#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ANGPT4	51378	genome.wustl.edu	37	20	865878	865878	+	Silent	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr20:865878C>T	ENST00000381922.3	-	4	780	c.678G>A	c.(676-678)acG>acA	p.T226T	ANGPT4_ENST00000546022.1_Silent_p.T226T	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	226					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						GGCGGCTCAGCGTGTTCAGCA	0.677																																					Pancreas(181;481 2077 3259 31286 49856)	dbGAP											0													23.0	18.0	20.0					20																	865878		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.678G>A	20.37:g.865878C>T			B4E3J9|Q5TFF4|Q9H4Z4	Silent	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.T226	ENST00000381922.3	37	c.678	CCDS13009.1	20																																																																																			ANGPT4	-	NULL	ENSG00000101280		0.677	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPT4	HGNC	protein_coding	OTTHUMT00000077493.1	20	0.00	0	C	NM_015985		865878	865878	-1	no_errors	ENST00000381922	ensembl	human	known	69_37n	silent	15	21.05	4	SNP	0.971	T
ANK3	288	genome.wustl.edu	37	10	61842433	61842433	+	Silent	SNP	T	T	C			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr10:61842433T>C	ENST00000280772.2	-	34	4454	c.4263A>G	c.(4261-4263)acA>acG	p.T1421T	ANK3_ENST00000355288.2_Silent_p.T555T|ANK3_ENST00000373827.2_Silent_p.T1415T|Y_RNA_ENST00000365320.1_RNA|ANK3_ENST00000503366.1_Silent_p.T1422T	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1421					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GCAGTCCTTTTGTTGTCTTTG	0.393																																						dbGAP											0													159.0	156.0	157.0					10																	61842433		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.4263A>G	10.37:g.61842433T>C			B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.T1421	ENST00000280772.2	37	c.4263	CCDS7258.1	10																																																																																			ANK3	-	NULL	ENSG00000151150		0.393	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	354	0.00	0	T	NM_020987		61842433	61842433	-1	no_errors	ENST00000280772	ensembl	human	known	69_37n	silent	208	24.28	67	SNP	0.210	C
AQP12B	653437	genome.wustl.edu	37	2	241621869	241621869	+	Missense_Mutation	SNP	G	G	A	rs74882485	byFrequency	TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr2:241621869G>A	ENST00000407834.3	-	1	448	c.386C>T	c.(385-387)aCg>aTg	p.T129M		NM_001102467.1	NP_001095937.1	A6NM10	AQ12B_HUMAN	aquaporin 12B	117						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|lung(8)|ovary(1)	13		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		GCAGAGGCGCGTCAGGGTGCA	0.697																																						dbGAP											0													24.0	24.0	24.0					2																	241621869		2196	4279	6475	-	-	-	SO:0001583	missense	0			BC041460	CCDS46560.1	2q37.3	2007-12-14	2005-05-26	2005-05-26	ENSG00000185176	ENSG00000185176		"""Ion channels / Aquaporins"""	6096	protein-coding gene	gene with protein product			"""insulin synthesis associated 3"""	INSSA3			Standard	NM_001102467		Approved		uc010fzj.3	A6NM10	OTTHUMG00000152263	ENST00000407834.3:c.386C>T	2.37:g.241621869G>A	ENSP00000384894:p.Thr129Met		A4QPB9	Missense_Mutation	SNP	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12,prints_Aquaporin_12,prints_MIP	p.T129M	ENST00000407834.3	37	c.386	CCDS46560.1	2	.	.	.	.	.	.	.	.	.	.	.	7.337	0.620131	0.14193	.	.	ENSG00000185176	ENST00000407834	T	0.15017	2.46	2.84	1.94	0.25998	.	0.293024	0.38492	N	0.001671	T	0.26810	0.0656	.	.	.	0.80722	P	0.0	D	0.71674	0.998	P	0.61592	0.891	T	0.30995	-0.9959	8	0.28530	T	0.3	-0.0254	8.3053	0.32038	0.1286:0.0:0.8714:0.0	.	129	A6NM10-2	.	M	129	ENSP00000384894:T129M	ENSP00000384894:T129M	T	-	2	0	AQP12B	241270542	0.997000	0.39634	0.002000	0.10522	0.132000	0.20833	5.268000	0.65536	0.748000	0.32831	0.473000	0.43528	ACG	AQP12B	-	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12,prints_Aquaporin_12	ENSG00000185176		0.697	AQP12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP12B	HGNC	protein_coding	OTTHUMT00000325625.1	10	0.00	0	G			241621869	241621869	-1	no_errors	ENST00000407834	ensembl	human	known	69_37n	missense	10	41.18	7	SNP	0.017	A
ATAD2	29028	genome.wustl.edu	37	8	124381414	124381414	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr8:124381414T>C	ENST00000287394.5	-	8	1040	c.933A>G	c.(931-933)aaA>aaG	p.K311K	ATAD2_ENST00000521903.1_5'UTR|ATAD2_ENST00000534257.1_5'UTR	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	311					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GGTGACGAGGTTCTAAAAAAA	0.323																																						dbGAP											0													48.0	45.0	46.0					8																	124381414		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.932-1A>G	8.37:g.124381414T>C			Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Silent	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.K311	ENST00000287394.5	37	c.933	CCDS6343.1	8																																																																																			ATAD2	-	NULL	ENSG00000156802		0.323	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	130	0.00	0	T	NM_014109	Silent	124381414	124381414	-1	no_errors	ENST00000287394	ensembl	human	known	69_37n	silent	256	13.80	41	SNP	1.000	C
C1R	715	genome.wustl.edu	37	12	7242776	7242777	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr12:7242776_7242777insG	ENST00000542285.1	-	3	445_446	c.296_297insC	c.(295-297)ccgfs	p.P99fs	C1R_ENST00000602298.1_5'Flank			P00736	C1R_HUMAN	complement component 1, r subcomponent	100	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|pancreas(1)	16					Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CCTTCTTTCCCGGGGGGTTGCC	0.525																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			M14058		12p13.31	2014-05-14			ENSG00000159403	ENSG00000159403	3.4.21.41	"""Complement system"""	1246	protein-coding gene	gene with protein product		613785					Standard	NM_001733		Approved		uc010sfy.2	P00736	OTTHUMG00000168149	ENST00000542285.1:c.297dupC	12.37:g.7242782_7242782dupG	ENSP00000438615:p.Pro99fs		A6NJQ8|Q68D77|Q8J012	Frame_Shift_Ins	INS	pfam_Peptidase_S1_S6,pfam_CUB,pfam_EGF-like_Ca-bd,pfam_Sushi_SCR_CCP,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_CUB,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6	p.K117fs	ENST00000542285.1	37	c.342_341		12																																																																																			C1R	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000159403		0.525	C1R-201	KNOWN	basic|appris_candidate_longest	protein_coding	C1R	HGNC	protein_coding		14	0.00	0	-	NM_001733		7242776	7242777	-1	no_errors	ENST00000290575	ensembl	human	known	69_37n	frame_shift_ins	25	10.71	3	INS	0.377:1.000	G
C1R	715	genome.wustl.edu	37	12	7242776	7242777	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr12:7242776_7242777insG	ENST00000542285.1	-	3	445_446	c.296_297insC	c.(295-297)ccgfs	p.P99fs	C1R_ENST00000602298.1_5'Flank			P00736	C1R_HUMAN	complement component 1, r subcomponent	100	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|pancreas(1)	16					Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CCTTCTTTCCCGGGGGGTTGCC	0.525																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			M14058		12p13.31	2014-05-14			ENSG00000159403	ENSG00000159403	3.4.21.41	"""Complement system"""	1246	protein-coding gene	gene with protein product		613785					Standard	NM_001733		Approved		uc010sfy.2	P00736	OTTHUMG00000168149	ENST00000542285.1:c.297dupC	12.37:g.7242782_7242782dupG	ENSP00000438615:p.Pro99fs		A6NJQ8|Q68D77|Q8J012	Frame_Shift_Ins	INS	pfam_Peptidase_S1_S6,pfam_CUB,pfam_EGF-like_Ca-bd,pfam_Sushi_SCR_CCP,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_CUB,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6	p.K117fs	ENST00000542285.1	37	c.342_341		12																																																																																			C1R	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000159403		0.525	C1R-201	KNOWN	basic|appris_candidate_longest	protein_coding	C1R	HGNC	protein_coding		35	0.00	0	-	NM_001733		7242776	7242777	-1	no_errors	ENST00000290575	ensembl	human	known	69_37n	frame_shift_ins	25	10.71	3	INS	0.377:1.000	G
C8orf34	116328	genome.wustl.edu	37	8	69434116	69434116	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr8:69434116C>T	ENST00000539993.1	+	6	1139	c.590C>T	c.(589-591)cCc>cTc	p.P197L	C8orf34_ENST00000348340.2_Missense_Mutation_p.P197L|C8orf34_ENST00000518698.1_Missense_Mutation_p.P283L|C8orf34_ENST00000349492.3_3'UTR|C8orf34_ENST00000337103.4_Missense_Mutation_p.P172L			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	197										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			GATGCTGATCCCCTAGCTGCT	0.438																																						dbGAP											0													108.0	102.0	104.0					8																	69434116		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.590C>T	8.37:g.69434116C>T	ENSP00000438159:p.Pro197Leu		A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.P283L	ENST00000539993.1	37	c.848		8	.	.	.	.	.	.	.	.	.	.	C	19.14	3.770096	0.69992	.	.	ENSG00000165084	ENST00000518698;ENST00000539993;ENST00000348340;ENST00000337103	T;T;T	0.54279	0.58;0.63;0.6	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.71584	0.3357	M	0.63428	1.95	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.68394	-0.5420	9	.	.	.	-12.6285	19.961	0.97250	0.0:1.0:0.0:0.0	.	197;197	Q49A92;Q49A92-3	CH034_HUMAN;.	L	283;197;197;172	ENSP00000427820:P283L;ENSP00000438159:P197L;ENSP00000337174:P172L	.	P	+	2	0	C8orf34	69596670	1.000000	0.71417	0.696000	0.30242	0.321000	0.28281	6.628000	0.74262	2.783000	0.95769	0.655000	0.94253	CCC	C8orf34	-	NULL	ENSG00000165084		0.438	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	C8orf34	HGNC	protein_coding		241	0.00	0	C	NM_052958		69434116	69434116	+1	no_errors	ENST00000518698	ensembl	human	known	69_37n	missense	421	13.17	64	SNP	0.998	T
CA9	768	genome.wustl.edu	37	9	35676375	35676375	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr9:35676375G>T	ENST00000378357.4	+	5	933	c.829G>T	c.(829-831)Gcc>Tcc	p.A277S	CA9_ENST00000493245.1_Intron	NM_001216.2	NP_001207.2	Q16790	CAH9_HUMAN	carbonic anhydrase IX	277	Catalytic.				bicarbonate transport (GO:0015701)|cellular response to hypoxia (GO:0071456)|morphogenesis of an epithelium (GO:0002009)|one-carbon metabolic process (GO:0006730)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to drug (GO:0042493)|response to testosterone (GO:0033574)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	17	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	CGTGTTGGCCGCCTTTCTGGA	0.637																																						dbGAP											0													95.0	101.0	99.0					9																	35676375		2203	4300	6503	-	-	-	SO:0001583	missense	0			X66839	CCDS6585.1	9p13.3	2012-08-21			ENSG00000107159	ENSG00000107159		"""Carbonic anhydrases"""	1383	protein-coding gene	gene with protein product	"""carbonic dehydratase"", ""RCC-associated protein G250"""	603179				8661007, 9787087	Standard	NM_001216		Approved	MN, CAIX	uc003zxo.4	Q16790	OTTHUMG00000021029	ENST00000378357.4:c.829G>T	9.37:g.35676375G>T	ENSP00000367608:p.Ala277Ser		Q5T4R1	Missense_Mutation	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.A277S	ENST00000378357.4	37	c.829	CCDS6585.1	9	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893310	0.33442	.	.	ENSG00000107159	ENST00000378357;ENST00000544074	T	0.68025	-0.3	4.85	3.94	0.45596	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.188396	0.34725	N	0.003732	T	0.71762	0.3378	L	0.46819	1.47	0.32179	N	0.580612	B;P	0.48016	0.413;0.904	P;P	0.58820	0.503;0.846	T	0.77552	-0.2545	10	0.72032	D	0.01	.	10.6002	0.45362	0.0:0.0:0.8079:0.1921	.	277;277	F5H404;Q16790	.;CAH9_HUMAN	S	277	ENSP00000367608:A277S	ENSP00000367608:A277S	A	+	1	0	CA9	35666375	0.784000	0.28713	0.804000	0.32291	0.024000	0.10985	1.191000	0.32138	1.379000	0.46325	-0.182000	0.12963	GCC	CA9	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000107159		0.637	CA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA9	HGNC	protein_coding	OTTHUMT00000055479.1	106	0.00	0	G	NM_001216		35676375	35676375	+1	no_errors	ENST00000378357	ensembl	human	known	69_37n	missense	88	21.43	24	SNP	0.874	T
CCDC146	57639	genome.wustl.edu	37	7	76871096	76871096	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr7:76871096G>C	ENST00000285871.4	+	4	455	c.328G>C	c.(328-330)Gat>Cat	p.D110H	CCDC146_ENST00000431197.1_5'UTR	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	110										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				GCAGCAAGCTGATAATTTTCC	0.428																																						dbGAP											0													110.0	109.0	109.0					7																	76871096		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.328G>C	7.37:g.76871096G>C	ENSP00000285871:p.Asp110His		A8K8X6|Q9P223	Missense_Mutation	SNP	NULL	p.D110H	ENST00000285871.4	37	c.328	CCDS34671.1	7	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397067	0.83120	.	.	ENSG00000135205	ENST00000415750;ENST00000285871	T;T	0.24908	2.28;1.83	5.69	5.69	0.88448	.	0.183932	0.47093	D	0.000252	T	0.48429	0.1499	M	0.62723	1.935	0.80722	D	1	D	0.63046	0.992	D	0.63381	0.914	T	0.30001	-0.9993	10	0.45353	T	0.12	-10.6075	19.4155	0.94694	0.0:0.0:1.0:0.0	.	110	Q8IYE0	CC146_HUMAN	H	110	ENSP00000388649:D110H;ENSP00000285871:D110H	ENSP00000285871:D110H	D	+	1	0	AC007000.1	76709032	1.000000	0.71417	0.573000	0.28510	0.993000	0.82548	4.959000	0.63666	2.670000	0.90874	0.585000	0.79938	GAT	CCDC146	-	NULL	ENSG00000135205		0.428	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC146	HGNC	protein_coding	OTTHUMT00000341449.1	227	0.00	0	G	NM_020879		76871096	76871096	+1	no_errors	ENST00000285871	ensembl	human	known	69_37n	missense	177	15.31	32	SNP	0.951	C
CCL4L2	388372	genome.wustl.edu	37	17	34641454	34641454	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr17:34641454C>T	ENST00000394465.2	+	3	513	c.196C>T	c.(196-198)Caa>Taa	p.Q66*	CCL4L2_ENST00000482104.1_3'UTR|TBC1D3H_ENST00000535446.1_Intron|CCL4L2_ENST00000339270.6_Silent_p.S27S|TBC1D3C_ENST00000451448.2_Intron|TBC1D3C_ENST00000308078.7_Intron|TBC1D3H_ENST00000400684.4_Intron			Q8NHW4	CC4L_HUMAN	chemokine (C-C motif) ligand 4-like 2	66					cell chemotaxis (GO:0060326)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular space (GO:0005615)				endometrium(1)	1		Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTACAGATTCCAAACCAAAAG	0.517																																						dbGAP											0													209.0	145.0	167.0					17																	34641454		2159	4153	6312	-	-	-	SO:0001587	stop_gained	0					17q12	2005-08-09			ENSG00000197262			"""Chemokine ligands"""	24066	protein-coding gene	gene with protein product		603782				15028295	Standard	NM_001291468		Approved		uc010cuj.3	Q8NHW4	OTTHUMG00000133066	ENST00000394465.2:c.196C>T	17.37:g.34641454C>T	ENSP00000377978:p.Gln66*		B2RUZ3|B7ZMA8|Q50EM1|Q50EM2|Q50EM3|Q50EM4|Q50EM5|Q50EM6|Q50EM7|Q50EM8|Q569J2|Q6NSB0	Nonsense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.Q66*	ENST00000394465.2	37	c.196	CCDS11311.1	17	.	.	.	.	.	.	.	.	.	.	C	21.3	4.131398	0.77549	.	.	ENSG00000197262	ENST00000394465	.	.	.	3.1	1.99	0.26369	.	0.647222	0.12405	U	0.471774	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	6.5852	0.22616	0.2853:0.7147:0.0:0.0	.	.	.	.	X	66	.	ENSP00000377978:Q66X	Q	+	1	0	CCL4L2	31665567	0.511000	0.26179	0.986000	0.45419	0.641000	0.38312	1.571000	0.36450	1.306000	0.44926	0.420000	0.28162	CAA	CCL4L2	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	ENSG00000197262		0.517	CCL4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL4L2	HGNC	protein_coding	OTTHUMT00000256699.1	67	0.00	0	C	NM_207007		34641454	34641454	+1	no_errors	ENST00000394465	ensembl	human	known	69_37n	nonsense	42	17.65	9	SNP	0.873	T
CCL4L2	388372	genome.wustl.edu	37	17	34641454	34641454	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr17:34641454C>T	ENST00000394465.2	+	3	513	c.196C>T	c.(196-198)Caa>Taa	p.Q66*	CCL4L2_ENST00000482104.1_3'UTR|TBC1D3H_ENST00000535446.1_Intron|CCL4L2_ENST00000339270.6_Silent_p.S27S|TBC1D3C_ENST00000451448.2_Intron|TBC1D3C_ENST00000308078.7_Intron|TBC1D3H_ENST00000400684.4_Intron			Q8NHW4	CC4L_HUMAN	chemokine (C-C motif) ligand 4-like 2	66					cell chemotaxis (GO:0060326)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular space (GO:0005615)				endometrium(1)	1		Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTACAGATTCCAAACCAAAAG	0.517																																						dbGAP											0													209.0	145.0	167.0					17																	34641454		2159	4153	6312	-	-	-	SO:0001587	stop_gained	0					17q12	2005-08-09			ENSG00000197262			"""Chemokine ligands"""	24066	protein-coding gene	gene with protein product		603782				15028295	Standard	NM_001291468		Approved		uc010cuj.3	Q8NHW4	OTTHUMG00000133066	ENST00000394465.2:c.196C>T	17.37:g.34641454C>T	ENSP00000377978:p.Gln66*		B2RUZ3|B7ZMA8|Q50EM1|Q50EM2|Q50EM3|Q50EM4|Q50EM5|Q50EM6|Q50EM7|Q50EM8|Q569J2|Q6NSB0	Nonsense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.Q66*	ENST00000394465.2	37	c.196	CCDS11311.1	17	.	.	.	.	.	.	.	.	.	.	C	21.3	4.131398	0.77549	.	.	ENSG00000197262	ENST00000394465	.	.	.	3.1	1.99	0.26369	.	0.647222	0.12405	U	0.471774	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	6.5852	0.22616	0.2853:0.7147:0.0:0.0	.	.	.	.	X	66	.	ENSP00000377978:Q66X	Q	+	1	0	CCL4L2	31665567	0.511000	0.26179	0.986000	0.45419	0.641000	0.38312	1.571000	0.36450	1.306000	0.44926	0.420000	0.28162	CAA	CCL4L2	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	ENSG00000197262		0.517	CCL4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL4L2	HGNC	protein_coding	OTTHUMT00000256699.1	108	0.00	0	C	NM_207007		34641454	34641454	+1	no_errors	ENST00000394465	ensembl	human	known	69_37n	nonsense	42	17.65	9	SNP	0.873	T
CD22	933	genome.wustl.edu	37	19	35827245	35827245	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr19:35827245G>A	ENST00000085219.5	+	4	784		c.e4+1		CD22_ENST00000419549.2_Splice_Site|CD22_ENST00000594250.1_Splice_Site|CD22_ENST00000536635.2_Splice_Site|CD22_ENST00000341773.6_Splice_Site|CD22_ENST00000544992.2_Splice_Site|CD22_ENST00000270311.6_Splice_Site	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule						cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			AACGTGAAGCGTGAGTCTCCC	0.617																																					Ovarian(42;1009 1133 23674 26041)	dbGAP											0													55.0	43.0	47.0					19																	35827245		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.718+1G>A	19.37:g.35827245G>A			F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Splice_Site	SNP	-	e3+1	ENST00000085219.5	37	c.718+1	CCDS12457.1	19	.	.	.	.	.	.	.	.	.	.	G	15.23	2.773002	0.49680	.	.	ENSG00000012124	ENST00000085219;ENST00000536635;ENST00000341773;ENST00000544992;ENST00000270311;ENST00000419549	.	.	.	4.48	4.48	0.54585	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.559	0.56271	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CD22	40519085	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	4.235000	0.58666	2.339000	0.79563	0.561000	0.74099	.	CD22	-	-	ENSG00000012124		0.617	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD22	HGNC	protein_coding	OTTHUMT00000466099.1	87	0.00	0	G	NM_001771	Intron	35827245	35827245	+1	no_errors	ENST00000085219	ensembl	human	known	69_37n	splice_site	35	52.05	38	SNP	1.000	A
CDC45	8318	genome.wustl.edu	37	22	19504407	19504407	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr22:19504407G>A	ENST00000407835.1	+	18	1883	c.1627G>A	c.(1627-1629)Gac>Aac	p.D543N	CDC45_ENST00000404724.3_Missense_Mutation_p.D497N|CDC45_ENST00000437685.2_Missense_Mutation_p.D575N|CDC45_ENST00000263201.1_Missense_Mutation_p.D543N			O75419	CDC45_HUMAN	cell division cycle 45	543					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	19						CAACCATTTTGACCTCTCAGG	0.572																																						dbGAP											0													61.0	58.0	59.0					22																	19504407		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF053074	CCDS13762.1, CCDS54499.1, CCDS54500.1	22q11.21	2013-01-17	2013-01-17	2010-03-24	ENSG00000093009	ENSG00000093009			1739	protein-coding gene	gene with protein product	"""human CDC45"""	603465	"""CDC45 (cell division cycle 45, S.cerevisiae, homolog)-like"", ""CDC45 cell division cycle 45-like (S. cerevisiae)"", ""cell division cycle 45 homolog (S. cerevisiae)"""	CDC45L2, CDC45L		9660782, 9724329, 17608804	Standard	NM_001178010		Approved		uc011aha.2	O75419	OTTHUMG00000150386	ENST00000407835.1:c.1627G>A	22.37:g.19504407G>A	ENSP00000385240:p.Asp543Asn		B4DDB4|B4DDU3|E9PDH7|O60856|Q20WK8|Q6UW54|Q9UP68	Missense_Mutation	SNP	pfam_CDC45	p.D575N	ENST00000407835.1	37	c.1723	CCDS13762.1	22	.	.	.	.	.	.	.	.	.	.	G	28.2	4.899730	0.91962	.	.	ENSG00000093009	ENST00000407835;ENST00000437685;ENST00000263201;ENST00000404724	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	4.79	4.79	0.61399	.	0.092011	0.64402	D	0.000001	T	0.44244	0.1284	M	0.75447	2.3	0.80722	D	1	P;P;P;P	0.44044	0.825;0.674;0.673;0.717	P;P;B;P	0.50440	0.641;0.558;0.444;0.641	T	0.41574	-0.9501	10	0.52906	T	0.07	-27.0971	18.3899	0.90479	0.0:0.0:1.0:0.0	.	575;497;575;543	E9PDH7;B4DDB4;B4DDU3;O75419	.;.;.;CDC45_HUMAN	N	543;575;543;497	ENSP00000385240:D543N;ENSP00000405726:D575N;ENSP00000263201:D543N;ENSP00000384978:D497N	ENSP00000263201:D543N	D	+	1	0	CDC45	17884407	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.235000	0.72332	2.649000	0.89929	0.655000	0.94253	GAC	CDC45	-	pfam_CDC45	ENSG00000093009		0.572	CDC45-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	CDC45	HGNC	protein_coding	OTTHUMT00000317903.1	30	0.00	0	G	NM_003504		19504407	19504407	+1	no_errors	ENST00000437685	ensembl	human	known	69_37n	missense	11	42.11	8	SNP	1.000	A
CHD6	84181	genome.wustl.edu	37	20	40126068	40126068	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr20:40126068G>A	ENST00000373233.3	-	8	1225	c.1048C>T	c.(1048-1050)Cga>Tga	p.R350*	CHD6_ENST00000373222.3_3'UTR|CHD6_ENST00000309279.7_Nonsense_Mutation_p.R350*	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	350	Required for DNA-dependent ATPase activity.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TTCCTAAATCGCTTGATCTTC	0.408																																						dbGAP											0													167.0	140.0	149.0					20																	40126068		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.1048C>T	20.37:g.40126068G>A	ENSP00000362330:p.Arg350*		Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_BRK_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R350*	ENST00000373233.3	37	c.1048	CCDS13317.1	20	.	.	.	.	.	.	.	.	.	.	G	39	7.661654	0.98419	.	.	ENSG00000124177	ENST00000373233;ENST00000309279	.	.	.	5.48	4.51	0.55191	.	0.000000	0.47093	D	0.000245	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.428	15.421	0.75011	0.0:0.0:0.8599:0.1401	.	.	.	.	X	350	.	ENSP00000308684:R350X	R	-	1	2	CHD6	39559482	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.694000	0.68272	1.269000	0.44280	0.655000	0.94253	CGA	CHD6	-	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow	ENSG00000124177		0.408	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	HGNC	protein_coding	OTTHUMT00000079270.1	199	0.00	0	G			40126068	40126068	-1	no_errors	ENST00000373233	ensembl	human	known	69_37n	nonsense	156	14.75	27	SNP	1.000	A
CDH26	60437	genome.wustl.edu	37	20	58571003	58571003	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr20:58571003C>G	ENST00000244047.5	+	12	2093	c.1782C>G	c.(1780-1782)atC>atG	p.I594M	CDH26_ENST00000244049.3_5'Flank|CDH26_ENST00000348616.4_Missense_Mutation_p.I594M|CDH26_ENST00000497614.1_3'UTR|CDH26_ENST00000350849.6_5'Flank			Q8IXH8	CAD26_HUMAN	cadherin 26	594					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			ATGTAAGGATCTGCCCCTGTG	0.527																																						dbGAP											0													125.0	108.0	114.0					20																	58571003		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.1782C>G	20.37:g.58571003C>G	ENSP00000244047:p.Ile594Met		A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I594M	ENST00000244047.5	37	c.1782		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.87|11.87	1.766705|1.766705	0.31228|0.31228	.|.	.|.	ENSG00000124215|ENSG00000124215	ENST00000244047;ENST00000348616|ENST00000370991	T;T|.	0.65178|.	-0.14;-0.14|.	4.56|4.56	-1.26|-1.26	0.09376|0.09376	Cadherin-like (1);|.	0.894145|.	0.09630|.	N|.	0.776431|.	T|T	0.39384|0.39384	0.1076|0.1076	M|M	0.63843|0.63843	1.955|1.955	0.09310|0.09310	N|N	0.999994|0.999994	D;P|.	0.54047|.	0.964;0.564|.	P;B|.	0.50791|.	0.65;0.391|.	T|T	0.39583|0.39583	-0.9607|-0.9607	10|5	0.87932|.	D|.	0|.	.|.	3.071|3.071	0.06230|0.06230	0.361:0.3174:0.2385:0.0831|0.361:0.3174:0.2385:0.0831	.|.	594;594|.	Q8IXH8;Q8IXH8-4|.	CAD26_HUMAN;.|.	M|C	594|186	ENSP00000244047:I594M;ENSP00000339390:I594M|.	ENSP00000244047:I594M|.	I|S	+|+	3|2	3|0	CDH26|CDH26	58004398|58004398	0.786000|0.786000	0.28738|0.28738	0.011000|0.011000	0.14972|0.14972	0.363000|0.363000	0.29612|0.29612	-0.091000|-0.091000	0.11146|0.11146	0.048000|0.048000	0.15891|0.15891	0.655000|0.655000	0.94253|0.94253	ATC|TCT	CDH26	-	superfamily_Cadherin-like	ENSG00000124215		0.527	CDH26-201	KNOWN	basic	protein_coding	CDH26	HGNC	protein_coding		69	0.00	0	C	NM_177980		58571003	58571003	+1	no_errors	ENST00000244047	ensembl	human	known	69_37n	missense	143	10.62	17	SNP	0.072	G
CHSY3	337876	genome.wustl.edu	37	5	129520729	129520729	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr5:129520729G>A	ENST00000305031.4	+	3	2252	c.1894G>A	c.(1894-1896)Gac>Aac	p.D632N		NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	632					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		CGGAAGGTATGACATTTTCTT	0.368																																						dbGAP											0													76.0	77.0	76.0					5																	129520729		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.1894G>A	5.37:g.129520729G>A	ENSP00000302629:p.Asp632Asn		B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_Fringe-like	p.D632N	ENST00000305031.4	37	c.1894	CCDS34223.1	5	.	.	.	.	.	.	.	.	.	.	G	16.74	3.206504	0.58343	.	.	ENSG00000198108	ENST00000305031	T	0.36340	1.26	4.12	4.12	0.48240	.	0.000000	0.64402	D	0.000018	T	0.38585	0.1046	L	0.58302	1.8	0.49051	D	0.999749	B	0.28258	0.205	B	0.32022	0.139	T	0.24476	-1.0159	9	.	.	.	-8.2171	17.6798	0.88239	0.0:0.0:1.0:0.0	.	632	Q70JA7	CHSS3_HUMAN	N	632	ENSP00000302629:D632N	.	D	+	1	0	CHSY3	129548628	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.802000	0.85969	2.559000	0.86315	0.650000	0.86243	GAC	CHSY3	-	pfam_Chond_GalNAc	ENSG00000198108		0.368	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHSY3	HGNC	protein_coding	OTTHUMT00000371453.1	141	0.00	0	G	NM_175856		129520729	129520729	+1	no_errors	ENST00000305031	ensembl	human	known	69_37n	missense	132	17.50	28	SNP	1.000	A
CHSY3	337876	genome.wustl.edu	37	5	129520729	129520729	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr5:129520729G>A	ENST00000305031.4	+	3	2252	c.1894G>A	c.(1894-1896)Gac>Aac	p.D632N		NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	632					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		CGGAAGGTATGACATTTTCTT	0.368																																						dbGAP											0													76.0	77.0	76.0					5																	129520729		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.1894G>A	5.37:g.129520729G>A	ENSP00000302629:p.Asp632Asn		B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_Fringe-like	p.D632N	ENST00000305031.4	37	c.1894	CCDS34223.1	5	.	.	.	.	.	.	.	.	.	.	G	16.74	3.206504	0.58343	.	.	ENSG00000198108	ENST00000305031	T	0.36340	1.26	4.12	4.12	0.48240	.	0.000000	0.64402	D	0.000018	T	0.38585	0.1046	L	0.58302	1.8	0.49051	D	0.999749	B	0.28258	0.205	B	0.32022	0.139	T	0.24476	-1.0159	9	.	.	.	-8.2171	17.6798	0.88239	0.0:0.0:1.0:0.0	.	632	Q70JA7	CHSS3_HUMAN	N	632	ENSP00000302629:D632N	.	D	+	1	0	CHSY3	129548628	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.802000	0.85969	2.559000	0.86315	0.650000	0.86243	GAC	CHSY3	-	pfam_Chond_GalNAc	ENSG00000198108		0.368	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHSY3	HGNC	protein_coding	OTTHUMT00000371453.1	74	0.00	0	G	NM_175856		129520729	129520729	+1	no_errors	ENST00000305031	ensembl	human	known	69_37n	missense	132	17.50	28	SNP	1.000	A
COL22A1	169044	genome.wustl.edu	37	8	139638436	139638436	+	Silent	SNP	G	G	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr8:139638436G>A	ENST00000303045.6	-	51	4160	c.3714C>T	c.(3712-3714)atC>atT	p.I1238I	COL22A1_ENST00000435777.1_Silent_p.I1218I|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1238	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CACTTACTGGGATTCCGGGTA	0.393										HNSCC(7;0.00092)																												dbGAP											0													46.0	51.0	49.0					8																	139638436		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.3714C>T	8.37:g.139638436G>A			B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.I1238	ENST00000303045.6	37	c.3714	CCDS6376.1	8																																																																																			COL22A1	-	pfam_Collagen	ENSG00000169436		0.393	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	316	0.00	0	G	XM_291257		139638436	139638436	-1	no_errors	ENST00000303045	ensembl	human	known	69_37n	silent	607	21.47	166	SNP	0.993	A
DGKB	1607	genome.wustl.edu	37	7	14216525	14216525	+	Splice_Site	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr7:14216525C>T	ENST00000403951.2	-	25	2666		c.e25-1		DGKB_ENST00000407950.1_Splice_Site|DGKB_ENST00000399322.3_Splice_Site|DGKB_ENST00000258767.5_Splice_Site|DGKB_ENST00000406247.3_Splice_Site|DGKB_ENST00000444700.2_Splice_Site|DGKB_ENST00000402815.1_Splice_Site			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						CTTGCTCGTCCTGGGGGAAAA	0.408																																						dbGAP											0													150.0	139.0	143.0					7																	14216525		1873	4114	5987	-	-	-	SO:0001630	splice_region_variant	0			AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.2247-1G>A	7.37:g.14216525C>T			A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Splice_Site	SNP	-	e24-1	ENST00000403951.2	37	c.2247-1	CCDS47547.1	7	.	.	.	.	.	.	.	.	.	.	C	22.0	4.231477	0.79688	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	.	.	.	4.4	4.4	0.53042	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1286	0.86721	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DGKB	14183050	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.463000	0.80869	2.432000	0.82394	0.655000	0.94253	.	DGKB	-	-	ENSG00000136267		0.408	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKB	HGNC	protein_coding	OTTHUMT00000326356.2	589	0.00	0	C	NM_004080	Intron	14216525	14216525	-1	no_errors	ENST00000258767	ensembl	human	known	69_37n	splice_site	378	17.79	82	SNP	1.000	T
DYRK3	8444	genome.wustl.edu	37	1	206820860	206820860	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr1:206820860G>T	ENST00000367109.2	+	3	485	c.317G>T	c.(316-318)aGt>aTt	p.S106I	DYRK3_ENST00000367106.1_Missense_Mutation_p.S86I|DYRK3_ENST00000367108.3_Missense_Mutation_p.S86I|DYRK3_ENST00000489878.1_Intron	NM_003582.2	NP_003573.2	O43781	DYRK3_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3	106					erythrocyte differentiation (GO:0030218)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)|skin(1)|stomach(2)	25	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			GATGGCATCAGTGACTCTGAA	0.408																																					Melanoma(164;427 2622 26826 51707)	dbGAP											0													131.0	128.0	129.0					1																	206820860		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y12735	CCDS30999.1, CCDS31000.1	1q32	2008-07-18			ENSG00000143479	ENSG00000143479	2.7.12.1		3094	protein-coding gene	gene with protein product	"""regulatory erythroid kinase"", ""dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 5"", ""protein kinase Dyrk3"""	603497				9748265	Standard	NM_003582		Approved	RED, REDK, hYAK3-2	uc001hej.3	O43781	OTTHUMG00000036339	ENST00000367109.2:c.317G>T	1.37:g.206820860G>T	ENSP00000356076:p.Ser106Ile		D3DT79|Q7Z752|Q9HBY6|Q9HBY7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S106I	ENST00000367109.2	37	c.317	CCDS30999.1	1	.	.	.	.	.	.	.	.	.	.	G	0.315	-0.965297	0.02249	.	.	ENSG00000143479	ENST00000367109;ENST00000367108;ENST00000441486;ENST00000367106	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	4.98	-5.04	0.02964	.	2.299770	0.01481	N	0.016661	T	0.31544	0.0800	N	0.14661	0.345	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.20384	0.013;0.029	T	0.25117	-1.0141	10	0.36615	T	0.2	.	10.3813	0.44113	0.1652:0.3555:0.4793:0.0	.	106;86	O43781;O43781-2	DYRK3_HUMAN;.	I	106;86;86;86	ENSP00000356076:S106I;ENSP00000356075:S86I;ENSP00000410187:S86I;ENSP00000356073:S86I	ENSP00000356073:S86I	S	+	2	0	DYRK3	204887483	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.032000	0.13732	-1.239000	0.02532	-0.323000	0.08544	AGT	DYRK3	-	NULL	ENSG00000143479		0.408	DYRK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK3	HGNC	protein_coding	OTTHUMT00000088458.1	358	0.00	0	G	NM_003582		206820860	206820860	+1	no_errors	ENST00000367109	ensembl	human	known	69_37n	missense	465	15.76	87	SNP	0.000	T
EMB	133418	genome.wustl.edu	37	5	49707043	49707043	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr5:49707043T>C	ENST00000303221.5	-	3	586	c.371A>G	c.(370-372)tAt>tGt	p.Y124C	EMB_ENST00000506190.1_5'UTR|EMB_ENST00000514111.1_Missense_Mutation_p.Y74C|EMB_ENST00000508934.1_Missense_Mutation_p.Y70C	NM_198449.2	NP_940851.1	Q6PCB8	EMB_HUMAN	embigin	124	Ig-like V-type 1.				cell adhesion (GO:0007155)|plasma membrane lactate transport (GO:0035879)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	organic cyclic compound binding (GO:0097159)			breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	15	Lung SC(58;0.218)	Lung NSC(810;0.0795)				GTATTGGGTATACAAGGTGCT	0.368																																						dbGAP											0													79.0	79.0	79.0					5																	49707043		2202	4298	6500	-	-	-	SO:0001583	missense	0			BC059398	CCDS3953.1	5q11.1	2013-01-29	2010-06-24		ENSG00000170571	ENSG00000170571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30465	protein-coding gene	gene with protein product		615669	"""embigin homolog (mouse)"""			9438341	Standard	NM_198449		Approved	MGC71745	uc003jom.3	Q6PCB8	OTTHUMG00000131161	ENST00000303221.5:c.371A>G	5.37:g.49707043T>C	ENSP00000302289:p.Tyr124Cys		B7Z6S3|B7Z902	Missense_Mutation	SNP	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	p.Y124C	ENST00000303221.5	37	c.371	CCDS3953.1	5	.	.	.	.	.	.	.	.	.	.	T	8.179	0.793392	0.16327	.	.	ENSG00000170571	ENST00000303221;ENST00000510295;ENST00000508934;ENST00000514111	T;T;T	0.43688	2.56;0.94;2.56	5.4	1.37	0.22104	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.495943	0.21088	N	0.080378	T	0.35480	0.0933	L	0.59436	1.845	0.09310	N	1	B;B	0.24317	0.069;0.101	B;B	0.16722	0.009;0.016	T	0.20438	-1.0275	9	.	.	.	-2.7165	10.8777	0.46921	0.0:0.0:0.4708:0.5292	.	70;124	D6RDX7;Q6PCB8	.;EMB_HUMAN	C	124;96;70;74	ENSP00000302289:Y124C;ENSP00000425215:Y70C;ENSP00000426404:Y74C	.	Y	-	2	0	EMB	49742800	0.000000	0.05858	0.005000	0.12908	0.088000	0.18126	0.007000	0.13174	0.005000	0.14708	0.524000	0.50904	TAT	EMB	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000170571		0.368	EMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMB	HGNC	protein_coding	OTTHUMT00000253853.1	399	0.00	0	T	NM_198449		49707043	49707043	-1	no_errors	ENST00000303221	ensembl	human	known	69_37n	missense	340	15.00	60	SNP	0.001	C
ESPNP	284729	genome.wustl.edu	37	1	17023376	17023376	+	RNA	SNP	C	C	T	rs613579	byFrequency	TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr1:17023376C>T	ENST00000492551.1	-	0	1571					NR_026567.1				espin pseudogene																		CCAGTAGCTCCGAGTTGTCGC	0.617													c|||	1978	0.394968	0.2474	0.415	5008	,	,		39011	0.497		0.4264	False		,,,				2504	0.4427					dbGAP											0																																										-	-	-			0			AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17023376C>T				RNA	SNP	-	NULL	ENST00000492551.1	37	NULL		1																																																																																			ESPNP	-	-	ENSG00000116219		0.617	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	HGNC	pseudogene	OTTHUMT00000326311.1	10	0.00	0	C			17023376	17023376	-1	no_errors	ENST00000492551	ensembl	human	known	69_37n	rna	1	85.71	6	SNP	0.527	T
FAM188B	84182	genome.wustl.edu	37	7	30898940	30898941	+	Splice_Site	DEL	TG	TG	-			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr7:30898940_30898941delTG	ENST00000265299.6	+	13	1822	c.1745delTG	c.(1744-1746)ctg>cg	p.L582fs	AQP1_ENST00000434909.2_5'UTR|INMT-FAM188B_ENST00000458257.1_3'UTR|AQP1_ENST00000509504.1_Splice_Site_p.L45fs	NM_032222.2	NP_115598.2	Q4G0A6	F188B_HUMAN	family with sequence similarity 188, member B	582										endometrium(1)|large_intestine(5)|lung(19)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TCTACAGAGCTGTGAGtatctt	0.574																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AK026027	CCDS43565.1	7p14.3	2010-08-17	2009-07-14	2009-07-14	ENSG00000106125	ENSG00000106125			21916	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 67"""	C7orf67			Standard	NM_032222		Approved	FLJ22374	uc003tbt.3	Q4G0A6	OTTHUMG00000152800	ENST00000265299.6:c.1745+1TG>-	7.37:g.30898942_30898943delTG			Q71AZ7|Q9H6D2	Frame_Shift_Del	DEL	NULL	p.L582fs	ENST00000265299.6	37	c.1745	CCDS43565.1	7																																																																																			FAM188B	-	NULL	ENSG00000106125		0.574	FAM188B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM188B	HGNC	protein_coding	OTTHUMT00000327962.1	23	0.00	0	TG	NM_032222	Frame_Shift_Del	30898940	30898941	+1	no_errors	ENST00000265299	ensembl	human	known	69_37n	frame_shift_del	47	52.53	52	DEL	0.997	-
FAM188B	84182	genome.wustl.edu	37	7	30898940	30898941	+	Splice_Site	DEL	TG	TG	-			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr7:30898940_30898941delTG	ENST00000265299.6	+	13	1822	c.1745delTG	c.(1744-1746)ctg>cg	p.L582fs	AQP1_ENST00000434909.2_5'UTR|INMT-FAM188B_ENST00000458257.1_3'UTR|AQP1_ENST00000509504.1_Splice_Site_p.L45fs	NM_032222.2	NP_115598.2	Q4G0A6	F188B_HUMAN	family with sequence similarity 188, member B	582										endometrium(1)|large_intestine(5)|lung(19)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TCTACAGAGCTGTGAGtatctt	0.574																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AK026027	CCDS43565.1	7p14.3	2010-08-17	2009-07-14	2009-07-14	ENSG00000106125	ENSG00000106125			21916	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 67"""	C7orf67			Standard	NM_032222		Approved	FLJ22374	uc003tbt.3	Q4G0A6	OTTHUMG00000152800	ENST00000265299.6:c.1745+1TG>-	7.37:g.30898942_30898943delTG			Q71AZ7|Q9H6D2	Frame_Shift_Del	DEL	NULL	p.L582fs	ENST00000265299.6	37	c.1745	CCDS43565.1	7																																																																																			FAM188B	-	NULL	ENSG00000106125		0.574	FAM188B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM188B	HGNC	protein_coding	OTTHUMT00000327962.1	65	0.00	0	TG	NM_032222	Frame_Shift_Del	30898940	30898941	+1	no_errors	ENST00000265299	ensembl	human	known	69_37n	frame_shift_del	47	52.53	52	DEL	0.997	-
FAM47B	170062	genome.wustl.edu	37	X	34962578	34962578	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chrX:34962578G>A	ENST00000329357.5	+	1	1666	c.1630G>A	c.(1630-1632)Ggg>Agg	p.G544R		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	544										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						TGCACAGCGTGGGAGGATAAG	0.507																																						dbGAP											0													102.0	89.0	93.0					X																	34962578		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1630G>A	X.37:g.34962578G>A	ENSP00000328307:p.Gly544Arg		Q5JQN5|Q6PIG3	Missense_Mutation	SNP	NULL	p.G544R	ENST00000329357.5	37	c.1630	CCDS14236.1	X	.	.	.	.	.	.	.	.	.	.	G	7.370	0.626631	0.14257	.	.	ENSG00000189132	ENST00000329357	T	0.41758	0.99	0.602	0.602	0.17535	.	.	.	.	.	T	0.21801	0.0525	N	0.08118	0	0.09310	N	1	P	0.48503	0.911	B	0.41813	0.367	T	0.10451	-1.0629	8	0.56958	D	0.05	.	.	.	.	.	544	Q8NA70	FA47B_HUMAN	R	544	ENSP00000328307:G544R	ENSP00000328307:G544R	G	+	1	0	FAM47B	34872499	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	-0.222000	0.09190	0.543000	0.28864	0.292000	0.19580	GGG	FAM47B	-	NULL	ENSG00000189132		0.507	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47B	HGNC	protein_coding	OTTHUMT00000056211.1	336	0.00	0	G	NM_152631		34962578	34962578	+1	no_errors	ENST00000329357	ensembl	human	known	69_37n	missense	176	26.05	62	SNP	0.001	A
SPATA31A3	727830	genome.wustl.edu	37	9	40705542	40705542	+	Missense_Mutation	SNP	C	C	T	rs200232419	byFrequency	TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr9:40705542C>T	ENST00000356699.5	+	4	3228	c.3199C>T	c.(3199-3201)Cgg>Tgg	p.R1067W	RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	1067					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TGGGAACATGCGGGCTTCCCA	0.557													C|||	4	0.000798722	0.003	0.0	5008	,	,		13204	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													15.0	13.0	14.0					9																	40705542		808	1720	2528	-	-	-	SO:0001583	missense	0					9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.3199C>T	9.37:g.40705542C>T	ENSP00000349132:p.Arg1067Trp			Missense_Mutation	SNP	NULL	p.R1067W	ENST00000356699.5	37	c.3199	CCDS47969.1	9	.	.	.	.	.	.	.	.	.	.	C	10.74	1.436840	0.25900	.	.	ENSG00000147926	ENST00000356699	T	0.04083	3.71	2.4	-3.32	0.04973	.	2.867030	0.01597	N	0.021847	T	0.05410	0.0143	N	0.14661	0.345	0.09310	N	1	D	0.69078	0.997	P	0.49047	0.599	T	0.29397	-1.0013	10	0.59425	D	0.04	.	8.1723	0.31262	0.0:0.2636:0.0:0.7364	.	1067	Q5VYP0	F75A3_HUMAN	W	1067	ENSP00000349132:R1067W	ENSP00000349132:R1067W	R	+	1	2	FAM75A3	40695542	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-4.492000	0.00225	-0.962000	0.03604	-0.522000	0.04353	CGG	FAM75A3	-	NULL	ENSG00000147926		0.557	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75A3	HGNC	protein_coding	OTTHUMT00000036919.1	140	0.71	1	C	NM_001083124		40705542	40705542	+1	no_errors	ENST00000356699	ensembl	human	known	69_37n	missense	19	44.12	15	SNP	0.000	T
FGL2	10875	genome.wustl.edu	37	7	76826243	76826243	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr7:76826243C>G	ENST00000248598.5	-	2	705	c.673G>C	c.(673-675)Gag>Cag	p.E225Q	CCDC146_ENST00000285871.4_Intron|CCDC146_ENST00000431197.1_Intron|RP11-467H10.2_ENST00000459742.1_RNA	NM_006682.2	NP_006673.1	Q14314	FGL2_HUMAN	fibrinogen-like 2	225	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)				breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	13						CTGTAGGTCTCACTGCTTCTT	0.428																																						dbGAP											0													87.0	83.0	84.0					7																	76826243		2203	4299	6502	-	-	-	SO:0001583	missense	0			Z36531	CCDS5591.1	7q11.23	2013-02-06			ENSG00000127951	ENSG00000127951		"""Fibrinogen C domain containing"""	3696	protein-coding gene	gene with protein product		605351				7642106	Standard	NM_006682		Approved	pT49, T49	uc003ugb.3	Q14314	OTTHUMG00000130681	ENST00000248598.5:c.673G>C	7.37:g.76826243C>G	ENSP00000248598:p.Glu225Gln			Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.E225Q	ENST00000248598.5	37	c.673	CCDS5591.1	7	.	.	.	.	.	.	.	.	.	.	C	16.54	3.150757	0.57151	.	.	ENSG00000127951	ENST00000248598	T	0.81330	-1.48	5.63	5.63	0.86233	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.200424	0.52532	D	0.000066	T	0.71600	0.3359	N	0.08118	0	0.31474	N	0.66804	P	0.38195	0.622	B	0.42245	0.381	T	0.76462	-0.2950	10	0.56958	D	0.05	.	19.2849	0.94067	0.0:1.0:0.0:0.0	.	225	Q14314	FGL2_HUMAN	Q	225	ENSP00000248598:E225Q	ENSP00000248598:E225Q	E	-	1	0	FGL2	76664179	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.743000	0.68655	2.669000	0.90835	0.655000	0.94253	GAG	FGL2	-	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	ENSG00000127951		0.428	FGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGL2	HGNC	protein_coding	OTTHUMT00000253176.1	209	0.00	0	C	NM_006682		76826243	76826243	-1	no_errors	ENST00000248598	ensembl	human	known	69_37n	missense	173	14.71	30	SNP	1.000	G
FMO6P	388714	genome.wustl.edu	37	1	171121173	171121173	+	Missense_Mutation	SNP	A	A	G	rs7889839	byFrequency	TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr1:171121173A>G	ENST00000236166.3	+	6	1062	c.952A>G	c.(952-954)Atg>Gtg	p.M318V				O60774	FMO6_HUMAN	flavin containing monooxygenase 6 pseudogene	318						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)										GGATGGGACCATGTTTGAGGC	0.483													G|||	655	0.130791	0.1876	0.0865	5008	,	,		21235	0.1726		0.1392	False		,,,				2504	0.0337					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK130511		1q24.3	2011-08-04	2006-12-04	2006-12-04	ENSG00000117507	ENSG00000117507			24024	pseudogene	pseudogene			"""flavin containing monooxygenase 6"""	FMO6		15077013	Standard	NR_002601		Approved		uc001ghj.1	O60774	OTTHUMG00000035503	ENST00000236166.3:c.952A>G	1.37:g.171121173A>G	ENSP00000236166:p.Met318Val			Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_3,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.M318V	ENST00000236166.3	37	c.952		1	356	0.163003663003663	98	0.1991869918699187	31	0.0856353591160221	110	0.19230769230769232	117	0.15435356200527706	G	0.004	-2.275774	0.00254	.	.	ENSG00000117507	ENST00000236166	.	.	.	5.19	0.141	0.14811	.	0.389589	0.25472	N	0.030435	T	0.07773	0.0195	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36939	-0.9727	7	0.05833	T	0.94	-0.9272	10.296	0.43625	0.4572:0.0:0.5428:0.0	rs7889839;rs17566319;rs52809741;rs60614841;rs7889839	318	O60774	FMO6_HUMAN	V	318	.	ENSP00000236166:M318V	M	+	1	0	FMO6P	169387797	0.000000	0.05858	0.018000	0.16275	0.403000	0.30841	-0.037000	0.12164	-0.519000	0.06444	-1.247000	0.01520	ATG	FMO6P	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase	ENSG00000117507		0.483	FMO6P-003	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	FMO6P	HGNC	protein_coding	OTTHUMT00000385941.4	16	0.00	0	A	XM_371326		171121173	171121173	+1	no_errors	ENST00000236166	ensembl	human	novel	69_37n	missense	3	72.73	8	SNP	0.036	G
GIMAP6	474344	genome.wustl.edu	37	7	150324841	150324841	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr7:150324841G>A	ENST00000328902.5	-	3	1061	c.845C>T	c.(844-846)gCc>gTc	p.A282V	GIMAP6_ENST00000493969.1_3'UTR	NM_001244072.1|NM_024711.5	NP_001231001.1|NP_078987.3	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	282						cytosol (GO:0005829)	GTP binding (GO:0005525)			endometrium(4)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCATCTGTGGGCTTCCTCAGA	0.587																																						dbGAP											0													87.0	74.0	79.0					7																	150324841		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026343	CCDS34778.1, CCDS59087.1, CCDS75676.1	7q36.1	2014-04-04			ENSG00000133561	ENSG00000133561		"""GTPases, IMAP"""	21918	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 6"""					15474311	Standard	NM_001244072		Approved	FLJ22690, IAN6	uc022apv.1	Q6P9H5	OTTHUMG00000159137	ENST00000328902.5:c.845C>T	7.37:g.150324841G>A	ENSP00000330374:p.Ala282Val		C9J7B6|D3DWZ4|Q5ZPR6|Q9H612	Missense_Mutation	SNP	pfam_AIG1	p.A282V	ENST00000328902.5	37	c.845	CCDS34778.1	7	.	.	.	.	.	.	.	.	.	.	G	11.21	1.572493	0.28092	.	.	ENSG00000133561	ENST00000328902;ENST00000392862	T	0.05925	3.37	3.3	-1.69	0.08186	.	2.954240	0.01187	N	0.007228	T	0.04543	0.0124	L	0.27053	0.805	0.09310	N	1	B;B	0.22003	0.063;0.025	B;B	0.19666	0.026;0.006	T	0.34576	-0.9823	10	0.16420	T	0.52	.	2.4116	0.04426	0.2901:0.0:0.3113:0.3986	.	282;202	Q6P9H5;Q6P9H5-2	GIMA6_HUMAN;.	V	282;343	ENSP00000330374:A282V	ENSP00000330374:A282V	A	-	2	0	GIMAP6	149955774	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.072000	0.11486	-0.196000	0.10366	-0.345000	0.07892	GCC	GIMAP6	-	NULL	ENSG00000133561		0.587	GIMAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP6	HGNC	protein_coding	OTTHUMT00000353457.1	248	0.00	0	G	NM_024711		150324841	150324841	-1	no_errors	ENST00000328902	ensembl	human	known	69_37n	missense	145	26.40	52	SNP	0.000	A
GLRA2	2742	genome.wustl.edu	37	X	14627177	14627177	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chrX:14627177G>C	ENST00000218075.4	+	7	1310	c.780G>C	c.(778-780)caG>caC	p.Q260H	GLRA2_ENST00000355020.4_Missense_Mutation_p.Q260H|GLRA2_ENST00000443437.2_Missense_Mutation_p.Q171H	NM_002063.3	NP_002054.1	P23416	GLRA2_HUMAN	glycine receptor, alpha 2	260					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)|synapse assembly (GO:0007416)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(22)|ovary(1)|prostate(1)|skin(2)	37	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)|Lindane(DB00431)	ATTTGATCCAGATGTACATCC	0.448																																						dbGAP											0													117.0	111.0	113.0					X																	14627177		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14160.1, CCDS48085.1, CCDS55371.1	Xp22.2	2012-02-07			ENSG00000101958	ENSG00000101958		"""Ligand-gated ion channels / Glycine receptors"""	4327	protein-coding gene	gene with protein product		305990		GLR			Standard	NM_002063		Approved		uc010nep.3	P23416	OTTHUMG00000021166	ENST00000218075.4:c.780G>C	X.37:g.14627177G>C	ENSP00000218075:p.Gln260His		A8K0J6|B2R6I8|B7Z4F5|J3KQ59|Q53YX7|Q6ICQ0|Q99862	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A,prints_Glycine_rcpt_A2,prints_Neur_channel,tigrfam_Neur_channel	p.Q260H	ENST00000218075.4	37	c.780	CCDS14160.1	X	.	.	.	.	.	.	.	.	.	.	G	24.7	4.565377	0.86439	.	.	ENSG00000101958	ENST00000443437;ENST00000218075;ENST00000355020	D;D;D	0.83755	-1.76;-1.76;-1.76	5.64	5.64	0.86602	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.91801	0.7406	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	0.972;0.98;1.0	P;D;D	0.83275	0.88;0.948;0.996	D	0.92657	0.6138	10	0.87932	D	0	.	18.7674	0.91879	0.0:0.0:1.0:0.0	.	244;260;260	B7Z4E9;P23416;P23416-2	.;GLRA2_HUMAN;.	H	171;260;260	ENSP00000387756:Q171H;ENSP00000218075:Q260H;ENSP00000347123:Q260H	ENSP00000218075:Q260H	Q	+	3	2	GLRA2	14537098	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.899000	0.87370	2.378000	0.81104	0.600000	0.82982	CAG	GLRA2	-	superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Neur_channel,tigrfam_Neur_channel	ENSG00000101958		0.448	GLRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GLRA2	HGNC	protein_coding	OTTHUMT00000055829.1	398	0.00	0	G			14627177	14627177	+1	no_errors	ENST00000218075	ensembl	human	known	69_37n	missense	129	28.73	52	SNP	1.000	C
HOMER1	9456	genome.wustl.edu	37	5	78742884	78742884	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr5:78742884G>C	ENST00000334082.6	-	4	1821	c.379C>G	c.(379-381)Cct>Gct	p.P127A	HOMER1_ENST00000535690.1_Intron|HOMER1_ENST00000282260.6_Intron|HOMER1_ENST00000508576.1_Missense_Mutation_p.P127A	NM_004272.3	NP_004263.1	Q86YM7	HOME1_HUMAN	homer homolog 1 (Drosophila)	127					behavioral response to cocaine (GO:0048148)|chemical homeostasis within a tissue (GO:0048875)|circadian rhythm (GO:0007623)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of signal transduction (GO:0009967)|protein localization to synapse (GO:0035418)|regulation of calcium ion import (GO:0090279)|regulation of cation channel activity (GO:2001257)|regulation of store-operated calcium entry (GO:2001256)|response to calcium ion (GO:0051592)|response to nicotine (GO:0035094)|skeletal muscle contraction (GO:0003009)|skeletal muscle fiber development (GO:0048741)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell junction (GO:0030054)|costamere (GO:0043034)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|signaling adaptor activity (GO:0035591)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|skin(1)	14		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		ACCTGTGAAGGTGTACTGGTA	0.353																																						dbGAP											0													152.0	150.0	151.0					5																	78742884		1834	4082	5916	-	-	-	SO:0001583	missense	0			BC015502	CCDS43335.1, CCDS64188.1, CCDS64189.1	5q14.2	2008-02-05			ENSG00000152413	ENSG00000152413			17512	protein-coding gene	gene with protein product		604798				9808459, 9808458	Standard	NM_004272		Approved	Ves-1, SYN47, HOMER-1B	uc003kfy.4	Q86YM7	OTTHUMG00000134278	ENST00000334082.6:c.379C>G	5.37:g.78742884G>C	ENSP00000334382:p.Pro127Ala		B2R688|O96003|Q86YM5	Missense_Mutation	SNP	pfam_EVH1,smart_EVH1,pfscan_EVH1	p.P127A	ENST00000334082.6	37	c.379	CCDS43335.1	5	.	.	.	.	.	.	.	.	.	.	G	10.65	1.409618	0.25465	.	.	ENSG00000152413	ENST00000334082;ENST00000508576	T;T	0.44881	2.24;0.91	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.22513	0.0543	N	0.02011	-0.69	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.11518	-1.0584	10	0.25751	T	0.34	-6.7389	20.091	0.97817	0.0:0.0:1.0:0.0	.	127;127	Q86YM7-3;Q86YM7	.;HOME1_HUMAN	A	127	ENSP00000334382:P127A;ENSP00000426651:P127A	ENSP00000334382:P127A	P	-	1	0	HOMER1	78778640	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.648000	0.67930	2.739000	0.93911	0.655000	0.94253	CCT	HOMER1	-	NULL	ENSG00000152413		0.353	HOMER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOMER1	HGNC	protein_coding	OTTHUMT00000258856.1	114	0.00	0	G	NM_004272		78742884	78742884	-1	no_errors	ENST00000334082	ensembl	human	known	69_37n	missense	90	18.18	20	SNP	1.000	C
GRXCR2	643226	genome.wustl.edu	37	5	145239466	145239466	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr5:145239466G>A	ENST00000377976.1	-	3	576	c.577C>T	c.(577-579)Ccc>Tcc	p.P193S		NM_001080516.1	NP_001073985.1	A6NFK2	GRCR2_HUMAN	glutaredoxin, cysteine rich 2	193						cell projection (GO:0042995)				breast(1)|endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						CTGTCCTCGGGAATATCCCCT	0.517																																						dbGAP											0													31.0	31.0	31.0					5																	145239466		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34263.1	5q32	2014-03-14			ENSG00000204928	ENSG00000204928			33862	protein-coding gene	gene with protein product		615762				24619944	Standard	NM_001080516		Approved	DFNB101	uc003lns.1	A6NFK2	OTTHUMG00000163417	ENST00000377976.1:c.577C>T	5.37:g.145239466G>A	ENSP00000367214:p.Pro193Ser			Missense_Mutation	SNP	NULL	p.P193S	ENST00000377976.1	37	c.577	CCDS34263.1	5	.	.	.	.	.	.	.	.	.	.	G	13.49	2.253871	0.39896	.	.	ENSG00000204928	ENST00000377976	T	0.55052	0.54	5.57	2.55	0.30701	.	0.305697	0.34700	N	0.003757	T	0.45155	0.1328	L	0.51422	1.61	0.20403	N	0.999904	B	0.26845	0.161	B	0.24394	0.053	T	0.27262	-1.0079	10	0.21014	T	0.42	-14.5532	15.2477	0.73517	0.0:0.5997:0.4003:0.0	.	193	A6NFK2	GRCR2_HUMAN	S	193	ENSP00000367214:P193S	ENSP00000367214:P193S	P	-	1	0	GRXCR2	145219659	0.811000	0.29063	0.994000	0.49952	0.897000	0.52465	0.738000	0.26158	0.666000	0.31087	0.561000	0.74099	CCC	GRXCR2	-	NULL	ENSG00000204928		0.517	GRXCR2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	GRXCR2	HGNC	protein_coding	OTTHUMT00000373289.2	84	0.00	0	G			145239466	145239466	-1	no_errors	ENST00000377976	ensembl	human	known	69_37n	missense	90	36.81	53	SNP	0.293	A
HOOK1	51361	genome.wustl.edu	37	1	60328544	60328544	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr1:60328544G>A	ENST00000371208.3	+	16	1878	c.1621G>A	c.(1621-1623)Gaa>Aaa	p.E541K	HOOK1_ENST00000395561.2_Missense_Mutation_p.E499K|HOOK1_ENST00000465876.1_3'UTR	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	541	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					GTCTGAAGGCGAAAGTGTAAG	0.368																																						dbGAP											0													79.0	83.0	82.0					1																	60328544		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1621G>A	1.37:g.60328544G>A	ENSP00000360252:p.Glu541Lys		A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	pfam_HOOK,superfamily_Prefoldin	p.E541K	ENST00000371208.3	37	c.1621	CCDS612.1	1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870704	0.72065	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	T;T	0.34859	1.73;1.34	5.64	5.64	0.86602	.	0.060019	0.64402	D	0.000005	T	0.28797	0.0714	L	0.44542	1.39	0.47737	D	0.999503	P	0.47350	0.894	B	0.33620	0.167	T	0.09530	-1.0670	10	0.14656	T	0.56	.	20.0534	0.97636	0.0:0.0:1.0:0.0	.	541	Q9UJC3	HOOK1_HUMAN	K	541;499	ENSP00000360252:E541K;ENSP00000378928:E499K	ENSP00000360252:E541K	E	+	1	0	HOOK1	60101132	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.564000	0.90726	2.807000	0.96579	0.650000	0.86243	GAA	HOOK1	-	pfam_HOOK	ENSG00000134709		0.368	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK1	HGNC	protein_coding	OTTHUMT00000024934.1	236	0.00	0	G	NM_015888		60328544	60328544	+1	no_errors	ENST00000371208	ensembl	human	known	69_37n	missense	140	21.79	39	SNP	1.000	A
IQSEC2	23096	genome.wustl.edu	37	X	53283878	53283878	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chrX:53283878G>A	ENST00000375368.5	-	3	1405	c.1205C>T	c.(1204-1206)tCg>tTg	p.S402L	IQSEC2_ENST00000396435.3_Missense_Mutation_p.S412L|IQSEC2_ENST00000375365.2_Missense_Mutation_p.S207L			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	402					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						CTCGTCCAGCGAGGCAGGCTT	0.622																																						dbGAP											0													34.0	23.0	27.0					X																	53283878		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.1205C>T	X.37:g.53283878G>A	ENSP00000364517:p.Ser402Leu		B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.S412L	ENST00000375368.5	37	c.1235		X	.	.	.	.	.	.	.	.	.	.	G	17.45	3.392249	0.62066	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.50813	0.73;0.73;0.73	5.09	5.09	0.68999	.	0.252943	0.33438	N	0.004911	T	0.52869	0.1761	L	0.39898	1.24	0.47949	D	0.999551	D;D	0.64830	0.994;0.989	P;P	0.58391	0.838;0.648	T	0.43228	-0.9404	10	0.12430	T	0.62	.	16.3278	0.82994	0.0:0.0:1.0:0.0	.	412;207	Q5JU85-2;Q5JU85-3	.;.	L	412;402;207	ENSP00000379712:S412L;ENSP00000364517:S402L;ENSP00000364514:S207L	ENSP00000364514:S207L	S	-	2	0	IQSEC2	53300603	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.686000	0.84128	2.108000	0.64289	0.513000	0.50165	TCG	IQSEC2	-	NULL	ENSG00000124313		0.622	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		59	0.00	0	G	XM_291345		53283878	53283878	-1	no_errors	ENST00000396435	ensembl	human	known	69_37n	missense	24	35.14	13	SNP	1.000	A
HS6ST2	90161	genome.wustl.edu	37	X	131762517	131762517	+	Missense_Mutation	SNP	G	G	A	rs545395522		TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chrX:131762517G>A	ENST00000370836.2	-	4	1967	c.1552C>T	c.(1552-1554)Cgc>Tgc	p.R518C	HS6ST2_ENST00000521489.1_Missense_Mutation_p.R558C|HS6ST2_ENST00000370833.2_Missense_Mutation_p.R412C|HS6ST2_ENST00000406696.3_Missense_Mutation_p.R244C	NM_147175.3	NP_671704.3	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2	518					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)	9	Acute lymphoblastic leukemia(192;0.000127)					AGAAATTTGCGTTGTTCCTGA	0.493													G|||	5	0.0013245	0.0	0.0	3775	,	,		14851	0.0		0.0	False		,,,				2504	0.0051					dbGAP											0													98.0	95.0	96.0					X																	131762517		1976	4127	6103	-	-	-	SO:0001583	missense	0			AB067776	CCDS48169.1, CCDS48170.1	Xq26.2	2008-02-05			ENSG00000171004	ENSG00000171004		"""Sulfotransferases, membrane-bound"""	19133	protein-coding gene	gene with protein product		300545				10644753	Standard	NM_147175		Approved		uc011mvd.1	Q96MM7	OTTHUMG00000022430	ENST00000370836.2:c.1552C>T	X.37:g.131762517G>A	ENSP00000359873:p.Arg518Cys		B9WRT4|B9WRT5|E9PDY5|Q2TB13|Q4VC07|Q6PIC4|Q86SM9|Q8N3T4|Q8NBN4|Q96SJ4	Missense_Mutation	SNP	pfam_Sulfotransferase	p.R558C	ENST00000370836.2	37	c.1672	CCDS48169.1	X	.	.	.	.	.	.	.	.	.	.	G	13.04	2.119576	0.37436	.	.	ENSG00000171004	ENST00000370837;ENST00000370836;ENST00000521489;ENST00000406696;ENST00000370833	T;T;T;D;T	0.81659	-1.41;-0.93;-0.84;-1.52;-1.26	6.01	4.24	0.50183	.	0.046854	0.85682	N	0.000000	T	0.72985	0.3529	L	0.52905	1.665	0.58432	D	0.999994	P;P;P	0.38300	0.626;0.626;0.626	B;B;B	0.32022	0.085;0.139;0.085	T	0.71728	-0.4505	10	0.87932	D	0	-0.6425	9.8267	0.40916	0.0735:0.0:0.7873:0.1392	.	518;558;244	Q96MM7;E9PDY5;B7Z5H6	H6ST2_HUMAN;.;.	C	372;518;558;244;412	ENSP00000359874:R372C;ENSP00000359873:R518C;ENSP00000429473:R558C;ENSP00000384013:R244C;ENSP00000359870:R412C	ENSP00000359870:R412C	R	-	1	0	HS6ST2	131590198	1.000000	0.71417	0.916000	0.36221	0.546000	0.35178	3.109000	0.50345	0.655000	0.30866	-0.245000	0.11935	CGC	HS6ST2	-	NULL	ENSG00000171004		0.493	HS6ST2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HS6ST2	HGNC	protein_coding	OTTHUMT00000058332.3	216	0.00	0	G	NM_147174		131762517	131762517	-1	no_errors	ENST00000521489	ensembl	human	known	69_37n	missense	48	62.20	79	SNP	1.000	A
KCNA4	3739	genome.wustl.edu	37	11	30033717	30033717	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr11:30033717C>T	ENST00000328224.6	-	2	1742	c.509G>A	c.(508-510)cGc>cAc	p.R170H	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	170					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	GTCACTGTAGCGGACTGAACT	0.502																																						dbGAP											0													65.0	65.0	65.0					11																	30033717		2153	4253	6406	-	-	-	SO:0001583	missense	0			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.509G>A	11.37:g.30033717C>T	ENSP00000328511:p.Arg170His			Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv1.4_TID,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.4,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.R170H	ENST00000328224.6	37	c.509	CCDS41629.1	11	.	.	.	.	.	.	.	.	.	.	C	18.14	3.557223	0.65425	.	.	ENSG00000182255	ENST00000328224	D	0.96940	-4.18	4.66	4.66	0.58398	.	0.133902	0.45126	U	0.000393	D	0.92724	0.7687	N	0.14661	0.345	0.45747	D	0.998647	D	0.60575	0.988	P	0.49799	0.622	D	0.91051	0.4878	10	0.13108	T	0.6	.	15.7518	0.77992	0.0:1.0:0.0:0.0	.	170	P22459	KCNA4_HUMAN	H	170	ENSP00000328511:R170H	ENSP00000328511:R170H	R	-	2	0	KCNA4	29990293	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.447000	0.60020	2.145000	0.66743	0.561000	0.74099	CGC	KCNA4	-	NULL	ENSG00000182255		0.502	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA4	HGNC	protein_coding	OTTHUMT00000388074.2	168	0.00	0	C	NM_002233		30033717	30033717	-1	no_errors	ENST00000328224	ensembl	human	known	69_37n	missense	176	37.98	109	SNP	1.000	T
LARP7	51574	genome.wustl.edu	37	4	113578482	113578483	+	Stop_Codon_Ins	INS	-	-	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr4:113578482_113578483insA	ENST00000344442.5	+	0	2026_2027				LARP7_ENST00000509061.1_Stop_Codon_Ins|LARP7_ENST00000503898.1_3'UTR|LARP7_ENST00000324052.6_Stop_Codon_Ins	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7						RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		GAATATGATTGAAAAAAAAAAC	0.302																																						dbGAP											0																																										-	-	-	SO:0001567	stop_retained_variant	0			AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.1756dupA	4.37:g.113578492_113578492dupA			B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Frame_Shift_Ins	INS	pfam_RRM_3,pfam_Lupus_La_RNA-bd,pfam_RRM_dom,smart_Lupus_La_RNA-bd,smart_RRM_dom,pfscan_Lupus_La_RNA-bd,pfscan_RRM_dom,prints_Lupus_La	p.*584fs	ENST00000344442.5	37	c.1748_1749	CCDS3701.2	4																																																																																			LARP7	-	NULL	ENSG00000174720		0.302	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP7	HGNC	protein_coding	OTTHUMT00000256417.2	28	0.00	0	-	NM_016648		113578482	113578483	+1	no_errors	ENST00000324052	ensembl	human	known	69_37n	frame_shift_ins	25	10.71	3	INS	0.998:1.000	A
LHX6	26468	genome.wustl.edu	37	9	124971974	124971974	+	Silent	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr9:124971974C>T	ENST00000373755.2	-	8	1098	c.990G>A	c.(988-990)gtG>gtA	p.V330V	LHX6_ENST00000559895.1_Silent_p.V143V|LHX6_ENST00000482062.1_Silent_p.V17V|LHX6_ENST00000464484.2_Intron|LHX6_ENST00000340587.3_Intron|LHX6_ENST00000373754.2_Intron|LHX6_ENST00000394319.4_Silent_p.V359V|LHX6_ENST00000541397.2_Intron	NM_001242334.1	NP_001229263.1	Q9UPM6	LHX6_HUMAN	LIM homeobox 6	330					cell maturation (GO:0048469)|cerebral cortex GABAergic interneuron migration (GO:0021853)|cerebral cortex radially oriented cell migration (GO:0021799)|cerebral cortex tangential migration (GO:0021800)|forebrain neuron fate commitment (GO:0021877)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(5)	8						gccggcagtgcacctgcccgc	0.632																																						dbGAP											0													69.0	58.0	62.0					9																	124971974		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB031041	CCDS6837.2, CCDS6838.2, CCDS56583.1, CCDS56584.1, CCDS59144.1	9q33.2	2011-06-20			ENSG00000106852	ENSG00000106852		"""Homeoboxes / LIM class"""	21735	protein-coding gene	gene with protein product		608215				10393337	Standard	NM_014368		Approved	LHX6.1	uc004blx.4	Q9UPM6	OTTHUMG00000020601	ENST00000373755.2:c.990G>A	9.37:g.124971974C>T			A6PVQ1|A6PVQ2|A8K1B2|B7Z4D0|H0YN76|Q5T7S7|Q5T7S8|Q9NTK3|Q9UPM5	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,pfscan_Homeodomain	p.C104Y	ENST00000373755.2	37	c.311	CCDS56583.1	9																																																																																			LHX6	-	NULL	ENSG00000106852		0.632	LHX6-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	LHX6	HGNC	protein_coding	OTTHUMT00000053924.2	30	0.00	0	C	NM_014368		124971974	124971974	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000482062	ensembl	human	putative	69_37n	missense	8	42.86	6	SNP	1.000	T
LHX6	26468	genome.wustl.edu	37	9	124971974	124971974	+	Silent	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr9:124971974C>T	ENST00000373755.2	-	8	1098	c.990G>A	c.(988-990)gtG>gtA	p.V330V	LHX6_ENST00000559895.1_Silent_p.V143V|LHX6_ENST00000482062.1_Silent_p.V17V|LHX6_ENST00000464484.2_Intron|LHX6_ENST00000340587.3_Intron|LHX6_ENST00000373754.2_Intron|LHX6_ENST00000394319.4_Silent_p.V359V|LHX6_ENST00000541397.2_Intron	NM_001242334.1	NP_001229263.1	Q9UPM6	LHX6_HUMAN	LIM homeobox 6	330					cell maturation (GO:0048469)|cerebral cortex GABAergic interneuron migration (GO:0021853)|cerebral cortex radially oriented cell migration (GO:0021799)|cerebral cortex tangential migration (GO:0021800)|forebrain neuron fate commitment (GO:0021877)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(5)	8						gccggcagtgcacctgcccgc	0.632																																						dbGAP											0													69.0	58.0	62.0					9																	124971974		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB031041	CCDS6837.2, CCDS6838.2, CCDS56583.1, CCDS56584.1, CCDS59144.1	9q33.2	2011-06-20			ENSG00000106852	ENSG00000106852		"""Homeoboxes / LIM class"""	21735	protein-coding gene	gene with protein product		608215				10393337	Standard	NM_014368		Approved	LHX6.1	uc004blx.4	Q9UPM6	OTTHUMG00000020601	ENST00000373755.2:c.990G>A	9.37:g.124971974C>T			A6PVQ1|A6PVQ2|A8K1B2|B7Z4D0|H0YN76|Q5T7S7|Q5T7S8|Q9NTK3|Q9UPM5	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,pfscan_Homeodomain	p.C104Y	ENST00000373755.2	37	c.311	CCDS56583.1	9																																																																																			LHX6	-	NULL	ENSG00000106852		0.632	LHX6-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	LHX6	HGNC	protein_coding	OTTHUMT00000053924.2	12	0.00	0	C	NM_014368		124971974	124971974	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000482062	ensembl	human	putative	69_37n	missense	8	42.86	6	SNP	1.000	T
METTL9	51108	genome.wustl.edu	37	16	21636383	21636383	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr16:21636383G>C	ENST00000358154.3	+	4	956	c.698G>C	c.(697-699)aGa>aCa	p.R233T	CTB-31N19.3_ENST00000564271.1_RNA|METTL9_ENST00000396014.4_Missense_Mutation_p.R233T	NM_001077180.1|NM_016025.3	NP_001070648.1|NP_057109.3	Q9H1A3	METL9_HUMAN	methyltransferase like 9	233										endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	7				GBM - Glioblastoma multiforme(48;0.0759)		GAGCCAACTAGAGGCAGGGTC	0.493																																						dbGAP											0													119.0	105.0	110.0					16																	21636383		2199	4300	6499	-	-	-	SO:0001583	missense	0			NM_016025, AF151839	CCDS10598.2, CCDS45440.1	16p12.2	2008-11-06			ENSG00000197006	ENSG00000197006			24586	protein-coding gene	gene with protein product	"""DORA reverse strand protein 1"""	609388				10810093, 11132146	Standard	NM_001077180		Approved	DREV1	uc002dje.3	Q9H1A3	OTTHUMG00000131584	ENST00000358154.3:c.698G>C	16.37:g.21636383G>C	ENSP00000350874:p.Arg233Thr		Q8NBT8|Q9BWJ7|Q9H1A2|Q9Y390	Missense_Mutation	SNP	pfam_DREV_MeTrfase,pfam_Methyltransf_12,pfam_Methyltransf_11	p.R233T	ENST00000358154.3	37	c.698	CCDS10598.2	16	.	.	.	.	.	.	.	.	.	.	G	10.82	1.457339	0.26161	.	.	ENSG00000197006	ENST00000358154;ENST00000396014;ENST00000540294	.	.	.	6.17	4.22	0.49857	.	0.137681	0.64402	D	0.000003	T	0.12732	0.0309	N	0.00760	-1.21	0.33669	D	0.610699	B;B	0.12630	0.001;0.006	B;B	0.09377	0.004;0.002	T	0.20472	-1.0274	9	0.06891	T	0.86	-2.4591	10.192	0.43032	0.1612:0.0:0.8388:0.0	.	233;233	Q9H1A3-2;Q9H1A3	.;METL9_HUMAN	T	233;233;197	.	ENSP00000350874:R233T	R	+	2	0	METTL9	21543884	1.000000	0.71417	0.937000	0.37676	0.998000	0.95712	4.273000	0.58914	0.923000	0.37045	0.655000	0.94253	AGA	METTL9	-	pfam_DREV_MeTrfase	ENSG00000197006		0.493	METTL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	METTL9	HGNC	protein_coding	OTTHUMT00000254465.1	96	0.00	0	G	NM_016025		21636383	21636383	+1	no_errors	ENST00000358154	ensembl	human	known	69_37n	missense	86	23.21	26	SNP	0.996	C
MIOS	54468	genome.wustl.edu	37	7	7636043	7636043	+	Silent	SNP	A	A	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr7:7636043A>T	ENST00000340080.4	+	11	2773	c.2352A>T	c.(2350-2352)cgA>cgT	p.R784R	MIOS_ENST00000405785.1_Silent_p.R784R	NM_019005.3	NP_061878.3	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog (Drosophila)	784						lysosomal membrane (GO:0005765)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CACTTCCTCGATGTGCGCTTT	0.408																																						dbGAP											0													173.0	166.0	168.0					7																	7636043		1965	4145	6110	-	-	-	SO:0001819	synonymous_variant	0				CCDS43554.1	7p21.3	2011-09-12			ENSG00000164654	ENSG00000164654			21905	protein-coding gene	gene with protein product	"""WD repeat-containing protein mio"""	615359				14973288	Standard	NM_019005		Approved	FLJ20323	uc003srf.3	Q9NXC5	OTTHUMG00000152440	ENST00000340080.4:c.2352A>T	7.37:g.7636043A>T			B2RTV6|O75216|Q7L551|Q9H092	Silent	SNP	smart_WD40_repeat	p.R784	ENST00000340080.4	37	c.2352	CCDS43554.1	7																																																																																			MIOS	-	NULL	ENSG00000164654		0.408	MIOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIOS	HGNC	protein_coding	OTTHUMT00000326218.1	279	0.00	0	A	NM_019005		7636043	7636043	+1	no_errors	ENST00000340080	ensembl	human	known	69_37n	silent	227	23.83	71	SNP	1.000	T
MOGAT3	346606	genome.wustl.edu	37	7	100839208	100839208	+	3'UTR	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr7:100839208C>T	ENST00000223114.4	-	0	1211				MOGAT3_ENST00000440203.2_3'UTR|MOGAT3_ENST00000379423.3_Missense_Mutation_p.R281H	NM_178176.2	NP_835470.1	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3						glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(3)	22	Lung NSC(181;0.168)|all_lung(186;0.215)					AGGGGCTCAGCGAAAGGCCGC	0.622																																						dbGAP											0													58.0	59.0	58.0					7																	100839208		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AY229854	CCDS5714.1, CCDS75643.1	7q22	2012-09-06			ENSG00000106384	ENSG00000106384	2.3.1.20, 2.3.1.22		23249	protein-coding gene	gene with protein product		610184				12618427, 14970677	Standard	XM_005250309		Approved	DC7, MGAT3	uc003uyc.3	Q86VF5	OTTHUMG00000023328	ENST00000223114.4:c.*19G>A	7.37:g.100839208C>T			Q496A6|Q496A7|Q496A8|Q9UDW7	Missense_Mutation	SNP	pfam_DAGAT	p.R281H	ENST00000223114.4	37	c.842	CCDS5714.1	7	.	.	.	.	.	.	.	.	.	.	C	12.30	1.896786	0.33535	.	.	ENSG00000106384	ENST00000379423	T	0.33438	1.41	3.57	-2.49	0.06403	.	.	.	.	.	T	0.17280	0.0415	.	.	.	0.09310	N	1	P	0.36712	0.566	B	0.30855	0.121	T	0.16129	-1.0413	8	0.87932	D	0	.	5.1336	0.14922	0.3625:0.4004:0.2371:0.0	.	281	Q86VF5-2	.	H	281	ENSP00000368734:R281H	ENSP00000368734:R281H	R	-	2	0	MOGAT3	100625928	0.008000	0.16893	0.000000	0.03702	0.005000	0.04900	-0.235000	0.09016	-0.266000	0.09339	0.644000	0.83932	CGC	MOGAT3	-	NULL	ENSG00000106384		0.622	MOGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOGAT3	HGNC	protein_coding	OTTHUMT00000059649.3	37	0.00	0	C	NM_178176		100839208	100839208	-1	no_errors	ENST00000379423	ensembl	human	known	69_37n	missense	16	30.43	7	SNP	0.000	T
MRPS31	10240	genome.wustl.edu	37	13	41333178	41333178	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr13:41333178C>G	ENST00000323563.6	-	3	541	c.505G>C	c.(505-507)Gat>Cat	p.D169H		NM_005830.3	NP_005821.2	Q92665	RT31_HUMAN	mitochondrial ribosomal protein S31	169						mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|structural constituent of ribosome (GO:0003735)	p.D169N(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	13		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.52e-08)|Epithelial(112;7.63e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000192)|GBM - Glioblastoma multiforme(144;0.00233)|BRCA - Breast invasive adenocarcinoma(63;0.0706)		GTTTGCTTATCAAAAGGGAGA	0.458																																						dbGAP											1	Substitution - Missense(1)	lung(1)											78.0	76.0	77.0					13																	41333178		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z68747	CCDS9372.1	13q14.11	2012-09-13			ENSG00000102738	ENSG00000102738		"""Mitochondrial ribosomal proteins / small subunits"""	16632	protein-coding gene	gene with protein product		611992				11279123, 8567980	Standard	NM_005830		Approved	IMOGN38	uc001uxm.4	Q92665	OTTHUMG00000016777	ENST00000323563.6:c.505G>C	13.37:g.41333178C>G	ENSP00000315397:p.Asp169His		B2RCS3|Q5VYC8|Q8WTV8	Missense_Mutation	SNP	NULL	p.D169H	ENST00000323563.6	37	c.505	CCDS9372.1	13	.	.	.	.	.	.	.	.	.	.	C	14.50	2.554613	0.45487	.	.	ENSG00000102738	ENST00000323563	T	0.35421	1.31	5.02	5.02	0.67125	.	0.144071	0.64402	D	0.000010	T	0.63379	0.2506	M	0.84846	2.72	0.35010	D	0.756796	D	0.89917	1.0	D	0.75484	0.986	T	0.76523	-0.2928	10	0.72032	D	0.01	.	14.1907	0.65637	0.0:1.0:0.0:0.0	.	169	Q92665	RT31_HUMAN	H	169	ENSP00000315397:D169H	ENSP00000315397:D169H	D	-	1	0	MRPS31	40231178	0.991000	0.36638	1.000000	0.80357	0.322000	0.28314	0.667000	0.25112	2.482000	0.83794	0.557000	0.71058	GAT	MRPS31	-	NULL	ENSG00000102738		0.458	MRPS31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS31	HGNC	protein_coding	OTTHUMT00000044640.2	173	0.00	0	C			41333178	41333178	-1	no_errors	ENST00000323563	ensembl	human	known	69_37n	missense	64	41.28	45	SNP	1.000	G
TSC2	7249	genome.wustl.edu	37	16	2096132	2096133	+	5'Flank	INS	-	-	G			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr16:2096132_2096133insG	ENST00000219476.3	+	0	0				TSC2_ENST00000439673.2_5'Flank|NTHL1_ENST00000562951.1_5'Flank|TSC2_ENST00000401874.2_5'Flank|NTHL1_ENST00000219066.1_Frame_Shift_Ins_p.P125fs|TSC2_ENST00000382538.6_5'Flank|TSC2_ENST00000350773.4_5'Flank|TSC2_ENST00000568454.1_5'Flank|TSC2_ENST00000353929.4_5'Flank	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2						acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				TGCCTACCTTTGGGGGGGCACT	0.579			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																													dbGAP	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0																																										-	-	-	SO:0001631	upstream_gene_variant	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745		16.37:g.2096139_2096139dupG	Exception_encountered		A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Frame_Shift_Ins	INS	pfam_HhH-GPD_domain,pfam_HhH_motif,superfamily_DNA_glycosylase,smart_HhH-GPD_domain,smart_Endouclease3_FeS-loop_motif	p.V127fs	ENST00000219476.3	37	c.375_374	CCDS10458.1	16																																																																																			NTHL1	-	superfamily_DNA_glycosylase	ENSG00000065057		0.579	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTHL1	HGNC	protein_coding	OTTHUMT00000250657.2	14	0.00	0	-	NM_000548		2096132	2096133	-1	no_errors	ENST00000219066	ensembl	human	known	69_37n	frame_shift_ins	20	13.04	3	INS	0.794:1.000	G
OR2T35	403244	genome.wustl.edu	37	1	248801953	248801954	+	Frame_Shift_Ins	INS	-	-	T	rs140070233	byFrequency	TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr1:248801953_248801954insT	ENST00000317450.3	-	1	605_606	c.606_607insA	c.(604-609)tgctgcfs	p.C203fs		NM_001001827.1	NP_001001827.1	Q8NGX2	O2T35_HUMAN	olfactory receptor, family 2, subfamily T, member 35	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	6	all_cancers(71;2.04e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATCAGCACGCAGCAGGCATACA	0.525																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BK004475	CCDS31123.1	1q44	2012-08-09			ENSG00000177151	ENSG00000177151		"""GPCR / Class A : Olfactory receptors"""	31257	protein-coding gene	gene with protein product							Standard	NM_001001827		Approved		uc001ies.1	Q8NGX2	OTTHUMG00000040380	ENST00000317450.3:c.606_607insA	1.37:g.248801953_248801954insT	ENSP00000324369:p.Cys203fs		Q6IEY7	Frame_Shift_Ins	INS	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.C202fs	ENST00000317450.3	37	c.607_606	CCDS31123.1	1																																																																																			OR2T35	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000177151		0.525	OR2T35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T35	HGNC	protein_coding	OTTHUMT00000097130.1	8	0.00	0	-	NM_001001827		248801953	248801954	-1	no_errors	ENST00000317450	ensembl	human	known	69_37n	frame_shift_ins	10	28.57	4	INS	0.101:0.095	T
OR2T35	403244	genome.wustl.edu	37	1	248801953	248801954	+	Frame_Shift_Ins	INS	-	-	T	rs140070233	byFrequency	TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr1:248801953_248801954insT	ENST00000317450.3	-	1	605_606	c.606_607insA	c.(604-609)tgctgcfs	p.C203fs		NM_001001827.1	NP_001001827.1	Q8NGX2	O2T35_HUMAN	olfactory receptor, family 2, subfamily T, member 35	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	6	all_cancers(71;2.04e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATCAGCACGCAGCAGGCATACA	0.525																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BK004475	CCDS31123.1	1q44	2012-08-09			ENSG00000177151	ENSG00000177151		"""GPCR / Class A : Olfactory receptors"""	31257	protein-coding gene	gene with protein product							Standard	NM_001001827		Approved		uc001ies.1	Q8NGX2	OTTHUMG00000040380	ENST00000317450.3:c.606_607insA	1.37:g.248801953_248801954insT	ENSP00000324369:p.Cys203fs		Q6IEY7	Frame_Shift_Ins	INS	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.C202fs	ENST00000317450.3	37	c.607_606	CCDS31123.1	1																																																																																			OR2T35	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000177151		0.525	OR2T35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T35	HGNC	protein_coding	OTTHUMT00000097130.1	11	0.00	0	-	NM_001001827		248801953	248801954	-1	no_errors	ENST00000317450	ensembl	human	known	69_37n	frame_shift_ins	10	28.57	4	INS	0.101:0.095	T
OR4A15	81328	genome.wustl.edu	37	11	55135676	55135676	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr11:55135676C>A	ENST00000314706.3	+	1	317	c.317C>A	c.(316-318)gCt>gAt	p.A106D		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	106						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						ACTGCATTTGCTCCCAAAATG	0.413																																						dbGAP											0													141.0	139.0	140.0					11																	55135676		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.317C>A	11.37:g.55135676C>A	ENSP00000325065:p.Ala106Asp		Q6IFL4|Q96R65	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.A106D	ENST00000314706.3	37	c.317	CCDS31500.1	11	.	.	.	.	.	.	.	.	.	.	c	12.05	1.820307	0.32145	.	.	ENSG00000181958	ENST00000314706	T	0.03094	4.05	3.48	3.48	0.39840	GPCR, rhodopsin-like superfamily (1);	0.135983	0.33110	N	0.005267	T	0.10078	0.0247	M	0.91510	3.215	0.09310	N	1	P	0.34934	0.476	B	0.39299	0.296	T	0.09840	-1.0656	10	0.87932	D	0	.	6.6321	0.22863	0.0:0.8678:0.0:0.1322	.	106	Q8NGL6	O4A15_HUMAN	D	106	ENSP00000325065:A106D	ENSP00000325065:A106D	A	+	2	0	OR4A15	54892252	0.000000	0.05858	0.011000	0.14972	0.158000	0.22134	0.095000	0.15127	1.785000	0.52413	0.492000	0.49549	GCT	OR4A15	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181958		0.413	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A15	HGNC	protein_coding	OTTHUMT00000391161.1	479	0.00	0	C	NM_001005275		55135676	55135676	+1	no_errors	ENST00000314706	ensembl	human	known	69_37n	missense	323	34.75	172	SNP	0.003	A
PBRM1	55193	genome.wustl.edu	37	3	52584437	52584438	+	Splice_Site	INS	-	-	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr3:52584437_52584438insT	ENST00000296302.7	-	29	4897_4898	c.4896_4897insA	c.(4894-4899)gcagct>gcaAgct	p.A1633fs	PBRM1_ENST00000409114.3_Splice_Site_p.A1596fs|PBRM1_ENST00000410007.1_Splice_Site_p.A1553fs|PBRM1_ENST00000394830.3_Splice_Site_p.A1526fs|PBRM1_ENST00000337303.4_Splice_Site_p.A1526fs|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000356770.4_Splice_Site_p.A1546fs|RNU6-856P_ENST00000516959.1_RNA|PBRM1_ENST00000409057.1_Splice_Site_p.A1578fs|PBRM1_ENST00000409767.1_Splice_Site_p.A1541fs			Q86U86	PB1_HUMAN	polybromo 1	1633					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GGAATCTTACCTGCCAGTGTCT	0.436			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																	dbGAP		Rec	yes		3	3p21	55193	polybromo 1		E	0																																										-	-	-	SO:0001630	splice_region_variant	0			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.4897+1->A	3.37:g.52584438_52584438dupT			A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Ins	INS	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_superfamily,superfamily_Bromodomain,superfamily_HMG_superfamily,smart_Bromodomain,smart_BAH_dom,smart_HMG_superfamily,pfscan_BAH_dom,pfscan_HMG_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.A1632fs	ENST00000296302.7	37	c.4897_4896		3																																																																																			PBRM1	-	NULL	ENSG00000163939		0.436	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	HGNC	protein_coding	OTTHUMT00000327232.1	62	0.00	0	-	NM_018165	Frame_Shift_Ins	52584437	52584438	-1	no_errors	ENST00000296302	ensembl	human	known	69_37n	frame_shift_ins	32	11.11	4	INS	1.000:1.000	T
PI3	5266	genome.wustl.edu	37	20	43804672	43804672	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr20:43804672G>A	ENST00000243924.3	+	2	297	c.250G>A	c.(250-252)Gcc>Acc	p.A84T		NM_002638.3	NP_002629.1	P19957	ELAF_HUMAN	peptidase inhibitor 3, skin-derived	84	WAP. {ECO:0000255|PROSITE- ProRule:PRU00722}.				copulation (GO:0007620)|negative regulation of endopeptidase activity (GO:0010951)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			large_intestine(1)|lung(5)|skin(1)	7		Myeloproliferative disorder(115;0.0122)				GATCCGGTGCGCCATGTTGAA	0.512																																						dbGAP											0													127.0	111.0	117.0					20																	43804672		2203	4300	6503	-	-	-	SO:0001583	missense	0			D13156	CCDS13344.1	20q13.12	2013-01-21	2008-10-03		ENSG00000124102	ENSG00000124102		"""WAP four-disulfide core domain containing"""	8947	protein-coding gene	gene with protein product	"""skin-derived antileukoproteinase"", ""trappin-2"""	182257	"""protease inhibitor 3, skin-derived (SKALP)"""			8287685, 12206714	Standard	NM_002638		Approved	ESI, SKALP, ELAFIN, WAP3, WFDC14, cementoin	uc002xng.3	P19957	OTTHUMG00000032567	ENST00000243924.3:c.250G>A	20.37:g.43804672G>A	ENSP00000243924:p.Ala84Thr		E1P618|Q6FG74	Missense_Mutation	SNP	pfam_Trappin_transglut-bd_rpt,pfam_Whey_acidic_protein_4-diS_core,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,prints_4-disulphide_core	p.A84T	ENST00000243924.3	37	c.250	CCDS13344.1	20	.	.	.	.	.	.	.	.	.	.	G	7.304	0.613717	0.14066	.	.	ENSG00000124102	ENST00000243924	T	0.72051	-0.62	4.23	0.985	0.19779	Whey acidic protein, 4-disulphide core (5);	0.340802	0.21535	N	0.072998	T	0.51601	0.1684	L	0.60957	1.885	0.09310	N	1	P	0.46457	0.878	B	0.34722	0.188	T	0.46133	-0.9213	10	0.14656	T	0.56	.	2.9748	0.05934	0.1042:0.1768:0.537:0.182	.	84	P19957	ELAF_HUMAN	T	84	ENSP00000243924:A84T	ENSP00000243924:A84T	A	+	1	0	PI3	43238086	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.443000	0.06862	0.115000	0.18071	0.650000	0.86243	GCC	PI3	-	pfam_Whey_acidic_protein_4-diS_core,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core	ENSG00000124102		0.512	PI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PI3	HGNC	protein_coding	OTTHUMT00000079418.3	240	0.00	0	G	NM_002638		43804672	43804672	+1	no_errors	ENST00000243924	ensembl	human	known	69_37n	missense	130	36.89	76	SNP	0.001	A
PLEKHF2	79666	genome.wustl.edu	37	8	96166776	96166776	+	Silent	SNP	T	T	C			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr8:96166776T>C	ENST00000315367.3	+	2	745	c.504T>C	c.(502-504)ccT>ccC	p.P168P	PLEKHF2_ENST00000519516.1_Silent_p.P168P	NM_024613.3	NP_078889.1	Q9H8W4	PKHF2_HUMAN	pleckstrin homology domain containing, family F (with FYVE domain) member 2	168					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|membrane (GO:0016020)|transport vesicle (GO:0030133)	metal ion binding (GO:0046872)			breast(1)|large_intestine(1)|lung(1)|ovary(2)	5	Breast(36;3.18e-05)					AATTCACACCTGTTAATCGTC	0.488																																						dbGAP											0													104.0	99.0	101.0					8																	96166776		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF434819	CCDS6267.1	8q22.1	2013-01-10				ENSG00000175895		"""Zinc fingers, FYVE domain containing"", ""Pleckstrin homology (PH) domain containing"""	20757	protein-coding gene	gene with protein product		615208					Standard	NM_024613		Approved	ZFYVE18, PHAFIN2, FLJ13187	uc003yhn.2	Q9H8W4		ENST00000315367.3:c.504T>C	8.37:g.96166776T>C				Silent	SNP	pfam_Znf_FYVE,pfam_Pleckstrin_homology,superfamily_Znf_FYVE_PHD,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel	p.P168	ENST00000315367.3	37	c.504	CCDS6267.1	8																																																																																			PLEKHF2	-	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	ENSG00000175895		0.488	PLEKHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHF2	HGNC	protein_coding	OTTHUMT00000379666.1	190	0.00	0	T	NM_024613		96166776	96166776	+1	no_errors	ENST00000315367	ensembl	human	known	69_37n	silent	591	14.70	102	SNP	0.996	C
CDH12	1010	genome.wustl.edu	37	5	22142618	22142618	+	Intron	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr5:22142618C>T	ENST00000382254.1	-	5	901				RP11-855C21.1_ENST00000524042.1_RNA|CDH12_ENST00000522262.1_Intron|PMCHL1_ENST00000418902.1_RNA|CDH12_ENST00000504376.2_Intron	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						GATACCGAATCAACACAAGAA	0.378										HNSCC(59;0.17)																												dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.186-63647G>A	5.37:g.22142618C>T			B2RBT1|B7Z2U6|Q86UD2	RNA	SNP	-	NULL	ENST00000382254.1	37	NULL	CCDS3890.1	5																																																																																			PMCHL1	-	-	ENSG00000168967		0.378	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMCHL1	HGNC	protein_coding	OTTHUMT00000207139.1	93	0.00	0	C	NM_004061		22142618	22142618	+1	no_errors	ENST00000418902	ensembl	human	known	69_37n	rna	48	34.25	25	SNP	0.999	T
PXDN	7837	genome.wustl.edu	37	2	1652010	1652010	+	Missense_Mutation	SNP	G	G	A	rs536136666		TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr2:1652010G>A	ENST00000252804.4	-	17	3592	c.3542C>T	c.(3541-3543)gCg>gTg	p.A1181V		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	1181					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CGTGTGTGCCGCCGATAGATT	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		17314	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													123.0	131.0	128.0					2																	1652010		1984	4169	6153	-	-	-	SO:0001583	missense	0			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.3542C>T	2.37:g.1652010G>A	ENSP00000252804:p.Ala1181Val		A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like	p.A1181V	ENST00000252804.4	37	c.3542	CCDS46221.1	2	.	.	.	.	.	.	.	.	.	.	G	7.909	0.736057	0.15574	.	.	ENSG00000130508	ENST00000252804	T	0.68765	-0.35	5.48	5.48	0.80851	.	0.257374	0.40469	N	0.001099	T	0.55081	0.1898	N	0.17838	0.53	0.32377	N	0.555029	B	0.27229	0.172	B	0.29862	0.108	T	0.55835	-0.8078	10	0.19590	T	0.45	-22.493	19.4069	0.94651	0.0:0.0:1.0:0.0	.	1181	Q92626	PXDN_HUMAN	V	1181	ENSP00000252804:A1181V	ENSP00000252804:A1181V	A	-	2	0	PXDN	1631017	1.000000	0.71417	0.008000	0.14137	0.084000	0.17831	9.759000	0.98931	2.588000	0.87417	0.650000	0.86243	GCG	PXDN	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000130508		0.572	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDN	HGNC	protein_coding	OTTHUMT00000322505.1	126	0.79	1	G	XM_056455		1652010	1652010	-1	no_errors	ENST00000252804	ensembl	human	known	69_37n	missense	24	62.50	40	SNP	0.736	A
POTEF	728378	genome.wustl.edu	37	2	130832165	130832165	+	Silent	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr2:130832165C>T	ENST00000409914.2	-	17	3279	c.2880G>A	c.(2878-2880)gcG>gcA	p.A960A	POTEF_ENST00000357462.5_Silent_p.A960A	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	960	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GCTGGAAGAGCGCCTCGGGGC	0.587																																						dbGAP											0													1.0	1.0	1.0					2																	130832165		295	872	1167	-	-	-	SO:0001819	synonymous_variant	0			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2880G>A	2.37:g.130832165C>T			A6NC34	Silent	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,prints_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A960	ENST00000409914.2	37	c.2880	CCDS46409.1	2																																																																																			POTEF	-	pfam_Actin-like,smart_Actin-like	ENSG00000196604		0.587	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2	21	0.00	0	C	NM_001099771		130832165	130832165	-1	no_errors	ENST00000357462	ensembl	human	known	69_37n	silent	21	25.00	7	SNP	1.000	T
QRFP	347148	genome.wustl.edu	37	9	133769047	133769048	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr9:133769047_133769048insCT	ENST00000343079.1	-	1	177_178	c.178_179insAG	c.(178-180)agafs	p.R60fs		NM_198180.1	NP_937823.1			pyroglutamylated RFamide peptide											cervix(1)|endometrium(3)|lung(1)|skin(2)	7	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.17e-05)|Epithelial(140;0.000267)		CTGTGAAGCTCTCAGCCACCGA	0.668																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB109625	CCDS6936.1	9q34.12	2013-02-28			ENSG00000188710	ENSG00000188710		"""Endogenous ligands"""	29982	protein-coding gene	gene with protein product	"""prepro-QRFP"""	609795				12714592, 15808908	Standard	NM_198180		Approved	26RFa, P518	uc011mcb.2	P83859	OTTHUMG00000131663	ENST00000343079.1:c.178_179insAG	9.37:g.133769047_133769048insCT	ENSP00000345487:p.Arg60fs			Frame_Shift_Ins	INS	pfam_P518	p.R60fs	ENST00000343079.1	37	c.179_178	CCDS6936.1	9																																																																																			QRFP	-	pfam_P518	ENSG00000188710		0.668	QRFP-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	QRFP	HGNC	protein_coding	OTTHUMT00000254566.1	27	0.00	0	-	NM_198180		133769047	133769048	-1	no_errors	ENST00000343079	ensembl	human	known	69_37n	frame_shift_ins	15	48.28	14	INS	0.000:0.000	CT
QRFP	347148	genome.wustl.edu	37	9	133769047	133769048	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr9:133769047_133769048insCT	ENST00000343079.1	-	1	177_178	c.178_179insAG	c.(178-180)agafs	p.R60fs		NM_198180.1	NP_937823.1			pyroglutamylated RFamide peptide											cervix(1)|endometrium(3)|lung(1)|skin(2)	7	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.17e-05)|Epithelial(140;0.000267)		CTGTGAAGCTCTCAGCCACCGA	0.668																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB109625	CCDS6936.1	9q34.12	2013-02-28			ENSG00000188710	ENSG00000188710		"""Endogenous ligands"""	29982	protein-coding gene	gene with protein product	"""prepro-QRFP"""	609795				12714592, 15808908	Standard	NM_198180		Approved	26RFa, P518	uc011mcb.2	P83859	OTTHUMG00000131663	ENST00000343079.1:c.178_179insAG	9.37:g.133769047_133769048insCT	ENSP00000345487:p.Arg60fs			Frame_Shift_Ins	INS	pfam_P518	p.R60fs	ENST00000343079.1	37	c.179_178	CCDS6936.1	9																																																																																			QRFP	-	pfam_P518	ENSG00000188710		0.668	QRFP-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	QRFP	HGNC	protein_coding	OTTHUMT00000254566.1	29	0.00	0	-	NM_198180		133769047	133769048	-1	no_errors	ENST00000343079	ensembl	human	known	69_37n	frame_shift_ins	15	48.28	14	INS	0.000:0.000	CT
RCOR2	283248	genome.wustl.edu	37	11	63681584	63681585	+	Frame_Shift_Ins	INS	-	-	CTAT			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr11:63681584_63681585insCTAT	ENST00000301459.4	-	8	1119_1120	c.732_733insATAG	c.(730-735)caggtgfs	p.V245fs	RCOR2_ENST00000473926.2_5'Flank	NM_173587.3	NP_775858.2	Q8IZ40	RCOR2_HUMAN	REST corepressor 2	245					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	17						TACTGAGACACCTGGACCTCCT	0.639																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC010608	CCDS8052.1	11q13.1	2008-02-05			ENSG00000167771	ENSG00000167771			27455	protein-coding gene	gene with protein product						12477932	Standard	NM_173587		Approved		uc001nyc.3	Q8IZ40	OTTHUMG00000150472	ENST00000301459.4:c.732_733insATAG	11.37:g.63681584_63681585insCTAT	ENSP00000301459:p.Val245fs		Q96FP3	Frame_Shift_Ins	INS	pfam_SANT/Myb,pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.V244fs	ENST00000301459.4	37	c.733_732	CCDS8052.1	11																																																																																			RCOR2	-	NULL	ENSG00000167771		0.639	RCOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCOR2	HGNC	protein_coding	OTTHUMT00000318233.1	8	0.00	0	-	NM_173587		63681584	63681585	-1	no_errors	ENST00000301459	ensembl	human	known	69_37n	frame_shift_ins	15	31.82	7	INS	0.846:0.963	CTAT
RCOR2	283248	genome.wustl.edu	37	11	63681584	63681585	+	Frame_Shift_Ins	INS	-	-	CTAT			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr11:63681584_63681585insCTAT	ENST00000301459.4	-	8	1119_1120	c.732_733insATAG	c.(730-735)caggtgfs	p.V245fs	RCOR2_ENST00000473926.2_5'Flank	NM_173587.3	NP_775858.2	Q8IZ40	RCOR2_HUMAN	REST corepressor 2	245					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	17						TACTGAGACACCTGGACCTCCT	0.639																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC010608	CCDS8052.1	11q13.1	2008-02-05			ENSG00000167771	ENSG00000167771			27455	protein-coding gene	gene with protein product						12477932	Standard	NM_173587		Approved		uc001nyc.3	Q8IZ40	OTTHUMG00000150472	ENST00000301459.4:c.732_733insATAG	11.37:g.63681584_63681585insCTAT	ENSP00000301459:p.Val245fs		Q96FP3	Frame_Shift_Ins	INS	pfam_SANT/Myb,pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.V244fs	ENST00000301459.4	37	c.733_732	CCDS8052.1	11																																																																																			RCOR2	-	NULL	ENSG00000167771		0.639	RCOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCOR2	HGNC	protein_coding	OTTHUMT00000318233.1	24	0.00	0	-	NM_173587		63681584	63681585	-1	no_errors	ENST00000301459	ensembl	human	known	69_37n	frame_shift_ins	15	31.82	7	INS	0.846:0.963	CTAT
RTN2	6253	genome.wustl.edu	37	19	45997475	45997475	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr19:45997475delA	ENST00000245923.4	-	4	998	c.763delT	c.(763-765)tgcfs	p.C255fs	RTN2_ENST00000590526.1_5'UTR|RTN2_ENST00000589384.1_5'Flank|PPM1N_ENST00000401705.1_Intron|RTN2_ENST00000430715.2_5'Flank|RTN2_ENST00000344680.4_Frame_Shift_Del_p.C255fs	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	255					cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		CTATCGAGGCACTGTCCCCTT	0.552																																						dbGAP											0													141.0	121.0	128.0					19																	45997475		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.763delT	19.37:g.45997475delA	ENSP00000245923:p.Cys255fs		O60509|Q7RTM6|Q7RTN1|Q7RTN2	Frame_Shift_Del	DEL	pfam_Reticulon,pfscan_Reticulon	p.C255fs	ENST00000245923.4	37	c.763	CCDS12665.1	19																																																																																			RTN2	-	NULL	ENSG00000125744		0.552	RTN2-001	KNOWN	basic|CCDS	protein_coding	RTN2	HGNC	protein_coding	OTTHUMT00000459574.1	57	0.00	0	A	NM_005619		45997475	45997475	-1	no_errors	ENST00000245923	ensembl	human	known	69_37n	frame_shift_del	29	36.17	17	DEL	0.963	-
RTN2	6253	genome.wustl.edu	37	19	45997475	45997475	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr19:45997475delA	ENST00000245923.4	-	4	998	c.763delT	c.(763-765)tgcfs	p.C255fs	RTN2_ENST00000590526.1_5'UTR|RTN2_ENST00000589384.1_5'Flank|PPM1N_ENST00000401705.1_Intron|RTN2_ENST00000430715.2_5'Flank|RTN2_ENST00000344680.4_Frame_Shift_Del_p.C255fs	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	255					cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		CTATCGAGGCACTGTCCCCTT	0.552																																						dbGAP											0													141.0	121.0	128.0					19																	45997475		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.763delT	19.37:g.45997475delA	ENSP00000245923:p.Cys255fs		O60509|Q7RTM6|Q7RTN1|Q7RTN2	Frame_Shift_Del	DEL	pfam_Reticulon,pfscan_Reticulon	p.C255fs	ENST00000245923.4	37	c.763	CCDS12665.1	19																																																																																			RTN2	-	NULL	ENSG00000125744		0.552	RTN2-001	KNOWN	basic|CCDS	protein_coding	RTN2	HGNC	protein_coding	OTTHUMT00000459574.1	54	0.00	0	A	NM_005619		45997475	45997475	-1	no_errors	ENST00000245923	ensembl	human	known	69_37n	frame_shift_del	29	36.17	17	DEL	0.963	-
SEC24B	10427	genome.wustl.edu	37	4	110394171	110394171	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr4:110394171T>G	ENST00000265175.5	+	3	944	c.889T>G	c.(889-891)Tta>Gta	p.L297V	SEC24B_ENST00000504968.2_Missense_Mutation_p.L328V|SEC24B_ENST00000399100.2_Missense_Mutation_p.L297V	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	297					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		TGCAGATTCTTTATCCTGTCC	0.353																																						dbGAP											0													121.0	107.0	111.0					4																	110394171		1830	4092	5922	-	-	-	SO:0001583	missense	0			AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.889T>G	4.37:g.110394171T>G	ENSP00000265175:p.Leu297Val		B7ZKM8|B7ZKN4|Q0VG08	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.L297V	ENST00000265175.5	37	c.889	CCDS47124.1	4	.	.	.	.	.	.	.	.	.	.	T	6.109	0.388439	0.11581	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	T;T;T	0.78595	-0.93;-1.19;-1.11	5.58	0.763	0.18459	.	1.727610	0.02965	N	0.143653	T	0.59609	0.2206	N	0.08118	0	0.19300	N	0.999974	B;B;B;B	0.21606	0.034;0.034;0.058;0.034	B;B;B;B	0.24155	0.023;0.023;0.051;0.023	T	0.49224	-0.8962	10	0.15499	T	0.54	-7.2158	7.9372	0.29937	0.0:0.4386:0.0:0.5614	.	247;328;297;297	B4DTM6;B7ZKM8;O95487-2;O95487	.;.;.;SC24B_HUMAN	V	328;297;297	ENSP00000428564:L328V;ENSP00000382051:L297V;ENSP00000265175:L297V	ENSP00000265175:L297V	L	+	1	2	SEC24B	110613620	0.544000	0.26441	0.040000	0.18447	0.696000	0.40369	0.345000	0.19979	0.419000	0.25927	0.533000	0.62120	TTA	SEC24B	-	NULL	ENSG00000138802		0.353	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24B	HGNC	protein_coding	OTTHUMT00000364693.2	229	0.00	0	T			110394171	110394171	+1	no_errors	ENST00000265175	ensembl	human	known	69_37n	missense	140	21.79	39	SNP	0.697	G
SKIL	6498	genome.wustl.edu	37	3	170078760	170078760	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr3:170078760A>G	ENST00000458537.3	+	1	1350	c.641A>G	c.(640-642)aAt>aGt	p.N214S	SKIL_ENST00000259119.4_Missense_Mutation_p.N214S|SKIL_ENST00000426052.2_Missense_Mutation_p.N194S|SKIL_ENST00000413427.2_Missense_Mutation_p.N214S	NM_001145097.2|NM_001248008.1|NM_005414.4	NP_001138569.1|NP_001234937.1|NP_005405.2	P12757	SKIL_HUMAN	SKI-like proto-oncogene	214					blastocyst formation (GO:0001825)|cell cycle arrest (GO:0007050)|gene expression (GO:0010467)|lens fiber cell differentiation (GO:0070306)|lymphocyte homeostasis (GO:0002260)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of axonogenesis (GO:0050772)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|protein heterotrimerization (GO:0070208)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|response to antibiotic (GO:0046677)|response to cytokine (GO:0034097)|response to growth factor (GO:0070848)|skeletal muscle tissue development (GO:0007519)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	25	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			CTTCCATTCAATGCCCCATCC	0.398																																						dbGAP											0													108.0	99.0	102.0					3																	170078760		2203	4300	6503	-	-	-	SO:0001583	missense	0			X15217	CCDS33890.1, CCDS46953.1, CCDS46954.1	3q26	2014-06-25	2014-06-25		ENSG00000136603	ENSG00000136603		"""SKI transcriptional corepressors"""	10897	protein-coding gene	gene with protein product		165340	"""SKI-like oncogene"""			2762147	Standard	NM_005414		Approved	SNO, SnoN, SnoA	uc003fgw.3	P12757	OTTHUMG00000158831	ENST00000458537.3:c.641A>G	3.37:g.170078760A>G	ENSP00000415243:p.Asn214Ser		A6NGT1|B4DT50|O00464|P12756|Q07501	Missense_Mutation	SNP	pfam_c-SKI_SMAD4-bd_dom,pfam_Transform_Ski,superfamily_SAND_dom-like,superfamily_DNA-bd_dom_put	p.N214S	ENST00000458537.3	37	c.641	CCDS33890.1	3	.	.	.	.	.	.	.	.	.	.	A	2.952	-0.216424	0.06101	.	.	ENSG00000136603	ENST00000259119;ENST00000426052;ENST00000413427;ENST00000458537	D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53	5.51	4.34	0.51931	DNA binding domain, putative (1);Transforming protein Ski (2);	0.133326	0.64402	D	0.000003	T	0.69223	0.3087	N	0.01668	-0.77	0.38179	D	0.939568	D;D	0.89917	0.998;1.0	D;D	0.81914	0.976;0.995	T	0.68221	-0.5466	10	0.02654	T	1	-16.3702	12.7121	0.57096	0.8623:0.1377:0.0:0.0	.	214;214	P12757-3;P12757	.;SKIL_HUMAN	S	214;194;214;214	ENSP00000259119:N214S;ENSP00000406520:N194S;ENSP00000400193:N214S;ENSP00000415243:N214S	ENSP00000259119:N214S	N	+	2	0	SKIL	171561454	1.000000	0.71417	1.000000	0.80357	0.552000	0.35366	4.012000	0.57131	0.917000	0.36895	-0.331000	0.08364	AAT	SKIL	-	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	ENSG00000136603		0.398	SKIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIL	HGNC	protein_coding	OTTHUMT00000352351.4	80	0.00	0	A	NM_005414		170078760	170078760	+1	no_errors	ENST00000259119	ensembl	human	known	69_37n	missense	118	13.24	18	SNP	1.000	G
SLC10A4	201780	genome.wustl.edu	37	4	48490772	48490773	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr4:48490772_48490773delTT	ENST00000273861.4	+	3	1349_1350	c.1130_1131delTT	c.(1129-1131)attfs	p.I377fs	ZAR1_ENST00000327939.4_5'Flank	NM_152679.3	NP_689892.1	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	377						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	6						GAAGCGGGGATTTTTGTTTTAA	0.366																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC012048	CCDS3482.1	4p12	2013-07-18	2013-07-18		ENSG00000145248	ENSG00000145248		"""Solute carriers"""	22980	protein-coding gene	gene with protein product							Standard	NM_152679		Approved	MGC29802	uc003gyc.2	Q96EP9	OTTHUMG00000102092	ENST00000273861.4:c.1130_1131delTT	4.37:g.48490774_48490775delTT	ENSP00000273861:p.Ile377fs		Q8WUZ2	Frame_Shift_Del	DEL	pfam_BilAc/Na_symport	p.F378fs	ENST00000273861.4	37	c.1130_1131	CCDS3482.1	4																																																																																			SLC10A4	-	NULL	ENSG00000145248		0.366	SLC10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A4	HGNC	protein_coding	OTTHUMT00000219926.3	37	0.00	0	TT	NM_152679		48490772	48490773	+1	no_errors	ENST00000273861	ensembl	human	known	69_37n	frame_shift_del	45	37.50	27	DEL	0.635:0.497	-
SLC10A4	201780	genome.wustl.edu	37	4	48490772	48490773	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr4:48490772_48490773delTT	ENST00000273861.4	+	3	1349_1350	c.1130_1131delTT	c.(1129-1131)attfs	p.I377fs	ZAR1_ENST00000327939.4_5'Flank	NM_152679.3	NP_689892.1	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	377						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	6						GAAGCGGGGATTTTTGTTTTAA	0.366																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC012048	CCDS3482.1	4p12	2013-07-18	2013-07-18		ENSG00000145248	ENSG00000145248		"""Solute carriers"""	22980	protein-coding gene	gene with protein product							Standard	NM_152679		Approved	MGC29802	uc003gyc.2	Q96EP9	OTTHUMG00000102092	ENST00000273861.4:c.1130_1131delTT	4.37:g.48490774_48490775delTT	ENSP00000273861:p.Ile377fs		Q8WUZ2	Frame_Shift_Del	DEL	pfam_BilAc/Na_symport	p.F378fs	ENST00000273861.4	37	c.1130_1131	CCDS3482.1	4																																																																																			SLC10A4	-	NULL	ENSG00000145248		0.366	SLC10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A4	HGNC	protein_coding	OTTHUMT00000219926.3	37	0.00	0	TT	NM_152679		48490772	48490773	+1	no_errors	ENST00000273861	ensembl	human	known	69_37n	frame_shift_del	45	37.50	27	DEL	0.635:0.497	-
SLC10A4	201780	genome.wustl.edu	37	4	48490777	48490778	+	In_Frame_Ins	INS	-	-	ACA			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr4:48490777_48490778insACA	ENST00000273861.4	+	3	1354_1355	c.1135_1136insACA	c.(1135-1137)gtt>gACAtt	p.379_379V>DI	ZAR1_ENST00000327939.4_5'Flank	NM_152679.3	NP_689892.1	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	379						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	6						GGGGATTTTTGTTTTAATCTAT	0.366																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			BC012048	CCDS3482.1	4p12	2013-07-18	2013-07-18		ENSG00000145248	ENSG00000145248		"""Solute carriers"""	22980	protein-coding gene	gene with protein product							Standard	NM_152679		Approved	MGC29802	uc003gyc.2	Q96EP9	OTTHUMG00000102092	Exception_encountered	4.37:g.48490777_48490778insACA	ENSP00000273861:p.Val379delinsAspIle		Q8WUZ2	In_Frame_Ins	INS	pfam_BilAc/Na_symport	p.V379in_frame_insDI	ENST00000273861.4	37	c.1135_1136	CCDS3482.1	4																																																																																			SLC10A4	-	NULL	ENSG00000145248		0.366	SLC10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A4	HGNC	protein_coding	OTTHUMT00000219926.3	38	0.00	0	-	NM_152679		48490777	48490778	+1	no_errors	ENST00000273861	ensembl	human	known	69_37n	in_frame_ins	35	43.55	27	INS	1.000:1.000	ACA
SLC10A4	201780	genome.wustl.edu	37	4	48490777	48490778	+	In_Frame_Ins	INS	-	-	ACA			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr4:48490777_48490778insACA	ENST00000273861.4	+	3	1354_1355	c.1135_1136insACA	c.(1135-1137)gtt>gACAtt	p.379_379V>DI	ZAR1_ENST00000327939.4_5'Flank	NM_152679.3	NP_689892.1	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	379						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	6						GGGGATTTTTGTTTTAATCTAT	0.366																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			BC012048	CCDS3482.1	4p12	2013-07-18	2013-07-18		ENSG00000145248	ENSG00000145248		"""Solute carriers"""	22980	protein-coding gene	gene with protein product							Standard	NM_152679		Approved	MGC29802	uc003gyc.2	Q96EP9	OTTHUMG00000102092	Exception_encountered	4.37:g.48490777_48490778insACA	ENSP00000273861:p.Val379delinsAspIle		Q8WUZ2	In_Frame_Ins	INS	pfam_BilAc/Na_symport	p.V379in_frame_insDI	ENST00000273861.4	37	c.1135_1136	CCDS3482.1	4																																																																																			SLC10A4	-	NULL	ENSG00000145248		0.366	SLC10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A4	HGNC	protein_coding	OTTHUMT00000219926.3	38	0.00	0	-	NM_152679		48490777	48490778	+1	no_errors	ENST00000273861	ensembl	human	known	69_37n	in_frame_ins	35	43.55	27	INS	1.000:1.000	ACA
SPR	6697	genome.wustl.edu	37	2	73118645	73118645	+	Silent	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr2:73118645C>T	ENST00000234454.5	+	3	838	c.765C>T	c.(763-765)caC>caT	p.H255H	SPR_ENST00000498749.1_3'UTR	NM_003124.4	NP_003115.1	P35270	SPRE_HUMAN	sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)	255					cell morphogenesis involved in neuron differentiation (GO:0048667)|death (GO:0016265)|dopamine metabolic process (GO:0042417)|L-phenylalanine metabolic process (GO:0006558)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|norepinephrine metabolic process (GO:0042415)|oxidation-reduction process (GO:0055114)|pteridine metabolic process (GO:0019889)|regulation of multicellular organism growth (GO:0040014)|regulation of nitric-oxide synthase activity (GO:0050999)|serotonin metabolic process (GO:0042428)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldo-keto reductase (NADP) activity (GO:0004033)|NADP binding (GO:0050661)|sepiapterin reductase activity (GO:0004757)	p.H255H(1)		lung(4)|ovary(2)	6						CTGGAGCCCACGTGGACTTCT	0.527																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											83.0	76.0	78.0					2																	73118645		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1920.1	2p14-p12	2013-06-03			ENSG00000116096	ENSG00000116096	1.1.1.153	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	11257	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 38C, member 1"""	182125				1883349, 19027726	Standard	NM_003124		Approved	SDR38C1	uc002sik.2	P35270	OTTHUMG00000129777	ENST00000234454.5:c.765C>T	2.37:g.73118645C>T			A8K741|D6W5H2|Q53GI9|Q9UBB1	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,tigrfam_Sepiapterin_red	p.H255	ENST00000234454.5	37	c.765	CCDS1920.1	2																																																																																			SPR	-	tigrfam_Sepiapterin_red	ENSG00000116096		0.527	SPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPR	HGNC	protein_coding	OTTHUMT00000251993.2	47	0.00	0	C			73118645	73118645	+1	no_errors	ENST00000234454	ensembl	human	known	69_37n	silent	69	21.59	19	SNP	0.713	T
SPR	6697	genome.wustl.edu	37	2	73118645	73118645	+	Silent	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr2:73118645C>T	ENST00000234454.5	+	3	838	c.765C>T	c.(763-765)caC>caT	p.H255H	SPR_ENST00000498749.1_3'UTR	NM_003124.4	NP_003115.1	P35270	SPRE_HUMAN	sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)	255					cell morphogenesis involved in neuron differentiation (GO:0048667)|death (GO:0016265)|dopamine metabolic process (GO:0042417)|L-phenylalanine metabolic process (GO:0006558)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|norepinephrine metabolic process (GO:0042415)|oxidation-reduction process (GO:0055114)|pteridine metabolic process (GO:0019889)|regulation of multicellular organism growth (GO:0040014)|regulation of nitric-oxide synthase activity (GO:0050999)|serotonin metabolic process (GO:0042428)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldo-keto reductase (NADP) activity (GO:0004033)|NADP binding (GO:0050661)|sepiapterin reductase activity (GO:0004757)	p.H255H(1)		lung(4)|ovary(2)	6						CTGGAGCCCACGTGGACTTCT	0.527																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											83.0	76.0	78.0					2																	73118645		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1920.1	2p14-p12	2013-06-03			ENSG00000116096	ENSG00000116096	1.1.1.153	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	11257	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 38C, member 1"""	182125				1883349, 19027726	Standard	NM_003124		Approved	SDR38C1	uc002sik.2	P35270	OTTHUMG00000129777	ENST00000234454.5:c.765C>T	2.37:g.73118645C>T			A8K741|D6W5H2|Q53GI9|Q9UBB1	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,tigrfam_Sepiapterin_red	p.H255	ENST00000234454.5	37	c.765	CCDS1920.1	2																																																																																			SPR	-	tigrfam_Sepiapterin_red	ENSG00000116096		0.527	SPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPR	HGNC	protein_coding	OTTHUMT00000251993.2	80	0.00	0	C			73118645	73118645	+1	no_errors	ENST00000234454	ensembl	human	known	69_37n	silent	69	21.59	19	SNP	0.713	T
SPAG16	79582	genome.wustl.edu	37	2	214215282	214215282	+	Silent	SNP	G	G	A	rs201827442	byFrequency	TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr2:214215282G>A	ENST00000331683.5	+	7	770	c.675G>A	c.(673-675)ccG>ccA	p.P225P	SPAG16_ENST00000414961.2_Intron|SPAG16_ENST00000447990.1_Silent_p.P225P|SPAG16_ENST00000374309.3_Silent_p.P131P|SPAG16_ENST00000272898.7_Silent_p.P225P|SPAG16_ENST00000413312.1_Silent_p.P194P	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	225					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		CTTATGAACCGACTATAAGGG	0.348													G|||	2	0.000399361	0.0	0.0	5008	,	,		16684	0.001		0.0	False		,,,				2504	0.001					dbGAP											0													91.0	87.0	88.0					2																	214215282		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.675G>A	2.37:g.214215282G>A			Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.P225	ENST00000331683.5	37	c.675	CCDS2396.1	2																																																																																			SPAG16	-	NULL	ENSG00000144451		0.348	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG16	HGNC	protein_coding	OTTHUMT00000256601.2	297	0.00	0	G	NM_024532		214215282	214215282	+1	no_errors	ENST00000331683	ensembl	human	known	69_37n	silent	227	26.92	84	SNP	1.000	A
TBC1D3P5	440419	genome.wustl.edu	37	17	25749251	25749251	+	RNA	SNP	A	A	G			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr17:25749251A>G	ENST00000586223.1	+	0	1152					NR_033892.1				TBC1 domain family, member 3 pseudogene 5																		GGAAATCAAGATGAAAAATCC	0.498																																						dbGAP											0																																										-	-	-			0					17q11.1	2014-03-20			ENSG00000266433	ENSG00000266433			43567	pseudogene	pseudogene							Standard	NR_033892		Approved		uc002gzg.3		OTTHUMG00000179156		17.37:g.25749251A>G				RNA	SNP	-	NULL	ENST00000586223.1	37	NULL		17																																																																																			TBC1D3P5	-	-	ENSG00000266433		0.498	TBC1D3P5-003	KNOWN	non_canonical_TEC|basic	processed_transcript	TBC1D3P5	HGNC	pseudogene	OTTHUMT00000451073.1	27	0.00	0	A	NR_033892		25749251	25749251	+1	no_errors	ENST00000586223	ensembl	human	known	69_37n	rna	6	50.00	6	SNP	0.142	G
TBC1D3P5	440419	genome.wustl.edu	37	17	25749251	25749251	+	RNA	SNP	A	A	G			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr17:25749251A>G	ENST00000586223.1	+	0	1152					NR_033892.1				TBC1 domain family, member 3 pseudogene 5																		GGAAATCAAGATGAAAAATCC	0.498																																						dbGAP											0																																										-	-	-			0					17q11.1	2014-03-20			ENSG00000266433	ENSG00000266433			43567	pseudogene	pseudogene							Standard	NR_033892		Approved		uc002gzg.3		OTTHUMG00000179156		17.37:g.25749251A>G				RNA	SNP	-	NULL	ENST00000586223.1	37	NULL		17																																																																																			TBC1D3P5	-	-	ENSG00000266433		0.498	TBC1D3P5-003	KNOWN	non_canonical_TEC|basic	processed_transcript	TBC1D3P5	HGNC	pseudogene	OTTHUMT00000451073.1	16	0.00	0	A	NR_033892		25749251	25749251	+1	no_errors	ENST00000586223	ensembl	human	known	69_37n	rna	6	50.00	6	SNP	0.142	G
TBP	6908	genome.wustl.edu	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000540980.1_Silent_p.Q56Q|TBP_ENST00000230354.6_Silent_p.Q76Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																						dbGAP											4	Substitution - coding silent(4)	lung(3)|prostate(1)											14.0	19.0	17.0					6																	170871052		1952	3842	5794	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A			B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q76	ENST00000392092.2	37	c.228	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	34	0.00	0	G	NM_003194		170871052	170871052	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	35	18.60	8	SNP	0.994	A
THUMPD2	80745	genome.wustl.edu	37	2	39983082	39983082	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr2:39983082C>T	ENST00000505747.1	-	7	937	c.910G>A	c.(910-912)Gat>Aat	p.D304N	THUMPD2_ENST00000260619.6_Missense_Mutation_p.D274N	NM_025264.4	NP_079540.2	Q9BTF0	THUM2_HUMAN	THUMP domain containing 2	304							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	17		all_hematologic(82;0.248)				CACATTGGATCTAAAACAAAT	0.333																																						dbGAP											0													70.0	74.0	73.0					2																	39983082		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF380576	CCDS1805.1, CCDS1805.2	2p22.2	2004-06-04	2004-06-04	2004-06-04	ENSG00000138050	ENSG00000138050			14890	protein-coding gene	gene with protein product		611751	"""chromosome 2 open reading frame 8"""	C2orf8		12063391	Standard	NM_025264		Approved	MGC2454	uc002rru.2	Q9BTF0	OTTHUMG00000102149	ENST00000505747.1:c.910G>A	2.37:g.39983082C>T	ENSP00000423933:p.Asp304Asn		A8K7I7|Q53TT8|Q53TV0	Missense_Mutation	SNP	pfam_RNA_methylase_dom,pfam_Methyltransf_11,pfam_THUMP,pfam_Small_mtfrase_dom,pfam_UbiE/COQ5_MeTrFase,smart_THUMP,pfscan_THUMP	p.D304N	ENST00000505747.1	37	c.910	CCDS1805.2	2	.	.	.	.	.	.	.	.	.	.	C	25.0	4.593481	0.86953	.	.	ENSG00000138050	ENST00000505747;ENST00000260619	T;T	0.59224	0.28;0.28	5.74	5.74	0.90152	Putative RNA methylase (1);	0.000000	0.85682	D	0.000000	T	0.79799	0.4508	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82651	-0.0352	9	.	.	.	.	15.4198	0.75003	0.0:1.0:0.0:0.0	.	195;304	B4DP37;Q9BTF0	.;THUM2_HUMAN	N	304;274	ENSP00000423933:D304N;ENSP00000260619:D274N	.	D	-	1	0	THUMPD2	39836586	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.907000	0.63300	2.702000	0.92279	0.655000	0.94253	GAT	THUMPD2	-	pfam_RNA_methylase_dom,pfam_Methyltransf_11,pfam_Small_mtfrase_dom,pfam_UbiE/COQ5_MeTrFase	ENSG00000138050		0.333	THUMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THUMPD2	HGNC	protein_coding	OTTHUMT00000219991.2	109	0.00	0	C	NM_025264		39983082	39983082	-1	no_errors	ENST00000505747	ensembl	human	known	69_37n	missense	81	15.62	15	SNP	1.000	T
TNS1	7145	genome.wustl.edu	37	2	218696257	218696258	+	Frame_Shift_Ins	INS	-	-	G	rs545831386		TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr2:218696257_218696258insG	ENST00000171887.4	-	20	3370_3371	c.2918_2919insC	c.(2917-2919)ccgfs	p.P973fs	TNS1_ENST00000419504.1_Frame_Shift_Ins_p.P973fs|TNS1_ENST00000430930.1_Frame_Shift_Ins_p.P973fs	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	973					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TGGCCAGACCCGGGGGGGACCG	0.634																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.2919dupC	2.37:g.218696264_218696264dupG	ENSP00000171887:p.Pro973fs		Q4ZG71|Q6IPI5	Frame_Shift_Ins	INS	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.L975fs	ENST00000171887.4	37	c.2919_2918	CCDS2407.1	2																																																																																			TNS1	-	NULL	ENSG00000079308		0.634	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNS1	HGNC	protein_coding	OTTHUMT00000256672.2	16	0.00	0	-	NM_022648		218696257	218696258	-1	no_errors	ENST00000171887	ensembl	human	known	69_37n	frame_shift_ins	11	15.38	2	INS	0.910:1.000	G
TP53	7157	genome.wustl.edu	37	17	7577547	7577547	+	Missense_Mutation	SNP	C	C	T	rs121912656|rs397516437		TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr17:7577547C>T	ENST00000269305.4	-	7	923	c.734G>A	c.(733-735)gGc>gAc	p.G245D	TP53_ENST00000359597.4_Missense_Mutation_p.G245D|TP53_ENST00000455263.2_Missense_Mutation_p.G245D|TP53_ENST00000420246.2_Missense_Mutation_p.G245D|TP53_ENST00000413465.2_Missense_Mutation_p.G245D|TP53_ENST00000445888.2_Missense_Mutation_p.G245D|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245D(104)|p.G245V(66)|p.G245A(8)|p.0?(8)|p.?(5)|p.G152V(4)|p.G244_M246>V(3)|p.G152D(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.G245fs*2(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.C238_M246delCNSSCMGGM(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGTTCATGCCGCCCATGCA	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	219	Substitution - Missense(191)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)	large_intestine(37)|lung(32)|oesophagus(23)|breast(22)|ovary(18)|upper_aerodigestive_tract(16)|haematopoietic_and_lymphoid_tissue(15)|liver(9)|prostate(7)|stomach(6)|central_nervous_system(6)|skin(6)|biliary_tract(5)|urinary_tract(5)|bone(5)|pancreas(4)|cervix(1)|vulva(1)|endometrium(1)	GRCh37	CM010464|CM900209	TP53	M	rs121912656						151.0	113.0	126.0					17																	7577547		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.734G>A	17.37:g.7577547C>T	ENSP00000269305:p.Gly245Asp		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.G245D	ENST00000269305.4	37	c.734	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838149	0.91117	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91920	3.255	0.80722	A	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;1.0;1.0	D	0.96045	0.9027	9	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	.	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	D	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245D;ENSP00000352610:G245D;ENSP00000269305:G245D;ENSP00000398846:G245D;ENSP00000391127:G245D;ENSP00000391478:G245D;ENSP00000425104:G113D;ENSP00000423862:G152D	ENSP00000269305:G245D	G	-	2	0	TP53	7518272	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	97	0.00	0	C	NM_000546		7577547	7577547	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	22	63.93	39	SNP	1.000	T
TPSAB1	7177	genome.wustl.edu	37	16	1291454	1291454	+	Missense_Mutation	SNP	G	G	A	rs201351744		TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr16:1291454G>A	ENST00000338844.3	+	4	286	c.253G>A	c.(253-255)Gcc>Acc	p.A85T	TPSAB1_ENST00000461509.2_Missense_Mutation_p.A92T	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	85	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		A -> T (in dbSNP:rs1141968). {ECO:0000269|PubMed:10898108, ECO:0000269|PubMed:2677049, ECO:0000269|Ref.5}.		defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				GGATCTGGCCGCCCTCAGGGT	0.667																																						dbGAP											0													6.0	7.0	7.0					16																	1291454		2030	4042	6072	-	-	-	SO:0001583	missense	0			M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.253G>A	16.37:g.1291454G>A	ENSP00000343577:p.Ala85Thr		D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.A85T	ENST00000338844.3	37	c.253	CCDS10431.1	16	.	.	.	.	.	.	.	.	.	.	g	1.250	-0.618741	0.03663	.	.	ENSG00000172236	ENST00000338844;ENST00000461509	D;D	0.88975	-2.45;-2.45	2.93	-5.57	0.02521	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	2.192380	0.02106	N	0.054344	T	0.64204	0.2577	N	0.01146	-0.985	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.63475	-0.6629	10	0.12766	T	0.61	.	1.3572	0.02184	0.1257:0.3104:0.2064:0.3575	.	85	Q15661	TRYB1_HUMAN	T	85;92	ENSP00000343577:A85T;ENSP00000418247:A92T	ENSP00000343577:A85T	A	+	1	0	TPSAB1	1231455	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	-1.166000	0.03129	-0.748000	0.04753	-0.346000	0.07831	GCC	TPSAB1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000172236		0.667	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TPSAB1	HGNC	protein_coding	OTTHUMT00000206914.1	10	0.00	0	G	NM_003294		1291454	1291454	+1	no_errors	ENST00000562675	ensembl	human	known	69_37n	missense	1	75.00	3	SNP	0.000	A
TRAIP	10293	genome.wustl.edu	37	3	49878478	49878478	+	Silent	SNP	C	C	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr3:49878478C>A	ENST00000331456.2	-	8	758	c.645G>T	c.(643-645)cgG>cgT	p.R215R	TRAIP_ENST00000469027.1_Intron|TRAIP_ENST00000473863.1_5'Flank	NM_005879.2	NP_005870.2	Q9BWF2	TRAIP_HUMAN	TRAF interacting protein	215	Interaction with CYLD.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|receptor signaling protein activity (GO:0005057)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CTGAGGCCTTCCGTGCCTCTT	0.498											OREG0015575	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													175.0	165.0	168.0					3																	49878478		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC019283	CCDS2806.1	3p21.31	2013-01-09			ENSG00000183763	ENSG00000183763		"""RING-type (C3HC4) zinc fingers"""	30764	protein-coding gene	gene with protein product	"""ring finger protein 206"""	605958				9104814	Standard	NM_005879		Approved	TRIP, RNF206	uc003cxs.1	Q9BWF2	OTTHUMG00000158269	ENST00000331456.2:c.645G>T	3.37:g.49878478C>A		965	B5BU84|B5BUL3|O00467	Silent	SNP	pfam_Znf_C3HC4_RING-type,superfamily_Prefoldin,smart_Znf_RING,pfscan_Znf_RING	p.R215	ENST00000331456.2	37	c.645	CCDS2806.1	3																																																																																			TRAIP	-	superfamily_Prefoldin	ENSG00000183763		0.498	TRAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAIP	HGNC	protein_coding	OTTHUMT00000350518.1	175	0.00	0	C	NM_005879		49878478	49878478	-1	no_errors	ENST00000331456	ensembl	human	known	69_37n	silent	39	60.61	60	SNP	1.000	A
USP34	9736	genome.wustl.edu	37	2	61417673	61417673	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr2:61417673T>C	ENST00000398571.2	-	77	9785	c.9709A>G	c.(9709-9711)Atg>Gtg	p.M3237V	AHSA2_ENST00000394457.3_3'UTR	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	3237					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			AAATGTGTCATGAACGTGTAG	0.338																																						dbGAP											0													78.0	78.0	78.0					2																	61417673		1843	4085	5928	-	-	-	SO:0001583	missense	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.9709A>G	2.37:g.61417673T>C	ENSP00000381577:p.Met3237Val		A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.M3237V	ENST00000398571.2	37	c.9709	CCDS42686.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.05|14.05	2.418743|2.418743	0.42918|0.42918	.|.	.|.	ENSG00000115464|ENSG00000115464	ENST00000411912|ENST00000263989;ENST00000398569;ENST00000398571;ENST00000436269	.|T	.|0.64803	.|-0.12	5.87|5.87	4.59|4.59	0.56863|0.56863	.|.	.|0.046256	.|0.85682	.|D	.|0.000000	T|T	0.37128|0.37128	0.0992|0.0992	N|N	0.08118|0.08118	0|0	0.31267|0.31267	N|N	0.692201|0.692201	.|B	.|0.02656	.|0.0	.|B	.|0.08055	.|0.003	T|T	0.29274|0.29274	-1.0017|-1.0017	5|10	.|0.46703	.|T	.|0.11	.|.	5.772|5.772	0.18259|0.18259	0.3596:0.0:0.1164:0.524|0.3596:0.0:0.1164:0.524	.|.	.|3237	.|Q70CQ2	.|UBP34_HUMAN	R|V	913|3085;3002;3237;115	.|ENSP00000381577:M3237V	.|ENSP00000263989:M3085V	H|M	-|-	2|1	0|0	USP34|USP34	61271177|61271177	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.096000|3.096000	0.50243|0.50243	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	CAT|ATG	USP34	-	NULL	ENSG00000115464		0.338	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	98	0.00	0	T			61417673	61417673	-1	no_errors	ENST00000398571	ensembl	human	known	69_37n	missense	80	16.67	16	SNP	1.000	C
XPNPEP3	63929	genome.wustl.edu	37	22	41265020	41265020	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr22:41265020C>T	ENST00000357137.4	+	2	166	c.82C>T	c.(82-84)Cag>Tag	p.Q28*	XPNPEP3_ENST00000544094.1_Nonsense_Mutation_p.Q5*|XPNPEP3_ENST00000414396.1_Nonsense_Mutation_p.Q28*|XPNPEP3_ENST00000541156.1_Nonsense_Mutation_p.Q28*	NM_022098.3	NP_071381.1	Q9NQH7	XPP3_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 3, putative	28					glomerular filtration (GO:0003094)|protein processing (GO:0016485)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metallopeptidase activity (GO:0008237)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	17						GTTGTGTTCACAGCGAAGGTA	0.438																																					Ovarian(145;306 1841 7037 21878 30110)	dbGAP											0													179.0	164.0	169.0					22																	41265020		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS14007.1, CCDS74869.1	22q13.2	2010-07-20			ENSG00000196236	ENSG00000196236			28052	protein-coding gene	gene with protein product		613553				15708373, 20179356	Standard	NM_022098		Approved	APP3, NPHPL1	uc003azh.3	Q9NQH7	OTTHUMG00000151312	ENST00000357137.4:c.82C>T	22.37:g.41265020C>T	ENSP00000349658:p.Gln28*		B2R9G1|B7Z790|B7Z7B2|Q6I9V9|Q8NDA6|Q9BV27|Q9BVH0	Nonsense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Aminopep_P_N,superfamily_Pept_M24_structural-domain	p.Q28*	ENST00000357137.4	37	c.82	CCDS14007.1	22	.	.	.	.	.	.	.	.	.	.	C	17.14	3.312375	0.60414	.	.	ENSG00000196236	ENST00000541156;ENST00000414396;ENST00000357137;ENST00000544094	.	.	.	5.43	5.43	0.79202	.	0.487694	0.22915	N	0.054093	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	11.4954	0.50404	0.0:0.9163:0.0:0.0837	.	.	.	.	X	28;28;28;5	.	ENSP00000349658:Q28X	Q	+	1	0	XPNPEP3	39594966	0.868000	0.29978	0.740000	0.30986	0.581000	0.36288	1.646000	0.37249	2.545000	0.85829	0.561000	0.74099	CAG	XPNPEP3	-	NULL	ENSG00000196236		0.438	XPNPEP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP3	HGNC	protein_coding	OTTHUMT00000322201.2	269	0.00	0	C	NM_022098		41265020	41265020	+1	no_errors	ENST00000357137	ensembl	human	known	69_37n	nonsense	211	14.57	36	SNP	0.537	T
XPNPEP3	63929	genome.wustl.edu	37	22	41265020	41265020	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr22:41265020C>T	ENST00000357137.4	+	2	166	c.82C>T	c.(82-84)Cag>Tag	p.Q28*	XPNPEP3_ENST00000544094.1_Nonsense_Mutation_p.Q5*|XPNPEP3_ENST00000414396.1_Nonsense_Mutation_p.Q28*|XPNPEP3_ENST00000541156.1_Nonsense_Mutation_p.Q28*	NM_022098.3	NP_071381.1	Q9NQH7	XPP3_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 3, putative	28					glomerular filtration (GO:0003094)|protein processing (GO:0016485)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metallopeptidase activity (GO:0008237)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	17						GTTGTGTTCACAGCGAAGGTA	0.438																																					Ovarian(145;306 1841 7037 21878 30110)	dbGAP											0													179.0	164.0	169.0					22																	41265020		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS14007.1, CCDS74869.1	22q13.2	2010-07-20			ENSG00000196236	ENSG00000196236			28052	protein-coding gene	gene with protein product		613553				15708373, 20179356	Standard	NM_022098		Approved	APP3, NPHPL1	uc003azh.3	Q9NQH7	OTTHUMG00000151312	ENST00000357137.4:c.82C>T	22.37:g.41265020C>T	ENSP00000349658:p.Gln28*		B2R9G1|B7Z790|B7Z7B2|Q6I9V9|Q8NDA6|Q9BV27|Q9BVH0	Nonsense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Aminopep_P_N,superfamily_Pept_M24_structural-domain	p.Q28*	ENST00000357137.4	37	c.82	CCDS14007.1	22	.	.	.	.	.	.	.	.	.	.	C	17.14	3.312375	0.60414	.	.	ENSG00000196236	ENST00000541156;ENST00000414396;ENST00000357137;ENST00000544094	.	.	.	5.43	5.43	0.79202	.	0.487694	0.22915	N	0.054093	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	11.4954	0.50404	0.0:0.9163:0.0:0.0837	.	.	.	.	X	28;28;28;5	.	ENSP00000349658:Q28X	Q	+	1	0	XPNPEP3	39594966	0.868000	0.29978	0.740000	0.30986	0.581000	0.36288	1.646000	0.37249	2.545000	0.85829	0.561000	0.74099	CAG	XPNPEP3	-	NULL	ENSG00000196236		0.438	XPNPEP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP3	HGNC	protein_coding	OTTHUMT00000322201.2	221	0.00	0	C	NM_022098		41265020	41265020	+1	no_errors	ENST00000357137	ensembl	human	known	69_37n	nonsense	211	14.57	36	SNP	0.537	T
ZNF513	130557	genome.wustl.edu	37	2	27600657	27600657	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr2:27600657G>A	ENST00000323703.6	-	4	1579	c.1381C>T	c.(1381-1383)Cgt>Tgt	p.R461C	ZNF513_ENST00000491924.1_5'UTR|ZNF513_ENST00000407879.1_Missense_Mutation_p.R399C	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	461					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCATGTGACGTTTGAGGTTC	0.572																																						dbGAP											0													176.0	171.0	173.0					2																	27600657		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.1381C>T	2.37:g.27600657G>A	ENSP00000318373:p.Arg461Cys		A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R461C	ENST00000323703.6	37	c.1381	CCDS1751.1	2	.	.	.	.	.	.	.	.	.	.	G	12.01	1.809478	0.31961	.	.	ENSG00000163795	ENST00000323703;ENST00000407879	T;T	0.26660	1.72;1.72	5.13	5.13	0.70059	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.148904	0.32687	N	0.005770	T	0.52289	0.1725	M	0.75150	2.29	0.51012	D	0.999901	D	0.89917	1.0	D	0.87578	0.998	T	0.50750	-0.8791	10	0.48119	T	0.1	-14.1951	17.2919	0.87159	0.0:0.0:1.0:0.0	.	461	Q8N8E2	ZN513_HUMAN	C	461;399	ENSP00000318373:R461C;ENSP00000384874:R399C	ENSP00000318373:R461C	R	-	1	0	ZNF513	27454161	1.000000	0.71417	1.000000	0.80357	0.144000	0.21451	5.250000	0.65432	2.667000	0.90743	0.655000	0.94253	CGT	ZNF513	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000163795		0.572	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF513	HGNC	protein_coding	OTTHUMT00000215026.2	73	0.00	0	G	NM_144631		27600657	27600657	-1	no_errors	ENST00000323703	ensembl	human	known	69_37n	missense	70	11.39	9	SNP	1.000	A
ZNF513	130557	genome.wustl.edu	37	2	27600657	27600657	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	bd560d56-fd13-4213-8e29-2a99fee0a055	g.chr2:27600657G>A	ENST00000323703.6	-	4	1579	c.1381C>T	c.(1381-1383)Cgt>Tgt	p.R461C	ZNF513_ENST00000491924.1_5'UTR|ZNF513_ENST00000407879.1_Missense_Mutation_p.R399C	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	461					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCATGTGACGTTTGAGGTTC	0.572																																						dbGAP											0													176.0	171.0	173.0					2																	27600657		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.1381C>T	2.37:g.27600657G>A	ENSP00000318373:p.Arg461Cys		A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R461C	ENST00000323703.6	37	c.1381	CCDS1751.1	2	.	.	.	.	.	.	.	.	.	.	G	12.01	1.809478	0.31961	.	.	ENSG00000163795	ENST00000323703;ENST00000407879	T;T	0.26660	1.72;1.72	5.13	5.13	0.70059	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.148904	0.32687	N	0.005770	T	0.52289	0.1725	M	0.75150	2.29	0.51012	D	0.999901	D	0.89917	1.0	D	0.87578	0.998	T	0.50750	-0.8791	10	0.48119	T	0.1	-14.1951	17.2919	0.87159	0.0:0.0:1.0:0.0	.	461	Q8N8E2	ZN513_HUMAN	C	461;399	ENSP00000318373:R461C;ENSP00000384874:R399C	ENSP00000318373:R461C	R	-	1	0	ZNF513	27454161	1.000000	0.71417	1.000000	0.80357	0.144000	0.21451	5.250000	0.65432	2.667000	0.90743	0.655000	0.94253	CGT	ZNF513	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000163795		0.572	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF513	HGNC	protein_coding	OTTHUMT00000215026.2	52	0.00	0	G	NM_144631		27600657	27600657	-1	no_errors	ENST00000323703	ensembl	human	known	69_37n	missense	70	11.39	9	SNP	1.000	A
ZNF536	9745	genome.wustl.edu	37	19	31038893	31038893	+	Silent	SNP	G	G	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr19:31038893G>A	ENST00000355537.3	+	4	2514	c.2367G>A	c.(2365-2367)acG>acA	p.T789T		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	789					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.T789T(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					ATGCCGGCACGCAGTCAGCAT	0.507																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											66.0	70.0	69.0					19																	31038893		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2367G>A	19.37:g.31038893G>A			A2RU18	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T789	ENST00000355537.3	37	c.2367	CCDS32984.1	19																																																																																			ZNF536	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198597		0.507	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	142	0.70	1	G	NM_014717		31038893	31038893	+1	no_errors	ENST00000355537	ensembl	human	known	69_37n	silent	69	42.02	50	SNP	0.999	A
ZNF646	9726	genome.wustl.edu	37	16	31088893	31088894	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BH-A0H7-01A-13W-A071-09	TCGA-BH-A0H7-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8623830e-3fdd-4707-83e9-5f528105aa55	51420539-3e3b-4b35-8041-3ec47b0adeea	g.chr16:31088893_31088894insA	ENST00000394979.2	+	1	1671_1672	c.1248_1249insA	c.(1249-1251)aaafs	p.K417fs	ZNF646_ENST00000300850.5_Frame_Shift_Ins_p.K417fs			O15015	ZN646_HUMAN	zinc finger protein 646	417					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CGGCTGCCCTCAAAAACCATGT	0.589																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.1253dupA	16.37:g.31088898_31088898dupA	ENSP00000378429:p.Lys417fs		Q8IVD8	Frame_Shift_Ins	INS	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N417fs	ENST00000394979.2	37	c.1248_1249		16																																																																																			ZNF646	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167395		0.589	ZNF646-003	KNOWN	basic	protein_coding	ZNF646	HGNC	protein_coding	OTTHUMT00000108510.2	8	0.00	0	-	NM_014699		31088893	31088894	+1	no_errors	ENST00000300850	ensembl	human	known	69_37n	frame_shift_ins	10	16.67	2	INS	0.970:0.996	A
