#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB5	340273	genome.wustl.edu	37	7	20691242	20691242	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr7:20691242C>G	ENST00000404938.2	+	13	2184	c.1532C>G	c.(1531-1533)cCt>cGt	p.P511R	ABCB5_ENST00000406935.1_Missense_Mutation_p.P66R|ABCB5_ENST00000258738.6_Missense_Mutation_p.P66R|ABCB5_ENST00000477094.1_3'UTR|ABCB5_ENST00000443026.2_Missense_Mutation_p.P66R	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	511	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)	p.P66R(2)|p.P511R(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						ATGGAGTTTCCTAATGTGAGT	0.418																																						dbGAP											3	Substitution - Missense(3)	breast(3)											223.0	178.0	194.0					7																	20691242		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.1532C>G	7.37:g.20691242C>G	ENSP00000384881:p.Pro511Arg		A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.P66R	ENST00000404938.2	37	c.197	CCDS55090.1	7	.	.	.	.	.	.	.	.	.	.	C	24.1	4.488816	0.84962	.	.	ENSG00000004846	ENST00000404938;ENST00000443026;ENST00000406935;ENST00000258738	D;D;D;D	0.92299	-1.93;-3.01;-3.01;-1.93	4.2	4.2	0.49525	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.64402	D	0.000016	D	0.96253	0.8778	M	0.84846	2.72	0.80722	D	1	D;D;D;D	0.89917	0.993;1.0;1.0;0.991	P;D;D;P	0.97110	0.868;1.0;0.998;0.792	D	0.96739	0.9545	10	0.87932	D	0	.	16.7954	0.85600	0.0:1.0:0.0:0.0	.	66;511;66;66	B5MD19;A7BKA4;Q2M3G0;Q2M3G0-2	.;.;ABCB5_HUMAN;.	R	511;66;66;66	ENSP00000384881:P511R;ENSP00000406730:P66R;ENSP00000383899:P66R;ENSP00000258738:P66R	ENSP00000258738:P66R	P	+	2	0	ABCB5	20657767	1.000000	0.71417	0.996000	0.52242	0.967000	0.64934	7.508000	0.81686	2.634000	0.89283	0.591000	0.81541	CCT	ABCB5	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000004846		0.418	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	ABCB5	HGNC	protein_coding	OTTHUMT00000326736.2	202	0.00	0	C	NM_178559		20691242	20691242	+1	no_errors	ENST00000258738	ensembl	human	known	69_37n	missense	110	19.12	26	SNP	1.000	G
ADAM11	4185	genome.wustl.edu	37	17	42856604	42856604	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr17:42856604G>A	ENST00000200557.6	+	26	2460	c.2291G>A	c.(2290-2292)gGa>gAa	p.G764E	ADAM11_ENST00000535346.1_Missense_Mutation_p.G564E	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	764					integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G764E(2)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				ATTCGCCGAGGAAGGTACGAC	0.602											OREG0024465	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											2	Substitution - Missense(2)	breast(2)											141.0	115.0	123.0					17																	42856604		2203	4300	6503	-	-	-	SO:0001583	missense	0			D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.2291G>A	17.37:g.42856604G>A	ENSP00000200557:p.Gly764Glu	911	Q14808|Q14809|Q14810	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,prints_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.G764E	ENST00000200557.6	37	c.2291	CCDS11486.1	17	.	.	.	.	.	.	.	.	.	.	G	12.70	2.015698	0.35606	.	.	ENSG00000073670	ENST00000200557;ENST00000535346	T;T	0.01947	4.54;4.93	4.16	4.16	0.48862	.	0.162179	0.39759	N	0.001261	T	0.02571	0.0078	L	0.41236	1.265	0.80722	D	1	B;B	0.31968	0.048;0.349	B;B	0.32289	0.038;0.143	T	0.52946	-0.8507	10	0.08179	T	0.78	.	15.7481	0.77962	0.0:0.0:1.0:0.0	.	564;764	B4DKD2;O75078	.;ADA11_HUMAN	E	764;564	ENSP00000200557:G764E;ENSP00000443773:G564E	ENSP00000200557:G764E	G	+	2	0	ADAM11	40212130	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.769000	0.74985	2.307000	0.77673	0.561000	0.74099	GGA	ADAM11	-	NULL	ENSG00000073670		0.602	ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM11	HGNC	protein_coding	OTTHUMT00000444531.1	134	0.00	0	G	NM_002390		42856604	42856604	+1	no_errors	ENST00000200557	ensembl	human	known	69_37n	missense	43	25.86	15	SNP	1.000	A
AFG3L1P	172	genome.wustl.edu	37	16	90048205	90048205	+	RNA	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr16:90048205G>A	ENST00000437774.1	+	0	536					NR_003226.1				AFG3-like AAA ATPase 1, pseudogene																		GGGATGACGAGGATTTCCGCA	0.443																																						dbGAP											0													69.0	63.0	65.0					16																	90048205		692	1591	2283	-	-	-			0			AJ001495		16q24.3	2013-10-17	2013-10-17	2010-10-28	ENSG00000223959	ENSG00000223959		"""ATPases / AAA-type"""	314	pseudogene	pseudogene		603020	"""AFG3 ATPase family gene 3-like 1 (S. cerevisiae), pseudogene"", ""AFG3 ATPase family member 3-like 1 (S. cerevisiae), pseudogene"""	AFG3, AFG3L1		9545647, 11549317	Standard	NR_003228		Approved		uc002fpz.1		OTTHUMG00000138987		16.37:g.90048205G>A				RNA	SNP	-	NULL	ENST00000437774.1	37	NULL		16																																																																																			AFG3L1P	-	-	ENSG00000223959		0.443	AFG3L1P-004	KNOWN	basic	processed_transcript	AFG3L1P	HGNC	pseudogene	OTTHUMT00000316791.1	116	0.00	0	G	NR_003226		90048205	90048205	+1	no_errors	ENST00000388970	ensembl	human	known	69_37n	rna	31	71.82	79	SNP	0.957	A
ALPP	250	genome.wustl.edu	37	2	233244985	233244985	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr2:233244985G>C	ENST00000392027.2	+	6	1016	c.747G>C	c.(745-747)agG>agC	p.R249S	AC068134.8_ENST00000441266.1_RNA|AC068134.8_ENST00000439072.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	249					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		GTGGGACCAGGCTGGACGGGA	0.627																																						dbGAP											0													102.0	99.0	100.0					2																	233244985		2203	4299	6502	-	-	-	SO:0001583	missense	0			M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.747G>C	2.37:g.233244985G>C	ENSP00000375881:p.Arg249Ser		P05188|P06861|Q53S78|Q96DB7	Missense_Mutation	SNP	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.R249S	ENST00000392027.2	37	c.747	CCDS2490.1	2	.	.	.	.	.	.	.	.	.	.	.	12.75	2.032260	0.35893	.	.	ENSG00000163283	ENST00000392027	D	0.96802	-4.13	2.31	1.39	0.22231	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.103873	0.64402	D	0.000005	D	0.97763	0.9266	M	0.92317	3.295	0.21184	N	0.999761	D	0.89917	1.0	D	0.97110	1.0	D	0.92399	0.5928	10	0.87932	D	0	.	3.7853	0.08698	0.2466:0.2054:0.548:0.0	.	249	P05187	PPB1_HUMAN	S	249	ENSP00000375881:R249S	ENSP00000375881:R249S	R	+	3	2	ALPP	232953229	0.000000	0.05858	0.002000	0.10522	0.024000	0.10985	-0.565000	0.05929	0.293000	0.22520	0.298000	0.19748	AGG	ALPP	-	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase	ENSG00000163283		0.627	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPP	HGNC	protein_coding	OTTHUMT00000257032.3	101	0.00	0	G	NM_001632		233244985	233244985	+1	no_errors	ENST00000392027	ensembl	human	known	69_37n	missense	68	15.00	12	SNP	0.005	C
ALPPL2	251	genome.wustl.edu	37	2	233273066	233273066	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr2:233273066G>C	ENST00000295453.3	+	6	790	c.738G>C	c.(736-738)agG>agC	p.R246S		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	246					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)	p.R246S(1)		breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	GTGGGACCAGGCTGGACGGGA	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											81.0	86.0	84.0					2																	233273066		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.738G>C	2.37:g.233273066G>C	ENSP00000295453:p.Arg246Ser		A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.R246S	ENST00000295453.3	37	c.738	CCDS2491.1	2	.	.	.	.	.	.	.	.	.	.	g	13.56	2.273439	0.40194	.	.	ENSG00000163286	ENST00000295453	D	0.96802	-4.13	3.37	1.42	0.22433	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.103873	0.64402	D	0.000005	D	0.97598	0.9213	M	0.92691	3.335	0.21802	N	0.999534	D	0.89917	1.0	D	0.97110	1.0	D	0.91638	0.5324	10	0.87932	D	0	.	0.9768	0.01427	0.3042:0.1573:0.3787:0.1598	.	246	P10696	PPBN_HUMAN	S	246	ENSP00000295453:R246S	ENSP00000295453:R246S	R	+	3	2	ALPPL2	232981310	0.000000	0.05858	0.003000	0.11579	0.009000	0.06853	-1.015000	0.03637	0.481000	0.27557	0.411000	0.27672	AGG	ALPPL2	-	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase	ENSG00000163286		0.617	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPPL2	HGNC	protein_coding	OTTHUMT00000257034.2	96	0.00	0	G	NM_031313		233273066	233273066	+1	no_errors	ENST00000295453	ensembl	human	known	69_37n	missense	17	63.04	29	SNP	0.019	C
AGAP1	116987	genome.wustl.edu	37	2	236877203	236877203	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr2:236877203G>T	ENST00000304032.8	+	13	2161	c.1581G>T	c.(1579-1581)aaG>aaT	p.K527N	AGAP1_ENST00000428334.2_Missense_Mutation_p.K366N|AGAP1_ENST00000409538.1_Missense_Mutation_p.K739N|AGAP1_ENST00000336665.5_Missense_Mutation_p.K474N	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	527	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)	p.K527N(2)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						CCAACAGAAAGAAGCACCGAA	0.622																																						dbGAP											2	Substitution - Missense(2)	breast(2)											47.0	58.0	54.0					2																	236877203		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.1581G>T	2.37:g.236877203G>T	ENSP00000307634:p.Lys527Asn		B2RTX7|Q541S5|Q6P9D7|Q9NV93	Nonsense_Mutation	SNP	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.E55*	ENST00000304032.8	37	c.163	CCDS33408.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.57|18.57	3.652762|3.652762	0.67472|0.67472	.|.	.|.	ENSG00000157985|ENSG00000157985	ENST00000448025;ENST00000418654|ENST00000304032;ENST00000336665;ENST00000409538;ENST00000428334	.|T;T;T;T	.|0.76709	.|-0.78;-1.04;-1.04;0.25	5.09|5.09	3.26|3.26	0.37387|0.37387	.|Pleckstrin homology domain (3);	.|0.116551	.|0.56097	.|D	.|0.000028	.|D	.|0.86418	.|0.5928	M|M	0.81112|0.81112	2.525|2.525	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.999;0.975	.|D;P	.|0.80764	.|0.994;0.901	.|D	.|0.87026	.|0.2132	.|10	.|0.87932	.|D	.|0	.|.	10.1389|10.1389	0.42723|0.42723	0.2183:0.0:0.7817:0.0|0.2183:0.0:0.7817:0.0	.|.	.|474;527	.|Q9UPQ3-2;Q9UPQ3	.|.;AGAP1_HUMAN	X|N	161;55|527;474;739;366	.|ENSP00000307634:K527N;ENSP00000338378:K474N;ENSP00000386897:K739N;ENSP00000411824:K366N	.|ENSP00000307634:K527N	E|K	+|+	1|3	0|2	AGAP1|AGAP1	236541942|236541942	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.453000|3.453000	0.52978|0.52978	1.135000|1.135000	0.42183|0.42183	0.650000|0.650000	0.86243|0.86243	GAA|AAG	AGAP1	-	NULL	ENSG00000157985		0.622	AGAP1-001	KNOWN	basic|CCDS	protein_coding	AGAP1	HGNC	protein_coding	OTTHUMT00000257076.2	70	0.00	0	G	NM_014914		236877203	236877203	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000418654	ensembl	human	novel	69_37n	nonsense	10	70.27	26	SNP	1.000	T
AMBRA1	55626	genome.wustl.edu	37	11	46563919	46563919	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr11:46563919T>G	ENST00000458649.2	-	7	2066	c.1648A>C	c.(1648-1650)Acc>Ccc	p.T550P	AMBRA1_ENST00000426438.1_Missense_Mutation_p.T550P|AMBRA1_ENST00000533727.1_Missense_Mutation_p.T460P|AMBRA1_ENST00000528950.1_Missense_Mutation_p.T550P|AMBRA1_ENST00000314845.3_Missense_Mutation_p.T460P|AMBRA1_ENST00000298834.3_Missense_Mutation_p.T550P|AMBRA1_ENST00000534300.1_Missense_Mutation_p.T550P			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	550					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)		p.T460P(2)|p.T550P(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		CTGTGTGGGGTGGGCTGGTGG	0.572																																						dbGAP											4	Substitution - Missense(4)	breast(4)											113.0	93.0	100.0					11																	46563919		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.1648A>C	11.37:g.46563919T>G	ENSP00000415327:p.Thr550Pro		A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T550P	ENST00000458649.2	37	c.1648		11	.	.	.	.	.	.	.	.	.	.	T	11.59	1.684685	0.29872	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000314823;ENST00000458649;ENST00000528950	T;T;T;T;T;T;T	0.71817	-0.44;-0.6;-0.18;-0.3;-0.18;-0.3;-0.3	5.91	5.91	0.95273	.	0.429424	0.28754	N	0.014260	T	0.51295	0.1666	N	0.12182	0.205	0.44652	D	0.997632	B;B;B;B;B;B	0.14438	0.003;0.005;0.005;0.001;0.01;0.0	B;B;B;B;B;B	0.09377	0.002;0.004;0.004;0.003;0.004;0.003	T	0.51980	-0.8636	10	0.87932	D	0	.	8.1201	0.30965	0.0:0.0693:0.1352:0.7956	.	550;550;550;460;460;460	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	P	460;460;550;550;550;460;550;550	ENSP00000318313:T460P;ENSP00000433372:T460P;ENSP00000431926:T550P;ENSP00000410899:T550P;ENSP00000298834:T550P;ENSP00000415327:T550P;ENSP00000433945:T550P	ENSP00000298834:T550P	T	-	1	0	AMBRA1	46520495	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.434000	0.52841	2.252000	0.74401	0.533000	0.62120	ACC	AMBRA1	-	NULL	ENSG00000110497		0.572	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	80	0.00	0	T	NM_017749		46563919	46563919	-1	no_errors	ENST00000458649	ensembl	human	known	69_37n	missense	35	32.69	17	SNP	1.000	G
ARHGEF1	9138	genome.wustl.edu	37	19	42396123	42396123	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr19:42396123G>T	ENST00000354532.3	+	5	401	c.253G>T	c.(253-255)Ggc>Tgc	p.G85C	ARHGEF1_ENST00000337665.4_Missense_Mutation_p.G100C|ARHGEF1_ENST00000599846.1_Missense_Mutation_p.G85C|ARHGEF1_ENST00000596957.1_3'UTR|ARHGEF1_ENST00000378152.4_Intron|ARHGEF1_ENST00000347545.4_Intron	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	85	RGSL.				cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G100C(2)		breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		CGACATGCTGGGCTCACTGGG	0.592																																						dbGAP											2	Substitution - Missense(2)	breast(2)											53.0	51.0	52.0					19																	42396123		2203	4300	6503	-	-	-	SO:0001583	missense	0			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.253G>T	19.37:g.42396123G>T	ENSP00000346532:p.Gly85Cys		O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.G100C	ENST00000354532.3	37	c.298	CCDS12591.1	19	.	.	.	.	.	.	.	.	.	.	G	10.38	1.335266	0.24253	.	.	ENSG00000076928	ENST00000354532;ENST00000316079;ENST00000337665	D;D	0.82984	-1.67;-1.67	3.9	-1.15	0.09709	Regulator of G protein signalling superfamily (1);Regulator of G protein signalling-like fold (1);	.	.	.	.	T	0.70561	0.3238	L	0.36672	1.1	0.09310	N	0.999999	B;B;B	0.20459	0.004;0.002;0.045	B;B;B	0.15484	0.002;0.003;0.013	T	0.59166	-0.7505	9	0.72032	D	0.01	.	3.4767	0.07587	0.4247:0.0:0.3991:0.1762	.	100;85;145	Q92888-3;Q92888;Q8NF33	.;ARHG1_HUMAN;.	C	85;121;100	ENSP00000346532:G85C;ENSP00000337261:G100C	ENSP00000323044:G121C	G	+	1	0	ARHGEF1	47087963	0.000000	0.05858	0.071000	0.20095	0.986000	0.74619	-0.571000	0.05889	-0.173000	0.10761	0.460000	0.39030	GGC	ARHGEF1	-	pfam_Regulat_G_prot_signal-like,superfamily_Regulat_G_prot_signal_superfam	ENSG00000076928		0.592	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF1	HGNC	protein_coding	OTTHUMT00000463360.1	40	0.00	0	G	NM_199002		42396123	42396123	+1	no_errors	ENST00000337665	ensembl	human	known	69_37n	missense	19	38.71	12	SNP	0.011	T
ARMCX5	64860	genome.wustl.edu	37	X	101857506	101857506	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chrX:101857506C>G	ENST00000604957.1	+	1	3059	c.437C>G	c.(436-438)aCt>aGt	p.T146S	ARMCX5_ENST00000536530.1_Missense_Mutation_p.T146S|ARMCX5_ENST00000246174.2_Missense_Mutation_p.T146S|ARMCX5_ENST00000541409.1_Missense_Mutation_p.T146S|ARMCX5_ENST00000537008.1_Missense_Mutation_p.T146S|ARMCX5_ENST00000372742.1_Missense_Mutation_p.T146S|RP4-769N13.6_ENST00000476910.2_RNA|RP4-769N13.7_ENST00000602441.1_RNA	NM_001168478.1	NP_001161950.1	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	146								p.T146S(2)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	22						AAGGCCAATACTGGGTCCAGA	0.453																																						dbGAP											2	Substitution - Missense(2)	breast(2)											203.0	178.0	186.0					X																	101857506		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14500.1	Xq22.1-q22.3	2014-03-21			ENSG00000125962	ENSG00000125962		"""Armadillo repeat containing"""	25772	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_022838		Approved	FLJ12969, GASP5	uc004ejh.3	Q6P1M9	OTTHUMG00000022062	ENST00000604957.1:c.437C>G	X.37:g.101857506C>G	ENSP00000474720:p.Thr146Ser		B3KU88|D3DX99|Q68DB4|Q9BVZ3|Q9H969	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.T146S	ENST00000604957.1	37	c.437	CCDS14500.1	X	.	.	.	.	.	.	.	.	.	.	C	2.124	-0.400722	0.04865	.	.	ENSG00000125962	ENST00000246174;ENST00000537008;ENST00000541409;ENST00000536530;ENST00000372742	T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16	3.5	-2.06	0.07298	.	0.949973	0.08663	N	0.912101	T	0.09379	0.0231	N	0.19112	0.55	0.09310	N	1	B	0.19331	0.035	B	0.12156	0.007	T	0.39272	-0.9622	10	0.09590	T	0.72	-0.3118	3.4931	0.07645	0.3518:0.3962:0.0:0.252	.	146	Q6P1M9	ARMX5_HUMAN	S	146	ENSP00000246174:T146S;ENSP00000439001:T146S;ENSP00000446385:T146S;ENSP00000445851:T146S;ENSP00000361827:T146S	ENSP00000246174:T146S	T	+	2	0	ARMCX5	101744162	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.773000	0.04689	-0.515000	0.06479	-0.380000	0.06706	ACT	ARMCX5	-	NULL	ENSG00000125962		0.453	ARMCX5-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARMCX5	HGNC	protein_coding	OTTHUMT00000469659.1	204	0.00	0	C	NM_022838		101857506	101857506	+1	no_errors	ENST00000246174	ensembl	human	known	69_37n	missense	107	26.03	38	SNP	0.000	G
ASXL3	80816	genome.wustl.edu	37	18	31319718	31319718	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr18:31319718G>T	ENST00000269197.5	+	11	2350	c.2350G>T	c.(2350-2352)Gat>Tat	p.D784Y		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	784	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D784Y(2)|p.D491Y(2)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CCCGCAGAAAGATGAGTCTTC	0.458																																						dbGAP											4	Substitution - Missense(4)	breast(4)											34.0	36.0	35.0					18																	31319718		1893	4116	6009	-	-	-	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.2350G>T	18.37:g.31319718G>T	ENSP00000269197:p.Asp784Tyr		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.D784Y	ENST00000269197.5	37	c.2350	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	G	12.45	1.942903	0.34283	.	.	ENSG00000141431	ENST00000269197	T	0.17528	2.27	6.04	4.22	0.49857	.	1.357460	0.04660	N	0.408746	T	0.26557	0.0649	L	0.29908	0.895	0.33933	D	0.642325	D	0.59767	0.986	P	0.53722	0.733	T	0.03910	-1.0993	10	0.66056	D	0.02	.	11.2653	0.49106	0.1506:0.0:0.8494:0.0	.	784	Q9C0F0	ASXL3_HUMAN	Y	784	ENSP00000269197:D784Y	ENSP00000269197:D784Y	D	+	1	0	ASXL3	29573716	1.000000	0.71417	0.997000	0.53966	0.258000	0.26162	2.916000	0.48813	0.846000	0.35142	0.563000	0.77884	GAT	ASXL3	-	NULL	ENSG00000141431		0.458	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	56	0.00	0	G			31319718	31319718	+1	no_errors	ENST00000269197	ensembl	human	known	69_37n	missense	62	15.07	11	SNP	1.000	T
AXIN1	8312	genome.wustl.edu	37	16	396580	396580	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr16:396580A>G	ENST00000262320.3	-	2	817	c.446T>C	c.(445-447)aTt>aCt	p.I149T	AXIN1_ENST00000354866.3_Missense_Mutation_p.I149T|AXIN1_ENST00000481769.1_Intron	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	149	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)	p.I149T(2)		biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				GTTATCAAGAATGTACTTTCG	0.532											OREG0003698	type=REGULATORY REGION|Gene=AXIN1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											2	Substitution - Missense(2)	breast(2)											107.0	103.0	104.0					16																	396580		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.446T>C	16.37:g.396580A>G	ENSP00000262320:p.Ile149Thr	588	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	SNP	pfam_DIX,pfam_Regulat_G_prot_signal,pfam_Axin_b-cat-bd,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_DIX,pfscan_DIX,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.I149T	ENST00000262320.3	37	c.446	CCDS10405.1	16	.	.	.	.	.	.	.	.	.	.	A	16.09	3.024028	0.54683	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	T;T	0.29917	1.55;1.55	5.48	5.48	0.80851	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.65450	0.2692	M	0.92970	3.365	0.80722	D	1	D;D	0.71674	0.994;0.998	D;D	0.87578	0.995;0.998	T	0.75337	-0.3353	10	0.87932	D	0	-5.2849	15.5742	0.76362	1.0:0.0:0.0:0.0	.	149;149	O15169-2;O15169	.;AXIN1_HUMAN	T	149	ENSP00000262320:I149T;ENSP00000346935:I149T	ENSP00000262320:I149T	I	-	2	0	AXIN1	336581	1.000000	0.71417	0.998000	0.56505	0.213000	0.24496	9.206000	0.95056	2.078000	0.62432	0.533000	0.62120	ATT	AXIN1	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal	ENSG00000103126		0.532	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXIN1	HGNC	protein_coding	OTTHUMT00000139441.3	142	0.00	0	A			396580	396580	-1	no_errors	ENST00000262320	ensembl	human	known	69_37n	missense	24	66.20	47	SNP	1.000	G
BRCA1	672	genome.wustl.edu	37	17	41223256	41223256	+	Splice_Site	SNP	C	C	T	rs80358008		TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr17:41223256C>T	ENST00000357654.3	-	15	4794		c.e15-1		BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000468300.1_Splice_Site|BRCA1_ENST00000352993.3_Splice_Site|BRCA1_ENST00000493795.1_Splice_Site|BRCA1_ENST00000346315.3_Intron|BRCA1_ENST00000471181.2_Splice_Site|BRCA1_ENST00000491747.2_Splice_Site|BRCA1_ENST00000591534.1_Splice_Site|BRCA1_ENST00000351666.3_Splice_Site|BRCA1_ENST00000354071.3_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000309486.4_Splice_Site	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset						androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GGGGTTCCCTCTGAAAGGAAT	0.413			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0													58.0	62.0	61.0					17																	41223256		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.4676-1G>A	17.37:g.41223256C>T			O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Splice_Site	SNP	-	e15-1	ENST00000357654.3	37	c.4739-1	CCDS11453.1	17	.	.	.	.	.	.	.	.	.	.	C	9.115	1.007622	0.19199	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000352993;ENST00000351666;ENST00000309486;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5068	0.61489	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BRCA1	38476782	1.000000	0.71417	1.000000	0.80357	0.067000	0.16453	3.612000	0.54142	2.646000	0.89796	0.561000	0.74099	.	BRCA1	-	-	ENSG00000012048		0.413	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	30	0.00	0	C	NM_007294	Intron	41223256	41223256	-1	no_errors	ENST00000471181	ensembl	human	known	69_37n	splice_site	9	52.63	10	SNP	1.000	T
NUTM1	256646	genome.wustl.edu	37	15	34647278	34647278	+	Silent	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr15:34647278G>A	ENST00000333756.4	+	6	1490	c.1335G>A	c.(1333-1335)caG>caA	p.Q445Q	NUTM1_ENST00000438749.3_Silent_p.Q463Q|NUTM1_ENST00000537011.1_Silent_p.Q473Q	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	445						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Q445Q(2)									CAGAAAAACAGAGAGATCCCT	0.463																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											124.0	124.0	124.0					15																	34647278		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.1335G>A	15.37:g.34647278G>A			B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Silent	SNP	NULL	p.Q445	ENST00000333756.4	37	c.1335	CCDS32190.1	15																																																																																			C15orf55	-	NULL	ENSG00000184507		0.463	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf55	HGNC	protein_coding	OTTHUMT00000418026.1	149	0.00	0	G	NM_175741		34647278	34647278	+1	no_errors	ENST00000333756	ensembl	human	known	69_37n	silent	36	46.27	31	SNP	0.330	A
CCDC150	284992	genome.wustl.edu	37	2	197565833	197565833	+	Splice_Site	SNP	C	C	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr2:197565833C>G	ENST00000389175.4	+	15	1759	c.1624C>G	c.(1624-1626)Ctt>Gtt	p.L542V	CCDC150_ENST00000272831.7_Splice_Site_p.L210V	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	542								p.L542V(2)		breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						GCCTTATCAGCTTGCCCAACA	0.338																																						dbGAP											2	Substitution - Missense(2)	breast(2)											69.0	62.0	64.0					2																	197565833		1826	4086	5912	-	-	-	SO:0001630	splice_region_variant	0				CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.1624-1C>G	2.37:g.197565833C>G			Q6P5U6|Q6P663|Q8N8V5	Missense_Mutation	SNP	NULL	p.L542V	ENST00000389175.4	37	c.1624	CCDS46478.1	2	.	.	.	.	.	.	.	.	.	.	C	0.041	-1.284001	0.01398	.	.	ENSG00000144395	ENST00000272831;ENST00000389175	T	0.43688	0.94	5.08	-3.18	0.05186	.	2.708170	0.01875	N	0.037493	T	0.18467	0.0443	N	0.08118	0	0.44447	D	0.997378	B;B;B	0.16396	0.002;0.017;0.017	B;B;B	0.12156	0.003;0.007;0.007	T	0.32508	-0.9904	9	.	.	.	-2.2404	0.3882	0.00406	0.3175:0.2146:0.1252:0.3427	.	16;210;542	B4DWS7;B4DZ03;Q8NCX0	.;.;CC150_HUMAN	V	210;542	ENSP00000373827:L542V	.	L	+	1	0	CCDC150	197274078	0.926000	0.31397	0.596000	0.28811	0.144000	0.21451	-0.461000	0.06712	-0.489000	0.06716	-1.751000	0.00678	CTT	CCDC150	-	NULL	ENSG00000144395		0.338	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CCDC150	HGNC	protein_coding	OTTHUMT00000335377.2	195	0.00	0	C	NM_001080539	Missense_Mutation	197565833	197565833	+1	no_errors	ENST00000389175	ensembl	human	known	69_37n	missense	79	33.61	40	SNP	0.708	G
CCDC37	348807	genome.wustl.edu	37	3	126139043	126139044	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C|A	C|A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr3:126139043_126139044CA>AG	ENST00000352312.1	+	11	1152_1153	c.1053_1054CA>AG	c.(1051-1056)ccCAgc>ccAGgc	p.S352G	CCDC37_ENST00000393425.1_Missense_Mutation_p.S353G|CCDC37_ENST00000505024.1_Missense_Mutation_p.S353G	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	352										NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		GCAGCCAGCCCAGCGAGTCCAG	0.668																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	Exception_encountered	3.37:g.126139043_126139044delinsAG	ENSP00000344749:p.Ser352Gly		D3DNA8|Q494V1|Q494V4|Q8N838	Silent|Missense_Mutation	SNP	superfamily_SuperAg_toxin_C_Staph/Strep	p.P352|p.S353G	ENST00000352312.1	37	c.1056|c.1057	CCDS3037.1	3																																																																																			CCDC37	-	NULL	ENSG00000163885		0.668	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	CCDC37	HGNC	protein_coding	OTTHUMT00000370099.4	22|21	0.00	0	C|A	NM_182628		126139043|126139044	126139043|126139044	+1	no_errors	ENST00000393425	ensembl	human	known	69_37n	silent|missense	13|12	23.53|25.00	4	SNP	0.000|0.006	A|G
CHD7	55636	genome.wustl.edu	37	8	61765545	61765545	+	Silent	SNP	G	G	C	rs368807380		TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr8:61765545G>C	ENST00000423902.2	+	31	6740	c.6261G>C	c.(6259-6261)ctG>ctC	p.L2087L	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2087					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.L2087L(4)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GCTTGGATCTGCCAGAGTGGT	0.577																																						dbGAP											4	Substitution - coding silent(4)	breast(4)											82.0	93.0	89.0					8																	61765545		2063	4200	6263	-	-	-	SO:0001819	synonymous_variant	0			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.6261G>C	8.37:g.61765545G>C			D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.L2087	ENST00000423902.2	37	c.6261	CCDS47865.1	8																																																																																			CHD7	-	NULL	ENSG00000171316		0.577	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	148	0.00	0	G	XM_098762		61765545	61765545	+1	no_errors	ENST00000307121	ensembl	human	known	69_37n	silent	89	12.75	13	SNP	1.000	C
COL27A1	85301	genome.wustl.edu	37	9	117027349	117027350	+	Missense_Mutation	DNP	GT	GT	TG	rs571665121		TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G|T	G|T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr9:117027349_117027350GT>TG	ENST00000356083.3	+	31	3689_3690	c.3298_3299GT>TG	c.(3298-3300)GTg>TGg	p.V1100W		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1100	Collagen-like 8.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						CTTCCAGGGTGTGGCTGGTGAG	0.594																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	Exception_encountered	9.37:g.117027349_117027350delinsTG	ENSP00000348385:p.Val1100Trp		Q66K43|Q96JF7	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_Fib_collagen_C	p.V1100L|p.V1100G	ENST00000356083.3	37	c.3298|c.3299	CCDS6802.1	9																																																																																			COL27A1	-	NULL	ENSG00000196739		0.594	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL27A1	HGNC	protein_coding	OTTHUMT00000053763.1	163|164	0.00	0	G|T	NM_032888		117027349|117027350	117027349|117027350	+1	no_errors	ENST00000356083	ensembl	human	known	69_37n	missense	51	25.00|26.09	17|18	SNP	0.007	T|G
CRELD1	78987	genome.wustl.edu	37	3	9976594	9976594	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr3:9976594A>C	ENST00000383811.3	+	2	849	c.250A>C	c.(250-252)Aaa>Caa	p.K84Q	RP11-1020A11.1_ENST00000602411.1_RNA|CRELD1_ENST00000397170.3_Missense_Mutation_p.K84Q|CRELD1_ENST00000326434.5_Missense_Mutation_p.K84Q|CRELD1_ENST00000452070.1_Missense_Mutation_p.K84Q	NM_015513.4	NP_056328	Q96HD1	CREL1_HUMAN	cysteine-rich with EGF-like domains 1	84					cardiac septum development (GO:0003279)|endocardial cushion development (GO:0003197)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.K84Q(4)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|urinary_tract(1)	14						GTCCAAATACAAAGACAGGTA	0.517																																						dbGAP											4	Substitution - Missense(4)	breast(4)											49.0	56.0	53.0					3																	9976594		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF452623	CCDS2593.1, CCDS33693.1	3p25.3	2005-12-08	2004-02-13		ENSG00000163703	ENSG00000163703			14630	protein-coding gene	gene with protein product		607170	"""atrioventricular septal defect 2"""	AVSD2		10922384, 12137942	Standard	NM_015513		Approved		uc003buf.3	Q96HD1	OTTHUMG00000128653	ENST00000383811.3:c.250A>C	3.37:g.9976594A>C	ENSP00000373322:p.Lys84Gln		A8MX90|B2RAA9|Q6I9X5|Q8NFT4|Q9Y409	Missense_Mutation	SNP	pfam_DUF3456,pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_Furin_repeat,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.K84Q	ENST00000383811.3	37	c.250	CCDS2593.1	3	.	.	.	.	.	.	.	.	.	.	A	16.53	3.149296	0.57151	.	.	ENSG00000163703	ENST00000397170;ENST00000383811;ENST00000452070;ENST00000326434	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	4.49	4.49	0.54785	.	0.138719	0.47852	D	0.000204	T	0.38348	0.1037	L	0.59436	1.845	0.37900	D	0.931009	B;D	0.53462	0.117;0.96	B;P	0.48795	0.11;0.59	T	0.40627	-0.9553	9	.	.	.	.	6.7271	0.23363	0.8925:0.0:0.1075:0.0	.	84;84	Q96HD1;Q96HD1-2	CREL1_HUMAN;.	Q	84	ENSP00000380355:K84Q;ENSP00000373322:K84Q;ENSP00000393643:K84Q;ENSP00000321856:K84Q	.	K	+	1	0	CRELD1	9951594	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.733000	0.55029	1.660000	0.50760	0.459000	0.35465	AAA	CRELD1	-	pfam_DUF3456	ENSG00000163703		0.517	CRELD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRELD1	HGNC	protein_coding	OTTHUMT00000250533.1	164	0.00	0	A	NM_015513		9976594	9976594	+1	no_errors	ENST00000326434	ensembl	human	known	69_37n	missense	41	52.87	46	SNP	1.000	C
CHDC2	286464	genome.wustl.edu	37	X	36117974	36117974	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chrX:36117974A>G	ENST00000313548.4	+	7	1016	c.830A>G	c.(829-831)gAt>gGt	p.D277G		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	277						integral component of membrane (GO:0016021)		p.D277G(1)									GCATGGACAGATGTATTTCTA	0.333																																						dbGAP											1	Substitution - Missense(1)	breast(1)											103.0	116.0	112.0					X																	36117974		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.830A>G	X.37:g.36117974A>G	ENSP00000324767:p.Asp277Gly			Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain	p.D277G	ENST00000313548.4	37	c.830	CCDS14238.1	X	.	.	.	.	.	.	.	.	.	.	A	19.08	3.756970	0.69648	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000014	T	0.65491	0.2696	M	0.66939	2.045	0.27247	N	0.958983	D	0.89917	1.0	D	0.74674	0.984	T	0.62950	-0.6745	9	0.62326	D	0.03	-25.6285	12.798	0.57569	1.0:0.0:0.0:0.0	.	277	Q8N9S7	CX059_HUMAN	G	277	.	ENSP00000324767:D277G	D	+	2	0	CXorf59	36027895	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	5.886000	0.69743	1.930000	0.55929	0.412000	0.27726	GAT	CXorf59	-	NULL	ENSG00000176034		0.333	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf59	HGNC	protein_coding		265	0.00	0	A	NM_173695		36117974	36117974	+1	no_errors	ENST00000313548	ensembl	human	known	69_37n	missense	57	38.04	35	SNP	1.000	G
CYP2W1	54905	genome.wustl.edu	37	7	1024915	1024915	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr7:1024915C>G	ENST00000308919.7	+	4	614	c.601C>G	c.(601-603)Ctc>Gtc	p.L201V	CYP2W1_ENST00000340150.6_Missense_Mutation_p.L145V	NM_017781.2	NP_060251.2	Q8TAV3	CP2W1_HUMAN	cytochrome P450, family 2, subfamily W, polypeptide 1	201					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)	p.L201V(1)		breast(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		CCTGCTGGGTCTCATCGATGA	0.647																																						dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	37.0	42.0					7																	1024915		2137	4229	6366	-	-	-	SO:0001583	missense	0			AK000366	CCDS5319.2	7p22.3	2004-07-05			ENSG00000073067	ENSG00000073067		"""Cytochrome P450s"""	20243	protein-coding gene	gene with protein product		615967					Standard	XM_005249792		Approved	FLJ20359, MGC34287	uc003sjq.1	Q8TAV3	OTTHUMG00000074071	ENST00000308919.7:c.601C>G	7.37:g.1024915C>G	ENSP00000310149:p.Leu201Val			Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.L201V	ENST00000308919.7	37	c.601	CCDS5319.2	7	.	.	.	.	.	.	.	.	.	.	C	13.70	2.314387	0.40996	.	.	ENSG00000073067	ENST00000308919;ENST00000340150	T;T	0.69306	-0.39;-0.39	5.06	5.06	0.68205	.	0.065298	0.64402	D	0.000010	T	0.77329	0.4114	M	0.72479	2.2	0.23138	N	0.998236	P;D	0.60575	0.786;0.988	P;P	0.61722	0.733;0.893	T	0.69320	-0.5176	10	0.17832	T	0.49	.	16.5795	0.84711	0.0:1.0:0.0:0.0	.	145;201	A6NJ10;Q8TAV3	.;CP2W1_HUMAN	V	201;145	ENSP00000310149:L201V;ENSP00000344178:L145V	ENSP00000310149:L201V	L	+	1	0	CYP2W1	991441	0.125000	0.22332	0.486000	0.27416	0.946000	0.59487	1.505000	0.35736	2.353000	0.79882	0.491000	0.48974	CTC	CYP2W1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000073067		0.647	CYP2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2W1	HGNC	protein_coding	OTTHUMT00000157249.1	62	0.00	0	C	NM_017781		1024915	1024915	+1	no_errors	ENST00000308919	ensembl	human	known	69_37n	missense	35	20.00	9	SNP	0.515	G
DDX50	79009	genome.wustl.edu	37	10	70706250	70706250	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr10:70706250C>T	ENST00000373585.3	+	15	2185	c.2078C>T	c.(2077-2079)tCa>tTa	p.S693L	DDX50_ENST00000466265.1_3'UTR	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	693	Arg-rich.					membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.S693L(1)		breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						TCAGGCCGGTCAGGTGGTCGA	0.493																																						dbGAP											1	Substitution - Missense(1)	breast(1)											42.0	43.0	42.0					10																	70706250		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.2078C>T	10.37:g.70706250C>T	ENSP00000362687:p.Ser693Leu		Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_GUCT,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S693L	ENST00000373585.3	37	c.2078	CCDS7283.1	10	.	.	.	.	.	.	.	.	.	.	C	16.32	3.088968	0.55968	.	.	ENSG00000107625	ENST00000373585	T	0.20738	2.05	5.2	5.2	0.72013	.	1.508050	0.03561	N	0.226979	T	0.14313	0.0346	N	0.08118	0	0.34802	D	0.736864	B	0.12013	0.005	B	0.12156	0.007	T	0.05971	-1.0853	10	0.15952	T	0.53	-3.3718	12.385	0.55327	0.0:0.8305:0.1695:0.0	.	693	Q9BQ39	DDX50_HUMAN	L	693	ENSP00000362687:S693L	ENSP00000362687:S693L	S	+	2	0	DDX50	70376256	0.995000	0.38212	1.000000	0.80357	0.993000	0.82548	1.417000	0.34770	2.584000	0.87258	0.467000	0.42956	TCA	DDX50	-	NULL	ENSG00000107625		0.493	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX50	HGNC	protein_coding	OTTHUMT00000048363.1	70	0.00	0	C	NM_024045		70706250	70706250	+1	no_errors	ENST00000373585	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.991	T
DIDO1	11083	genome.wustl.edu	37	20	61512736	61512736	+	Silent	SNP	T	T	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr20:61512736T>G	ENST00000266070.4	-	16	4897	c.4572A>C	c.(4570-4572)ccA>ccC	p.P1524P	DIDO1_ENST00000395343.1_Silent_p.P1524P	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1524					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P1524P(1)		NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					ACGACTTTGGTGGTGGAGACA	0.632																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	dbGAP											1	Substitution - coding silent(1)	breast(1)											77.0	78.0	78.0					20																	61512736		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.4572A>C	20.37:g.61512736T>G			A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Silent	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.P1524	ENST00000266070.4	37	c.4572	CCDS33506.1	20																																																																																			DIDO1	-	NULL	ENSG00000101191		0.632	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2	44	0.00	0	T	NM_080796		61512736	61512736	-1	no_errors	ENST00000266070	ensembl	human	known	69_37n	silent	25	30.56	11	SNP	0.995	G
EDC3	80153	genome.wustl.edu	37	15	74948230	74948230	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr15:74948230T>C	ENST00000315127.4	-	4	845	c.664A>G	c.(664-666)Att>Gtt	p.I222V	EDC3_ENST00000568176.1_Missense_Mutation_p.I222V|EDC3_ENST00000426797.3_Missense_Mutation_p.I222V	NM_001142444.1|NM_025083.3	NP_001135916.1|NP_079359.2	Q96F86	EDC3_HUMAN	enhancer of mRNA decapping 3	222	DFDF. {ECO:0000255|PROSITE- ProRule:PRU00845}.|Required for interaction with DDX6. {ECO:0000250}.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|membrane (GO:0016020)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)	p.I222V(2)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						TAGGTATCAATCTCCTCAAAC	0.502																																						dbGAP											2	Substitution - Missense(2)	breast(2)											118.0	114.0	115.0					15																	74948230		2197	4296	6493	-	-	-	SO:0001583	missense	0			BC011534	CCDS10267.1	15q24.1	2013-05-02	2013-05-02	2006-07-07	ENSG00000179151	ENSG00000179151			26114	protein-coding gene	gene with protein product		609842	"""yjeF domain containing (E.coli)"", ""LSM16 homolog (EDC3, S. cerevisiae)"", ""enhancer of mRNA decapping 3 homolog (S. cerevisiae)"""	YJDC, LSM16		15225602, 17533573, 22483619	Standard	NM_025083		Approved	FLJ21128, hYjeF_N2-15q23, YJEFN2	uc002aym.3	Q96F86	OTTHUMG00000142815	ENST00000315127.4:c.664A>G	15.37:g.74948230T>C	ENSP00000320503:p.Ile222Val		B3KPH0|D3DW61|Q9H797	Missense_Mutation	SNP	pfam_YjeF_N,pfam_FDF_dom,superfamily_YjeF_N	p.I222V	ENST00000315127.4	37	c.664	CCDS10267.1	15	.	.	.	.	.	.	.	.	.	.	T	17.36	3.371002	0.61624	.	.	ENSG00000179151	ENST00000315127;ENST00000426797	.	.	.	5.54	5.54	0.83059	DFDF motif (1);	0.124089	0.64402	D	0.000020	T	0.60130	0.2245	M	0.68317	2.08	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	T	0.56444	-0.7978	9	0.20519	T	0.43	.	14.8438	0.70246	0.0:0.0:0.0:1.0	.	222	Q96F86	EDC3_HUMAN	V	222	.	ENSP00000320503:I222V	I	-	1	0	EDC3	72735283	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.478000	0.81082	2.095000	0.63458	0.533000	0.62120	ATT	EDC3	-	pfam_FDF_dom	ENSG00000179151		0.502	EDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDC3	HGNC	protein_coding	OTTHUMT00000286399.1	228	0.00	0	T	NM_025083		74948230	74948230	-1	no_errors	ENST00000315127	ensembl	human	known	69_37n	missense	100	49.75	99	SNP	1.000	C
ELOVL3	83401	genome.wustl.edu	37	10	103988761	103988761	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr10:103988761G>C	ENST00000370005.3	+	4	786	c.565G>C	c.(565-567)Gct>Cct	p.A189P		NM_152310.1	NP_689523.1	Q9HB03	ELOV3_HUMAN	ELOVL fatty acid elongase 3	189					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)	p.A189P(1)		breast(2)|lung(10)|ovary(2)|prostate(1)|skin(1)	16		Colorectal(252;0.207)		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)		CACTCTGAAGGCTGCCAACGT	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											127.0	117.0	120.0					10																	103988761		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF292387	CCDS7531.1	10q24	2011-05-25	2011-05-25		ENSG00000119915	ENSG00000119915			18047	protein-coding gene	gene with protein product		611815	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3"""				Standard	NM_152310		Approved	CIG-30	uc001kut.3	Q9HB03	OTTHUMG00000018951	ENST00000370005.3:c.565G>C	10.37:g.103988761G>C	ENSP00000359022:p.Ala189Pro		Q5VZL3|Q8N180	Missense_Mutation	SNP	pfam_GNS1_SUR4	p.A189P	ENST00000370005.3	37	c.565	CCDS7531.1	10	.	.	.	.	.	.	.	.	.	.	G	34	5.355350	0.95854	.	.	ENSG00000119915	ENST00000370005	T	0.27104	1.69	5.57	5.57	0.84162	.	0.000000	0.52532	D	0.000061	T	0.63640	0.2528	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.73675	-0.3908	10	0.87932	D	0	-19.1796	18.1268	0.89589	0.0:0.0:1.0:0.0	.	189	Q9HB03	ELOV3_HUMAN	P	189	ENSP00000359022:A189P	ENSP00000359022:A189P	A	+	1	0	ELOVL3	103978751	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	9.869000	0.99810	2.619000	0.88677	0.650000	0.86243	GCT	ELOVL3	-	pfam_GNS1_SUR4	ENSG00000119915		0.512	ELOVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL3	HGNC	protein_coding	OTTHUMT00000050030.1	140	0.00	0	G	NM_152310		103988761	103988761	+1	no_errors	ENST00000370005	ensembl	human	known	69_37n	missense	57	27.85	22	SNP	1.000	C
ESCO1	114799	genome.wustl.edu	37	18	19153877	19153877	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr18:19153877T>C	ENST00000269214.5	-	4	1865	c.928A>G	c.(928-930)Att>Gtt	p.I310V		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	310					mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)	p.I310V(2)		breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						TCACCAGCAATTTCTTCACAG	0.403																																						dbGAP											2	Substitution - Missense(2)	breast(2)											80.0	80.0	80.0					18																	19153877		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.928A>G	18.37:g.19153877T>C	ENSP00000269214:p.Ile310Val		B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Missense_Mutation	SNP	NULL	p.I310V	ENST00000269214.5	37	c.928	CCDS32800.1	18	.	.	.	.	.	.	.	.	.	.	T	15.84	2.951874	0.53293	.	.	ENSG00000141446	ENST00000269214;ENST00000383276	T;T	0.70869	-0.52;0.93	5.74	4.55	0.56014	.	0.095853	0.46442	D	0.000291	T	0.63426	0.2510	M	0.66939	2.045	0.37242	D	0.906181	P	0.43287	0.802	B	0.38616	0.277	T	0.63879	-0.6537	10	0.10377	T	0.69	-16.3776	10.7849	0.46398	0.1413:0.0:0.0:0.8587	.	310	Q5FWF5	ESCO1_HUMAN	V	310	ENSP00000269214:I310V;ENSP00000372763:I310V	ENSP00000269214:I310V	I	-	1	0	ESCO1	17407875	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.172000	0.65003	0.967000	0.38186	0.533000	0.62120	ATT	ESCO1	-	NULL	ENSG00000141446		0.403	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESCO1	HGNC	protein_coding	OTTHUMT00000443942.1	156	0.00	0	T	NM_052911		19153877	19153877	-1	no_errors	ENST00000269214	ensembl	human	known	69_37n	missense	110	37.14	65	SNP	1.000	C
EPG5	57724	genome.wustl.edu	37	18	43534805	43534805	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr18:43534805G>A	ENST00000282041.5	-	2	597	c.563C>T	c.(562-564)tCt>tTt	p.S188F		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	188					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)			p.S188F(2)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						CACCTCTGAAGAACAAACCAG	0.433																																						dbGAP											2	Substitution - Missense(2)	breast(2)											50.0	50.0	50.0					18																	43534805		1958	4149	6107	-	-	-	SO:0001583	missense	0			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.563C>T	18.37:g.43534805G>A	ENSP00000282041:p.Ser188Phe		A2BDF3|Q9H8C8	Missense_Mutation	SNP	NULL	p.S188F	ENST00000282041.5	37	c.563	CCDS11926.2	18	.	.	.	.	.	.	.	.	.	.	G	11.18	1.561449	0.27915	.	.	ENSG00000152223	ENST00000282041	T	0.11385	2.78	5.49	4.62	0.57501	.	0.869636	0.10280	N	0.693650	T	0.07638	0.0192	N	0.14661	0.345	0.23232	N	0.998071	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.31110	-0.9955	10	0.42905	T	0.14	-7.8272	9.2818	0.37733	0.2154:0.0:0.7846:0.0	.	188;188	Q9HCE0-2;Q9HCE0	.;EPG5_HUMAN	F	188	ENSP00000282041:S188F	ENSP00000282041:S188F	S	-	2	0	EPG5	41788803	1.000000	0.71417	0.676000	0.29932	0.016000	0.09150	2.997000	0.49457	1.308000	0.44962	-0.251000	0.11542	TCT	EPG5	-	NULL	ENSG00000152223		0.433	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPG5	HGNC	protein_coding	OTTHUMT00000445081.1	89	0.00	0	G	NM_020964		43534805	43534805	-1	no_errors	ENST00000282041	ensembl	human	known	69_37n	missense	63	44.74	51	SNP	0.703	A
ETNK1	55500	genome.wustl.edu	37	12	22797179	22797179	+	Intron	SNP	A	A	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr12:22797179A>G	ENST00000266517.4	+	2	772				ETNK1_ENST00000335148.3_Missense_Mutation_p.T240A	NM_018638.4	NP_061108.2	Q9HBU6	EKI1_HUMAN	ethanolamine kinase 1						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)	p.T240A(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						AGGAAAAACTACAAGATGTTT	0.343																																					Esophageal Squamous(42;87 913 3224 6226 43339)	dbGAP											2	Substitution - Missense(2)	breast(2)											114.0	102.0	106.0					12																	22797179		1816	4080	5896	-	-	-	SO:0001627	intron_variant	0			BC006111	CCDS8698.1, CCDS41760.1	12p12.2	2004-07-09			ENSG00000139163	ENSG00000139163			24649	protein-coding gene	gene with protein product		609858				11912161, 11044454	Standard	XM_005253420		Approved	EKI1, EKI	uc001rft.3	Q9HBU6	OTTHUMG00000169008	ENST00000266517.4:c.683+223A>G	12.37:g.22797179A>G			G5E969	Missense_Mutation	SNP	pfam_Choline/ethanolamine_kinase,superfamily_Kinase-like_dom	p.T240A	ENST00000266517.4	37	c.718	CCDS8698.1	12	.	.	.	.	.	.	.	.	.	.	A	1.031	-0.681950	0.03353	.	.	ENSG00000139163	ENST00000335148	.	.	.	3.16	-6.31	0.02001	.	.	.	.	.	T	0.15739	0.0379	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17471	-1.0368	8	0.49607	T	0.09	.	2.7962	0.05402	0.2747:0.3289:0.3004:0.096	.	240	G5E969	.	A	240	.	ENSP00000334041:T240A	T	+	1	0	ETNK1	22688446	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.855000	0.00729	-1.898000	0.01100	-0.429000	0.05907	ACA	ETNK1	-	NULL	ENSG00000139163		0.343	ETNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETNK1	HGNC	protein_coding	OTTHUMT00000401926.2	252	0.00	0	A	NM_018638		22797179	22797179	+1	no_errors	ENST00000335148	ensembl	human	known	69_37n	missense	449	16.39	88	SNP	0.000	G
FAM122B	159090	genome.wustl.edu	37	X	133906273	133906273	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chrX:133906273A>T	ENST00000370790.1	-	9	1568	c.640T>A	c.(640-642)Tcc>Acc	p.S214T	FAM122B_ENST00000486347.1_Missense_Mutation_p.S215T|FAM122B_ENST00000298090.6_Intron|FAM122B_ENST00000343004.5_Missense_Mutation_p.S233T|FAM122B_ENST00000493333.1_5'UTR	NM_001166599.2|NM_145284.5	NP_001160071.1|NP_660327.2	Q7Z309	F122B_HUMAN	family with sequence similarity 122B	214	Ser-rich.							p.S215T(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|skin(1)	6	Acute lymphoblastic leukemia(192;0.000127)					GGGTCTGAGGATAAGCCACTG	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											81.0	65.0	71.0					X																	133906273		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX538218	CCDS14643.1, CCDS55497.1, CCDS55498.1	Xq26.3	2008-02-05			ENSG00000156504	ENSG00000156504			30490	protein-coding gene	gene with protein product						12477932	Standard	NM_145284		Approved	DKFZp686L20116, RP11-308B5.5	uc004exq.3	Q7Z309	OTTHUMG00000022461	ENST00000370790.1:c.640T>A	X.37:g.133906273A>T	ENSP00000359826:p.Ser214Thr		A8K902|Q6PIM2|Q6ZU47|Q6ZV64|Q6ZVE4|Q8TB75	Missense_Mutation	SNP	NULL	p.S233T	ENST00000370790.1	37	c.697	CCDS55497.1	X	.	.	.	.	.	.	.	.	.	.	A	20.9	4.072430	0.76415	.	.	ENSG00000156504	ENST00000370790;ENST00000343004;ENST00000486347	T;T;T	0.58940	0.3;0.3;0.3	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000005	T	0.74397	0.3711	M	0.69823	2.125	0.52099	D	0.999944	D;D;P	0.71674	0.998;0.998;0.933	D;D;B	0.78314	0.991;0.991;0.359	T	0.77493	-0.2567	10	0.72032	D	0.01	.	13.9995	0.64424	1.0:0.0:0.0:0.0	.	215;214;233	Q7Z309-2;Q7Z309;Q7Z309-3	.;F122B_HUMAN;.	T	214;233;215	ENSP00000359826:S214T;ENSP00000339207:S233T;ENSP00000419592:S215T	ENSP00000339207:S233T	S	-	1	0	FAM122B	133733939	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	7.830000	0.86741	1.904000	0.55121	0.486000	0.48141	TCC	FAM122B	-	NULL	ENSG00000156504		0.448	FAM122B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM122B	HGNC	protein_coding	OTTHUMT00000058382.1	68	0.00	0	A	NM_145284		133906273	133906273	-1	no_errors	ENST00000343004	ensembl	human	known	69_37n	missense	53	19.70	13	SNP	1.000	T
FAM71B	153745	genome.wustl.edu	37	5	156590215	156590215	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr5:156590215T>C	ENST00000302938.4	-	2	1156	c.1061A>G	c.(1060-1062)gAa>gGa	p.E354G		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	354						nucleus (GO:0005634)		p.E354G(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGAAGTACCTTCCAAGGAGGT	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											56.0	55.0	55.0					5																	156590215		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1061A>G	5.37:g.156590215T>C	ENSP00000305596:p.Glu354Gly		Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	pfam_DUF3699	p.E354G	ENST00000302938.4	37	c.1061	CCDS4335.1	5	.	.	.	.	.	.	.	.	.	.	T	6.037	0.375146	0.11409	.	.	ENSG00000170613	ENST00000302938	T	0.04502	3.61	3.48	-6.68	0.01778	.	4.406720	0.00575	N	0.000302	T	0.02083	0.0065	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41142	-0.9525	10	0.22109	T	0.4	6.7841	0.9598	0.01393	0.1761:0.1359:0.2526:0.4353	.	354	Q8TC56	FA71B_HUMAN	G	354	ENSP00000305596:E354G	ENSP00000305596:E354G	E	-	2	0	FAM71B	156522793	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.956000	0.01522	-1.414000	0.02025	-0.249000	0.11873	GAA	FAM71B	-	NULL	ENSG00000170613		0.567	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71B	HGNC	protein_coding	OTTHUMT00000252570.2	59	0.00	0	T	NM_130899		156590215	156590215	-1	no_errors	ENST00000302938	ensembl	human	known	69_37n	missense	31	34.04	16	SNP	0.000	C
FAT3	120114	genome.wustl.edu	37	11	92532859	92532859	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr11:92532859C>G	ENST00000298047.6	+	9	6697	c.6680C>G	c.(6679-6681)cCt>cGt	p.P2227R	FAT3_ENST00000525166.1_Missense_Mutation_p.P2077R|FAT3_ENST00000409404.2_Missense_Mutation_p.P2227R			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2227	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P2227R(4)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GATGGGGACCCTTTTAAACAG	0.418										TCGA Ovarian(4;0.039)																												dbGAP											4	Substitution - Missense(4)	breast(4)											53.0	50.0	51.0					11																	92532859		1909	4139	6048	-	-	-	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.6680C>G	11.37:g.92532859C>G	ENSP00000298047:p.Pro2227Arg		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.P2227R	ENST00000298047.6	37	c.6680		11	.	.	.	.	.	.	.	.	.	.	C	15.16	2.750986	0.49257	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.53423	0.62;0.62;0.62	6.16	4.22	0.49857	.	.	.	.	.	T	0.65069	0.2656	M	0.75085	2.285	0.80722	D	1	D	0.60575	0.988	P	0.60068	0.868	T	0.68405	-0.5417	9	0.56958	D	0.05	.	15.208	0.73195	0.0:0.9207:0.0:0.0793	.	2227	Q8TDW7-3	.	R	2227;2227;2077	ENSP00000298047:P2227R;ENSP00000387040:P2227R;ENSP00000432586:P2077R	ENSP00000298047:P2227R	P	+	2	0	FAT3	92172507	0.998000	0.40836	0.886000	0.34754	0.969000	0.65631	3.241000	0.51376	0.799000	0.34018	0.650000	0.86243	CCT	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.418	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		91	0.00	0	C	NM_001008781		92532859	92532859	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	missense	28	58.82	40	SNP	1.000	G
FBXW4	6468	genome.wustl.edu	37	10	103432723	103432724	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr10:103432723_103432724delCA	ENST00000331272.7	-	4	1241_1242	c.623_624delTG	c.(622-624)gtgfs	p.V208fs		NM_022039.3	NP_071322.1	P57775	FBXW4_HUMAN	F-box and WD repeat domain containing 4	208					cartilage development (GO:0051216)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|positive regulation of mesenchymal cell proliferation (GO:0002053)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	ubiquitin ligase complex (GO:0000151)		p.V208fs*36(2)		breast(3)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	15		Colorectal(252;0.123)		Epithelial(162;4.35e-08)|all cancers(201;1.92e-06)		CTTTGCAATCCACACAGTTCAC	0.51																																						dbGAP											2	Deletion - Frameshift(2)	breast(2)																																								-	-	-	SO:0001589	frameshift_variant	0			AF281859	CCDS31271.1	10q24	2013-01-09	2007-02-08	2005-03-12	ENSG00000107829	ENSG00000107829		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	10847	protein-coding gene	gene with protein product		608071	"""split hand/foot malformation (ectrodactyly) type 3"", ""F-box and WD-40 domain protein 4"""	SHFM3		8723077, 7912888	Standard	XM_005270053		Approved	Fbw4, dactylin	uc001kto.3	P57775	OTTHUMG00000018938	ENST00000331272.7:c.623_624delTG	10.37:g.103432727_103432728delCA	ENSP00000359149:p.Val208fs		Q5SVS1|Q96IM6	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V208fs	ENST00000331272.7	37	c.624_623	CCDS31271.1	10																																																																																			FBXW4	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000107829		0.510	FBXW4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW4	HGNC	protein_coding	OTTHUMT00000049979.2	362	0.00	0	CA	NM_022039		103432723	103432724	-1	no_errors	ENST00000331272	ensembl	human	known	69_37n	frame_shift_del	141	15.57	26	DEL	1.000:1.000	-
FHL1	2273	genome.wustl.edu	37	X	135288565	135288565	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chrX:135288565G>A	ENST00000345434.3	+	2	55		c.e2-1		FHL1_ENST00000394153.2_Splice_Site|FHL1_ENST00000394155.2_Splice_Site|FHL1_ENST00000539015.1_Splice_Site|FHL1_ENST00000543669.1_Splice_Site|FHL1_ENST00000370690.3_Splice_Site|FHL1_ENST00000477080.1_Splice_Site|FHL1_ENST00000535737.1_Splice_Site|FHL1_ENST00000370676.3_Splice_Site|FHL1_ENST00000370683.1_Splice_Site			Q13642	FHL1_HUMAN	four and a half LIM domains 1						cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|organ morphogenesis (GO:0009887)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane depolarization (GO:0003254)|regulation of potassium ion transmembrane transporter activity (GO:1901016)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel binding (GO:0044325)|zinc ion binding (GO:0008270)	p.?(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(192;0.000127)					TGCCCCCGCAGGTCCCTCCAG	0.582																																						dbGAP											2	Unknown(2)	breast(2)											98.0	93.0	95.0					X																	135288565		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U60115	CCDS14655.1, CCDS55505.1, CCDS55506.1, CCDS55507.1, CCDS76036.1	Xq26.3	2014-09-17			ENSG00000022267	ENSG00000022267			3702	protein-coding gene	gene with protein product	"""Four-and-a-half LIM domains 1"", ""LIM protein SLIMMER"""	300163				8753811, 9714789	Standard	NM_001449		Approved	SLIM1, KYO-T, bA535K18.1, FHL1B, XMPMA, FLH1A, MGC111107	uc004ezo.3	Q13642	OTTHUMG00000022504	ENST00000345434.3:c.-26-1G>A	X.37:g.135288565G>A			B7Z5T4|B7Z793|O95212|Q13230|Q13645|Q5JXI7|Q5M7Y6|Q6IB30|Q9NZ40|Q9UKZ8|Q9Y630	Splice_Site	SNP	-	e1-1	ENST00000345434.3	37	c.1-1	CCDS55507.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.3|24.3	4.519767|4.519767	0.85495|0.85495	.|.	.|.	ENSG00000022267|ENSG00000022267	ENST00000539015;ENST00000370683;ENST00000370676;ENST00000542704|ENST00000456218	.|.	.|.	.|.	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	.|.	.|.	.|.	.|.	.|T	.|0.66781	.|0.2824	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.59747	.|-0.7396	.|5	.|0.16896	.|T	.|0.51	.|.	18.84|18.84	0.92180|0.92180	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	.|S	-1|32	.|.	.|ENSP00000392813:G32S	.|G	+|+	.|1	.|0	FHL1|FHL1	135116231|135116231	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.938000|0.938000	0.57974|0.57974	7.309000|7.309000	0.78937|0.78937	2.396000|2.396000	0.81511|0.81511	0.600000|0.600000	0.82982|0.82982	.|GGT	FHL1	-	-	ENSG00000022267		0.582	FHL1-002	KNOWN	basic|CCDS	protein_coding	FHL1	HGNC	protein_coding	OTTHUMT00000058461.1	79	0.00	0	G	NM_001449	Intron	135288565	135288565	+1	no_errors	ENST00000345434	ensembl	human	known	69_37n	splice_site	29	45.28	24	SNP	1.000	A
FMR1NB	158521	genome.wustl.edu	37	X	147088318	147088318	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chrX:147088318C>T	ENST00000370467.3	+	3	568	c.494C>T	c.(493-495)tCa>tTa	p.S165L	5S_rRNA_ENST00000364415.1_RNA	NM_152578.2	NP_689791.1	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor	165	P-type.					integral component of membrane (GO:0016021)|nucleolus (GO:0005730)		p.S165L(2)		breast(2)|cervix(1)|endometrium(3)|large_intestine(7)|lung(10)|ovary(1)|skin(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					TGTTTTTCATCATCGGGGACC	0.363																																						dbGAP											2	Substitution - Missense(2)	breast(2)											187.0	164.0	172.0					X																	147088318		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14683.1	Xq28	2009-03-25			ENSG00000176988	ENSG00000176988			26372	protein-coding gene	gene with protein product	"""cancer/testis antigen 37"""					12601173	Standard	NM_152578		Approved	FLJ25736, NY-SAR-35, CT37	uc004fcm.3	Q8N0W7	OTTHUMG00000022608	ENST00000370467.3:c.494C>T	X.37:g.147088318C>T	ENSP00000359498:p.Ser165Leu		D3DWT3	Missense_Mutation	SNP	superfamily_P_trefoil	p.S165L	ENST00000370467.3	37	c.494	CCDS14683.1	X	.	.	.	.	.	.	.	.	.	.	C	13.68	2.309183	0.40895	.	.	ENSG00000176988	ENST00000370467	T	0.35421	1.31	4.62	1.82	0.25136	P-type trefoil (1);	1.688710	0.03824	N	0.268059	T	0.28234	0.0697	L	0.27053	0.805	0.09310	N	1	B	0.27229	0.172	B	0.23716	0.048	T	0.29941	-0.9995	10	0.66056	D	0.02	-0.0768	6.9633	0.24610	0.0:0.6641:0.0:0.3359	.	165	Q8N0W7	FMR1N_HUMAN	L	165	ENSP00000359498:S165L	ENSP00000359498:S165L	S	+	2	0	FMR1NB	146896010	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.692000	0.25482	0.344000	0.23847	-1.031000	0.02408	TCA	FMR1NB	-	superfamily_P_trefoil	ENSG00000176988		0.363	FMR1NB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMR1NB	HGNC	protein_coding	OTTHUMT00000058667.1	314	0.00	0	C	NM_152578		147088318	147088318	+1	no_errors	ENST00000370467	ensembl	human	known	69_37n	missense	111	53.88	132	SNP	0.000	T
GCC2	9648	genome.wustl.edu	37	2	109098250	109098253	+	Frame_Shift_Del	DEL	AATT	AATT	-			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	AATT	AATT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr2:109098250_109098253delAATT	ENST00000309863.6	+	10	3872_3875	c.3158_3161delAATT	c.(3157-3162)caattafs	p.QL1053fs		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	1053					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)	p.L1054fs*10(2)		breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						CTTACAAGACAATTAAGAAATTCG	0.265																																						dbGAP											2	Deletion - Frameshift(2)	breast(2)																																								-	-	-	SO:0001589	frameshift_variant	0			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.3158_3161delAATT	2.37:g.109098250_109098253delAATT	ENSP00000307939:p.Gln1053fs		A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Frame_Shift_Del	DEL	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,smart_GRIP,pfscan_GRIP	p.L1054fs	ENST00000309863.6	37	c.3158_3161	CCDS33268.1	2																																																																																			GCC2	-	NULL	ENSG00000135968		0.265	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC2	HGNC	protein_coding	OTTHUMT00000358516.3	65	0.00	0	AATT	NM_014635		109098250	109098253	+1	no_errors	ENST00000309863	ensembl	human	known	69_37n	frame_shift_del	37	43.08	28	DEL	0.998:0.956:0.954:0.990	-
GCM2	9247	genome.wustl.edu	37	6	10874470	10874470	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr6:10874470G>C	ENST00000379491.4	-	5	1426	c.1279C>G	c.(1279-1281)Cca>Gca	p.P427A	RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	427					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.P427A(2)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				CAGGGTTCTGGATAGACAGAC	0.552																																						dbGAP											2	Substitution - Missense(2)	breast(2)											55.0	56.0	56.0					6																	10874470		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.1279C>G	6.37:g.10874470G>C	ENSP00000368805:p.Pro427Ala		D3GDV6|Q5THN5	Missense_Mutation	SNP	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	p.P427A	ENST00000379491.4	37	c.1279	CCDS4517.1	6	.	.	.	.	.	.	.	.	.	.	G	15.88	2.964417	0.53507	.	.	ENSG00000124827	ENST00000379491	T	0.68903	-0.36	5.61	3.78	0.43462	.	0.278457	0.36815	N	0.002399	T	0.48187	0.1486	M	0.68952	2.095	0.40238	D	0.977928	P	0.42456	0.78	B	0.38106	0.265	T	0.58188	-0.7680	10	0.66056	D	0.02	-2.5988	8.1709	0.31254	0.1245:0.0:0.734:0.1415	.	427	O75603	GCM2_HUMAN	A	427	ENSP00000368805:P427A	ENSP00000368805:P427A	P	-	1	0	GCM2	10982456	0.995000	0.38212	0.025000	0.17156	0.012000	0.07955	1.194000	0.32174	1.474000	0.48178	0.655000	0.94253	CCA	GCM2	-	NULL	ENSG00000124827		0.552	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCM2	HGNC	protein_coding	OTTHUMT00000039844.1	100	0.00	0	G			10874470	10874470	-1	no_errors	ENST00000379491	ensembl	human	known	69_37n	missense	68	43.90	54	SNP	0.398	C
GPR156	165829	genome.wustl.edu	37	3	119886036	119886036	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr3:119886036C>G	ENST00000464295.1	-	10	2733	c.2288G>C	c.(2287-2289)tGt>tCt	p.C763S	GPR156_ENST00000315843.3_Missense_Mutation_p.C763S|GPR156_ENST00000461057.1_Missense_Mutation_p.C759S			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	763						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)	p.C763S(2)		breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		GCAGATTTCACAGTAGGGCCG	0.557																																						dbGAP											2	Substitution - Missense(2)	breast(2)											104.0	118.0	113.0					3																	119886036		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.2288G>C	3.37:g.119886036C>G	ENSP00000417261:p.Cys763Ser		B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Missense_Mutation	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3_GABA_rcpt_B	p.C763S	ENST00000464295.1	37	c.2288	CCDS2997.1	3	.	.	.	.	.	.	.	.	.	.	C	25.1	4.601888	0.87055	.	.	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	T;T;T	0.70516	-0.49;-0.49;-0.44	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.77219	0.4098	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.74630	-0.3601	9	.	.	.	-10.3784	17.7635	0.88470	0.0:1.0:0.0:0.0	.	759;763	E9PFZ4;Q8NFN8	.;GP156_HUMAN	S	763;763;759	ENSP00000417261:C763S;ENSP00000324553:C763S;ENSP00000418758:C759S	.	C	-	2	0	GPR156	121368726	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.922000	0.75811	2.758000	0.94735	0.561000	0.74099	TGT	GPR156	-	NULL	ENSG00000175697		0.557	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR156	HGNC	protein_coding	OTTHUMT00000355139.1	72	0.00	0	C	NM_153002		119886036	119886036	-1	no_errors	ENST00000315843	ensembl	human	known	69_37n	missense	41	30.51	18	SNP	1.000	G
GPRASP1	9737	genome.wustl.edu	37	X	101912281	101912281	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chrX:101912281G>A	ENST00000361600.5	+	5	4241	c.3440G>A	c.(3439-3441)tGt>tAt	p.C1147Y	GPRASP1_ENST00000415986.1_Missense_Mutation_p.C1147Y|GPRASP1_ENST00000444152.1_Missense_Mutation_p.C1147Y|GPRASP1_ENST00000537097.1_Missense_Mutation_p.C1147Y|RP4-769N13.7_ENST00000602441.1_RNA	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	1147	OPRD1-binding.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)		p.C1147Y(2)		NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TGCATACAATGTGAGCTGAAA	0.398																																						dbGAP											2	Substitution - Missense(2)	breast(2)											94.0	86.0	89.0					X																	101912281		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.3440G>A	X.37:g.101912281G>A	ENSP00000355146:p.Cys1147Tyr		O43168|Q96LA1	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.C1147Y	ENST00000361600.5	37	c.3440	CCDS35352.1	X	.	.	.	.	.	.	.	.	.	.	G	8.259	0.810753	0.16537	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.09163	3.01;3.01;3.01;3.01	2.74	2.74	0.32292	Armadillo-type fold (1);	.	.	.	.	T	0.25158	0.0611	M	0.63428	1.95	0.29083	N	0.882583	D	0.89917	1.0	D	0.91635	0.999	T	0.02942	-1.1091	9	0.31617	T	0.26	-4.7672	8.175	0.31276	0.0:0.0:1.0:0.0	.	1147	Q5JY77	GASP1_HUMAN	Y	1147	ENSP00000393691:C1147Y;ENSP00000409420:C1147Y;ENSP00000355146:C1147Y;ENSP00000445683:C1147Y	ENSP00000355146:C1147Y	C	+	2	0	GPRASP1	101798937	1.000000	0.71417	0.998000	0.56505	0.538000	0.34931	3.606000	0.54095	1.646000	0.50622	0.284000	0.19432	TGT	GPRASP1	-	superfamily_ARM-type_fold	ENSG00000198932		0.398	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP1	HGNC	protein_coding	OTTHUMT00000057634.2	200	0.00	0	G	NM_014710		101912281	101912281	+1	no_errors	ENST00000361600	ensembl	human	known	69_37n	missense	140	36.07	79	SNP	0.997	A
GSPT1	2935	genome.wustl.edu	37	16	12009404	12009404	+	Intron	SNP	C	C	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr16:12009404C>T	ENST00000420576.2	-	1	41				AC007216.1_ENST00000583357.1_RNA|GSPT1_ENST00000434724.2_Silent_p.R58R|GSPT1_ENST00000439887.2_Silent_p.R58R	NM_001130007.1	NP_001123479.1	P15170	ERF3A_HUMAN	G1 to S phase transition 1						G1/S transition of mitotic cell cycle (GO:0000082)|GTP catabolic process (GO:0006184)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|translational termination (GO:0006415)	intracellular (GO:0005622)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation release factor activity (GO:0003747)	p.R58R(1)		breast(1)|central_nervous_system(1)|kidney(4)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	14						TGAGGTTCTCCCGCTGGGCCT	0.741																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											7.0	10.0	9.0					16																	12009404		1441	3354	4795	-	-	-	SO:0001627	intron_variant	0			BC008391	CCDS45412.1, CCDS45413.1, CCDS45414.1	16p13.1	2008-08-01							4621	protein-coding gene	gene with protein product		139259				2511002, 17700517	Standard	NM_002094		Approved	GST1, ETF3A, eRF3a	uc002dbt.3	P15170		ENST00000420576.2:c.61+494G>A	16.37:g.12009404C>T			J3KQG6|Q96GF2	Silent	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,pfam_Ataxin-2_C,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel,prints_ProtSyn_GTP-bd	p.R58	ENST00000420576.2	37	c.174	CCDS45414.1	16																																																																																			GSPT1	-	NULL	ENSG00000103342		0.741	GSPT1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	GSPT1	HGNC	protein_coding	OTTHUMT00000421514.1	10	0.00	0	C	NM_002094		12009404	12009404	-1	no_errors	ENST00000434724	ensembl	human	known	69_37n	silent	6	53.85	7	SNP	0.807	T
GSTZ1	2954	genome.wustl.edu	37	14	77793827	77793827	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr14:77793827T>A	ENST00000216465.5	+	4	433	c.148T>A	c.(148-150)Ttc>Atc	p.F50I	GSTZ1_ENST00000556627.1_Intron|GSTZ1_ENST00000557639.1_5'UTR|GSTZ1_ENST00000393734.1_5'UTR|GSTZ1_ENST00000349555.3_Missense_Mutation_p.F50I|GSTZ1_ENST00000553586.1_Missense_Mutation_p.F51I|GSTZ1_ENST00000361389.4_5'UTR|GSTZ1_ENST00000554279.1_Missense_Mutation_p.F50I|GSTZ1_ENST00000557053.1_5'UTR	NM_145870.2	NP_665877.1	O43708	MAAI_HUMAN	glutathione S-transferase zeta 1	50	GST N-terminal.				cellular nitrogen compound metabolic process (GO:0034641)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|L-phenylalanine catabolic process (GO:0006559)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|maleylacetoacetate isomerase activity (GO:0016034)|protein homodimerization activity (GO:0042803)	p.F50I(2)		lung(2)|prostate(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)	Glutathione(DB00143)	TTCTAAGGACTTCCAGGCACT	0.587																																						dbGAP											2	Substitution - Missense(2)	breast(2)											45.0	39.0	41.0					14																	77793827		2203	4300	6503	-	-	-	SO:0001583	missense	0			U86529	CCDS9858.1, CCDS9859.1, CCDS9860.1	14q24.3	2012-06-22	2012-06-22		ENSG00000100577	ENSG00000100577	5.2.1.2, 2.5.1.18	"""Glutathione S-transferases / Soluble"""	4643	protein-coding gene	gene with protein product	"""maleylacetoacetate isomerase"""	603758	"""glutathione transferase zeta 1"""			9396740, 9417084	Standard	NM_001513		Approved	GSTZ1-1, MAAI, MAI	uc001xtj.3	O43708	OTTHUMG00000171551	ENST00000216465.5:c.148T>A	14.37:g.77793827T>A	ENSP00000216465:p.Phe50Ile		A6NED0|A6NNB8|A8MWD7|B2RCK3|O15308|O75430|Q6IB17|Q7Z610|Q9BV63	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,tigrfam_Mal_ac_isom	p.F50I	ENST00000216465.5	37	c.148	CCDS9858.1	14	.	.	.	.	.	.	.	.	.	.	T	25.7	4.666989	0.88251	.	.	ENSG00000100577	ENST00000216465;ENST00000554279;ENST00000349555;ENST00000553586	T;T;T;T	0.25912	1.77;2.51;1.77;1.77	5.63	5.63	0.86233	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.097259	0.64402	D	0.000001	T	0.40791	0.1131	L	0.41356	1.27	0.80722	D	1	D;D	0.61697	0.988;0.99	D;D	0.66979	0.948;0.91	T	0.25606	-1.0127	10	0.87932	D	0	-3.5587	13.3422	0.60551	0.0:0.0:0.0:1.0	.	50;50	A6NED0;O43708	.;MAAI_HUMAN	I	50;50;50;51	ENSP00000216465:F50I;ENSP00000452498:F50I;ENSP00000314404:F50I;ENSP00000451976:F51I	ENSP00000216465:F50I	F	+	1	0	GSTZ1	76863580	1.000000	0.71417	0.996000	0.52242	0.830000	0.47004	4.744000	0.62118	2.138000	0.66242	0.533000	0.62120	TTC	GSTZ1	-	pfam_Glutathione_S-Trfase_N,superfamily_Thioredoxin-like_fold,tigrfam_Mal_ac_isom	ENSG00000100577		0.587	GSTZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTZ1	HGNC	protein_coding	OTTHUMT00000414082.1	65	0.00	0	T	NM_145870		77793827	77793827	+1	no_errors	ENST00000216465	ensembl	human	known	69_37n	missense	8	68.00	17	SNP	1.000	A
HSPA12A	259217	genome.wustl.edu	37	10	118439170	118439170	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr10:118439170G>A	ENST00000369209.3	-	10	1234	c.1130C>T	c.(1129-1131)gCa>gTa	p.A377V		NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	377						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.A998V(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		AACCCAGGCTGCAGGGCGTTT	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											107.0	104.0	105.0					10																	118439170		1844	4091	5935	-	-	-	SO:0001583	missense	0			AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.1130C>T	10.37:g.118439170G>A	ENSP00000358211:p.Ala377Val			Missense_Mutation	SNP	NULL	p.A377V	ENST00000369209.3	37	c.1130	CCDS41569.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.429645	0.96131	.	.	ENSG00000165868	ENST00000369209	T	0.29917	1.55	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.50154	0.1599	L	0.53249	1.67	0.80722	D	1	D	0.55605	0.972	P	0.60068	0.868	T	0.18524	-1.0334	10	0.37606	T	0.19	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	377	O43301	HS12A_HUMAN	V	377	ENSP00000358211:A377V	ENSP00000358211:A377V	A	-	2	0	HSPA12A	118429160	1.000000	0.71417	0.903000	0.35520	0.857000	0.48899	9.476000	0.97823	2.824000	0.97209	0.655000	0.94253	GCA	HSPA12A	-	NULL	ENSG00000165868		0.438	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA12A	HGNC	protein_coding	OTTHUMT00000050530.1	135	0.00	0	G	NM_025015		118439170	118439170	-1	no_errors	ENST00000369209	ensembl	human	known	69_37n	missense	97	23.62	30	SNP	1.000	A
IGKV2-24	28923	genome.wustl.edu	37	2	89476024	89476024	+	RNA	SNP	C	C	T	rs368646335		TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr2:89476024C>T	ENST00000484817.1	-	0	177									immunoglobulin kappa variable 2-24																		TCACTGTGTACGAGGCTTTGA	0.527																																						dbGAP											0													111.0	108.0	109.0					2																	89476024		1873	4099	5972	-	-	-			0			X12684		2p11.2	2012-02-08			ENSG00000241294	ENSG00000241294		"""Immunoglobulins / IGK locus"""	5781	other	immunoglobulin gene							Standard	NG_000834		Approved				OTTHUMG00000151655		2.37:g.89476024C>T				Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.V50I	ENST00000484817.1	37	c.148		2																																																																																			IGKV2-24	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000241294		0.527	IGKV2-24-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV2-24	HGNC	IG_V_gene	OTTHUMT00000323404.1	238	0.00	0	C	NG_000834		89476024	89476024	-1	no_stop_codon	ENST00000484817	ensembl	human	known	69_37n	missense	104	36.97	61	SNP	0.000	T
IL6ST	3572	genome.wustl.edu	37	5	55256367	55256367	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr5:55256367G>C	ENST00000381298.2	-	8	1148	c.836C>G	c.(835-837)tCc>tGc	p.S279C	IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000502326.3_Missense_Mutation_p.S279C|IL6ST_ENST00000522633.2_Missense_Mutation_p.S279C|IL6ST_ENST00000381293.2_Missense_Mutation_p.S113C|IL6ST_ENST00000536319.1_Missense_Mutation_p.S279C|IL6ST_ENST00000336909.5_Missense_Mutation_p.S279C|IL6ST_ENST00000381287.4_Missense_Mutation_p.S279C|IL6ST_ENST00000381294.3_Missense_Mutation_p.S279C	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	279	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)	p.S279C(2)		breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				AGATCGGGTGGATGCTGTGTC	0.378			O		hepatocellular ca																																	dbGAP		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	2	Substitution - Missense(2)	breast(2)											102.0	92.0	95.0					5																	55256367		2203	4300	6503	-	-	-	SO:0001583	missense	0			M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.836C>G	5.37:g.55256367G>C	ENSP00000370698:p.Ser279Cys		A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,pfam_IL6_recept-bd,pfam_Growth/epo_recpt_lig-bind,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S279C	ENST00000381298.2	37	c.836	CCDS3971.1	5	.	.	.	.	.	.	.	.	.	.	G	17.83	3.485061	0.63962	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294;ENST00000381287;ENST00000536319;ENST00000381293;ENST00000522633;ENST00000542298	T;T;T;T;T;T;T	0.58652	0.32;0.32;0.32;0.32;0.32;0.32;0.32	5.39	4.5	0.54988	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.448580	0.26307	N	0.025132	T	0.75989	0.3925	M	0.79258	2.445	0.80722	D	1	D;D;D;D	0.89917	1.0;0.982;0.999;0.99	D;P;D;P	0.77557	0.99;0.762;0.921;0.816	T	0.79420	-0.1811	10	0.66056	D	0.02	.	15.2169	0.73274	0.0:0.0:0.8581:0.1419	.	113;279;279;279	Q5FC05;Q5FC04;P40189-2;P40189	.;.;.;IL6RB_HUMAN	C	279;279;279;279;279;113;279;279	ENSP00000370698:S279C;ENSP00000338799:S279C;ENSP00000370694:S279C;ENSP00000370687:S279C;ENSP00000444456:S279C;ENSP00000370693:S113C;ENSP00000435399:S279C	ENSP00000338799:S279C	S	-	2	0	IL6ST	55292124	0.999000	0.42202	0.165000	0.22776	0.968000	0.65278	4.945000	0.63568	1.222000	0.43521	0.462000	0.41574	TCC	IL6ST	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000134352		0.378	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	IL6ST	HGNC	protein_coding	OTTHUMT00000214146.3	202	0.00	0	G	NM_002184		55256367	55256367	-1	no_errors	ENST00000336909	ensembl	human	known	69_37n	missense	73	29.52	31	SNP	0.763	C
KIAA2026	158358	genome.wustl.edu	37	9	5920327	5920327	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr9:5920327A>T	ENST00000399933.3	-	8	5668	c.5669T>A	c.(5668-5670)aTt>aAt	p.I1890N	KIAA2026_ENST00000381461.2_Missense_Mutation_p.I1860N	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1890								p.I1065N(2)|p.I1890N(2)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		GTTAATCATAATCTGAGTACC	0.428																																						dbGAP											4	Substitution - Missense(4)	breast(4)											158.0	158.0	158.0					9																	5920327		1929	4133	6062	-	-	-	SO:0001583	missense	0			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.5669T>A	9.37:g.5920327A>T	ENSP00000382815:p.Ile1890Asn		A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.I1890N	ENST00000399933.3	37	c.5669		9	.	.	.	.	.	.	.	.	.	.	A	16.71	3.198886	0.58126	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000014	T	0.78679	0.4321	M	0.72118	2.19	0.41082	D	0.985533	D	0.89917	1.0	D	0.83275	0.996	T	0.80783	-0.1228	9	0.62326	D	0.03	-6.8692	16.2127	0.82178	1.0:0.0:0.0:0.0	.	1890	Q5HYC2	K2026_HUMAN	N	1890;1860	.	ENSP00000370870:I1860N	I	-	2	0	KIAA2026	5910327	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.779000	0.91792	2.236000	0.73375	0.533000	0.62120	ATT	KIAA2026	-	NULL	ENSG00000183354		0.428	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2	146	0.00	0	A	NM_001017969		5920327	5920327	-1	no_errors	ENST00000399933	ensembl	human	novel	69_37n	missense	116	15.33	21	SNP	1.000	T
LGALSL	29094	genome.wustl.edu	37	2	64683524	64683524	+	Silent	SNP	T	T	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr2:64683524T>A	ENST00000238875.5	+	4	754	c.300T>A	c.(298-300)tcT>tcA	p.S100S	LGALSL_ENST00000409537.2_Intron|AC008074.3_ENST00000441630.1_RNA	NM_014181.2	NP_054900.2	Q3ZCW2	LEGL_HUMAN	lectin, galactoside-binding-like	100	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.					intracellular (GO:0005622)	carbohydrate binding (GO:0030246)	p.S100S(1)									TCAGAAATTCTTGTATATCTG	0.512																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											165.0	172.0	170.0					2																	64683524		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF161508	CCDS1877.1	2p14	2011-08-15			ENSG00000119862	ENSG00000119862			25012	protein-coding gene	gene with protein product	"""galectin-related protein"""					11042152, 16682780	Standard	NM_014181		Approved	HSPC159, GRP	uc002scy.4	Q3ZCW2	OTTHUMG00000129541	ENST00000238875.5:c.300T>A	2.37:g.64683524T>A			B2RBG8|D6W5E8|Q6P5T6|Q9P005	Silent	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	p.S100	ENST00000238875.5	37	c.300	CCDS1877.1	2																																																																																			LGALSL	-	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	ENSG00000119862		0.512	LGALSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALSL	HGNC	protein_coding	OTTHUMT00000251731.2	147	0.00	0	T	NM_014181		64683524	64683524	+1	no_errors	ENST00000238875	ensembl	human	novel	69_37n	silent	103	16.94	21	SNP	0.992	A
LCT	3938	genome.wustl.edu	37	2	136558268	136558268	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr2:136558268C>A	ENST00000264162.2	-	12	4785	c.4775G>T	c.(4774-4776)gGc>gTc	p.G1592V		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1592	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.G1592V(2)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GGAAATCACGCCACCTTGACT	0.537																																						dbGAP											2	Substitution - Missense(2)	breast(2)											113.0	104.0	107.0					2																	136558268		2203	4300	6503	-	-	-	SO:0001583	missense	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4775G>T	2.37:g.136558268C>A	ENSP00000264162:p.Gly1592Val		Q4ZG58	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.G1592V	ENST00000264162.2	37	c.4775	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	C	17.46	3.396182	0.62177	.	.	ENSG00000115850	ENST00000264162	T	0.39406	1.08	5.73	5.73	0.89815	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.76169	0.3950	H	0.94847	3.59	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82596	-0.0379	10	0.87932	D	0	-29.3475	19.9019	0.96988	0.0:1.0:0.0:0.0	.	1592	P09848	LPH_HUMAN	V	1592	ENSP00000264162:G1592V	ENSP00000264162:G1592V	G	-	2	0	LCT	136274738	1.000000	0.71417	0.306000	0.25113	0.040000	0.13550	7.818000	0.86416	2.706000	0.92434	0.563000	0.77884	GGC	LCT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000115850		0.537	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	97	0.00	0	C	NM_002299		136558268	136558268	-1	no_errors	ENST00000264162	ensembl	human	known	69_37n	missense	45	35.71	25	SNP	1.000	A
LIMK1	3984	genome.wustl.edu	37	7	73530288	73530288	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr7:73530288G>A	ENST00000336180.2	+	13	1618	c.1567G>A	c.(1567-1569)Ggc>Agc	p.G523S	LIMK1_ENST00000418310.1_Splice_Site_p.G553S|LIMK1_ENST00000538333.3_Splice_Site_p.G489S	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	523	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.G523S(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	GATGATCAACGGTGAGTGGTT	0.642																																						dbGAP											1	Substitution - Missense(1)	breast(1)											87.0	74.0	78.0					7																	73530288		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.1567+1G>A	7.37:g.73530288G>A			B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Znf_LIM,pfam_PDZ,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,superfamily_PDZ,smart_Znf_LIM,smart_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_LIM,pfscan_PDZ,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G523S	ENST00000336180.2	37	c.1567	CCDS5563.1	7	.	.	.	.	.	.	.	.	.	.	G	24.7	4.557864	0.86231	.	.	ENSG00000106683	ENST00000418310;ENST00000419043;ENST00000336180;ENST00000538333	T;T;T	0.64618	-0.11;-0.11;-0.11	5.25	5.25	0.73442	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.71333	0.3327	L	0.37850	1.14	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.73708	0.981;0.971	T	0.73626	-0.3923	10	0.62326	D	0.03	-33.0238	16.385	0.83501	0.0:0.0:1.0:0.0	.	489;523	B7Z6I8;P53667	.;LIMK1_HUMAN	S	553;523;523;489	ENSP00000409717:G553S;ENSP00000336740:G523S;ENSP00000444452:G489S	ENSP00000336740:G523S	G	+	1	0	LIMK1	73168224	1.000000	0.71417	0.997000	0.53966	0.550000	0.35303	9.466000	0.97665	2.463000	0.83235	0.543000	0.68304	GGC	LIMK1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000106683		0.642	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIMK1	HGNC	protein_coding	OTTHUMT00000252335.2	56	0.00	0	G	NM_002314	Missense_Mutation	73530288	73530288	+1	no_errors	ENST00000336180	ensembl	human	known	69_37n	missense	24	35.14	13	SNP	1.000	A
LMOD3	56203	genome.wustl.edu	37	3	69167916	69167916	+	Silent	SNP	C	C	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr3:69167916C>G	ENST00000420581.2	-	2	1769	c.1590G>C	c.(1588-1590)gtG>gtC	p.V530V	LMOD3_ENST00000475434.1_Silent_p.V530V|LMOD3_ENST00000489031.1_Silent_p.V530V	NM_198271.3	NP_938012.2	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	530						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.V530V(4)		breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)	13		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)		GAGTGATTTCCACCAATGGGG	0.512																																						dbGAP											4	Substitution - coding silent(4)	breast(4)											98.0	102.0	101.0					3																	69167916		1979	4168	6147	-	-	-	SO:0001819	synonymous_variant	0			AK096900	CCDS46862.1	3p14.1	2003-03-07			ENSG00000163380	ENSG00000163380			6649	protein-coding gene	gene with protein product							Standard	NM_198271		Approved		uc003dns.2	Q0VAK6	OTTHUMG00000158774	ENST00000420581.2:c.1590G>C	3.37:g.69167916C>G			B4DT85|Q0JTT2|Q5JPG6|Q8IUK4|Q96LS4	Silent	SNP	pfam_Tropomodulin	p.V530	ENST00000420581.2	37	c.1590	CCDS46862.1	3																																																																																			LMOD3	-	NULL	ENSG00000163380		0.512	LMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMOD3	HGNC	protein_coding	OTTHUMT00000352138.1	194	0.00	0	C	XM_067529		69167916	69167916	-1	no_errors	ENST00000420581	ensembl	human	known	69_37n	silent	87	35.56	48	SNP	1.000	G
LPHN3	23284	genome.wustl.edu	37	4	62778445	62778445	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr4:62778445A>T	ENST00000514591.1	+	12	2207	c.1878A>T	c.(1876-1878)aaA>aaT	p.K626N	LPHN3_ENST00000506720.1_Missense_Mutation_p.K694N|LPHN3_ENST00000506746.1_Missense_Mutation_p.K694N|LPHN3_ENST00000504896.1_Missense_Mutation_p.K626N|LPHN3_ENST00000545650.1_Missense_Mutation_p.K626N|LPHN3_ENST00000511324.1_Missense_Mutation_p.K694N|LPHN3_ENST00000508946.1_Missense_Mutation_p.K626N|LPHN3_ENST00000507164.1_Missense_Mutation_p.K694N|LPHN3_ENST00000514157.1_Missense_Mutation_p.K626N|LPHN3_ENST00000507625.1_Missense_Mutation_p.K694N|LPHN3_ENST00000506700.1_Missense_Mutation_p.K626N|LPHN3_ENST00000512091.2_Missense_Mutation_p.K626N|LPHN3_ENST00000509896.1_Missense_Mutation_p.K694N|LPHN3_ENST00000508693.1_Missense_Mutation_p.K694N|LPHN3_ENST00000514996.1_Missense_Mutation_p.K626N			Q9HAR2	LPHN3_HUMAN	latrophilin 3	623					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.K626N(6)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						AGCTTCAGAAAAGAGAGCGCT	0.368																																						dbGAP											6	Substitution - Missense(6)	breast(6)											169.0	152.0	157.0					4																	62778445		1835	4091	5926	-	-	-	SO:0001583	missense	0			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.1878A>T	4.37:g.62778445A>T	ENSP00000422533:p.Lys626Asn		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like	p.K694N	ENST00000514591.1	37	c.2082	CCDS54768.1	4	.	.	.	.	.	.	.	.	.	.	A	15.44	2.833048	0.50951	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.71698	-0.55;-0.54;-0.56;-0.56;-0.54;-0.54;-0.56;-0.56;-0.54;-0.54;-0.55;-0.58;-0.59;-0.58;-0.57	5.63	5.63	0.86233	.	.	.	.	.	T	0.81375	0.4809	L	0.61218	1.895	0.39822	D	0.972847	D;P	0.67145	0.996;0.939	D;P	0.67382	0.951;0.725	D	0.84155	0.0425	9	0.72032	D	0.01	.	15.009	0.71536	1.0:0.0:0.0:0.0	.	626;626	E9PE04;Q9HAR2-2	.;.	N	626;626;694;694;626;626;626;694;694;694;626;626;626;694;694;626	ENSP00000423388:K626N;ENSP00000422533:K626N;ENSP00000423787:K694N;ENSP00000425033:K694N;ENSP00000424120:K626N;ENSP00000439831:K626N;ENSP00000421476:K694N;ENSP00000424030:K694N;ENSP00000421372:K694N;ENSP00000425201:K626N;ENSP00000423434:K626N;ENSP00000421627:K626N;ENSP00000420931:K694N;ENSP00000425884:K694N;ENSP00000424258:K626N	ENSP00000280009:K626N	K	+	3	2	LPHN3	62461040	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.162000	0.64942	2.137000	0.66172	0.459000	0.35465	AAA	LPHN3	-	pfam_DUF3497	ENSG00000150471		0.368	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	LPHN3	HGNC	protein_coding	OTTHUMT00000361765.1	355	0.00	0	A			62778445	62778445	+1	no_errors	ENST00000507625	ensembl	human	known	69_37n	missense	66	59.51	97	SNP	1.000	T
LXN	56925	genome.wustl.edu	37	3	158387342	158387342	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr3:158387342C>T	ENST00000264265.3	-	3	464	c.250G>A	c.(250-252)Gca>Aca	p.A84T	GFM1_ENST00000486715.1_Intron|GFM1_ENST00000264263.5_Intron|GFM1_ENST00000478576.1_Intron	NM_020169.3	NP_064554.3	Q9BS40	LXN_HUMAN	latexin	84	Cystatin-like fold 1. {ECO:0000250}.				detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|metalloendopeptidase inhibitor activity (GO:0008191)	p.A84T(2)		breast(2)|endometrium(1)|kidney(2)	5			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			ACTTCTGGTGCAGTTTCTTGT	0.383																																						dbGAP											2	Substitution - Missense(2)	breast(2)											100.0	96.0	97.0					3																	158387342		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF087851	CCDS3183.1	3q25.32	2004-05-10			ENSG00000079257	ENSG00000079257			13347	protein-coding gene	gene with protein product		609305					Standard	NM_020169		Approved		uc003fch.3	Q9BS40	OTTHUMG00000158807	ENST00000264265.3:c.250G>A	3.37:g.158387342C>T	ENSP00000264265:p.Ala84Thr		Q96PN2|Q9NQS6	Missense_Mutation	SNP	pfam_Prot_inh_latexin,pirsf_Prot_inh_latexin	p.A84T	ENST00000264265.3	37	c.250	CCDS3183.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.75|19.75	3.885381|3.885381	0.72410|0.72410	.|.	.|.	ENSG00000079257|ENSG00000079257	ENST00000264265|ENST00000482640	T|.	0.24538|.	1.85|.	5.04|5.04	5.04|5.04	0.67666|0.67666	.|.	0.120635|.	0.56097|.	D|.	0.000024|.	T|T	0.76435|0.76435	0.3987|0.3987	M|M	0.74881|0.74881	2.28|2.28	0.45662|0.45662	D|D	0.998583|0.998583	B|.	0.26672|.	0.156|.	B|.	0.33846|.	0.171|.	T|T	0.76836|0.76836	-0.2812|-0.2812	10|5	0.54805|.	T|.	0.06|.	-21.7739|-21.7739	18.3997|18.3997	0.90511|0.90511	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	84|.	Q9BS40|.	LXN_HUMAN|.	T|Y	84|14	ENSP00000264265:A84T|.	ENSP00000264265:A84T|.	A|C	-|-	1|2	0|0	LXN|LXN	159870036|159870036	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.943000|0.943000	0.58893|0.58893	4.966000|4.966000	0.63715|0.63715	2.359000|2.359000	0.80004|0.80004	0.585000|0.585000	0.79938|0.79938	GCA|TGC	LXN	-	pfam_Prot_inh_latexin,pirsf_Prot_inh_latexin	ENSG00000079257		0.383	LXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LXN	HGNC	protein_coding	OTTHUMT00000352284.1	256	0.00	0	C	NM_020169		158387342	158387342	-1	no_errors	ENST00000264265	ensembl	human	known	69_37n	missense	218	21.30	59	SNP	1.000	T
LYNX1	66004	genome.wustl.edu	37	8	143856611	143856611	+	Intron	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr8:143856611G>A	ENST00000335822.5	-	3	782				LYNX1_ENST00000398906.1_Silent_p.L109L|LYNX1_ENST00000345173.6_Silent_p.L109L|LYNX1_ENST00000523332.1_Intron|LYNX1_ENST00000522906.1_5'Flank|LYNX1_ENST00000395192.2_Silent_p.L109L	NM_023946.2	NP_076435.1	Q9BZG9	LYNX1_HUMAN	Ly6/neurotoxin 1							anchored component of membrane (GO:0031225)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.L109L(2)		endometrium(1)|lung(2)|skin(1)	4	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					AGGGTGGCCAGGAGGATGGGG	0.657																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											32.0	34.0	33.0					8																	143856611		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			AF321824	CCDS6389.1, CCDS34951.1, CCDS34952.1	8q24.3	2008-03-12			ENSG00000180155	ENSG00000180155			29604	protein-coding gene	gene with protein product		606110				12573258, 10402197	Standard	NM_023946		Approved	SLURP2	uc003yxd.1	Q9BZG9	OTTHUMG00000164694	ENST00000335822.5:c.154+399C>T	8.37:g.143856611G>A			D3DWI7|G3XAC2|Q86SR0	Silent	SNP	pfam_LY6_UPAR,smart_LY6_UPA_recep-like	p.L109	ENST00000335822.5	37	c.325	CCDS34951.1	8																																																																																			LYNX1	-	NULL	ENSG00000180155		0.657	LYNX1-001	KNOWN	basic|CCDS	protein_coding	LYNX1	HGNC	protein_coding	OTTHUMT00000379786.3	53	0.00	0	G	NM_177476		143856611	143856611	-1	no_errors	ENST00000345173	ensembl	human	known	69_37n	silent	24	40.00	16	SNP	0.349	A
LYPD5	284348	genome.wustl.edu	37	19	44303921	44303921	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr19:44303921T>G	ENST00000377950.3	-	2	210	c.130A>C	c.(130-132)Atg>Ctg	p.M44L	LYPD5_ENST00000594013.1_Start_Codon_SNP_p.M1L|LYPD5_ENST00000414615.2_Start_Codon_SNP_p.M1L	NM_001031749.2	NP_001026919.2	Q6UWN5	LYPD5_HUMAN	LY6/PLAUR domain containing 5	44						anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.M1L(2)|p.M44L(2)		breast(3)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	8		Prostate(69;0.0352)				GGCAGCTTCATGGCCCTGAGG	0.602																																						dbGAP											4	Substitution - Missense(4)	breast(4)											57.0	54.0	55.0					19																	44303921		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055031	CCDS12631.1, CCDS46096.1	19q13.31	2008-02-05				ENSG00000159871			26397	protein-coding gene	gene with protein product						12477932	Standard	NM_182573		Approved	FLJ30469	uc002oxm.4	Q6UWN5		ENST00000377950.3:c.130A>C	19.37:g.44303921T>G	ENSP00000367185:p.Met44Leu		Q6PEX9|Q96DR2	Missense_Mutation	SNP	pfam_LY6_UPAR	p.M44L	ENST00000377950.3	37	c.130	CCDS46096.1	19	.	.	.	.	.	.	.	.	.	.	T	3.161	-0.172034	0.06421	.	.	ENSG00000159871	ENST00000377950;ENST00000414615	T;T	0.20463	3.37;2.07	2.69	-0.874	0.10631	.	1.434400	0.05022	U	0.473069	T	0.10680	0.0261	N	0.11560	0.145	0.80722	D	1	B	0.19331	0.035	B	0.06405	0.002	T	0.13282	-1.0515	10	0.28530	T	0.3	-1.4021	5.9127	0.19037	0.0:0.4359:0.0:0.5641	.	44	Q6UWN5	LYPD5_HUMAN	L	44;1	ENSP00000367185:M44L;ENSP00000408433:M1L	ENSP00000367185:M44L	M	-	1	0	LYPD5	48995761	0.000000	0.05858	0.000000	0.03702	0.338000	0.28826	-1.290000	0.02777	-0.289000	0.09038	0.260000	0.18958	ATG	LYPD5	-	NULL	ENSG00000159871		0.602	LYPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYPD5	HGNC	protein_coding	OTTHUMT00000463611.1	98	0.00	0	T	NM_182573		44303921	44303921	-1	no_errors	ENST00000377950	ensembl	human	known	69_37n	missense	42	22.22	12	SNP	0.000	G
MAGEA12	4111	genome.wustl.edu	37	X	151900151	151900151	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chrX:151900151G>T	ENST00000357916.4	-	2	805	c.650C>A	c.(649-651)cCt>cAt	p.P217H	MAGEA12_ENST00000393900.3_Missense_Mutation_p.P217H|MAGEA12_ENST00000393869.3_Missense_Mutation_p.P217H|CSAG4_ENST00000361201.4_RNA	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	217	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.P217H(2)		breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					TTTCTCCTCAGGGGCACAGTC	0.562																																						dbGAP											2	Substitution - Missense(2)	breast(2)											161.0	155.0	157.0					X																	151900151		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650	ENST00000357916.4:c.650C>A	X.37:g.151900151G>T	ENSP00000350592:p.Pro217His		Q9NSD3	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.P217H	ENST00000357916.4	37	c.650	CCDS14710.1	X	.	.	.	.	.	.	.	.	.	.	G	5.504	0.277926	0.10403	.	.	ENSG00000213401	ENST00000357916;ENST00000393869;ENST00000393900	T;T;T	0.05139	3.49;3.49;3.49	0.809	-0.791	0.10929	.	1.064740	0.07192	N	0.855907	T	0.11623	0.0283	M	0.84219	2.685	0.09310	N	1	B	0.26577	0.153	B	0.31751	0.135	T	0.39482	-0.9612	9	0.54805	T	0.06	.	.	.	.	.	217	P43365	MAGAC_HUMAN	H	217	ENSP00000350592:P217H;ENSP00000377447:P217H;ENSP00000377478:P217H	ENSP00000350592:P217H	P	-	2	0	MAGEA12	151650807	0.000000	0.05858	0.023000	0.16930	0.072000	0.16883	-0.413000	0.07123	-0.268000	0.09312	0.181000	0.17075	CCT	MAGEA12	-	pfam_MAGE,pfscan_MAGE	ENSG00000213401		0.562	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA12	HGNC	protein_coding	OTTHUMT00000058764.1	317	0.00	0	G	NM_005367		151900151	151900151	-1	no_errors	ENST00000357916	ensembl	human	known	69_37n	missense	125	45.18	103	SNP	0.022	T
MSI1	4440	genome.wustl.edu	37	12	120791150	120791150	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr12:120791150T>G	ENST00000257552.2	-	10	773	c.685A>C	c.(685-687)Agc>Cgc	p.S229R	MSI1_ENST00000546622.1_5'UTR	NM_002442.3	NP_002433.1	O43347	MSI1H_HUMAN	musashi RNA-binding protein 1	229					epithelial cell differentiation (GO:0030855)|nervous system development (GO:0007399)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)	p.S229R(2)		breast(4)|central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(5)|skin(2)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TAACTCCGGCTGGCGTAGGTT	0.612																																						dbGAP											2	Substitution - Missense(2)	breast(2)											121.0	117.0	118.0					12																	120791150		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB012851	CCDS9196.1	12q24	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	7330	protein-coding gene	gene with protein product		603328	"""Musashi (Drosophila) homolog 1"", ""musashi homolog 1 (Drosophila)"""			9790759	Standard	NM_002442		Approved		uc001tye.2	O43347	OTTHUMG00000169344	ENST00000257552.2:c.685A>C	12.37:g.120791150T>G	ENSP00000257552:p.Ser229Arg		Q96PU0|Q96PU1|Q96PU2|Q96PU3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S229R	ENST00000257552.2	37	c.685	CCDS9196.1	12	.	.	.	.	.	.	.	.	.	.	T	23.3	4.405157	0.83230	.	.	ENSG00000135097	ENST00000257552	T	0.26067	1.76	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.24812	0.0602	L	0.45581	1.43	0.48696	D	0.999696	B	0.25486	0.127	B	0.22753	0.041	T	0.03139	-1.1068	10	0.40728	T	0.16	.	14.564	0.68162	0.0:0.0:0.0:1.0	.	229	O43347	MSI1H_HUMAN	R	229	ENSP00000257552:S229R	ENSP00000257552:S229R	S	-	1	0	MSI1	119275533	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.473000	0.66774	1.832000	0.53329	0.374000	0.22700	AGC	MSI1	-	NULL	ENSG00000135097		0.612	MSI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSI1	HGNC	protein_coding	OTTHUMT00000403629.1	122	0.00	0	T	NM_002442		120791150	120791150	-1	no_errors	ENST00000257552	ensembl	human	known	69_37n	missense	28	53.33	32	SNP	1.000	G
MX2	4600	genome.wustl.edu	37	21	42749839	42749839	+	Missense_Mutation	SNP	G	G	A	rs527335705		TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr21:42749839G>A	ENST00000330714.3	+	3	557	c.373G>A	c.(373-375)Ggg>Agg	p.G125R	MX2_ENST00000543692.1_Missense_Mutation_p.G125R	NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	125	Dynamin-type G.				cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.G125R(2)		breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				CGCCGTCATCGGGGACCAGAG	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		17656	0.001		0.0	False		,,,				2504	0.0					dbGAP											2	Substitution - Missense(2)	breast(2)											63.0	60.0	61.0					21																	42749839		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.373G>A	21.37:g.42749839G>A	ENSP00000333657:p.Gly125Arg		B7Z5D3|D3DSI7	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,superfamily_CH-domain,smart_Dynamin_GTPase,smart_GED,prints_Dynamin	p.G125R	ENST00000330714.3	37	c.373	CCDS13672.1	21	.	.	.	.	.	.	.	.	.	.	G	22.1	4.240853	0.79912	.	.	ENSG00000183486	ENST00000330714;ENST00000436410;ENST00000435611;ENST00000543692;ENST00000418103	D;D;D;D	0.99931	-7.61;-8.19;-8.19;-8.19	3.92	3.92	0.45320	Dynamin, GTPase domain (2);	0.058360	0.64402	D	0.000002	D	0.99955	0.9981	H	0.99874	4.875	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95907	0.8920	10	0.87932	D	0	-27.7925	15.392	0.74751	0.0:0.0:1.0:0.0	.	125	P20592	MX2_HUMAN	R	125	ENSP00000333657:G125R;ENSP00000393975:G125R;ENSP00000446017:G125R;ENSP00000410188:G125R	ENSP00000333657:G125R	G	+	1	0	MX2	41671709	1.000000	0.71417	0.975000	0.42487	0.477000	0.33069	6.684000	0.74538	2.117000	0.64856	0.655000	0.94253	GGG	MX2	-	pfam_Dynamin_GTPase,smart_Dynamin_GTPase,prints_Dynamin	ENSG00000183486		0.652	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MX2	HGNC	protein_coding	OTTHUMT00000195147.1	69	0.00	0	G	NM_002463		42749839	42749839	+1	no_errors	ENST00000330714	ensembl	human	known	69_37n	missense	26	42.22	19	SNP	1.000	A
NAV3	89795	genome.wustl.edu	37	12	78513062	78513062	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr12:78513062T>A	ENST00000397909.2	+	15	3259	c.3086T>A	c.(3085-3087)cTa>cAa	p.L1029Q	NAV3_ENST00000266692.7_Missense_Mutation_p.L1029Q|NAV3_ENST00000228327.6_Missense_Mutation_p.L1029Q|NAV3_ENST00000536525.2_Missense_Mutation_p.L1029Q			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1029						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.L1029Q(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						AAAGCTCCCCTAAAAGGATCA	0.438										HNSCC(70;0.22)																												dbGAP											1	Substitution - Missense(1)	breast(1)											121.0	115.0	117.0					12																	78513062		1851	4091	5942	-	-	-	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3086T>A	12.37:g.78513062T>A	ENSP00000381007:p.Leu1029Gln		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.L1029Q	ENST00000397909.2	37	c.3086		12	.	.	.	.	.	.	.	.	.	.	T	18.63	3.665925	0.67700	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	6.0	6.0	0.97389	.	0.000000	0.33144	U	0.005238	T	0.52256	0.1723	L	0.40543	1.245	0.80722	D	1	D;D;D;D	0.76494	0.984;0.999;0.991;0.985	P;D;P;P	0.72075	0.737;0.976;0.68;0.693	T	0.51403	-0.8710	10	0.56958	D	0.05	-8.8576	16.4953	0.84238	0.0:0.0:0.0:1.0	.	1029;1029;1029;1029	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2	.;.;NAV3_HUMAN;.	Q	1029	ENSP00000446132:L1029Q;ENSP00000381007:L1029Q;ENSP00000228327:L1029Q;ENSP00000266692:L1029Q	ENSP00000228327:L1029Q	L	+	2	0	NAV3	77037193	0.695000	0.27747	0.389000	0.26208	0.943000	0.58893	3.808000	0.55598	2.287000	0.76781	0.533000	0.62120	CTA	NAV3	-	NULL	ENSG00000067798		0.438	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	82	0.00	0	T	NM_001024383		78513062	78513062	+1	no_errors	ENST00000397909	ensembl	human	known	69_37n	missense	33	52.17	36	SNP	0.880	A
NCOA3	8202	genome.wustl.edu	37	20	46264187	46264187	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr20:46264187C>G	ENST00000371998.3	+	11	1425	c.1234C>G	c.(1234-1236)Ccg>Gcg	p.P412A	NCOA3_ENST00000372004.3_Missense_Mutation_p.P412A|NCOA3_ENST00000371997.3_Missense_Mutation_p.P422A|NCOA3_ENST00000341724.6_Missense_Mutation_p.P422A			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	412					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.P412A(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						CTTACAGATGCCGAGCAGCAG	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	58.0	62.0					20																	46264187		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.1234C>G	20.37:g.46264187C>G	ENSP00000361066:p.Pro412Ala		A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_SRC-1,pfam_PAS_fold,superfamily_Nuc_rcpt_coact,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_HLH_DNA-bd	p.P412A	ENST00000371998.3	37	c.1234	CCDS13407.1	20	.	.	.	.	.	.	.	.	.	.	C	0.104	-1.148486	0.01714	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997;ENST00000542882	T;T;T;T	0.01998	4.51;4.68;4.68;4.52	5.46	4.51	0.55191	.	0.489691	0.17244	N	0.181439	T	0.01523	0.0049	N	0.08118	0	0.25820	N	0.984296	B;B;B;B;B;B	0.06786	0.0;0.001;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.0;0.0;0.001;0.0;0.001;0.0	T	0.42965	-0.9420	10	0.02654	T	1	-3.1938	15.8469	0.78899	0.1363:0.8637:0.0:0.0	.	412;422;416;412;412;412	A8K0W8;Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;.;NCOA3_HUMAN	A	412;422;412;412;422;178	ENSP00000342123:P422A;ENSP00000361073:P412A;ENSP00000361066:P412A;ENSP00000361065:P422A	ENSP00000345671:P412A	P	+	1	0	NCOA3	45697594	1.000000	0.71417	0.998000	0.56505	0.332000	0.28634	1.552000	0.36244	1.287000	0.44583	0.655000	0.94253	CCG	NCOA3	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000124151		0.542	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA3	HGNC	protein_coding	OTTHUMT00000080405.1	49	0.00	0	C	NM_006534		46264187	46264187	+1	no_errors	ENST00000371998	ensembl	human	known	69_37n	missense	35	12.50	5	SNP	1.000	G
NDUFV1	4723	genome.wustl.edu	37	11	67377047	67377047	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr11:67377047G>A	ENST00000322776.6	+	4	604	c.451G>A	c.(451-453)Gcc>Acc	p.A151T	RP11-655M14.12_ENST00000533876.1_RNA|NDUFV1_ENST00000526169.1_3'UTR|NDUFV1_ENST00000529927.1_Missense_Mutation_p.A142T|NDUFV1_ENST00000415352.2_Missense_Mutation_p.A144T|NDUFV1_ENST00000532303.1_Missense_Mutation_p.A50T|C11orf72_ENST00000333139.3_5'Flank	NM_001166102.1|NM_007103.3	NP_001159574.1|NP_009034.2	P49821	NDUV1_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa	151					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.A151T(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	16						GGCCATGGGCGCCCGCGCTGC	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	87.0	80.0					11																	67377047		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF092131	CCDS8173.1, CCDS53669.1	11q13	2011-07-04	2002-08-29		ENSG00000167792	ENSG00000167792	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7716	protein-coding gene	gene with protein product	"""complex I 51kDa subunit"", ""NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial"""	161015	"""NADH dehydrogenase (ubiquinone) flavoprotein 1 (51kD)"""			1478657	Standard	NM_007103		Approved	CI-51K	uc001omj.2	P49821	OTTHUMG00000166215	ENST00000322776.6:c.451G>A	11.37:g.67377047G>A	ENSP00000322450:p.Ala151Thr		O60924|O60940|Q16104|Q6IBR3|Q96BF8|Q96HS7	Missense_Mutation	SNP	pfam_NADH_UbQ_OxRdtase_51kDa_su,pfam_NADH-UbQ_OxRdtase_Fsu_4Fe4S-bd,pfam_Soluble_ligand-bd,smart_NADH-UbQ_OxRdtase_Fsu_4Fe4S-bd,tigrfam_NADH-UbQ_OxRdtase_suF	p.A151T	ENST00000322776.6	37	c.451	CCDS8173.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.107051	0.94292	.	.	ENSG00000167792	ENST00000322776;ENST00000532303;ENST00000532244;ENST00000529927;ENST00000532343;ENST00000415352;ENST00000533075;ENST00000529867;ENST00000530638;ENST00000528314	D;D;D;D;D;D;D;D;D;D	0.93307	-3.2;-3.2;-3.2;-3.2;-3.2;-3.2;-3.2;-3.2;-3.2;-3.2	4.17	4.17	0.49024	NADH:ubiquinone oxidoreductase, 51kDa subunit (1);	0.118671	0.56097	D	0.000030	D	0.97701	0.9246	H	0.96398	3.815	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;P;P;D	0.97110	0.986;0.903;0.903;1.0	D	0.98985	1.0806	10	0.87932	D	0	-8.7644	15.3019	0.73958	0.0:0.0:1.0:0.0	.	50;144;142;151	B4DE93;G3V0I5;P49821-2;P49821	.;.;.;NDUV1_HUMAN	T	151;50;50;142;50;144;144;139;112;50	ENSP00000322450:A151T;ENSP00000432015:A50T;ENSP00000435202:A50T;ENSP00000436766:A142T;ENSP00000431751:A50T;ENSP00000395368:A144T;ENSP00000437267:A144T;ENSP00000434438:A139T;ENSP00000436936:A112T;ENSP00000434581:A50T	ENSP00000322450:A151T	A	+	1	0	NDUFV1	67133623	1.000000	0.71417	0.956000	0.39512	0.945000	0.59286	9.490000	0.97952	2.174000	0.68829	0.555000	0.69702	GCC	NDUFV1	-	pfam_NADH_UbQ_OxRdtase_51kDa_su,tigrfam_NADH-UbQ_OxRdtase_suF	ENSG00000167792		0.602	NDUFV1-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	NDUFV1	HGNC	protein_coding	OTTHUMT00000388406.1	30	0.00	0	G	NM_007103		67377047	67377047	+1	no_errors	ENST00000322776	ensembl	human	known	69_37n	missense	25	26.47	9	SNP	0.999	A
NET1	10276	genome.wustl.edu	37	10	5493833	5493833	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr10:5493833C>T	ENST00000355029.4	+	4	438	c.296C>T	c.(295-297)aCg>aTg	p.T99M	NET1_ENST00000542715.1_5'UTR|NET1_ENST00000380359.3_Missense_Mutation_p.T45M	NM_001047160.2	NP_001040625.1	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming 1	99					apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|myoblast migration (GO:0051451)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T99M(1)|p.T45M(1)		breast(4)|kidney(2)|large_intestine(9)|lung(5)|prostate(2)|skin(1)	23						GCTCGTGTCACGTCCTTGGCA	0.393																																						dbGAP											2	Substitution - Missense(2)	breast(2)											166.0	173.0	171.0					10																	5493833		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010046	CCDS7067.1, CCDS41483.1	10p15	2013-01-10	2008-09-12		ENSG00000173848	ENSG00000173848		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14592	protein-coding gene	gene with protein product		606450				8649828	Standard	NR_073040		Approved	ARHGEF8, NET1A	uc001iia.4	Q7Z628	OTTHUMG00000017596	ENST00000355029.4:c.296C>T	10.37:g.5493833C>T	ENSP00000347134:p.Thr99Met		Q12773|Q96D82|Q99903|Q9UEN6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.T99M	ENST00000355029.4	37	c.296	CCDS41483.1	10	.	.	.	.	.	.	.	.	.	.	C	16.37	3.105216	0.56291	.	.	ENSG00000173848	ENST00000355029;ENST00000380359	T;T	0.15834	2.39;2.42	5.83	4.92	0.64577	.	0.000000	0.43110	D	0.000605	T	0.37128	0.0992	M	0.73217	2.22	0.80722	D	1	D;D	0.76494	0.998;0.999	P;P	0.60789	0.832;0.879	T	0.09357	-1.0678	10	0.87932	D	0	-16.7879	14.1221	0.65195	0.0:0.9259:0.0:0.0741	.	45;99	Q5SQI7;Q7Z628	.;ARHG8_HUMAN	M	99;45	ENSP00000347134:T99M;ENSP00000369717:T45M	ENSP00000347134:T99M	T	+	2	0	NET1	5483833	1.000000	0.71417	1.000000	0.80357	0.297000	0.27493	7.463000	0.80869	2.763000	0.94921	0.563000	0.77884	ACG	NET1	-	NULL	ENSG00000173848		0.393	NET1-005	KNOWN	basic|CCDS	protein_coding	NET1	HGNC	protein_coding	OTTHUMT00000046553.3	226	0.00	0	C	NM_005863		5493833	5493833	+1	no_errors	ENST00000355029	ensembl	human	known	69_37n	missense	170	15.00	30	SNP	1.000	T
NXPH1	30010	genome.wustl.edu	37	7	8791150	8791150	+	Silent	SNP	C	C	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr7:8791150C>T	ENST00000405863.1	+	3	1478	c.567C>T	c.(565-567)tcC>tcT	p.S189S	NXPH1_ENST00000602349.1_Silent_p.S72S|NXPH1_ENST00000497400.1_3'UTR	NM_152745.2	NP_689958.1	P58417	NXPH1_HUMAN	neurexophilin 1	189	V (Cys-rich).					extracellular region (GO:0005576)		p.S189S(2)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|ovary(1)	17		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		CCAAAGATTCCAAGTCTTTTA	0.413																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											60.0	58.0	59.0					7																	8791150		1866	4103	5969	-	-	-	SO:0001819	synonymous_variant	0			AB047362	CCDS47540.1	7p22	2003-03-20			ENSG00000122584	ENSG00000122584			20693	protein-coding gene	gene with protein product		604639				9570794	Standard	NM_152745		Approved		uc003srv.3	P58417	OTTHUMG00000151941	ENST00000405863.1:c.567C>T	7.37:g.8791150C>T			Q8NB31	Silent	SNP	pirsf_Neurexophilin	p.S189	ENST00000405863.1	37	c.567	CCDS47540.1	7																																																																																			NXPH1	-	pirsf_Neurexophilin	ENSG00000122584		0.413	NXPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXPH1	HGNC	protein_coding	OTTHUMT00000324591.1	81	0.00	0	C	NM_152745		8791150	8791150	+1	no_errors	ENST00000405863	ensembl	human	known	69_37n	silent	50	25.37	17	SNP	1.000	T
PAPD7	11044	genome.wustl.edu	37	5	6755013	6755014	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr5:6755013_6755014delAC	ENST00000230859.6	+	13	1713_1714	c.1584_1585delAC	c.(1582-1587)aaacacfs	p.H529fs		NM_001171805.1|NM_001171806.1|NM_006999.4	NP_001165276.1|NP_001165277.1|NP_008930.1	Q5XG87	PAPD7_HUMAN	PAP associated domain containing 7	759					double-strand break repair (GO:0006302)|mitotic chromosome condensation (GO:0007076)|response to drug (GO:0042493)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|SMC family protein binding (GO:0043221)			cervix(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						GGAGGAAAAAACACACACACAC	0.653																																					NSCLC(7;212 333 5667 23379 46547)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF089896	CCDS3871.1	5p15	2010-11-18	2010-01-19	2010-01-19	ENSG00000112941	ENSG00000112941			16705	protein-coding gene	gene with protein product	"""topoisomerase-related function protein 4-1"", ""polymerase (DNA-directed) sigma"", ""DNA polymerase kappa"", ""TUTase5"""	605198	"""polymerase (DNA directed) sigma"""	POLS		10066793, 10926539	Standard	NM_006999		Approved	POLK, TRF4, LAK-1, TRF4-1	uc003jdx.1	Q5XG87	OTTHUMG00000090457	ENST00000230859.6:c.1584_1585delAC	5.37:g.6755023_6755024delAC	ENSP00000230859:p.His529fs		A8K1E2|M1JCE6|O43289|Q17RZ1|Q9Y6C1	Frame_Shift_Del	DEL	pfam_PAP_assoc,pfam_Nucleotidyltransferase	p.T532fs	ENST00000230859.6	37	c.1584_1585	CCDS3871.1	5																																																																																			PAPD7	-	NULL	ENSG00000112941		0.653	PAPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPD7	HGNC	protein_coding	OTTHUMT00000206904.1	12	0.00	0	AC	NM_006999		6755013	6755014	+1	no_errors	ENST00000230859	ensembl	human	known	69_37n	frame_shift_del	9	25.00	3	DEL	1.000:1.000	-
CFAP221	200373	genome.wustl.edu	37	2	120362809	120362809	+	Silent	SNP	C	C	G	rs536158307		TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr2:120362809C>G	ENST00000413369.3	+	11	1164	c.1077C>G	c.(1075-1077)ctC>ctG	p.L359L	PCDP1_ENST00000597189.1_3'UTR|PCDP1_ENST00000602047.1_Silent_p.L73L	NM_001271049.1	NP_001257978												p.L73L(2)				Colorectal(110;0.196)					AGGAGGCACTCTTTGAACAGA	0.378																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											73.0	75.0	74.0					2																	120362809		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000413369.3:c.1077C>G	2.37:g.120362809C>G				Silent	SNP	NULL	p.L359	ENST00000413369.3	37	c.1077	CCDS33282.2	2																																																																																			AC069154.2	-	NULL	ENSG00000163075		0.378	PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCDP1	Clone_based_vega_gene	protein_coding	OTTHUMT00000464236.1	103	0.00	0	C			120362809	120362809	+1	no_errors	ENST00000413369	ensembl	human	known	69_37n	silent	30	38.78	19	SNP	0.879	G
PKHD1	5314	genome.wustl.edu	37	6	51483961	51483961	+	Missense_Mutation	SNP	T	T	G	rs9381994	byFrequency	TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr6:51483961T>G	ENST00000371117.3	-	67	12418	c.12143A>C	c.(12142-12144)cAa>cCa	p.Q4048P	RP3-335N17.2_ENST00000589278.2_RNA|RP3-335N17.2_ENST00000454361.1_RNA|RP3-335N17.2_ENST00000587000.1_RNA	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	4048			Q -> R (in dbSNP:rs9381994). {ECO:0000269|PubMed:11919560, ECO:0000269|PubMed:12846734}.		cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TTTCTTCTCTTGGGAAAGCCC	0.547																																						dbGAP											0													42.0	45.0	44.0					6																	51483961		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.12143A>C	6.37:g.51483961T>G	ENSP00000360158:p.Gln4048Pro		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT_TIG_rcpt,smart_PbH1	p.Q4048P	ENST00000371117.3	37	c.12143	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	T	11.84	1.758069	0.31137	.	.	ENSG00000170927	ENST00000371117	D	0.86432	-2.12	5.27	3.95	0.45737	.	0.000000	0.45606	D	0.000358	D	0.84023	0.5381	L	0.59436	1.845	0.09310	P	0.999999999928248	D	0.61697	0.99	P	0.56398	0.797	D	0.85108	0.0961	9	0.62326	D	0.03	.	5.3886	0.16231	0.0:0.155:0.0:0.845	.	4048	P08F94	PKHD1_HUMAN	P	4048	ENSP00000360158:Q4048P	ENSP00000360158:Q4048P	Q	-	2	0	PKHD1	51591920	0.634000	0.27190	1.000000	0.80357	0.266000	0.26442	0.430000	0.21428	2.128000	0.65567	0.533000	0.62120	CAA	PKHD1	-	NULL	ENSG00000170927		0.547	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	49	0.00	0	T	NM_138694		51483961	51483961	-1	no_errors	ENST00000371117	ensembl	human	known	69_37n	missense	58	17.14	12	SNP	0.998	G
PWP1	11137	genome.wustl.edu	37	12	108086667	108086667	+	Silent	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr12:108086667G>A	ENST00000412830.3	+	4	564	c.396G>A	c.(394-396)ctG>ctA	p.L132L	PWP1_ENST00000541166.1_Silent_p.L70L	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	132					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.L132L(2)		breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						ACGTTACTCTGAAAGATACAG	0.358																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											117.0	116.0	116.0					12																	108086667		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.396G>A	12.37:g.108086667G>A			A8K3R6|Q7Z3X9	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L132	ENST00000412830.3	37	c.396	CCDS9114.1	12																																																																																			PWP1	-	superfamily_WD40_repeat_dom	ENSG00000136045		0.358	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PWP1	HGNC	protein_coding	OTTHUMT00000406539.1	294	0.00	0	G	NM_007062		108086667	108086667	+1	no_errors	ENST00000412830	ensembl	human	known	69_37n	silent	188	20.17	48	SNP	0.984	A
PXDNL	137902	genome.wustl.edu	37	8	52339306	52339306	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr8:52339306A>T	ENST00000356297.4	-	13	1638	c.1538T>A	c.(1537-1539)tTt>tAt	p.F513Y	PXDNL_ENST00000543296.1_Missense_Mutation_p.F513Y	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	513	Ig-like C2-type 4.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.F513Y(2)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				AAGTTGAGTAAACACTGCAAG	0.373																																						dbGAP											2	Substitution - Missense(2)	breast(2)											86.0	76.0	79.0					8																	52339306		1868	4109	5977	-	-	-	SO:0001583	missense	0				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1538T>A	8.37:g.52339306A>T	ENSP00000348645:p.Phe513Tyr		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like	p.F513Y	ENST00000356297.4	37	c.1538	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	A	8.908	0.958111	0.18507	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.73047	-0.71;-0.71	4.18	4.18	0.49190	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.80369	0.4610	H	0.94264	3.515	0.20196	N	0.999926	P	0.36974	0.576	B	0.41666	0.363	T	0.75886	-0.3159	9	0.87932	D	0	.	9.875	0.41197	1.0:0.0:0.0:0.0	.	513	A1KZ92	PXDNL_HUMAN	Y	513	ENSP00000348645:F513Y;ENSP00000444865:F513Y	ENSP00000348645:F513Y	F	-	2	0	PXDNL	52501859	1.000000	0.71417	0.020000	0.16555	0.028000	0.11728	5.128000	0.64733	1.652000	0.50683	0.528000	0.53228	TTT	PXDNL	-	pfam_Ig_I-set,pfscan_Ig-like	ENSG00000147485		0.373	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1	188	0.00	0	A	NM_144651		52339306	52339306	-1	no_errors	ENST00000356297	ensembl	human	known	69_37n	missense	168	25.00	56	SNP	0.554	T
RAD23B	5887	genome.wustl.edu	37	9	110086219	110086219	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr9:110086219G>A	ENST00000358015.3	+	8	1217	c.866G>A	c.(865-867)aGa>aAa	p.R289K	RAD23B_ENST00000416373.2_Missense_Mutation_p.R217K	NM_001244713.1|NM_002874.4	NP_001231642.1|NP_002865.1	P54727	RD23B_HUMAN	RAD23 homolog B (S. cerevisiae)	289	STI1.				DNA repair (GO:0006281)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|XPC complex (GO:0071942)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)	p.R289K(2)		breast(3)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						CAACAGATGAGACAAATTATT	0.373								Direct reversal of damage;Nucleotide excision repair (NER)																														dbGAP											2	Substitution - Missense(2)	breast(2)											160.0	151.0	154.0					9																	110086219		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6769.1, CCDS59138.1	9q31.2	2008-07-21	2001-11-28		ENSG00000119318	ENSG00000119318			9813	protein-coding gene	gene with protein product	"""XP-C repair complementing protein"", ""XP-C repair complementing complex 58 kDa"""	600062	"""RAD23 (S. cerevisiae) homolog B"""			7851894, 8168482	Standard	NM_002874		Approved	HHR23B, P58, HR23B	uc004bde.3	P54727	OTTHUMG00000020446	ENST00000358015.3:c.866G>A	9.37:g.110086219G>A	ENSP00000350708:p.Arg289Lys		B3KWK8|G5E9P0|Q7Z5K8|Q8WUB0	Missense_Mutation	SNP	pfam_XPC-bd,pfam_Ubiquitin,pfam_UBA/transl_elong_EF1B_N,pfam_SUMO,superfamily_XPC-bd,superfamily_UBA-like,smart_Ubiquitin,smart_UBA/transl_elong_EF1B_N_euk,smart_STI1_HS-bd,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup,prints_Rad23,tigrfam_Rad23	p.R289K	ENST00000358015.3	37	c.866	CCDS6769.1	9	.	.	.	.	.	.	.	.	.	.	G	36	5.739300	0.96873	.	.	ENSG00000119318	ENST00000358015;ENST00000416373	T;T	0.32272	1.53;1.46	5.51	5.51	0.81932	XPC-binding domain (3);Heat shock chaperonin-binding (1);	0.000000	0.85682	D	0.000000	T	0.62901	0.2466	M	0.84846	2.72	0.80722	D	1	D;D;D	0.65815	0.992;0.995;0.988	D;D;D	0.76071	0.987;0.98;0.966	T	0.67488	-0.5658	10	0.87932	D	0	-12.8654	19.7828	0.96424	0.0:0.0:1.0:0.0	.	268;289;289	B7Z4W4;B4DEA3;P54727	.;.;RD23B_HUMAN	K	289;217	ENSP00000350708:R289K;ENSP00000405623:R217K	ENSP00000350708:R289K	R	+	2	0	RAD23B	109126040	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.747000	0.94245	0.650000	0.86243	AGA	RAD23B	-	pfam_XPC-bd,superfamily_XPC-bd,smart_STI1_HS-bd,tigrfam_Rad23	ENSG00000119318		0.373	RAD23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD23B	HGNC	protein_coding	OTTHUMT00000053548.1	267	0.00	0	G	NM_002874		110086219	110086219	+1	no_errors	ENST00000358015	ensembl	human	known	69_37n	missense	96	35.57	53	SNP	1.000	A
RCOR3	55758	genome.wustl.edu	37	1	211486914	211486914	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr1:211486914A>T	ENST00000367005.4	+	11	1433	c.1292A>T	c.(1291-1293)cAg>cTg	p.Q431L	RCOR3_ENST00000367006.4_Silent_p.A408A|RCOR3_ENST00000419091.2_Missense_Mutation_p.Q489L|RCOR3_ENST00000526255.1_3'UTR	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	431	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.Q431L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		CTTCACCGGCAGCCTCCTCCA	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											105.0	88.0	94.0					1																	211486914		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.1292A>T	1.37:g.211486914A>T	ENSP00000355972:p.Gln431Leu		B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Missense_Mutation	SNP	pfam_SANT/Myb,pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.Q489L	ENST00000367005.4	37	c.1466	CCDS31016.1	1	.	.	.	.	.	.	.	.	.	.	A	15.11	2.735128	0.48939	.	.	ENSG00000117625	ENST00000419091;ENST00000367005;ENST00000529763	T;T	0.34275	1.37;1.42	5.07	5.07	0.68467	.	0.069132	0.64402	D	0.000012	T	0.34890	0.0913	.	.	.	0.40821	D	0.983503	B;B	0.30439	0.005;0.279	B;B	0.30572	0.003;0.117	T	0.28839	-1.0031	9	0.62326	D	0.03	-8.3658	14.8169	0.70041	1.0:0.0:0.0:0.0	.	489;431	Q9P2K3-3;Q9P2K3	.;RCOR3_HUMAN	L	489;431;207	ENSP00000413929:Q489L;ENSP00000355972:Q431L	ENSP00000355972:Q431L	Q	+	2	0	RCOR3	209553537	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.709000	0.61867	1.910000	0.55303	0.528000	0.53228	CAG	RCOR3	-	NULL	ENSG00000117625		0.592	RCOR3-001	KNOWN	basic|CCDS	protein_coding	RCOR3	HGNC	protein_coding	OTTHUMT00000089821.1	231	0.00	0	A	NM_018254		211486914	211486914	+1	no_errors	ENST00000419091	ensembl	human	known	69_37n	missense	114	22.97	34	SNP	1.000	T
SAAL1	113174	genome.wustl.edu	37	11	18124894	18124894	+	Splice_Site	SNP	C	C	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr11:18124894C>T	ENST00000524803.1	-	2	185		c.e2-1		SAAL1_ENST00000533851.1_Splice_Site|SAAL1_ENST00000300013.4_Splice_Site|SAAL1_ENST00000529318.1_Splice_Site			Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1									p.?(2)		breast(2)|large_intestine(5)|lung(8)	15						GGCTAACAATCTTCAGAAACA	0.388																																						dbGAP											2	Unknown(2)	breast(2)											137.0	125.0	129.0					11																	18124894		2200	4293	6493	-	-	-	SO:0001630	splice_region_variant	0			AK123457	CCDS31439.1	11p15.1	2005-10-28			ENSG00000166788	ENSG00000166788			25158	protein-coding gene	gene with protein product							Standard	NM_138421		Approved	FLJ41463	uc001mnq.3	Q96ER3	OTTHUMG00000166428	ENST00000524803.1:c.136-1G>A	11.37:g.18124894C>T			A6NH05	Splice_Site	SNP	-	e2-1	ENST00000524803.1	37	c.136-1	CCDS31439.1	11	.	.	.	.	.	.	.	.	.	.	C	18.87	3.715044	0.68844	.	.	ENSG00000166788	ENST00000524803;ENST00000300013;ENST00000532452;ENST00000529318;ENST00000530180	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2374	0.87002	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SAAL1	18081470	1.000000	0.71417	0.992000	0.48379	0.822000	0.46500	4.779000	0.62375	2.809000	0.96659	0.655000	0.94253	.	SAAL1	-	-	ENSG00000166788		0.388	SAAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAAL1	HGNC	protein_coding	OTTHUMT00000389728.1	172	0.00	0	C	NM_138421	Intron	18124894	18124894	-1	no_errors	ENST00000524803	ensembl	human	known	69_37n	splice_site	70	49.28	68	SNP	0.997	T
LINC00969	440993	genome.wustl.edu	37	3	195391070	195391070	+	lincRNA	SNP	C	C	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr3:195391070C>T	ENST00000445430.1	+	0	596									long intergenic non-protein coding RNA 969																		ATCGGTGCTGCTGTGTGGCTG	0.562																																						dbGAP											0																																										-	-	-			0			AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195391070C>T				RNA	SNP	-	NULL	ENST00000445430.1	37	NULL		3																																																																																			SDHAP2	-	-	ENSG00000215837		0.562	LINC00969-038	KNOWN	basic	lincRNA	SDHAP2	HGNC	lincRNA	OTTHUMT00000341951.1	62	0.00	0	C			195391070	195391070	+1	no_errors	ENST00000429897	ensembl	human	known	69_37n	rna	46	31.34	21	SNP	1.000	T
SLC9A7	84679	genome.wustl.edu	37	X	46539151	46539151	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chrX:46539151G>A	ENST00000328306.4	-	3	590	c.565C>T	c.(565-567)Cct>Tct	p.P189S		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	189					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)	p.P189S(2)		breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						ATAATTGGAGGCAGAAGAATG	0.299																																					Pancreas(118;454 1696 1930 13865 39976)	dbGAP											2	Substitution - Missense(2)	breast(2)											60.0	54.0	56.0					X																	46539151		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.565C>T	X.37:g.46539151G>A	ENSP00000330320:p.Pro189Ser		O75827|Q5JXP9	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.P189S	ENST00000328306.4	37	c.565	CCDS14269.1	X	.	.	.	.	.	.	.	.	.	.	G	29.1	4.975799	0.92982	.	.	ENSG00000065923	ENST00000328306	T	0.18338	2.22	6.16	6.16	0.99307	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.60353	0.2262	H	0.97186	3.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74090	-0.3777	10	0.87932	D	0	.	19.7182	0.96132	0.0:0.0:1.0:0.0	.	189	Q96T83	SL9A7_HUMAN	S	189	ENSP00000330320:P189S	ENSP00000330320:P189S	P	-	1	0	SLC9A7	46424095	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.178000	0.94855	2.614000	0.88457	0.594000	0.82650	CCT	SLC9A7	-	pfam_Cation/H_exchanger,prints_NaH_exchanger,tigrfam_NaH_exchanger	ENSG00000065923		0.299	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A7	HGNC	protein_coding	OTTHUMT00000056370.1	188	0.00	0	G	NM_032591		46539151	46539151	-1	no_errors	ENST00000328306	ensembl	human	known	69_37n	missense	44	34.33	23	SNP	1.000	A
SLC6A8	6535	genome.wustl.edu	37	X	152959549	152959549	+	Intron	SNP	C	C	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chrX:152959549C>T	ENST00000253122.5	+	9	1730				SLC6A8_ENST00000485324.1_3'UTR|SLC6A8_ENST00000430077.2_Intron	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8						cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	GGGTGGAGGGCGGTGCGGGGC	0.672																																						dbGAP											0													22.0	19.0	20.0					X																	152959549		2203	4295	6498	-	-	-	SO:0001627	intron_variant	0				CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.1255-36C>T	X.37:g.152959549C>T			B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	RNA	SNP	-	NULL	ENST00000253122.5	37	NULL	CCDS14726.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|N	0|0	-2.656274|-2.656274	0.00108|0.00108	.|.	.|.	ENSG00000130821|ENSG00000130821	ENST00000328897|ENST00000328897	.|.	.|.	.|.	4.02|4.02	-8.03|-8.03	0.01114|0.01114	.|.	.|.	.|.	.|.	.|.	.|T	.|0.24812	.|0.0602	.|.	.|.	.|.	0.25868|0.25868	N|N	0.983749|0.983749	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.26121	.|-1.0112	.|4	.|.	.|.	.|.	.|.	7.3586|7.3586	0.26733|0.26733	0.4394:0.4254:0.0:0.1352|0.4394:0.4254:0.0:0.1352	.|.	.|.	.|.	.|.	.|W	-1|450	.|.	.|.	.|R	+|+	.|1	.|2	SLC6A8|SLC6A8	152612743|152612743	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.020000|0.020000	0.10135|0.10135	-2.174000|-2.174000	0.01264|0.01264	-2.187000|-2.187000	0.00759|0.00759	-1.849000|-1.849000	0.00571|0.00571	.|CGG	SLC6A8	-	-	ENSG00000130821		0.672	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A8	HGNC	protein_coding	OTTHUMT00000061003.1	49	0.00	0	C			152959549	152959549	+1	no_errors	ENST00000485324	ensembl	human	known	69_37n	rna	31	45.61	26	SNP	0.000	T
SMTNL2	342527	genome.wustl.edu	37	17	4496467	4496467	+	Splice_Site	SNP	G	G	T	rs202160684	byFrequency	TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr17:4496467G>T	ENST00000389313.4	+	3	797		c.e3+1		SMTNL2_ENST00000338859.4_Splice_Site	NM_001114974.1	NP_001108446.1	Q2TAL5	SMTL2_HUMAN	smoothelin-like 2									p.?(17)		breast(1)|endometrium(9)|kidney(1)|lung(1)|skin(1)	13				READ - Rectum adenocarcinoma(115;0.0325)		AGTCCTAGCGGTATGAGCTGG	0.657																																						dbGAP											17	Unknown(17)	endometrium(16)|breast(1)											31.0	33.0	33.0					17																	4496467		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK124452	CCDS11048.1, CCDS45583.1	17p13.2	2006-04-26			ENSG00000188176	ENSG00000188176			24764	protein-coding gene	gene with protein product							Standard	NM_001114974		Approved	FLJ42461	uc002fyf.1	Q2TAL5	OTTHUMG00000132938	ENST00000389313.4:c.730+1G>T	17.37:g.4496467G>T			Q6ZVK6	Splice_Site	SNP	-	e3+1	ENST00000389313.4	37	c.730+1	CCDS45583.1	17	.	.	.	.	.	.	.	.	.	.	G	12.61	1.990579	0.35131	.	.	ENSG00000188176	ENST00000338859;ENST00000389313	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5337	0.67944	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SMTNL2	4443216	1.000000	0.71417	1.000000	0.80357	0.314000	0.28054	3.181000	0.50903	2.722000	0.93159	0.655000	0.94253	.	SMTNL2	-	-	ENSG00000188176		0.657	SMTNL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMTNL2	HGNC	protein_coding	OTTHUMT00000439129.1	21	0.00	0	G	NM_198501	Intron	4496467	4496467	+1	no_errors	ENST00000389313	ensembl	human	known	69_37n	splice_site	14	30.00	6	SNP	0.999	T
SPG11	80208	genome.wustl.edu	37	15	44944117	44944117	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr15:44944117G>A	ENST00000261866.7	-	6	1044	c.1028C>T	c.(1027-1029)tCa>tTa	p.S343L	SPG11_ENST00000558319.1_Missense_Mutation_p.S343L|SPG11_ENST00000427534.2_Missense_Mutation_p.S343L|SPG11_ENST00000559193.1_Missense_Mutation_p.S343L|SPG11_ENST00000535302.2_Missense_Mutation_p.S343L	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	343					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)		p.S343L(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		ATTCAATGATGATAGCTGGGC	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											39.0	34.0	36.0					15																	44944117		2198	4298	6496	-	-	-	SO:0001583	missense	0				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.1028C>T	15.37:g.44944117G>A	ENSP00000261866:p.Ser343Leu		A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	NULL	p.S343L	ENST00000261866.7	37	c.1028	CCDS10112.1	15	.	.	.	.	.	.	.	.	.	.	G	11.91	1.781014	0.31502	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	T;T;T	0.79653	-1.29;-1.02;-1.02	5.96	2.0	0.26442	.	0.358507	0.26300	N	0.025171	T	0.67458	0.2895	L	0.33485	1.01	0.09310	N	1	B;B;B;B	0.12013	0.002;0.005;0.004;0.002	B;B;B;B	0.13407	0.009;0.009;0.004;0.009	T	0.53165	-0.8477	10	0.29301	T	0.29	-6.2607	8.6753	0.34176	0.367:0.0:0.633:0.0	.	343;343;343;343	C4B7M2;F5H3N6;B9EK60;Q96JI7	.;.;.;SPTCS_HUMAN	L	343	ENSP00000261866:S343L;ENSP00000445278:S343L;ENSP00000396110:S343L	ENSP00000261866:S343L	S	-	2	0	SPG11	42731409	0.004000	0.15560	0.514000	0.27761	0.994000	0.84299	0.497000	0.22514	0.407000	0.25591	0.655000	0.94253	TCA	SPG11	-	NULL	ENSG00000104133		0.398	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	HGNC	protein_coding	OTTHUMT00000253927.1	50	0.00	0	G			44944117	44944117	-1	no_errors	ENST00000261866	ensembl	human	known	69_37n	missense	23	37.84	14	SNP	0.004	A
STAG1	10274	genome.wustl.edu	37	3	136096565	136096565	+	Silent	SNP	C	C	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr3:136096565C>T	ENST00000383202.2	-	23	2563	c.2307G>A	c.(2305-2307)gtG>gtA	p.V769V	STAG1_ENST00000434713.2_Silent_p.V543V|STAG1_ENST00000536929.1_Silent_p.V353V|STAG1_ENST00000236698.5_Silent_p.V769V	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	769					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.V769V(2)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						AAAAGGATTTCACCGTTTTCC	0.368																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											85.0	82.0	83.0					3																	136096565		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.2307G>A	3.37:g.136096565C>T			O00539|Q6P275	Silent	SNP	pfam_STAG,superfamily_ARM-type_fold	p.V769	ENST00000383202.2	37	c.2307	CCDS3090.1	3																																																																																			STAG1	-	superfamily_ARM-type_fold	ENSG00000118007		0.368	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG1	HGNC	protein_coding	OTTHUMT00000357366.1	134	0.00	0	C	NM_005862		136096565	136096565	-1	no_errors	ENST00000383202	ensembl	human	known	69_37n	silent	103	19.53	25	SNP	1.000	T
SYT11	23208	genome.wustl.edu	37	1	155850298	155850298	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr1:155850298T>A	ENST00000368324.4	+	3	1122	c.869T>A	c.(868-870)aTc>aAc	p.I290N	SYT11_ENST00000539162.1_5'UTR	NM_152280.4	NP_689493.3	Q9BT88	SYT11_HUMAN	synaptotagmin XI	290					negative regulation of neurotransmitter secretion (GO:0046929)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.I290N(2)		breast(2)|central_nervous_system(1)|endometrium(1)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			CAGAAGTGCATCAGCAGAGGG	0.542																																						dbGAP											2	Substitution - Missense(2)	breast(2)											88.0	82.0	84.0					1																	155850298		2203	4300	6503	-	-	-	SO:0001583	missense	0			D38522	CCDS1122.1	1q22	2013-01-21			ENSG00000132718	ENSG00000132718		"""Synaptotagmins"""	19239	protein-coding gene	gene with protein product		608741				11543631	Standard	NM_152280		Approved	KIAA0080, MGC10881, MGC17226, DKFZp781D015	uc001fmg.3	Q9BT88	OTTHUMG00000014105	ENST00000368324.4:c.869T>A	1.37:g.155850298T>A	ENSP00000357307:p.Ile290Asn		Q14998|Q5W0D4|Q68CT5|Q8IXU3|Q96SU2	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin	p.I290N	ENST00000368324.4	37	c.869	CCDS1122.1	1	.	.	.	.	.	.	.	.	.	.	T	10.29	1.308642	0.23821	.	.	ENSG00000132718	ENST00000368324	T	0.40476	1.03	5.2	5.2	0.72013	.	0.486238	0.22236	N	0.062759	T	0.12944	0.0314	N	0.14661	0.345	0.80722	D	1	B	0.23735	0.09	B	0.19148	0.024	T	0.07927	-1.0747	10	0.17369	T	0.5	.	14.8907	0.70606	0.0:0.0:0.0:1.0	.	290	Q9BT88	SYT11_HUMAN	N	290	ENSP00000357307:I290N	ENSP00000357307:I290N	I	+	2	0	SYT11	154116922	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	3.149000	0.50655	2.177000	0.69029	0.533000	0.62120	ATC	SYT11	-	NULL	ENSG00000132718		0.542	SYT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT11	HGNC	protein_coding	OTTHUMT00000039597.1	123	0.00	0	T	NM_152280		155850298	155850298	+1	no_errors	ENST00000368324	ensembl	human	known	69_37n	missense	44	60.36	67	SNP	1.000	A
TADA2B	93624	genome.wustl.edu	37	4	7055893	7055893	+	Silent	SNP	C	C	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr4:7055893C>T	ENST00000310074.7	+	2	564	c.375C>T	c.(373-375)ccC>ccT	p.P125P	TADA2B_ENST00000515646.1_Silent_p.P33P|TADA2B_ENST00000512388.1_Silent_p.P50P	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	125					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.P125P(2)		breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						CCTGCATCCCCGACACCATCC	0.642																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											26.0	31.0	29.0					4																	7055893		2103	4210	6313	-	-	-	SO:0001819	synonymous_variant	0			AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.375C>T	4.37:g.7055893C>T			A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Silent	SNP	pfam_SANT/Myb,pfam_Znf_ZZ,superfamily_Homeodomain-like,smart_Znf_ZZ,smart_SANT/Myb,pirsf_Transcriptional_adaptor_2,pfscan_Znf_ZZ,pfscan_Myb-like_dom	p.P125	ENST00000310074.7	37	c.375	CCDS47007.1	4																																																																																			TADA2B	-	pirsf_Transcriptional_adaptor_2	ENSG00000173011		0.642	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA2B	HGNC	protein_coding	OTTHUMT00000358687.2	59	0.00	0	C	NM_152293		7055893	7055893	+1	no_errors	ENST00000310074	ensembl	human	known	69_37n	silent	9	56.52	13	SNP	0.115	T
TAS2R1	50834	genome.wustl.edu	37	5	9629727	9629727	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr5:9629727T>G	ENST00000382492.2	-	1	736	c.418A>C	c.(418-420)Att>Ctt	p.I140L	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	140					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.I140L(2)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						AAAACACAAATCATAGATACA	0.438																																						dbGAP											2	Substitution - Missense(2)	breast(2)											58.0	62.0	61.0					5																	9629727		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.418A>C	5.37:g.9629727T>G	ENSP00000371932:p.Ile140Leu		Q646G8	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.I140L	ENST00000382492.2	37	c.418	CCDS3876.1	5	.	.	.	.	.	.	.	.	.	.	T	11.94	1.790038	0.31685	.	.	ENSG00000169777	ENST00000382492	T	0.00730	5.77	5.43	-10.9	0.00192	.	2.122320	0.01981	N	0.044846	T	0.00552	0.0018	L	0.31207	0.915	0.09310	N	1	B	0.22080	0.064	B	0.18263	0.021	T	0.50162	-0.8860	9	.	.	.	.	0.4482	0.00497	0.2932:0.1912:0.2918:0.2238	.	140	Q9NYW7	TA2R1_HUMAN	L	140	ENSP00000371932:I140L	.	I	-	1	0	TAS2R1	9682727	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.006000	0.13152	-1.742000	0.01342	-0.327000	0.08410	ATT	TAS2R1	-	pfam_TAS2_rcpt	ENSG00000169777		0.438	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R1	HGNC	protein_coding	OTTHUMT00000206988.2	38	0.00	0	T			9629727	9629727	-1	no_errors	ENST00000382492	ensembl	human	known	69_37n	missense	70	16.67	14	SNP	0.000	G
TCF20	6942	genome.wustl.edu	37	22	42609210	42609210	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr22:42609210G>A	ENST00000359486.3	-	1	2238	c.2102C>T	c.(2101-2103)tCt>tTt	p.S701F	TCF20_ENST00000404876.1_5'Flank|TCF20_ENST00000335626.4_Missense_Mutation_p.S701F	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	701					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.S701F(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						ACTTCCAGGAGATTTGCTAGG	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											131.0	126.0	127.0					22																	42609210		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.2102C>T	22.37:g.42609210G>A	ENSP00000352463:p.Ser701Phe		A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	smart_Znf_PHD	p.S701F	ENST00000359486.3	37	c.2102	CCDS14033.1	22	.	.	.	.	.	.	.	.	.	.	G	17.15	3.316597	0.60524	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.67171	-0.25;-0.25	5.93	5.93	0.95920	.	0.000000	0.64402	D	0.000001	T	0.74473	0.3721	N	0.24115	0.695	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.83275	0.996;0.991	T	0.76929	-0.2777	10	0.87932	D	0	-15.9947	20.3368	0.98748	0.0:0.0:1.0:0.0	.	701;701	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	F	701	ENSP00000352463:S701F;ENSP00000335561:S701F	ENSP00000335561:S701F	S	-	2	0	TCF20	40939154	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.716000	0.74702	2.805000	0.96524	0.655000	0.94253	TCT	TCF20	-	NULL	ENSG00000100207		0.502	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	HGNC	protein_coding	OTTHUMT00000320531.1	87	0.00	0	G	NM_181492		42609210	42609210	-1	no_errors	ENST00000359486	ensembl	human	known	69_37n	missense	45	28.12	18	SNP	1.000	A
TNNT3	7140	genome.wustl.edu	37	11	1950349	1950349	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr11:1950349G>A	ENST00000397301.1	+	8	123		c.e8-1		TNNT3_ENST00000360603.3_Intron|TNNT3_ENST00000381549.3_Intron|TNNT3_ENST00000446240.1_Intron|TNNT3_ENST00000381548.3_Splice_Site|TNNT3_ENST00000381589.3_Intron|TNNT3_ENST00000381579.3_Intron|TNNT3_ENST00000381558.1_Intron|TNNT3_ENST00000278317.6_Splice_Site|TNNT3_ENST00000381561.4_Intron|TNNT3_ENST00000397304.2_Intron			P45378	TNNT3_HUMAN	troponin T type 3 (skeletal, fast)						ATP catabolic process (GO:0006200)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)|regulation of striated muscle contraction (GO:0006942)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|troponin complex (GO:0005861)	calcium-dependent protein binding (GO:0048306)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)	p.?(2)		breast(2)|endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(4)|stomach(1)	19		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)		CCACCTGGAAGACACCGCAGA	0.677																																						dbGAP											2	Unknown(2)	breast(2)											109.0	111.0	110.0					11																	1950349		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			M21984	CCDS7727.1, CCDS41594.1, CCDS41595.1, CCDS41596.1	11p15.5	2014-09-17	2005-09-12		ENSG00000130595	ENSG00000130595			11950	protein-coding gene	gene with protein product	"""troponin-T3, skeletal, fast"""	600692	"""troponin T3, skeletal, fast"""			8172653	Standard	NM_001042782		Approved	AMCD2B, DA2B, FSSV, DKFZp779M2348	uc001lup.4	P45378	OTTHUMG00000012475	ENST00000397301.1:c.116-1G>A	11.37:g.1950349G>A			A8MQ76|A8MSW1|B3KPX3|B7WP64|B7ZL26|B7ZVV9|Q12975|Q12976|Q12977|Q12978|Q17RG9|Q6FH29|Q6N056|Q86TH6	Splice_Site	SNP	-	e8-1	ENST00000397301.1	37	c.116-1		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|.	0.322|0.322	-0.961236|-0.961236	0.02249|0.02249	.|.	.|.	ENSG00000130595|ENSG00000130595	ENST00000278317;ENST00000381548;ENST00000397301|ENST00000397309	.|.	.|.	.|.	2.89|2.89	1.96|1.96	0.26148|0.26148	.|.	.|25.583500	.|0.05177	.|U	.|0.500671	.|T	.|0.37919	.|0.1021	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.37126	.|-0.9719	.|6	.|0.44086	.|T	.|0.13	.|-18.8111	6.6485|6.6485	0.22949|0.22949	0.1491:0.0:0.8509:0.0|0.1491:0.0:0.8509:0.0	.|.	.|.	.|.	.|.	.|N	-1|40	.|.	.|ENSP00000380476:D40N	.|D	+|+	.|1	.|0	TNNT3|TNNT3	1906925|1906925	0.190000|0.190000	0.23276|0.23276	0.016000|0.016000	0.15963|0.15963	0.004000|0.004000	0.04260|0.04260	0.871000|0.871000	0.28023|0.28023	0.499000|0.499000	0.27970|0.27970	-0.332000|-0.332000	0.08345|0.08345	.|GAC	TNNT3	-	-	ENSG00000130595		0.677	TNNT3-010	KNOWN	basic	protein_coding	TNNT3	HGNC	protein_coding	OTTHUMT00000142920.3	70	0.00	0	G	NM_006757	Intron	1950349	1950349	+1	no_errors	ENST00000397301	ensembl	human	known	69_37n	splice_site	26	23.53	8	SNP	0.002	A
TP53	7157	genome.wustl.edu	37	17	7577559	7577559	+	Missense_Mutation	SNP	G	G	C	rs397516437|rs28934573		TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr17:7577559G>C	ENST00000269305.4	-	7	911	c.722C>G	c.(721-723)tCc>tGc	p.S241C	TP53_ENST00000445888.2_Missense_Mutation_p.S241C|TP53_ENST00000359597.4_Missense_Mutation_p.S241C|TP53_ENST00000413465.2_Missense_Mutation_p.S241C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.S241C|TP53_ENST00000455263.2_Missense_Mutation_p.S241C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	241	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		S -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|S -> C (in sporadic cancers; somatic mutation).|S -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934573). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228}.|S -> P (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S241F(85)|p.S241C(26)|p.0?(8)|p.S241Y(8)|p.C242fs*5(6)|p.?(5)|p.S241del(5)|p.S148F(4)|p.N239_C242delNSSC(3)|p.N239_C242>S(1)|p.C238fs*21(1)|p.S241fs*22(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.S148C(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCCATGCAGGAACTGTTACA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	160	Substitution - Missense(124)|Deletion - In frame(13)|Deletion - Frameshift(9)|Whole gene deletion(8)|Unknown(5)|Complex - deletion inframe(1)	urinary_tract(19)|large_intestine(18)|breast(17)|endometrium(15)|ovary(15)|lung(12)|skin(9)|biliary_tract(8)|central_nervous_system(8)|haematopoietic_and_lymphoid_tissue(7)|upper_aerodigestive_tract(6)|stomach(6)|oesophagus(5)|bone(5)|liver(3)|pancreas(3)|eye(2)|thyroid(1)|kidney(1)	GRCh37	CM920673	TP53	M	rs28934573						139.0	108.0	118.0					17																	7577559		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.722C>G	17.37:g.7577559G>C	ENSP00000269305:p.Ser241Cys		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.S241C	ENST00000269305.4	37	c.722	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	17.00	3.276619	0.59758	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99857	-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22	4.62	3.64	0.41730	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.120078	0.56097	D	0.000022	D	0.99871	0.9939	M	0.92784	3.345	0.51233	D	0.999916	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0;0.999	D	0.96551	0.9408	10	0.87932	D	0	-35.4617	12.8645	0.57932	0.0:0.1651:0.8349:0.0	.	241;241;148;241;241;241	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	C	241;241;241;241;241;241;230;148;109;148	ENSP00000410739:S241C;ENSP00000352610:S241C;ENSP00000269305:S241C;ENSP00000398846:S241C;ENSP00000391127:S241C;ENSP00000391478:S241C;ENSP00000425104:S109C;ENSP00000423862:S148C	ENSP00000269305:S241C	S	-	2	0	TP53	7518284	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.346000	0.44027	1.295000	0.44724	0.462000	0.41574	TCC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	105	0.00	0	G	NM_000546		7577559	7577559	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	18	58.14	25	SNP	1.000	C
TRPM2	7226	genome.wustl.edu	37	21	45795833	45795833	+	Missense_Mutation	SNP	G	G	A	rs140112668		TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr21:45795833G>A	ENST00000397928.1	+	6	1334	c.889G>A	c.(889-891)Gtg>Atg	p.V297M	TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000300482.5_Missense_Mutation_p.V297M|TRPM2_ENST00000300481.9_Missense_Mutation_p.V297M|TRPM2_ENST00000397932.2_Missense_Mutation_p.V297M	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	297					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)	p.V297M(2)		breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						CCAGTACGGGGTGGAGATTCC	0.567																																						dbGAP											2	Substitution - Missense(2)	breast(2)											126.0	116.0	119.0					21																	45795833		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.889G>A	21.37:g.45795833G>A	ENSP00000381023:p.Val297Met		D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.V297M	ENST00000397928.1	37	c.889	CCDS13710.1	21	.	.	.	.	.	.	.	.	.	.	G	15.78	2.933448	0.52866	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.06068	3.35;3.35;3.35;3.35	4.27	4.27	0.50696	.	0.236154	0.34828	N	0.003658	T	0.23249	0.0562	M	0.66506	2.035	0.51233	D	0.999918	D;D	0.89917	1.0;0.999	D;D	0.75484	0.986;0.969	T	0.01105	-1.1450	10	0.51188	T	0.08	-33.2083	16.8938	0.86094	0.0:0.0:1.0:0.0	.	297;297	E9PGK7;O94759	.;TRPM2_HUMAN	M	297	ENSP00000300482:V297M;ENSP00000381023:V297M;ENSP00000300481:V297M;ENSP00000381026:V297M	ENSP00000300481:V297M	V	+	1	0	TRPM2	44620261	1.000000	0.71417	0.979000	0.43373	0.238000	0.25445	6.062000	0.71155	2.207000	0.71202	0.563000	0.77884	GTG	TRPM2	-	NULL	ENSG00000142185		0.567	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	HGNC	protein_coding	OTTHUMT00000098086.1	204	0.00	0	G	NM_003307		45795833	45795833	+1	no_errors	ENST00000300482	ensembl	human	known	69_37n	missense	68	26.09	24	SNP	0.996	A
TRPM4	54795	genome.wustl.edu	37	19	49692303	49692303	+	Silent	SNP	C	C	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr19:49692303C>A	ENST00000252826.5	+	14	2100	c.1974C>A	c.(1972-1974)gcC>gcA	p.A658A	TRPM4_ENST00000427978.2_Silent_p.A658A|TRPM4_ENST00000355712.5_Silent_p.A304A	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	658					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)	p.A658A(1)		breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		TCCAGCTGGCCATGCAAGCTG	0.617																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											65.0	69.0	67.0					19																	49692303		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.1974C>A	19.37:g.49692303C>A			A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Silent	SNP	pfam_Ion_trans_dom	p.A658	ENST00000252826.5	37	c.1974	CCDS33073.1	19																																																																																			TRPM4	-	NULL	ENSG00000130529		0.617	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM4	HGNC	protein_coding	OTTHUMT00000465543.2	41	0.00	0	C	NM_017636		49692303	49692303	+1	no_errors	ENST00000252826	ensembl	human	known	69_37n	silent	15	33.33	8	SNP	0.751	A
UBR7	55148	genome.wustl.edu	37	14	93686633	93686633	+	Silent	SNP	T	T	C			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr14:93686633T>C	ENST00000013070.6	+	9	1235	c.999T>C	c.(997-999)gaT>gaC	p.D333D	UBR7_ENST00000416753.1_Silent_p.D257D	NM_175748.3	NP_786924.2	Q8N806	UBR7_HUMAN	ubiquitin protein ligase E3 component n-recognin 7 (putative)	333							ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D333D(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(12)|urinary_tract(1)	19						TCCTGACAGATGAATACGACA	0.388																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											109.0	111.0	110.0					14																	93686633		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001345	CCDS9909.1	14q32.12	2008-06-23	2008-06-23	2008-06-23		ENSG00000012963		"""Ubiquitin protein ligase E3 component n-recognins"""	20344	protein-coding gene	gene with protein product		613816	"""chromosome 14 open reading frame 130"""	C14orf130		18162545	Standard	NM_175748		Approved		uc001ybm.4	Q8N806		ENST00000013070.6:c.999T>C	14.37:g.93686633T>C			Q86U21|Q86UA9|Q96BY0|Q9NVV6	Nonstop_Mutation	SNP	NULL	p.*32R	ENST00000013070.6	37	c.94	CCDS9909.1	14	.	.	.	.	.	.	.	.	.	.	T	9.992	1.231194	0.22626	.	.	ENSG00000012963	ENST00000555329	.	.	.	5.8	0.342	0.15996	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-24.4324	2.4143	0.04432	0.1129:0.3001:0.1166:0.4704	.	.	.	.	R	32	.	.	X	+	1	0	UBR7	92756386	0.999000	0.42202	0.976000	0.42696	0.997000	0.91878	0.419000	0.21247	-0.170000	0.10816	0.482000	0.46254	TGA	UBR7	-	NULL	ENSG00000012963		0.388	UBR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR7	HGNC	protein_coding	OTTHUMT00000412693.1	62	0.00	0	T	NM_175748		93686633	93686633	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000555329	ensembl	human	novel	69_37n	nonstop	20	48.72	19	SNP	0.999	C
USH2A	7399	genome.wustl.edu	37	1	215847863	215847863	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr1:215847863A>T	ENST00000307340.3	-	63	13776	c.13390T>A	c.(13390-13392)Tgg>Agg	p.W4464R	USH2A_ENST00000366943.2_Missense_Mutation_p.W4464R	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4464	Fibronectin type-III 30. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.W4464R(2)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGAGGTTTCCAGGTGATTTCT	0.453										HNSCC(13;0.011)																												dbGAP											2	Substitution - Missense(2)	breast(2)											117.0	121.0	119.0					1																	215847863		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.13390T>A	1.37:g.215847863A>T	ENSP00000305941:p.Trp4464Arg		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.W4464R	ENST00000307340.3	37	c.13390	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	A	19.39	3.817961	0.71028	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	D;D	0.91011	-2.77;-2.1	4.41	4.41	0.53225	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.39985	U	0.001213	D	0.96685	0.8918	H	0.96430	3.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97815	1.0253	10	0.87932	D	0	.	13.9406	0.64052	1.0:0.0:0.0:0.0	.	4464	O75445	USH2A_HUMAN	R	4464	ENSP00000305941:W4464R;ENSP00000355910:W4464R	ENSP00000305941:W4464R	W	-	1	0	USH2A	213914486	1.000000	0.71417	0.999000	0.59377	0.901000	0.52897	7.082000	0.76851	1.754000	0.51921	0.383000	0.25322	TGG	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.453	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	184	0.00	0	A	NM_007123		215847863	215847863	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	95	16.67	19	SNP	1.000	T
WDHD1	11169	genome.wustl.edu	37	14	55408276	55408276	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr14:55408276T>G	ENST00000360586.3	-	26	3387	c.3322A>C	c.(3322-3324)Aaa>Caa	p.K1108Q	WDHD1_ENST00000359167.4_Missense_Mutation_p.K626Q|WDHD1_ENST00000420358.2_Missense_Mutation_p.K985Q|WDHD1_ENST00000421192.1_Missense_Mutation_p.K985Q	NM_007086.3	NP_009017.1	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	1108					heterochromatin maintenance (GO:0070829)|regulation of chromosome organization (GO:0033044)|RNA processing (GO:0006396)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA binding (GO:0003723)	p.K1108Q(2)		breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(2)	42						TTCTGCTTTTTAGACAAATTC	0.363																																						dbGAP											2	Substitution - Missense(2)	breast(2)											138.0	139.0	139.0					14																	55408276		2201	4298	6499	-	-	-	SO:0001583	missense	0			AJ006266	CCDS9721.1, CCDS41955.1	14q22.2	2013-01-09			ENSG00000198554	ENSG00000198554		"""WD repeat domain containing"""	23170	protein-coding gene	gene with protein product	"""CTF4, chromosome transmission fidelity factor 4 homolog (S. cerevisiae)"""	608126				9175701, 20028748	Standard	NM_007086		Approved	AND-1, CTF4, CHTF4	uc001xbm.2	O75717	OTTHUMG00000140304	ENST00000360586.3:c.3322A>C	14.37:g.55408276T>G	ENSP00000353793:p.Lys1108Gln		C9JW18|F6W0U7	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_DUF3639,pfam_TIF2A_beta_prop-like,superfamily_WD40_repeat_dom,superfamily_HMG_superfamily,smart_WD40_repeat,smart_HMG_superfamily,pfscan_HMG_superfamily,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K1108Q	ENST00000360586.3	37	c.3322	CCDS9721.1	14	.	.	.	.	.	.	.	.	.	.	T	14.33	2.502956	0.44558	.	.	ENSG00000198554	ENST00000360586;ENST00000359167;ENST00000421192	T;T;T	0.68331	0.08;0.45;-0.32	5.78	4.64	0.57946	.	0.053401	0.64402	N	0.000001	T	0.78007	0.4216	M	0.65498	2.005	0.49798	D	0.999826	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77645	-0.2510	10	0.52906	T	0.07	.	10.1115	0.42565	0.0:0.0764:0.0:0.9236	.	626;1108	F8W7P7;O75717	.;WDHD1_HUMAN	Q	1108;626;985	ENSP00000353793:K1108Q;ENSP00000352085:K626Q;ENSP00000391049:K985Q	ENSP00000352085:K626Q	K	-	1	0	WDHD1	54478026	1.000000	0.71417	0.939000	0.37840	0.035000	0.12851	4.985000	0.63845	1.029000	0.39812	-0.250000	0.11733	AAA	WDHD1	-	NULL	ENSG00000198554		0.363	WDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDHD1	HGNC	protein_coding	OTTHUMT00000276897.2	562	0.00	0	T	NM_007086		55408276	55408276	-1	no_errors	ENST00000360586	ensembl	human	known	69_37n	missense	114	60.00	171	SNP	0.987	G
WDR37	22884	genome.wustl.edu	37	10	1123883	1123883	+	Silent	SNP	C	C	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr10:1123883C>T	ENST00000358220.1	+	3	319	c.175C>T	c.(175-177)Ctg>Ttg	p.L59L	WDR37_ENST00000263150.4_Silent_p.L59L|WDR37_ENST00000381329.1_Silent_p.L59L			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	59								p.L59L(2)		breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		CAGTACACTTCTGGAACTGTT	0.318																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											87.0	89.0	89.0					10																	1123883		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540	ENST00000358220.1:c.175C>T	10.37:g.1123883C>T			A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L59	ENST00000358220.1	37	c.175	CCDS7057.1	10																																																																																			WDR37	-	NULL	ENSG00000047056		0.318	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR37	HGNC	protein_coding	OTTHUMT00000046418.1	167	0.00	0	C	NM_014023		1123883	1123883	+1	no_errors	ENST00000263150	ensembl	human	known	69_37n	silent	103	32.26	50	SNP	0.998	T
WISP2	8839	genome.wustl.edu	37	20	43348649	43348649	+	Missense_Mutation	SNP	C	C	T	rs377297178		TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr20:43348649C>T	ENST00000372868.2	+	3	515	c.172C>T	c.(172-174)Cgg>Tgg	p.R58W	WISP2_ENST00000372865.4_Missense_Mutation_p.R58W|RP11-445H22.4_ENST00000427598.1_RNA|RP11-445H22.4_ENST00000445420.1_RNA|RP11-445H22.4_ENST00000427303.1_RNA|WISP2_ENST00000190983.4_Missense_Mutation_p.R58W			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2	58	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.R58W(1)		skin(1)	1		Myeloproliferative disorder(115;0.0122)				GGTATGTGCACGGCGGCTGGG	0.731																																						dbGAP											1	Substitution - Missense(1)	breast(1)											28.0	24.0	26.0					20																	43348649		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.172C>T	20.37:g.43348649C>T	ENSP00000361959:p.Arg58Trp		B2R9N4|E1P612|Q6PEG3	Missense_Mutation	SNP	pfam_IGFBP-like,pfam_VWF_C,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_IGFBP-like,smart_VWF_C,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.R58W	ENST00000372868.2	37	c.172	CCDS13336.1	20	.	.	.	.	.	.	.	.	.	.	C	21.1	4.105258	0.77096	.	.	ENSG00000064205	ENST00000372868;ENST00000372865;ENST00000190983	T;T;T	0.62788	-0.0;-0.0;-0.0	5.41	4.45	0.53987	Insulin-like growth factor-binding protein, IGFBP (3);Insulin-like growth factor binding protein, N-terminal, Cys-rich conserved site (1);	0.000000	0.85682	D	0.000000	T	0.81029	0.4738	M	0.85197	2.74	0.45634	D	0.998563	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84734	0.0747	10	0.87932	D	0	-34.9539	15.4048	0.74868	0.1402:0.8598:0.0:0.0	.	58;58	Q6PEG3;O76076	.;WISP2_HUMAN	W	58	ENSP00000361959:R58W;ENSP00000361956:R58W;ENSP00000190983:R58W	ENSP00000190983:R58W	R	+	1	2	WISP2	42782063	0.553000	0.26513	0.994000	0.49952	0.953000	0.61014	1.823000	0.39062	1.245000	0.43885	0.644000	0.83932	CGG	WISP2	-	pfam_IGFBP-like,smart_IGFBP-like	ENSG00000064205		0.731	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WISP2	HGNC	protein_coding	OTTHUMT00000127824.1	41	0.00	0	C	NM_003881		43348649	43348649	+1	no_errors	ENST00000190983	ensembl	human	known	69_37n	missense	11	54.17	13	SNP	0.987	T
ZNF318	24149	genome.wustl.edu	37	6	43316157	43316157	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr6:43316157T>A	ENST00000361428.2	-	6	3054	c.2977A>T	c.(2977-2979)Agt>Tgt	p.S993C	ZNF318_ENST00000318149.3_Missense_Mutation_p.S993C	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	993					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S993C(2)		autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CTACTGTCACTTAAAGACTTC	0.443																																						dbGAP											2	Substitution - Missense(2)	breast(2)											221.0	218.0	219.0					6																	43316157		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.2977A>T	6.37:g.43316157T>A	ENSP00000354964:p.Ser993Cys		O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	smart_Znf_U1	p.S993C	ENST00000361428.2	37	c.2977	CCDS4895.2	6	.	.	.	.	.	.	.	.	.	.	T	16.72	3.200932	0.58234	.	.	ENSG00000171467	ENST00000318149;ENST00000361428	T;T	0.34667	1.35;2.59	6.03	3.65	0.41850	.	0.980581	0.08395	N	0.952317	T	0.12689	0.0308	N	0.14661	0.345	0.28073	N	0.932489	P	0.51351	0.944	P	0.50192	0.634	T	0.19516	-1.0303	10	0.72032	D	0.01	-1.2227	0.7367	0.00967	0.3029:0.1176:0.1598:0.4197	.	993	Q5VUA4	ZN318_HUMAN	C	993	ENSP00000323032:S993C;ENSP00000354964:S993C	ENSP00000323032:S993C	S	-	1	0	ZNF318	43424135	0.959000	0.32827	1.000000	0.80357	0.536000	0.34869	0.633000	0.24598	1.080000	0.41073	0.533000	0.62120	AGT	ZNF318	-	NULL	ENSG00000171467		0.443	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF318	HGNC	protein_coding	OTTHUMT00000040601.2	355	0.00	0	T	NM_014345		43316157	43316157	-1	no_errors	ENST00000361428	ensembl	human	known	69_37n	missense	195	46.72	171	SNP	0.963	A
ZNF619	285267	genome.wustl.edu	37	3	40528623	40528623	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr3:40528623G>T	ENST00000314686.5	+	6	979	c.574G>T	c.(574-576)Gag>Tag	p.E192*	ZNF619_ENST00000521353.1_Nonsense_Mutation_p.E248*|ZNF619_ENST00000432264.2_Nonsense_Mutation_p.E208*|ZNF619_ENST00000429348.2_Nonsense_Mutation_p.E208*|ZNF619_ENST00000522736.1_Nonsense_Mutation_p.E199*|ZNF619_ENST00000447116.2_Nonsense_Mutation_p.E248*|ZNF619_ENST00000456778.1_Nonsense_Mutation_p.E164*|ZNF619_ENST00000520737.1_3'UTR			Q8N2I2	ZN619_HUMAN	zinc finger protein 619	192					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E192*(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		TAAATGTGGTGAGTGTGGCAG	0.428																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											76.0	73.0	74.0					3																	40528623		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK075245	CCDS46801.1, CCDS46802.1, CCDS46803.1	3p21.33	2013-01-08			ENSG00000177873	ENSG00000177873		"""Zinc fingers, C2H2-type"", ""-"""	26910	protein-coding gene	gene with protein product							Standard	NM_001145083		Approved	FLJ90764	uc011azb.2	Q8N2I2	OTTHUMG00000131391	ENST00000314686.5:c.574G>T	3.37:g.40528623G>T	ENSP00000322529:p.Glu192*		B4E271|C9JRN5|D4PHA2|E9PCD9	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E248*	ENST00000314686.5	37	c.742		3	.	.	.	.	.	.	.	.	.	.	G	23.2	4.392967	0.83011	.	.	ENSG00000177873	ENST00000314686;ENST00000447116;ENST00000429348;ENST00000456778;ENST00000522736;ENST00000521353;ENST00000432264	.	.	.	2.55	2.55	0.30701	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	10.8249	0.46627	0.0:0.0:1.0:0.0	.	.	.	.	X	192;248;208;164;199;248;208	.	ENSP00000322529:E192X	E	+	1	0	ZNF619	40503627	0.000000	0.05858	0.927000	0.36925	0.559000	0.35586	0.201000	0.17276	1.452000	0.47756	0.563000	0.77884	GAG	ZNF619	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000177873		0.428	ZNF619-001	KNOWN	basic	protein_coding	ZNF619	HGNC	protein_coding	OTTHUMT00000254180.2	53	0.00	0	G	NM_173656		40528623	40528623	+1	no_errors	ENST00000447116	ensembl	human	known	69_37n	nonsense	37	24.49	12	SNP	0.079	T
ZNF804A	91752	genome.wustl.edu	37	2	185803357	185803357	+	Silent	SNP	C	C	T			TCGA-BH-A0WA-01A-11D-A10G-09	TCGA-BH-A0WA-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4076f947-a1f0-4101-9a79-79828eb3bbe3	ad51aa61-d74c-430e-b8aa-1aae099e247d	g.chr2:185803357C>T	ENST00000302277.6	+	4	3828	c.3234C>T	c.(3232-3234)agC>agT	p.S1078S		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	1078							metal ion binding (GO:0046872)	p.S1078S(2)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CACCCCCTAGCACACCTCTGC	0.512																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											91.0	87.0	88.0					2																	185803357		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.3234C>T	2.37:g.185803357C>T			A7E253|Q6ZN26	Silent	SNP	pfam_Znf_C2H2_jaz	p.S1078	ENST00000302277.6	37	c.3234	CCDS2291.1	2																																																																																			ZNF804A	-	NULL	ENSG00000170396		0.512	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	HGNC	protein_coding	OTTHUMT00000255871.1	149	0.00	0	C	NM_194250		185803357	185803357	+1	no_errors	ENST00000302277	ensembl	human	known	69_37n	silent	92	35.21	50	SNP	0.809	T
