#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB11	8647	genome.wustl.edu	37	2	169842673	169842673	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr2:169842673C>T	ENST00000263817.6	-	10	1154	c.1030G>A	c.(1030-1032)Ggc>Agc	p.G344S		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	344	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)	p.G344S(2)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	AGTGTGGAGCCGTACCAGAAG	0.468																																						dbGAP											2	Substitution - Missense(2)	breast(1)|endometrium(1)											116.0	113.0	114.0					2																	169842673		1923	4142	6065	-	-	-	SO:0001583	missense	0			AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.1030G>A	2.37:g.169842673C>T	ENSP00000263817:p.Gly344Ser		Q53TL2|Q9UNB2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.G344S	ENST00000263817.6	37	c.1030	CCDS46444.1	2	.	.	.	.	.	.	.	.	.	.	C	20.7	4.028984	0.75504	.	.	ENSG00000073734	ENST00000263817	D	0.94497	-3.44	5.52	4.64	0.57946	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.096159	0.64402	N	0.000001	D	0.97365	0.9138	M	0.86573	2.825	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98066	1.0396	10	0.87932	D	0	.	14.3974	0.67020	0.0:0.9287:0.0:0.0713	.	344	O95342	ABCBB_HUMAN	S	344	ENSP00000263817:G344S	ENSP00000263817:G344S	G	-	1	0	ABCB11	169550919	1.000000	0.71417	0.900000	0.35374	0.242000	0.25591	7.776000	0.85560	1.458000	0.47871	0.557000	0.71058	GGC	ABCB11	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000073734		0.468	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB11	HGNC	protein_coding	OTTHUMT00000333616.2	327	0.00	0	C	NM_003742		169842673	169842673	-1	no_errors	ENST00000263817	ensembl	human	known	69_37n	missense	193	26.62	70	SNP	1.000	T
AKAP13	11214	genome.wustl.edu	37	15	86123003	86123003	+	Silent	SNP	G	G	A			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr15:86123003G>A	ENST00000394518.2	+	7	1799	c.1704G>A	c.(1702-1704)acG>acA	p.T568T	RP11-815J21.2_ENST00000561409.1_RNA|AKAP13_ENST00000361243.2_Silent_p.T568T	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	568					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.T568T(1)		NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CAGCAGAAACGGAAACTTCAC	0.458																																					Melanoma(94;603 1453 3280 32295 32951)	dbGAP											1	Substitution - coding silent(1)	breast(1)											81.0	85.0	84.0					15																	86123003		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.1704G>A	15.37:g.86123003G>A			Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.T568	ENST00000394518.2	37	c.1704	CCDS32319.1	15																																																																																			AKAP13	-	NULL	ENSG00000170776		0.458	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	39	0.00	0	G	NM_007200		86123003	86123003	+1	no_errors	ENST00000361243	ensembl	human	known	69_37n	silent	40	10.87	5	SNP	0.000	A
CHRNA1	1134	genome.wustl.edu	37	2	175624061	175624061	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr2:175624061G>T	ENST00000261007.5	-	3	298	c.232C>A	c.(232-234)Cag>Aag	p.Q78K	CHRNA1_ENST00000409219.1_Missense_Mutation_p.Q78K|AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000348749.5_Missense_Mutation_p.Q78K|CHRNA1_ENST00000409323.1_Missense_Mutation_p.Q78K|CHRNA1_ENST00000409542.1_Missense_Mutation_p.Q78K	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	78					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)	p.Q78K(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	TAAGTTACCTGTTTCAGACGC	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											106.0	101.0	103.0					2																	175624061		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.232C>A	2.37:g.175624061G>T	ENSP00000261007:p.Gln78Lys		B4DRV6|D3DPE8	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel	p.Q78K	ENST00000261007.5	37	c.232	CCDS33331.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.488746	0.96323	.	.	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542;ENST00000409219;ENST00000409323	T;T;D;T;T	0.84660	-1.29;-1.29;-1.88;-1.29;-1.29	6.08	6.08	0.98989	Neurotransmitter-gated ion-channel ligand-binding (3);	0.100008	0.64402	D	0.000001	D	0.94742	0.8303	M	0.92459	3.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.996;0.996;0.999	D	0.94885	0.8042	10	0.87932	D	0	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	78;78;78	G5E9G9;Q53SH4;P02708	.;.;ACHA_HUMAN	K	78	ENSP00000261008:Q78K;ENSP00000261007:Q78K;ENSP00000387026:Q78K;ENSP00000386611:Q78K;ENSP00000386684:Q78K	ENSP00000261007:Q78K	Q	-	1	0	CHRNA1	175332307	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.803000	0.99136	2.894000	0.99253	0.655000	0.94253	CAG	CHRNA1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd	ENSG00000138435		0.418	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	CHRNA1	HGNC	protein_coding	OTTHUMT00000334116.1	143	0.00	0	G			175624061	175624061	-1	no_errors	ENST00000261007	ensembl	human	known	69_37n	missense	51	45.16	42	SNP	1.000	T
ASIC4	55515	genome.wustl.edu	37	2	220402756	220402756	+	Silent	SNP	T	T	C			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr2:220402756T>C	ENST00000347842.3	+	9	1946	c.1932T>C	c.(1930-1932)gaT>gaC	p.D644D	ASIC4_ENST00000358078.4_Silent_p.D663D	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	644					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)	p.D663D(1)									TCTTTGAAGATTTTGCTTGCT	0.652																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											40.0	38.0	38.0					2																	220402756		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.1932T>C	2.37:g.220402756T>C			Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Silent	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC	p.D644	ENST00000347842.3	37	c.1932	CCDS2442.1	2																																																																																			ASIC4	-	NULL	ENSG00000072182		0.652	ASIC4-001	KNOWN	basic|CCDS	protein_coding	ASIC4	HGNC	protein_coding	OTTHUMT00000130263.1	107	0.00	0	T	NM_018674		220402756	220402756	+1	no_errors	ENST00000347842	ensembl	human	known	69_37n	silent	32	50.00	32	SNP	1.000	C
COL19A1	1310	genome.wustl.edu	37	6	70639432	70639432	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr6:70639432G>A	ENST00000322773.4	+	6	608	c.506G>A	c.(505-507)cGt>cAt	p.R169H		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	169	Laminin G-like.				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)	p.R169H(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						TTGTTTGATCGTCAGTGGCAC	0.403																																						dbGAP											1	Substitution - Missense(1)	breast(1)											124.0	119.0	121.0					6																	70639432		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.506G>A	6.37:g.70639432G>A	ENSP00000316030:p.Arg169His		Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.R169H	ENST00000322773.4	37	c.506	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	G	15.90	2.970632	0.53614	.	.	ENSG00000082293	ENST00000322773	T	0.13657	2.57	5.52	5.52	0.82312	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.64402	D	0.000001	T	0.31765	0.0807	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.01657	-1.1302	10	0.41790	T	0.15	.	19.4456	0.94845	0.0:0.0:1.0:0.0	.	169	Q14993	COJA1_HUMAN	H	169	ENSP00000316030:R169H	ENSP00000316030:R169H	R	+	2	0	COL19A1	70696153	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	9.224000	0.95209	2.592000	0.87571	0.467000	0.42956	CGT	COL19A1	-	superfamily_ConA-like_lec_gl,smart_Laminin_G	ENSG00000082293		0.403	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	HGNC	protein_coding	OTTHUMT00000041127.1	384	0.00	0	G			70639432	70639432	+1	no_errors	ENST00000322773	ensembl	human	known	69_37n	missense	226	39.57	148	SNP	1.000	A
CXorf40A	91966	genome.wustl.edu	37	X	148627391	148627391	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chrX:148627391T>G	ENST00000441248.1	+	3	1802	c.215T>G	c.(214-216)cTc>cGc	p.L72R	CXorf40A_ENST00000514208.1_Missense_Mutation_p.L72R|CXorf40A_ENST00000423540.2_Missense_Mutation_p.L72R|CXorf40A_ENST00000423421.1_Missense_Mutation_p.L72R|CXorf40A_ENST00000359293.5_Missense_Mutation_p.L72R|CXorf40A_ENST00000434353.2_Missense_Mutation_p.L72R|CXorf40A_ENST00000450602.2_Missense_Mutation_p.L72R|CXorf40A_ENST00000422892.2_Missense_Mutation_p.L72R|RP5-937E21.8_ENST00000431993.1_RNA|CXorf40A_ENST00000428236.1_Missense_Mutation_p.L10R|CXorf40A_ENST00000393985.3_Missense_Mutation_p.L72R			Q8TE69	CX04A_HUMAN	chromosome X open reading frame 40A	72								p.L72R(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(2)	7	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CAGACCTTGCTCAGGAAAGGG	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											39.0	9.0	19.0					X																	148627391		2199	4263	6462	-	-	-	SO:0001583	missense	0			AF011889	CCDS14687.1, CCDS55522.1	Xq28	2010-03-16	2005-09-13	2005-09-13	ENSG00000197620	ENSG00000197620			28089	protein-coding gene	gene with protein product	"""endothelial-overexpressed lipopolysaccharide-associated factor 1"""		"""chromosome X open reading frame 40"""	CXorf40		8717057, 9147653, 16383041	Standard	XM_005278212		Approved	EOLA1	uc004fdg.3	Q8TE69	OTTHUMG00000022622	ENST00000441248.1:c.215T>G	X.37:g.148627391T>G	ENSP00000423099:p.Leu72Arg		A8K784|B7Z6H6|B7ZL96|D6RA72|E7ENU3|Q2M3E9	Missense_Mutation	SNP	superfamily_PUA-like_domain	p.L72R	ENST00000441248.1	37	c.215	CCDS14687.1	X	.	.	.	.	.	.	.	.	.	.	T	10.78	1.446761	0.25987	.	.	ENSG00000197620	ENST00000450602;ENST00000441248;ENST00000393985;ENST00000423421;ENST00000423540;ENST00000434353;ENST00000514208;ENST00000428236;ENST00000422892;ENST00000359293	D;D;D;D;D;D;D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15	3.71	2.46	0.29980	PUA-like domain (1);	0.148635	0.44483	D	0.000459	D	0.95484	0.8533	M	0.81682	2.555	0.09310	N	0.999999	P;P;D	0.69078	0.484;0.484;0.997	B;B;D	0.66351	0.16;0.105;0.943	D	0.89367	0.3672	10	0.87932	D	0	.	8.6526	0.34044	0.0:0.0:0.1913:0.8087	.	72;72;72	Q8TE69;E7ENU3;D6RA72	CX04A_HUMAN;.;.	R	72;72;72;72;72;72;72;10;72;72	ENSP00000427540:L72R;ENSP00000423099:L72R;ENSP00000421745:L72R;ENSP00000422512:L72R;ENSP00000425520:L72R;ENSP00000423160:L72R;ENSP00000423708:L72R;ENSP00000426158:L10R;ENSP00000422312:L72R;ENSP00000420882:L72R	ENSP00000420882:L72R	L	+	2	0	CXorf40A	148435296	0.852000	0.29690	0.008000	0.14137	0.003000	0.03518	5.951000	0.70273	0.412000	0.25729	0.371000	0.22339	CTC	CXorf40A	-	superfamily_PUA-like_domain	ENSG00000197620		0.562	CXorf40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf40A	HGNC	protein_coding	OTTHUMT00000058699.3	37	0.00	0	T	NM_178124		148627391	148627391	+1	no_errors	ENST00000359293	ensembl	human	known	69_37n	missense	12	60.00	18	SNP	0.008	G
DCHS2	54798	genome.wustl.edu	37	4	155180776	155180776	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr4:155180776T>A	ENST00000357232.4	-	20	5344	c.5345A>T	c.(5344-5346)gAt>gTt	p.D1782V		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1782	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D1782V(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TGGTGAATTATCATTCTCATC	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											207.0	184.0	192.0					4																	155180776		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.5345A>T	4.37:g.155180776T>A	ENSP00000349768:p.Asp1782Val		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D1782V	ENST00000357232.4	37	c.5345	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	T	17.66	3.444507	0.63178	.	.	ENSG00000197410	ENST00000357232	T	0.72051	-0.62	5.52	5.52	0.82312	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.64402	D	0.000001	D	0.89319	0.6681	H	0.97186	3.955	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92710	0.6182	10	0.87932	D	0	.	14.9183	0.70815	0.0:0.0:0.0:1.0	.	1782	Q6V1P9	PCD23_HUMAN	V	1782	ENSP00000349768:D1782V	ENSP00000349768:D1782V	D	-	2	0	DCHS2	155400226	1.000000	0.71417	0.972000	0.41901	0.477000	0.33069	6.084000	0.71335	2.228000	0.72767	0.533000	0.62120	GAT	DCHS2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.383	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	299	0.00	0	T	NM_001142552		155180776	155180776	-1	no_errors	ENST00000357232	ensembl	human	known	69_37n	missense	110	45.59	93	SNP	1.000	A
EIF5B	9669	genome.wustl.edu	37	2	99993052	99993052	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr2:99993052C>T	ENST00000289371.6	+	10	1997	c.1795C>T	c.(1795-1797)Cgg>Tgg	p.R599W		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	599					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.R599W(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TGATGATGATCGGACTAAAGA	0.378																																					Colon(162;2388 2567 2705 3444)	dbGAP											1	Substitution - Missense(1)	breast(1)											180.0	176.0	177.0					2																	99993052		1899	4111	6010	-	-	-	SO:0001583	missense	0			AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.1795C>T	2.37:g.99993052C>T	ENSP00000289371:p.Arg599Trp		O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_init/rib_B-barrel,superfamily_TIF_IF2_dom3,prints_ProtSyn_GTP-bd,tigrfam_Small_GTP-bd_dom	p.R599W	ENST00000289371.6	37	c.1795	CCDS42721.1	2	.	.	.	.	.	.	.	.	.	.	C	20.3	3.974247	0.74246	.	.	ENSG00000158417	ENST00000289371	T	0.49139	0.79	5.96	4.12	0.48240	.	.	.	.	.	T	0.63616	0.2526	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	P	0.60117	0.869	T	0.64939	-0.6289	8	.	.	.	-11.0169	15.3281	0.74182	0.2554:0.7446:0.0:0.0	.	599	O60841	IF2P_HUMAN	W	599	ENSP00000289371:R599W	.	R	+	1	2	EIF5B	99359484	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	3.765000	0.55272	0.809000	0.34255	0.655000	0.94253	CGG	EIF5B	-	NULL	ENSG00000158417		0.378	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF5B	HGNC	protein_coding	OTTHUMT00000330364.2	600	0.00	0	C	NM_015904		99993052	99993052	+1	no_errors	ENST00000289371	ensembl	human	known	69_37n	missense	329	24.37	106	SNP	1.000	T
FMN2	56776	genome.wustl.edu	37	1	240371704	240371704	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr1:240371704C>A	ENST00000319653.9	+	5	3822	c.3592C>A	c.(3592-3594)Ccg>Acg	p.P1198T		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1198	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.P1341T(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AATACCTCCTCCGCCCCCTCT	0.667																																						dbGAP											1	Substitution - Missense(1)	breast(1)											17.0	18.0	18.0					1																	240371704		2200	4300	6500	-	-	-	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3592C>A	1.37:g.240371704C>A	ENSP00000318884:p.Pro1198Thr		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.P1198T	ENST00000319653.9	37	c.3592	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	c	10.53	1.376101	0.24857	.	.	ENSG00000155816	ENST00000319653	T	0.65364	-0.15	3.65	2.73	0.32206	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (1);	.	.	.	.	T	0.75302	0.3831	M	0.82433	2.59	0.80722	D	1	D	0.63046	0.992	P	0.60789	0.879	T	0.76321	-0.3002	8	.	.	.	.	10.8728	0.46894	0.0:0.9058:0.0:0.0942	.	1198	Q9NZ56	FMN2_HUMAN	T	1198	ENSP00000318884:P1198T	.	P	+	1	0	FMN2	238438327	0.269000	0.24143	0.544000	0.28141	0.096000	0.18686	2.142000	0.42177	0.766000	0.33244	0.466000	0.42574	CCG	FMN2	-	pfam_Formin_homology_1,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000155816		0.667	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	26	0.00	0	C	XM_371352		240371704	240371704	+1	no_errors	ENST00000319653	ensembl	human	known	69_37n	missense	12	63.64	21	SNP	1.000	A
FNDC4	64838	genome.wustl.edu	37	2	27717516	27717517	+	Frame_Shift_Ins	INS	-	-	G	rs375116041		TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr2:27717516_27717517insG	ENST00000264703.3	-	2	421_422	c.30_31insC	c.(28-33)cccagcfs	p.S11fs	GCKR_ENST00000264717.2_5'Flank|GCKR_ENST00000424318.2_5'Flank	NM_022823.2	NP_073734.1	Q9H6D8	FNDC4_HUMAN	fibronectin type III domain containing 4	11						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S11fs*28(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|prostate(1)|skin(1)	9	Acute lymphoblastic leukemia(172;0.155)					CGGAGTCCGCTGGGGGGGGAAC	0.649																																						dbGAP											1	Insertion - Frameshift(1)	liver(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AK026015	CCDS1756.1	2p23.3	2013-02-11			ENSG00000115226	ENSG00000115226		"""Fibronectin type III domain containing"""	20239	protein-coding gene	gene with protein product		611905				12384288	Standard	NM_022823		Approved	FLJ22362, FRCP1	uc002rkx.3	Q9H6D8	OTTHUMG00000097787	ENST00000264703.3:c.31dupC	2.37:g.27717524_27717524dupG	ENSP00000264703:p.Ser11fs		D6W560	Frame_Shift_Ins	INS	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S10fs	ENST00000264703.3	37	c.31_30	CCDS1756.1	2																																																																																			FNDC4	-	NULL	ENSG00000115226		0.649	FNDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC4	HGNC	protein_coding	OTTHUMT00000215031.1	23	0.00	0	-	NM_022823		27717516	27717517	-1	no_errors	ENST00000264703	ensembl	human	known	69_37n	frame_shift_ins	44	12.00	6	INS	0.989:0.915	G
GOLGA6L1	283767	genome.wustl.edu	37	15	22742829	22742829	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr15:22742829T>G	ENST00000560659.2	+	8	1064	c.1064T>G	c.(1063-1065)aTa>aGa	p.I355R	GOLGA6L1_ENST00000316397.3_Missense_Mutation_p.I405R			Q8N7Z2	GG6L1_HUMAN	golgin A6 family-like 1	399								p.I405R(1)		NS(1)|breast(2)|endometrium(5)|large_intestine(1)|lung(1)|skin(1)	11						gaggagaagatacgcgagcag	0.552																																						dbGAP											1	Substitution - Missense(1)	breast(1)											1.0	1.0	1.0					15																	22742829		56	65	121	-	-	-	SO:0001583	missense	0			AK097517	CCDS73699.1	15q11.2	2012-10-05	2010-02-12		ENSG00000197414	ENSG00000277865			37444	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 1"""				Standard	NM_001001413		Approved		uc010tzx.1	Q8N7Z2	OTTHUMG00000171883	ENST00000560659.2:c.1064T>G	15.37:g.22742829T>G	ENSP00000452626:p.Ile355Arg			Missense_Mutation	SNP	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.I405R	ENST00000560659.2	37	c.1214		15	.	.	.	.	.	.	.	.	.	.	.	0.077	-1.191624	0.01607	.	.	ENSG00000197414	ENST00000316397;ENST00000355145	T	0.10288	2.89	.	.	.	.	.	.	.	.	T	0.06462	0.0166	N	0.22421	0.69	0.09310	N	1	.	.	.	.	.	.	T	0.45293	-0.9271	5	0.15499	T	0.54	.	.	.	.	.	.	.	.	R	405	ENSP00000320207:I405R	ENSP00000320207:I405R	I	+	2	0	GOLGA6L1	20294193	0.001000	0.12720	0.149000	0.22428	0.151000	0.21798	0.174000	0.16743	0.129000	0.18514	0.128000	0.15822	ATA	GOLGA6L1	-	NULL	ENSG00000197414		0.552	GOLGA6L1-002	KNOWN	basic|appris_candidate	protein_coding	GOLGA6L1	HGNC	protein_coding	OTTHUMT00000415616.2	42	0.00	0	T	NM_001001413		22742829	22742829	+1	no_errors	ENST00000316397	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	0.161	G
GPKOW	27238	genome.wustl.edu	37	X	48972279	48972279	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chrX:48972279T>C	ENST00000156109.5	-	8	1184	c.1106A>G	c.(1105-1107)aAc>aGc	p.N369S		NM_015698.4	NP_056513.2	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs	369						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.N369S(1)		breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)	21						TTTGTACATGTTGTCCACAAA	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											72.0	58.0	62.0					X																	48972279		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66359	CCDS35251.1	Xp11.23	2013-01-28			ENSG00000068394	ENSG00000068394		"""G patch domain containing"""	30677	protein-coding gene	gene with protein product	"""G patch domain containing 5"""					21880142, 22365833	Standard	NM_015698		Approved	T54, GPATC5, GPATCH5, Spp2	uc004dmr.3	Q92917	OTTHUMG00000021511	ENST00000156109.5:c.1106A>G	X.37:g.48972279T>C	ENSP00000156109:p.Asn369Ser		Q59EK5|Q9BQA8	Missense_Mutation	SNP	pfam_KOW,pfam_G_patch_dom,superfamily_Translation_prot_SH3-like,smart_G_patch_dom,smart_KOW,pfscan_G_patch_dom	p.N369S	ENST00000156109.5	37	c.1106	CCDS35251.1	X	.	.	.	.	.	.	.	.	.	.	T	10.89	1.479470	0.26511	.	.	ENSG00000068394	ENST00000156109	.	.	.	5.49	3.1	0.35709	.	0.096370	0.64402	D	0.000001	T	0.17959	0.0431	N	0.08118	0	0.20403	N	0.999903	B	0.02656	0.0	B	0.01281	0.0	T	0.17228	-1.0376	9	0.62326	D	0.03	-3.438	7.4445	0.27203	0.0:0.1786:0.0:0.8214	.	369	Q92917	GPKOW_HUMAN	S	369	.	ENSP00000156109:N369S	N	-	2	0	GPKOW	48859223	0.997000	0.39634	0.487000	0.27428	0.347000	0.29111	2.898000	0.48672	0.317000	0.23160	-0.351000	0.07748	AAC	GPKOW	-	NULL	ENSG00000068394		0.572	GPKOW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPKOW	HGNC	protein_coding	OTTHUMT00000056535.2	109	0.00	0	T	NM_015698		48972279	48972279	-1	no_errors	ENST00000156109	ensembl	human	known	69_37n	missense	57	57.14	76	SNP	0.863	C
HSPA5	3309	genome.wustl.edu	37	9	128001807	128001807	+	Silent	SNP	G	G	A			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr9:128001807G>A	ENST00000324460.6	-	4	701	c.498C>T	c.(496-498)acC>acT	p.T166T	RP11-65N13.8_ENST00000468244.1_RNA	NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	166					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)	p.T166T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	CAACTGCATGGGTAACCTAAA	0.408										Prostate(1;0.17)																												dbGAP											1	Substitution - coding silent(1)	breast(1)											78.0	75.0	76.0					9																	128001807		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.498C>T	9.37:g.128001807G>A			B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.T166	ENST00000324460.6	37	c.498	CCDS6863.1	9																																																																																			HSPA5	-	pfam_Hsp_70_fam,pfam_MreB_Mrl	ENSG00000044574		0.408	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA5	HGNC	protein_coding	OTTHUMT00000054062.1	77	0.00	0	G			128001807	128001807	-1	no_errors	ENST00000324460	ensembl	human	known	69_37n	silent	53	33.75	27	SNP	0.959	A
INSL5	10022	genome.wustl.edu	37	1	67266829	67266829	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr1:67266829C>A	ENST00000304526.2	-	1	110	c.76G>T	c.(76-78)Gtg>Ttg	p.V26L		NM_005478.4	NP_005469.2	Q9Y5Q6	INSL5_HUMAN	insulin-like 5	26						extracellular region (GO:0005576)		p.V26L(1)		breast(2)|endometrium(1)|lung(5)	8						CAGAGTCTCACAGACTCCTTG	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											101.0	94.0	96.0					1																	67266829		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF133816	CCDS634.1	1p31.3	2013-02-26			ENSG00000172410	ENSG00000172410		"""Endogenous ligands"""	6088	protein-coding gene	gene with protein product	"""prepro-INSL5"""	606413				10458910	Standard	NM_005478		Approved		uc001dcw.3	Q9Y5Q6	OTTHUMG00000009164	ENST00000304526.2:c.76G>T	1.37:g.67266829C>A	ENSP00000302724:p.Val26Leu		Q3MIY4|Q5VYD8	Missense_Mutation	SNP	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like	p.V26L	ENST00000304526.2	37	c.76	CCDS634.1	1	.	.	.	.	.	.	.	.	.	.	C	9.311	1.055694	0.19907	.	.	ENSG00000172410	ENST00000304526	D	0.84370	-1.84	4.58	-0.168	0.13343	Insulin-like (3);	1.154560	0.06566	N	0.747647	T	0.58206	0.2106	L	0.49126	1.545	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.34576	-0.9823	10	0.12103	T	0.63	3.6212	3.4859	0.07619	0.1372:0.413:0.3391:0.1107	.	26	Q9Y5Q6	INSL5_HUMAN	L	26	ENSP00000302724:V26L	ENSP00000302724:V26L	V	-	1	0	INSL5	67039417	0.007000	0.16637	0.062000	0.19696	0.103000	0.19146	-0.250000	0.08830	0.087000	0.17167	0.655000	0.94253	GTG	INSL5	-	superfamily_Insulin-like,smart_Insulin-like	ENSG00000172410		0.478	INSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSL5	HGNC	protein_coding	OTTHUMT00000025403.1	182	0.00	0	C	NM_005478		67266829	67266829	-1	no_errors	ENST00000304526	ensembl	human	known	69_37n	missense	263	23.32	80	SNP	0.028	A
LILRA6	79168	genome.wustl.edu	37	19	54745497	54745497	+	Missense_Mutation	SNP	G	G	A	rs146470981		TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr19:54745497G>A	ENST00000396365.2	-	4	652	c.613C>T	c.(613-615)Cgg>Tgg	p.R205W	LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000270464.5_Missense_Mutation_p.R205W|LILRA6_ENST00000245621.5_Missense_Mutation_p.R205W|LILRA6_ENST00000391735.3_Intron|LILRA6_ENST00000440558.2_Missense_Mutation_p.R205W|LILRA6_ENST00000419410.2_Missense_Mutation_p.R205W	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	205					immune system process (GO:0002376)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GACCACACCCGGGGGGTGTTT	0.617																																						dbGAP											0													52.0	58.0	56.0					19																	54745497		1987	4041	6028	-	-	-	SO:0001583	missense	0			AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.613C>T	19.37:g.54745497G>A	ENSP00000379651:p.Arg205Trp			Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R205W	ENST00000396365.2	37	c.613	CCDS42610.1	19	.	.	.	.	.	.	.	.	.	.	G	7.506	0.653694	0.14580	.	.	ENSG00000244482	ENST00000440558;ENST00000270464;ENST00000419410;ENST00000421123;ENST00000396365;ENST00000245621	T;T;T;T;T	0.00737	5.76;5.76;5.76;5.76;5.76	2.38	0.972	0.19704	Immunoglobulin-like fold (1);	1.294080	0.05328	N	0.527713	T	0.00875	0.0029	L	0.31926	0.97	0.09310	N	1	B;B;B;B	0.14012	0.009;0.007;0.004;0.005	B;B;B;B	0.11329	0.004;0.006;0.0;0.003	T	0.47799	-0.9089	10	0.49607	T	0.09	.	4.4216	0.11482	0.2737:0.0:0.7263:0.0	.	205;205;205;205	C9JFH3;Q6PI73;F8WCY4;D3YTC4	.;LIRA6_HUMAN;.;.	W	205	ENSP00000390120:R205W;ENSP00000270464:R205W;ENSP00000411227:R205W;ENSP00000379651:R205W;ENSP00000245621:R205W	ENSP00000245621:R205W	R	-	1	2	LILRA6	59437309	0.000000	0.05858	0.017000	0.16124	0.103000	0.19146	0.029000	0.13666	0.312000	0.23038	0.162000	0.16502	CGG	LILRA6	-	NULL	ENSG00000244482		0.617	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	LILRA6	HGNC	protein_coding	OTTHUMT00000313725.1	15	0.00	0	G	NM_024318		54745497	54745497	-1	no_errors	ENST00000270464	ensembl	human	known	69_37n	missense	10	37.50	6	SNP	0.022	A
MBD6	114785	genome.wustl.edu	37	12	57921731	57921732	+	Frame_Shift_Ins	INS	-	-	G	rs573269662	byFrequency	TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr12:57921731_57921732insG	ENST00000355673.3	+	9	2693_2694	c.2337_2338insG	c.(2338-2340)gggfs	p.G780fs	MBD6_ENST00000431731.2_Frame_Shift_Ins_p.G780fs	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	780	Pro-rich.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						AGCTCCTCCCTGGGGGGGGAGC	0.629																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.2345dupG	12.37:g.57921739_57921739dupG	ENSP00000347896:p.Gly780fs		Q8N3M0|Q8NA81|Q96Q00	Frame_Shift_Ins	INS	superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd	p.A782fs	ENST00000355673.3	37	c.2337_2338	CCDS8944.1	12																																																																																			MBD6	-	NULL	ENSG00000166987		0.629	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD6	HGNC	protein_coding	OTTHUMT00000407250.1	8	0.00	0	-			57921731	57921732	+1	no_errors	ENST00000355673	ensembl	human	known	69_37n	frame_shift_ins	14	17.65	3	INS	1.000:1.000	G
MDN1	23195	genome.wustl.edu	37	6	90402292	90402292	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr6:90402292C>G	ENST00000369393.3	-	63	10572	c.10457G>C	c.(10456-10458)gGc>gCc	p.G3486A	MDN1_ENST00000428876.1_Missense_Mutation_p.G3486A			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	3486					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.G3486A(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CTGGCCCTTGCCTTCCAGCTC	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											86.0	82.0	83.0					6																	90402292		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.10457G>C	6.37:g.90402292C>G	ENSP00000358400:p.Gly3486Ala		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.G3486A	ENST00000369393.3	37	c.10457	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	C	6.077	0.382490	0.11524	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.02787	4.16;4.16	5.19	-1.67	0.08238	.	0.713156	0.14186	N	0.335663	T	0.00608	0.0020	L	0.57536	1.79	0.19300	N	0.999974	B	0.02656	0.0	B	0.04013	0.001	T	0.51236	-0.8731	10	0.02654	T	1	.	1.1719	0.01827	0.1279:0.2868:0.251:0.3342	.	3486	Q9NU22	MDN1_HUMAN	A	3486	ENSP00000358400:G3486A;ENSP00000413970:G3486A	ENSP00000358400:G3486A	G	-	2	0	MDN1	90459013	0.000000	0.05858	0.888000	0.34837	0.596000	0.36781	0.171000	0.16685	-0.221000	0.09973	-0.379000	0.06801	GGC	MDN1	-	pirsf_Midasin	ENSG00000112159		0.557	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	52	0.00	0	C			90402292	90402292	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	missense	60	41.75	43	SNP	0.234	G
MST1L	11223	genome.wustl.edu	37	1	17083888	17083888	+	RNA	SNP	C	C	T	rs75141545		TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr1:17083888C>T	ENST00000455405.2	-	0	700							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										CCGTAGTCACCCTGGCAGGTA	0.562																																						dbGAP											0																																										-	-	-			0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17083888C>T			B7WPB1|Q13209	Missense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.G637S	ENST00000455405.2	37	c.1909		1	.	.	.	.	.	.	.	.	.	.	.	12.74	2.028492	0.35797	.	.	ENSG00000186715	ENST00000334998;ENST00000442552	.	.	.	.	.	.	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.43110	D	0.000618	T	0.66096	0.2755	.	.	.	.	.	.	D;D	0.89917	1.0;1.0	D;D	0.87578	0.993;0.998	T	0.71738	-0.4502	6	0.66056	D	0.02	.	6.7402	0.23431	0.0:0.9998:0.0:2.0E-4	.	637;663	Q2TV78-2;Q2TV78	.;MSTP9_HUMAN	S	637;663	.	ENSP00000439273:G637S	G	-	1	0	MST1P9	16956475	1.000000	0.71417	0.948000	0.38648	0.000000	0.00434	2.280000	0.43443	0.502000	0.28037	0.000000	0.15137	GGT	MST1P9	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000186715		0.562	MST1L-002	KNOWN	basic	processed_transcript	MST1P9	HGNC	pseudogene	OTTHUMT00000400328.1	33	0.00	0	C	NM_001271733		17083888	17083888	-1	no_errors	ENST00000334998	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	1.000	T
MUC2	4583	genome.wustl.edu	37	11	1090919	1090919	+	Missense_Mutation	SNP	A	A	C	rs527508204	byFrequency	TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr11:1090919A>C	ENST00000441003.2	+	28	3841	c.3814A>C	c.(3814-3816)Acc>Ccc	p.T1272P	MUC2_ENST00000359061.5_Missense_Mutation_p.T1273P|MUC2_ENST00000361558.6_5'Flank|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1272					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1272P(1)|p.T1273P(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caccaccatcaccctccccac	0.622													-|||	219	0.04373	0.0469	0.0389	5008	,	,		10015	0.0407		0.0338	False		,,,				2504	0.0562					dbGAP											2	Substitution - Missense(2)	breast(2)											95.0	98.0	97.0					11																	1090919		2059	4181	6240	-	-	-	SO:0001583	missense	0			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.3814A>C	11.37:g.1090919A>C	ENSP00000415183:p.Thr1272Pro		Q14878	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.T1272P	ENST00000441003.2	37	c.3814		11	.	.	.	.	.	.	.	.	.	.	a	7.023	0.559023	0.13436	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14640	2.52;2.49	3.03	0.433	0.16534	.	.	.	.	.	T	0.19127	0.0459	M	0.66297	2.02	0.09310	N	1	P	0.50617	0.937	P	0.48488	0.579	T	0.11494	-1.0585	9	0.41790	T	0.15	.	7.3663	0.26774	0.497:0.503:0.0:0.0	.	1272	E7EUV1	.	P	1272;1273	ENSP00000415183:T1272P;ENSP00000351956:T1273P	ENSP00000351956:T1273P	T	+	1	0	MUC2	1080919	0.000000	0.05858	0.001000	0.08648	0.118000	0.20060	-1.864000	0.01650	0.018000	0.15052	0.381000	0.24937	ACC	MUC2	-	NULL	ENSG00000198788		0.622	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	27	0.00	0	A	NM_002457		1090919	1090919	+1	no_errors	ENST00000441003	ensembl	human	known	69_37n	missense	28	26.32	10	SNP	0.002	C
NR4A3	8013	genome.wustl.edu	37	9	102626006	102626006	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr9:102626006G>A	ENST00000395097.2	+	8	2467	c.1738G>A	c.(1738-1740)Gag>Aag	p.E580K	NR4A3_ENST00000330847.1_Missense_Mutation_p.E591K	NM_006981.3|NM_173200.2	NP_008912.2|NP_775292.1	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	580					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|zinc ion binding (GO:0008270)	p.E591K(1)	TCF12/NR4A3(2)|TAF15/NR4A3(33)|EWSR1/NR4A3(146)|TFG/NR4A3(2)				Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				GGAGCCCACCGAGTCCAAGGT	0.527			T	EWSR1	extraskeletal myxoid chondrosarcoma																																	dbGAP		Dom	yes		9	9q22	8013	"""nuclear receptor subfamily 4, group A, member 3 (NOR1)"""		M	1	Substitution - Missense(1)	breast(1)											80.0	70.0	74.0					9																	102626006		2203	4300	6503	-	-	-	SO:0001583	missense	0			U12767	CCDS6742.1, CCDS6743.1, CCDS6744.1	9q22	2013-01-16			ENSG00000119508	ENSG00000119508		"""Nuclear hormone receptors"""	7982	protein-coding gene	gene with protein product		600542				8614405	Standard	NM_006981		Approved	CSMF, CHN, NOR1, MINOR	uc004baf.1	Q92570	OTTHUMG00000021030	ENST00000395097.2:c.1738G>A	9.37:g.102626006G>A	ENSP00000378531:p.Glu580Lys		A2A3I7|Q12935|Q14979|Q16420|Q4VXA8|Q4VXA9|Q9UEK2|Q9UEK3	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_NOR1_rcpt,prints_Nuc_orph_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt	p.E591K	ENST00000395097.2	37	c.1771	CCDS6743.1	9	.	.	.	.	.	.	.	.	.	.	G	16.02	3.002850	0.54254	.	.	ENSG00000119508	ENST00000395097;ENST00000330847	T;T	0.50548	0.74;0.74	5.92	5.92	0.95590	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	5.219300	0.00397	N	0.000049	T	0.47192	0.1432	N	0.08118	0	0.38956	D	0.958448	D;D	0.57899	0.981;0.957	B;P	0.50791	0.332;0.65	T	0.42378	-0.9455	10	0.59425	D	0.04	.	15.0929	0.72211	0.0:0.0:0.8584:0.1416	.	591;580	Q92570-3;Q92570	.;NR4A3_HUMAN	K	580;591	ENSP00000378531:E580K;ENSP00000333122:E591K	ENSP00000333122:E591K	E	+	1	0	NR4A3	101665827	1.000000	0.71417	0.946000	0.38457	0.967000	0.64934	2.696000	0.47052	2.805000	0.96524	0.655000	0.94253	GAG	NR4A3	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_NOR1_rcpt	ENSG00000119508		0.527	NR4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR4A3	HGNC	protein_coding	OTTHUMT00000055482.1	194	0.00	0	G			102626006	102626006	+1	no_errors	ENST00000330847	ensembl	human	known	69_37n	missense	142	33.64	72	SNP	0.977	A
OR6P1	128366	genome.wustl.edu	37	1	158532693	158532693	+	Silent	SNP	G	G	C			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr1:158532693G>C	ENST00000334632.1	-	1	701	c.702C>G	c.(700-702)cgC>cgG	p.R234R		NM_001160325.1	NP_001153797.1	Q8NGX9	OR6P1_HUMAN	olfactory receptor, family 6, subfamily P, member 1	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|lung(1)	6						AGGCTTTGTGGCGTCCCCTGG	0.537																																						dbGAP											0													126.0	103.0	110.0					1																	158532693		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BK004193	CCDS53391.1	1q23.1	2012-08-09			ENSG00000186440	ENSG00000186440		"""GPCR / Class A : Olfactory receptors"""	15036	protein-coding gene	gene with protein product							Standard	NM_001160325		Approved		uc010pim.2	Q8NGX9	OTTHUMG00000019633	ENST00000334632.1:c.702C>G	1.37:g.158532693G>C			Q6IFR9	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R234	ENST00000334632.1	37	c.702	CCDS53391.1	1																																																																																			OR6P1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186440		0.537	OR6P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6P1	HGNC	protein_coding	OTTHUMT00000051848.1	101	0.00	0	G			158532693	158532693	-1	no_errors	ENST00000334632	ensembl	human	known	69_37n	silent	170	23.08	51	SNP	0.006	C
OR2T2	401992	genome.wustl.edu	37	1	248616883	248616883	+	Missense_Mutation	SNP	T	T	A	rs143551105	byFrequency	TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr1:248616883T>A	ENST00000342927.3	+	1	807	c.785T>A	c.(784-786)cTg>cAg	p.L262Q		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	262						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACCAACGTGCTGCCCCACTCC	0.537																																						dbGAP											0													21.0	19.0	20.0					1																	248616883		2179	4264	6443	-	-	-	SO:0001583	missense	0			BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.785T>A	1.37:g.248616883T>A	ENSP00000343062:p.Leu262Gln		B2RNM1|B9EH01	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L262Q	ENST00000342927.3	37	c.785	CCDS31116.1	1	.	.	.	.	.	.	.	.	.	.	t	9.878	1.200859	0.22121	.	.	ENSG00000196240	ENST00000342927	T	0.37584	1.19	3.5	2.26	0.28386	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35291	N	0.003307	T	0.28962	0.0719	N	0.04260	-0.245	0.19300	N	0.999975	D	0.89917	1.0	D	0.97110	1.0	T	0.06092	-1.0846	10	0.30078	T	0.28	.	5.2576	0.15555	0.1723:0.0:0.1769:0.6508	.	262	Q6IF00	OR2T2_HUMAN	Q	262	ENSP00000343062:L262Q	ENSP00000343062:L262Q	L	+	2	0	OR2T2	246683506	0.000000	0.05858	0.864000	0.33941	0.263000	0.26337	0.284000	0.18864	1.431000	0.47355	0.374000	0.22700	CTG	OR2T2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196240		0.537	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T2	HGNC	protein_coding	OTTHUMT00000097421.1	34	0.00	0	T	NM_001004136		248616883	248616883	+1	no_errors	ENST00000342927	ensembl	human	known	69_37n	missense	173	12.12	24	SNP	0.339	A
ORM2	5005	genome.wustl.edu	37	9	117092701	117092701	+	Intron	SNP	C	C	A	rs117654479		TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr9:117092701C>A	ENST00000431067.2	+	2	150				ORM2_ENST00000412657.1_Missense_Mutation_p.P173T	NM_000608.2	NP_000599.1	P19652	A1AG2_HUMAN	orosomucoid 2						acute-phase response (GO:0006953)|regulation of immune system process (GO:0002682)|transport (GO:0006810)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(1)	7		Myeloproliferative disorder(63;0.163)			Chlorpromazine(DB00477)|Oxycodone(DB00497)|Thalidomide(DB01041)	ACCAGCTCCCCCCTTCTCCCC	0.517																																					NSCLC(65;867 1308 1814 2391 12508)	dbGAP											0													34.0	62.0	53.0					9																	117092701		1889	4241	6130	-	-	-	SO:0001627	intron_variant	0				CCDS6804.1	9q32	2013-09-19			ENSG00000228278	ENSG00000228278		"""Lipocalins"""	8499	protein-coding gene	gene with protein product	"""alpha-1-acid glycoprotein, type 2"""	138610				4711474, 2970990	Standard	NM_000608		Approved	AGP-B, AGP-B', AGP2		P19652	OTTHUMG00000021014	ENST00000431067.2:c.115-13C>A	9.37:g.117092701C>A			B2R5L2|Q16571|Q5T538|Q6IB74	Missense_Mutation	SNP	NULL	p.P173T	ENST00000431067.2	37	c.517	CCDS6804.1	9	493	0.22573260073260074	219	0.4451219512195122	59	0.16298342541436464	116	0.20279720279720279	99	0.13060686015831136	-	1.549	-0.539706	0.04053	.	.	ENSG00000228278	ENST00000412657	T	0.39787	1.06	2.74	-5.48	0.02592	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.33445	-0.9868	5	0.02654	T	1	.	0.6687	0.00855	0.205:0.2469:0.1554:0.3927	.	.	.	.	T	173	ENSP00000407099:P173T	ENSP00000407099:P173T	P	+	1	0	ORM2	116132522	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.635000	0.05471	-2.017000	0.00944	-3.378000	0.00040	CCC	ORM2	-	NULL	ENSG00000228278		0.517	ORM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORM2	HGNC	protein_coding	OTTHUMT00000055432.1	71	0.00	0	C	NM_000608		117092701	117092701	+1	no_errors	ENST00000412657	ensembl	human	known	69_37n	missense	58	17.14	12	SNP	0.000	A
PIWIL1	9271	genome.wustl.edu	37	12	130827144	130827144	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr12:130827144G>A	ENST00000245255.3	+	2	280	c.8G>A	c.(7-9)gGg>gAg	p.G3E		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	3					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)	p.G3E(1)		breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		ACAATGACTGGGAGAGCCCGA	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											27.0	36.0	33.0					12																	130827144		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.8G>A	12.37:g.130827144G>A	ENSP00000245255:p.Gly3Glu		A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.G3E	ENST00000245255.3	37	c.8	CCDS9268.1	12	.	.	.	.	.	.	.	.	.	.	G	18.90	3.722174	0.68959	.	.	ENSG00000125207	ENST00000245255;ENST00000546060;ENST00000539400;ENST00000539995;ENST00000535956;ENST00000542723	T;T;T;T;T;T	0.09630	2.96;2.96;2.96;2.96;2.96;2.96	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.37293	0.0998	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.20273	-1.0280	10	0.62326	D	0.03	-27.9058	17.761	0.88464	0.0:0.0:1.0:0.0	.	3;3	Q96J94;Q96J94-2	PIWL1_HUMAN;.	E	3	ENSP00000245255:G3E;ENSP00000442086:G3E;ENSP00000440677:G3E;ENSP00000439096:G3E;ENSP00000444353:G3E;ENSP00000438582:G3E	ENSP00000245255:G3E	G	+	2	0	PIWIL1	129393097	1.000000	0.71417	0.954000	0.39281	0.821000	0.46438	7.867000	0.87062	2.421000	0.82119	0.655000	0.94253	GGG	PIWIL1	-	pfam_GAGE	ENSG00000125207		0.488	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	HGNC	protein_coding	OTTHUMT00000399510.1	97	0.00	0	G			130827144	130827144	+1	no_errors	ENST00000245255	ensembl	human	known	69_37n	missense	69	26.60	25	SNP	1.000	A
C10orf55	414236	genome.wustl.edu	37	10	75673437	75673438	+	Intron	INS	-	-	G	rs549461157|rs145070893	byFrequency	TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr10:75673437_75673438insG	ENST00000409178.1	-	3	268				PLAU_ENST00000372762.4_Frame_Shift_Ins_p.R165fs|PLAU_ENST00000494287.1_3'UTR|PLAU_ENST00000372764.3_Frame_Shift_Ins_p.R201fs|C10orf55_ENST00000412307.2_Intron|PLAU_ENST00000446342.1_Frame_Shift_Ins_p.R184fs	NM_001001791.2	NP_001001791.2	Q5SWW7	CJ055_HUMAN	chromosome 10 open reading frame 55											endometrium(1)	1	Prostate(51;0.0112)					CAGGAGGCACCGGGGGGGCTCT	0.589																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS53541.1	10q22.2	2012-05-24			ENSG00000222047	ENSG00000222047			31008	protein-coding gene	gene with protein product							Standard	NM_001001791		Approved	bA417O11.3	uc001jvz.2	Q5SWW7	OTTHUMG00000018496	ENST00000409178.1:c.73-604->C	10.37:g.75673444_75673444dupG			Q3KRG4|Q8NAK4	Frame_Shift_Ins	INS	pfam_Peptidase_S1_S6,pfam_Kringle,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1_S6,pfscan_EG-like_dom,pfscan_Kringle,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.S204fs	ENST00000409178.1	37	c.601_602	CCDS53541.1	10																																																																																			PLAU	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000122861		0.589	C10orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAU	HGNC	protein_coding	OTTHUMT00000048746.1	24	0.00	0	-	NM_001001791		75673437	75673438	+1	no_errors	ENST00000372764	ensembl	human	known	69_37n	frame_shift_ins	23	11.54	3	INS	0.156:0.201	G
POC5	134359	genome.wustl.edu	37	5	74998503	74998503	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr5:74998503C>A	ENST00000428202.2	-	5	629	c.440G>T	c.(439-441)aGc>aTc	p.S147I	POC5_ENST00000510798.1_Missense_Mutation_p.S30I|POC5_ENST00000514838.2_Missense_Mutation_p.S119I|POC5_ENST00000446329.2_Missense_Mutation_p.S122I|POC5_ENST00000504862.1_5'UTR|POC5_ENST00000380475.2_Missense_Mutation_p.S30I	NM_001099271.1	NP_001092741.1	Q8NA72	POC5_HUMAN	POC5 centriolar protein	147					cell cycle (GO:0007049)	centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.S121I(1)|p.S147I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						AAGAAAATCGCTCACAAGTAT	0.393																																						dbGAP											2	Substitution - Missense(2)	breast(2)											92.0	87.0	88.0					5																	74998503		1890	4120	6010	-	-	-	SO:0001583	missense	0			AK093098	CCDS47236.1, CCDS47237.1	5q13.3	2013-08-05	2013-08-05	2010-03-26	ENSG00000152359	ENSG00000152359			26658	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 37"", ""POC5 centriolar protein homolog (Chlamydomonas)"""	C5orf37		19349582	Standard	NM_152408		Approved	FLJ35779, MGC120442, MGC120443, MGC120444, hPOC5	uc003keh.4	Q8NA72	OTTHUMG00000162487	ENST00000428202.2:c.440G>T	5.37:g.74998503C>A	ENSP00000410216:p.Ser147Ile		B4DJG7|Q494X7|Q494X9|Q6P085	Missense_Mutation	SNP	NULL	p.S147I	ENST00000428202.2	37	c.440	CCDS47236.1	5	.	.	.	.	.	.	.	.	.	.	C	7.366	0.625742	0.14257	.	.	ENSG00000152359	ENST00000428202;ENST00000514838;ENST00000380475;ENST00000510798;ENST00000446329;ENST00000503835;ENST00000502826;ENST00000506164	T;T;T;T;T	0.46451	1.89;1.49;0.87;0.87;1.89	5.65	-0.654	0.11443	.	0.562558	0.20448	N	0.092145	T	0.29652	0.0740	L	0.44542	1.39	0.09310	N	1	P;B;B	0.50443	0.935;0.135;0.135	B;B;B	0.40256	0.324;0.054;0.054	T	0.26121	-1.0112	10	0.62326	D	0.03	-1.3549	8.6268	0.33895	0.0:0.1703:0.5696:0.26	.	30;147;122	Q8NA72-2;Q8NA72;Q8NA72-3	.;POC5_HUMAN;.	I	147;119;30;30;122;30;30;30	ENSP00000410216:S147I;ENSP00000420971:S119I;ENSP00000369842:S30I;ENSP00000426796:S30I;ENSP00000399481:S122I	ENSP00000369842:S30I	S	-	2	0	POC5	75034259	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	0.145000	0.16157	0.214000	0.20742	0.563000	0.77884	AGC	POC5	-	NULL	ENSG00000152359		0.393	POC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POC5	HGNC	protein_coding	OTTHUMT00000369124.1	292	0.00	0	C	NM_152408		74998503	74998503	-1	no_errors	ENST00000428202	ensembl	human	known	69_37n	missense	168	43.05	127	SNP	0.000	A
RIF1	55183	genome.wustl.edu	37	2	152320145	152320145	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr2:152320145A>T	ENST00000243326.5	+	29	4594	c.4111A>T	c.(4111-4113)Aat>Tat	p.N1371Y	RIF1_ENST00000428287.2_Missense_Mutation_p.N1371Y|RIF1_ENST00000444746.2_Missense_Mutation_p.N1371Y|RIF1_ENST00000453091.2_Missense_Mutation_p.N1371Y|RIF1_ENST00000430328.2_Missense_Mutation_p.N1371Y			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.N1371Y(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		ATTGGAAACTAATACTGTAGA	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											64.0	70.0	68.0					2																	152320145		2200	4300	6500	-	-	-	SO:0001583	missense	0			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.4111A>T	2.37:g.152320145A>T	ENSP00000243326:p.Asn1371Tyr		A0AVS0|Q9NS16	Missense_Mutation	SNP	pfam_Rif1_N,superfamily_ARM-type_fold	p.N1371Y	ENST00000243326.5	37	c.4111	CCDS2194.1	2	.	.	.	.	.	.	.	.	.	.	A	7.822	0.718048	0.15372	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58	4.78	2.39	0.29439	.	1.569420	0.03029	N	0.151802	T	0.33789	0.0875	L	0.54323	1.7	0.09310	N	0.999991	P;P	0.51351	0.925;0.944	B;B	0.41813	0.26;0.367	T	0.32955	-0.9887	10	0.62326	D	0.03	-0.6475	8.4049	0.32608	0.835:0.0:0.165:0.0	.	1371;1371	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	Y	1371	ENSP00000390181:N1371Y;ENSP00000414615:N1371Y;ENSP00000415691:N1371Y;ENSP00000243326:N1371Y;ENSP00000416123:N1371Y	ENSP00000243326:N1371Y	N	+	1	0	RIF1	152028391	0.000000	0.05858	0.013000	0.15412	0.111000	0.19643	0.230000	0.17852	0.788000	0.33755	0.455000	0.32223	AAT	RIF1	-	NULL	ENSG00000080345		0.348	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RIF1	HGNC	protein_coding	OTTHUMT00000254836.3	70	0.00	0	A			152320145	152320145	+1	no_errors	ENST00000243326	ensembl	human	known	69_37n	missense	35	46.97	31	SNP	0.024	T
RP1L1	94137	genome.wustl.edu	37	8	10466220	10466220	+	Silent	SNP	G	G	T			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr8:10466220G>T	ENST00000382483.3	-	4	5611	c.5388C>A	c.(5386-5388)ggC>ggA	p.G1796G		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1876					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.G1796G(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TTTCACTTATGCCCTCTCCCT	0.572																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											183.0	201.0	195.0					8																	10466220		2093	4205	6298	-	-	-	SO:0001819	synonymous_variant	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5388C>A	8.37:g.10466220G>T			Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.G1796	ENST00000382483.3	37	c.5388	CCDS43708.1	8																																																																																			RP1L1	-	NULL	ENSG00000183638		0.572	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	151	0.00	0	G			10466220	10466220	-1	no_errors	ENST00000382483	ensembl	human	known	69_37n	silent	37	41.27	26	SNP	0.000	T
SCAF1	58506	genome.wustl.edu	37	19	50158041	50158042	+	Frame_Shift_Ins	INS	-	-	C	rs149487378		TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr19:50158041_50158042insC	ENST00000360565.3	+	9	3656_3657	c.3532_3533insC	c.(3532-3534)accfs	p.T1178fs		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	1178					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		CTGCGGTTCGACCCCCCCCACC	0.693																																						dbGAP											0										36,4184		1,34,2075						4.2	0.8			26	32,8138		0,32,4053	no	frameshift	SCAF1	NM_021228.2		1,66,6128	A1A1,A1R,RR		0.3917,0.8531,0.5488				68,12322				-	-	-	SO:0001589	frameshift_variant	0			AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.3540dupC	19.37:g.50158049_50158049dupC	ENSP00000353769:p.Thr1178fs		Q7Z5V7|Q8WVA1|Q9NR59	Frame_Shift_Ins	INS	NULL	p.T1181fs	ENST00000360565.3	37	c.3532_3533	CCDS33074.1	19																																																																																			SCAF1	-	NULL	ENSG00000126461		0.693	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF1	HGNC	protein_coding	OTTHUMT00000465764.1	34	0.00	0	-	NM_021228		50158041	50158042	+1	no_errors	ENST00000360565	ensembl	human	known	69_37n	frame_shift_ins	38	13.64	6	INS	0.839:0.934	C
SERPINA1	5265	genome.wustl.edu	37	14	94845800	94845800	+	Splice_Site	SNP	C	C	T			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr14:94845800C>T	ENST00000448921.1	-	6	1638		c.e6+1		SERPINA1_ENST00000449399.3_Splice_Site|SERPINA1_ENST00000393087.4_Splice_Site|SERPINA1_ENST00000437397.1_Splice_Site|SERPINA1_ENST00000393088.4_Splice_Site|SERPINA1_ENST00000402629.1_Missense_Mutation_p.V356M|SERPINA1_ENST00000355814.4_Splice_Site|SERPINA1_ENST00000440909.1_Splice_Site|SERPINA1_ENST00000404814.4_Splice_Site	NM_001002236.2|NM_001127701.1|NM_001127703.1|NM_001127704.1|NM_001127705.1	NP_001002236.1|NP_001121173.1|NP_001121175.1|NP_001121176.1|NP_001121177.1	P01009	A1AT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1						acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of proteolysis (GO:0030162)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.?(2)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|skin(6)|stomach(1)	24		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		GGTGATCTCACCTTGGAGAGC	0.587																																						dbGAP											2	Unknown(2)	breast(1)|skin(1)											103.0	97.0	99.0					14																	94845800		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X01683	CCDS9925.1	14q32.1	2014-02-18	2005-08-18		ENSG00000197249	ENSG00000197249		"""Serine (or cysteine) peptidase inhibitors"""	8941	protein-coding gene	gene with protein product	"""protease inhibitor 1 (anti-elastase), alpha-1-antitrypsin"""	107400	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1"""	PI		24172014	Standard	NM_000295		Approved	AAT, A1A, PI1, alpha-1-antitrypsin, A1AT, alpha1AT	uc010aux.3	P01009	OTTHUMG00000150355	ENST00000448921.1:c.1065+1G>A	14.37:g.94845800C>T			A6PX14|B2RDQ8|Q0PVP5|Q13672|Q53XB8|Q5U0M1|Q7M4R2|Q86U18|Q86U19|Q96BF9|Q96ES1|Q9P1P0|Q9UCE6|Q9UCM3	Splice_Site	SNP	-	e3+1	ENST00000448921.1	37	c.1065+1	CCDS9925.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.9|22.9	4.350978|4.350978	0.82132|0.82132	.|.	.|.	ENSG00000197249|ENSG00000197249	ENST00000440909;ENST00000448921;ENST00000437397;ENST00000355814;ENST00000393087;ENST00000393088;ENST00000404814;ENST00000449399|ENST00000402629	.|D	.|0.87029	.|-2.2	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	.|.	.|.	.|.	.|.	.|D	.|0.92831	.|0.7720	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|D	.|0.55385	.|0.971	.|D	.|0.64321	.|0.924	.|D	.|0.93408	.|0.6766	.|8	.|0.87932	.|D	.|0	.|.	16.4139|16.4139	0.83728|0.83728	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|356	.|P01009-2	.|.	.|M	-1|356	.|ENSP00000386094:V356M	.|ENSP00000386094:V356M	.|V	-|-	.|1	.|0	SERPINA1|SERPINA1	93915553|93915553	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.957000|0.957000	0.61999|0.61999	5.750000|5.750000	0.68712|0.68712	2.702000|2.702000	0.92279|0.92279	0.655000|0.655000	0.94253|0.94253	.|GTG	SERPINA1	-	-	ENSG00000197249		0.587	SERPINA1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA1	HGNC	protein_coding	OTTHUMT00000317768.2	79	0.00	0	C	NM_001002235	Intron	94845800	94845800	-1	no_errors	ENST00000355814	ensembl	human	known	69_37n	splice_site	77	41.67	55	SNP	1.000	T
SMARCC2	6601	genome.wustl.edu	37	12	56559112	56559113	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr12:56559112_56559113insG	ENST00000267064.4	-	26	3214_3215	c.3128_3129insC	c.(3127-3129)cctfs	p.P1043fs	SMARCC2_ENST00000347471.4_Frame_Shift_Ins_p.P1074fs|RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000550164.1_Frame_Shift_Ins_p.P1074fs|SMARCC2_ENST00000394023.3_Frame_Shift_Ins_p.P1074fs	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	1043	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CATGGGGTCCAGGGGGGGGAAC	0.574																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.3129dupC	12.37:g.56559120_56559120dupG	ENSP00000267064:p.Pro1043fs		F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Frame_Shift_Ins	INS	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.G1044fs	ENST00000267064.4	37	c.3129_3128	CCDS8907.1	12																																																																																			SMARCC2	-	NULL	ENSG00000139613		0.574	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	HGNC	protein_coding	OTTHUMT00000408370.1	19	0.00	0	-			56559112	56559113	-1	no_errors	ENST00000267064	ensembl	human	known	69_37n	frame_shift_ins	34	10.53	4	INS	1.000:1.000	G
SPATA22	84690	genome.wustl.edu	37	17	3346557	3346557	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr17:3346557C>A	ENST00000573128.1	-	8	1294	c.811G>T	c.(811-813)Gat>Tat	p.D271Y	SPATA22_ENST00000268981.5_Intron|SPATA22_ENST00000355380.4_Missense_Mutation_p.D228Y|SPATA22_ENST00000575375.1_Missense_Mutation_p.D271Y|SPATA22_ENST00000541913.1_Missense_Mutation_p.D255Y|SPATA22_ENST00000397168.3_Missense_Mutation_p.D271Y|SPATA22_ENST00000572969.1_Missense_Mutation_p.D271Y			Q8NHS9	SPT22_HUMAN	spermatogenesis associated 22	271					fertilization (GO:0009566)|gamete generation (GO:0007276)|meiotic DNA repair synthesis (GO:0000711)|regulation of meiotic cell cycle (GO:0051445)|reproductive system development (GO:0061458)|synapsis (GO:0007129)	chromosome (GO:0005694)		p.D271Y(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)	19						ACAGCTGAATCAAGAACAGCT	0.333																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	53.0	56.0					17																	3346557		2203	4298	6501	-	-	-	SO:0001583	missense	0			AY035868	CCDS11027.1, CCDS54066.1, CCDS54067.1	17p13.3	2005-12-19							30705	protein-coding gene	gene with protein product						12477932	Standard	NM_001170696		Approved	NYD-SP20	uc002fvn.3	Q8NHS9		ENST00000573128.1:c.811G>T	17.37:g.3346557C>A	ENSP00000459580:p.Asp271Tyr		B4DXB1|D3DTI9|J3KN63|Q969H3|Q96JT4	Missense_Mutation	SNP	NULL	p.D271Y	ENST00000573128.1	37	c.811	CCDS11027.1	17	.	.	.	.	.	.	.	.	.	.	C	18.01	3.528761	0.64860	.	.	ENSG00000141255	ENST00000355380;ENST00000397168;ENST00000541913	T;T;T	0.80738	-1.41;-1.41;-1.41	5.32	4.33	0.51752	.	0.071692	0.49305	N	0.000141	D	0.83825	0.5338	L	0.29908	0.895	0.39214	D	0.963371	D;D;D	0.89917	0.964;0.964;1.0	P;P;D	0.91635	0.593;0.593;0.999	D	0.86805	0.1994	10	0.87932	D	0	-21.751	14.6088	0.68501	0.1471:0.8529:0.0:0.0	.	255;228;271	F5GWB9;Q8NHS9-2;Q8NHS9	.;.;SPT22_HUMAN	Y	228;271;255	ENSP00000347541:D228Y;ENSP00000380354:D271Y;ENSP00000441920:D255Y	ENSP00000347541:D228Y	D	-	1	0	SPATA22	3293307	0.999000	0.42202	0.978000	0.43139	0.924000	0.55760	4.425000	0.59875	1.349000	0.45751	0.557000	0.71058	GAT	SPATA22	-	NULL	ENSG00000141255		0.333	SPATA22-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SPATA22	HGNC	protein_coding	OTTHUMT00000438067.2	99	0.00	0	C	NM_032598		3346557	3346557	-1	no_errors	ENST00000397168	ensembl	human	known	69_37n	missense	48	26.15	17	SNP	0.994	A
TUBBP5	643224	genome.wustl.edu	37	9	141070909	141070909	+	RNA	SNP	A	A	G	rs200088126		TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr9:141070909A>G	ENST00000503395.1	+	0	1684									tubulin, beta pseudogene 5									p.S176S(1)									CCAAGGTGTCAGACACCGTGG	0.537																																						dbGAP											1	Substitution - coding silent(1)	kidney(1)																																								-	-	-			0			AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141070909A>G				RNA	SNP	-	NULL	ENST00000503395.1	37	NULL		9																																																																																			TUBBP5	-	-	ENSG00000159247		0.537	TUBBP5-003	KNOWN	basic	processed_transcript	TUBBP5	HGNC	pseudogene	OTTHUMT00000373087.1	48	0.00	0	A	NR_027156		141070909	141070909	+1	no_errors	ENST00000290377	ensembl	human	known	69_37n	rna	23	25.81	8	SNP	0.988	G
ZNF443	10224	genome.wustl.edu	37	19	12541421	12541421	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr19:12541421T>C	ENST00000301547.5	-	4	1762	c.1565A>G	c.(1564-1566)cAt>cGt	p.H522R	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	522					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H522R(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						AGTCCTTTTATGTCGAGAAAG	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											99.0	96.0	97.0					19																	12541421		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.1565A>G	19.37:g.12541421T>C	ENSP00000301547:p.His522Arg			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H522R	ENST00000301547.5	37	c.1565	CCDS32918.1	19	.	.	.	.	.	.	.	.	.	.	T	14.39	2.521869	0.44866	.	.	ENSG00000180855	ENST00000301547;ENST00000411622	D	0.86865	-2.18	1.37	1.37	0.22104	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94618	0.8265	H	0.95884	3.735	0.21933	N	0.999468	D	0.89917	1.0	D	0.91635	0.999	D	0.85029	0.0916	9	0.87932	D	0	.	8.1902	0.31363	0.0:0.0:0.0:1.0	.	522	Q9Y2A4	ZN443_HUMAN	R	522	ENSP00000301547:H522R	ENSP00000301547:H522R	H	-	2	0	ZNF443	12402421	1.000000	0.71417	0.002000	0.10522	0.026000	0.11368	6.045000	0.71020	0.893000	0.36288	0.378000	0.23410	CAT	ZNF443	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000180855		0.383	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF443	HGNC	protein_coding	OTTHUMT00000344084.1	189	0.00	0	T	NM_005815		12541421	12541421	-1	no_errors	ENST00000301547	ensembl	human	known	69_37n	missense	174	35.56	96	SNP	0.452	C
ZNF420	147923	genome.wustl.edu	37	19	37619086	37619086	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr19:37619086A>G	ENST00000337995.3	+	5	1408	c.1193A>G	c.(1192-1194)aAg>aGg	p.K398R	ZNF585A_ENST00000588723.1_Intron|ZNF420_ENST00000304239.7_Missense_Mutation_p.K398R|CTC-454I21.4_ENST00000587645.1_RNA	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420	398					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K398R(1)		breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAATGTGGAAAGATGTTTAGT	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	89.0	89.0					19																	37619086		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.1193A>G	19.37:g.37619086A>G	ENSP00000338770:p.Lys398Arg		B2RDY6|Q96ML5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K398R	ENST00000337995.3	37	c.1193	CCDS12498.1	19	.	.	.	.	.	.	.	.	.	.	A	13.27	2.186135	0.38609	.	.	ENSG00000197050	ENST00000304239;ENST00000337995	T;T	0.26223	1.75;1.75	4.24	3.18	0.36537	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25195	0.0612	L	0.57130	1.785	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.05484	-1.0882	9	0.66056	D	0.02	.	8.9121	0.35559	0.8327:0.0:0.0:0.1673	.	398	Q8TAQ5	ZN420_HUMAN	R	398	ENSP00000306102:K398R;ENSP00000338770:K398R	ENSP00000306102:K398R	K	+	2	0	ZNF420	42310926	0.912000	0.30974	0.980000	0.43619	0.946000	0.59487	2.258000	0.43249	0.622000	0.30249	0.533000	0.62120	AAG	ZNF420	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197050		0.418	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF420	HGNC	protein_coding	OTTHUMT00000109587.3	139	0.00	0	A	NM_144689		37619086	37619086	+1	no_errors	ENST00000337995	ensembl	human	known	69_37n	missense	128	37.25	76	SNP	0.995	G
ZNF606	80095	genome.wustl.edu	37	19	58489891	58489891	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr19:58489891C>G	ENST00000341164.4	-	7	2777	c.2157G>C	c.(2155-2157)gaG>gaC	p.E719D	ZNF606_ENST00000536132.1_Missense_Mutation_p.E629D	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	719					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E719D(2)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		GGGATGAACTCTCATTAAATG	0.368																																						dbGAP											2	Substitution - Missense(2)	breast(2)											125.0	129.0	127.0					19																	58489891		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.2157G>C	19.37:g.58489891C>G	ENSP00000343617:p.Glu719Asp		A8KAN2|Q8NE04|Q96JH5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E719D	ENST00000341164.4	37	c.2157	CCDS12968.1	19	.	.	.	.	.	.	.	.	.	.	C	4.518	0.096208	0.08681	.	.	ENSG00000166704	ENST00000341164;ENST00000536132	T;T	0.35973	1.28;1.28	4.42	2.31	0.28768	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45867	D	0.000326	T	0.11537	0.0281	N	0.02296	-0.605	0.25312	N	0.989195	B	0.24651	0.108	B	0.26614	0.071	T	0.08889	-1.0700	10	0.28530	T	0.3	.	1.2863	0.02051	0.1778:0.4535:0.1718:0.1969	.	719	Q8WXB4	ZN606_HUMAN	D	719;629	ENSP00000343617:E719D;ENSP00000445624:E629D	ENSP00000343617:E719D	E	-	3	2	ZNF606	63181703	0.000000	0.05858	1.000000	0.80357	0.958000	0.62258	-1.064000	0.03461	1.191000	0.43056	0.555000	0.69702	GAG	ZNF606	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000166704		0.368	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF606	HGNC	protein_coding	OTTHUMT00000405961.1	330	0.00	0	C	NM_025027		58489891	58489891	-1	no_errors	ENST00000341164	ensembl	human	known	69_37n	missense	300	21.47	82	SNP	0.999	G
ZNF324	25799	genome.wustl.edu	37	19	58983206	58983206	+	Silent	SNP	C	C	T			TCGA-BH-A0HU-01A-11W-A050-09	TCGA-BH-A0HU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b46f2619-5937-4847-bb38-fe6022225ab9	630a5659-c666-4da0-bb90-969cf071fde3	g.chr19:58983206C>T	ENST00000536459.2	+	4	2056	c.1347C>T	c.(1345-1347)ggC>ggT	p.G449G	ZNF324_ENST00000196482.3_Silent_p.G449G|ZNF324_ENST00000535298.1_Silent_p.G226G|ZNF446_ENST00000596341.1_5'Flank			O75467	Z324A_HUMAN	zinc finger protein 324	449					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G449G(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(2)|prostate(2)|urinary_tract(2)	16		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		TGCACACGGGCGAGCGGCCCT	0.687																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											43.0	45.0	45.0					19																	58983206		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF060503	CCDS12981.1	19q13.43	2013-01-08				ENSG00000083812		"""Zinc fingers, C2H2-type"", ""-"""	14096	protein-coding gene	gene with protein product							Standard	NM_014347		Approved	ZF5128, ZNF324A	uc002qsw.2	O75467		ENST00000536459.2:c.1347C>T	19.37:g.58983206C>T			B3KRX1	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G449	ENST00000536459.2	37	c.1347	CCDS12981.1	19																																																																																			ZNF324	-	pfscan_Znf_C2H2	ENSG00000083812		0.687	ZNF324-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF324	HGNC	protein_coding	OTTHUMT00000467044.1	9	0.00	0	C	NM_014347		58983206	58983206	+1	no_errors	ENST00000196482	ensembl	human	known	69_37n	silent	9	40.00	6	SNP	0.023	T
