#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADCK3	56997	genome.wustl.edu	37	1	227174270	227174270	+	Silent	SNP	C	C	A	rs7545723		TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr1:227174270C>A	ENST00000366779.1	+	20	4547	c.1776C>A	c.(1774-1776)ccC>ccA	p.P592P	ADCK3_ENST00000366777.3_Silent_p.P592P|ADCK3_ENST00000478406.1_3'UTR|ADCK3_ENST00000366778.1_Silent_p.P540P|ADCK3_ENST00000433743.2_Silent_p.P266P|ADCK3_ENST00000458507.2_Silent_p.P313P			Q8NI60	ADCK3_HUMAN	aarF domain containing kinase 3	592					cell death (GO:0008219)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(2)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	9						ACCTGATTCCCGTCATGCTGA	0.587																																						dbGAP											0													139.0	130.0	133.0					1																	227174270		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ278126	CCDS1557.1	1q42.11	2011-05-03	2010-10-01	2010-10-01	ENSG00000163050	ENSG00000163050			16812	protein-coding gene	gene with protein product	"""coenzyme Q8 homolog (yeast)"""	606980	"""chaperone-ABC1 (activity of bc1 complex, S.pombe)-like"", ""chaperone, ABC1 activity of bc1 complex like (S. pombe)"", ""chaperone, ABC1 activity of bc1 complex homolog (S. pombe)"""	CABC1			Standard	NM_020247		Approved	COQ8, SCAR9	uc001hqn.1	Q8NI60	OTTHUMG00000037621	ENST00000366779.1:c.1776C>A	1.37:g.227174270C>A			Q5T7A5|Q63HK0|Q8NCJ6|Q9HBQ1|Q9NQ67	Silent	SNP	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.P592	ENST00000366779.1	37	c.1776	CCDS1557.1	1																																																																																			ADCK3	-	NULL	ENSG00000163050		0.587	ADCK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ADCK3	HGNC	protein_coding	OTTHUMT00000091712.1	94	0.00	0	C	NM_020247		227174270	227174270	+1	no_errors	ENST00000366777	ensembl	human	known	69_37n	silent	63	15.58	12	SNP	0.832	A
AGAP5	729092	genome.wustl.edu	37	10	75456920	75456920	+	Splice_Site	SNP	A	A	C			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr10:75456920A>C	ENST00000374094.4	-	2	265	c.225T>G	c.(223-225)gcT>gcG	p.A75A	RP11-464F9.1_ENST00000399449.3_RNA|RP11-574K11.28_ENST00000580790.1_RNA|AGAP5_ENST00000443782.2_Intron	NM_001144000.1	NP_001137472.1	A6NIR3	AGAP5_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 5	75					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(5)|skin(1)	12						TAAACTCCAAAGCTATATGTA	0.348																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS44439.1	10q22.2	2013-01-10	2008-09-22	2008-09-22	ENSG00000172650	ENSG00000172650		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23467	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 2"""	CTGLF2			Standard	NM_001144000		Approved	Em:AC073389.1	uc009xri.3	A6NIR3	OTTHUMG00000018473	ENST00000374094.4:c.224-1T>G	10.37:g.75456920A>C			A8MSN5	Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.A75	ENST00000374094.4	37	c.225	CCDS44439.1	10																																																																																			AGAP5	-	NULL	ENSG00000172650		0.348	AGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGAP5	HGNC	protein_coding		99	0.00	0	A	XM_001132585	Silent	75456920	75456920	-1	no_errors	ENST00000374094	ensembl	human	known	69_37n	silent	76	41.09	53	SNP	0.576	C
ANKRD34C	390616	genome.wustl.edu	37	15	79586661	79586661	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr15:79586661G>T	ENST00000558647.2	+	1	1035	c.1035G>T	c.(1033-1035)agG>agT	p.R345S	ANKRD34C_ENST00000421388.2_Missense_Mutation_p.R345S			P0C6C1	AN34C_HUMAN	ankyrin repeat domain 34C	345										endometrium(3)|kidney(1)|skin(1)	5						GTCTGGCCAGGAGAGGAACTC	0.542																																						dbGAP											0													28.0	27.0	27.0					15																	79586661		685	1584	2269	-	-	-	SO:0001583	missense	0				CCDS53965.1	15q25.1	2013-01-10			ENSG00000235711	ENSG00000235711		"""Ankyrin repeat domain containing"""	33888	protein-coding gene	gene with protein product							Standard	NM_001146341		Approved		uc002bet.3	P0C6C1		ENST00000558647.2:c.1035G>T	15.37:g.79586661G>T	ENSP00000454921:p.Arg345Ser		H3BNM1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R345S	ENST00000558647.2	37	c.1035	CCDS53965.1	15	.	.	.	.	.	.	.	.	.	.	G	14.52	2.558792	0.45590	.	.	ENSG00000235711	ENST00000421388	T	0.15372	2.43	4.52	-0.405	0.12392	.	.	.	.	.	T	0.29223	0.0727	L	0.60455	1.87	0.31748	N	0.634968	D	0.69078	0.997	D	0.63488	0.915	T	0.29397	-1.0013	9	0.42905	T	0.14	.	7.8959	0.29706	0.5795:0.0:0.4205:0.0	.	345	P0C6C1	AN34C_HUMAN	S	345	ENSP00000401089:R345S	ENSP00000401089:R345S	R	+	3	2	ANKRD34C	77373716	0.003000	0.15002	0.776000	0.31678	0.765000	0.43378	-1.028000	0.03589	-0.244000	0.09639	-0.469000	0.05056	AGG	ANKRD34C	-	NULL	ENSG00000235711		0.542	ANKRD34C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD34C	HGNC	protein_coding	OTTHUMT00000416713.2	20	0.00	0	G	NM_001146341		79586661	79586661	+1	no_errors	ENST00000421388	ensembl	human	known	69_37n	missense	10	54.55	12	SNP	0.996	T
APAF1	317	genome.wustl.edu	37	12	99074109	99074109	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr12:99074109G>A	ENST00000551964.1	+	14	2711	c.1975G>A	c.(1975-1977)Gaa>Aaa	p.E659K	APAF1_ENST00000552268.1_Intron|APAF1_ENST00000359972.2_Missense_Mutation_p.E648K|APAF1_ENST00000333991.1_Intron|APAF1_ENST00000339433.3_Missense_Mutation_p.E659K|APAF1_ENST00000357310.1_Missense_Mutation_p.E659K|APAF1_ENST00000549007.1_Missense_Mutation_p.E659K|APAF1_ENST00000547045.1_Missense_Mutation_p.E659K|APAF1_ENST00000550527.1_Missense_Mutation_p.E648K	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	659					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	TCATGAGGATGAAGTGCTTTG	0.348																																						dbGAP											0													88.0	87.0	87.0					12																	99074109		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.1975G>A	12.37:g.99074109G>A	ENSP00000448165:p.Glu659Lys		B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_NB-ARC,pfam_CARD,superfamily_WD40_repeat_dom,superfamily_DEATH-like,smart_WD40_repeat,pirsf_Apoptotic_pept-activating_1,pfscan_CARD,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Disease_R,prints_G-protein_beta_WD-40_rep	p.E659K	ENST00000551964.1	37	c.1975	CCDS9069.1	12	.	.	.	.	.	.	.	.	.	.	G	33	5.263390	0.95399	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T	0.60040	0.22;0.22;0.22;0.22;0.22;0.22;0.22	5.33	5.33	0.75918	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.045405	0.85682	D	0.000000	T	0.68659	0.3025	L	0.42686	1.345	0.80722	D	1	P;D;B;P;D	0.67145	0.607;0.967;0.182;0.789;0.996	B;P;B;B;D	0.71656	0.3;0.836;0.092;0.346;0.974	T	0.62623	-0.6815	10	0.22109	T	0.4	-2.398	19.0194	0.92906	0.0:0.0:1.0:0.0	.	659;659;648;659;648	C9JLV4;O14727-4;O14727-3;O14727;O14727-2	.;.;.;APAF_HUMAN;.	K	659;648;659;659;648;659;659	ENSP00000448165:E659K;ENSP00000353059:E648K;ENSP00000349862:E659K;ENSP00000341830:E659K;ENSP00000448449:E648K;ENSP00000449791:E659K;ENSP00000448161:E659K	ENSP00000341830:E659K	E	+	1	0	APAF1	97598240	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.410000	0.97335	2.496000	0.84212	0.467000	0.42956	GAA	APAF1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Apoptotic_pept-activating_1,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000120868		0.348	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APAF1	HGNC	protein_coding	OTTHUMT00000408006.1	94	0.00	0	G	NM_181861.1		99074109	99074109	+1	no_errors	ENST00000551964	ensembl	human	known	69_37n	missense	152	16.94	31	SNP	1.000	A
ARMC12	221481	genome.wustl.edu	37	6	35705872	35705872	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr6:35705872G>C	ENST00000373866.3	+	2	254	c.232G>C	c.(232-234)Gag>Cag	p.E78Q	ARMC12_ENST00000373869.3_Missense_Mutation_p.E78Q|ARMC12_ENST00000288065.2_Missense_Mutation_p.E105Q|RP3-510O8.4_ENST00000452048.1_RNA			Q5T9G4	ARM12_HUMAN	armadillo repeat containing 12	78						nucleus (GO:0005634)											CAACTCTTTGGAGTGCAAACA	0.602											OREG0017379	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													84.0	86.0	86.0					6																	35705872		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058119	CCDS4809.1, CCDS69093.1, CCDS69094.1	6p21.31	2013-02-14	2011-12-14	2011-12-14	ENSG00000157343	ENSG00000157343		"""Armadillo repeat containing"""	21099	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 81"""	C6orf81			Standard	XM_005248920		Approved	FLJ25390	uc003ola.3	Q5T9G4	OTTHUMG00000014577	ENST00000373866.3:c.232G>C	6.37:g.35705872G>C	ENSP00000362973:p.Glu78Gln	857	Q8NEB2|Q96LL8	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.E105Q	ENST00000373866.3	37	c.313		6	.	.	.	.	.	.	.	.	.	.	G	17.83	3.484373	0.63962	.	.	ENSG00000157343	ENST00000373869;ENST00000288065;ENST00000373866	T;T;T	0.55234	0.53;0.53;0.53	5.58	5.58	0.84498	.	0.110909	0.39834	N	0.001251	T	0.22437	0.0541	L	0.27053	0.805	0.29088	N	0.882297	B;P	0.46220	0.435;0.874	B;B	0.37989	0.136;0.262	T	0.09997	-1.0649	10	0.23891	T	0.37	.	15.1312	0.72527	0.0:0.0:1.0:0.0	.	78;105	Q5T9G4-3;Q5T9G4-2	.;.	Q	78;105;78	ENSP00000362976:E78Q;ENSP00000288065:E105Q;ENSP00000362973:E78Q	ENSP00000288065:E105Q	E	+	1	0	C6orf81	35813850	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	3.552000	0.53705	2.631000	0.89168	0.558000	0.71614	GAG	ARMC12	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	ENSG00000157343		0.602	ARMC12-002	KNOWN	basic|appris_principal	protein_coding	ARMC12	HGNC	protein_coding	OTTHUMT00000040311.2	58	0.00	0	G	NM_145028		35705872	35705872	+1	no_errors	ENST00000288065	ensembl	human	known	69_37n	missense	36	16.28	7	SNP	0.999	C
BCCIP	56647	genome.wustl.edu	37	10	127519171	127519171	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr10:127519171A>C	ENST00000278100.6	+	4	374	c.362A>C	c.(361-363)gAa>gCa	p.E121A	BCCIP_ENST00000429863.2_Intron|BCCIP_ENST00000299130.3_Missense_Mutation_p.E121A|BCCIP_ENST00000368759.5_Missense_Mutation_p.E121A|BCCIP_ENST00000478798.1_3'UTR	NM_078468.2	NP_510868.1	Q9P287	BCCIP_HUMAN	BRCA2 and CDKN1A interacting protein	121	Interaction with BRCA2.				cell cycle (GO:0007049)|DNA repair (GO:0006281)|neuroendocrine cell differentiation (GO:0061101)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nucleus (GO:0005634)	kinase regulator activity (GO:0019207)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)	8		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				GATATGGATGAAGATGAGGTT	0.303																																						dbGAP											0													178.0	178.0	178.0					10																	127519171		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040451	CCDS7649.1, CCDS7650.1, CCDS7651.1	10q26.2	2008-05-14	2001-11-29		ENSG00000107949	ENSG00000107949			978	protein-coding gene	gene with protein product		611883	"""BRCA2 and CDKN1A-interacting protein"""			11313963, 10878006	Standard	NM_016567		Approved	BCCIPalpha, TOK-1	uc001ljd.4	Q9P287	OTTHUMG00000019237	ENST00000278100.6:c.362A>C	10.37:g.127519171A>C	ENSP00000278100:p.Glu121Ala		B3KP45|Q8ND15|Q96GC4|Q9P288	Missense_Mutation	SNP	NULL	p.E121A	ENST00000278100.6	37	c.362	CCDS7651.1	10	.	.	.	.	.	.	.	.	.	.	A	13.64	2.297034	0.40594	.	.	ENSG00000107949	ENST00000278100;ENST00000299130;ENST00000368759;ENST00000392718	T;T;T	0.51817	0.69;0.69;0.69	5.46	5.46	0.80206	.	0.243494	0.44097	D	0.000487	T	0.37100	0.0991	L	0.41236	1.265	0.80722	D	1	B;P;B;B	0.36010	0.328;0.532;0.41;0.195	B;B;B;B	0.37480	0.251;0.122;0.122;0.152	T	0.22626	-1.0211	10	0.31617	T	0.26	-16.6406	7.3139	0.26489	0.7087:0.1486:0.0:0.1427	.	121;121;121;121	B4DUS0;Q9P287-2;Q9P287-4;Q9P287	.;.;.;BCCIP_HUMAN	A	121	ENSP00000278100:E121A;ENSP00000299130:E121A;ENSP00000357748:E121A	ENSP00000278100:E121A	E	+	2	0	BCCIP	127509161	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	4.979000	0.63806	2.086000	0.62901	0.477000	0.44152	GAA	BCCIP	-	NULL	ENSG00000107949		0.303	BCCIP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BCCIP	HGNC	protein_coding	OTTHUMT00000050941.1	156	0.00	0	A			127519171	127519171	+1	no_errors	ENST00000368759	ensembl	human	known	69_37n	missense	190	15.18	34	SNP	1.000	C
C16orf62	57020	genome.wustl.edu	37	16	19628021	19628021	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr16:19628021C>T	ENST00000251143.5	+	14	1127	c.1115C>T	c.(1114-1116)aCg>aTg	p.T372M	C16orf62_ENST00000448695.1_Missense_Mutation_p.T222M|C16orf62_ENST00000543152.1_Missense_Mutation_p.T121M|C16orf62_ENST00000542263.1_Intron|C16orf62_ENST00000417362.2_Intron|C16orf62_ENST00000438132.3_Missense_Mutation_p.T461M			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	372						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						CATGGGGATACGGTCCAGAAC	0.493																																						dbGAP											0													128.0	107.0	114.0					16																	19628021		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.1115C>T	16.37:g.19628021C>T	ENSP00000251143:p.Thr372Met		A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	NULL	p.T461M	ENST00000251143.5	37	c.1382		16	.	.	.	.	.	.	.	.	.	.	C	17.20	3.327860	0.60743	.	.	ENSG00000103544	ENST00000438132;ENST00000251143;ENST00000448695	T;T;T	0.67345	-0.26;-0.26;-0.26	5.38	4.42	0.53409	.	0.209767	0.49916	N	0.000131	T	0.57548	0.2061	L	0.44542	1.39	0.42809	D	0.993959	B;B	0.18610	0.008;0.029	B;B	0.15870	0.005;0.014	T	0.52873	-0.8517	9	.	.	.	-8.5652	14.1029	0.65068	0.0:0.9262:0.0:0.0738	.	372;461	Q7Z3J2;E7EWW0	CP062_HUMAN;.	M	461;372;222	ENSP00000400815:T461M;ENSP00000251143:T372M;ENSP00000398009:T222M	.	T	+	2	0	C16orf62	19535522	0.985000	0.35326	0.123000	0.21794	0.986000	0.74619	2.351000	0.44071	1.257000	0.44085	0.557000	0.71058	ACG	C16orf62	-	NULL	ENSG00000103544		0.493	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	C16orf62	HGNC	protein_coding		95	0.00	0	C	NM_020314		19628021	19628021	+1	no_errors	ENST00000438132	ensembl	human	known	69_37n	missense	84	40.00	56	SNP	0.937	T
C21orf58	54058	genome.wustl.edu	37	21	47737979	47737979	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr21:47737979C>G	ENST00000291691.7	-	2	1392	c.256G>C	c.(256-258)Gac>Cac	p.D86H	C21orf58_ENST00000397679.1_5'UTR|C21orf58_ENST00000397685.4_Missense_Mutation_p.D3H|C21orf58_ENST00000397680.1_5'UTR|C21orf58_ENST00000397682.3_5'UTR|C21orf58_ENST00000397683.1_5'UTR	NM_058180.3	NP_478060.2	P58505	CU058_HUMAN	chromosome 21 open reading frame 58	86										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(1)|pancreas(1)	9	Breast(49;0.112)			Colorectal(79;0.239)		GCTGATGAGTCCAGCATGGTG	0.597																																						dbGAP											0													83.0	76.0	78.0					21																	47737979		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13735.1, CCDS68229.1	21q22.3	2008-07-07			ENSG00000160298	ENSG00000160298			1300	protein-coding gene	gene with protein product							Standard	XM_005261149		Approved		uc002zjf.3	P58505	OTTHUMG00000090634	ENST00000291691.7:c.256G>C	21.37:g.47737979C>G	ENSP00000291691:p.Asp86His		B3KPI1	Missense_Mutation	SNP	NULL	p.D86H	ENST00000291691.7	37	c.256	CCDS13735.1	21	.	.	.	.	.	.	.	.	.	.	C	14.49	2.551095	0.45383	.	.	ENSG00000160298	ENST00000417060;ENST00000291691;ENST00000397685	T;T	0.21543	2.0;2.0	4.99	4.09	0.47781	.	0.219310	0.35903	N	0.002920	T	0.25344	0.0616	L	0.58810	1.83	0.37063	D	0.898181	P;P	0.49862	0.929;0.844	P;B	0.44772	0.46;0.383	T	0.23868	-1.0176	10	0.87932	D	0	-24.7473	11.2132	0.48810	0.0:0.8141:0.1859:0.0	.	86;86	P58505;P58505-2	CU058_HUMAN;.	H	48;86;3	ENSP00000402356:D48H;ENSP00000291691:D86H	ENSP00000291691:D86H	D	-	1	0	C21orf58	46562407	0.883000	0.30277	0.746000	0.31095	0.266000	0.26442	1.814000	0.38972	1.068000	0.40764	0.460000	0.39030	GAC	C21orf58	-	NULL	ENSG00000160298		0.597	C21orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf58	HGNC	protein_coding	OTTHUMT00000207283.1	64	0.00	0	C	NM_058180		47737979	47737979	-1	no_errors	ENST00000291691	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	0.938	G
CA11	770	genome.wustl.edu	37	19	49143044	49143044	+	Splice_Site	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr19:49143044C>T	ENST00000084798.4	-	5	1247		c.e5+1		SEC1P_ENST00000430145.2_RNA|DBP_ENST00000601104.1_5'Flank|DBP_ENST00000222122.5_5'Flank	NM_001217.3	NP_001208.2	O75493	CAH11_HUMAN	carbonic anhydrase XI							basolateral plasma membrane (GO:0016323)|extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)	14		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000103)|all cancers(93;0.000119)|GBM - Glioblastoma multiforme(486;0.00634)|Epithelial(262;0.016)	Zonisamide(DB00909)	CCTCCGCTCACGTTGACAAAG	0.632																																						dbGAP											0													58.0	62.0	61.0					19																	49143044		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF067662	CCDS12729.1	19q13.3	2012-07-02			ENSG00000063180	ENSG00000063180		"""Carbonic anhydrases"""	1370	protein-coding gene	gene with protein product	"""CA-RP XI"", ""carbonic anhydrase-related protein XI"", ""carbonic anhydrase-related protein 2"""	604644				9878252	Standard	XR_243956		Approved	CARP2, CARPX1	uc002pjz.1	O75493		ENST00000084798.4:c.567+1G>A	19.37:g.49143044C>T			O60596|Q6FHI1|Q9UEC4	Splice_Site	SNP	-	e5+1	ENST00000084798.4	37	c.567+1	CCDS12729.1	19	.	.	.	.	.	.	.	.	.	.	C	16.21	3.058724	0.55325	.	.	ENSG00000063180	ENST00000084798	.	.	.	3.63	3.63	0.41609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0057	0.47633	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CA11	53834856	1.000000	0.71417	0.998000	0.56505	0.687000	0.40016	3.235000	0.51328	2.055000	0.61198	0.462000	0.41574	.	CA11	-	-	ENSG00000063180		0.632	CA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA11	HGNC	protein_coding	OTTHUMT00000466172.1	68	0.00	0	C	NM_001217	Intron	49143044	49143044	-1	no_errors	ENST00000084798	ensembl	human	known	69_37n	splice_site	24	27.27	9	SNP	1.000	T
CEP41	95681	genome.wustl.edu	37	7	130040629	130040629	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr7:130040629C>T	ENST00000223208.5	-	9	946	c.676G>A	c.(676-678)Gac>Aac	p.D226N	CEP41_ENST00000343969.5_Missense_Mutation_p.D226N|CEP41_ENST00000541543.1_Missense_Mutation_p.D210N	NM_001257158.1|NM_018718.2	NP_001244087.1|NP_061188.1	Q9BYV8	CEP41_HUMAN	centrosomal protein 41kDa	226	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein polyglutamylation (GO:0018095)|protein transport (GO:0015031)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|membrane (GO:0016020)|primary cilium (GO:0072372)											TCATCATCGTCATACAGAATG	0.502																																						dbGAP											0													68.0	57.0	61.0					7																	130040629		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ278890	CCDS5821.1, CCDS59078.1, CCDS59079.1, CCDS59080.1	7q32	2014-02-20	2011-10-04	2011-10-04	ENSG00000106477	ENSG00000106477			12370	protein-coding gene	gene with protein product		610523	"""testis specific, 14"""	TSGA14		14654843, 22246503	Standard	NM_018718		Approved	DKFZp762H1311, FLJ22445, JBTS15	uc003vpz.4	Q9BYV8	OTTHUMG00000157823	ENST00000223208.5:c.676G>A	7.37:g.130040629C>T	ENSP00000223208:p.Asp226Asn		A4D1M0|B4DQ35|F5H0V6|Q7Z496|Q86TM1|Q8NFU8|Q9H6A3|Q9NPV3	Missense_Mutation	SNP	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	p.D226N	ENST00000223208.5	37	c.676	CCDS5821.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.467350	0.96257	.	.	ENSG00000106477	ENST00000223208;ENST00000541543;ENST00000343969;ENST00000492389	T;T;T;T	0.51574	0.7;1.62;1.62;1.62	6.03	6.03	0.97812	Rhodanese-like (5);	0.000000	0.85682	D	0.000000	T	0.77412	0.4126	M	0.92317	3.295	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	T	0.80448	-0.1378	10	0.52906	T	0.07	-25.7843	19.1304	0.93404	0.0:1.0:0.0:0.0	.	210;226;226	F5H0V6;Q9BYV8-2;Q9BYV8	.;.;CEP41_HUMAN	N	226;210;226;191	ENSP00000223208:D226N;ENSP00000445888:D210N;ENSP00000342738:D226N;ENSP00000419192:D191N	ENSP00000223208:D226N	D	-	1	0	TSGA14	129827865	1.000000	0.71417	0.146000	0.22360	0.951000	0.60555	7.698000	0.84413	2.854000	0.98071	0.655000	0.94253	GAC	CEP41	-	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	ENSG00000106477		0.502	CEP41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP41	HGNC	protein_coding	OTTHUMT00000349702.2	49	0.00	0	C	NM_018718		130040629	130040629	-1	no_errors	ENST00000223208	ensembl	human	known	69_37n	missense	45	27.42	17	SNP	0.998	T
CHD3	1107	genome.wustl.edu	37	17	7797876	7797876	+	Missense_Mutation	SNP	G	G	C	rs551155540		TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr17:7797876G>C	ENST00000330494.7	+	8	1369	c.1219G>C	c.(1219-1221)Gat>Cat	p.D407H	CHD3_ENST00000380358.4_Missense_Mutation_p.D466H|CHD3_ENST00000358181.4_Missense_Mutation_p.D407H	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	407					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				CGTCTGCCTTGATCCTGAGCT	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		19858	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													154.0	116.0	129.0					17																	7797876		2203	4300	6503	-	-	-	SO:0001583	missense	0			U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.1219G>C	17.37:g.7797876G>C	ENSP00000332628:p.Asp407His		D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.D407H	ENST00000330494.7	37	c.1219	CCDS32554.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.94|16.94	3.259902|3.259902	0.59321|0.59321	.|.	.|.	ENSG00000170004|ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494|ENST00000452447	D;D;D|.	0.97831|.	-4.56;-4.56;-4.56|.	4.81|4.81	4.81|4.81	0.61882|0.61882	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);|.	0.000000|.	0.46442|.	D|.	0.000285|.	T|.	0.76300|.	0.3968|.	M|M	0.76328|0.76328	2.33|2.33	0.80722|0.80722	D|D	1|1	P;D;D|.	0.58970|.	0.95;0.96;0.984|.	P;P;P|.	0.62649|.	0.789;0.866;0.905|.	T|.	0.76903|.	-0.2787|.	10|.	0.87932|.	D|.	0|.	-21.1657|-21.1657	18.0617|18.0617	0.89379|0.89379	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	407;407;466|.	Q12873-2;Q12873;E9PG89|.	.;CHD3_HUMAN;.|.	H|S	466;407;407|277	ENSP00000369716:D466H;ENSP00000350907:D407H;ENSP00000332628:D407H|.	ENSP00000332628:D407H|.	D|X	+|+	1|2	0|2	CHD3|CHD3	7738601|7738601	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.537000|9.537000	0.98070|0.98070	2.499000|2.499000	0.84300|0.84300	0.557000|0.557000	0.71058|0.71058	GAT|TGA	CHD3	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000170004		0.572	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1	54	0.00	0	G	NM_001005273		7797876	7797876	+1	no_errors	ENST00000330494	ensembl	human	known	69_37n	missense	44	20.00	11	SNP	1.000	C
CHD9	80205	genome.wustl.edu	37	16	53337698	53337698	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr16:53337698delG	ENST00000398510.3	+	30	5867	c.5780delG	c.(5779-5781)cgcfs	p.R1927fs	CHD9_ENST00000564845.1_Frame_Shift_Del_p.R1927fs|CHD9_ENST00000566029.1_Frame_Shift_Del_p.R1927fs|CHD9_ENST00000447540.1_Frame_Shift_Del_p.R1927fs			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1927					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				ACTTTGTATCGCATTGAACTT	0.403																																						dbGAP											0													50.0	49.0	49.0					16																	53337698		1875	4109	5984	-	-	-	SO:0001589	frameshift_variant	0			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.5780delG	16.37:g.53337698delG	ENSP00000381522:p.Arg1927fs		B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Frame_Shift_Del	DEL	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R1927fs	ENST00000398510.3	37	c.5780		16																																																																																			CHD9	-	NULL	ENSG00000177200		0.403	CHD9-020	KNOWN	basic	protein_coding	CHD9	HGNC	protein_coding	OTTHUMT00000422345.1	31	0.00	0	G	NM_025134		53337698	53337698	+1	no_errors	ENST00000398510	ensembl	human	known	69_37n	frame_shift_del	28	24.32	9	DEL	1.000	-
CHORDC1	26973	genome.wustl.edu	37	11	89938730	89938730	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr11:89938730C>T	ENST00000320585.6	-	8	976	c.567G>A	c.(565-567)atG>atA	p.M189I	CHORDC1_ENST00000457199.2_Missense_Mutation_p.M170I|CHORDC1_ENST00000529987.1_Start_Codon_SNP_p.M1I|CHORDC1_ENST00000529726.1_Start_Codon_SNP_p.M1I	NM_012124.2	NP_036256.2	Q9UHD1	CHRD1_HUMAN	cysteine and histidine-rich domain (CHORD) containing 1	189	CHORD 2. {ECO:0000255|PROSITE- ProRule:PRU00734}.|Interaction with HSP90AA1 and HSP90AB1. {ECO:0000250}.				chaperone-mediated protein folding (GO:0061077)|negative regulation of Rho-dependent protein serine/threonine kinase activity (GO:2000299)|regulation of cellular response to heat (GO:1900034)|regulation of centrosome duplication (GO:0010824)|response to stress (GO:0006950)		Hsp90 protein binding (GO:0051879)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(1)|lung(6)	11		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.00915)				TCCAGTATTTCATCCTTTAAA	0.313																																						dbGAP											0													45.0	49.0	47.0					11																	89938730		2199	4294	6493	-	-	-	SO:0001583	missense	0			AF192466	CCDS8289.1, CCDS44705.1	11q14.3	2011-01-25	2011-01-25		ENSG00000110172	ENSG00000110172			14525	protein-coding gene	gene with protein product		604353	"""cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1"", ""cysteine and histidine-rich domain (CHORD)-containing 1"""			10571178	Standard	NM_012124		Approved	CHP1	uc001pdg.2	Q9UHD1	OTTHUMG00000167305	ENST00000320585.6:c.567G>A	11.37:g.89938730C>T	ENSP00000319255:p.Met189Ile		B2R6P8|Q6IN49|Q8WVL9|Q9H3D6	Missense_Mutation	SNP	pfam_CHORD,pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	p.M189I	ENST00000320585.6	37	c.567	CCDS8289.1	11	.	.	.	.	.	.	.	.	.	.	C	32	5.193013	0.94960	.	.	ENSG00000110172	ENST00000320585;ENST00000529987;ENST00000457199;ENST00000529726	T;T;T;T	0.45276	0.93;0.9;0.91;0.9	5.16	5.16	0.70880	Cysteine/histidine-rich domain (2);	0.117694	0.85682	D	0.000000	T	0.69360	0.3102	M	0.89214	3.015	0.80722	D	1	D;D	0.56287	0.97;0.975	P;P	0.62885	0.878;0.908	T	0.74861	-0.3520	9	.	.	.	-12.9254	18.6831	0.91554	0.0:1.0:0.0:0.0	.	170;189	Q9UHD1-2;Q9UHD1	.;CHRD1_HUMAN	I	189;1;170;1	ENSP00000319255:M189I;ENSP00000433719:M1I;ENSP00000401080:M170I;ENSP00000436632:M1I	.	M	-	3	0	CHORDC1	89578378	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.010000	0.76353	2.589000	0.87451	0.650000	0.86243	ATG	CHORDC1	-	pfam_CHORD	ENSG00000110172		0.313	CHORDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHORDC1	HGNC	protein_coding	OTTHUMT00000394111.1	70	0.00	0	C	NM_012124		89938730	89938730	-1	no_errors	ENST00000320585	ensembl	human	known	69_37n	missense	60	16.67	12	SNP	1.000	T
CILP	8483	genome.wustl.edu	37	15	65490934	65490934	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr15:65490934C>T	ENST00000261883.4	-	9	1856	c.1690G>A	c.(1690-1692)Gtg>Atg	p.V564M		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	564					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						TCATGGAACACGGCACTCCCC	0.527																																						dbGAP											0													74.0	67.0	69.0					15																	65490934		2202	4299	6501	-	-	-	SO:0001583	missense	0			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.1690G>A	15.37:g.65490934C>T	ENSP00000261883:p.Val564Met		B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.V564M	ENST00000261883.4	37	c.1690	CCDS10203.1	15	.	.	.	.	.	.	.	.	.	.	C	13.92	2.381250	0.42207	.	.	ENSG00000138615	ENST00000261883	T	0.51574	0.7	5.63	3.74	0.42951	.	0.000000	0.85682	D	0.000000	T	0.65893	0.2735	M	0.76328	2.33	0.53688	D	0.999971	D	0.89917	1.0	D	0.75484	0.986	T	0.69562	-0.5112	10	0.66056	D	0.02	-25.1322	11.7622	0.51910	0.0:0.8562:0.0:0.1438	.	564	O75339	CILP1_HUMAN	M	564	ENSP00000261883:V564M	ENSP00000261883:V564M	V	-	1	0	CILP	63277987	0.999000	0.42202	0.826000	0.32828	0.653000	0.38743	4.076000	0.57591	1.390000	0.46547	-0.136000	0.14681	GTG	CILP	-	NULL	ENSG00000138615		0.527	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CILP	HGNC	protein_coding	OTTHUMT00000256829.1	59	0.00	0	C	NM_003613		65490934	65490934	-1	no_errors	ENST00000261883	ensembl	human	known	69_37n	missense	41	25.45	14	SNP	0.995	T
CLTC	1213	genome.wustl.edu	37	17	57763136	57763136	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr17:57763136delT	ENST00000269122.3	+	30	5068	c.4794delT	c.(4792-4794)tatfs	p.Y1598fs	CLTC_ENST00000579456.1_Frame_Shift_Del_p.Y535fs|CLTC_ENST00000393043.1_Frame_Shift_Del_p.Y1598fs	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	1598	Heavy chain arm.|Proximal segment.|Trimerization. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					CCATGCCCTATTTCATCCAGG	0.398			T	"""ALK, TFE3"""	"""ALCL, renal """																																	dbGAP		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	0													149.0	136.0	141.0					17																	57763136		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.4794delT	17.37:g.57763136delT	ENSP00000269122:p.Tyr1598fs		D3DU00|Q6N0A0|Q86TF2	Frame_Shift_Del	DEL	pfam_Clathrin_H-chain/VPS_repeat,pfam_Clathrin_H-chain_propeller_rpt,pfam_Clathrin_H-chain_linker_core,superfamily_Clathrin_H-chain_propeller_N,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	p.F1599fs	ENST00000269122.3	37	c.4794	CCDS32696.1	17																																																																																			CLTC	-	pirsf_Clathrin_heavy_chain	ENSG00000141367		0.398	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLTC	HGNC	protein_coding	OTTHUMT00000258859.1	71	0.00	0	T	NM_004859		57763136	57763136	+1	no_errors	ENST00000269122	ensembl	human	known	69_37n	frame_shift_del	119	15.00	21	DEL	1.000	-
CMTM7	112616	genome.wustl.edu	37	3	32491026	32491026	+	Silent	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr3:32491026C>T	ENST00000334983.5	+	3	650	c.414C>T	c.(412-414)agC>agT	p.S138S	CMTM7_ENST00000349718.4_Intron	NM_138410.2	NP_612419.1	Q96FZ5	CKLF7_HUMAN	CKLF-like MARVEL transmembrane domain containing 7	138	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(1)|lung(2)	4						ACAACCAGAGCGGACTGGTAG	0.493																																						dbGAP											0													104.0	105.0	105.0					3																	32491026		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF479263	CCDS33730.1, CCDS33731.1	3p22.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000153551	ENSG00000153551			19178	protein-coding gene	gene with protein product		607890	"""chemokine-like factor super family 7"", ""chemokine-like factor superfamily 7"""	CKLFSF7			Standard	NM_138410		Approved	FLJ30992	uc003cey.1	Q96FZ5	OTTHUMG00000155869	ENST00000334983.5:c.414C>T	3.37:g.32491026C>T			Q5VLK1	Missense_Mutation	SNP	NULL	p.A7V	ENST00000334983.5	37	c.20	CCDS33730.1	3																																																																																			CMTM7	-	NULL	ENSG00000153551		0.493	CMTM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMTM7	HGNC	protein_coding	OTTHUMT00000342084.1	91	0.00	0	C			32491026	32491026	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000487007	ensembl	human	known	69_37n	missense	97	17.09	20	SNP	0.054	T
COL12A1	1303	genome.wustl.edu	37	6	75887490	75887490	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr6:75887490T>C	ENST00000322507.8	-	12	2635	c.2326A>G	c.(2326-2328)Agg>Ggg	p.R776G	COL12A1_ENST00000416123.2_Missense_Mutation_p.R776G|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000483888.2_Missense_Mutation_p.R776G	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	776	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						AGTGTTCTCCTCCTCTGATTG	0.433																																						dbGAP											0													302.0	294.0	297.0					6																	75887490		1869	4109	5978	-	-	-	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.2326A>G	6.37:g.75887490T>C	ENSP00000325146:p.Arg776Gly		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.R776G	ENST00000322507.8	37	c.2326	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	T	9.761	1.170203	0.21621	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.58210	0.35;0.35;0.35	5.87	4.68	0.58851	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.309004	0.32015	N	0.006711	T	0.24005	0.0581	L	0.58101	1.795	0.28009	N	0.934986	B;B	0.24651	0.108;0.108	B;B	0.25140	0.058;0.053	T	0.31696	-0.9934	10	0.54805	T	0.06	.	1.4575	0.02388	0.1561:0.1416:0.1432:0.5591	.	776;776	D6RGG3;Q99715	.;COCA1_HUMAN	G	776	ENSP00000325146:R776G;ENSP00000412864:R776G;ENSP00000421216:R776G	ENSP00000325146:R776G	R	-	1	2	COL12A1	75944210	1.000000	0.71417	1.000000	0.80357	0.366000	0.29705	2.496000	0.45346	1.001000	0.39076	0.528000	0.53228	AGG	COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.433	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	136	0.00	0	T	NM_004370		75887490	75887490	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	missense	127	19.11	30	SNP	0.979	C
CNR1	1268	genome.wustl.edu	37	6	88853975	88853975	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr6:88853975C>G	ENST00000537554.1	-	2	4581	c.1019G>C	c.(1018-1020)aGg>aCg	p.R340T	CNR1_ENST00000362094.5_3'UTR|CNR1_ENST00000369501.2_Missense_Mutation_p.R340T|CNR1_ENST00000468898.1_Missense_Mutation_p.R307T|CNR1_ENST00000549716.1_Missense_Mutation_p.R279T|CNR1_ENST00000369499.2_Missense_Mutation_p.R340T|CNR1_ENST00000428600.2_Missense_Mutation_p.R340T|CNR1_ENST00000549890.1_Missense_Mutation_p.R340T|CNR1_ENST00000535130.1_Missense_Mutation_p.R340T	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	340					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	CTTGGCTAACCTAATGTCCAT	0.542																																						dbGAP											0													167.0	175.0	173.0					6																	88853975		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.1019G>C	6.37:g.88853975C>G	ENSP00000441046:p.Arg340Thr		B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pirsf_Cnoid_rcpt_1,pfscan_GPCR_Rhodpsn_supfam,prints_Cnoid_rcpt_1,prints_Cnbnoid_rcpt,prints_7TM_GPCR_Rhodpsn	p.R340T	ENST00000537554.1	37	c.1019	CCDS5015.1	6	.	.	.	.	.	.	.	.	.	.	C	15.69	2.909406	0.52439	.	.	ENSG00000118432	ENST00000369501;ENST00000535130;ENST00000537554;ENST00000369499;ENST00000549890;ENST00000468898;ENST00000428600;ENST00000549716	T;T;T;T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16;1.16;1.16;1.16	6.05	6.05	0.98169	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.60183	0.2249	M	0.79693	2.465	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.77557	0.99;0.98	T	0.60934	-0.7164	10	0.62326	D	0.03	.	20.6086	0.99469	0.0:1.0:0.0:0.0	.	307;340	P21554-3;P21554	.;CNR1_HUMAN	T	340;340;340;340;340;307;340;279	ENSP00000358513:R340T;ENSP00000442689:R340T;ENSP00000441046:R340T;ENSP00000358511:R340T;ENSP00000446819:R340T;ENSP00000420188:R307T;ENSP00000412192:R340T;ENSP00000449549:R279T	ENSP00000358511:R340T	R	-	2	0	CNR1	88910694	1.000000	0.71417	0.990000	0.47175	0.203000	0.24098	7.818000	0.86416	2.880000	0.98712	0.655000	0.94253	AGG	CNR1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pirsf_Cnoid_rcpt_1,pfscan_GPCR_Rhodpsn_supfam,prints_Cnbnoid_rcpt	ENSG00000118432		0.542	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CNR1	HGNC	protein_coding	OTTHUMT00000354204.2	89	0.00	0	C			88853975	88853975	-1	no_errors	ENST00000369499	ensembl	human	known	69_37n	missense	80	13.04	12	SNP	1.000	G
CPEB2	132864	genome.wustl.edu	37	4	15067831	15067831	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr4:15067831G>A	ENST00000507071.1	+	11	1684	c.1597G>A	c.(1597-1599)Gca>Aca	p.A533T	RP11-665G4.1_ENST00000502344.1_RNA|CPEB2_ENST00000345451.3_Missense_Mutation_p.A503T|RP11-665G4.1_ENST00000513384.1_RNA|CPEB2_ENST00000259997.5_Missense_Mutation_p.A541T|CPEB2_ENST00000541112.1_Missense_Mutation_p.A970T|CPEB2_ENST00000442003.2_Missense_Mutation_p.A951T|CPEB2_ENST00000382401.3_Missense_Mutation_p.A506T|CPEB2_ENST00000382395.3_Missense_Mutation_p.A511T|CPEB2_ENST00000538197.1_Missense_Mutation_p.A978T			Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding protein 2	533					cellular response to arsenic-containing substance (GO:0071243)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to oxidative stress (GO:0034599)|negative regulation of cytoplasmic translation (GO:2000766)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of GTPase activity (GO:0034260)	cytoplasm (GO:0005737)|messenger ribonucleoprotein complex (GO:1990124)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|ribosome binding (GO:0043022)|translation repressor activity, nucleic acid binding (GO:0000900)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(3)	14						ATGCCAGGGCGCACGCTGTGG	0.443																																						dbGAP											0													274.0	255.0	261.0					4																	15067831		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY247744	CCDS56325.1, CCDS56326.1	4p15.33	2013-02-12			ENSG00000137449	ENSG00000137449		"""RNA binding motif (RRM) containing"""	21745	protein-coding gene	gene with protein product		610605				12672660	Standard	NM_182485		Approved		uc003gnk.2	Q7Z5Q1	OTTHUMG00000090669	ENST00000507071.1:c.1597G>A	4.37:g.15067831G>A	ENSP00000424084:p.Ala533Thr		E7EPM3|F5H160|Q3B8N6|Q3MI89|Q3MI90|Q3MI92|Q7Z5Q0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A978T	ENST00000507071.1	37	c.2932		4	.	.	.	.	.	.	.	.	.	.	G	7.348	0.622299	0.14193	.	.	ENSG00000137449	ENST00000538197;ENST00000541112;ENST00000442003;ENST00000507071;ENST00000345451;ENST00000382395;ENST00000382401;ENST00000259997;ENST00000382391	T;T;T;T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01	6.03	5.18	0.71444	.	0.047237	0.85682	D	0.000000	T	0.23649	0.0572	N	0.14661	0.345	0.80722	D	1	D;P;P;P;P;D	0.76494	0.99;0.919;0.644;0.582;0.835;0.999	P;B;B;B;B;P	0.57911	0.504;0.129;0.126;0.249;0.129;0.829	T	0.07083	-1.0791	10	0.15066	T	0.55	-7.8172	16.5732	0.84630	0.0:0.0:0.8686:0.1314	.	506;511;951;978;503;533	Q7Z5Q1-4;Q7Z5Q1-6;E7EPM3;F5H160;Q7Z5Q1-5;Q7Z5Q1	.;.;.;.;.;CPEB2_HUMAN	T	978;970;951;533;503;511;506;541;520	ENSP00000443985:A978T;ENSP00000437884:A970T;ENSP00000414270:A951T;ENSP00000424084:A533T;ENSP00000334058:A503T;ENSP00000371832:A511T;ENSP00000371838:A506T;ENSP00000259997:A541T	ENSP00000259997:A541T	A	+	1	0	CPEB2	14676929	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	6.728000	0.74769	1.512000	0.48834	0.557000	0.71058	GCA	CPEB2	-	NULL	ENSG00000137449		0.443	CPEB2-001	KNOWN	basic|appris_candidate	protein_coding	CPEB2	HGNC	protein_coding	OTTHUMT00000207349.2	219	0.00	0	G	XM_059607		15067831	15067831	+1	no_errors	ENST00000538197	ensembl	human	known	69_37n	missense	234	15.71	44	SNP	1.000	A
CROCCP2	84809	genome.wustl.edu	37	1	16951293	16951293	+	lincRNA	SNP	C	C	T	rs967939		TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr1:16951293C>T	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											aaaaattagccgggcatggtg	0.547																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16951293C>T			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.547	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	9	0.00	0	C	NR_026752.1		16951293	16951293	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	19	20.83	5	SNP	0.212	T
DDX10	1662	genome.wustl.edu	37	11	108577472	108577472	+	Silent	SNP	A	A	G			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr11:108577472A>G	ENST00000322536.3	+	10	1359	c.1230A>G	c.(1228-1230)aaA>aaG	p.K410K	DDX10_ENST00000526794.1_Silent_p.K410K	NM_004398.2	NP_004389.2	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	410	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				metabolic process (GO:0008152)		ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|prostate(2)	27		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		TTAGGTACAAAGAGGATGGTG	0.358			T	NUP98	AML*																																	dbGAP		Dom	yes		11	11q22-q23	1662	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10		L	0													215.0	212.0	213.0					11																	108577472		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			U28042	CCDS8342.1	11q22-q23	2005-10-11	2003-06-13		ENSG00000178105	ENSG00000178105		"""DEAD-boxes"""	2735	protein-coding gene	gene with protein product		601235	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 10 (RNA helicase)"""			8660968	Standard	NM_004398		Approved	HRH-J8	uc001pkm.3	Q13206	OTTHUMG00000166540	ENST00000322536.3:c.1230A>G	11.37:g.108577472A>G			B2RCQ3|Q5BJD8	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.K410	ENST00000322536.3	37	c.1230	CCDS8342.1	11																																																																																			DDX10	-	smart_Helicase_C,pfscan_Helicase_C	ENSG00000178105		0.358	DDX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX10	HGNC	protein_coding	OTTHUMT00000390343.1	121	0.00	0	A	NM_004398		108577472	108577472	+1	no_errors	ENST00000322536	ensembl	human	known	69_37n	silent	101	24.63	33	SNP	0.996	G
DDX17	10521	genome.wustl.edu	37	22	38891866	38891866	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr22:38891866C>G	ENST00000396821.3	-	6	914	c.815G>C	c.(814-816)aGa>aCa	p.R272T	DDX17_ENST00000432525.1_5'UTR|DDX17_ENST00000381633.3_Missense_Mutation_p.R193T	NM_001098504.1|NM_006386.4	NP_001091974|NP_006377.2	Q92841	DDX17_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 17	272	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of skeletal muscle cell differentiation (GO:2001014)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA helicase activity (GO:0003724)|RNA-dependent ATPase activity (GO:0008186)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	25	Melanoma(58;0.0286)					ACTCTTCAATCTAGAACATTT	0.413																																					Ovarian(55;1085 1454 6392 21425)	dbGAP											0													116.0	121.0	119.0					22																	38891866		2203	4300	6503	-	-	-	SO:0001583	missense	0			U59321	CCDS33646.1, CCDS46706.1	22q13.1	2012-02-23	2012-02-23		ENSG00000100201	ENSG00000100201		"""DEAD-boxes"""	2740	protein-coding gene	gene with protein product		608469	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17 (72kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 17"""			8871553, 17226766	Standard	NM_006386		Approved	P72	uc003avy.4	Q92841	OTTHUMG00000151136	ENST00000396821.3:c.815G>C	22.37:g.38891866C>G	ENSP00000380033:p.Arg272Thr		B1AHM0|Q69YT1|Q6ICD6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R272T	ENST00000396821.3	37	c.815	CCDS46706.1	22	.	.	.	.	.	.	.	.	.	.	C	18.49	3.636369	0.67130	.	.	ENSG00000100201	ENST00000396821;ENST00000381633;ENST00000403230;ENST00000404499	T;T;T	0.04706	3.57;3.57;3.57	5.41	4.4	0.53042	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.044842	0.85682	D	0.000000	T	0.14485	0.0350	M	0.79475	2.455	0.80722	D	1	P;D;D	0.54964	0.931;0.969;0.962	P;P;P	0.51918	0.522;0.684;0.459	T	0.01848	-1.1261	10	0.46703	T	0.11	-3.2349	14.4501	0.67379	0.0:0.9287:0.0:0.0713	.	193;274;272	Q92841;Q59F66;Q92841-4	DDX17_HUMAN;.;.	T	272;193;272;274	ENSP00000380033:R272T;ENSP00000371046:R193T;ENSP00000385536:R272T	ENSP00000371046:R193T	R	-	2	0	DDX17	37221812	0.991000	0.36638	0.876000	0.34364	0.995000	0.86356	5.753000	0.68736	1.426000	0.47256	0.563000	0.77884	AGA	DDX17	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000100201		0.413	DDX17-001	KNOWN	basic|CCDS	protein_coding	DDX17	HGNC	protein_coding	OTTHUMT00000321476.2	81	0.00	0	C	NM_030881		38891866	38891866	-1	no_errors	ENST00000396821	ensembl	human	known	69_37n	missense	54	36.47	31	SNP	0.953	G
DDX5	1655	genome.wustl.edu	37	17	62496729	62496729	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr17:62496729A>C	ENST00000225792.5	-	12	1780	c.1379T>G	c.(1378-1380)cTt>cGt	p.L460R	DDX5_ENST00000578804.1_Missense_Mutation_p.L460R|DDX5_ENST00000580026.1_5'UTR|MIR3064_ENST00000581130.1_RNA|DDX5_ENST00000450599.2_Missense_Mutation_p.L381R|MIR5047_ENST00000579212.1_RNA	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	460	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			AGCTTCACGAAGCACAGAGAT	0.423			T	ETV4	prostate																																NSCLC(22;406 813 4871 19580 40307)	dbGAP		Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	0													140.0	123.0	129.0					17																	62496729		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.1379T>G	17.37:g.62496729A>C	ENSP00000225792:p.Leu460Arg		B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_P68HR,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.L460R	ENST00000225792.5	37	c.1379	CCDS11659.1	17	.	.	.	.	.	.	.	.	.	.	A	9.612	1.131602	0.21041	.	.	ENSG00000108654	ENST00000540698;ENST00000450599;ENST00000225792	.	.	.	5.73	5.73	0.89815	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.86083	0.5848	M	0.92219	3.285	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.996;0.997;0.997	D	0.89438	0.3721	9	0.87932	D	0	-14.7332	16.3123	0.82883	1.0:0.0:0.0:0.0	.	381;460;460	B4DLW8;B5BUE6;P17844	.;.;DDX5_HUMAN	R	460;390;449	.	ENSP00000225792:L449R	L	-	2	0	DDX5	59927191	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.605000	0.90883	2.308000	0.77769	0.533000	0.62120	CTT	DDX5	-	pfscan_Helicase_C	ENSG00000108654		0.423	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX5	HGNC	protein_coding	OTTHUMT00000444030.1	108	0.00	0	A	NM_004396		62496729	62496729	-1	no_errors	ENST00000225792	ensembl	human	known	69_37n	missense	139	32.52	67	SNP	1.000	C
DOK1	1796	genome.wustl.edu	37	2	74783724	74783724	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr2:74783724C>T	ENST00000233668.5	+	5	1598	c.929C>T	c.(928-930)tCc>tTc	p.S310F	DOK1_ENST00000480318.1_3'UTR|LOXL3_ENST00000409986.1_5'Flank|M1AP_ENST00000464686.1_5'Flank|LOXL3_ENST00000393937.2_5'Flank|DOK1_ENST00000409429.1_Missense_Mutation_p.S171F|DOK1_ENST00000340004.6_3'UTR|LOXL3_ENST00000264094.3_5'Flank	NM_001381.3	NP_001372.1	Q99704	DOK1_HUMAN	docking protein 1, 62kDa (downstream of tyrosine kinase 1)	310	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|insulin receptor signaling pathway (GO:0008286)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor signaling protein activity (GO:0005057)			endometrium(3)|large_intestine(2)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						CCATGCCCTTCCCAGGACTCC	0.582																																					Esophageal Squamous(36;520 860 12502 33616 51270)	dbGAP											0													91.0	93.0	93.0					2																	74783724		2203	4300	6503	-	-	-	SO:0001583	missense	0			U70987	CCDS1954.1, CCDS56125.1	2p13	2008-05-21	2002-08-29		ENSG00000115325	ENSG00000115325			2990	protein-coding gene	gene with protein product		602919	"""docking protein 1, 62kD (downstream of tyrosine kinase 1)"""			9008160, 9790776, 15546884	Standard	NM_001381		Approved	p62dok	uc002sms.3	Q99704	OTTHUMG00000129956	ENST00000233668.5:c.929C>T	2.37:g.74783724C>T	ENSP00000233668:p.Ser310Phe		O43204|Q53TY2|Q9UHG6	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.S310F	ENST00000233668.5	37	c.929	CCDS1954.1	2	.	.	.	.	.	.	.	.	.	.	C	5.419	0.262495	0.10294	.	.	ENSG00000115325	ENST00000409429;ENST00000233668	T;T	0.32753	1.44;1.44	4.67	3.79	0.43588	.	0.899159	0.09640	N	0.775066	T	0.28134	0.0694	L	0.59436	1.845	0.09310	N	0.999991	B;B	0.29716	0.255;0.119	B;B	0.24269	0.052;0.037	T	0.26155	-1.0111	10	0.52906	T	0.07	-14.2661	5.6714	0.17725	0.1934:0.7075:0.0:0.0992	.	299;310	B4DJN1;Q99704	.;DOK1_HUMAN	F	171;310	ENSP00000387016:S171F;ENSP00000233668:S310F	ENSP00000233668:S310F	S	+	2	0	DOK1	74637232	0.000000	0.05858	0.990000	0.47175	0.292000	0.27327	-0.080000	0.11339	1.179000	0.42884	0.561000	0.74099	TCC	DOK1	-	NULL	ENSG00000115325		0.582	DOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOK1	HGNC	protein_coding	OTTHUMT00000252218.3	43	0.00	0	C	NM_001381		74783724	74783724	+1	no_errors	ENST00000233668	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	0.002	T
ECE1	1889	genome.wustl.edu	37	1	21582517	21582517	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr1:21582517C>T	ENST00000374893.6	-	8	1017	c.943G>A	c.(943-945)Gcc>Acc	p.A315T	ECE1_ENST00000415912.2_Missense_Mutation_p.A299T|ECE1_ENST00000436918.2_Missense_Mutation_p.A315T|ECE1_ENST00000264205.6_Missense_Mutation_p.A312T|ECE1_ENST00000357071.4_Missense_Mutation_p.A303T|ECE1_ENST00000528294.1_5'UTR	NM_001397.2	NP_001388.1	P42892	ECE1_HUMAN	endothelin converting enzyme 1	315					bradykinin catabolic process (GO:0010815)|calcitonin catabolic process (GO:0010816)|ear development (GO:0043583)|embryonic digit morphogenesis (GO:0042733)|endothelin maturation (GO:0034959)|heart development (GO:0007507)|hormone catabolic process (GO:0042447)|peptide hormone processing (GO:0016486)|pharyngeal system development (GO:0060037)|positive regulation of receptor recycling (GO:0001921)|protein processing (GO:0016485)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|substance P catabolic process (GO:0010814)	early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endosome membrane (GO:0031302)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)|Weibel-Palade body (GO:0033093)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)			endometrium(5)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	25		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		GTGATGTTGGCCAGTGCCGTC	0.612																																						dbGAP											0													136.0	110.0	119.0					1																	21582517		2203	4300	6503	-	-	-	SO:0001583	missense	0			D49471	CCDS215.1, CCDS44081.1, CCDS44082.1, CCDS44083.1	1p36.1	2008-02-05			ENSG00000117298	ENSG00000117298			3146	protein-coding gene	gene with protein product		600423		ECE		7805846, 7864876, 17592116	Standard	NM_001397		Approved		uc001bei.2	P42892	OTTHUMG00000002625	ENST00000374893.6:c.943G>A	1.37:g.21582517C>T	ENSP00000364028:p.Ala315Thr		A8K3P1|B4E291|Q14217|Q17RN5|Q2Z2K8|Q58GE7|Q5THM5|Q5THM7|Q5THM8|Q9UJQ6|Q9UPF4|Q9UPM4|Q9Y501	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.A315T	ENST00000374893.6	37	c.943	CCDS215.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.529625	0.96446	.	.	ENSG00000117298	ENST00000415912;ENST00000357071;ENST00000374893;ENST00000436918;ENST00000264205	T;T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28;-1.28	5.73	5.73	0.89815	Peptidase M13 (1);	0.000000	0.85682	D	0.000000	D	0.92928	0.7750	H	0.94964	3.605	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.997;0.998;0.998	D	0.94131	0.7388	10	0.87932	D	0	-41.5215	18.8402	0.92180	0.0:1.0:0.0:0.0	.	315;299;315;303;312	B4DKB2;Q2Z2K8;P42892;P42892-2;P42892-4	.;.;ECE1_HUMAN;.;.	T	299;303;315;315;312	ENSP00000405088:A299T;ENSP00000349581:A303T;ENSP00000364028:A315T;ENSP00000388439:A315T;ENSP00000264205:A312T	ENSP00000264205:A312T	A	-	1	0	ECE1	21455104	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.379000	0.79691	2.868000	0.98415	0.555000	0.69702	GCC	ECE1	-	pfam_Peptidase_M13_N	ENSG00000117298		0.612	ECE1-002	KNOWN	basic|CCDS	protein_coding	ECE1	HGNC	protein_coding	OTTHUMT00000007470.2	84	0.00	0	C	NM_001397		21582517	21582517	-1	no_errors	ENST00000374893	ensembl	human	known	69_37n	missense	76	31.25	35	SNP	1.000	T
EHD1	10938	genome.wustl.edu	37	11	64627773	64627773	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr11:64627773C>T	ENST00000320631.3	-	3	792	c.538G>A	c.(538-540)Gag>Aag	p.E180K	EHD1_ENST00000359393.2_Missense_Mutation_p.E180K	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	180	Dynamin-type G.			ERV -> DCW (in Ref. 2; AAD45866). {ECO:0000305}.	blood coagulation (GO:0007596)|cellular response to nerve growth factor stimulus (GO:1990090)|cholesterol homeostasis (GO:0042632)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|low-density lipoprotein particle clearance (GO:0034383)|neuron projection development (GO:0031175)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein homooligomerization (GO:0051260)	early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12						TCCACACGCTCCGCGAACCAC	0.582																																						dbGAP											0													44.0	40.0	41.0					11																	64627773		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047		"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1		10395801, 10673336	Standard	NM_001282444		Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.538G>A	11.37:g.64627773C>T	ENSP00000320516:p.Glu180Lys		O14611|Q2M3Q4|Q9UNR3	Missense_Mutation	SNP	pfam_Dynamin_GTPase,smart_EPS15_homology,pfscan_EF_HAND_2,pfscan_EPS15_homology	p.E180K	ENST00000320631.3	37	c.538	CCDS8084.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.490701	0.96339	.	.	ENSG00000110047	ENST00000320631;ENST00000359393;ENST00000541001;ENST00000421303;ENST00000421510;ENST00000433803;ENST00000455148	D;D;D;D;D	0.96427	-4.01;-4.01;-4.01;-4.01;-4.01	5.07	5.07	0.68467	Dynamin, GTPase domain (1);	0.000000	0.85682	D	0.000000	D	0.97570	0.9204	M	0.73372	2.23	0.80722	D	1	D;D	0.63046	0.992;0.992	D;D	0.66351	0.943;0.943	D	0.98061	1.0393	10	0.87932	D	0	-58.4511	15.9821	0.80116	0.0:1.0:0.0:0.0	.	180;180	B2R5U3;Q9H4M9	.;EHD1_HUMAN	K	180;180;156;194;44;194;44	ENSP00000320516:E180K;ENSP00000352354:E180K;ENSP00000391429:E44K;ENSP00000404944:E194K;ENSP00000396273:E44K	ENSP00000320516:E180K	E	-	1	0	EHD1	64384349	1.000000	0.71417	0.965000	0.40720	0.817000	0.46193	7.588000	0.82629	2.639000	0.89480	0.561000	0.74099	GAG	EHD1	-	pfam_Dynamin_GTPase	ENSG00000110047		0.582	EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD1	HGNC	protein_coding	OTTHUMT00000143229.2	38	0.00	0	C	NM_006795		64627773	64627773	-1	no_errors	ENST00000320631	ensembl	human	known	69_37n	missense	27	47.06	24	SNP	1.000	T
STRIP1	85369	genome.wustl.edu	37	1	110584264	110584264	+	Splice_Site	SNP	G	G	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr1:110584264G>T	ENST00000369795.3	+	7	779	c.757G>T	c.(757-759)Ggc>Tgc	p.G253C	STRIP1_ENST00000369796.1_Splice_Site_p.G158C	NM_033088.3	NP_149079.2	Q5VSL9	STRP1_HUMAN	striatin interacting protein 1	253					cortical actin cytoskeleton organization (GO:0030866)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											AGCCGAGCTGGGTAGGACCCT	0.597																																						dbGAP											0													87.0	89.0	88.0					1																	110584264		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK027649	CCDS30798.1, CCDS59197.1	1p13.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000143093	ENSG00000143093			25916	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog A (yeast)"""		"""family with sequence similarity 40, member A"""	FAM40A		11214970, 12588993, 22782902, 22298706, 18782753	Standard	NM_033088		Approved	FLJ14743, KIAA1761, FAR11A	uc001dza.2	Q5VSL9	OTTHUMG00000170607	ENST00000369795.3:c.757+1G>T	1.37:g.110584264G>T			Q0V925|Q5VSL8|Q658K2|Q6ZV31|Q8N598|Q96SN2|Q9C0A2	Missense_Mutation	SNP	pfam_DUF3402,pfam_N1221	p.G253C	ENST00000369795.3	37	c.757	CCDS30798.1	1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.868517	0.91587	.	.	ENSG00000143093	ENST00000369796;ENST00000369795	T;T	0.46451	0.88;0.87	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.55737	0.1939	L	0.60455	1.87	0.80722	D	1	D;D	0.71674	0.998;0.996	P;D	0.65443	0.893;0.935	T	0.53315	-0.8456	10	0.56958	D	0.05	-16.949	20.3214	0.98679	0.0:0.0:1.0:0.0	.	158;253	Q5VSL9-2;Q5VSL9	.;FA40A_HUMAN	C	158;253	ENSP00000358811:G158C;ENSP00000358810:G253C	ENSP00000358810:G253C	G	+	1	0	FAM40A	110385787	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	9.369000	0.97156	2.804000	0.96469	0.655000	0.94253	GGC	FAM40A	-	pfam_N1221	ENSG00000143093		0.597	STRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM40A	HGNC	protein_coding	OTTHUMT00000032213.1	118	0.00	0	G	NM_033088	Missense_Mutation	110584264	110584264	+1	no_errors	ENST00000369795	ensembl	human	known	69_37n	missense	87	17.92	19	SNP	1.000	T
GART	2618	genome.wustl.edu	37	21	34903121	34903121	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr21:34903121C>G	ENST00000381831.3	-	7	930	c.667G>C	c.(667-669)Gag>Cag	p.E223Q	GART_ENST00000497313.1_5'UTR|GART_ENST00000361093.5_Missense_Mutation_p.E223Q|GART_ENST00000381839.3_Missense_Mutation_p.E223Q|GART_ENST00000381815.4_Missense_Mutation_p.E223Q	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	223	ATP-grasp.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)			NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	CCATCTCCCTCCAGTAATCGC	0.493																																						dbGAP											0													79.0	62.0	68.0					21																	34903121		2203	4300	6503	-	-	-	SO:0001583	missense	0			M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.667G>C	21.37:g.34903121C>G	ENSP00000371253:p.Glu223Gln		A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Missense_Mutation	SNP	pfam_PRibGlycinamid_synth_ATP-grasp,pfam_Formyl_transf_N,pfam_PRibGlycinamide_synth_N,pfam_AIR_synth_C,pfam_PRibGlycinamide_synth_C-dom,pfam_AIR_synth,pfam_ATP-grasp_carboxylate-amine,pfam_CbamoylP_synth_lsu-like_ATP-bd,superfamily_Formyl_transf_N,superfamily_AIR_synth_C,superfamily_PurM_N-like,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,pfscan_ATP-grasp,tigrfam_PRibGlycinamide_synth,tigrfam_PurM_cligase,tigrfam_PurN_trans	p.E223Q	ENST00000381831.3	37	c.667	CCDS13627.1	21	.	.	.	.	.	.	.	.	.	.	C	24.8	4.568795	0.86439	.	.	ENSG00000159131	ENST00000381815;ENST00000381831;ENST00000381839;ENST00000361093;ENST00000430874;ENST00000426819	T;T;T;T;T;T	0.50813	1.36;1.36;1.36;1.31;0.75;0.73	5.72	5.72	0.89469	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain (1);	0.088754	0.85682	D	0.000000	T	0.58836	0.2150	M	0.72624	2.21	0.80722	D	1	B	0.23185	0.081	B	0.36289	0.221	T	0.59037	-0.7529	10	0.87932	D	0	-17.1491	19.8965	0.96963	0.0:1.0:0.0:0.0	.	223	P22102	PUR2_HUMAN	Q	223	ENSP00000371236:E223Q;ENSP00000371253:E223Q;ENSP00000371261:E223Q;ENSP00000354388:E223Q;ENSP00000413040:E223Q;ENSP00000398631:E223Q	ENSP00000354388:E223Q	E	-	1	0	GART	33824991	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.289000	0.78701	2.717000	0.92951	0.655000	0.94253	GAG	GART	-	pfam_PRibGlycinamid_synth_ATP-grasp,pfscan_ATP-grasp,tigrfam_PRibGlycinamide_synth	ENSG00000159131		0.493	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GART	HGNC	protein_coding	OTTHUMT00000140626.3	66	0.00	0	C	NM_000819		34903121	34903121	-1	no_errors	ENST00000381815	ensembl	human	known	69_37n	missense	31	31.11	14	SNP	1.000	G
GPSM2	29899	genome.wustl.edu	37	1	109466693	109466693	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr1:109466693C>A	ENST00000406462.2	+	15	2445	c.1672C>A	c.(1672-1674)Cgt>Agt	p.R558S	AKNAD1_ENST00000357393.4_Intron|GPSM2_ENST00000264126.3_Missense_Mutation_p.R558S			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	558	GoLoco 2. {ECO:0000255|PROSITE- ProRule:PRU00097}.				establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		ACAGAGTCGCCGTCTGGATGA	0.463																																						dbGAP											0													86.0	88.0	88.0					1																	109466693		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.1672C>A	1.37:g.109466693C>A	ENSP00000385510:p.Arg558Ser		Q5T1N8|Q6IBL7|Q8N0Z5	Missense_Mutation	SNP	pfam_GoLoco_motif,pfam_TPR-1,pfam_TPR-4,smart_TPR_repeat,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R558S	ENST00000406462.2	37	c.1672	CCDS792.2	1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.549999	0.86127	.	.	ENSG00000121957	ENST00000406462;ENST00000264126	D;D	0.98512	-4.97;-4.97	5.62	5.62	0.85841	GoLoco motif (3);	0.051839	0.85682	D	0.000000	D	0.98779	0.9589	M	0.81682	2.555	0.49483	D	0.999792	D	0.89917	1.0	D	0.97110	1.0	D	0.99771	1.1024	10	0.87932	D	0	-10.4894	14.4881	0.67631	0.1468:0.8532:0.0:0.0	.	558	P81274	GPSM2_HUMAN	S	558	ENSP00000385510:R558S;ENSP00000264126:R558S	ENSP00000264126:R558S	R	+	1	0	GPSM2	109268216	0.998000	0.40836	1.000000	0.80357	0.943000	0.58893	3.408000	0.52651	2.646000	0.89796	0.655000	0.94253	CGT	GPSM2	-	pfam_GoLoco_motif,smart_GoLoco_motif,pfscan_GoLoco_motif	ENSG00000121957		0.463	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPSM2	HGNC	protein_coding	OTTHUMT00000032400.3	71	0.00	0	C	NM_013296		109466693	109466693	+1	no_errors	ENST00000264126	ensembl	human	known	69_37n	missense	81	13.83	13	SNP	0.999	A
GRID2	2895	genome.wustl.edu	37	4	94159637	94159637	+	Missense_Mutation	SNP	G	G	A	rs568845338		TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr4:94159637G>A	ENST00000282020.4	+	8	1499	c.1241G>A	c.(1240-1242)cGa>cAa	p.R414Q	GRID2_ENST00000510992.1_Missense_Mutation_p.R319Q	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	414					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		AGAGGTGTTCGAAAAGTAAGA	0.398													G|||	1	0.000199681	0.0	0.0	5008	,	,		13414	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													125.0	133.0	130.0					4																	94159637		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.1241G>A	4.37:g.94159637G>A	ENSP00000282020:p.Arg414Gln		E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R414Q	ENST00000282020.4	37	c.1241	CCDS3637.1	4	.	.	.	.	.	.	.	.	.	.	G	21.8	4.198265	0.79015	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	D;D	0.86297	-2.1;-2.1	5.89	5.89	0.94794	.	0.124783	0.56097	D	0.000029	T	0.79028	0.4377	N	0.24115	0.695	0.54753	D	0.999983	P;P;P	0.52692	0.892;0.892;0.955	B;B;B	0.35655	0.054;0.054;0.207	T	0.80284	-0.1447	10	0.38643	T	0.18	.	19.8631	0.96790	0.0:0.0:1.0:0.0	.	319;414;319	E9PH24;O43424;Q4KKU8	.;GRID2_HUMAN;.	Q	414;319	ENSP00000282020:R414Q;ENSP00000421257:R319Q	ENSP00000282020:R414Q	R	+	2	0	GRID2	94378660	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	5.320000	0.65841	2.788000	0.95919	0.557000	0.71058	CGA	GRID2	-	NULL	ENSG00000152208		0.398	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2	76	0.00	0	G			94159637	94159637	+1	no_errors	ENST00000282020	ensembl	human	known	69_37n	missense	100	15.25	18	SNP	1.000	A
INTS10	55174	genome.wustl.edu	37	8	19694625	19694625	+	Silent	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr8:19694625C>T	ENST00000397977.3	+	13	1991	c.1593C>T	c.(1591-1593)ggC>ggT	p.G531G		NM_018142.2	NP_060612.2	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	531					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	20				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		AAGATGGAGGCAAATCCCAGG	0.388																																						dbGAP											0													112.0	111.0	111.0					8																	19694625		1873	4094	5967	-	-	-	SO:0001819	synonymous_variant	0			AK001431	CCDS6011.2	8p21.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000104613	ENSG00000104613			25548	protein-coding gene	gene with protein product		611353	"""chromosome 8 open reading frame 35"""	C8orf35		16239144	Standard	XM_005273558		Approved	FLJ10569, INT10	uc003wzj.3	Q9NVR2	OTTHUMG00000131065	ENST00000397977.3:c.1593C>T	8.37:g.19694625C>T			Q6IA93|Q7L538|Q7L8C8|Q9H3W8	Nonsense_Mutation	SNP	NULL	p.Q12*	ENST00000397977.3	37	c.34	CCDS6011.2	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.04|10.04	1.241488|1.241488	0.22711|0.22711	.|.	.|.	ENSG00000104613|ENSG00000104613	ENST00000520670|ENST00000518799	.|.	.|.	.|.	5.54|5.54	3.5|3.5	0.40072|0.40072	.|.	.|.	.|.	.|.	.|.	T|.	0.55401|.	0.1918|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.51529|.	-0.8694|.	4|.	.|.	.|.	.|.	-15.0297|-15.0297	6.5058|6.5058	0.22194|0.22194	0.1397:0.6511:0.1284:0.0808|0.1397:0.6511:0.1284:0.0808	.|.	.|.	.|.	.|.	V|X	21|114	.|.	.|.	A|Q	+|+	2|1	0|0	INTS10|INTS10	19738905|19738905	0.983000|0.983000	0.35010|0.35010	0.999000|0.999000	0.59377|0.59377	0.968000|0.968000	0.65278|0.65278	0.140000|0.140000	0.16056|0.16056	1.297000|1.297000	0.44761|0.44761	0.655000|0.655000	0.94253|0.94253	GCA|CAA	INTS10	-	NULL	ENSG00000104613		0.388	INTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS10	HGNC	protein_coding	OTTHUMT00000253724.2	81	0.00	0	C	NM_018142		19694625	19694625	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000521008	ensembl	human	known	69_37n	nonsense	80	27.93	31	SNP	0.996	T
IPCEF1	26034	genome.wustl.edu	37	6	154489200	154489200	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr6:154489200G>A	ENST00000265198.4	-	11	1111	c.956C>T	c.(955-957)tCa>tTa	p.S319L	IPCEF1_ENST00000422970.2_Missense_Mutation_p.S320L|IPCEF1_ENST00000367220.4_Missense_Mutation_p.S320L|OPRM1_ENST00000337049.4_Intron|IPCEF1_ENST00000519344.1_Missense_Mutation_p.S291L	NM_001130700.1|NM_015553.2	NP_001124172.1|NP_056368.1	Q8WWN9	ICEF1_HUMAN	interaction protein for cytohesin exchange factors 1	319					oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|positive regulation of GTP catabolic process (GO:0033126)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	oxygen transporter activity (GO:0005344)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	12						TTGCTCTAATGATTTGTACAG	0.358																																						dbGAP											0													207.0	201.0	203.0					6																	154489200		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007863	CCDS5245.1, CCDS47509.1	6q25.2	2013-01-10			ENSG00000074706	ENSG00000074706		"""Pleckstrin homology (PH) domain containing"""	21204	protein-coding gene	gene with protein product	"""phosphoinositide binding protein PIP3-E"""					11804589, 19756519	Standard	NM_001130699		Approved	PIP3-E, KIAA0403	uc021zhc.1	Q8WWN9	OTTHUMG00000015872	ENST00000265198.4:c.956C>T	6.37:g.154489200G>A	ENSP00000265198:p.Ser319Leu		A8K1K2|B7ZL78|B7ZL80|O43153|Q5HYL8	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S320L	ENST00000265198.4	37	c.959	CCDS5245.1	6	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068581	0.76301	.	.	ENSG00000074706	ENST00000265198;ENST00000422970;ENST00000367220;ENST00000519344	T;T;T;T	0.15718	2.4;2.4;2.4;2.42	5.57	5.57	0.84162	.	0.130451	0.52532	D	0.000063	T	0.31104	0.0786	M	0.67953	2.075	0.27301	N	0.957577	D;D;D	0.76494	0.997;0.999;0.999	P;D;D	0.71656	0.882;0.973;0.974	T	0.05370	-1.0889	10	0.46703	T	0.11	-17.5544	19.5657	0.95391	0.0:0.0:1.0:0.0	.	319;320;291	Q8WWN9;Q8WWN9-2;G3V132	ICEF1_HUMAN;.;.	L	319;320;320;291	ENSP00000265198:S319L;ENSP00000394751:S320L;ENSP00000356189:S320L;ENSP00000430287:S291L	ENSP00000265198:S319L	S	-	2	0	IPCEF1	154530892	1.000000	0.71417	0.953000	0.39169	0.716000	0.41182	5.784000	0.68990	2.630000	0.89119	0.591000	0.81541	TCA	IPCEF1	-	NULL	ENSG00000074706		0.358	IPCEF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IPCEF1	HGNC	protein_coding	OTTHUMT00000042789.2	146	0.00	0	G	NM_001130699		154489200	154489200	-1	no_errors	ENST00000367220	ensembl	human	known	69_37n	missense	128	18.47	29	SNP	0.996	A
KCNA5	3741	genome.wustl.edu	37	12	5154220	5154220	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr12:5154220G>A	ENST00000252321.3	+	1	1136	c.907G>A	c.(907-909)Gtc>Atc	p.V303I		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	303					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	CGGCAGCGGGGTCATGGCCCC	0.711																																						dbGAP											0													30.0	35.0	33.0					12																	5154220		2201	4289	6490	-	-	-	SO:0001583	missense	0			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.907G>A	12.37:g.5154220G>A	ENSP00000252321:p.Val303Ile		Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.V303I	ENST00000252321.3	37	c.907	CCDS8536.1	12	.	.	.	.	.	.	.	.	.	.	G	0.024	-1.385582	0.01194	.	.	ENSG00000130037	ENST00000252321	D	0.97328	-4.34	4.77	3.85	0.44370	.	40.030700	0.01525	U	0.018517	D	0.92731	0.7689	N	0.04636	-0.2	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.82428	-0.0462	10	0.34782	T	0.22	.	13.0858	0.59140	0.0:0.0:0.8331:0.1669	.	303	P22460	KCNA5_HUMAN	I	303	ENSP00000252321:V303I	ENSP00000252321:V303I	V	+	1	0	KCNA5	5024481	0.000000	0.05858	0.006000	0.13384	0.104000	0.19210	-0.765000	0.04730	1.172000	0.42781	0.561000	0.74099	GTC	KCNA5	-	NULL	ENSG00000130037		0.711	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	25	0.00	0	G	NM_002234		5154220	5154220	+1	no_errors	ENST00000252321	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	0.001	A
KCNK2	3776	genome.wustl.edu	37	1	215259881	215259881	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr1:215259881C>G	ENST00000444842.2	+	2	367	c.217C>G	c.(217-219)Ctg>Gtg	p.L73V	KCNK2_ENST00000391894.2_Missense_Mutation_p.L58V|KCNK2_ENST00000391895.2_Missense_Mutation_p.L69V	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	73					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	TGTCCTCTATCTGATCATCGG	0.483																																						dbGAP											0													105.0	90.0	95.0					1																	215259881		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.217C>G	1.37:g.215259881C>G	ENSP00000394033:p.Leu73Val		A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	pfam_Ion_trans_2,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.L73V	ENST00000444842.2	37	c.217	CCDS41467.1	1	.	.	.	.	.	.	.	.	.	.	C	19.99	3.928961	0.73327	.	.	ENSG00000082482	ENST00000366948;ENST00000391895;ENST00000478774;ENST00000391894;ENST00000444842;ENST00000457122	T;D;T;T;T	0.97598	1.79;-4.45;1.79;1.79;1.79	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.98188	0.9401	M	0.76838	2.35	0.80722	D	1	D;D;D	0.89917	0.985;0.995;1.0	D;D;D	0.91635	0.943;0.925;0.999	D	0.98532	1.0628	10	0.87932	D	0	.	13.65	0.62306	0.0:0.9203:0.0:0.0797	.	58;73;69	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	V	69;69;17;58;73;17	ENSP00000375765:L69V;ENSP00000420569:L17V;ENSP00000375764:L58V;ENSP00000394033:L73V;ENSP00000413460:L17V	ENSP00000355915:L69V	L	+	1	2	KCNK2	213326504	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.600000	0.54052	2.729000	0.93468	0.557000	0.71058	CTG	KCNK2	-	prints_2pore_dom_K_chnl_TASK	ENSG00000082482		0.483	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK2	HGNC	protein_coding	OTTHUMT00000089856.2	50	0.00	0	C	NM_014217		215259881	215259881	+1	no_errors	ENST00000444842	ensembl	human	known	69_37n	missense	59	23.38	18	SNP	1.000	G
KIAA1211L	343990	genome.wustl.edu	37	2	99449358	99449358	+	Silent	SNP	T	T	C			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr2:99449358T>C	ENST00000397899.2	-	4	673	c.342A>G	c.(340-342)caA>caG	p.Q114Q	KIAA1211L_ENST00000462314.1_Intron	NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	114																	ACACATTTTCTTGGGAAAACA	0.498																																						dbGAP											0													200.0	209.0	206.0					2																	99449358		1904	4132	6036	-	-	-	SO:0001819	synonymous_variant	0			BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.342A>G	2.37:g.99449358T>C				Silent	SNP	NULL	p.Q114	ENST00000397899.2	37	c.342	CCDS42720.1	2																																																																																			KIAA1211L	-	NULL	ENSG00000196872		0.498	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211L	HGNC	protein_coding	OTTHUMT00000329933.1	74	0.00	0	T	NM_207362		99449358	99449358	-1	no_errors	ENST00000397899	ensembl	human	known	69_37n	silent	72	26.53	26	SNP	1.000	C
KIAA1324L	222223	genome.wustl.edu	37	7	86539164	86539164	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr7:86539164A>G	ENST00000450689.2	-	16	2508	c.2323T>C	c.(2323-2325)Tca>Cca	p.S775P	KIAA1324L_ENST00000444627.1_Missense_Mutation_p.S704P|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.S535P|KIAA1324L_ENST00000416314.1_Missense_Mutation_p.S608P	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	775						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					GATTGTGATGATAAGGCTGCT	0.368																																						dbGAP											0													155.0	150.0	152.0					7																	86539164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.2323T>C	7.37:g.86539164A>G	ENSP00000413445:p.Ser775Pro		A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Growth_fac_rcpt	p.S775P	ENST00000450689.2	37	c.2323	CCDS47632.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.77|15.77	2.931620|2.931620	0.52866|0.52866	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000423294|ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314	.|T;T;T;T	.|0.21031	.|2.33;2.07;2.03;2.08	5.87|5.87	5.87|5.87	0.94306|0.94306	.|Mannose-6-phosphate receptor, binding (1);	.|0.116476	.|0.64402	.|D	.|0.000010	T|T	0.45776|0.45776	0.1359|0.1359	M|M	0.77103|0.77103	2.36|2.36	0.58432|0.58432	D|D	0.999997|0.999997	.|D;D;P	.|0.69078	.|0.997;0.963;0.937	.|D;P;P	.|0.68765	.|0.96;0.626;0.626	T|T	0.47560|0.47560	-0.9108|-0.9108	5|10	.|0.72032	.|D	.|0.01	.|.	12.0111|12.0111	0.53289|0.53289	0.8458:0.1542:0.0:0.0|0.8458:0.1542:0.0:0.0	.|.	.|775;535;608	.|A8MWY0;A8MWY0-2;B4DJV3	.|K132L_HUMAN;.;.	T|P	735|775;535;704;608	.|ENSP00000413445:S775P;ENSP00000297222:S535P;ENSP00000397377:S704P;ENSP00000402390:S608P	.|ENSP00000297222:S535P	I|S	-|-	2|1	0|0	KIAA1324L|KIAA1324L	86377100|86377100	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.981000|0.981000	0.71138|0.71138	5.574000|5.574000	0.67424|0.67424	2.248000|2.248000	0.74166|0.74166	0.533000|0.533000	0.62120|0.62120	ATC|TCA	KIAA1324L	-	superfamily_Man6P_isomerase_rcpt-bd_dom	ENSG00000164659		0.368	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1324L	HGNC	protein_coding	OTTHUMT00000333372.3	95	0.00	0	A	NM_152748		86539164	86539164	-1	no_errors	ENST00000450689	ensembl	human	known	69_37n	missense	76	33.04	38	SNP	0.993	G
KPNA3	3839	genome.wustl.edu	37	13	50299608	50299608	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr13:50299608G>A	ENST00000261667.3	-	7	827	c.413C>T	c.(412-414)gCa>gTa	p.A138V		NM_002267.3	NP_002258.2	O00505	IMA4_HUMAN	karyopherin alpha 3 (importin alpha 4)	138	NLS binding site (major). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)|protein complex assembly (GO:0006461)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(4)	21		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		GTTAGTTAATGCCCAAGCAGC	0.333																																						dbGAP											0													84.0	76.0	79.0					13																	50299608		2203	4300	6503	-	-	-	SO:0001583	missense	0			D89618	CCDS9421.1	13q14.3	2013-02-14			ENSG00000102753	ENSG00000102753		"""Importins"", ""Armadillo repeat containing"""	6396	protein-coding gene	gene with protein product		601892				9154134, 9435235	Standard	NM_002267		Approved	SRP1gamma, SRP4, hSRP1, IPOA4	uc001vdj.2	O00505	OTTHUMG00000016922	ENST00000261667.3:c.413C>T	13.37:g.50299608G>A	ENSP00000261667:p.Ala138Val		O00191|O43195|Q5JVM9|Q96AA7	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.A138V	ENST00000261667.3	37	c.413	CCDS9421.1	13	.	.	.	.	.	.	.	.	.	.	G	35	5.448824	0.96205	.	.	ENSG00000102753	ENST00000261667	T	0.79454	-1.27	5.72	5.72	0.89469	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.89238	0.6658	M	0.80028	2.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89330	0.3646	10	0.59425	D	0.04	-11.4861	19.8891	0.96923	0.0:0.0:1.0:0.0	.	138	O00505	IMA3_HUMAN	V	138	ENSP00000261667:A138V	ENSP00000261667:A138V	A	-	2	0	KPNA3	49197609	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.689000	0.91719	0.655000	0.94253	GCA	KPNA3	-	pfam_Armadillo,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	ENSG00000102753		0.333	KPNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA3	HGNC	protein_coding	OTTHUMT00000044939.2	55	0.00	0	G	NM_002267		50299608	50299608	-1	no_errors	ENST00000261667	ensembl	human	known	69_37n	missense	35	31.37	16	SNP	1.000	A
LEPR	3953	genome.wustl.edu	37	1	66064359	66064359	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr1:66064359C>G	ENST00000349533.6	+	8	1051	c.866C>G	c.(865-867)tCa>tGa	p.S289*	LEPR_ENST00000344610.8_Nonsense_Mutation_p.S289*|LEPR_ENST00000406510.3_Intron|LEPR_ENST00000371058.1_Nonsense_Mutation_p.S289*|LEPR_ENST00000462765.1_3'UTR|LEPR_ENST00000371060.3_Nonsense_Mutation_p.S289*|LEPR_ENST00000371059.3_Nonsense_Mutation_p.S289*	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		AAGATTGTCTCAGCTACATCC	0.423																																						dbGAP											0													100.0	96.0	98.0					1																	66064359		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.866C>G	1.37:g.66064359C>G	ENSP00000330393:p.Ser289*		Q6FHL5	Nonsense_Mutation	SNP	pfam_IgC2-like_lig-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S289*	ENST00000349533.6	37	c.866	CCDS631.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.790200	0.96945	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	.	.	.	5.81	0.267	0.15622	.	0.993651	0.08185	N	0.984792	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-0.5318	8.4936	0.33115	0.0:0.5082:0.0:0.4918	.	.	.	.	X	289	.	ENSP00000340884:S289X	S	+	2	0	LEPR	65836947	0.000000	0.05858	0.621000	0.29145	0.803000	0.45373	0.056000	0.14256	0.056000	0.16144	0.455000	0.32223	TCA	LEPR	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000116678		0.423	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPR	HGNC	protein_coding	OTTHUMT00000025275.1	76	0.00	0	C	NM_002303		66064359	66064359	+1	no_errors	ENST00000349533	ensembl	human	known	69_37n	nonsense	79	12.22	11	SNP	0.001	G
MARCH6	10299	genome.wustl.edu	37	5	10390504	10390504	+	Silent	SNP	A	A	C			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr5:10390504A>C	ENST00000274140.5	+	6	600	c.468A>C	c.(466-468)gcA>gcC	p.A156A	MARCH6_ENST00000449913.2_Silent_p.A108A|MARCH6_ENST00000503788.1_Silent_p.A51A	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	156					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						CACTGTGTGCATTCATCAGCC	0.463																																						dbGAP											0													175.0	170.0	172.0					5																	10390504		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.468A>C	5.37:g.10390504A>C			A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.A156	ENST00000274140.5	37	c.468	CCDS34135.1	5																																																																																			MARCH6	-	NULL	ENSG00000145495		0.463	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH6	HGNC	protein_coding	OTTHUMT00000366919.2	101	0.98	1	A	NM_005885		10390504	10390504	+1	no_errors	ENST00000274140	ensembl	human	known	69_37n	silent	116	20.41	30	SNP	0.353	C
MDP1	145553	genome.wustl.edu	37	14	24683764	24683764	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr14:24683764A>C	ENST00000288087.7	-	4	362	c.251T>G	c.(250-252)tTt>tGt	p.F84C	CHMP4A_ENST00000609024.1_5'Flank|TM9SF1_ENST00000556387.1_5'Flank|CHMP4A_ENST00000347519.6_5'Flank|MDP1_ENST00000532557.1_5'UTR|NEDD8-MDP1_ENST00000604306.1_5'UTR|MDP1_ENST00000396833.2_Missense_Mutation_p.F84C|AL136419.6_ENST00000565988.1_RNA|NEDD8-MDP1_ENST00000534348.1_Missense_Mutation_p.F101C|CHMP4A_ENST00000530996.1_5'Flank|CHMP4A_ENST00000542700.2_5'Flank|TM9SF1_ENST00000530611.1_5'Flank	NM_001199822.1|NM_138476.3	NP_001186751.1|NP_612485.2	Q86V88	MGDP1_HUMAN	magnesium-dependent phosphatase 1	84						extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|large_intestine(2)|lung(3)	7						GAAGAGGTCAAAGAGCTCCAG	0.483																																						dbGAP											0													108.0	107.0	107.0					14																	24683764		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC046912	CCDS9620.1, CCDS55908.1	14q12	2009-07-09			ENSG00000213920	ENSG00000213920			28781	protein-coding gene	gene with protein product	"""fructosamine-6-phosphatase"""					10889041, 16670083	Standard	NM_138476		Approved	MGC5987, FN6Pase		Q86V88	OTTHUMG00000133477	ENST00000288087.7:c.251T>G	14.37:g.24683764A>C	ENSP00000288087:p.Phe84Cys		Q86Y84|Q8NAD9	Missense_Mutation	SNP	pfam_NIF,superfamily_HAD-like_dom,tigrfam_MDP_1_eu_arc,tigrfam_HAD_SF_ppase_IIIC	p.F84C	ENST00000288087.7	37	c.251	CCDS9620.1	14	.	.	.	.	.	.	.	.	.	.	A	20.6	4.012483	0.75161	.	.	ENSG00000213920;ENSG00000213920;ENSG00000255526	ENST00000288087;ENST00000396833;ENST00000534348	D;D;D	0.97505	-4.41;-4.41;-4.41	5.53	5.53	0.82687	HAD-like domain (2);HAD-superfamily phosphatase, subfamily IIIC (1);	0.000000	0.30850	U	0.008748	D	0.98349	0.9452	M	0.85373	2.75	0.26405	N	0.976363	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.965;0.988;0.99	D	0.95044	0.8181	10	0.66056	D	0.02	-8.2563	13.1812	0.59655	1.0:0.0:0.0:0.0	.	84;84;84	Q86V88-3;Q86V88;Q86V88-2	.;MGDP1_HUMAN;.	C	84;84;101	ENSP00000288087:F84C;ENSP00000380045:F84C;ENSP00000431482:F101C	ENSP00000288087:F84C	F	-	2	0	MDP1;NEDD8-MDP1	23753604	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.298000	0.65710	2.107000	0.64212	0.533000	0.62120	TTT	MDP1	-	pfam_NIF,superfamily_HAD-like_dom,tigrfam_MDP_1_eu_arc,tigrfam_HAD_SF_ppase_IIIC	ENSG00000213920		0.483	MDP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MDP1	HGNC	protein_coding	OTTHUMT00000257367.1	98	0.00	0	A	NM_138476		24683764	24683764	-1	no_errors	ENST00000288087	ensembl	human	known	69_37n	missense	55	52.94	63	SNP	1.000	C
MMD	23531	genome.wustl.edu	37	17	53471851	53471851	+	Silent	SNP	A	A	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr17:53471851A>T	ENST00000262065.3	-	7	857	c.561T>A	c.(559-561)atT>atA	p.I187I		NM_012329.2	NP_036461.2	Q15546	PAQRB_HUMAN	monocyte to macrophage differentiation-associated	187					cytolysis (GO:0019835)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|large_intestine(1)|lung(4)|prostate(1)	7						CCAAGCAATAAATTAAGCCCC	0.463																																						dbGAP											0													81.0	73.0	75.0					17																	53471851		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X85750	CCDS11586.1	17q	2008-05-02				ENSG00000108960			7153	protein-coding gene	gene with protein product		604467				7503749, 16044242	Standard	NM_012329		Approved	MMA, PAQR11	uc002iui.3	Q15546		ENST00000262065.3:c.561T>A	17.37:g.53471851A>T			B2R6X9|D3DTY6|Q8TAN7	Silent	SNP	pfam_HlyIII-related,tigrfam_HylIII	p.I187	ENST00000262065.3	37	c.561	CCDS11586.1	17																																																																																			MMD	-	pfam_HlyIII-related,tigrfam_HylIII	ENSG00000108960		0.463	MMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMD	HGNC	protein_coding	OTTHUMT00000439214.1	44	0.00	0	A			53471851	53471851	-1	no_errors	ENST00000262065	ensembl	human	known	69_37n	silent	44	40.54	30	SNP	1.000	T
MMS22L	253714	genome.wustl.edu	37	6	97613182	97613182	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr6:97613182C>G	ENST00000275053.4	-	21	3426	c.3161G>C	c.(3160-3162)aGa>aCa	p.R1054T	MMS22L_ENST00000369251.2_Missense_Mutation_p.R1014T	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	1054					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						GGCTGTGTTTCTCAATGCCAG	0.363																																						dbGAP											0													105.0	105.0	105.0					6																	97613182		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.3161G>C	6.37:g.97613182C>G	ENSP00000275053:p.Arg1054Thr		D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R1054T	ENST00000275053.4	37	c.3161	CCDS5039.1	6	.	.	.	.	.	.	.	.	.	.	C	10.09	1.253876	0.22965	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.28255	1.62;1.62	5.79	1.67	0.24075	.	0.334043	0.39544	N	0.001331	T	0.09247	0.0228	L	0.40543	1.245	0.22366	N	0.99916	B;B	0.20988	0.05;0.05	B;B	0.21917	0.037;0.023	T	0.34775	-0.9815	10	0.21540	T	0.41	-19.528	11.6351	0.51198	0.0:0.7659:0.0:0.2341	.	1014;1054	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	T	1054;1014	ENSP00000275053:R1054T;ENSP00000358254:R1014T	ENSP00000275053:R1054T	R	-	2	0	MMS22L	97719903	0.858000	0.29795	0.993000	0.49108	0.701000	0.40568	0.762000	0.26503	0.273000	0.22049	0.655000	0.94253	AGA	MMS22L	-	superfamily_ARM-type_fold	ENSG00000146263		0.363	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMS22L	HGNC	protein_coding	OTTHUMT00000041573.3	111	0.00	0	C	NM_198468		97613182	97613182	-1	no_errors	ENST00000275053	ensembl	human	known	69_37n	missense	86	18.35	20	SNP	0.900	G
MSI2	124540	genome.wustl.edu	37	17	55334455	55334455	+	Intron	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr17:55334455C>T	ENST00000284073.2	+	2	271				MSI2_ENST00000416426.2_Intron|MSI2_ENST00000322684.3_Missense_Mutation_p.S16F	NM_138962.2	NP_620412.1	Q96DH6	MSI2H_HUMAN	musashi RNA-binding protein 2							cytoplasm (GO:0005737)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	7	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		TTTTCTCCCTCTAGTAAAATG	0.532			T	HOXA9	CML																																	dbGAP		Dom	yes		17	17q23.2	124540	musashi homolog 2 (Drosophila)		L	0													84.0	73.0	77.0					17																	55334455		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC001526	CCDS11596.1, CCDS11597.1	17q23.2	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	18585	protein-coding gene	gene with protein product		607897	"""musashi homolog 2 (Drosophila)"""			11588182	Standard	NM_138962		Approved		uc002iuz.1	Q96DH6		ENST00000284073.2:c.63-4C>T	17.37:g.55334455C>T			Q7Z6M7|Q8N9T4	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S16F	ENST00000284073.2	37	c.47	CCDS11596.1	17	.	.	.	.	.	.	.	.	.	.	C	8.537	0.872268	0.17322	.	.	ENSG00000153944	ENST00000322684	T	0.07114	3.22	2.55	2.55	0.30701	.	.	.	.	.	T	0.05044	0.0135	.	.	.	0.80722	D	1	B	0.15141	0.012	B	0.10450	0.005	T	0.28996	-1.0026	8	0.10111	T	0.7	.	12.4096	0.55459	0.0:1.0:0.0:0.0	.	16	Q96DH6-2	.	F	16	ENSP00000313616:S16F	ENSP00000313616:S16F	S	+	2	0	MSI2	52689454	1.000000	0.71417	0.991000	0.47740	0.976000	0.68499	2.220000	0.42908	1.364000	0.46038	0.379000	0.24179	TCT	MSI2	-	NULL	ENSG00000153944		0.532	MSI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSI2	HGNC	protein_coding	OTTHUMT00000441813.1	58	0.00	0	C			55334455	55334455	+1	no_errors	ENST00000322684	ensembl	human	known	69_37n	missense	70	27.84	27	SNP	1.000	T
MST1L	11223	genome.wustl.edu	37	1	17086439	17086439	+	RNA	SNP	C	C	T	rs199717911		TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr1:17086439C>T	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										TAGTGTAGCACCATGGCCGCT	0.637																																						dbGAP											0																																										-	-	-			0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17086439C>T			B7WPB1|Q13209	Nonsense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.W220*	ENST00000455405.2	37	c.660		1	.	.	.	.	.	.	.	.	.	.	.	15.15	2.747962	0.49257	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	.	0.267871	0.20764	N	0.086120	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.7402	0.23431	0.0:0.9998:0.0:2.0E-4	.	.	.	.	X	225;220;220	.	ENSP00000439273:W220X	W	-	3	0	MST1P9	16959026	1.000000	0.71417	0.739000	0.30968	0.000000	0.00434	4.973000	0.63763	0.502000	0.28037	0.000000	0.15137	TGG	MST1P9	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000186715		0.637	MST1L-002	KNOWN	basic	processed_transcript	MST1P9	HGNC	pseudogene	OTTHUMT00000400328.1	8	0.00	0	C	NM_001271733		17086439	17086439	-1	no_errors	ENST00000334998	ensembl	human	known	69_37n	nonsense	2	60.00	3	SNP	1.000	T
MST1R	4486	genome.wustl.edu	37	3	49939908	49939908	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr3:49939908C>T	ENST00000296474.3	-	1	1162	c.1135G>A	c.(1135-1137)Gat>Aat	p.D379N	CTD-2330K9.3_ENST00000419183.1_5'Flank|MST1R_ENST00000344206.4_Missense_Mutation_p.D379N|CTD-2330K9.2_ENST00000435478.1_RNA	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	379	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)			cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		ACACCCTCATCAATTAGTGTG	0.582																																						dbGAP											0													117.0	122.0	120.0					3																	49939908		2203	4300	6503	-	-	-	SO:0001583	missense	0			X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.1135G>A	3.37:g.49939908C>T	ENSP00000296474:p.Asp379Asn		B5A944|B5A945|B5A946|B5A947	Missense_Mutation	SNP	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_IPT_TIG_rcpt,superfamily_Semaphorin/CD100_Ag,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semaphorin/CD100_Ag,pfscan_Prot_kinase_cat_dom	p.D379N	ENST00000296474.3	37	c.1135	CCDS2807.1	3	.	.	.	.	.	.	.	.	.	.	C	11.85	1.760487	0.31137	.	.	ENSG00000164078	ENST00000296474;ENST00000344206	T;T	0.04194	3.68;3.68	4.77	4.77	0.60923	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.637047	0.16682	N	0.203881	T	0.05273	0.0140	N	0.16368	0.405	0.26758	N	0.970062	P;P;P;P;P	0.51933	0.551;0.949;0.551;0.551;0.801	P;P;P;P;B	0.47528	0.466;0.52;0.549;0.549;0.346	T	0.40572	-0.9556	10	0.08179	T	0.78	-1.0484	17.3884	0.87423	0.0:1.0:0.0:0.0	.	379;379;379;379;379	Q04912-3;Q04912-4;Q04912-6;Q04912-5;Q04912	.;.;.;.;RON_HUMAN	N	379	ENSP00000296474:D379N;ENSP00000341325:D379N	ENSP00000296474:D379N	D	-	1	0	MST1R	49914912	0.193000	0.23313	0.014000	0.15608	0.030000	0.12068	2.409000	0.44583	2.190000	0.69967	0.561000	0.74099	GAT	MST1R	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000164078		0.582	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MST1R	HGNC	protein_coding	OTTHUMT00000345403.1	66	0.00	0	C			49939908	49939908	-1	no_errors	ENST00000296474	ensembl	human	known	69_37n	missense	18	40.00	12	SNP	0.580	T
MUC17	140453	genome.wustl.edu	37	7	100686638	100686638	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr7:100686638A>G	ENST00000306151.4	+	3	12005	c.11941A>G	c.(11941-11943)Acc>Gcc	p.T3981A		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3981					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAGTAGTAGTACCACCACATC	0.468																																						dbGAP											0													139.0	138.0	139.0					7																	100686638		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.11941A>G	7.37:g.100686638A>G	ENSP00000302716:p.Thr3981Ala		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.T3981A	ENST00000306151.4	37	c.11941	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	a	7.771	0.707522	0.15239	.	.	ENSG00000169876	ENST00000306151	T	0.01947	4.54	1.43	-2.23	0.06930	.	.	.	.	.	T	0.01558	0.0050	N	0.14661	0.345	0.09310	N	1	P	0.49358	0.923	P	0.45538	0.484	T	0.46005	-0.9222	9	0.20519	T	0.43	.	4.5626	0.12168	0.5951:0.0:0.4049:0.0	.	3981	Q685J3	MUC17_HUMAN	A	3981	ENSP00000302716:T3981A	ENSP00000302716:T3981A	T	+	1	0	MUC17	100473358	0.000000	0.05858	0.021000	0.16686	0.133000	0.20885	-1.829000	0.01701	-0.664000	0.05324	-0.506000	0.04501	ACC	MUC17	-	NULL	ENSG00000169876		0.468	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	67	0.00	0	A	NM_001040105		100686638	100686638	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	96	16.95	20	SNP	0.229	G
MYO9B	4650	genome.wustl.edu	37	19	17320474	17320474	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr19:17320474G>A	ENST00000594824.1	+	36	5851	c.5704G>A	c.(5704-5706)Gag>Aag	p.E1902K	MYO9B_ENST00000595618.1_Missense_Mutation_p.E1902K|CTD-3032J10.3_ENST00000601929.1_RNA|MYO9B_ENST00000397274.2_Missense_Mutation_p.E1902K			Q13459	MYO9B_HUMAN	myosin IXB	1902	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						GGAGGCTGCAGAGAGTATCGC	0.577																																						dbGAP											0													62.0	76.0	71.0					19																	17320474		2114	4231	6345	-	-	-	SO:0001583	missense	0				CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.5704G>A	19.37:g.17320474G>A	ENSP00000471367:p.Glu1902Lys		O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.E1902K	ENST00000594824.1	37	c.5704		19	.	.	.	.	.	.	.	.	.	.	G	34	5.390405	0.95988	.	.	ENSG00000099331	ENST00000397274;ENST00000319396	D	0.86097	-2.07	3.87	3.87	0.44632	.	0.000000	0.44285	D	0.000477	D	0.90734	0.7092	M	0.75615	2.305	0.53005	D	0.999965	D;D;D	0.71674	0.997;0.997;0.998	D;D;D	0.75484	0.98;0.98;0.986	D	0.88768	0.3262	10	0.21540	T	0.41	.	15.3272	0.74176	0.0:0.0:1.0:0.0	.	1902;1902;1908	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	K	1902;247	ENSP00000380444:E1902K	ENSP00000314032:E247K	E	+	1	0	MYO9B	17181474	1.000000	0.71417	0.914000	0.36105	0.951000	0.60555	9.258000	0.95555	2.173000	0.68751	0.462000	0.41574	GAG	MYO9B	-	NULL	ENSG00000099331		0.577	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	MYO9B	HGNC	protein_coding	OTTHUMT00000463236.1	92	0.00	0	G			17320474	17320474	+1	no_errors	ENST00000397274	ensembl	human	known	69_37n	missense	27	60.87	42	SNP	0.999	A
NCOR1	9611	genome.wustl.edu	37	17	15943783	15943783	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr17:15943783G>C	ENST00000268712.3	-	43	6962	c.6705C>G	c.(6703-6705)atC>atG	p.I2235M	AC002553.1_ENST00000442828.1_Intron|NCOR1_ENST00000395851.1_Missense_Mutation_p.I2132M|NCOR1_ENST00000395857.3_Missense_Mutation_p.I819M	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	2235	ID2. {ECO:0000250}.|Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GCAGATTAAAGATCTCAGTTC	0.343																																						dbGAP											0													87.0	79.0	81.0					17																	15943783		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.6705C>G	17.37:g.15943783G>C	ENSP00000268712:p.Ile2235Met		B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.I2235M	ENST00000268712.3	37	c.6705	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	G	9.974	1.226245	0.22542	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395857	T;T;T	0.61274	0.12;0.73;0.24	5.64	2.32	0.28847	.	0.000000	0.85682	D	0.000000	T	0.69450	0.3112	M	0.67700	2.07	0.54753	D	0.999987	D;D;D;D;D	0.89917	0.999;0.995;0.998;1.0;1.0	D;D;D;D;D	0.91635	0.996;0.986;0.993;0.999;0.998	T	0.69296	-0.5182	10	0.87932	D	0	-8.0886	8.2271	0.31575	0.077:0.0:0.563:0.3601	.	2139;2235;2132;755;249	E7EVK1;O75376;O75376-2;Q86YY1;Q86YY2	.;NCOR1_HUMAN;.;.;.	M	2235;2132;2139;819	ENSP00000268712:I2235M;ENSP00000379192:I2132M;ENSP00000379198:I819M	ENSP00000268712:I2235M	I	-	3	3	NCOR1	15884508	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.063000	0.30567	0.693000	0.31634	-0.140000	0.14226	ATC	NCOR1	-	NULL	ENSG00000141027		0.343	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	106	0.00	0	G	NM_006311		15943783	15943783	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	missense	181	11.65	24	SNP	1.000	C
NEFM	4741	genome.wustl.edu	37	8	24771805	24771805	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr8:24771805G>A	ENST00000221166.5	+	1	1281	c.499G>A	c.(499-501)Gag>Aag	p.E167K	RP11-624C23.1_ENST00000519689.1_RNA|GS1-72M22.1_ENST00000607058.1_RNA|NEFM_ENST00000521540.1_3'UTR|NEFM_ENST00000433454.2_5'Flank|NEFM_ENST00000437366.2_Missense_Mutation_p.E167K|NEFM_ENST00000518131.1_Missense_Mutation_p.E167K			P07197	NFM_HUMAN	neurofilament, medium polypeptide	167	Coil 1B.|Rod.				axon cargo transport (GO:0008088)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|regulation of axon diameter (GO:0031133)	axon (GO:0030424)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)|neuromuscular junction (GO:0031594)	microtubule binding (GO:0008017)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|endometrium(7)|kidney(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|urinary_tract(1)	36		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		GGTGAACCACGAGAAGGCTCA	0.672																																						dbGAP											0													32.0	35.0	34.0					8																	24771805		2201	4300	6501	-	-	-	SO:0001583	missense	0			BC002421	CCDS6046.1, CCDS47831.1	8p21	2013-01-16	2008-09-19	2006-11-20	ENSG00000104722	ENSG00000104722		"""Intermediate filaments type IV"""	7734	protein-coding gene	gene with protein product		162250	"""neurofilament, medium polypeptide 150kDa"""	NEF3		1348579	Standard	NM_001105541		Approved	NFM, NF-M	uc003xed.4	P07197	OTTHUMG00000131990	ENST00000221166.5:c.499G>A	8.37:g.24771805G>A	ENSP00000221166:p.Glu167Lys		B4DGN2|E9PBF7|Q4QRK6	Missense_Mutation	SNP	pfam_F,pfam_Intermed_filament_DNA-bd,superfamily_Prefoldin,prints_Keratin_I	p.E167K	ENST00000221166.5	37	c.499	CCDS6046.1	8	.	.	.	.	.	.	.	.	.	.	G	27.3	4.817986	0.90790	.	.	ENSG00000104722	ENST00000221166;ENST00000518131;ENST00000437366	D;D;D	0.90324	-2.65;-2.65;-2.65	4.85	4.85	0.62838	Filament (1);	0.000000	0.47455	D	0.000223	D	0.94581	0.8254	M	0.80183	2.485	0.58432	D	0.999991	D;D	0.71674	0.998;0.986	P;P	0.62649	0.905;0.448	D	0.95125	0.8250	10	0.72032	D	0.01	.	14.7678	0.69654	0.0:0.1452:0.8548:0.0	.	167;167	E7EMV2;P07197	.;NFM_HUMAN	K	167	ENSP00000221166:E167K;ENSP00000427872:E167K;ENSP00000410137:E167K	ENSP00000221166:E167K	E	+	1	0	NEFM	24827710	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.812000	0.86109	2.385000	0.81259	0.467000	0.42956	GAG	NEFM	-	pfam_F	ENSG00000104722		0.672	NEFM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEFM	HGNC	protein_coding	OTTHUMT00000254954.2	23	0.00	0	G	NM_005382		24771805	24771805	+1	no_errors	ENST00000221166	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	1.000	A
NUP107	57122	genome.wustl.edu	37	12	69135678	69135678	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr12:69135678C>T	ENST00000229179.4	+	27	2920	c.2588C>T	c.(2587-2589)aCg>aTg	p.T863M	NUP107_ENST00000378905.2_Missense_Mutation_p.T624M|NUP107_ENST00000539906.1_Missense_Mutation_p.T834M	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	863					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)		NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			CTGCTTCATACGATATTGCAC	0.428																																						dbGAP											0													222.0	199.0	207.0					12																	69135678		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.2588C>T	12.37:g.69135678C>T	ENSP00000229179:p.Thr863Met		B4DZ67|Q6PJE1	Missense_Mutation	SNP	pfam_Nup84_Nup100	p.T863M	ENST00000229179.4	37	c.2588	CCDS8985.1	12	.	.	.	.	.	.	.	.	.	.	C	15.28	2.787771	0.49997	.	.	ENSG00000111581	ENST00000229179;ENST00000378905;ENST00000539906	.	.	.	5.4	5.4	0.78164	.	0.138322	0.64402	D	0.000005	T	0.66761	0.2822	M	0.70275	2.135	0.26494	N	0.974885	D;D;D	0.89917	0.99;1.0;0.999	P;P;P	0.61658	0.836;0.892;0.753	T	0.61277	-0.7095	8	.	.	.	-1.9342	19.5664	0.95395	0.0:1.0:0.0:0.0	.	834;624;863	B4DZ67;Q6PJE1;P57740	.;.;NU107_HUMAN	M	863;624;834	.	.	T	+	2	0	NUP107	67421945	1.000000	0.71417	0.758000	0.31321	0.007000	0.05969	5.156000	0.64905	2.723000	0.93209	0.655000	0.94253	ACG	NUP107	-	pfam_Nup84_Nup100	ENSG00000111581		0.428	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP107	HGNC	protein_coding	OTTHUMT00000403195.1	141	0.00	0	C	NM_020401		69135678	69135678	+1	no_errors	ENST00000229179	ensembl	human	known	69_37n	missense	233	14.34	39	SNP	0.996	T
OR51Q1	390061	genome.wustl.edu	37	11	5444283	5444283	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr11:5444283G>T	ENST00000300778.4	+	1	943	c.853G>T	c.(853-855)Gca>Tca	p.A285S	HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001004757.2	NP_001004757.1	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q, member 1 (gene/pseudogene)	285						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(3)|liver(2)|lung(21)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	37		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTACCTGCTGGCACCCCCGGT	0.453																																						dbGAP											0													84.0	78.0	80.0					11																	5444283		2201	4297	6498	-	-	-	SO:0001583	missense	0			AB065531	CCDS31381.1	11p15.4	2013-10-10	2013-10-10		ENSG00000167360	ENSG00000167360		"""GPCR / Class A : Olfactory receptors"""	14851	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily Q, member 1"""				Standard	NM_001004757		Approved		uc010qzd.2	Q8NH59	OTTHUMG00000066896	ENST00000300778.4:c.853G>T	11.37:g.5444283G>T	ENSP00000300778:p.Ala285Ser		B2RNN1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A285S	ENST00000300778.4	37	c.853	CCDS31381.1	11	.	.	.	.	.	.	.	.	.	.	G	9.239	1.037734	0.19669	.	.	ENSG00000167360	ENST00000300778	T	0.00107	8.72	5.0	4.04	0.47022	GPCR, rhodopsin-like superfamily (1);	0.514144	0.17987	N	0.155359	T	0.00144	0.0004	L	0.52126	1.63	0.09310	N	0.999999	B	0.32302	0.363	B	0.31812	0.136	T	0.36890	-0.9729	10	0.87932	D	0	.	8.7024	0.34334	0.0:0.1375:0.6215:0.241	.	285	Q8NH59	O51Q1_HUMAN	S	285	ENSP00000300778:A285S	ENSP00000300778:A285S	A	+	1	0	OR51Q1	5400859	0.000000	0.05858	1.000000	0.80357	0.159000	0.22180	0.157000	0.16402	2.641000	0.89580	0.380000	0.24917	GCA	OR51Q1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000167360		0.453	OR51Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51Q1	HGNC	protein_coding	OTTHUMT00000143373.1	42	0.00	0	G	NM_001004757		5444283	5444283	+1	no_errors	ENST00000300778	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	0.489	T
OR8B12	219858	genome.wustl.edu	37	11	124412897	124412897	+	Silent	SNP	G	G	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr11:124412897G>T	ENST00000306842.2	-	1	678	c.654C>A	c.(652-654)gcC>gcA	p.A218A		NM_001005195.1	NP_001005195.1	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B, member 12	218						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		AGAGGATGAGGGCATAAGAAA	0.438																																						dbGAP											0													89.0	75.0	80.0					11																	124412897		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS31711.1	11q24.2	2013-09-24			ENSG00000170953	ENSG00000170953		"""GPCR / Class A : Olfactory receptors"""	15307	protein-coding gene	gene with protein product							Standard	NM_001005195		Approved		uc010sam.2	Q8NGG6	OTTHUMG00000165922	ENST00000306842.2:c.654C>A	11.37:g.124412897G>T			B2RNF6|Q6IEW8|Q96RC7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A218	ENST00000306842.2	37	c.654	CCDS31711.1	11																																																																																			OR8B12	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000170953		0.438	OR8B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B12	HGNC	protein_coding	OTTHUMT00000387061.1	66	0.00	0	G			124412897	124412897	-1	no_errors	ENST00000306842	ensembl	human	known	69_37n	silent	43	17.31	9	SNP	0.159	T
OXSR1	9943	genome.wustl.edu	37	3	38224558	38224558	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr3:38224558C>G	ENST00000446845.1	+	2	507	c.135C>G	c.(133-135)atC>atG	p.I45M	OXSR1_ENST00000311806.3_Missense_Mutation_p.I45M					oxidative stress responsive 1											skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		AAGTGGCAATCAAACGGATAA	0.368																																						dbGAP											0													97.0	91.0	93.0					3																	38224558		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB017642	CCDS2675.1	3p22.2	2013-05-17	2013-05-17	2004-11-26	ENSG00000172939	ENSG00000172939			8508	protein-coding gene	gene with protein product		604046	"""oxidative-stress responsive 1"""	OSR1		10083736	Standard	XM_005265638		Approved	KIAA1101	uc003chy.3	O95747	OTTHUMG00000131084	ENST00000446845.1:c.135C>G	3.37:g.38224558C>G	ENSP00000415851:p.Ile45Met			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.I45M	ENST00000446845.1	37	c.135		3	.	.	.	.	.	.	.	.	.	.	C	17.52	3.410538	0.62399	.	.	ENSG00000172939	ENST00000446845;ENST00000311806	T;T	0.26373	1.74;1.74	5.2	4.31	0.51392	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.42630	0.1211	M	0.64630	1.985	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.28299	-1.0048	9	.	.	.	-11.9967	6.5814	0.22596	0.3231:0.5936:0.0:0.0832	.	45	O95747	OXSR1_HUMAN	M	45	ENSP00000415851:I45M;ENSP00000311713:I45M	.	I	+	3	3	OXSR1	38199562	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	0.347000	0.20014	1.313000	0.45069	0.655000	0.94253	ATC	OXSR1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000172939		0.368	OXSR1-004	NOVEL	basic|exp_conf	protein_coding	OXSR1	HGNC	protein_coding	OTTHUMT00000342708.1	94	0.00	0	C	NM_005109		38224558	38224558	+1	no_errors	ENST00000311806	ensembl	human	known	69_37n	missense	101	24.63	33	SNP	1.000	G
PAPOLA	10914	genome.wustl.edu	37	14	97003383	97003383	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr14:97003383C>A	ENST00000216277.8	+	12	1321	c.1101C>A	c.(1099-1101)ttC>ttA	p.F367L	PAPOLA_ENST00000392990.2_Missense_Mutation_p.F367L	NM_032632.4	NP_116021.2	P51003	PAPOA_HUMAN	poly(A) polymerase alpha	367					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|RNA polyadenylation (GO:0043631)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		CTCCAAACTTCTTTCAAAAGT	0.343																																					NSCLC(19;254 734 11908 35501 39234)	dbGAP											0													85.0	82.0	83.0					14																	97003383		2203	4300	6503	-	-	-	SO:0001583	missense	0			X76770	CCDS9946.1, CCDS58334.1, CCDS58335.1	14q32.1-q32.2	2008-02-08				ENSG00000090060	2.7.7.19		14981	protein-coding gene	gene with protein product		605553				8302877, 10429366	Standard	NM_032632		Approved	PAP	uc001yfq.3	P51003		ENST00000216277.8:c.1101C>A	14.37:g.97003383C>A	ENSP00000216277:p.Phe367Leu		Q86SX4|Q86TV0|Q8IYF5|Q9BVU2	Missense_Mutation	SNP	pfam_PolA_pol_cen_dom,pfam_PolA_pol_RNA-bd_dom,pfam_Nucleotidyltransferase,superfamily_NuclTrfase_I_C,pirsf_PolyA_polymerase	p.F367L	ENST00000216277.8	37	c.1101	CCDS9946.1	14	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415458	0.83449	.	.	ENSG00000090060	ENST00000216277;ENST00000546064;ENST00000392990;ENST00000555626	.	.	.	5.01	5.01	0.66863	Poly(A) polymerase, RNA-binding domain (2);Nucleotidyltransferase, class I, C-terminal-like (1);	0.000000	0.85682	D	0.000000	D	0.87107	0.6095	M	0.94142	3.5	0.80722	D	1	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.79108	0.987;0.987;0.992	D	0.90621	0.4559	9	0.66056	D	0.02	.	18.6891	0.91576	0.0:1.0:0.0:0.0	.	383;383;367	F5H5I8;B4DYF4;P51003	.;.;PAPOA_HUMAN	L	367;383;367;117	.	ENSP00000216277:F367L	F	+	3	2	PAPOLA	96073136	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.921000	0.56454	2.473000	0.83533	0.650000	0.86243	TTC	PAPOLA	-	pfam_PolA_pol_RNA-bd_dom,superfamily_NuclTrfase_I_C,pirsf_PolyA_polymerase	ENSG00000090060		0.343	PAPOLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPOLA	HGNC	protein_coding	OTTHUMT00000413411.2	105	0.94	1	C			97003383	97003383	+1	no_errors	ENST00000216277	ensembl	human	known	69_37n	missense	133	18.90	31	SNP	1.000	A
PCDHGA4	56111	genome.wustl.edu	37	5	140735310	140735310	+	Silent	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr5:140735310C>T	ENST00000571252.1	+	1	543	c.543C>T	c.(541-543)gaC>gaT	p.D181D	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	181	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTCCCTGGACGTGCAAAGTG	0.547																																						dbGAP											0													40.0	42.0	42.0					5																	140735310		2110	4247	6357	-	-	-	SO:0001819	synonymous_variant	0			AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.543C>T	5.37:g.140735310C>T			Q9Y5D3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D181	ENST00000571252.1	37	c.543	CCDS58979.1	5																																																																																			PCDHGA4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000262576		0.547	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA4	HGNC	protein_coding	OTTHUMT00000437959.1	45	0.00	0	C	NM_018917		140735310	140735310	+1	no_errors	ENST00000571252	ensembl	human	known	69_37n	silent	42	25.00	14	SNP	0.002	T
PPEF2	5470	genome.wustl.edu	37	4	76804229	76804229	+	Splice_Site	SNP	C	C	G			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr4:76804229C>G	ENST00000286719.7	-	10	1140		c.e10-1			NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2						detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TCCCGTGTACCTGGAAAAAAT	0.373																																					NSCLC(105;1359 1603 15961 44567 47947)	dbGAP											0													102.0	101.0	101.0					4																	76804229		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.784-1G>C	4.37:g.76804229C>G			O14831	Splice_Site	SNP	-	e9-1	ENST00000286719.7	37	c.784-1	CCDS34013.1	4	.	.	.	.	.	.	.	.	.	.	C	16.57	3.159622	0.57368	.	.	ENSG00000156194	ENST00000286719;ENST00000337500	.	.	.	3.91	3.91	0.45181	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8048	0.63223	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PPEF2	77023253	1.000000	0.71417	0.135000	0.22099	0.473000	0.32948	7.019000	0.76412	2.180000	0.69256	0.655000	0.94253	.	PPEF2	-	-	ENSG00000156194		0.373	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF2	HGNC	protein_coding	OTTHUMT00000362929.1	140	0.00	0	C	NM_006239	Intron	76804229	76804229	-1	no_errors	ENST00000286719	ensembl	human	known	69_37n	splice_site	171	18.18	38	SNP	0.999	G
PPP4R4	57718	genome.wustl.edu	37	14	94718122	94718122	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr14:94718122G>A	ENST00000304338.3	+	16	1908	c.1754G>A	c.(1753-1755)cGa>cAa	p.R585Q		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	585					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						AATAGACTTCGATTTTTGGAT	0.279																																						dbGAP											0													55.0	61.0	59.0					14																	94718122		2199	4290	6489	-	-	-	SO:0001583	missense	0			AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.1754G>A	14.37:g.94718122G>A	ENSP00000305924:p.Arg585Gln		Q9BUF8|Q9HCF0	Missense_Mutation	SNP	superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.R585Q	ENST00000304338.3	37	c.1754	CCDS9921.1	14	.	.	.	.	.	.	.	.	.	.	G	34	5.338588	0.95783	.	.	ENSG00000119698	ENST00000304338	T	0.35048	1.33	5.72	5.72	0.89469	Armadillo-like helical (1);Armadillo-type fold (1);	0.054481	0.64402	D	0.000001	T	0.53753	0.1816	M	0.63428	1.95	0.80722	D	1	D	0.67145	0.996	P	0.55615	0.78	T	0.52003	-0.8633	10	0.52906	T	0.07	-11.4773	19.8599	0.96779	0.0:0.0:1.0:0.0	.	585	Q6NUP7	PP4R4_HUMAN	Q	585	ENSP00000305924:R585Q	ENSP00000305924:R585Q	R	+	2	0	PPP4R4	93787875	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.755000	0.91646	2.696000	0.92011	0.462000	0.41574	CGA	PPP4R4	-	superfamily_ARM-type_fold	ENSG00000119698		0.279	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP4R4	HGNC	protein_coding	OTTHUMT00000413056.1	87	0.00	0	G	NM_058237		94718122	94718122	+1	no_errors	ENST00000304338	ensembl	human	known	69_37n	missense	90	15.09	16	SNP	1.000	A
PROM1	8842	genome.wustl.edu	37	4	15981063	15981064	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr4:15981063_15981064insA	ENST00000510224.1	-	26	2784_2785	c.2536_2537insT	c.(2536-2538)tatfs	p.Y846fs	PROM1_ENST00000539194.1_Intron|PROM1_ENST00000543373.1_Intron|PROM1_ENST00000540805.1_Intron|PROM1_ENST00000447510.2_Frame_Shift_Ins_p.Y846fs|PROM1_ENST00000508167.1_Frame_Shift_Ins_p.Y837fs|PROM1_ENST00000505450.1_Frame_Shift_Ins_p.Y837fs			O43490	PROM1_HUMAN	prominin 1	846					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						ATCTTTATGATAACCATTATTA	0.347																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.2537dupT	4.37:g.15981065_15981065dupA	ENSP00000426809:p.Tyr846fs		Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Frame_Shift_Ins	INS	pfam_Prominin	p.Y846fs	ENST00000510224.1	37	c.2537_2536	CCDS47029.1	4																																																																																			PROM1	-	NULL	ENSG00000007062		0.347	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PROM1	HGNC	protein_coding	OTTHUMT00000359595.2	86	0.00	0	-	NM_006017		15981063	15981064	-1	no_errors	ENST00000447510	ensembl	human	known	69_37n	frame_shift_ins	81	38.17	50	INS	1.000:1.000	A
RNA5-8SP2	100873571	genome.wustl.edu	37	16	33965518	33965518	+	RNA	SNP	G	G	A	rs483066		TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr16:33965518G>A	ENST00000363564.1	+	0	93									RNA, 5.8S ribosomal pseudogene 2																		ATTGATCATCGACACTTCGAA	0.557																																						dbGAP											0																																										-	-	-			0					16p11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000200434	ENSG00000200434			41956	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 2"""	RN5-8S2			Standard	NG_033434		Approved						16.37:g.33965518G>A				RNA	SNP	-	NULL	ENST00000363564.1	37	NULL		16																																																																																			RNA5-8SP2	-	-	ENSG00000200434		0.557	RNA5-8SP2-201	KNOWN	basic	rRNA	RNA5-8SP2	HGNC	rRNA		43	0.00	0	G			33965518	33965518	+1	no_errors	ENST00000363564	ensembl	human	known	69_37n	rna	55	15.15	10	SNP	1.000	A
RRAGD	58528	genome.wustl.edu	37	6	90097153	90097153	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr6:90097153C>T	ENST00000369415.4	-	2	581	c.305G>A	c.(304-306)cGg>cAg	p.R102Q	RRAGD_ENST00000492783.1_5'UTR|RRAGD_ENST00000359203.3_Intron	NM_021244.4	NP_067067.1			Ras-related GTP binding D									p.R102L(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(2)	15		all_cancers(76;7.01e-07)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00139)		BRCA - Breast invasive adenocarcinoma(108;0.0144)		AACATCTTCCCGGCATATCTT	0.428																																						dbGAP											1	Substitution - Missense(1)	lung(1)											157.0	172.0	167.0					6																	90097153		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF272036	CCDS5022.1	6q15-q16	2008-02-05			ENSG00000025039	ENSG00000025039			19903	protein-coding gene	gene with protein product		608268				11073942	Standard	NM_021244		Approved	DKFZP761H171, bA11D8.2.1	uc003pnd.4	Q9NQL2	OTTHUMG00000015200	ENST00000369415.4:c.305G>A	6.37:g.90097153C>T	ENSP00000358423:p.Arg102Gln			Missense_Mutation	SNP	pfam_Gtr1_RagA,pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su	p.R102Q	ENST00000369415.4	37	c.305	CCDS5022.1	6	.	.	.	.	.	.	.	.	.	.	C	19.21	3.783719	0.70222	.	.	ENSG00000025039	ENST00000369415	D	0.82167	-1.58	5.71	5.71	0.89125	.	0.095824	0.64402	D	0.000001	T	0.62588	0.2440	N	0.20483	0.58	0.80722	D	1	B	0.33549	0.417	B	0.21917	0.037	T	0.65578	-0.6134	10	0.37606	T	0.19	-12.4484	19.8632	0.96793	0.0:1.0:0.0:0.0	.	102	Q9NQL2	RRAGD_HUMAN	Q	102	ENSP00000358423:R102Q	ENSP00000358423:R102Q	R	-	2	0	RRAGD	90153872	0.997000	0.39634	1.000000	0.80357	0.968000	0.65278	1.710000	0.37920	2.699000	0.92147	0.655000	0.94253	CGG	RRAGD	-	pfam_Gtr1_RagA,pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su	ENSG00000025039		0.428	RRAGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRAGD	HGNC	protein_coding	OTTHUMT00000041484.1	77	0.00	0	C	NM_021244		90097153	90097153	-1	no_errors	ENST00000369415	ensembl	human	known	69_37n	missense	72	20.00	18	SNP	1.000	T
SH3GL2	6456	genome.wustl.edu	37	9	17761476	17761476	+	Silent	SNP	T	T	A			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr9:17761476T>A	ENST00000380607.4	+	3	276	c.156T>A	c.(154-156)acT>acA	p.T52T	SH3GL2_ENST00000537391.1_Silent_p.T5T	NM_003026.2	NP_003017.1	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	52	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.|Binds and tubulates liposomes. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of receptor internalization (GO:0002090)|signal transduction (GO:0007165)|synaptic vesicle endocytosis (GO:0048488)	clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		AAATAATGACTAAAACAATTG	0.358																																						dbGAP											0													118.0	114.0	116.0					9																	17761476		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X99657	CCDS6483.1	9p22	2008-02-05			ENSG00000107295	ENSG00000107295			10831	protein-coding gene	gene with protein product		604465				9169142	Standard	XM_005251549		Approved	SH3P4, SH3D2A, CNSA2, EEN-B1	uc003zna.3	Q99962	OTTHUMG00000019601	ENST00000380607.4:c.156T>A	9.37:g.17761476T>A			B2R618|Q9NQK5	Silent	SNP	pfam_BAR_dom,pfam_SH3_2,pfam_SH3_domain,pfam_BAR_dom-cont,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,prints_SH3_domain,prints_Spectrin_alpha_SH3	p.T52	ENST00000380607.4	37	c.156	CCDS6483.1	9																																																																																			SH3GL2	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000107295		0.358	SH3GL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GL2	HGNC	protein_coding	OTTHUMT00000051796.1	51	0.00	0	T	NM_003026		17761476	17761476	+1	no_errors	ENST00000380607	ensembl	human	known	69_37n	silent	82	26.13	29	SNP	0.920	A
SLC39A12	221074	genome.wustl.edu	37	10	18289724	18289724	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr10:18289724A>G	ENST00000377369.2	+	11	2002	c.1729A>G	c.(1729-1731)Atc>Gtc	p.I577V	SLC39A12_ENST00000377374.4_Missense_Mutation_p.I540V|SLC39A12_ENST00000377371.3_Missense_Mutation_p.I576V|SLC39A12-AS1_ENST00000445287.1_RNA|SLC39A12_ENST00000539911.1_Missense_Mutation_p.I443V|SLC39A12-AS1_ENST00000439319.1_RNA	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	577					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						TACGATTGCTATCTTGTGTCA	0.438																																						dbGAP											0													125.0	105.0	111.0					10																	18289724		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1729A>G	10.37:g.18289724A>G	ENSP00000366586:p.Ile577Val		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	pfam_ZIP	p.I577V	ENST00000377369.2	37	c.1729	CCDS44362.1	10	.	.	.	.	.	.	.	.	.	.	A	15.41	2.824550	0.50739	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	5.62	4.49	0.54785	.	0.045428	0.85682	N	0.000000	T	0.43100	0.1232	N	0.16743	0.435	0.54753	D	0.999982	D;P;D	0.89917	1.0;0.699;0.999	D;P;D	0.85130	0.997;0.759;0.997	T	0.20672	-1.0268	10	0.11182	T	0.66	-17.2681	11.662	0.51352	0.9305:0.0:0.0695:0.0	.	576;577;540	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	V	577;540;576;443;497	ENSP00000366586:I577V;ENSP00000366591:I540V;ENSP00000366588:I576V;ENSP00000440445:I443V	ENSP00000366586:I577V	I	+	1	0	SLC39A12	18329730	1.000000	0.71417	0.991000	0.47740	0.831000	0.47069	6.262000	0.72514	1.080000	0.41073	0.533000	0.62120	ATC	SLC39A12	-	pfam_ZIP	ENSG00000148482		0.438	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC39A12	HGNC	protein_coding		90	0.00	0	A	NM_152725		18289724	18289724	+1	no_errors	ENST00000377369	ensembl	human	known	69_37n	missense	92	60.00	138	SNP	1.000	G
SMARCAD1	56916	genome.wustl.edu	37	4	95162063	95162063	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr4:95162063G>C	ENST00000354268.4	+	6	684	c.611G>C	c.(610-612)gGg>gCg	p.G204A	SMARCAD1_ENST00000457823.2_Missense_Mutation_p.G204A			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	204					ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		AAAGGTGGTGGGCCCAGGAAA	0.318																																						dbGAP											0													62.0	64.0	64.0					4																	95162063		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.611G>C	4.37:g.95162063G>C	ENSP00000346217:p.Gly204Ala		B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_UBA-like,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_CUE,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G204A	ENST00000354268.4	37	c.611	CCDS3639.1	4	.	.	.	.	.	.	.	.	.	.	G	7.474	0.647323	0.14516	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000536267;ENST00000354268	T;T;T	0.08282	3.11;3.11;3.11	5.11	3.26	0.37387	.	0.373012	0.19707	N	0.107906	T	0.03739	0.0106	N	0.12182	0.205	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.36866	-0.9730	10	0.08179	T	0.78	-15.7265	7.3398	0.26630	0.0:0.1825:0.6288:0.1887	.	204;204	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	A	204	ENSP00000351947:G204A;ENSP00000415576:G204A;ENSP00000346217:G204A	ENSP00000346217:G204A	G	+	2	0	SMARCAD1	95381086	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.860000	0.39428	2.530000	0.85305	0.585000	0.79938	GGG	SMARCAD1	-	NULL	ENSG00000163104		0.318	SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMARCAD1	HGNC	protein_coding	OTTHUMT00000253583.1	100	0.00	0	G	NM_020159		95162063	95162063	+1	no_errors	ENST00000359052	ensembl	human	known	69_37n	missense	94	24.80	31	SNP	1.000	C
SNN	8303	genome.wustl.edu	37	16	11769936	11769936	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr16:11769936C>A	ENST00000329565.5	+	2	233	c.21C>A	c.(19-21)agC>agA	p.S7R		NM_003498.5	NP_003489.1	O75324	SNN_HUMAN	stannin	7					response to abiotic stimulus (GO:0009628)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)				endometrium(1)	1						TGGACCACAGCCCCACCACGG	0.642																																						dbGAP											0													50.0	44.0	46.0					16																	11769936		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF030196	CCDS10549.1	16p13	2008-02-05			ENSG00000184602	ENSG00000184602			11149	protein-coding gene	gene with protein product		603032				9657854	Standard	NM_003498		Approved		uc002dbf.3	O75324	OTTHUMG00000090535	ENST00000329565.5:c.21C>A	16.37:g.11769936C>A	ENSP00000329287:p.Ser7Arg		D3DUG4|Q6FGI0	Missense_Mutation	SNP	pfam_SNN_transmemb,pfam_SNN_linker,pfam_SNN_cytoplasm	p.S7R	ENST00000329565.5	37	c.21	CCDS10549.1	16	.	.	.	.	.	.	.	.	.	.	C	11.63	1.695436	0.30052	.	.	ENSG00000184602	ENST00000329565	T	0.55234	0.53	5.48	3.54	0.40534	Stannin transmembrane (1);	0.048273	0.85682	D	0.000000	T	0.43122	0.1233	.	.	.	0.54753	D	0.999985	B	0.21688	0.059	B	0.21917	0.037	T	0.35425	-0.9789	9	0.72032	D	0.01	-38.8167	8.5002	0.33152	0.0:0.7663:0.0:0.2337	.	7	O75324	SNN_HUMAN	R	7	ENSP00000329287:S7R	ENSP00000329287:S7R	S	+	3	2	SNN	11677437	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.421000	0.44688	0.683000	0.31428	0.561000	0.74099	AGC	SNN	-	pfam_SNN_transmemb	ENSG00000184602		0.642	SNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNN	HGNC	protein_coding	OTTHUMT00000207059.1	40	0.00	0	C	NM_003498		11769936	11769936	+1	no_errors	ENST00000329565	ensembl	human	known	69_37n	missense	30	25.00	10	SNP	1.000	A
SYNE1	23345	genome.wustl.edu	37	6	152861142	152861142	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr6:152861142C>G	ENST00000367255.5	-	4	683	c.82G>C	c.(82-84)Gta>Cta	p.V28L	SYNE1_ENST00000448038.1_Missense_Mutation_p.V28L|SYNE1_ENST00000265368.4_Missense_Mutation_p.V28L|SYNE1_ENST00000341594.5_Missense_Mutation_p.V28L|SYNE1_ENST00000466159.2_Missense_Mutation_p.V28L|SYNE1_ENST00000367248.3_Missense_Mutation_p.V28L|SYNE1_ENST00000423061.1_Missense_Mutation_p.V28L|SYNE1_ENST00000413186.2_Missense_Mutation_p.V28L|SYNE1_ENST00000367253.4_Missense_Mutation_p.V28L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	28	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CGTTTTTGTACTATCTCTTGC	0.343										HNSCC(10;0.0054)																												dbGAP											0													217.0	208.0	211.0					6																	152861142		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.82G>C	6.37:g.152861142C>G	ENSP00000356224:p.Val28Leu		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.V28L	ENST00000367255.5	37	c.82	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	23.5	4.419005	0.83559	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	D;D;D;D;D;D;D;D;D;D	0.95656	-3.77;-3.77;-3.77;-3.77;-3.77;-3.77;-3.77;-3.77;-3.77;-3.77	5.36	5.36	0.76844	Calponin homology domain (3);	0.000000	0.39909	N	0.001223	D	0.97607	0.9216	M	0.84219	2.685	0.80722	D	1	D;D;D;D;D	0.89917	0.991;1.0;1.0;1.0;1.0	P;D;D;D;D	0.83275	0.858;0.991;0.996;0.991;0.996	D	0.97845	1.0271	10	0.62326	D	0.03	.	16.9363	0.86203	0.0:1.0:0.0:0.0	.	28;28;28;28;28	B3W695;Q8NF91;F5H4Q0;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	L	28	ENSP00000356224:V28L;ENSP00000396024:V28L;ENSP00000265368:V28L;ENSP00000390975:V28L;ENSP00000341887:V28L;ENSP00000356222:V28L;ENSP00000356217:V28L;ENSP00000414510:V28L;ENSP00000446021:V28L;ENSP00000441264:V28L	ENSP00000265368:V28L	V	-	1	0	SYNE1	152902835	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.762000	0.68809	2.669000	0.90835	0.655000	0.94253	GTA	SYNE1	-	superfamily_CH-domain,pfscan_CH-domain	ENSG00000131018		0.343	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	171	0.00	0	C	NM_182961		152861142	152861142	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	187	15.77	35	SNP	1.000	G
TACC3	10460	genome.wustl.edu	37	4	1737522	1737522	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr4:1737522G>T	ENST00000313288.4	+	8	1815	c.1709G>T	c.(1708-1710)aGt>aTt	p.S570I		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	570					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			CTGAGGGACAGTCCTGGTAGA	0.587																																					Ovarian(120;482 2294 11894 35824)	dbGAP											0													121.0	100.0	107.0					4																	1737522		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.1709G>T	4.37:g.1737522G>T	ENSP00000326550:p.Ser570Ile		Q2NKK4|Q3KQS5|Q9UMQ1	Missense_Mutation	SNP	pfam_TACC	p.S570I	ENST00000313288.4	37	c.1709	CCDS3352.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	17.91|17.91	3.504697|3.504697	0.64410|0.64410	.|.	.|.	ENSG00000013810|ENSG00000013810	ENST00000470136|ENST00000313288	.|T	.|0.26810	.|1.71	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	.|0.220422	.|0.31438	.|N	.|0.007641	T|T	0.54175|0.54175	0.1842|0.1842	M|M	0.76838|0.76838	2.35|2.35	0.80722|0.80722	D|D	1|1	.|D;P	.|0.89917	.|1.0;0.821	.|D;P	.|0.87578	.|0.998;0.645	T|T	0.54984|0.54984	-0.8211|-0.8211	5|9	.|.	.|.	.|.	-22.4576|-22.4576	18.5091|18.5091	0.90909|0.90909	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|570;570	.|B4DYJ1;Q9Y6A5	.|.;TACC3_HUMAN	H|I	206|570	.|ENSP00000326550:S570I	.|.	Q|S	+|+	3|2	2|0	TACC3|TACC3	1707320|1707320	1.000000|1.000000	0.71417|0.71417	0.897000|0.897000	0.35233|0.35233	0.016000|0.016000	0.09150|0.09150	8.911000|8.911000	0.92721|0.92721	2.465000|2.465000	0.83290|0.83290	0.645000|0.645000	0.84053|0.84053	CAG|AGT	TACC3	-	NULL	ENSG00000013810		0.587	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACC3	HGNC	protein_coding	OTTHUMT00000203730.2	49	0.00	0	G			1737522	1737522	+1	no_errors	ENST00000313288	ensembl	human	known	69_37n	missense	43	29.51	18	SNP	1.000	T
TCHHL1	126637	genome.wustl.edu	37	1	152059455	152059455	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr1:152059455C>T	ENST00000368806.1	-	3	767	c.703G>A	c.(703-705)Gga>Aga	p.G235R		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	235							calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			GGTTCATCTCCTTCCTGGGAG	0.463																																						dbGAP											0													147.0	132.0	137.0					1																	152059455		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.703G>A	1.37:g.152059455C>T	ENSP00000357796:p.Gly235Arg		B2RPK8|Q5VTJ9	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub	p.G235R	ENST00000368806.1	37	c.703	CCDS30857.1	1	.	.	.	.	.	.	.	.	.	.	.	7.224	0.597914	0.13939	.	.	ENSG00000182898	ENST00000368806	T	0.23552	1.9	5.1	1.06	0.20224	.	1.117940	0.06958	N	0.815852	T	0.05044	0.0135	N	0.20685	0.6	0.09310	N	1	B	0.10296	0.003	B	0.12837	0.008	T	0.44097	-0.9350	10	0.21540	T	0.41	-0.2948	7.589	0.28010	0.0:0.6391:0.0:0.3609	.	235	Q5QJ38	TCHL1_HUMAN	R	235	ENSP00000357796:G235R	ENSP00000357796:G235R	G	-	1	0	TCHHL1	150326079	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.019000	0.13444	-0.062000	0.13088	-0.252000	0.11476	GGA	TCHHL1	-	NULL	ENSG00000182898		0.463	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHHL1	HGNC	protein_coding	OTTHUMT00000036638.2	129	0.77	1	C	XM_060104		152059455	152059455	-1	no_errors	ENST00000368806	ensembl	human	known	69_37n	missense	261	43.38	200	SNP	0.000	T
TEC	7006	genome.wustl.edu	37	4	48148341	48148341	+	Splice_Site	SNP	C	C	A			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr4:48148341C>A	ENST00000381501.3	-	12	1239		c.e12+1		TEC_ENST00000511471.2_Splice_Site	NM_003215.2	NP_003206.2	P42680	TEC_HUMAN	tec protein tyrosine kinase						B cell receptor signaling pathway (GO:0050853)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of platelet activation (GO:0010543)|tissue regeneration (GO:0042246)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31						ATAAGAGTTACCATAGCTGAA	0.398																																						dbGAP											0													149.0	141.0	144.0					4																	48148341		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			D29767	CCDS3481.1	4p12	2013-02-14			ENSG00000135605	ENSG00000135605		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	11719	protein-coding gene	gene with protein product		600583				7934162	Standard	NM_003215		Approved	PSCTK4	uc003gxz.3	P42680	OTTHUMG00000128623	ENST00000381501.3:c.1081+1G>T	4.37:g.48148341C>A			B7ZKZ6|Q3MIS5	Splice_Site	SNP	-	e11+1	ENST00000381501.3	37	c.1081+1	CCDS3481.1	4	.	.	.	.	.	.	.	.	.	.	C	16.60	3.169491	0.57584	.	.	ENSG00000135605	ENST00000381501	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3599	0.94432	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TEC	47843098	1.000000	0.71417	1.000000	0.80357	0.523000	0.34469	7.116000	0.77119	2.646000	0.89796	0.655000	0.94253	.	TEC	-	-	ENSG00000135605		0.398	TEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEC	HGNC	protein_coding	OTTHUMT00000250492.3	62	0.00	0	C		Intron	48148341	48148341	-1	no_errors	ENST00000381501	ensembl	human	known	69_37n	splice_site	122	14.69	21	SNP	1.000	A
TFAP2E	339488	genome.wustl.edu	37	1	36054084	36054084	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr1:36054084G>A	ENST00000373235.3	+	4	924	c.716G>A	c.(715-717)gGg>gAg	p.G239E		NM_178548.3	NP_848643.2			transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)											endometrium(1)|large_intestine(1)	2		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				GTGACGGTGGGGGAGGTGCAG	0.657																																						dbGAP											0													111.0	100.0	104.0					1																	36054084		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC041175	CCDS393.2	1p34.3	2008-02-05			ENSG00000116819	ENSG00000116819			30774	protein-coding gene	gene with protein product		614428				14636996	Standard	NM_178548		Approved	AP2E	uc010ohy.2	Q6VUC0	OTTHUMG00000004388	ENST00000373235.3:c.716G>A	1.37:g.36054084G>A	ENSP00000362332:p.Gly239Glu			Missense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_C	p.G239E	ENST00000373235.3	37	c.716	CCDS393.2	1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.744109	0.89663	.	.	ENSG00000116819	ENST00000373235	D	0.96041	-3.89	5.8	4.88	0.63580	Transcription factor AP-2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94765	0.8310	L	0.59912	1.85	0.80722	D	1	P	0.34757	0.467	B	0.40901	0.343	D	0.94861	0.8022	10	0.87932	D	0	-16.6341	15.2783	0.73760	0.0683:0.0:0.9317:0.0	.	239	Q6VUC0	AP2E_HUMAN	E	239	ENSP00000362332:G239E	ENSP00000362332:G239E	G	+	2	0	TFAP2E	35826671	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.936000	0.56568	2.747000	0.94245	0.462000	0.41574	GGG	TFAP2E	-	pfam_TF_AP2_C	ENSG00000116819		0.657	TFAP2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2E	HGNC	protein_coding	OTTHUMT00000012732.1	35	0.00	0	G	NM_178548		36054084	36054084	+1	no_errors	ENST00000373235	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577610	7577610	+	Splice_Site	SNP	T	T	C			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr17:7577610T>C	ENST00000269305.4	-	7	862		c.e7-2		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(43)|p.0?(8)|p.V225fs*24(1)|p.E224_V225insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGAGCCAACCTAGGAGATAAC	0.522		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	53	Unknown(43)|Whole gene deletion(8)|Insertion - In frame(1)|Insertion - Frameshift(1)	lung(16)|liver(7)|upper_aerodigestive_tract(5)|biliary_tract(5)|ovary(5)|breast(4)|bone(4)|central_nervous_system(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|urinary_tract(1)|oesophagus(1)											88.0	74.0	79.0					17																	7577610		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.673-2A>G	17.37:g.7577610T>C			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e6-2	ENST00000269305.4	37	c.673-2	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	17.76	3.468043	0.63625	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	3.35	3.35	0.38373	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3302	0.43818	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7518335	1.000000	0.71417	0.324000	0.25361	0.557000	0.35523	7.634000	0.83273	1.750000	0.51863	0.379000	0.24179	.	TP53	-	-	ENSG00000141510		0.522	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	67	0.00	0	T	NM_000546	Intron	7577610	7577610	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	splice_site	26	49.02	25	SNP	0.999	C
USH2A	7399	genome.wustl.edu	37	1	215814011	215814011	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr1:215814011C>T	ENST00000307340.3	-	68	15243	c.14857G>A	c.(14857-14859)Gac>Aac	p.D4953N	USH2A_ENST00000366943.2_Missense_Mutation_p.D4953N	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4953					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGGAAGGTGTCACTCCAGTTC	0.532										HNSCC(13;0.011)																												dbGAP											0													142.0	115.0	124.0					1																	215814011		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.14857G>A	1.37:g.215814011C>T	ENSP00000305941:p.Asp4953Asn		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.D4953N	ENST00000307340.3	37	c.14857	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	5.446	0.267421	0.10294	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.12039	2.73;2.72	5.42	1.18	0.20946	Fibronectin, type III (1);	0.915855	0.09066	N	0.853646	T	0.04588	0.0125	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45629	-0.9248	10	0.10377	T	0.69	.	6.1997	0.20569	0.0:0.458:0.2115:0.3305	.	4953	O75445	USH2A_HUMAN	N	4953	ENSP00000305941:D4953N;ENSP00000355910:D4953N	ENSP00000305941:D4953N	D	-	1	0	USH2A	213880634	0.000000	0.05858	0.000000	0.03702	0.199000	0.23934	0.168000	0.16622	-0.028000	0.13850	-0.126000	0.14955	GAC	USH2A	-	NULL	ENSG00000042781		0.532	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	82	0.00	0	C	NM_007123		215814011	215814011	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	68	36.45	39	SNP	0.000	T
VIMP	55829	genome.wustl.edu	37	15	101813007	101813007	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr15:101813007C>T	ENST00000398226.3	-	6	571	c.539G>A	c.(538-540)cGc>cAc	p.R180H	VIMP_ENST00000526049.1_Missense_Mutation_p.R180H|VIMP_ENST00000537379.1_Missense_Mutation_p.R180H|VIMP_ENST00000531964.1_Missense_Mutation_p.R157H			Q9BQE4	SELS_HUMAN	VCP-interacting membrane protein	180					cell redox homeostasis (GO:0045454)|cellular response to insulin stimulus (GO:0032869)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oxidative stress (GO:0034599)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|negative regulation of acute inflammatory response to antigenic stimulus (GO:0002865)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of tumor necrosis factor production (GO:0032720)|regulation of gluconeogenesis (GO:0006111)|regulation of nitric oxide metabolic process (GO:0080164)|response to glucose (GO:0009749)|response to redox state (GO:0051775)|retrograde protein transport, ER to cytosol (GO:0030970)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|enzyme binding (GO:0019899)|receptor activity (GO:0004872)|selenium binding (GO:0008430)										CGGGCCTCTGCGTCCAGGTCT	0.483																																						dbGAP											0													36.0	37.0	37.0					15																	101813007		1943	4141	6084	-	-	-	SO:0001583	missense	0			AF328864	CCDS53979.1	15q26.3	2012-10-02			ENSG00000131871	ENSG00000131871			30396	protein-coding gene	gene with protein product	"""selenoprotein S"""	607918				16227999, 16186510	Standard	NM_018445		Approved	SELS, MGC2553, SBBI8, AD-015, SEPS1	uc021sxu.1	Q9BQE4	OTTHUMG00000166441	ENST00000398226.3:c.539G>A	15.37:g.101813007C>T	ENSP00000381282:p.Arg180His		Q3B771|Q9P0I6	Missense_Mutation	SNP	pfam_Selenoprotein_S	p.R180H	ENST00000398226.3	37	c.539	CCDS53979.1	15	.	.	.	.	.	.	.	.	.	.	C	24.6	4.549532	0.86127	.	.	ENSG00000131871	ENST00000398226;ENST00000537379;ENST00000531964;ENST00000526049	.	.	.	5.71	5.71	0.89125	.	0.051958	0.85682	D	0.000000	D	0.83046	0.5169	M	0.80422	2.495	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.73380	0.98;0.98	D	0.84637	0.0693	9	0.72032	D	0.01	-16.2732	18.4217	0.90592	0.0:1.0:0.0:0.0	.	180;180	Q6GYA4;Q9BQE4	.;SELS_HUMAN	H	180;180;157;180	.	ENSP00000381282:R180H	R	-	2	0	AC023024.1	99630530	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.134000	0.57990	2.687000	0.91594	0.655000	0.94253	CGC	VIMP	-	pfam_Selenoprotein_S	ENSG00000131871		0.483	VIMP-001	KNOWN	basic|appris_candidate_longest|CCDS|seleno	protein_coding	VIMP	HGNC	protein_coding	OTTHUMT00000389784.2	42	0.00	0	C	NM_018445		101813007	101813007	-1	no_errors	ENST00000537379	ensembl	human	known	69_37n	missense	31	29.55	13	SNP	1.000	T
YIPF6	286451	genome.wustl.edu	37	X	67738655	67738655	+	Splice_Site	SNP	G	G	T			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chrX:67738655G>T	ENST00000462683.1	+	4	1052		c.e4+1		YIPF6_ENST00000374622.2_Splice_Site	NM_173834.3	NP_776195.2	Q96EC8	YIPF6_HUMAN	Yip1 domain family, member 6						intestinal epithelial cell development (GO:0060576)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(1)	7						CACTCGCATTGTAAGTACTTG	0.353																																						dbGAP											0													309.0	266.0	280.0					X																	67738655		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC012469	CCDS14389.1, CCDS56604.1	Xq13.1	2008-02-05			ENSG00000181704	ENSG00000181704		"""Yip1 domain family"""	28304	protein-coding gene	gene with protein product						12477932	Standard	NM_173834		Approved	MGC21416, FinGER6	uc004dwz.3	Q96EC8	OTTHUMG00000021745	ENST00000462683.1:c.308+1G>T	X.37:g.67738655G>T			B4E1U7|G5E997|Q5JP08	Splice_Site	SNP	-	e4+1	ENST00000462683.1	37	c.308+1	CCDS14389.1	X	.	.	.	.	.	.	.	.	.	.	G	23.4	4.417171	0.83449	.	.	ENSG00000181704	ENST00000462683;ENST00000451537;ENST00000374622	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8797	0.79195	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	YIPF6	67655380	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.581000	0.82535	2.348000	0.79779	0.594000	0.82650	.	YIPF6	-	-	ENSG00000181704		0.353	YIPF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YIPF6	HGNC	protein_coding	OTTHUMT00000057016.1	458	0.22	1	G	NM_173834	Intron	67738655	67738655	+1	no_errors	ENST00000462683	ensembl	human	known	69_37n	splice_site	241	36.48	139	SNP	1.000	T
ZNF669	79862	genome.wustl.edu	37	1	247264537	247264537	+	Silent	SNP	C	C	G			TCGA-BH-A1FC-01A-11D-A13L-09	TCGA-BH-A1FC-11A-32D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	84c77098-03d0-4b22-afb1-797703e85c6c	ba3a5382-893d-4365-88cd-b4922f5c070e	g.chr1:247264537C>G	ENST00000343381.6	-	4	706	c.534G>C	c.(532-534)ctG>ctC	p.L178L	ZNF669_ENST00000448299.2_Silent_p.L92L|ZNF669_ENST00000366501.1_3'UTR|ZNF669_ENST00000366500.1_Nonstop_Mutation_p.*72S|ZNF669_ENST00000358785.4_Nonstop_Mutation_p.*158S	NM_024804.2	NP_079080.2	Q96BR6	ZN669_HUMAN	zinc finger protein 669	178					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(4)|large_intestine(2)|lung(6)	17	all_cancers(71;4.09e-05)|all_epithelial(71;6.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0283)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00427)			TGTTCTCGTTCAGATCAAGAT	0.368																																						dbGAP											0													174.0	176.0	175.0					1																	247264537		2184	4288	6472	-	-	-	SO:0001819	synonymous_variant	0				CCDS31088.1, CCDS44345.1	1q44	2013-01-08			ENSG00000188295	ENSG00000188295		"""Zinc fingers, C2H2-type"", ""-"""	25736	protein-coding gene	gene with protein product						12477932	Standard	NM_024804		Approved	FLJ12606	uc001ice.2	Q96BR6	OTTHUMG00000040869	ENST00000343381.6:c.534G>C	1.37:g.247264537C>G			B3KP94|Q5VT39|Q9H9Q6	Nonstop_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.*158S	ENST00000343381.6	37	c.473	CCDS31088.1	1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.471609	0.01044	.	.	ENSG00000188295	ENST00000358785;ENST00000366500	.	.	.	0.719	-1.44	0.08856	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.7505	0.05279	0.2634:0.5066:0.0:0.2301	.	.	.	.	S	158;72	.	.	X	-	2	2	ZNF669	245331160	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-2.826000	0.00746	-1.036000	0.03287	-0.397000	0.06425	TGA	ZNF669	-	NULL	ENSG00000188295		0.368	ZNF669-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF669	HGNC	protein_coding	OTTHUMT00000098394.4	130	0.76	1	C	NM_024804		247264537	247264537	-1	no_errors	ENST00000358785	ensembl	human	known	69_37n	nonstop	266	17.85	58	SNP	0.003	G
