)	cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|skin(2)	15						TCCGAGACCCCTATGGCCGCC	0.637																																						dbGAP											0													20.0	24.0	23.0					X																	55478908		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF320912	CCDS14369.1	Xp11.22	2008-02-05			ENSG00000187601	ENSG00000187601			24092	protein-coding gene	gene with protein product		300548				12414813, 9485030	Standard	NM_014061		Approved	APR1	uc004dum.3	Q9H213	OTTHUMG00000021655	ENST00000342972.1:c.101C>A	X.37:g.55478908C>A	ENSP00000343706:p.Pro34His		B2R8V9|Q5JRJ3|Q9Y5M2	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.P34H	ENST00000342972.1	37	c.101	CCDS14369.1	X	.	.	.	.	.	.	.	.	.	.	.	3.505	-0.100956	0.06967	.	.	ENSG00000187601	ENST00000342972	T	0.15718	2.4	3.03	1.05	0.20165	.	0.249612	0.21242	N	0.077795	T	0.06781	0.0173	N	0.08118	0	0.09310	N	1	P	0.37233	0.588	B	0.34346	0.18	T	0.23762	-1.0179	10	0.66056	D	0.02	-1.4865	4.3765	0.11272	0.0:0.6091:0.0:0.3909	.	34	Q9H213	MAGH1_HUMAN	H	34	ENSP00000343706:P34H	ENSP00000343706:P34H	P	+	2	0	MAGEH1	55495633	0.001000	0.12720	0.005000	0.12908	0.007000	0.05969	-0.092000	0.11129	0.143000	0.18926	-0.297000	0.09499	CCT	MAGEH1	-	NULL	ENSG00000187601		0.637	MAGEH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEH1	HGNC	protein_coding	OTTHUMT00000056868.1	18	0.00	0	C	NM_014061		55478908	55478908	+1	no_errors	ENST00000342972	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	0.004	A
ME3	10873	genome.wustl.edu	37	11	86382866	86382866	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr11:86382866C>T	ENST00000393324.3	-	1	374	c.121G>A	c.(121-123)Gcg>Acg	p.A41T	ME3_ENST00000543262.1_Missense_Mutation_p.A41T|ME3_ENST00000359636.2_Missense_Mutation_p.A41T	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	41					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				ACAGGGCGCGCCGGGCCAGGC	0.721																																						dbGAP											0													36.0	37.0	37.0					11																	86382866		2199	4298	6497	-	-	-	SO:0001583	missense	0			X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.121G>A	11.37:g.86382866C>T	ENSP00000376998:p.Ala41Thr		B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	pfam_Malic_NAD-bd,pfam_Malic_N,smart_Malic_NAD-bd,prints_Malic_OxRdtase	p.A41T	ENST00000393324.3	37	c.121	CCDS8277.1	11	.	.	.	.	.	.	.	.	.	.	C	21.6	4.171613	0.78452	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826;ENST00000530335;ENST00000532471;ENST00000526834;ENST00000526944	T;T;T;T;T	0.28666	2.29;2.29;2.29;2.29;1.6	5.16	-0.213	0.13165	.	0.773311	0.12231	N	0.487471	T	0.08802	0.0218	N	0.02539	-0.55	0.09310	N	0.999996	B	0.11235	0.004	B	0.08055	0.003	T	0.30179	-0.9987	9	.	.	.	.	1.3367	0.02146	0.1451:0.4361:0.1511:0.2677	.	41	Q16798	MAON_HUMAN	T	41	ENSP00000352657:A41T;ENSP00000440246:A41T;ENSP00000376998:A41T;ENSP00000431182:A41T;ENSP00000434690:A41T	.	A	-	1	0	ME3	86060514	0.197000	0.23362	0.002000	0.10522	0.228000	0.25075	0.301000	0.19174	-0.053000	0.13289	0.555000	0.69702	GCG	ME3	-	NULL	ENSG00000151376		0.721	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ME3	HGNC	protein_coding	OTTHUMT00000393767.2	18	0.00	0	C			86382866	86382866	-1	no_errors	ENST00000359636	ensembl	human	known	69_37n	missense	40	24.53	13	SNP	0.000	T
PKHD1	5314	genome.wustl.edu	37	6	51512917	51512917	+	Splice_Site	SNP	C	C	G			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr6:51512917C>G	ENST00000371117.3	-	63	11586		c.e63-1			NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)						cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CTCTTCGATTCTAGAAATGGG	0.413																																						dbGAP											0													78.0	81.0	80.0					6																	51512917		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.11311-1G>C	6.37:g.51512917C>G			Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Splice_Site	SNP	-	e62-1	ENST00000371117.3	37	c.11311-1	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	C	17.64	3.439049	0.63067	.	.	ENSG00000170927	ENST00000371117	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4149	0.87497	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PKHD1	51620876	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	4.138000	0.58017	2.435000	0.82474	0.650000	0.86243	.	PKHD1	-	-	ENSG00000170927		0.413	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	190	0.00	0	C	NM_138694	Intron	51512917	51512917	-1	no_errors	ENST00000371117	ensembl	human	known	69_37n	splice_site	116	22.15	33	SNP	1.000	G
POLE	5426	genome.wustl.edu	37	12	133249314	133249314	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr12:133249314C>A	ENST00000320574.5	-	15	1628	c.1585G>T	c.(1585-1587)Gac>Tac	p.D529Y	POLE_ENST00000535270.1_Missense_Mutation_p.D502Y	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	529					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	TGTCCGTCGTCCGTCAGCTTA	0.592								DNA polymerases (catalytic subunits)																														dbGAP											0													146.0	135.0	139.0					12																	133249314		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.1585G>T	12.37:g.133249314C>A	ENSP00000322570:p.Asp529Tyr		Q13533|Q86VH9	Missense_Mutation	SNP	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.D540Y	ENST00000320574.5	37	c.1618	CCDS9278.1	12	.	.	.	.	.	.	.	.	.	.	C	6.700	0.497840	0.12762	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577;ENST00000535934	T;T;T;T	0.13538	4.25;4.25;4.25;2.58	5.57	4.68	0.58851	.	0.402931	0.28754	N	0.014249	T	0.08626	0.0214	N	0.05330	-0.07	0.09310	N	0.999993	B;P	0.42203	0.053;0.773	B;B	0.41813	0.023;0.367	T	0.12993	-1.0526	10	0.62326	D	0.03	.	10.4879	0.44733	0.0:0.8513:0.0:0.1487	.	502;529	F5H1D6;Q07864	.;DPOE1_HUMAN	Y	529;540;502;309;464;147	ENSP00000322570:D529Y;ENSP00000406383:D540Y;ENSP00000445753:D502Y;ENSP00000442519:D309Y	ENSP00000322570:D529Y	D	-	1	0	POLE	131759387	0.647000	0.27304	0.012000	0.15200	0.265000	0.26407	3.283000	0.51701	1.345000	0.45676	0.313000	0.20887	GAC	POLE	-	smart_DNA-dir_DNA_pol_B	ENSG00000177084		0.592	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	HGNC	protein_coding	OTTHUMT00000397689.2	224	0.00	0	C	NM_006231		133249314	133249314	-1	no_errors	ENST00000455752	ensembl	human	known	69_37n	missense	249	20.45	64	SNP	0.140	A
RNF207	388591	genome.wustl.edu	37	1	6272428	6272428	+	Silent	SNP	C	C	T			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr1:6272428C>T	ENST00000377939.4	+	14	1561	c.1434C>T	c.(1432-1434)atC>atT	p.I478I	RNF207_ENST00000377948.2_3'UTR	NM_207396.2	NP_997279.2	Q6ZRF8	RN207_HUMAN	ring finger protein 207	478						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(2)	16	Ovarian(185;0.0634)	all_cancers(23;1.22e-38)|all_epithelial(116;4.25e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.84e-38)|GBM - Glioblastoma multiforme(13;5.77e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.88e-19)|Colorectal(212;6.9e-08)|COAD - Colon adenocarcinoma(227;8.13e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		ACGTGCAGATCGCCTCGGAGC	0.607																																						dbGAP											0													68.0	73.0	72.0					1																	6272428		2115	4217	6332	-	-	-	SO:0001819	synonymous_variant	0			AK128246	CCDS59.2	1p36.31	2008-11-19			ENSG00000158286	ENSG00000158286		"""RING-type (C3HC4) zinc fingers"""	32947	protein-coding gene	gene with protein product	"""OTTHUMG00000001089"""		"""chromosome 1 open reading frame 188"""	C1orf188			Standard	NM_207396		Approved	FLJ46380, FLJ32096	uc001amg.3	Q6ZRF8	OTTHUMG00000001089	ENST00000377939.4:c.1434C>T	1.37:g.6272428C>T			A2VCM8|B4DFR6|Q5TGS6|Q6ZS63|Q96MP2	Silent	SNP	pfam_Znf_B-box,smart_Znf_RING,pfscan_Znf_B-box,pfscan_Znf_RING	p.I478	ENST00000377939.4	37	c.1434	CCDS59.2	1																																																																																			RNF207	-	NULL	ENSG00000158286		0.607	RNF207-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RNF207	HGNC	protein_coding	OTTHUMT00000003669.2	39	0.00	0	C	NM_207396		6272428	6272428	+1	no_errors	ENST00000377939	ensembl	human	novel	69_37n	silent	22	26.67	8	SNP	0.310	T
SCD	6319	genome.wustl.edu	37	10	102108102	102108102	+	Splice_Site	SNP	G	G	C			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr10:102108102G>C	ENST00000370355.2	+	2	690	c.309G>C	c.(307-309)tgG>tgC	p.W103C	RP11-34D15.2_ENST00000429420.1_RNA	NM_005063.4	NP_005054.3	O00767	ACOD_HUMAN	stearoyl-CoA desaturase (delta-9-desaturase)	103					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			endometrium(1)|large_intestine(3)|lung(5)	9		Colorectal(252;0.0323)		Epithelial(162;1.97e-10)|all cancers(201;1.73e-08)		CCTGGCTTTGGGGTAAGCAGC	0.502																																					Colon(67;260 1459 9574 11663)	dbGAP											0													118.0	120.0	119.0					10																	102108102		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF097514	CCDS7493.1	10q23-q24	2013-01-25			ENSG00000099194	ENSG00000099194	1.14.19.1	"""Fatty acid desaturases"""	10571	protein-coding gene	gene with protein product	"""acyl-CoA desaturase"", ""fatty acid desaturase"", ""delta-9-desaturase"""	604031	"""stearoyl-CoA desaturase opposite strand"""	SCDOS		7909540, 10229681	Standard	NM_005063		Approved	FADS5	uc001kqy.3	O00767	OTTHUMG00000018906	ENST00000370355.2:c.310+1G>C	10.37:g.102108102G>C			B2R5U0|D3DR68|Q16150|Q53GR9|Q5W037|Q5W038|Q6GSS4|Q96KF6|Q9BS07|Q9Y695	Missense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,prints_Fatty_acid_desaturase-1_core	p.W103C	ENST00000370355.2	37	c.309	CCDS7493.1	10	.	.	.	.	.	.	.	.	.	.	G	14.97	2.695770	0.48202	.	.	ENSG00000099194	ENST00000423840;ENST00000370355	T	0.18960	2.18	5.3	2.2	0.27929	Fatty acid desaturase, type 1 (1);	0.434509	0.22428	N	0.060182	T	0.50137	0.1598	M	0.91196	3.185	0.80722	D	1	D	0.64830	0.994	D	0.67382	0.951	T	0.59830	-0.7380	10	0.87932	D	0	-3.4448	11.4256	0.50009	0.0:0.1206:0.6299:0.2496	.	103	O00767	ACOD_HUMAN	C	103	ENSP00000359380:W103C	ENSP00000359380:W103C	W	+	3	0	SCD	102098092	1.000000	0.71417	0.997000	0.53966	0.371000	0.29859	2.995000	0.49441	0.706000	0.31912	0.462000	0.41574	TGG	SCD	-	pfam_Fatty_acid_desaturase-1,prints_Fatty_acid_desaturase-1_core	ENSG00000099194		0.502	SCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCD	HGNC	protein_coding	OTTHUMT00000049857.2	185	0.00	0	G	NM_005063	Missense_Mutation	102108102	102108102	+1	no_errors	ENST00000370355	ensembl	human	known	69_37n	missense	182	14.15	30	SNP	1.000	C
SHANK1	50944	genome.wustl.edu	37	19	51207386	51207386	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr19:51207386G>T	ENST00000293441.1	-	9	1231	c.1213C>A	c.(1213-1215)Cag>Aag	p.Q405K	SHANK1_ENST00000359082.3_Missense_Mutation_p.Q405K|SHANK1_ENST00000391814.1_Missense_Mutation_p.Q405K	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	405					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CCCACATCCTGTTCTCGGTGG	0.632																																						dbGAP											0													124.0	125.0	124.0					19																	51207386		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.1213C>A	19.37:g.51207386G>T	ENSP00000293441:p.Gln405Lys		A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.Q405K	ENST00000293441.1	37	c.1213	CCDS12799.1	19	.	.	.	.	.	.	.	.	.	.	G	9.392	1.075787	0.20227	.	.	ENSG00000161681	ENST00000293441;ENST00000359082;ENST00000391814	T;T;T	0.37915	1.29;1.28;1.17	4.08	4.08	0.47627	.	1.299420	0.05803	U	0.612644	T	0.22085	0.0532	N	0.12569	0.235	0.26334	N	0.977475	B	0.34372	0.451	B	0.34418	0.182	T	0.11421	-1.0588	10	0.36615	T	0.2	-10.3371	5.2773	0.15657	0.1042:0.0:0.6911:0.2047	.	405	Q9Y566	SHAN1_HUMAN	K	405	ENSP00000293441:Q405K;ENSP00000351984:Q405K;ENSP00000375690:Q405K	ENSP00000293441:Q405K	Q	-	1	0	SHANK1	55899198	0.102000	0.21896	1.000000	0.80357	0.934000	0.57294	0.724000	0.25954	2.279000	0.76181	0.455000	0.32223	CAG	SHANK1	-	smart_Ankyrin_rpt	ENSG00000161681		0.632	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	HGNC	protein_coding	OTTHUMT00000268071.1	150	0.00	0	G	NM_016148		51207386	51207386	-1	no_errors	ENST00000391814	ensembl	human	known	69_37n	missense	207	19.14	49	SNP	0.987	T
SRD5A1	6715	genome.wustl.edu	37	5	6663054	6663054	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr5:6663054T>C	ENST00000274192.5	+	4	922	c.688T>C	c.(688-690)Tct>Cct	p.S230P	SRD5A1_ENST00000538824.1_Missense_Mutation_p.S183P|SRD5A1_ENST00000537411.1_3'UTR	NM_001047.2	NP_001038.1	P18405	S5A1_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)	230					androgen biosynthetic process (GO:0006702)|cell differentiation (GO:0030154)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|electron carrier activity (GO:0009055)			endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Dutasteride(DB01126)|Finasteride(DB01216)|Levonorgestrel(DB00367)|Spironolactone(DB00421)	TTGTTTTTTATCTGGTAGAGC	0.383																																						dbGAP											0													111.0	106.0	107.0					5																	6663054		2203	4300	6503	-	-	-	SO:0001583	missense	0			M32313	CCDS3870.1	5p15.31	2008-02-05			ENSG00000145545	ENSG00000145545	1.3.99.5		11284	protein-coding gene	gene with protein product		184753				1686016	Standard	XR_427663		Approved		uc003jdw.3	P18405	OTTHUMG00000090456	ENST00000274192.5:c.688T>C	5.37:g.6663054T>C	ENSP00000274192:p.Ser230Pro		B2R7Q1|Q9UHY4|Q9UP36|Q9UP37	Missense_Mutation	SNP	pfam_3-oxo-5_a-steroid_4-DH_C,pfam_DUF1295,pirsf_3-oxo-5-alpha-steroid_4-DH,pfscan_3-oxo-5_a-steroid_4-DH_C	p.S230P	ENST00000274192.5	37	c.688	CCDS3870.1	5	.	.	.	.	.	.	.	.	.	.	T	12.68	2.011566	0.35511	.	.	ENSG00000145545	ENST00000274192;ENST00000538824	T;T	0.31247	1.5;1.5	4.66	-9.32	0.00643	3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (2);	1.580560	0.03028	N	0.151628	T	0.33265	0.0857	L	0.49126	1.545	0.09310	N	1	P;B	0.52842	0.956;0.065	P;B	0.54706	0.759;0.145	T	0.52983	-0.8502	10	0.30078	T	0.28	-11.2494	4.8561	0.13561	0.1183:0.0885:0.2101:0.5831	.	183;230	F5GXK9;P18405	.;S5A1_HUMAN	P	230;183	ENSP00000274192:S230P;ENSP00000440186:S183P	ENSP00000274192:S230P	S	+	1	0	SRD5A1	6716054	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.800000	0.00363	-3.426000	0.00165	-0.912000	0.02778	TCT	SRD5A1	-	pfam_3-oxo-5_a-steroid_4-DH_C,pirsf_3-oxo-5-alpha-steroid_4-DH,pfscan_3-oxo-5_a-steroid_4-DH_C	ENSG00000145545		0.383	SRD5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRD5A1	HGNC	protein_coding	OTTHUMT00000206903.1	415	0.00	0	T	NM_001047		6663054	6663054	+1	no_errors	ENST00000274192	ensembl	human	known	69_37n	missense	377	18.92	88	SNP	0.000	C
STXBP2	6813	genome.wustl.edu	37	19	7704692	7704692	+	Splice_Site	SNP	A	A	C			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr19:7704692A>C	ENST00000221283.5	+	4	276	c.245A>C	c.(244-246)aAg>aCg	p.K82T	CTD-3214H19.6_ENST00000601797.1_RNA|CTD-3214H19.4_ENST00000595866.1_3'UTR|STXBP2_ENST00000414284.2_Splice_Site_p.K82T|STXBP2_ENST00000441779.2_Splice_Site_p.K82T	NM_006949.2	NP_008880.2	Q15833	STXB2_HUMAN	syntaxin binding protein 2	82					leukocyte mediated cytotoxicity (GO:0001909)|neutrophil degranulation (GO:0043312)|protein transport (GO:0015031)|regulation of mast cell degranulation (GO:0043304)|vesicle docking involved in exocytosis (GO:0006904)	azurophil granule (GO:0042582)|cytolytic granule (GO:0044194)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin-3 binding (GO:0030348)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	23						CCCACGGAGAAGGTGCCTACA	0.507																																						dbGAP											0													142.0	121.0	128.0					19																	7704692		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U63533	CCDS12181.1, CCDS45948.1, CCDS62522.1	19p13.3-p13.2	2014-09-17				ENSG00000076944			11445	protein-coding gene	gene with protein product		601717				8921365	Standard	NM_001127396		Approved	UNC18B, Hunc18b	uc010xjr.3	Q15833		ENST00000221283.5:c.246+1A>C	19.37:g.7704692A>C			B4E175|E7EQD5|Q9BU65	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.K82T	ENST00000221283.5	37	c.245	CCDS12181.1	19	.	.	.	.	.	.	.	.	.	.	A	16.33	3.092609	0.56075	.	.	ENSG00000076944	ENST00000221283;ENST00000414284;ENST00000441779;ENST00000543902	T;T;T	0.80304	-1.05;-1.05;-1.36	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.82235	0.4993	M	0.83118	2.625	0.47862	D	0.999534	B;B;B	0.31227	0.314;0.268;0.314	B;B;B	0.34242	0.178;0.111;0.178	D	0.83460	0.0053	10	0.62326	D	0.03	-5.4159	12.5239	0.56075	1.0:0.0:0.0:0.0	.	82;82;82	E7EQD5;Q15833-2;Q15833	.;.;STXB2_HUMAN	T	82	ENSP00000221283:K82T;ENSP00000409471:K82T;ENSP00000413606:K82T	ENSP00000221283:K82T	K	+	2	0	STXBP2	7610692	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	5.369000	0.66138	1.901000	0.55032	0.459000	0.35465	AAG	STXBP2	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000076944		0.507	STXBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STXBP2	HGNC	protein_coding	OTTHUMT00000460963.1	122	0.00	0	A	NM_006949	Missense_Mutation	7704692	7704692	+1	no_errors	ENST00000441779	ensembl	human	known	69_37n	missense	162	19.40	39	SNP	1.000	C
TNNT3	7140	genome.wustl.edu	37	11	1954967	1954967	+	Missense_Mutation	SNP	G	G	A	rs121434638		TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr11:1954967G>A	ENST00000397301.1	+	11	229	c.221G>A	c.(220-222)cGt>cAt	p.R74H	TNNT3_ENST00000381558.1_Missense_Mutation_p.R55H|TNNT3_ENST00000446240.1_Missense_Mutation_p.R44H|TNNT3_ENST00000360603.3_Missense_Mutation_p.R57H|TNNT3_ENST00000381548.3_Missense_Mutation_p.R65H|TNNT3_ENST00000397304.2_Missense_Mutation_p.R44H|TNNT3_ENST00000278317.6_Missense_Mutation_p.R63H|TNNT3_ENST00000381549.3_Missense_Mutation_p.R55H|TNNT3_ENST00000381589.3_Missense_Mutation_p.R61H|TNNT3_ENST00000381561.4_Missense_Mutation_p.R66H|TNNT3_ENST00000381579.3_Missense_Mutation_p.R55H			P45378	TNNT3_HUMAN	troponin T type 3 (skeletal, fast)	74			R -> H (in DA2B). {ECO:0000269|PubMed:12865991}.		ATP catabolic process (GO:0006200)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)|regulation of striated muscle contraction (GO:0006942)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|troponin complex (GO:0005861)	calcium-dependent protein binding (GO:0048306)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)			breast(2)|endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(4)|stomach(1)	19		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)		CAGAAGAAGCGTCAGAACAAA	0.597																																						dbGAP											0			GRCh37	CM031754	TNNT3	M	rs121434638						85.0	76.0	79.0					11																	1954967		2201	4298	6499	-	-	-	SO:0001583	missense	0			M21984	CCDS7727.1, CCDS41594.1, CCDS41595.1, CCDS41596.1	11p15.5	2014-09-17	2005-09-12		ENSG00000130595	ENSG00000130595			11950	protein-coding gene	gene with protein product	"""troponin-T3, skeletal, fast"""	600692	"""troponin T3, skeletal, fast"""			8172653	Standard	NM_001042782		Approved	AMCD2B, DA2B, FSSV, DKFZp779M2348	uc001lup.4	P45378	OTTHUMG00000012475	ENST00000397301.1:c.221G>A	11.37:g.1954967G>A	ENSP00000380468:p.Arg74His		A8MQ76|A8MSW1|B3KPX3|B7WP64|B7ZL26|B7ZVV9|Q12975|Q12976|Q12977|Q12978|Q17RG9|Q6FH29|Q6N056|Q86TH6	Missense_Mutation	SNP	pfam_Troponin	p.R74H	ENST00000397301.1	37	c.221		11	.	.	.	.	.	.	.	.	.	.	.	19.81	3.896554	0.72639	.	.	ENSG00000130595	ENST00000278317;ENST00000397309;ENST00000381561;ENST00000381548;ENST00000360603;ENST00000381549;ENST00000381589;ENST00000381579;ENST00000381557;ENST00000453458;ENST00000381563;ENST00000344578;ENST00000381558;ENST00000397301;ENST00000397304;ENST00000446240	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.99023	-5.34;-5.34;-5.34;-5.34;-5.34;-5.34;-5.34;-5.34;-5.34;-5.34;-5.34;-5.34;-5.34;-5.34;-5.34	3.71	3.71	0.42584	.	0.000000	0.85682	D	0.000000	D	0.99408	0.9791	M	0.92122	3.275	0.58432	A	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98302	1.0519	9	0.87932	D	0	-5.9062	16.0439	0.80704	0.0:0.0:1.0:0.0	.	63;55;61;55	P45378-2;P45378-7;P45378-6;P45378-4	.;.;.;.	H	63;75;66;65;57;55;61;55;49;44;66;50;55;74;44;44	ENSP00000278317:R63H;ENSP00000370973:R66H;ENSP00000370960:R65H;ENSP00000353815:R57H;ENSP00000370961:R55H;ENSP00000371001:R61H;ENSP00000370991:R55H;ENSP00000370969:R49H;ENSP00000415614:R44H;ENSP00000370975:R66H;ENSP00000344870:R50H;ENSP00000370970:R55H;ENSP00000380468:R74H;ENSP00000380471:R44H;ENSP00000413203:R44H	ENSP00000278317:R63H	R	+	2	0	TNNT3	1911543	1.000000	0.71417	0.940000	0.37924	0.520000	0.34377	9.151000	0.94674	2.076000	0.62316	0.306000	0.20318	CGT	TNNT3	-	pfam_Troponin	ENSG00000130595		0.597	TNNT3-010	KNOWN	basic	protein_coding	TNNT3	HGNC	protein_coding	OTTHUMT00000142920.3	43	0.00	0	G	NM_006757		1954967	1954967	+1	no_errors	ENST00000397301	ensembl	human	known	69_37n	missense	53	19.70	13	SNP	1.000	A
TSKS	60385	genome.wustl.edu	37	19	50249950	50249950	+	Missense_Mutation	SNP	C	C	T	rs76911687|rs550916960|rs59626794	byFrequency	TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr19:50249950C>T	ENST00000246801.3	-	6	851	c.769G>A	c.(769-771)Gag>Aag	p.E257K	TSKS_ENST00000358830.3_Missense_Mutation_p.E57K	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	257					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		tcctccggctcctgcttctcc	0.721																																						dbGAP											0													13.0	13.0	13.0					19																	50249950		2192	4287	6479	-	-	-	SO:0001583	missense	0			BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.769G>A	19.37:g.50249950C>T	ENSP00000246801:p.Glu257Lys		Q8WXJ0	Missense_Mutation	SNP	NULL	p.E257K	ENST00000246801.3	37	c.769	CCDS12780.1	19	.	.	.	.	.	.	.	.	.	.	C	10.29	1.310367	0.23821	.	.	ENSG00000126467	ENST00000246801;ENST00000358830	T;T	0.44482	1.53;0.92	.	.	.	.	0.000000	0.47852	D	0.000216	T	0.14570	0.0352	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.23297	-1.0192	9	0.06494	T	0.89	-7.4983	3.9611	0.09410	0.0:0.4649:0.5351:0.0	.	257	Q9UJT2	TSKS_HUMAN	K	257;57	ENSP00000246801:E257K;ENSP00000351691:E57K	ENSP00000246801:E257K	E	-	1	0	TSKS	54941762	0.937000	0.31787	0.589000	0.28718	0.411000	0.31082	0.639000	0.24690	-0.000000	0.14550	0.000000	0.15137	GAG	TSKS	-	NULL	ENSG00000126467		0.721	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSKS	HGNC	protein_coding	OTTHUMT00000465795.1	16	0.00	0	C	NM_021733		50249950	50249950	-1	no_errors	ENST00000246801	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	0.208	T
YES1	7525	genome.wustl.edu	37	18	743380	743380	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr18:743380C>G	ENST00000584307.1	-	7	930	c.760G>C	c.(760-762)Gtg>Ctg	p.V254L	YES1_ENST00000577961.1_Missense_Mutation_p.V259L|YES1_ENST00000314574.4_Missense_Mutation_p.V254L			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	254	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	GTTGGACACACAGTTGTCAAC	0.378																																						dbGAP											0													86.0	81.0	83.0					18																	743380		2203	4300	6503	-	-	-	SO:0001583	missense	0			M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.760G>C	18.37:g.743380C>G	ENSP00000462468:p.Val254Leu		A6NLB3|D3DUH1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.V254L	ENST00000584307.1	37	c.760	CCDS11824.1	18	.	.	.	.	.	.	.	.	.	.	C	14.08	2.429387	0.43122	.	.	ENSG00000176105	ENST00000359834;ENST00000314574	T	0.25085	1.82	5.69	5.69	0.88448	SH2 motif (2);	0.056036	0.64402	D	0.000001	T	0.31765	0.0807	L	0.53729	1.69	0.80722	D	1	B	0.15141	0.012	B	0.19391	0.025	T	0.06041	-1.0849	10	0.66056	D	0.02	.	19.8252	0.96614	0.0:1.0:0.0:0.0	.	254	P07947	YES_HUMAN	L	254	ENSP00000324740:V254L	ENSP00000324740:V254L	V	-	1	0	YES1	733380	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	7.717000	0.84732	2.692000	0.91855	0.655000	0.94253	GTG	YES1	-	pfscan_SH2	ENSG00000176105		0.378	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YES1	HGNC	protein_coding	OTTHUMT00000440827.2	126	0.00	0	C	NM_005433		743380	743380	-1	no_errors	ENST00000314574	ensembl	human	known	69_37n	missense	84	35.38	46	SNP	1.000	G
ZDBF2	57683	genome.wustl.edu	37	2	207175935	207175935	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DG-01A-21D-A12Q-09	TCGA-BH-A0DG-11A-43D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ec4d4cbc-d5d1-418d-a292-cad9576624fd	d0d81468-73f6-4a8a-8f00-b99bd127c228	g.chr2:207175935C>T	ENST00000374423.3	+	5	7069	c.6683C>T	c.(6682-6684)tCg>tTg	p.S2228L		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2228							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AAGTATATTTCGAAATACTCT	0.358																																						dbGAP											0													39.0	38.0	38.0					2																	207175935		1817	4076	5893	-	-	-	SO:0001583	missense	0			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.6683C>T	2.37:g.207175935C>T	ENSP00000363545:p.Ser2228Leu		Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	pfam_Znf_DBF,smart_Znf_DBF	p.S2228L	ENST00000374423.3	37	c.6683	CCDS46501.1	2	.	.	.	.	.	.	.	.	.	.	C	10.14	1.268785	0.23136	.	.	ENSG00000204186	ENST00000374423	T	0.52983	0.64	5.46	1.68	0.24146	.	.	.	.	.	T	0.31358	0.0794	L	0.43152	1.355	0.09310	N	1	P	0.34662	0.462	B	0.18871	0.023	T	0.11542	-1.0583	9	0.45353	T	0.12	.	5.6254	0.17480	0.1275:0.6108:0.0:0.2617	.	2228	Q9HCK1	ZDBF2_HUMAN	L	2228	ENSP00000363545:S2228L	ENSP00000363545:S2228L	S	+	2	0	ZDBF2	206884180	0.000000	0.05858	0.001000	0.08648	0.097000	0.18754	0.022000	0.13511	0.093000	0.17368	0.655000	0.94253	TCG	ZDBF2	-	NULL	ENSG00000204186		0.358	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	HGNC	protein_coding	OTTHUMT00000336458.1	100	0.00	0	C	NM_020923		207175935	207175935	+1	no_errors	ENST00000374423	ensembl	human	known	69_37n	missense	96	14.91	17	SNP	0.006	T
