#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA10	10349	genome.wustl.edu	37	17	67188786	67188786	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr17:67188786C>A	ENST00000269081.4	-	17	2698	c.1789G>T	c.(1789-1791)Gta>Tta	p.V597L	ABCA10_ENST00000416101.2_3'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	597	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					GACAGAAATACTTTCCTATCT	0.323																																						dbGAP											0													104.0	111.0	109.0					17																	67188786		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.1789G>T	17.37:g.67188786C>A	ENSP00000269081:p.Val597Leu		C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.V597L	ENST00000269081.4	37	c.1789	CCDS11684.1	17	.	.	.	.	.	.	.	.	.	.	C	17.22	3.335091	0.60853	.	.	ENSG00000154263	ENST00000269081	T	0.62941	-0.01	3.08	3.08	0.35506	ATPase, AAA+ type, core (1);ABC transporter-like (1);	.	.	.	.	T	0.43590	0.1254	N	0.10645	0.015	0.80722	D	1	B;P	0.42692	0.225;0.787	B;B	0.40066	0.168;0.318	T	0.55897	-0.8068	9	0.62326	D	0.03	.	14.6097	0.68507	0.0:1.0:0.0:0.0	.	597;597	E5RFN6;Q8WWZ4	.;ABCAA_HUMAN	L	597	ENSP00000269081:V597L	ENSP00000269081:V597L	V	-	1	0	ABCA10	64700381	1.000000	0.71417	0.826000	0.32828	0.895000	0.52256	6.412000	0.73303	1.724000	0.51502	0.462000	0.41574	GTA	ABCA10	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000154263		0.323	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA10	HGNC	protein_coding	OTTHUMT00000379881.4	473	0.00	0	C	NM_080282		67188786	67188786	-1	no_errors	ENST00000269081	ensembl	human	known	69_37n	missense	155	26.19	55	SNP	1.000	A
AJAP1	55966	genome.wustl.edu	37	1	4832546	4832546	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr1:4832546C>T	ENST00000378191.4	+	4	1505	c.1124C>T	c.(1123-1125)tCg>tTg	p.S375L	AJAP1_ENST00000378190.3_Missense_Mutation_p.S375L	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	375	Targeting signals.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		ACGCTGCACTCGACGACGGGG	0.577																																						dbGAP											0													57.0	54.0	55.0					1																	4832546		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.1124C>T	1.37:g.4832546C>T	ENSP00000367433:p.Ser375Leu		Q9Y229	Missense_Mutation	SNP	NULL	p.S375L	ENST00000378191.4	37	c.1124	CCDS54.1	1	.	.	.	.	.	.	.	.	.	.	C	1.185	-0.636950	0.03557	.	.	ENSG00000196581	ENST00000378190;ENST00000378191	T;T	0.44881	0.91;0.91	0.235	0.235	0.15431	.	0.469933	0.24350	N	0.039300	T	0.23094	0.0558	N	0.08118	0	0.27078	N	0.963159	P	0.47302	0.893	P	0.46510	0.519	T	0.14504	-1.0470	9	0.34782	T	0.22	-1.2785	.	.	.	.	375	Q9UKB5	AJAP1_HUMAN	L	375	ENSP00000367432:S375L;ENSP00000367433:S375L	ENSP00000367432:S375L	S	+	2	0	AJAP1	4732406	0.998000	0.40836	0.126000	0.21872	0.636000	0.38137	0.305000	0.19254	0.308000	0.22923	0.313000	0.20887	TCG	AJAP1	-	NULL	ENSG00000196581		0.577	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	AJAP1	HGNC	protein_coding	OTTHUMT00000001542.3	37	0.00	0	C	NM_018836		4832546	4832546	+1	no_errors	ENST00000378190	ensembl	human	known	69_37n	missense	19	48.65	18	SNP	0.903	T
ABCA4	24	genome.wustl.edu	37	1	94528272	94528272	+	Missense_Mutation	SNP	C	C	G	rs61752397		TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr1:94528272C>G	ENST00000370225.3	-	13	1884	c.1798G>C	c.(1798-1800)Gat>Cat	p.D600H	ABCA4_ENST00000535735.1_Missense_Mutation_p.D600H	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	600					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TACCGGAAATCTTCCACGGGA	0.557																																						dbGAP											0			GRCh37	CM031606	ABCA4	M	rs61752397						61.0	60.0	60.0					1																	94528272		2203	4300	6503	-	-	-	SO:0001583	missense	0			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.1798G>C	1.37:g.94528272C>G	ENSP00000359245:p.Asp600His		O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.D600H	ENST00000370225.3	37	c.1798	CCDS747.1	1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.776880	0.90195	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.99158	-5.5;-5.5	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	D	0.99263	0.9743	M	0.79926	2.475	0.80722	D	1	D;P	0.89917	1.0;0.621	D;P	0.97110	1.0;0.474	D	0.99437	1.0937	10	0.56958	D	0.05	.	18.3765	0.90437	0.0:1.0:0.0:0.0	.	600;600	F5H6E5;P78363	.;ABCA4_HUMAN	H	600	ENSP00000359245:D600H;ENSP00000437682:D600H	ENSP00000359245:D600H	D	-	1	0	ABCA4	94300860	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.567000	0.82357	2.571000	0.86741	0.561000	0.74099	GAT	ABCA4	-	tigrfam_Rim_ABC_transpt	ENSG00000198691		0.557	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	HGNC	protein_coding	OTTHUMT00000029320.1	86	0.00	0	C	NM_000350		94528272	94528272	-1	no_errors	ENST00000370225	ensembl	human	known	69_37n	missense	86	65.49	167	SNP	1.000	G
ANO4	121601	genome.wustl.edu	37	12	101504243	101504243	+	Silent	SNP	C	C	G			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr12:101504243C>G	ENST00000392977.3	+	23	2421	c.2211C>G	c.(2209-2211)gcC>gcG	p.A737A	ANO4_ENST00000550015.1_Silent_p.A257A|ANO4_ENST00000392979.3_Silent_p.A702A|ANO4_ENST00000299222.9_Silent_p.A257A			Q32M45	ANO4_HUMAN	anoctamin 4	737					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.A702A(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						CACTTCTGGCCTTACTGAATA	0.398										HNSCC(74;0.22)																												dbGAP											1	Substitution - coding silent(1)	lung(1)											103.0	102.0	102.0					12																	101504243		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.2211C>G	12.37:g.101504243C>G			Q8NAJ0|Q8NB39|Q8NB53	Silent	SNP	pfam_Anoctamin	p.A737	ENST00000392977.3	37	c.2211		12																																																																																			ANO4	-	pfam_Anoctamin	ENSG00000151572		0.398	ANO4-002	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding	OTTHUMT00000409295.1	351	0.00	0	C	NM_178826		101504243	101504243	+1	no_errors	ENST00000392977	ensembl	human	known	69_37n	silent	130	38.97	83	SNP	1.000	G
BTBD18	643376	genome.wustl.edu	37	11	57509076	57509076	+	IGR	SNP	C	C	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr11:57509076C>T	ENST00000436147.3	-	0	2947				C11orf31_ENST00000534355.1_Silent_p.P3P|C11orf31_ENST00000388857.4_Silent_p.P3P|TMX2-CTNND1_ENST00000528395.1_Intron|RP11-691N7.6_ENST00000531074.1_5'Flank			B2RXH4	BTBDI_HUMAN	BTB (POZ) domain containing 18											endometrium(3)|kidney(1)	4						CCATGGCTCCCCGCGGGAGGA	0.692																																						dbGAP											0													11.0	15.0	14.0					11																	57509076		1916	4074	5990	-	-	-	SO:0001628	intergenic_variant	0				CCDS44603.1	11q12.1	2013-01-08			ENSG00000233436	ENSG00000233436		"""BTB/POZ domain containing"""	37214	protein-coding gene	gene with protein product							Standard	NM_001145101		Approved		uc010rjy.2	B2RXH4	OTTHUMG00000167203		11.37:g.57509076C>T				Silent	SNP	pfam_Selenoprotein_Rdx-typ,superfamily_Thioredoxin-like_fold,tigrfam_Selenoprotein_Rdx-typ	p.P3	ENST00000436147.3	37	c.9	CCDS44603.1	11																																																																																			C11orf31	-	NULL	ENSG00000211450		0.692	BTBD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf31	HGNC	protein_coding	OTTHUMT00000393718.2	18	0.00	0	C	NM_001145101		57509076	57509076	+1	pseudogene	ENST00000388857	ensembl	human	known	69_37n	silent	43	27.12	16	SNP	0.278	T
C2orf16	84226	genome.wustl.edu	37	2	27800838	27800838	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr2:27800838C>T	ENST00000408964.2	+	1	1450	c.1399C>T	c.(1399-1401)Cca>Tca	p.P467S		NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	467						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					AACCCCAGGACCACTGGGTCG	0.468																																						dbGAP											0													65.0	65.0	65.0					2																	27800838		1897	4105	6002	-	-	-	SO:0001583	missense	0			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.1399C>T	2.37:g.27800838C>T	ENSP00000386190:p.Pro467Ser		B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	NULL	p.P467S	ENST00000408964.2	37	c.1399	CCDS42666.1	2	.	.	.	.	.	.	.	.	.	.	C	8.877	0.950762	0.18431	.	.	ENSG00000221843	ENST00000408964	T	0.04654	3.58	4.02	-0.452	0.12205	.	.	.	.	.	T	0.02418	0.0074	N	0.19112	0.55	0.09310	N	1	B	0.28998	0.23	B	0.23574	0.047	T	0.47686	-0.9098	9	0.12103	T	0.63	.	3.3736	0.07229	0.0:0.3949:0.2067:0.3984	.	467	Q68DN1	CB016_HUMAN	S	467	ENSP00000386190:P467S	ENSP00000386190:P467S	P	+	1	0	C2orf16	27654342	0.000000	0.05858	0.007000	0.13788	0.433000	0.31745	-0.608000	0.05641	0.017000	0.15025	0.563000	0.77884	CCA	C2orf16	-	NULL	ENSG00000221843		0.468	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf16	HGNC	protein_coding	OTTHUMT00000353292.1	98	0.00	0	C	NM_032266		27800838	27800838	+1	no_errors	ENST00000408964	ensembl	human	known	69_37n	missense	28	56.92	37	SNP	0.036	T
C4A	720	genome.wustl.edu	37	6	31965519	31965519	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr6:31965519G>T	ENST00000428956.2	+	31	4199	c.4115G>T	c.(4114-4116)gGa>gTa	p.G1372V	C4A-AS1_ENST00000458633.1_RNA|C4A_ENST00000498271.1_Missense_Mutation_p.G1372V	NM_007293.2	NP_009224.2	P0C0L4	CO4A_HUMAN	complement component 4A (Rodgers blood group)	1372					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement component C1q binding (GO:0001849)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	AAGGTGGGAGGAAACAGCAAA	0.567																																						dbGAP											0													27.0	26.0	27.0					6																	31965519		2193	4270	6463	-	-	-	SO:0001583	missense	0			L26261, M14823, X77491, AY224378	CCDS47404.1, CCDS59005.1	6p21.3	2014-09-17	2006-01-19		ENSG00000244731	ENSG00000244731		"""Blood group antigens"", ""Complement system"""	1323	protein-coding gene	gene with protein product		120810	"""complement component 4A"""				Standard	NM_001252204		Approved	CPAMD2, C4S, CO4, C4, C4A3, C4A2, C4A4, C4A6, C4B, RG		P0C0L4	OTTHUMG00000031186	ENST00000428956.2:c.4115G>T	6.37:g.31965519G>T	ENSP00000396688:p.Gly1372Val		A6H8M8|A6NHJ5|A7E2V2|B0QZR6|B0V2C8|B2RUT6|B7ZVZ6|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q4LE82|Q5JNX2|Q5JQM8|Q6P4R1|Q6U2E5|Q6U2E8|Q6U2F0|Q6U2F3|Q6U2F4|Q6U2F6|Q6U2F8|Q6U2G0|Q96EG2|Q96SA8|Q9NPK5|Q9UIP5	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A-macroglobulin_rcpt-bd,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_A2M_N,pfam_Netrin_module_non-TIMP,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,superfamily_TIMP-like_OB-fold,superfamily_Anaphylatoxin_,superfamily_Invasin/intimin_cell_adhesion,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain,prints_Anaphylatoxn	p.G1372V	ENST00000428956.2	37	c.4115	CCDS47404.1	6	.	.	.	.	.	.	.	.	.	.	g	13.41	2.229052	0.39399	.	.	ENSG00000244731	ENST00000428956;ENST00000498271	T;T	0.65549	-0.16;0.38	2.89	2.89	0.33648	.	0.372499	0.28784	N	0.014145	T	0.71937	0.3399	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75816	-0.3184	10	0.87932	D	0	.	9.3862	0.38345	0.0:0.0:1.0:0.0	.	1372;1372	A6H8M8;P0C0L4	.;CO4A_HUMAN	V	1372	ENSP00000396688:G1372V;ENSP00000420212:G1372V	ENSP00000396688:G1372V	G	+	2	0	C4A	32073497	1.000000	0.71417	0.995000	0.50966	0.571000	0.35966	4.690000	0.61731	1.624000	0.50355	0.186000	0.17326	GGA	C4A	-	NULL	ENSG00000244731		0.567	C4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4A	HGNC	protein_coding	OTTHUMT00000076364.3	284	0.00	0	G	NM_007293		31965519	31965519	+1	no_errors	ENST00000428956	ensembl	human	known	69_37n	missense	304	16.94	62	SNP	0.999	T
C4B	721	genome.wustl.edu	37	6	31998256	31998256	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr6:31998256G>T	ENST00000435363.2	+	31	4199	c.4115G>T	c.(4114-4116)gGa>gTa	p.G1372V	C4B_ENST00000425700.2_Missense_Mutation_p.G1372V|C4B-AS1_ENST00000415626.1_RNA	NM_001002029.3	NP_001002029.3	P0C0L5	CO4B_HUMAN	complement component 4B (Chido blood group)	1372					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|detection of molecule of bacterial origin (GO:0032490)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|complement binding (GO:0001848)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	AAGGTGGGAGGAAACAGCAAA	0.567																																						dbGAP											0													2.0	4.0	3.0					6																	31998256		1027	2567	3594	-	-	-	SO:0001583	missense	0			AF019413	CCDS47405.1	6p21.3	2014-09-17	2009-01-06		ENSG00000224389	ENSG00000224389		"""Blood group antigens"", ""Complement system"""	1324	protein-coding gene	gene with protein product		120820	"""complement component 4B"""				Standard	NM_001002029		Approved	CPAMD3, C4F, CO4, C4B1, C4B3, CH	uc011jpm.2	P0C0L5	OTTHUMG00000031187	ENST00000435363.2:c.4115G>T	6.37:g.31998256G>T	ENSP00000415941:p.Gly1372Val		A2BHY4|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q6U2E9|Q6U2G1|Q6U2I5|Q6U2L1|Q6U2L7|Q6U2L9|Q6U2M5|Q6VCV8|Q96SA7|Q9NPK5|Q9UIP5	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A-macroglobulin_rcpt-bd,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_Netrin_module_non-TIMP,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,superfamily_TIMP-like_OB-fold,superfamily_Anaphylatoxin_,superfamily_Invasin/intimin_cell_adhesion,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain,prints_Anaphylatoxn	p.G1372V	ENST00000435363.2	37	c.4115	CCDS47405.1	6	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346405	0.61073	.	.	ENSG00000224389	ENST00000435363;ENST00000425700	T;T	0.64085	-0.08;0.42	3.97	3.97	0.46021	.	0.372499	0.28784	N	0.014145	T	0.73241	0.3562	M	0.81682	2.555	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77563	-0.2541	10	0.87932	D	0	.	11.6075	0.51041	0.0:0.0:1.0:0.0	.	1372;1372	F5GXS0;Q6U2E9	.;.	V	1372	ENSP00000415941:G1372V;ENSP00000391933:G1372V	ENSP00000391933:G1372V	G	+	2	0	C4B	32106235	1.000000	0.71417	0.987000	0.45799	0.998000	0.95712	4.735000	0.62051	2.082000	0.62665	0.551000	0.68910	GGA	C4B	-	NULL	ENSG00000224389		0.567	C4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4B	HGNC	protein_coding	OTTHUMT00000076368.5	81	0.00	0	G	NM_001002029		31998256	31998256	+1	no_errors	ENST00000435363	ensembl	human	known	69_37n	missense	53	15.87	10	SNP	0.998	T
C8orf44	56260	genome.wustl.edu	37	8	67592086	67592086	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr8:67592086C>T	ENST00000519561.1	+	3	528	c.377C>T	c.(376-378)cCg>cTg	p.P126L	C8orf44_ENST00000518860.1_3'UTR|C8orf44-SGK3_ENST00000519289.1_5'UTR|C8orf44_ENST00000390159.3_Missense_Mutation_p.P126L|C8orf44-SGK3_ENST00000520044.1_3'UTR	NM_019607.2	NP_062553.1	Q96CB5	CH044_HUMAN	chromosome 8 open reading frame 44	126						nucleus (GO:0005634)				endometrium(1)|kidney(1)|lung(2)	4	Breast(64;0.186)		Epithelial(68;0.000959)|OV - Ovarian serous cystadenocarcinoma(28;0.00318)|all cancers(69;0.00363)|BRCA - Breast invasive adenocarcinoma(89;0.149)			CCAGATGTACCGAGTTTGAAA	0.478																																						dbGAP											0													66.0	72.0	70.0					8																	67592086		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK002129	CCDS6193.1	8q13.1	2012-05-16		2005-08-09	ENSG00000213865	ENSG00000213865			25646	protein-coding gene	gene with protein product						12477932	Standard	NM_019607		Approved	FLJ11267	uc003xwo.2	Q96CB5	OTTHUMG00000164562	ENST00000519561.1:c.377C>T	8.37:g.67592086C>T	ENSP00000428002:p.Pro126Leu		Q9NUM6	Missense_Mutation	SNP	NULL	p.P126L	ENST00000519561.1	37	c.377	CCDS6193.1	8	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452296	0.43531	.	.	ENSG00000213865	ENST00000519561;ENST00000390159	T;T	0.40756	1.02;1.02	3.81	-1.99	0.07457	.	.	.	.	.	T	0.20618	0.0496	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.18335	-1.0340	9	0.45353	T	0.12	.	8.2932	0.31969	0.0:0.5169:0.0:0.4831	.	126	Q96CB5	CH044_HUMAN	L	126	ENSP00000428002:P126L;ENSP00000375087:P126L	ENSP00000375087:P126L	P	+	2	0	C8orf44	67754640	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.056000	0.14256	-0.397000	0.07691	-0.244000	0.11960	CCG	C8orf44	-	NULL	ENSG00000213865		0.478	C8orf44-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C8orf44	HGNC	protein_coding	OTTHUMT00000379242.2	216	0.00	0	C	NM_019607		67592086	67592086	+1	no_errors	ENST00000390159	ensembl	human	known	69_37n	missense	47	45.98	40	SNP	0.000	T
CCDC39	339829	genome.wustl.edu	37	3	180366114	180366114	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr3:180366114C>T	ENST00000442201.2	-	10	1320	c.1201G>A	c.(1201-1203)Gtg>Atg	p.V401M	CCDC39_ENST00000273654.4_Missense_Mutation_p.V485M	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	401					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.V401L(1)|p.V485L(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TTAAACAGCACACCTTTTATG	0.313																																						dbGAP											2	Substitution - Missense(2)	lung(2)											143.0	134.0	137.0					3																	180366114		1835	4072	5907	-	-	-	SO:0001583	missense	0			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.1201G>A	3.37:g.180366114C>T	ENSP00000405708:p.Val401Met		B4E2H1	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.V401M	ENST00000442201.2	37	c.1201	CCDS46964.1	3	.	.	.	.	.	.	.	.	.	.	C	9.798	1.179714	0.21787	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	T;T	0.78481	-1.18;-1.18	5.41	3.59	0.41128	.	0.282509	0.34046	N	0.004310	T	0.70046	0.3179	M	0.69823	2.125	0.23665	N	0.997165	P	0.44690	0.841	B	0.36845	0.234	T	0.65253	-0.6213	10	0.45353	T	0.12	-6.647	6.5771	0.22573	0.0:0.5589:0.2935:0.1476	.	401	Q9UFE4	CCD39_HUMAN	M	485;401	ENSP00000273654:V485M;ENSP00000405708:V401M	ENSP00000273654:V485M	V	-	1	0	CCDC39	181848808	0.008000	0.16893	0.614000	0.29051	0.474000	0.32979	0.332000	0.19751	1.263000	0.44181	0.563000	0.77884	GTG	CCDC39	-	NULL	ENSG00000145075		0.313	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC39	HGNC	protein_coding	OTTHUMT00000349783.3	466	0.00	0	C	XM_291028		180366114	180366114	-1	no_errors	ENST00000442201	ensembl	human	known	69_37n	missense	202	11.01	25	SNP	0.618	T
CCDC78	124093	genome.wustl.edu	37	16	774397	774397	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr16:774397G>C	ENST00000293889.6	-	9	983	c.878C>G	c.(877-879)gCc>gGc	p.A293G	HAGHL_ENST00000549114.1_5'Flank|HAGHL_ENST00000564537.1_5'Flank|HAGHL_ENST00000564545.1_5'Flank|HAGHL_ENST00000389703.3_5'Flank|HAGHL_ENST00000341413.4_5'Flank|HAGHL_ENST00000561546.1_5'Flank	NM_001031737.2	NP_001026907.2	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78	293					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)|skeletal muscle contraction (GO:0003009)	centriole (GO:0005814)|deuterosome (GO:0098536)|perinuclear region of cytoplasm (GO:0048471)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(2)|skin(3)	9		Hepatocellular(780;0.0218)				GGCAGCCCGGGCCAGCTGCTG	0.687																																						dbGAP											0													44.0	50.0	48.0					16																	774397		2200	4295	6495	-	-	-	SO:0001583	missense	0			BC042110	CCDS32353.1	16p13.3	2014-07-15		2006-02-20	ENSG00000162004	ENSG00000162004			14153	protein-coding gene	gene with protein product		614666		C16orf25		24075808	Standard	NM_001031737		Approved	FLJ34512	uc002cjg.3	A2IDD5	OTTHUMG00000121176	ENST00000293889.6:c.878C>G	16.37:g.774397G>C	ENSP00000293889:p.Ala293Gly		B4DNY4|B4E1U6|Q05BY7|Q05CA0|Q6T2V5|Q6ZR33|Q8IUR3|Q8NAY7|Q96S12	Missense_Mutation	SNP	NULL	p.A293G	ENST00000293889.6	37	c.878	CCDS32353.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	25.7|25.7	4.661162|4.661162	0.88154|0.88154	.|.	.|.	ENSG00000162004|ENSG00000162004	ENST00000293889|ENST00000345165	T|.	0.37584|.	1.19|.	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	0.068110|.	0.64402|.	D|.	0.000017|.	T|T	0.69975|0.69975	0.3171|0.3171	L|L	0.55990|0.55990	1.75|1.75	0.50171|0.50171	D|D	0.999856|0.999856	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.77004|.	0.983;0.989;0.983|.	T|T	0.67507|0.67507	-0.5653|-0.5653	10|5	0.66056|.	D|.	0.02|.	-10.1716|-10.1716	16.6197|16.6197	0.84927|0.84927	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	52;293;142|.	D3DU63;A2IDD5;D3DU61|.	.;CCD78_HUMAN;.|.	G|A	293|142	ENSP00000293889:A293G|.	ENSP00000293889:A293G|.	A|P	-|-	2|1	0|0	CCDC78|CCDC78	714398|714398	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.808000|0.808000	0.45660|0.45660	6.606000|6.606000	0.74159|0.74159	2.521000|2.521000	0.84997|0.84997	0.543000|0.543000	0.68304|0.68304	GCC|CCC	CCDC78	-	NULL	ENSG00000162004		0.687	CCDC78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC78	HGNC	protein_coding	OTTHUMT00000241665.3	14	0.00	0	G	NM_173476		774397	774397	-1	no_errors	ENST00000293889	ensembl	human	known	69_37n	missense	32	39.62	21	SNP	1.000	C
CDH17	1015	genome.wustl.edu	37	8	95182679	95182679	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr8:95182679G>T	ENST00000027335.3	-	9	1136	c.1012C>A	c.(1012-1014)Cct>Act	p.P338T	CDH17_ENST00000450165.2_Missense_Mutation_p.P338T|CDH17_ENST00000441892.2_Intron	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	338	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			GGACATGTAGGTGGATTATCA	0.403																																						dbGAP											0													152.0	143.0	146.0					8																	95182679		2203	4300	6503	-	-	-	SO:0001583	missense	0			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1012C>A	8.37:g.95182679G>T	ENSP00000027335:p.Pro338Thr		Q15336|Q2M2E0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P338T	ENST00000027335.3	37	c.1012	CCDS6260.1	8	.	.	.	.	.	.	.	.	.	.	G	18.69	3.677713	0.68042	.	.	ENSG00000079112	ENST00000027335;ENST00000450165	D;D	0.88124	-2.34;-2.34	6.06	5.19	0.71726	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.115066	0.39834	N	0.001259	D	0.95934	0.8676	H	0.97540	4.025	0.58432	D	0.999999	D	0.89917	1.0	D	0.77004	0.989	D	0.97470	1.0040	10	0.87932	D	0	-16.8272	15.7285	0.77784	0.0:0.0:0.8621:0.1379	.	338	Q12864	CAD17_HUMAN	T	338	ENSP00000027335:P338T;ENSP00000401468:P338T	ENSP00000027335:P338T	P	-	1	0	CDH17	95251855	1.000000	0.71417	0.997000	0.53966	0.769000	0.43574	6.676000	0.74498	1.557000	0.49525	0.650000	0.86243	CCT	CDH17	-	superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000079112		0.403	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH17	HGNC	protein_coding	OTTHUMT00000378560.1	215	0.46	1	G	NM_004063		95182679	95182679	-1	no_errors	ENST00000027335	ensembl	human	known	69_37n	missense	128	20.00	32	SNP	1.000	T
CLCNKA	1187	genome.wustl.edu	37	1	16351326	16351326	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr1:16351326C>T	ENST00000331433.4	+	4	317	c.298C>T	c.(298-300)Cct>Tct	p.P100S	CLCNKA_ENST00000375692.1_Missense_Mutation_p.P100S|CLCNKA_ENST00000420078.1_Missense_Mutation_p.P100S|CLCNKA_ENST00000439316.2_Intron|CLCNKA_ENST00000464764.1_Intron			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka	100					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	GACTGTGTACCCTGTGGCCCT	0.617																																						dbGAP											0													145.0	109.0	121.0					1																	16351326		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.298C>T	1.37:g.16351326C>T	ENSP00000332771:p.Pro100Ser		B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-K	p.P100S	ENST00000331433.4	37	c.298	CCDS167.1	1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.011920	0.75046	.	.	ENSG00000186510	ENST00000375692;ENST00000420078;ENST00000331433	D;D;D	0.93366	-3.21;-3.21;-3.21	4.0	4.0	0.46444	Chloride channel, core (2);	0.059201	0.64402	D	0.000002	D	0.95999	0.8697	M	0.80847	2.515	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.65987	0.94;0.94	D	0.96100	0.9068	10	0.62326	D	0.03	.	13.2727	0.60170	0.0:1.0:0.0:0.0	.	100;100	Q5T5Q4;P51800	.;CLCKA_HUMAN	S	100	ENSP00000364844:P100S;ENSP00000410353:P100S;ENSP00000332771:P100S	ENSP00000332771:P100S	P	+	1	0	CLCNKA	16223913	1.000000	0.71417	0.997000	0.53966	0.760000	0.43138	6.866000	0.75506	2.220000	0.72140	0.462000	0.41574	CCT	CLCNKA	-	superfamily_Cl-channel_core	ENSG00000186510		0.617	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCNKA	HGNC	protein_coding	OTTHUMT00000026326.1	170	0.00	0	C			16351326	16351326	+1	no_errors	ENST00000331433	ensembl	human	known	69_37n	missense	97	48.42	92	SNP	1.000	T
COPA	1314	genome.wustl.edu	37	1	160280016	160280016	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr1:160280016T>A	ENST00000241704.7	-	12	1338	c.1109A>T	c.(1108-1110)tAc>tTc	p.Y370F	COPA_ENST00000368069.3_Missense_Mutation_p.Y370F	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	370					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGCTGGATTGTATGACATATT	0.393																																						dbGAP											0													137.0	140.0	139.0					1																	160280016		2203	4300	6503	-	-	-	SO:0001583	missense	0			U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.1109A>T	1.37:g.160280016T>A	ENSP00000241704:p.Tyr370Phe		Q5T201|Q8IXZ9	Missense_Mutation	SNP	pfam_Coatomer_asu_C,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Coatomer_asu,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y370F	ENST00000241704.7	37	c.1109	CCDS1202.1	1	.	.	.	.	.	.	.	.	.	.	T	19.10	3.761766	0.69763	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.63417	2.87;-0.04	5.14	5.14	0.70334	Coatomer, WD associated region (1);	0.000000	0.85682	D	0.000000	T	0.47192	0.1432	L	0.41124	1.26	0.80722	D	1	B;B	0.31581	0.329;0.018	B;B	0.40375	0.327;0.034	T	0.52049	-0.8627	10	0.38643	T	0.18	-13.1226	13.9202	0.63926	0.0:0.0:0.0:1.0	.	370;370	P53621;P53621-2	COPA_HUMAN;.	F	370	ENSP00000357048:Y370F;ENSP00000241704:Y370F	ENSP00000241704:Y370F	Y	-	2	0	COPA	158546640	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.402000	0.79972	2.157000	0.67596	0.482000	0.46254	TAC	COPA	-	pfam_Coatomer_WD-assoc_reg,pirsf_Coatomer_asu	ENSG00000122218		0.393	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COPA	HGNC	protein_coding	OTTHUMT00000080638.1	404	0.00	0	T	NM_004371		160280016	160280016	-1	no_errors	ENST00000368069	ensembl	human	known	69_37n	missense	207	23.62	64	SNP	1.000	A
CPQ	10404	genome.wustl.edu	37	8	98041636	98041636	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr8:98041636C>T	ENST00000220763.5	+	6	1177	c.967C>T	c.(967-969)Cgt>Tgt	p.R323C		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	323					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										CCCAGGGCTGCGTCCAAAGAG	0.428																																						dbGAP											0													38.0	37.0	37.0					8																	98041636		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.967C>T	8.37:g.98041636C>T	ENSP00000220763:p.Arg323Cys		B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	pfam_Peptidase_M28,pfam_Peptidase_M20	p.R323C	ENST00000220763.5	37	c.967	CCDS6273.1	8	.	.	.	.	.	.	.	.	.	.	C	19.66	3.870003	0.72065	.	.	ENSG00000104324	ENST00000220763	T	0.51817	0.69	5.64	5.64	0.86602	Peptidase M28 (1);	0.179218	0.49916	D	0.000136	T	0.72645	0.3486	M	0.88377	2.95	0.54753	D	0.999987	D	0.71674	0.998	D	0.68192	0.956	T	0.77988	-0.2380	10	0.87932	D	0	-10.2544	15.2088	0.73202	0.0:1.0:0.0:0.0	.	323	Q9Y646	PGCP_HUMAN	C	323	ENSP00000220763:R323C	ENSP00000220763:R323C	R	+	1	0	AC010859.1	98110812	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	5.935000	0.70145	2.646000	0.89796	0.655000	0.94253	CGT	CPQ	-	pfam_Peptidase_M28,pfam_Peptidase_M20	ENSG00000104324		0.428	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPQ	HGNC	protein_coding	OTTHUMT00000379757.2	202	0.00	0	C	NM_016134		98041636	98041636	+1	no_errors	ENST00000220763	ensembl	human	known	69_37n	missense	77	38.40	48	SNP	0.998	T
CRB1	23418	genome.wustl.edu	37	1	197396665	197396665	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr1:197396665T>A	ENST00000367400.3	+	7	2345	c.2210T>A	c.(2209-2211)aTc>aAc	p.I737N	CRB1_ENST00000367399.2_Missense_Mutation_p.I625N|CRB1_ENST00000543483.1_3'UTR|CRB1_ENST00000367397.1_Missense_Mutation_p.I118N|CRB1_ENST00000535699.1_Missense_Mutation_p.I668N|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000544212.1_Missense_Mutation_p.I218N	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	737	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						GGAGACACCATCAGCCTCTCC	0.463																																						dbGAP											0													89.0	79.0	82.0					1																	197396665		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2210T>A	1.37:g.197396665T>A	ENSP00000356370:p.Ile737Asn		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.I737N	ENST00000367400.3	37	c.2210	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	T	8.056	0.767085	0.15983	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26	5.75	3.47	0.39725	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	.	.	.	.	T	0.64216	0.2578	L	0.29908	0.895	0.09310	N	1	B;P;P;P	0.44877	0.439;0.786;0.547;0.845	B;B;B;B	0.36959	0.139;0.237;0.179;0.185	T	0.54159	-0.8335	9	0.66056	D	0.02	.	8.8808	0.35374	0.0:0.2095:0.0:0.7905	.	668;625;386;737	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	N	668;737;625;218;118;386	ENSP00000438786:I668N;ENSP00000356370:I737N;ENSP00000356369:I625N;ENSP00000444556:I218N;ENSP00000356367:I118N	ENSP00000356367:I118N	I	+	2	0	CRB1	195663288	0.154000	0.22792	0.042000	0.18584	0.027000	0.11550	3.120000	0.50430	0.463000	0.27118	0.528000	0.53228	ATC	CRB1	-	superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000134376		0.463	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	163	0.00	0	T	NM_201253		197396665	197396665	+1	no_errors	ENST00000367400	ensembl	human	known	69_37n	missense	45	73.30	129	SNP	0.014	A
DDX24	57062	genome.wustl.edu	37	14	94524203	94524203	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr14:94524203C>G	ENST00000330836.5	-	6	2085	c.1954G>C	c.(1954-1956)Gat>Cat	p.D652H	DDX24_ENST00000555054.1_Missense_Mutation_p.D609H|DDX24_ENST00000544005.1_Missense_Mutation_p.D402H	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	652	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		TTAGGAATATCCAGACCCCGA	0.418																																						dbGAP											0													60.0	59.0	59.0					14																	94524203		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.1954G>C	14.37:g.94524203C>G	ENSP00000328690:p.Asp652His		E7EMJ4|Q4V9L5	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.D652H	ENST00000330836.5	37	c.1954	CCDS9918.1	14	.	.	.	.	.	.	.	.	.	.	C	23.0	4.362057	0.82353	.	.	ENSG00000089737	ENST00000330836;ENST00000544005;ENST00000440370;ENST00000543787;ENST00000555054;ENST00000542247	T;T;T	0.21361	2.01;2.01;2.01	5.5	4.59	0.56863	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.53286	0.1787	M	0.89214	3.015	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.65067	-0.6258	10	0.87932	D	0	-17.447	15.8556	0.78975	0.137:0.863:0.0:0.0	.	652	Q9GZR7	DDX24_HUMAN	H	652;402;597;278;609;609	ENSP00000328690:D652H;ENSP00000440623:D402H;ENSP00000452145:D609H	ENSP00000328690:D652H	D	-	1	0	DDX24	93593956	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.818000	0.86416	1.408000	0.46895	0.563000	0.77884	GAT	DDX24	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000089737		0.418	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX24	HGNC	protein_coding	OTTHUMT00000412861.1	119	0.00	0	C	NM_020414		94524203	94524203	-1	no_errors	ENST00000330836	ensembl	human	known	69_37n	missense	34	70.43	81	SNP	1.000	G
EGFL6	25975	genome.wustl.edu	37	X	13645206	13645206	+	Silent	SNP	T	T	A	rs144069148		TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chrX:13645206T>A	ENST00000361306.1	+	11	1619	c.1362T>A	c.(1360-1362)ccT>ccA	p.P454P	EGFL6_ENST00000380602.3_Silent_p.P455P	NM_001167890.1|NM_015507.3	NP_001161362.1|NP_056322.2	Q8IUX8	EGFL6_HUMAN	EGF-like-domain, multiple 6	454	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)|skin(3)	23						TTCTCCTACCTGACCTGCAAC	0.458																																						dbGAP											0													111.0	104.0	107.0					X																	13645206		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF186084	CCDS14155.1, CCDS55370.1	Xp22	2008-02-05	2002-10-09		ENSG00000198759	ENSG00000198759			3235	protein-coding gene	gene with protein product		300239	"""MAM and EGF domain containing"""	MAEG		10610727	Standard	NM_015507		Approved		uc004cvj.3	Q8IUX8	OTTHUMG00000021155	ENST00000361306.1:c.1362T>A	X.37:g.13645206T>A			B2RCB1|Q6UXJ1|Q8NBV0|Q8WYG3|Q9NY67|Q9NZL7|Q9UFK6	Silent	SNP	pfam_MAM_dom,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_MAM_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.P455	ENST00000361306.1	37	c.1365	CCDS14155.1	X																																																																																			EGFL6	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl,smart_MAM_dom,pfscan_MAM_dom	ENSG00000198759		0.458	EGFL6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	EGFL6	HGNC	protein_coding	OTTHUMT00000055800.1	201	0.00	0	T	NM_015507		13645206	13645206	+1	no_errors	ENST00000380602	ensembl	human	known	69_37n	silent	95	38.71	60	SNP	0.001	A
DDX26B	203522	genome.wustl.edu	37	X	134706902	134706902	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chrX:134706902C>G	ENST00000370752.4	+	11	1784	c.1450C>G	c.(1450-1452)Ctg>Gtg	p.L484V	DDX26B_ENST00000481908.1_3'UTR	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B	484										large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					TGCACTTAGACTGACAGAATT	0.338																																						dbGAP											0													74.0	76.0	76.0					X																	134706902		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.1450C>G	X.37:g.134706902C>G	ENSP00000359788:p.Leu484Val		Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	Missense_Mutation	SNP	pfscan_VWF_A	p.L484V	ENST00000370752.4	37	c.1450	CCDS35401.1	X	.	.	.	.	.	.	.	.	.	.	C	3.932	-0.016063	0.07681	.	.	ENSG00000165359	ENST00000370752	T	0.36520	1.25	5.35	3.56	0.40772	.	0.141150	0.48767	D	0.000175	T	0.23249	0.0562	L	0.38531	1.155	0.39039	D	0.960082	B;B	0.22683	0.073;0.044	B;B	0.22880	0.042;0.039	T	0.07578	-1.0765	10	0.16420	T	0.52	-1.0143	5.8673	0.18783	0.0:0.6688:0.1563:0.175	.	484;484	B9EIK3;Q5JSJ4	.;DX26B_HUMAN	V	484	ENSP00000359788:L484V	ENSP00000359788:L484V	L	+	1	2	DDX26B	134534568	1.000000	0.71417	0.496000	0.27539	0.034000	0.12701	3.034000	0.49751	1.150000	0.42419	0.594000	0.82650	CTG	DDX26B	-	NULL	ENSG00000165359		0.338	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX26B	HGNC	protein_coding	OTTHUMT00000058420.1	283	0.00	0	C	NM_182540		134706902	134706902	+1	no_errors	ENST00000370752	ensembl	human	known	69_37n	missense	81	19.80	20	SNP	0.966	G
ESRP1	54845	genome.wustl.edu	37	8	95658491	95658491	+	Silent	SNP	C	C	T	rs376259698		TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr8:95658491C>T	ENST00000433389.2	+	4	661	c.471C>T	c.(469-471)gaC>gaT	p.D157D	ESRP1_ENST00000358397.5_Silent_p.D157D|ESRP1_ENST00000423620.2_Silent_p.D157D|ESRP1_ENST00000454170.2_Silent_p.D157D	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	157					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						ACAAACTGGACGTTGCCACAA	0.333																																						dbGAP											0													150.0	138.0	142.0					8																	95658491		1869	4095	5964	-	-	-	SO:0001819	synonymous_variant	0			AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.471C>T	8.37:g.95658491C>T			A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Missense_Mutation	SNP	smart_RRM_dom,pfscan_RRM_dom	p.R23C	ENST00000433389.2	37	c.67	CCDS47897.1	8	.	.	.	.	.	.	.	.	.	.	C	0.137	-1.106600	0.01828	.	.	ENSG00000104413	ENST00000519505	.	.	.	5.45	1.75	0.24633	.	.	.	.	.	T	0.57607	0.2065	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49031	-0.8981	4	.	.	.	-16.5936	9.2172	0.37355	0.0:0.2081:0.0:0.7919	.	.	.	.	C	23	.	.	R	+	1	0	ESRP1	95727667	0.991000	0.36638	0.983000	0.44433	0.067000	0.16453	0.169000	0.16641	0.062000	0.16340	-1.004000	0.02495	CGT	ESRP1	-	NULL	ENSG00000104413		0.333	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ESRP1	HGNC	protein_coding	OTTHUMT00000379326.1	371	0.00	0	C	NM_017697		95658491	95658491	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000519505	ensembl	human	putative	69_37n	missense	136	17.07	28	SNP	0.998	T
EYS	346007	genome.wustl.edu	37	6	64498094	64498094	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr6:64498094C>A	ENST00000370621.3	-	39	8153	c.7627G>T	c.(7627-7629)Ggt>Tgt	p.G2543C	EYS_ENST00000503581.1_Missense_Mutation_p.G2543C|EYS_ENST00000486069.1_5'UTR|EYS_ENST00000370616.2_Missense_Mutation_p.G2543C			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	2543	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ACATTGAGACCAACCAGTCTT	0.368																																						dbGAP											0													143.0	122.0	128.0					6																	64498094		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.7627G>T	6.37:g.64498094C>A	ENSP00000359655:p.Gly2543Cys		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.G2543C	ENST00000370621.3	37	c.7627		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.84|17.84	3.487972|3.487972	0.64074|0.64074	.|.	.|.	ENSG00000188107|ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616|ENST00000398580	T;T;T|.	0.77877|.	-1.13;-1.13;-1.13|.	4.1|4.1	3.18|3.18	0.36537|0.36537	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);|.	0.000000|.	0.46758|.	U|.	0.000263|.	T|T	0.64461|0.64461	0.2600|0.2600	M|M	0.81341|0.81341	2.54|2.54	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.998;0.999|.	T|T	0.66488|0.66488	-0.5911|-0.5911	10|5	0.56958|.	D|.	0.05|.	.|.	11.6253|11.6253	0.51142|0.51142	0.0:0.8196:0.1804:0.0|0.0:0.8196:0.1804:0.0	.|.	2543;2543|.	Q5T1H1-1;Q5T1H1|.	.;EYS_HUMAN|.	C|F	2543|314	ENSP00000424243:G2543C;ENSP00000359655:G2543C;ENSP00000359650:G2543C|.	ENSP00000359650:G2543C|.	G|L	-|-	1|3	0|2	EYS|EYS	64556053|64556053	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.992000|0.992000	0.81027|0.81027	4.695000|4.695000	0.61767|0.61767	0.648000|0.648000	0.30732|0.30732	0.655000|0.655000	0.94253|0.94253	GGT|TTG	EYS	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000188107		0.368	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	396	0.25	1	C	XM_294050		64498094	64498094	-1	no_errors	ENST00000370616	ensembl	human	known	69_37n	missense	126	32.62	61	SNP	1.000	A
FAM47A	158724	genome.wustl.edu	37	X	34148875	34148875	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chrX:34148875C>A	ENST00000346193.3	-	1	1572	c.1521G>T	c.(1519-1521)gaG>gaT	p.E507D		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	507			Missing. {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						TCTTGGGAGGCTCCGAGCGGA	0.647																																						dbGAP											0													28.0	28.0	28.0					X																	34148875		2180	4241	6421	-	-	-	SO:0001583	missense	0			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1521G>T	X.37:g.34148875C>A	ENSP00000345029:p.Glu507Asp		A8K8I9|Q8TAA0	Missense_Mutation	SNP	NULL	p.E507D	ENST00000346193.3	37	c.1521	CCDS43926.1	X	.	.	.	.	.	.	.	.	.	.	c	0.675	-0.800335	0.02841	.	.	ENSG00000185448	ENST00000346193	T	0.15139	2.45	0.513	-1.03	0.10102	.	.	.	.	.	T	0.10680	0.0261	L	0.47190	1.495	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	8	0.16896	T	0.51	.	.	.	.	.	507	Q5JRC9	FA47A_HUMAN	D	507	ENSP00000345029:E507D	ENSP00000345029:E507D	E	-	3	2	FAM47A	34058796	0.044000	0.20184	0.000000	0.03702	0.000000	0.00434	-2.299000	0.01139	-2.976000	0.00284	-2.572000	0.00171	GAG	FAM47A	-	NULL	ENSG00000185448		0.647	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	HGNC	protein_coding	OTTHUMT00000056205.1	26	0.00	0	C	NM_203408		34148875	34148875	-1	no_errors	ENST00000346193	ensembl	human	known	69_37n	missense	64	26.44	23	SNP	0.000	A
FBXL17	64839	genome.wustl.edu	37	5	107559823	107559823	+	Splice_Site	SNP	T	T	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr5:107559823T>A	ENST00000542267.1	-	5	2019	c.1613A>T	c.(1612-1614)aAg>aTg	p.K538M	FBXL17_ENST00000496714.1_Splice_Site_p.K140M|FBXL17_ENST00000359660.5_Splice_Site_p.K140M	NM_001163315.2	NP_001156787.2	Q9UF56	FXL17_HUMAN	F-box and leucine-rich repeat protein 17	538										endometrium(1)|large_intestine(4)|lung(1)	6		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)		AGTACCTACCTTGGTTAGGTG	0.403																																						dbGAP											0													101.0	93.0	96.0					5																	107559823		2202	4300	6502	-	-	-	SO:0001630	splice_region_variant	0			AL133602	CCDS54886.1	5q21.3	2011-06-09	2004-06-15	2004-06-16	ENSG00000145743	ENSG00000145743		"""F-boxes / Leucine-rich repeats"""	13615	protein-coding gene	gene with protein product		609083	"""F-box only protein 13"""	FBXO13			Standard	NM_001163315		Approved	DKFZP434C1715, Fbx13, Fbl17	uc011cvc.2	Q9UF56	OTTHUMG00000159785	ENST00000542267.1:c.1614+1A>T	5.37:g.107559823T>A			A1A4E3	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom_cyclin-like	p.K538M	ENST00000542267.1	37	c.1613	CCDS54886.1	5	.	.	.	.	.	.	.	.	.	.	T	19.26	3.792789	0.70452	.	.	ENSG00000145743	ENST00000359660;ENST00000542267;ENST00000496714	T;T;T	0.18016	2.24;4.16;2.24	5.47	5.47	0.80525	.	0.280920	0.35378	N	0.003252	T	0.26774	0.0655	L	0.50333	1.59	0.40325	D	0.978862	P;D	0.59767	0.641;0.986	B;P	0.50378	0.259;0.639	T	0.02288	-1.1182	10	0.66056	D	0.02	.	15.5482	0.76126	0.0:0.0:0.0:1.0	.	538;140	Q9UF56;Q9UF56-2	FXL17_HUMAN;.	M	140;538;140	ENSP00000352683:K140M;ENSP00000437464:K538M;ENSP00000418111:K140M	ENSP00000352683:K140M	K	-	2	0	FBXL17	107587722	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	4.223000	0.58587	2.090000	0.63153	0.482000	0.46254	AAG	FBXL17	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000145743		0.403	FBXL17-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL17	HGNC	protein_coding		227	0.00	0	T		Missense_Mutation	107559823	107559823	-1	no_errors	ENST00000542267	ensembl	human	known	69_37n	missense	38	54.76	46	SNP	1.000	A
FLNB	2317	genome.wustl.edu	37	3	58156382	58156382	+	Frame_Shift_Del	DEL	C	C	-			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr3:58156382delC	ENST00000295956.4	+	46	7867	c.7702delC	c.(7702-7704)caafs	p.Q2568fs	FLNB_ENST00000493452.1_Frame_Shift_Del_p.Q2375fs|FLNB_ENST00000490882.1_Frame_Shift_Del_p.Q2599fs|FLNB-AS1_ENST00000488720.1_RNA|FLNB_ENST00000419752.2_Frame_Shift_Del_p.Q2388fs|FLNB_ENST00000429972.2_Frame_Shift_Del_p.Q2557fs|FLNB_ENST00000484981.1_3'UTR|FLNB_ENST00000348383.5_Frame_Shift_Del_p.Q2527fs|FLNB_ENST00000357272.4_3'UTR|FLNB_ENST00000358537.3_Frame_Shift_Del_p.Q2544fs	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	2568	Interaction with FLNA 2.|Interaction with INPPL1.|Self-association site, tail. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		AGGCAACCAGCAATACAACGT	0.567																																						dbGAP											0													103.0	86.0	92.0					3																	58156382		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.7702delC	3.37:g.58156382delC	ENSP00000295956:p.Gln2568fs		B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Frame_Shift_Del	DEL	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.Q2568fs	ENST00000295956.4	37	c.7702	CCDS2885.1	3																																																																																			FLNB	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000136068		0.567	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLNB	HGNC	protein_coding	OTTHUMT00000353569.1	112	0.00	0	C	NM_001457		58156382	58156382	+1	no_errors	ENST00000295956	ensembl	human	known	69_37n	frame_shift_del	54	49.17	59	DEL	0.997	-
GCK	2645	genome.wustl.edu	37	7	44192974	44192974	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr7:44192974A>T	ENST00000403799.3	-	2	603	c.134T>A	c.(133-135)cTg>cAg	p.L45Q	GCK_ENST00000395796.3_Missense_Mutation_p.L44Q|GCK_ENST00000476008.1_5'Flank|GCK_ENST00000437084.1_Missense_Mutation_p.L45Q|GCK_ENST00000345378.2_Missense_Mutation_p.L46Q	NM_000162.3	NP_000153.1	P35557	HXK4_HUMAN	glucokinase (hexokinase 4)	45	Hexokinase type-1.				calcium ion import (GO:0070509)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|cellular response to glucose starvation (GO:0042149)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|detection of glucose (GO:0051594)|endocrine pancreas development (GO:0031018)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|NADP metabolic process (GO:0006739)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gluconeogenesis (GO:0045721)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphorylation (GO:0042327)|regulation of glucose transport (GO:0010827)|regulation of glycolytic process (GO:0006110)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transport (GO:0043266)|second-messenger-mediated signaling (GO:0019932)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|secretory granule (GO:0030141)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|magnesium ion binding (GO:0000287)			central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	37						CTCCAGCCTCAGGCCGCGGTC	0.597																																						dbGAP											0													235.0	202.0	214.0					7																	44192974		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF041014	CCDS5479.1, CCDS5480.1, CCDS5481.1	7p15.3-p15.1	2008-02-07	2008-02-07		ENSG00000106633	ENSG00000106633	2.7.1.2, 2.7.1.1		4195	protein-coding gene	gene with protein product		138079	"""maturity onset diabetes of the young 2"""	MODY2		1740341, 1502186	Standard	NM_033507		Approved	HK4	uc003tkk.1	P35557	OTTHUMG00000022903	ENST00000403799.3:c.134T>A	7.37:g.44192974A>T	ENSP00000384247:p.Leu45Gln		A4D2J2|A4D2J3|Q05810	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.L46Q	ENST00000403799.3	37	c.137	CCDS5479.1	7	.	.	.	.	.	.	.	.	.	.	A	26.3	4.728604	0.89390	.	.	ENSG00000106633	ENST00000403799;ENST00000395796;ENST00000345378;ENST00000437084	D;D;D;D	0.99499	-6.02;-6.02;-6.02;-6.02	5.08	5.08	0.68730	Hexokinase, N-terminal (1);	0.072047	0.56097	D	0.000023	D	0.99591	0.9852	M	0.91920	3.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97900	1.0302	10	0.87932	D	0	-14.2224	14.8264	0.70117	1.0:0.0:0.0:0.0	.	45;46;44	P35557;P35557-2;P35557-3	HXK4_HUMAN;.;.	Q	45;44;46;45	ENSP00000384247:L45Q;ENSP00000379142:L44Q;ENSP00000223366:L46Q;ENSP00000402840:L45Q	ENSP00000223366:L46Q	L	-	2	0	GCK	44159499	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	9.255000	0.95524	2.038000	0.60285	0.533000	0.62120	CTG	GCK	-	pfam_Hexokinase_N	ENSG00000106633		0.597	GCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCK	HGNC	protein_coding	OTTHUMT00000251069.2	87	0.00	0	A			44192974	44192974	-1	no_errors	ENST00000345378	ensembl	human	known	69_37n	missense	147	31.34	68	SNP	1.000	T
GIPR	2696	genome.wustl.edu	37	19	46181247	46181247	+	Silent	SNP	G	G	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr19:46181247G>T	ENST00000590918.1	+	11	1107	c.1008G>T	c.(1006-1008)cgG>cgT	p.R336R	GIPR_ENST00000263281.3_Silent_p.R336R|GIPR_ENST00000593127.1_3'UTR|MIR642A_ENST00000385039.1_RNA|GIPR_ENST00000304207.8_Silent_p.R300R	NM_000164.2	NP_000155.1	P48546	GIPR_HUMAN	gastric inhibitory polypeptide receptor	336					activation of adenylate cyclase activity (GO:0007190)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|endocrine pancreas development (GO:0031018)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|response to axon injury (GO:0048678)|response to calcium ion (GO:0051592)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gastric inhibitory peptide receptor activity (GO:0016519)|peptide hormone binding (GO:0017046)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|kidney(2)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	12		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0056)|GBM - Glioblastoma multiforme(486;0.0832)|Epithelial(262;0.199)		GGGATTACCGGCTGAGGTGAG	0.602																																						dbGAP											0													60.0	56.0	57.0					19																	46181247		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12671.1	19q13.2-q13.3	2012-08-10				ENSG00000010310		"""GPCR / Class B : Glucagon receptors"""	4271	protein-coding gene	gene with protein product		137241				7490109	Standard	NM_000164		Approved		uc002pcu.1	P48546		ENST00000590918.1:c.1008G>T	19.37:g.46181247G>T			B7WP14|B7ZKQ0|Q14401|Q16400|Q52M04|Q9UPI1	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_GIP_rcpt,prints_GPCR_2_secretin-like	p.R336	ENST00000590918.1	37	c.1008	CCDS12671.1	19																																																																																			GIPR	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000010310		0.602	GIPR-001	KNOWN	basic|CCDS	protein_coding	GIPR	HGNC	protein_coding	OTTHUMT00000459640.1	69	0.00	0	G			46181247	46181247	+1	no_errors	ENST00000590918	ensembl	human	known	69_37n	silent	71	33.64	36	SNP	0.967	T
GPR141	353345	genome.wustl.edu	37	7	37780680	37780680	+	Frame_Shift_Del	DEL	T	T	-			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr7:37780680delT	ENST00000447769.1	+	4	974	c.685delT	c.(685-687)tttfs	p.F230fs	GPR141_ENST00000334425.1_Frame_Shift_Del_p.F230fs|EPDR1_ENST00000476620.1_Intron|GPR141_ENST00000461610.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.F230fs*2(1)		NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GAAAAACCTATTTTTTATAGG	0.433																																						dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)											149.0	152.0	151.0					7																	37780680		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.685delT	7.37:g.37780680delT	ENSP00000390410:p.Phe230fs		A4D1X7|Q0VAR5|Q86SP3	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.F230fs	ENST00000447769.1	37	c.685	CCDS5451.1	7																																																																																			GPR141	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187037		0.433	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	496	0.00	0	T	NM_181791		37780680	37780680	+1	no_errors	ENST00000334425	ensembl	human	known	69_37n	frame_shift_del	206	32.79	101	DEL	0.054	-
HAL	3034	genome.wustl.edu	37	12	96388760	96388760	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr12:96388760C>T	ENST00000261208.3	-	3	627	c.259G>A	c.(259-261)Gat>Aat	p.D87N	HAL_ENST00000541929.1_5'UTR|RP11-256L6.3_ENST00000551849.1_RNA|HAL_ENST00000538703.1_Missense_Mutation_p.D87N	NM_002108.3	NP_002099.1	P42357	HUTH_HUMAN	histidine ammonia-lyase	87					biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	histidine ammonia-lyase activity (GO:0004397)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	34					L-Histidine(DB00117)	GACATGGCATCACCCTCTATA	0.498																																					NSCLC(169;943 2815 23563 30031)	dbGAP											0													102.0	94.0	97.0					12																	96388760		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9058.1, CCDS58264.1, CCDS58265.1	12q22-q24.1	1991-07-12				ENSG00000084110	4.3.1.3		4806	protein-coding gene	gene with protein product		609457		HIS			Standard	NM_002108		Approved		uc001tem.2	P42357	OTTHUMG00000170354	ENST00000261208.3:c.259G>A	12.37:g.96388760C>T	ENSP00000261208:p.Asp87Asn		B4DQC1|B4E0V8|F5GXF2|F5H1U5|Q4VB92|Q4VB93	Missense_Mutation	SNP	pfam_Aromatic_Lyase,superfamily_L-Aspartase-like,tigrfam_HutH	p.D87N	ENST00000261208.3	37	c.259	CCDS9058.1	12	.	.	.	.	.	.	.	.	.	.	C	26.5	4.741943	0.89573	.	.	ENSG00000084110	ENST00000261208;ENST00000538703;ENST00000552509	T;T;D	0.87103	-1.25;-1.22;-2.21	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.85682	0.5753	L	0.52364	1.645	0.80722	D	1	B;B	0.11235	0.004;0.003	B;B	0.09377	0.004;0.004	T	0.79254	-0.1879	10	0.42905	T	0.14	-23.7741	20.3437	0.98782	0.0:1.0:0.0:0.0	.	87;87	F5GXF2;P42357	.;HUTH_HUMAN	N	87	ENSP00000261208:D87N;ENSP00000440861:D87N;ENSP00000450372:D87N	ENSP00000261208:D87N	D	-	1	0	HAL	94912891	1.000000	0.71417	0.904000	0.35570	0.905000	0.53344	7.487000	0.81328	2.821000	0.97095	0.555000	0.69702	GAT	HAL	-	NULL	ENSG00000084110		0.498	HAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAL	HGNC	protein_coding	OTTHUMT00000408644.1	135	0.00	0	C			96388760	96388760	-1	no_errors	ENST00000261208	ensembl	human	known	69_37n	missense	63	11.27	8	SNP	1.000	T
HAUS5	23354	genome.wustl.edu	37	19	36110636	36110636	+	Missense_Mutation	SNP	C	C	G	rs368308747		TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr19:36110636C>G	ENST00000203166.5	+	15	1407	c.1382C>G	c.(1381-1383)aCg>aGg	p.T461R	HAUS5_ENST00000379045.2_3'UTR	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	461					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						CTGTTGGGCACGCTGCTGCGG	0.632																																						dbGAP											0													20.0	23.0	22.0					19																	36110636		2112	4221	6333	-	-	-	SO:0001583	missense	0			AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.1382C>G	19.37:g.36110636C>G	ENSP00000439056:p.Thr461Arg		B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Missense_Mutation	SNP	NULL	p.T461R	ENST00000203166.5	37	c.1382	CCDS42550.1	19	.	.	.	.	.	.	.	.	.	.	C	9.580	1.123210	0.20959	.	.	ENSG00000249115	ENST00000203166	T	0.32023	1.47	4.49	3.43	0.39272	.	0.805472	0.11587	N	0.549135	T	0.28599	0.0708	L	0.40543	1.245	0.43808	D	0.996361	P	0.46142	0.873	B	0.42882	0.401	T	0.04440	-1.0951	10	0.59425	D	0.04	-10.8275	10.2232	0.43209	0.0:0.7985:0.2015:0.0	.	461	O94927	HAUS5_HUMAN	R	461	ENSP00000439056:T461R	ENSP00000439056:T461R	T	+	2	0	HAUS5	40802476	0.111000	0.22076	0.800000	0.32199	0.057000	0.15508	0.744000	0.26245	1.074000	0.40909	0.556000	0.70494	ACG	HAUS5	-	NULL	ENSG00000249115		0.632	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS5	HGNC	protein_coding	OTTHUMT00000459055.2	8	0.00	0	C			36110636	36110636	+1	no_errors	ENST00000203166	ensembl	human	known	69_37n	missense	26	29.73	11	SNP	0.655	G
HIST1H3D	8351	genome.wustl.edu	37	6	26197245	26197245	+	Missense_Mutation	SNP	G	G	T	rs376537131		TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr6:26197245G>T	ENST00000356476.2	-	1	233	c.234C>A	c.(232-234)gaC>gaA	p.D78E	HIST1H2BF_ENST00000359985.1_5'Flank|HIST1H3D_ENST00000377831.5_Missense_Mutation_p.D78E			P68431	H31_HUMAN	histone cluster 1, H3d	78					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)	14		all_hematologic(11;0.196)				CAGTCTTGAAGTCCTGCGCGA	0.612																																					GBM(108;3816 4467)	dbGAP											0													77.0	74.0	75.0					6																	26197245		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z80784	CCDS4590.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197409	ENSG00000197409		"""Histones / Replication-dependent"""	4767	protein-coding gene	gene with protein product		602811	"""H3 histone family, member B"", ""histone 1, H3d"""	H3FB		9119399, 12408966	Standard	NM_003530		Approved	H3/b	uc003ngv.4	P68431	OTTHUMG00000014433	ENST00000356476.2:c.234C>A	6.37:g.26197245G>T	ENSP00000366999:p.Asp78Glu		A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.D78E	ENST00000356476.2	37	c.234	CCDS4590.1	6	.	.	.	.	.	.	.	.	.	.	.	9.640	1.138687	0.21123	.	.	ENSG00000197409	ENST00000356476;ENST00000377831	T;T	0.67171	-0.25;-0.25	4.24	1.42	0.22433	.	.	.	.	.	T	0.54319	0.1851	.	.	.	0.25959	N	0.982648	.	.	.	.	.	.	T	0.53114	-0.8484	6	0.66056	D	0.02	.	12.6413	0.56711	0.1405:0.0:0.8595:0.0	.	.	.	.	E	78	ENSP00000366999:D78E;ENSP00000367062:D78E	ENSP00000366999:D78E	D	-	3	2	HIST1H3D	26305224	1.000000	0.71417	0.999000	0.59377	0.440000	0.31957	2.570000	0.45981	0.043000	0.15746	-1.708000	0.00717	GAC	HIST1H3D	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3	ENSG00000197409		0.612	HIST1H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3D	HGNC	protein_coding	OTTHUMT00000040096.1	53	0.00	0	G	NM_003530		26197245	26197245	-1	no_errors	ENST00000356476	ensembl	human	known	69_37n	missense	46	60.34	70	SNP	1.000	T
HM13	81502	genome.wustl.edu	37	20	30137882	30137882	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr20:30137882G>T	ENST00000340852.5	+	7	806	c.682G>T	c.(682-684)Gtg>Ttg	p.V228L	HM13_ENST00000398174.3_Missense_Mutation_p.V228L|HM13_ENST00000492709.1_3'UTR|HM13_ENST00000335574.5_Missense_Mutation_p.V228L|HM13_ENST00000376127.3_Missense_Mutation_p.V186L	NM_030789.2	NP_110416.1	Q8TCT9	HM13_HUMAN	histocompatibility (minor) 13	228					membrane protein proteolysis (GO:0033619)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			TGGCACCAATGTGATGGTGAC	0.557																																						dbGAP											0													226.0	207.0	213.0					20																	30137882		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL110115	CCDS13182.1, CCDS13183.1, CCDS42861.1	20q11.21	2012-02-21			ENSG00000101294	ENSG00000101294			16435	protein-coding gene	gene with protein product	"""signal peptide peptidase beta"", ""presenilin-like protein 3"", ""intramembrane protease"", ""signal peptide peptidase like 1"""	607106				12077416, 14704149	Standard	NM_030789		Approved	H13, dJ324O17.1, SPP, PSL3, IMP1, IMPAS, PSENL3, SPPL1	uc002wwc.3	Q8TCT9	OTTHUMG00000032175	ENST00000340852.5:c.682G>T	20.37:g.30137882G>T	ENSP00000343032:p.Val228Leu		B2RAY5|E1P5L3|Q15K36|Q540H8|Q5JWP2|Q5JWP3|Q5JWP4|Q5JWP5|Q7Z4F2|Q86Y35|Q95H87|Q9H110|Q9H111	Missense_Mutation	SNP	pfam_Peptidase_A22B_SPP,smart_Peptidase_A22	p.V228L	ENST00000340852.5	37	c.682	CCDS13182.1	20	.	.	.	.	.	.	.	.	.	.	G	34	5.299339	0.95574	.	.	ENSG00000101294	ENST00000335574;ENST00000340852;ENST00000398174;ENST00000376127;ENST00000344042	T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46	5.01	5.01	0.66863	.	0.108371	0.64402	D	0.000006	T	0.57154	0.2034	M	0.82923	2.615	0.80722	D	1	D;D;D	0.60160	0.971;0.987;0.969	P;P;P	0.62382	0.9;0.901;0.891	T	0.61657	-0.7018	10	0.52906	T	0.07	-16.7548	17.5052	0.87743	0.0:0.0:1.0:0.0	.	228;228;228	Q8TCT9;Q8TCT9-4;Q8TCT9-2	HM13_HUMAN;.;.	L	228;228;228;186;186	ENSP00000335294:V228L;ENSP00000343032:V228L;ENSP00000381237:V228L;ENSP00000365296:V186L;ENSP00000341347:V186L	ENSP00000335294:V228L	V	+	1	0	HM13	29601543	1.000000	0.71417	0.988000	0.46212	0.988000	0.76386	8.945000	0.92985	2.605000	0.88082	0.655000	0.94253	GTG	HM13	-	pfam_Peptidase_A22B_SPP,smart_Peptidase_A22	ENSG00000101294		0.557	HM13-011	KNOWN	basic|appris_principal|CCDS	protein_coding	HM13	HGNC	protein_coding	OTTHUMT00000078527.2	244	0.41	1	G	NM_178580		30137882	30137882	+1	no_errors	ENST00000398174	ensembl	human	known	69_37n	missense	158	23.67	49	SNP	1.000	T
HNRNPH2	3188	genome.wustl.edu	37	X	100667034	100667034	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chrX:100667034T>A	ENST00000316594.5	+	2	136	c.58T>A	c.(58-60)Tgg>Agg	p.W20R	RPL36A-HNRNPH2_ENST00000409170.3_3'UTR	NM_001032393.2|NM_001199973.1|NM_001199974.1|NM_019597.4	NP_001027565.1|NP_001186902.1|NP_001186903.1|NP_062543.1	P55795	HNRH2_HUMAN	heterogeneous nuclear ribonucleoprotein H2 (H')	20	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|large_intestine(2)|lung(6)|skin(1)	12						GGGCCTACCCTGGTCCTGCTC	0.527																																						dbGAP											0													144.0	115.0	125.0					X																	100667034		2203	4300	6503	-	-	-	SO:0001583	missense	0			U01923	CCDS14485.1	Xq22	2013-02-12		2008-04-18	ENSG00000126945	ENSG00000126945		"""RNA binding motif (RRM) containing"""	5042	protein-coding gene	gene with protein product		300610		HNRPH2		7499401	Standard	NM_019597		Approved	hnRNPH', FTP3, HNRPH'	uc004ehn.3	P55795	OTTHUMG00000022029	ENST00000316594.5:c.58T>A	X.37:g.100667034T>A	ENSP00000361927:p.Trp20Arg		A1L400|Q9HHA7	Missense_Mutation	SNP	pfam_RRM_dom,pfam_Znf_CHHC,smart_RRM_dom,pfscan_RRM_dom	p.W20R	ENST00000316594.5	37	c.58	CCDS14485.1	X	.	.	.	.	.	.	.	.	.	.	T	15.65	2.895828	0.52121	.	.	ENSG00000126945	ENST00000457902;ENST00000316594	T	0.29142	1.58	5.1	3.85	0.44370	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.57636	0.2067	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63985	-0.6513	10	0.87932	D	0	-4.2278	9.073	0.36504	0.0:0.0:0.1822:0.8178	.	20	P55795	HNRH2_HUMAN	R	20	ENSP00000361927:W20R	ENSP00000361927:W20R	W	+	1	0	HNRNPH2	100553690	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.988000	0.88194	1.821000	0.53095	0.486000	0.48141	TGG	HNRNPH2	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000126945		0.527	HNRNPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPH2	HGNC	protein_coding	OTTHUMT00000057556.1	166	0.00	0	T	NM_019597		100667034	100667034	+1	no_errors	ENST00000316594	ensembl	human	known	69_37n	missense	166	24.89	56	SNP	1.000	A
IL17RB	55540	genome.wustl.edu	37	3	53899288	53899288	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr3:53899288G>A	ENST00000288167.3	+	11	1471	c.1462G>A	c.(1462-1464)Gca>Aca	p.A488T		NM_018725.3	NP_061195.2	Q9NRM6	I17RB_HUMAN	interleukin 17 receptor B	488				Missing (in Ref. 2; AA sequence). {ECO:0000305}.	cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|regulation of cell growth (GO:0001558)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)			breast(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		GCAGGTGTCAGCAGGAAAAAG	0.507																																						dbGAP											0													42.0	38.0	39.0					3																	53899288		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF212365	CCDS2874.1	3p21.1	2008-02-05		2003-07-09	ENSG00000056736	ENSG00000056736		"""Interleukins and interleukin receptors"""	18015	protein-coding gene	gene with protein product		605458	"""interleukin 17B receptor"""	IL17BR		10749887, 10815801	Standard	NM_018725		Approved	IL17RH1, EVI27, CRL4	uc003dha.3	Q9NRM6	OTTHUMG00000158280	ENST00000288167.3:c.1462G>A	3.37:g.53899288G>A	ENSP00000288167:p.Ala488Thr		Q9BPZ0|Q9NRL4|Q9NRM5	Missense_Mutation	SNP	pfam_SEFIR	p.A488T	ENST00000288167.3	37	c.1462	CCDS2874.1	3	.	.	.	.	.	.	.	.	.	.	G	10.86	1.468643	0.26335	.	.	ENSG00000056736	ENST00000288167	T	0.07114	3.22	4.86	-3.72	0.04411	.	2.540010	0.01556	N	0.019908	T	0.04497	0.0123	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.36359	-0.9751	10	0.46703	T	0.11	2.9531	0.141	0.00083	0.3099:0.2352:0.2154:0.2394	.	488	Q9NRM6	I17RB_HUMAN	T	488	ENSP00000288167:A488T	ENSP00000288167:A488T	A	+	1	0	IL17RB	53874328	0.000000	0.05858	0.000000	0.03702	0.505000	0.33919	-0.516000	0.06282	-0.498000	0.06632	0.650000	0.86243	GCA	IL17RB	-	NULL	ENSG00000056736		0.507	IL17RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RB	HGNC	protein_coding	OTTHUMT00000350563.1	49	0.00	0	G	NM_172234		53899288	53899288	+1	no_errors	ENST00000288167	ensembl	human	known	69_37n	missense	24	52.94	27	SNP	0.000	A
IL7R	3575	genome.wustl.edu	37	5	35871268	35871268	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr5:35871268A>G	ENST00000303115.3	+	4	619	c.490A>G	c.(490-492)Atg>Gtg	p.M164V	IL7R_ENST00000343305.4_Missense_Mutation_p.M164V|IL7R_ENST00000506850.1_Missense_Mutation_p.M164V	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	164	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			AAAAGTTTTAATGCACGATGT	0.358			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																															dbGAP		Dom	yes		5	5p13	146661	interleukin 7 receptor	yes	L	0													74.0	73.0	74.0					5																	35871268		2203	4300	6503	-	-	-	SO:0001583	missense	0			M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.490A>G	5.37:g.35871268A>G	ENSP00000306157:p.Met164Val		B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3	p.M164V	ENST00000303115.3	37	c.490	CCDS3911.1	5	.	.	.	.	.	.	.	.	.	.	A	4.214	0.038525	0.08148	.	.	ENSG00000168685	ENST00000303115;ENST00000343305;ENST00000506850	T;T;T	0.56275	0.47;0.47;0.47	5.56	-4.41	0.03590	Fibronectin, type III (2);Immunoglobulin-like fold (1);	1.331630	0.04199	N	0.329718	T	0.22205	0.0535	N	0.04508	-0.205	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.04013	0.001;0.001	T	0.06881	-1.0802	10	0.15066	T	0.55	-0.0756	1.0453	0.01568	0.3215:0.1348:0.3261:0.2175	.	164;164	D6RGV2;P16871	.;IL7RA_HUMAN	V	164	ENSP00000306157:M164V;ENSP00000345819:M164V;ENSP00000421207:M164V	ENSP00000306157:M164V	M	+	1	0	IL7R	35907025	0.008000	0.16893	0.016000	0.15963	0.535000	0.34838	-0.221000	0.09202	-0.755000	0.04709	0.533000	0.62120	ATG	IL7R	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3	ENSG00000168685		0.358	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL7R	HGNC	protein_coding	OTTHUMT00000207577.2	222	0.00	0	A			35871268	35871268	+1	no_errors	ENST00000303115	ensembl	human	known	69_37n	missense	45	49.44	44	SNP	0.069	G
ITPK1	3705	genome.wustl.edu	37	14	93412701	93412701	+	Silent	SNP	G	G	C			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr14:93412701G>C	ENST00000267615.6	-	10	1049	c.876C>G	c.(874-876)gcC>gcG	p.A292A	ITPK1_ENST00000556954.1_5'UTR|ITPK1_ENST00000556603.2_Silent_p.A292A|ITPK1_ENST00000354313.3_Silent_p.A292A|ITPK1_ENST00000555495.1_Silent_p.A173A			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	292	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		TGTCAATGACGGCGTGCTGCC	0.642																																						dbGAP											0													129.0	113.0	118.0					14																	93412701		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.876C>G	14.37:g.93412701G>C			Q9BTL6|Q9H2E7	Silent	SNP	pfam_Inositol_tetrakis-P_1-kinase	p.A292	ENST00000267615.6	37	c.876	CCDS9907.1	14																																																																																			ITPK1	-	pfam_Inositol_tetrakis-P_1-kinase	ENSG00000100605		0.642	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPK1	HGNC	protein_coding	OTTHUMT00000412421.2	28	0.00	0	G	NM_014216		93412701	93412701	-1	no_errors	ENST00000267615	ensembl	human	known	69_37n	silent	23	74.44	67	SNP	0.003	C
KLK5	25818	genome.wustl.edu	37	19	51452007	51452007	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr19:51452007C>A	ENST00000336334.3	-	5	967	c.615G>T	c.(613-615)caG>caT	p.Q205H	CTB-147C22.8_ENST00000601506.1_RNA|KLK5_ENST00000391809.2_Missense_Mutation_p.Q205H|KLK5_ENST00000593428.1_Missense_Mutation_p.Q205H|CTB-147C22.8_ENST00000594939.1_RNA	NM_012427.4	NP_036559	Q9Y337	KLK5_HUMAN	kallikrein-related peptidase 5	205	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				epidermis development (GO:0008544)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	epidermal lamellar body (GO:0097209)|extracellular space (GO:0005615)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	15		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00379)|GBM - Glioblastoma multiforme(134;0.00888)		TATTCAAGCACTGGAGGACCT	0.502																																						dbGAP											0													121.0	107.0	112.0					19																	51452007		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF135028	CCDS12810.1	19q13.33	2008-02-05	2006-10-27			ENSG00000167754		"""Kallikreins"""	6366	protein-coding gene	gene with protein product		605643	"""kallikrein 5"""			10514489, 10608802, 1680072, 4, 16800723, 17012259	Standard	NM_012427		Approved	SCTE, KLK-L2	uc002puf.3	Q9Y337		ENST00000336334.3:c.615G>T	19.37:g.51452007C>A	ENSP00000337733:p.Gln205His		Q53ZR3|Q9HBG8	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.Q205H	ENST00000336334.3	37	c.615	CCDS12810.1	19	.	.	.	.	.	.	.	.	.	.	c	11.96	1.794391	0.31777	.	.	ENSG00000167754	ENST00000336334;ENST00000391809	D;D	0.94092	-3.35;-3.35	4.67	-0.107	0.13592	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.31612	U	0.007351	D	0.93363	0.7884	L	0.50333	1.59	0.36853	D	0.887988	D	0.89917	1.0	D	0.91635	0.999	D	0.90578	0.4527	10	0.42905	T	0.14	.	5.8969	0.18945	0.0:0.6057:0.1404:0.2539	.	205	Q9Y337	KLK5_HUMAN	H	205	ENSP00000337733:Q205H;ENSP00000375685:Q205H	ENSP00000337733:Q205H	Q	-	3	2	KLK5	56143819	1.000000	0.71417	0.740000	0.30986	0.006000	0.05464	3.484000	0.53201	0.174000	0.19809	-0.176000	0.13171	CAG	KLK5	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000167754		0.502	KLK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK5	HGNC	protein_coding	OTTHUMT00000465057.1	198	0.00	0	C	NM_012427		51452007	51452007	-1	no_errors	ENST00000336334	ensembl	human	known	69_37n	missense	164	35.43	90	SNP	0.996	A
MGAM	8972	genome.wustl.edu	37	7	141752213	141752213	+	Silent	SNP	C	C	T	rs386718585|rs2961085	byFrequency	TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr7:141752213C>T	ENST00000549489.2	+	25	3020	c.2925C>T	c.(2923-2925)gcC>gcT	p.A975A	MGAM_ENST00000475668.2_Silent_p.A975A	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	975	P-type 2. {ECO:0000255|PROSITE- ProRule:PRU00779}.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.A975A(1)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GTGCTTCTGCCGAAAACTGCA	0.448																																						dbGAP											1	Substitution - coding silent(1)	stomach(1)											76.0	70.0	72.0					7																	141752213		1955	4143	6098	-	-	-	SO:0001819	synonymous_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.2925C>T	7.37:g.141752213C>T			Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.A975	ENST00000549489.2	37	c.2925	CCDS47727.1	7																																																																																			MGAM	-	pfam_P_trefoil,smart_P_trefoil	ENSG00000257335		0.448	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	165	0.00	0	C			141752213	141752213	+1	no_errors	ENST00000549489	ensembl	human	known	69_37n	silent	100	34.21	52	SNP	0.094	T
MGAM	8972	genome.wustl.edu	37	7	141783171	141783171	+	Intron	SNP	C	C	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr7:141783171C>T	ENST00000549489.2	+	39	4713				MGAM_ENST00000475668.2_Silent_p.F2113F	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTTATGTGTTCTTGGGGCCAA	0.468																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4619-11249C>T	7.37:g.141783171C>T			Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.F2114	ENST00000549489.2	37	c.6342	CCDS47727.1	7																																																																																			MGAM	-	pfam_Glyco_hydro_31,superfamily_Glyco_hydro-type_carb-bd	ENSG00000257335		0.468	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	194	0.00	0	C			141783171	141783171	+1	no_errors	ENST00000475668	ensembl	human	putative	69_37n	silent	88	39.73	58	SNP	0.982	T
MYCBPAP	84073	genome.wustl.edu	37	17	48600415	48600415	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr17:48600415G>A	ENST00000323776.5	+	11	1664	c.1502G>A	c.(1501-1503)cGg>cAg	p.R501Q	MYCBPAP_ENST00000436259.2_Missense_Mutation_p.R464Q	NM_032133.4	NP_115509.4			MYCBP associated protein											breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			GACTGGCGACGGCAGCACCAG	0.512																																						dbGAP											0													107.0	105.0	105.0					17																	48600415		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.1502G>A	17.37:g.48600415G>A	ENSP00000323184:p.Arg501Gln			Missense_Mutation	SNP	NULL	p.R501Q	ENST00000323776.5	37	c.1502	CCDS32680.2	17	.	.	.	.	.	.	.	.	.	.	G	33	5.202248	0.94997	.	.	ENSG00000136449	ENST00000323776;ENST00000436259	T;T	0.41065	1.01;1.01	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.67933	0.2946	M	0.79475	2.455	0.43141	D	0.994892	D	0.89917	1.0	D	0.74674	0.984	T	0.69476	-0.5135	10	0.62326	D	0.03	-30.7076	20.1067	0.97897	0.0:0.0:1.0:0.0	.	464	Q8TBZ2	MYBPP_HUMAN	Q	501;464	ENSP00000323184:R501Q;ENSP00000397209:R464Q	ENSP00000323184:R501Q	R	+	2	0	MYCBPAP	45955414	1.000000	0.71417	0.690000	0.30148	0.688000	0.40055	7.174000	0.77620	2.753000	0.94483	0.655000	0.94253	CGG	MYCBPAP	-	NULL	ENSG00000136449		0.512	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYCBPAP	HGNC	protein_coding	OTTHUMT00000347814.1	80	0.00	0	G	NM_032133		48600415	48600415	+1	no_errors	ENST00000323776	ensembl	human	known	69_37n	missense	125	25.15	42	SNP	0.969	A
MYH9	4627	genome.wustl.edu	37	22	36696999	36696999	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr22:36696999T>G	ENST00000216181.5	-	22	2966	c.2736A>C	c.(2734-2736)gaA>gaC	p.E912D		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	912					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						TCTCTTCTAATTCCTGCTTCT	0.607			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																													dbGAP		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													86.0	93.0	90.0					22																	36696999		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2736A>C	22.37:g.36696999T>G	ENSP00000216181:p.Glu912Asp		A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.E912D	ENST00000216181.5	37	c.2736	CCDS13927.1	22	.	.	.	.	.	.	.	.	.	.	T	16.60	3.168571	0.57584	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	D	0.95853	-3.83	5.2	3.04	0.35103	.	0.000000	0.85682	D	0.000000	D	0.96081	0.8723	M	0.64676	1.99	0.80722	D	1	D	0.61080	0.989	D	0.63488	0.915	D	0.95028	0.8166	10	0.87932	D	0	.	8.5907	0.33686	0.0:0.6857:0.0:0.3143	.	912	P35579	MYH9_HUMAN	D	776;912	ENSP00000216181:E912D	ENSP00000216181:E912D	E	-	3	2	MYH9	35026945	1.000000	0.71417	1.000000	0.80357	0.401000	0.30781	2.157000	0.42320	0.702000	0.31825	-0.904000	0.02843	GAA	MYH9	-	NULL	ENSG00000100345		0.607	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	39	0.00	0	T	NM_002473		36696999	36696999	-1	no_errors	ENST00000216181	ensembl	human	known	69_37n	missense	62	38.61	39	SNP	1.000	G
NOS2	4843	genome.wustl.edu	37	17	26087755	26087755	+	Silent	SNP	G	G	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr17:26087755G>A	ENST00000313735.6	-	24	3137	c.2904C>T	c.(2902-2904)caC>caT	p.H968H		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	968	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	CCTCGGGGAGGTGGAAGCCGC	0.657											OREG0024268	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													17.0	15.0	15.0					17																	26087755		2026	3930	5956	-	-	-	SO:0001819	synonymous_variant	0			U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.2904C>T	17.37:g.26087755G>A		784	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Silent	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_met,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.H968	ENST00000313735.6	37	c.2904	CCDS11223.1	17	.	.	.	.	.	.	.	.	.	.	G	0.135	-1.108836	0.01813	.	.	ENSG00000007171	ENST00000302153	.	.	.	4.59	1.08	0.20341	.	.	.	.	.	T	0.63295	0.2499	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63545	-0.6613	5	0.62326	D	0.03	.	9.3303	0.38018	0.2497:0.3756:0.3747:0.0	.	.	.	.	I	688	.	ENSP00000305638:T688I	T	-	2	0	NOS2	23111882	0.942000	0.31987	0.999000	0.59377	0.092000	0.18411	0.003000	0.13083	0.367000	0.24454	-1.450000	0.01041	ACC	NOS2	-	pirsf_NOS_met	ENSG00000007171		0.657	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS2	HGNC	protein_coding	OTTHUMT00000255597.1	16	0.00	0	G	NM_000625		26087755	26087755	-1	no_errors	ENST00000313735	ensembl	human	known	69_37n	silent	54	31.65	25	SNP	0.870	A
OBSCN	84033	genome.wustl.edu	37	1	228402602	228402602	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr1:228402602C>G	ENST00000422127.1	+	5	1675	c.1631C>G	c.(1630-1632)aCt>aGt	p.T544S	OBSCN_ENST00000570156.2_Missense_Mutation_p.T544S|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.T544S|C1orf145_ENST00000295012.5_5'Flank|OBSCN_ENST00000366709.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	544	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CGCCCTGTCACTATCGACGGC	0.597																																						dbGAP											0													57.0	65.0	63.0					1																	228402602		2026	4184	6210	-	-	-	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.1631C>G	1.37:g.228402602C>G	ENSP00000409493:p.Thr544Ser		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.T544S	ENST00000422127.1	37	c.1631	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	C	9.431	1.085443	0.20390	.	.	ENSG00000154358	ENST00000284548;ENST00000422127	T;T	0.56611	0.45;0.45	5.51	4.58	0.56647	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.572117	0.17744	N	0.163448	T	0.47930	0.1472	L	0.53249	1.67	0.80722	D	1	B;B	0.22146	0.065;0.053	B;B	0.19391	0.025;0.015	T	0.38373	-0.9664	10	0.15066	T	0.55	.	15.4891	0.75590	0.1397:0.8603:0.0:0.0	.	544;544	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	S	544	ENSP00000284548:T544S;ENSP00000409493:T544S	ENSP00000284548:T544S	T	+	2	0	OBSCN	226469225	0.826000	0.29277	0.003000	0.11579	0.033000	0.12548	3.926000	0.56491	1.287000	0.44583	0.655000	0.94253	ACT	OBSCN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000154358		0.597	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		45	0.00	0	C	NM_052843		228402602	228402602	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	missense	135	17.07	28	SNP	0.968	G
OR2AG2	338755	genome.wustl.edu	37	11	6790159	6790159	+	Silent	SNP	G	G	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr11:6790159G>A	ENST00000338569.2	-	1	127	c.30C>T	c.(28-30)agC>agT	p.S10S		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	10						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S10S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AGATGAAGCCGCTTCCCAAGG	0.443																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)											77.0	77.0	77.0					11																	6790159		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.30C>T	11.37:g.6790159G>A				Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S10	ENST00000338569.2	37	c.30	CCDS31413.1	11																																																																																			OR2AG2	-	NULL	ENSG00000188124		0.443	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AG2	HGNC	protein_coding	OTTHUMT00000386775.1	237	0.42	1	G	NM_001004490		6790159	6790159	-1	no_errors	ENST00000338569	ensembl	human	novel	69_37n	silent	104	27.08	39	SNP	0.079	A
TENM4	26011	genome.wustl.edu	37	11	78369780	78369780	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr11:78369780A>G	ENST00000278550.7	-	34	8095	c.7633T>C	c.(7633-7635)Tcc>Ccc	p.S2545P		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2545					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GTGATTGTGGAGCCATAGAGC	0.542																																						dbGAP											0													65.0	68.0	67.0					11																	78369780		1998	4160	6158	-	-	-	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.7633T>C	11.37:g.78369780A>G	ENSP00000278550:p.Ser2545Pro		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.S2545P	ENST00000278550.7	37	c.7633	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	A	10.73	1.431203	0.25726	.	.	ENSG00000149256	ENST00000278550	D	0.90324	-2.65	5.35	2.94	0.34122	.	0.199992	0.43110	D	0.000605	T	0.81740	0.4886	L	0.27053	0.805	0.41562	D	0.988638	P	0.39391	0.671	B	0.35470	0.203	T	0.75411	-0.3327	9	.	.	.	.	10.5721	0.45206	0.7427:0.0:0.0:0.2573	.	2545	Q6N022	TEN4_HUMAN	P	2545	ENSP00000278550:S2545P	.	S	-	1	0	ODZ4	78047428	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	4.310000	0.59141	0.425000	0.26087	0.533000	0.62120	TCC	ODZ4	-	NULL	ENSG00000149256		0.542	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ4	HGNC	protein_coding	OTTHUMT00000391406.2	73	0.00	0	A			78369780	78369780	-1	no_errors	ENST00000278550	ensembl	human	known	69_37n	missense	94	12.96	14	SNP	1.000	G
PDCD11	22984	genome.wustl.edu	37	10	105173788	105173788	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr10:105173788C>G	ENST00000369797.3	+	10	1345	c.1251C>G	c.(1249-1251)caC>caG	p.H417Q		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	417	S1 motif 4. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GGAACACTCACAAGTGTAGAA	0.468																																						dbGAP											0													138.0	122.0	127.0					10																	105173788		2203	4300	6503	-	-	-	SO:0001583	missense	0			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.1251C>G	10.37:g.105173788C>G	ENSP00000358812:p.His417Gln		Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Suf,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,smart_HAT,pfscan_TPR-contain_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,prints_Ribosomal_S1	p.H417Q	ENST00000369797.3	37	c.1251	CCDS31276.1	10	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604083	0.66445	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.16897	2.31	5.55	3.69	0.42338	Nucleic acid-binding, OB-fold-like (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.37489	0.1005	M	0.81942	2.565	0.50813	D	0.999893	D	0.89917	1.0	D	0.81914	0.995	T	0.14783	-1.0460	10	0.52906	T	0.07	-18.1576	5.8179	0.18506	0.0:0.6942:0.0:0.3058	.	417	Q14690	RRP5_HUMAN	Q	417	ENSP00000358812:H417Q	ENSP00000358812:H417Q	H	+	3	2	PDCD11	105163778	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	0.757000	0.26433	1.357000	0.45904	-0.291000	0.09656	CAC	PDCD11	-	superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	ENSG00000148843		0.468	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD11	HGNC	protein_coding	OTTHUMT00000050151.1	181	0.00	0	C			105173788	105173788	+1	no_errors	ENST00000369797	ensembl	human	known	69_37n	missense	37	68.10	79	SNP	1.000	G
PDE4DIP	9659	genome.wustl.edu	37	1	144930847	144930847	+	Intron	SNP	G	G	C			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr1:144930847G>C	ENST00000369354.3	-	6	826				PDE4DIP_ENST00000530740.1_Intron|PDE4DIP_ENST00000479408.2_Intron|PDE4DIP_ENST00000369351.3_Intron|PDE4DIP_ENST00000313382.9_Intron|PDE4DIP_ENST00000369349.3_Intron|PDE4DIP_ENST00000529945.1_Missense_Mutation_p.L288V|PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000369356.4_Intron|PDE4DIP_ENST00000313431.9_Missense_Mutation_p.L288V			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GCTAATTCCAGCTTGTGATTA	0.483			T	PDGFRB	MPD																																	dbGAP		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													147.0	146.0	146.0					1																	144930847		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.637-7026C>G	1.37:g.144930847G>C			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L288V	ENST00000369354.3	37	c.862	CCDS30824.1	1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.896025	0.33442	.	.	ENSG00000178104	ENST00000369353;ENST00000313431;ENST00000529945	T;T	0.15017	2.46;2.46	5.49	4.58	0.56647	.	.	.	.	.	T	0.20414	0.0491	L	0.58810	1.83	0.80722	D	1	D	0.71674	0.998	D	0.66084	0.941	T	0.01863	-1.1258	9	0.39692	T	0.17	.	8.6893	0.34256	0.1723:0.0:0.8277:0.0	.	288	Q5VU43-2	.	V	288	ENSP00000316434:L288V;ENSP00000433392:L288V	ENSP00000316434:L288V	L	-	1	2	PDE4DIP	143642204	1.000000	0.71417	1.000000	0.80357	0.191000	0.23601	1.852000	0.39348	1.337000	0.45525	-0.225000	0.12378	CTG	PDE4DIP	-	NULL	ENSG00000178104		0.483	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	98	0.00	0	G	NM_022359		144930847	144930847	-1	no_errors	ENST00000313431	ensembl	human	known	69_37n	missense	201	15.19	36	SNP	1.000	C
PDHA2	5161	genome.wustl.edu	37	4	96762083	96762083	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr4:96762083G>A	ENST00000295266.4	+	1	845	c.782G>A	c.(781-783)cGt>cAt	p.R261H		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	261					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		CTGTGTGTTCGTGAGGCAACA	0.473																																						dbGAP											0													148.0	147.0	147.0					4																	96762083		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.782G>A	4.37:g.96762083G>A	ENSP00000295266:p.Arg261His		B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	p.R261H	ENST00000295266.4	37	c.782	CCDS3644.1	4	.	.	.	.	.	.	.	.	.	.	G	18.49	3.635923	0.67130	.	.	ENSG00000163114	ENST00000295266	D	0.95885	-3.84	4.91	4.06	0.47325	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.96346	0.8808	L	0.53561	1.675	0.53005	D	0.999965	D	0.89917	1.0	D	0.91635	0.999	D	0.95644	0.8701	10	0.87932	D	0	-18.3149	11.0734	0.48016	0.0921:0.0:0.9079:0.0	.	261	P29803	ODPAT_HUMAN	H	261	ENSP00000295266:R261H	ENSP00000295266:R261H	R	+	2	0	PDHA2	96981106	0.848000	0.29623	0.782000	0.31804	0.637000	0.38172	4.724000	0.61972	2.733000	0.93635	0.467000	0.42956	CGT	PDHA2	-	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	ENSG00000163114		0.473	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDHA2	HGNC	protein_coding	OTTHUMT00000253608.1	437	0.00	0	G			96762083	96762083	+1	no_errors	ENST00000295266	ensembl	human	known	69_37n	missense	199	24.33	64	SNP	0.696	A
PGLYRP2	114770	genome.wustl.edu	37	19	15586540	15586540	+	Frame_Shift_Del	DEL	A	A	-			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr19:15586540delA	ENST00000340880.4	-	2	1421	c.941delT	c.(940-942)ttcfs	p.F314fs	PGLYRP2_ENST00000292609.4_Frame_Shift_Del_p.F314fs	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	314					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						GTTGCTGCGGAACCCTGGGTC	0.627																																						dbGAP											0													40.0	40.0	40.0					19																	15586540		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.941delT	19.37:g.15586540delA	ENSP00000345968:p.Phe314fs		A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Frame_Shift_Del	DEL	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.F314fs	ENST00000340880.4	37	c.941	CCDS12330.2	19																																																																																			PGLYRP2	-	NULL	ENSG00000161031		0.627	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLYRP2	HGNC	protein_coding	OTTHUMT00000319626.1	14	0.00	0	A	NM_052890		15586540	15586540	-1	no_errors	ENST00000292609	ensembl	human	known	69_37n	frame_shift_del	40	46.75	36	DEL	0.225	-
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	191	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	43	80.45	177	SNP	1.000	G
PLA2G2D	26279	genome.wustl.edu	37	1	20442903	20442903	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr1:20442903C>T	ENST00000375105.3	-	2	166	c.108G>A	c.(106-108)atG>atA	p.M36I		NM_012400.2	NP_036532.1	Q9UNK4	PA2GD_HUMAN	phospholipase A2, group IID	36					glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			endometrium(1)|lung(2)	3		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000798)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AGAGGATGGGCATTTTCCCAG	0.572										Multiple Myeloma(11;0.12)																											Melanoma(60;742 1548 31762 39240)	dbGAP											0													144.0	123.0	130.0					1																	20442903		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF112982	CCDS203.1, CCDS72721.1	1p36.12	2008-09-19			ENSG00000117215	ENSG00000117215	3.1.1.4		9033	protein-coding gene	gene with protein product		605630				10455175	Standard	NM_012400		Approved	sPLA2S	uc001bcz.4	Q9UNK4	OTTHUMG00000002701	ENST00000375105.3:c.108G>A	1.37:g.20442903C>T	ENSP00000364246:p.Met36Ile		A8K2Z1|B1AEL9|Q9UK01	Missense_Mutation	SNP	pfam_PLipase_A2_euk,superfamily_PLipase_A2,smart_PLipase_A2,prints_PLipase_A2_euk	p.M36I	ENST00000375105.3	37	c.108	CCDS203.1	1	.	.	.	.	.	.	.	.	.	.	C	6.166	0.398752	0.11696	.	.	ENSG00000117215	ENST00000375105	T	0.26223	1.75	5.19	-10.4	0.00318	Phospholipase A2 (3);	1.598300	0.03369	N	0.198648	T	0.06917	0.0176	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26883	-1.0090	10	0.35671	T	0.21	0.1434	4.249	0.10686	0.1114:0.2464:0.478:0.1642	.	36	Q9UNK4	PA2GD_HUMAN	I	36	ENSP00000364246:M36I	ENSP00000364246:M36I	M	-	3	0	PLA2G2D	20315490	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.223000	0.01214	-1.206000	0.02641	-0.459000	0.05422	ATG	PLA2G2D	-	pfam_PLipase_A2_euk,superfamily_PLipase_A2,smart_PLipase_A2	ENSG00000117215		0.572	PLA2G2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G2D	HGNC	protein_coding	OTTHUMT00000007683.1	127	0.00	0	C			20442903	20442903	-1	no_errors	ENST00000375105	ensembl	human	known	69_37n	missense	65	50.72	70	SNP	0.000	T
PSME1	5720	genome.wustl.edu	37	14	24605501	24605501	+	Silent	SNP	C	C	G			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr14:24605501C>G	ENST00000206451.6	+	1	135	c.30C>G	c.(28-30)gcC>gcG	p.A10A	PSME1_ENST00000559123.1_5'UTR|PSME1_ENST00000561435.1_Silent_p.A10A|PSME1_ENST00000470718.1_3'UTR|PSME1_ENST00000382708.3_Silent_p.A10A	NM_001281528.1|NM_006263.2	NP_001268457.1|NP_006254.1	Q06323	PSME1_HUMAN	proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)	10					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(265;0.00831)		AGCCCGAGGCCCAAGCCAAGG	0.726																																						dbGAP											0													10.0	12.0	11.0					14																	24605501		2154	4224	6378	-	-	-	SO:0001819	synonymous_variant	0				CCDS9612.1, CCDS41930.1, CCDS61415.1	14q11.2	2008-08-29			ENSG00000092010	ENSG00000092010		"""Proteasome (prosome, macropain) subunits"""	9568	protein-coding gene	gene with protein product		600654				8269930	Standard	NM_006263		Approved	IFI5111, PA28alpha	uc001wmh.3	Q06323	OTTHUMG00000028795	ENST00000206451.6:c.30C>G	14.37:g.24605501C>G			A6NJG9|H0YNE3|Q6IBM2|Q9UEF4	Silent	SNP	pfam_Proteasome_activ_REG_bsu,pfam_Proteasome_activ_REG_asu,superfamily_Proteasome_activ_REG_asu/bsu	p.A10	ENST00000206451.6	37	c.30	CCDS9612.1	14																																																																																			PSME1	-	pfam_Proteasome_activ_REG_asu,superfamily_Proteasome_activ_REG_asu/bsu	ENSG00000092010		0.726	PSME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME1	HGNC	protein_coding	OTTHUMT00000071910.2	10	0.00	0	C	NM_006263		24605501	24605501	+1	no_errors	ENST00000382708	ensembl	human	known	69_37n	silent	15	28.57	6	SNP	1.000	G
PTPN11	5781	genome.wustl.edu	37	12	112884103	112884103	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr12:112884103G>A	ENST00000351677.2	+	2	236	c.38G>A	c.(37-39)gGt>gAt	p.G13D	PTPN11_ENST00000392597.1_Missense_Mutation_p.G13D	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	13	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						AATATCACTGGTGTGGAGGCA	0.403			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																													dbGAP		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	0													98.0	96.0	96.0					12																	112884103		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.38G>A	12.37:g.112884103G>A	ENSP00000340944:p.Gly13Asp		A8K1D9|Q96HD7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_SH2,smart_SH2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_SH2,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_SH2	p.G13D	ENST00000351677.2	37	c.38	CCDS9163.1	12	.	.	.	.	.	.	.	.	.	.	G	29.9	5.043042	0.93685	.	.	ENSG00000179295	ENST00000392597;ENST00000351677;ENST00000392596	D;D	0.89270	-2.49;-2.49	5.93	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.95459	0.8525	M	0.91612	3.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95929	0.8937	10	0.87932	D	0	.	15.5263	0.75910	0.0672:0.0:0.9328:0.0	.	13;13	Q06124-2;Q06124-3	.;.	D	13	ENSP00000376376:G13D;ENSP00000340944:G13D	ENSP00000340944:G13D	G	+	2	0	PTPN11	111368486	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.763000	0.98947	2.814000	0.96858	0.655000	0.94253	GGT	PTPN11	-	pfam_SH2,smart_SH2,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_SH2	ENSG00000179295		0.403	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN11	HGNC	protein_coding	OTTHUMT00000259496.2	333	0.00	0	G			112884103	112884103	+1	no_errors	ENST00000351677	ensembl	human	known	69_37n	missense	120	31.43	55	SNP	1.000	A
PTPN2	5771	genome.wustl.edu	37	18	12825813	12825813	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr18:12825813A>C	ENST00000309660.5	-	5	584	c.491T>G	c.(490-492)aTc>aGc	p.I164S	PTPN2_ENST00000591115.1_Missense_Mutation_p.I164S|PTPN2_ENST00000591497.1_Missense_Mutation_p.I135S|PTPN2_ENST00000353319.4_Missense_Mutation_p.I164S|PTPN2_ENST00000327283.3_Missense_Mutation_p.I164S	NM_002828.3	NP_002819.2	P17706	PTN2_HUMAN	protein tyrosine phosphatase, non-receptor type 2	164	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|erythrocyte differentiation (GO:0030218)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemotaxis (GO:0050922)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of interleukin-2-mediated signaling pathway (GO:1902206)|negative regulation of interleukin-4-mediated signaling pathway (GO:1902215)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage colony-stimulating factor signaling pathway (GO:1902227)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of positive thymic T cell selection (GO:1902233)|negative regulation of prolactin signaling pathway (GO:1902212)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|negative regulation of tyrosine phosphorylation of Stat1 protein (GO:0042512)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|negative regulation of tyrosine phosphorylation of Stat6 protein (GO:0042527)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of gluconeogenesis (GO:0045722)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|syntaxin binding (GO:0019905)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)|skin(3)	13		Lung NSC(161;8.94e-06)				TCTTACATTGATATTTTCTAA	0.318																																						dbGAP											0													98.0	93.0	95.0					18																	12825813		2203	4299	6502	-	-	-	SO:0001583	missense	0			M25393	CCDS11863.1, CCDS11864.1, CCDS11865.1, CCDS59306.1	18p11.3-p11.2	2011-06-09			ENSG00000175354	ENSG00000175354		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9650	protein-coding gene	gene with protein product		176887		PTPT		2164224	Standard	NM_002828		Approved	TCELLPTP, TC-PTP, TCPTP	uc002krp.3	P17706	OTTHUMG00000131702	ENST00000309660.5:c.491T>G	18.37:g.12825813A>C	ENSP00000311857:p.Ile164Ser		A8K955|A8MXU3|K7ENG3|Q96AU5|Q96HR2	Missense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-1/2,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.I164S	ENST00000309660.5	37	c.491	CCDS11865.1	18	.	.	.	.	.	.	.	.	.	.	A	13.17	2.156904	0.38119	.	.	ENSG00000175354	ENST00000327283;ENST00000353319;ENST00000341361;ENST00000309660	D;D;D	0.82433	-1.61;-1.61;-1.61	4.38	3.22	0.36961	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.303746	0.22842	N	0.054965	T	0.74816	0.3766	N	0.17872	0.535	0.36785	D	0.884531	B;B;B;B;B	0.24258	0.042;0.008;0.021;0.1;0.009	B;B;B;B;B	0.37346	0.178;0.031;0.117;0.247;0.052	T	0.73107	-0.4087	10	0.48119	T	0.1	.	9.4347	0.38632	0.9123:0.0:0.0877:0.0	.	164;164;141;164;164	P17706;P17706-2;Q59F91;Q96AU5;A8K3N4	PTN2_HUMAN;.;.;.;.	S	164;164;141;164	ENSP00000320298:I164S;ENSP00000320546:I164S;ENSP00000311857:I164S	ENSP00000311857:I164S	I	-	2	0	PTPN2	12815813	0.989000	0.36119	1.000000	0.80357	0.996000	0.88848	0.758000	0.26447	0.818000	0.34468	0.456000	0.33151	ATC	PTPN2	-	pirsf_Tyr_Pase_non-rcpt_typ-1/2,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000175354		0.318	PTPN2-002	KNOWN	basic|CCDS	protein_coding	PTPN2	HGNC	protein_coding	OTTHUMT00000254613.3	379	0.00	0	A	NM_002828, NM_080422, NM_080423		12825813	12825813	-1	no_errors	ENST00000309660	ensembl	human	known	69_37n	missense	85	40.14	57	SNP	1.000	C
PYHIN1	149628	genome.wustl.edu	37	1	158943528	158943528	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr1:158943528C>A	ENST00000368140.1	+	8	1696	c.1451C>A	c.(1450-1452)tCc>tAc	p.S484Y	PYHIN1_ENST00000392252.3_Intron|PYHIN1_ENST00000392254.2_Intron|PYHIN1_ENST00000368138.3_Missense_Mutation_p.S475Y	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	484					cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					TCTGACACTTCCACCAACCGC	0.458																																						dbGAP											0													147.0	132.0	137.0					1																	158943528		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.1451C>A	1.37:g.158943528C>A	ENSP00000357122:p.Ser484Tyr		Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN,pfscan_HIN200/IF120x	p.S484Y	ENST00000368140.1	37	c.1451	CCDS1178.1	1	.	.	.	.	.	.	.	.	.	.	C	0	-2.658981	0.00108	.	.	ENSG00000163564	ENST00000368140;ENST00000368138	T;T	0.06528	3.3;3.29	1.82	-3.36	0.04913	.	.	.	.	.	T	0.00906	0.0030	N	0.08118	0	0.09310	N	1	B;B	0.26775	0.159;0.099	B;B	0.21708	0.036;0.016	T	0.46721	-0.9171	9	0.87932	D	0	.	6.8324	0.23917	0.0:0.4139:0.0:0.5861	.	475;484	Q6K0P9-2;Q6K0P9	.;IFIX_HUMAN	Y	484;475	ENSP00000357122:S484Y;ENSP00000357120:S475Y	ENSP00000357120:S475Y	S	+	2	0	PYHIN1	157210152	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.891000	0.01611	-1.127000	0.02925	-1.429000	0.01096	TCC	PYHIN1	-	NULL	ENSG00000163564		0.458	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PYHIN1	HGNC	protein_coding	OTTHUMT00000090110.1	345	0.00	0	C	NM_152501		158943528	158943528	+1	no_errors	ENST00000368140	ensembl	human	known	69_37n	missense	237	33.33	119	SNP	0.000	A
RARB	5915	genome.wustl.edu	37	3	25622057	25622057	+	Silent	SNP	A	A	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr3:25622057A>T	ENST00000404969.1	+	5	651	c.651A>T	c.(649-651)cgA>cgT	p.R217R	RARB_ENST00000462272.1_3'UTR|RARB_ENST00000458646.1_Silent_p.R98R|RARB_ENST00000437042.2_Silent_p.R98R|RARB_ENST00000330688.4_Silent_p.R210R			P10826	RARB_HUMAN	retinoic acid receptor, beta	217	Ligand-binding.				embryonic digestive tract development (GO:0048566)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|retinal pigment epithelium development (GO:0003406)|signal transduction (GO:0007165)|striatum development (GO:0021756)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|kidney(1)|large_intestine(10)|lung(11)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	28					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CTGACCATCGAGTCCGACTGG	0.468																																						dbGAP											0													101.0	93.0	96.0					3																	25622057		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y00291	CCDS2642.1, CCDS46775.1	3p24	2013-01-16			ENSG00000077092	ENSG00000077092		"""Nuclear hormone receptors"""	9865	protein-coding gene	gene with protein product		180220					Standard	NM_016152		Approved	HAP, NR1B2, RRB2	uc003cdh.3	P10826	OTTHUMG00000130480	ENST00000404969.1:c.651A>T	3.37:g.25622057A>T			P12891|Q00989|Q15298|Q9UN48	Silent	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.R217	ENST00000404969.1	37	c.651		3																																																																																			RARB	-	superfamily_Nucl_hormone_rcpt_ligand-bd,prints_Retinoic_acid_rcpt	ENSG00000077092		0.468	RARB-201	KNOWN	basic	protein_coding	RARB	HGNC	protein_coding		128	0.00	0	A	NM_000965, NM_016152		25622057	25622057	+1	no_errors	ENST00000404969	ensembl	human	known	69_37n	silent	73	28.43	29	SNP	0.421	T
RYR1	6261	genome.wustl.edu	37	19	38960007	38960007	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr19:38960007G>A	ENST00000359596.3	+	27	3619	c.3619G>A	c.(3619-3621)Gtg>Atg	p.V1207M	RYR1_ENST00000355481.4_Missense_Mutation_p.V1207M|RYR1_ENST00000360985.3_Missense_Mutation_p.V1207M			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1207	6 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GGGCCAGGACGTGAGCTCTCT	0.622																																						dbGAP											0													127.0	121.0	123.0					19																	38960007		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.3619G>A	19.37:g.38960007G>A	ENSP00000352608:p.Val1207Met		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.V1207M	ENST00000359596.3	37	c.3619	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	g	15.92	2.974193	0.53720	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97041	-4.22;-4.22;-4.22	3.63	3.63	0.41609	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);	0.000000	0.53938	U	0.000043	D	0.98115	0.9378	M	0.77313	2.365	0.44570	D	0.997535	D;D	0.89917	1.0;1.0	D;D	0.76071	0.955;0.987	D	0.98676	1.0690	10	0.59425	D	0.04	.	15.1827	0.72972	0.0:0.0:1.0:0.0	.	1207;1207	P21817-2;P21817	.;RYR1_HUMAN	M	1207	ENSP00000352608:V1207M;ENSP00000347667:V1207M;ENSP00000354254:V1207M	ENSP00000347667:V1207M	V	+	1	0	RYR1	43651847	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	9.278000	0.95766	1.900000	0.55004	0.434000	0.28630	GTG	RYR1	-	superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000196218		0.622	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	53	0.00	0	G			38960007	38960007	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	missense	102	18.40	23	SNP	1.000	A
SETDB1	9869	genome.wustl.edu	37	1	150923915	150923915	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr1:150923915C>G	ENST00000271640.5	+	14	2478	c.2288C>G	c.(2287-2289)tCt>tGt	p.S763C	SETDB1_ENST00000459773.1_Intron|SETDB1_ENST00000368969.4_Missense_Mutation_p.S763C	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	763	Pre-SET. {ECO:0000255|PROSITE- ProRule:PRU00157}.				bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			AACCCTAACTCTGGCTACCAG	0.483																																						dbGAP											0													92.0	81.0	85.0					1																	150923915		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.2288C>G	1.37:g.150923915C>G	ENSP00000271640:p.Ser763Cys		A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	pfam_SET_dom,pfam_Pre-SET_dom,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Tudor,smart_Methyl_CpG_DNA-bd,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Methyl_CpG_DNA-bd,pfscan_SET_dom,pfscan_Pre-SET_dom,pfscan_Post-SET_dom	p.S763C	ENST00000271640.5	37	c.2288	CCDS44217.1	1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.752684	0.89753	.	.	ENSG00000143379	ENST00000271640;ENST00000368969;ENST00000498193	D;D;D	0.89343	-2.5;-2.5;-2.5	5.81	5.81	0.92471	Pre-SET zinc-binding sub-group (1);Pre-SET domain (2);	0.053607	0.64402	D	0.000001	D	0.89012	0.6594	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.996	D;P;P	0.65323	0.934;0.847;0.905	D	0.90336	0.4355	10	0.66056	D	0.02	.	19.6888	0.95989	0.0:1.0:0.0:0.0	.	763;763;763	E9PRF4;Q15047-3;Q15047	.;.;SETB1_HUMAN	C	763	ENSP00000271640:S763C;ENSP00000357965:S763C;ENSP00000432348:S763C	ENSP00000271640:S763C	S	+	2	0	SETDB1	149190539	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.582000	0.82546	2.736000	0.93811	0.655000	0.94253	TCT	SETDB1	-	pfam_Pre-SET_dom,smart_Pre-SET_Zn-bd_sub,pfscan_Pre-SET_dom	ENSG00000143379		0.483	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SETDB1	HGNC	protein_coding	OTTHUMT00000084717.2	131	0.00	0	C			150923915	150923915	+1	no_errors	ENST00000271640	ensembl	human	known	69_37n	missense	177	25.00	59	SNP	1.000	G
SEC16B	89866	genome.wustl.edu	37	1	177930700	177930700	+	Intron	SNP	C	C	T	rs368723722		TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr1:177930700C>T	ENST00000308284.6	-	6	877				SEC16B_ENST00000464631.2_Intron|RP4-798P15.3_ENST00000354921.3_RNA	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)						COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)				central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						ATTCAATCAACTCTTCTGATC	0.512																																						dbGAP											0													31.0	33.0	32.0					1																	177930700		1924	4137	6061	-	-	-	SO:0001627	intron_variant	0			AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.787+24G>A	1.37:g.177930700C>T			A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	RNA	SNP	-	NULL	ENST00000308284.6	37	NULL	CCDS44281.1	1																																																																																			SEC16B	-	-	ENSG00000254154		0.512	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC16B	HGNC	protein_coding	OTTHUMT00000084773.16	29	0.00	0	C	NM_033127		177930700	177930700	-1	no_errors	ENST00000464428	ensembl	human	known	69_37n	rna	42	16.00	8	SNP	0.000	T
SFI1	9814	genome.wustl.edu	37	22	31971290	31971291	+	Frame_Shift_Ins	INS	-	-	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr22:31971290_31971291insA	ENST00000400288.2	+	10	1101_1102	c.996_997insA	c.(997-999)aggfs	p.R333fs	SFI1_ENST00000414585.1_Frame_Shift_Ins_p.R180fs|SFI1_ENST00000443326.1_Frame_Shift_Ins_p.R251fs|SFI1_ENST00000432498.1_Frame_Shift_Ins_p.R333fs|SFI1_ENST00000400289.1_Frame_Shift_Ins_p.R251fs|SFI1_ENST00000540643.1_Frame_Shift_Ins_p.R309fs|SFI1_ENST00000443011.1_Frame_Shift_Ins_p.R180fs	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	333					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						CCTGGGAGCGGAGGGAGAGCTT	0.535																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.997dupA	22.37:g.31971291_31971291dupA	ENSP00000383145:p.Arg333fs		A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Frame_Shift_Ins	INS	superfamily_Cyclin-like	p.R332fs	ENST00000400288.2	37	c.996_997	CCDS43004.1	22																																																																																			SFI1	-	NULL	ENSG00000198089		0.535	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SFI1	HGNC	protein_coding	OTTHUMT00000337180.3	21	0.00	0	-	NM_014775		31971290	31971291	+1	no_errors	ENST00000400288	ensembl	human	known	69_37n	frame_shift_ins	58	19.44	14	INS	0.011:0.115	A
SGSM2	9905	genome.wustl.edu	37	17	2270688	2270688	+	Intron	SNP	A	A	G			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr17:2270688A>G	ENST00000426855.2	+	11	1463				SGSM2_ENST00000574563.1_Intron|SGSM2_ENST00000268989.3_Missense_Mutation_p.N471S	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2						late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		ACAGCTCCCAATCCGATGAAA	0.637																																						dbGAP											0													123.0	100.0	108.0					17																	2270688		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.1288+2053A>G	17.37:g.2270688A>G			A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Missense_Mutation	SNP	pfam_Run,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Run,smart_Rab-GTPase-TBC_dom,pfscan_Run,pfscan_Rab-GTPase-TBC_dom	p.N471S	ENST00000426855.2	37	c.1412	CCDS45570.1	17	.	.	.	.	.	.	.	.	.	.	A	10.28	1.306601	0.23736	.	.	ENSG00000141258	ENST00000268989	T	0.11169	2.8	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.14141	0.0342	.	.	.	0.80722	D	1	D;P	0.55385	0.971;0.835	P;B	0.50934	0.654;0.352	T	0.10894	-1.0610	9	0.09843	T	0.71	-9.0236	15.6154	0.76764	1.0:0.0:0.0:0.0	.	14;471	O43147-3;O43147-2	.;.	S	471	ENSP00000268989:N471S	ENSP00000268989:N471S	N	+	2	0	SGSM2	2217438	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.079000	0.76829	2.285000	0.76669	0.528000	0.53228	AAT	SGSM2	-	NULL	ENSG00000141258		0.637	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGSM2	HGNC	protein_coding	OTTHUMT00000438186.1	36	0.00	0	A	NM_014853		2270688	2270688	+1	no_errors	ENST00000268989	ensembl	human	known	69_37n	missense	24	45.45	20	SNP	1.000	G
SLC4A1	6521	genome.wustl.edu	37	17	42330612	42330612	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr17:42330612C>T	ENST00000262418.6	-	17	2340	c.2185G>A	c.(2185-2187)Gtg>Atg	p.V729M		NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	729	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		ACGGAACGCACGGTGGTGGCA	0.647																																						dbGAP											0													76.0	66.0	69.0					17																	42330612		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.2185G>A	17.37:g.42330612C>T	ENSP00000262418:p.Val729Met		G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_1,tigrfam_HCO3_transpt_euk	p.V729M	ENST00000262418.6	37	c.2185	CCDS11481.1	17	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416869	0.83449	.	.	ENSG00000004939	ENST00000262418	D	0.85556	-2.0	4.61	4.61	0.57282	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93939	0.8060	M	0.91872	3.25	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95393	0.8483	10	0.87932	D	0	.	17.5044	0.87740	0.0:1.0:0.0:0.0	.	729	P02730	B3AT_HUMAN	M	729	ENSP00000262418:V729M	ENSP00000262418:V729M	V	-	1	0	SLC4A1	39686138	1.000000	0.71417	0.592000	0.28758	0.809000	0.45718	7.744000	0.85034	2.304000	0.77564	0.555000	0.69702	GTG	SLC4A1	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk	ENSG00000004939		0.647	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A1	HGNC	protein_coding	OTTHUMT00000346194.1	12	0.00	0	C	NM_000342		42330612	42330612	-1	no_errors	ENST00000262418	ensembl	human	known	69_37n	missense	27	51.79	29	SNP	0.997	T
SLITRK2	84631	genome.wustl.edu	37	X	144905067	144905067	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chrX:144905067C>A	ENST00000370490.1	+	1	5379	c.1124C>A	c.(1123-1125)aCc>aAc	p.T375N	SLITRK2_ENST00000434188.2_Missense_Mutation_p.T375N|SLITRK2_ENST00000428560.2_Missense_Mutation_p.T375N|SLITRK2_ENST00000413937.2_Missense_Mutation_p.T375N|SLITRK2_ENST00000447897.2_Missense_Mutation_p.T375N			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	375					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					CCCAAACCGACCAGTCCAAAG	0.433																																						dbGAP											0													65.0	62.0	63.0					X																	144905067		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.1124C>A	X.37:g.144905067C>A	ENSP00000359521:p.Thr375Asn		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.T375N	ENST00000370490.1	37	c.1124	CCDS14680.1	X	.	.	.	.	.	.	.	.	.	.	C	13.51	2.259693	0.39995	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98	5.66	5.66	0.87406	Leucine-rich repeat-containing N-terminal (1);	0.117279	0.64402	D	0.000018	T	0.37376	0.1001	L	0.46157	1.445	0.44771	D	0.997777	B	0.33512	0.415	B	0.30401	0.115	T	0.13737	-1.0498	10	0.30078	T	0.28	-9.2698	15.9269	0.79624	0.0:1.0:0.0:0.0	.	375	Q9H156	SLIK2_HUMAN	N	375	ENSP00000334374:T375N;ENSP00000411681:T375N;ENSP00000359521:T375N;ENSP00000397015:T375N;ENSP00000407347:T375N;ENSP00000412010:T375N	ENSP00000334374:T375N	T	+	2	0	SLITRK2	144712759	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.992000	0.56980	2.360000	0.80028	0.594000	0.82650	ACC	SLITRK2	-	smart_LRR-contain_N	ENSG00000185985		0.433	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK2	HGNC	protein_coding	OTTHUMT00000058633.1	87	0.00	0	C	NM_032539		144905067	144905067	+1	no_errors	ENST00000370490	ensembl	human	known	69_37n	missense	109	17.42	23	SNP	1.000	A
SPTA1	6708	genome.wustl.edu	37	1	158582648	158582648	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr1:158582648C>T	ENST00000368147.4	-	51	7273	c.7093G>A	c.(7093-7095)Gca>Aca	p.A2365T	SPTA1_ENST00000485680.1_5'Flank	NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2365	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TTGCCCTCTGCCAGGGCTTGG	0.448																																						dbGAP											0													128.0	123.0	125.0					1																	158582648		1933	4140	6073	-	-	-	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.7093G>A	1.37:g.158582648C>T	ENSP00000357129:p.Ala2365Thr		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.A2365T	ENST00000368147.4	37	c.7093	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	19.16	3.774261	0.69992	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.57107	0.42;0.42	5.39	5.39	0.77823	EF-hand, Ca insensitive (1);EF-hand-like domain (1);	0.000000	0.32120	N	0.006559	T	0.36826	0.0981	M	0.66939	2.045	0.41997	D	0.990876	B	0.21821	0.061	B	0.28553	0.091	T	0.41910	-0.9482	10	0.45353	T	0.12	.	8.032	0.30470	0.0:0.8377:0.0:0.1623	.	2365	P02549	SPTA1_HUMAN	T	2365;2362	ENSP00000357130:A2365T;ENSP00000357129:A2362T	ENSP00000357129:A2362T	A	-	1	0	SPTA1	156849272	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	5.312000	0.65792	2.795000	0.96236	0.655000	0.94253	GCA	SPTA1	-	pfam_EF-hand_Ca_insen	ENSG00000163554		0.448	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	225	0.00	0	C	NM_003126		158582648	158582648	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	missense	180	25.00	60	SNP	1.000	T
TAF1L	138474	genome.wustl.edu	37	9	32634816	32634817	+	Frame_Shift_Ins	INS	-	-	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr9:32634816_32634817insA	ENST00000242310.4	-	1	850_851	c.761_762insT	c.(760-762)cgafs	p.R254fs	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	254					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CTTTTCCAGGTCGAAATTCTGG	0.49																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.761_762insT	9.37:g.32634816_32634817insA	ENSP00000418379:p.Arg254fs		Q0VG57	Frame_Shift_Ins	INS	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.P255fs	ENST00000242310.4	37	c.762_761	CCDS35003.1	9																																																																																			TAF1L	-	pirsf_TAF1_animal	ENSG00000122728		0.490	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	244	0.00	0	-			32634816	32634817	-1	no_errors	ENST00000242310	ensembl	human	known	69_37n	frame_shift_ins	119	47.11	106	INS	0.999:1.000	A
TENC1	23371	genome.wustl.edu	37	12	53453704	53453704	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr12:53453704C>T	ENST00000314250.6	+	18	2569	c.2279C>T	c.(2278-2280)gCa>gTa	p.A760V	TENC1_ENST00000379902.3_Missense_Mutation_p.A636V|TENC1_ENST00000451358.1_Missense_Mutation_p.A750V|TENC1_ENST00000314276.3_Missense_Mutation_p.A770V|TENC1_ENST00000546602.1_Missense_Mutation_p.A760V|TENC1_ENST00000549700.1_Missense_Mutation_p.A760V|TENC1_ENST00000552570.1_Missense_Mutation_p.A760V	NM_170754.2	NP_736610.2	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)	760	Pro-rich.				cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						CCACCCAAGGCAGGCGAGGAA	0.647																																						dbGAP											0													37.0	35.0	36.0					12																	53453704		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730	ENST00000314250.6:c.2279C>T	12.37:g.53453704C>T	ENSP00000319684:p.Ala760Val		A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	Missense_Mutation	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.A770V	ENST00000314250.6	37	c.2309	CCDS8843.1	12	.	.	.	.	.	.	.	.	.	.	C	0.852	-0.738359	0.03111	.	.	ENSG00000111077	ENST00000379902;ENST00000314276;ENST00000314250;ENST00000451358;ENST00000546602;ENST00000552570;ENST00000549700	D;D;D;D;D;D;D	0.94046	-3.33;-3.33;-3.33;-3.34;-3.31;-3.33;-3.26	4.54	2.24	0.28232	.	0.580975	0.17254	N	0.181021	T	0.81327	0.4799	N	0.08118	0	0.21416	N	0.999693	B;B;B;B	0.06786	0.0;0.001;0.0;0.0	B;B;B;B	0.08055	0.002;0.003;0.001;0.003	T	0.66304	-0.5957	10	0.14252	T	0.57	.	5.787	0.18338	0.0:0.6917:0.0:0.3083	.	760;760;760;770	Q63HR2-6;Q63HR2-2;Q63HR2;Q63HR2-4	.;.;TENC1_HUMAN;.	V	636;770;760;750;760;760;760	ENSP00000369232:A636V;ENSP00000319756:A770V;ENSP00000319684:A760V;ENSP00000393362:A750V;ENSP00000449363:A760V;ENSP00000447021:A760V;ENSP00000449361:A760V	ENSP00000319684:A760V	A	+	2	0	TENC1	51739971	0.004000	0.15560	0.623000	0.29173	0.987000	0.75469	-0.082000	0.11304	0.413000	0.25759	0.563000	0.77884	GCA	TENC1	-	NULL	ENSG00000111077		0.647	TENC1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	TENC1	HGNC	protein_coding	OTTHUMT00000405779.1	8	0.00	0	C	NM_170754		53453704	53453704	+1	no_errors	ENST00000314276	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	0.629	T
TP53	7157	genome.wustl.edu	37	17	7577568	7577568	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr17:7577568C>A	ENST00000269305.4	-	7	902	c.713G>T	c.(712-714)tGt>tTt	p.C238F	TP53_ENST00000413465.2_Missense_Mutation_p.C238F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.C238F|TP53_ENST00000445888.2_Missense_Mutation_p.C238F|TP53_ENST00000455263.2_Missense_Mutation_p.C238F|TP53_ENST00000420246.2_Missense_Mutation_p.C238F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	238	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C238Y(65)|p.C238F(46)|p.C238S(9)|p.0?(8)|p.?(5)|p.C145F(5)|p.C145Y(5)|p.M237_N239delMCN(4)|p.C238fs*21(1)|p.M237fs*1(1)|p.M144_N146delMCN(1)|p.C238del(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.H233fs*6(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)|p.N239_C242del(1)|p.C145S(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGAACTGTTACACATGTAGTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	158	Substitution - Missense(131)|Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(4)	breast(22)|ovary(17)|large_intestine(14)|haematopoietic_and_lymphoid_tissue(13)|endometrium(13)|lung(12)|upper_aerodigestive_tract(9)|pancreas(8)|soft_tissue(7)|urinary_tract(7)|oesophagus(7)|biliary_tract(6)|central_nervous_system(6)|liver(5)|bone(5)|stomach(4)|skin(2)|meninges(1)	GRCh37	CM034930	TP53	M							132.0	103.0	113.0					17																	7577568		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.713G>T	17.37:g.7577568C>A	ENSP00000269305:p.Cys238Phe		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C238F	ENST00000269305.4	37	c.713	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	22.2	4.262614	0.80358	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99964	-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96	4.09	4.09	0.47781	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99972	0.9991	M	0.92970	3.365	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.95847	0.8871	10	0.87932	D	0	-18.536	14.6088	0.68501	0.0:1.0:0.0:0.0	.	238;238;145;238;238;238	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	F	238;238;238;238;238;238;227;145;106;145	ENSP00000410739:C238F;ENSP00000352610:C238F;ENSP00000269305:C238F;ENSP00000398846:C238F;ENSP00000391127:C238F;ENSP00000391478:C238F;ENSP00000425104:C106F;ENSP00000423862:C145F	ENSP00000269305:C238F	C	-	2	0	TP53	7518293	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	2.564000	0.86499	0.462000	0.41574	TGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	82	0.00	0	C	NM_000546		7577568	7577568	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	47	42.68	35	SNP	1.000	A
TSPAN12	23554	genome.wustl.edu	37	7	120496813	120496813	+	Missense_Mutation	SNP	G	G	A	rs201257686		TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr7:120496813G>A	ENST00000222747.3	-	2	612	c.5C>T	c.(4-6)gCc>gTc	p.A2V	TSPAN12_ENST00000415871.1_Missense_Mutation_p.A2V	NM_012338.3	NP_036470.1	O95859	TSN12_HUMAN	tetraspanin 12	2					angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|regulation of angiogenesis (GO:0045765)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(3)|kidney(1)|lung(4)|ovary(1)|skin(1)	10	all_neural(327;0.117)					ATCTTCTCTGGCCATTGTGAG	0.567											OREG0018280	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0	0.0	5008	,	,		16573	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													101.0	90.0	94.0					7																	120496813		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF124522	CCDS5777.1	7q31.31	2013-02-14	2005-03-21	2005-03-21	ENSG00000106025	ENSG00000106025		"""Tetraspanins"""	21641	protein-coding gene	gene with protein product		613138	"""transmembrane 4 superfamily member 12"""	TM4SF12			Standard	NM_012338		Approved	NET-2	uc003vjk.3	O95859	OTTHUMG00000156980	ENST00000222747.3:c.5C>T	7.37:g.120496813G>A	ENSP00000222747:p.Ala2Val	1504	A4D0V8|B4DRG6|Q549U9|Q8N5Y0	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.A2V	ENST00000222747.3	37	c.5	CCDS5777.1	7	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	17.31	3.356527	0.61293	.	.	ENSG00000106025	ENST00000222747;ENST00000415871;ENST00000441017;ENST00000433758;ENST00000424710;ENST00000430985	T;T;T;T;T;T	0.72942	0.23;0.23;-0.7;-0.23;-0.22;0.71	4.95	4.95	0.65309	.	0.056037	0.64402	D	0.000001	T	0.72455	0.3462	M	0.66439	2.03	0.51767	D	0.99993	P	0.41748	0.761	B	0.41946	0.371	T	0.75528	-0.3286	10	0.46703	T	0.11	-5.8979	17.8117	0.88619	0.0:0.0:1.0:0.0	.	2	O95859	TSN12_HUMAN	V	2	ENSP00000222747:A2V;ENSP00000397699:A2V;ENSP00000411158:A2V;ENSP00000399059:A2V;ENSP00000404942:A2V;ENSP00000388819:A2V	ENSP00000222747:A2V	A	-	2	0	TSPAN12	120284049	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	6.598000	0.74122	2.299000	0.77371	0.655000	0.94253	GCC	TSPAN12	-	NULL	ENSG00000106025		0.567	TSPAN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN12	HGNC	protein_coding	OTTHUMT00000346951.1	81	0.00	0	G	NM_012338		120496813	120496813	-1	no_errors	ENST00000222747	ensembl	human	known	69_37n	missense	44	48.84	42	SNP	1.000	A
VANGL2	57216	genome.wustl.edu	37	1	160389022	160389022	+	Silent	SNP	C	C	T			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr1:160389022C>T	ENST00000368061.2	+	4	897	c.423C>T	c.(421-423)tgC>tgT	p.C141C		NM_020335.2	NP_065068.1	Q9ULK5	VANG2_HUMAN	VANGL planar cell polarity protein 2	141					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|cell migration involved in kidney development (GO:0035787)|cochlea morphogenesis (GO:0090103)|convergent extension involved in axis elongation (GO:0060028)|convergent extension involved in neural plate elongation (GO:0022007)|digestive tract morphogenesis (GO:0048546)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity involved in neural tube closure (GO:0090177)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|glomerulus development (GO:0032835)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|inner ear receptor stereocilium organization (GO:0060122)|kidney morphogenesis (GO:0060993)|lateral sprouting involved in lung morphogenesis (GO:0060490)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in axis elongation (GO:0003402)|planar cell polarity pathway involved in heart morphogenesis (GO:0061346)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|positive regulation of JUN kinase activity (GO:0043507)|post-anal tail morphogenesis (GO:0036342)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Wnt signaling pathway (GO:0030111)|Rho protein signal transduction (GO:0007266)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell pole (GO:0060187)|cell-cell junction (GO:0005911)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)				biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	37	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGGAGCCTTGCGGGACGGCCT	0.677																																						dbGAP											0													39.0	40.0	40.0					1																	160389022		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033041	CCDS30915.1	1q22-q23	2013-03-05	2013-03-05		ENSG00000162738	ENSG00000162738			15511	protein-coding gene	gene with protein product	"""vang, van gogh-like 2"", ""loop-tail-associated protein"", ""strabismus"""	600533	"""vang (van gogh, Drosophila)-like 2, vang, van gogh-like 2 (Drosophila)"", ""vang-like 2 (van gogh, Drosophila)"""			11431695	Standard	NM_020335		Approved	KIAA1215, LTAP, LPP1, STBM, STB1, STBM1, MGC119403, MGC119404	uc001fwc.2	Q9ULK5	OTTHUMG00000033122	ENST00000368061.2:c.423C>T	1.37:g.160389022C>T			D3DVE9|Q5T212	Silent	SNP	pfam_Strabismus,pirsf_Strabismus	p.C141	ENST00000368061.2	37	c.423	CCDS30915.1	1																																																																																			VANGL2	-	pfam_Strabismus,pirsf_Strabismus	ENSG00000162738		0.677	VANGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VANGL2	HGNC	protein_coding	OTTHUMT00000080677.1	15	0.00	0	C	NM_020335		160389022	160389022	+1	no_errors	ENST00000368061	ensembl	human	known	69_37n	silent	69	31.00	31	SNP	1.000	T
VSIG1	340547	genome.wustl.edu	37	X	107316029	107316029	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chrX:107316029G>A	ENST00000217957.5	+	4	652	c.535G>A	c.(535-537)Gga>Aga	p.G179R	VSIG1_ENST00000485533.1_3'UTR|VSIG1_ENST00000415430.3_Missense_Mutation_p.G215R	NM_182607.4	NP_872413.1	Q86XK7	VSIG1_HUMAN	V-set and immunoglobulin domain containing 1	179	Ig-like C2-type 2.					integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17						TAAACTTGAGGGAAGAGACAT	0.498																																						dbGAP											0													182.0	142.0	155.0					X																	107316029		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX648658	CCDS14535.1, CCDS55474.1	Xq22.3	2013-01-29			ENSG00000101842	ENSG00000101842		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28675	protein-coding gene	gene with protein product		300620				12477932	Standard	NM_182607		Approved	MGC44287	uc011msk.2	Q86XK7	OTTHUMG00000022175	ENST00000217957.5:c.535G>A	X.37:g.107316029G>A	ENSP00000217957:p.Gly179Arg		C9J4P2|Q6MZS4	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.G215R	ENST00000217957.5	37	c.643	CCDS14535.1	X	.	.	.	.	.	.	.	.	.	.	G	12.24	1.877343	0.33162	.	.	ENSG00000101842	ENST00000415430;ENST00000217957	T;T	0.25250	1.81;1.81	5.01	3.25	0.37280	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.384573	0.26711	N	0.022886	T	0.34395	0.0896	L	0.40543	1.245	0.30436	N	0.776677	D;D	0.76494	0.999;0.999	D;D	0.74674	0.984;0.976	T	0.16897	-1.0387	10	0.20519	T	0.43	.	8.3525	0.32310	0.1909:0.0:0.8091:0.0	.	215;179	C9J4P2;Q86XK7	.;VSIG1_HUMAN	R	215;179	ENSP00000402219:G215R;ENSP00000217957:G179R	ENSP00000217957:G179R	G	+	1	0	VSIG1	107202685	0.906000	0.30813	0.892000	0.35008	0.014000	0.08584	2.905000	0.48727	0.619000	0.30197	-0.192000	0.12808	GGA	VSIG1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000101842		0.498	VSIG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	VSIG1	HGNC	protein_coding	OTTHUMT00000057858.1	327	0.30	1	G	NM_182607		107316029	107316029	+1	no_errors	ENST00000415430	ensembl	human	known	69_37n	missense	135	34.47	71	SNP	0.908	A
WNT5B	81029	genome.wustl.edu	37	12	1755250	1755250	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr12:1755250C>G	ENST00000397196.2	+	5	1144	c.912C>G	c.(910-912)tgC>tgG	p.C304W	WNT5B_ENST00000537031.1_Missense_Mutation_p.C304W|WNT5B_ENST00000310594.3_Missense_Mutation_p.C304W|WNT5B_ENST00000545747.1_3'UTR	NM_032642.2	NP_116031.1	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family, member 5B	304					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fat cell differentiation (GO:0045444)|lens fiber cell development (GO:0070307)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor binding (GO:0005102)			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			GCCGCCTCTGCAACAAGACCT	0.662																																						dbGAP											0													55.0	60.0	58.0					12																	1755250		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB060966	CCDS8510.1	12p13.3	2008-07-07			ENSG00000111186	ENSG00000111186		"""Wingless-type MMTV integration sites"""	16265	protein-coding gene	gene with protein product		606361				11445850	Standard	NM_030775		Approved		uc001qjk.3	Q9H1J7	OTTHUMG00000090375	ENST00000397196.2:c.912C>G	12.37:g.1755250C>G	ENSP00000380379:p.Cys304Trp		A8K315|D3DUP9|Q96S49|Q9BV04	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt	p.C304W	ENST00000397196.2	37	c.912	CCDS8510.1	12	.	.	.	.	.	.	.	.	.	.	C	19.23	3.787644	0.70337	.	.	ENSG00000111186	ENST00000537031;ENST00000310594;ENST00000397196	D;D;D	0.91740	-2.9;-2.9;-2.9	5.15	4.26	0.50523	.	0.000000	0.85682	D	0.000000	D	0.97501	0.9182	H	0.98111	4.15	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98479	1.0604	10	0.87932	D	0	.	13.6883	0.62531	0.0:0.926:0.0:0.074	.	304	Q9H1J7	WNT5B_HUMAN	W	304	ENSP00000439312:C304W;ENSP00000308887:C304W;ENSP00000380379:C304W	ENSP00000308887:C304W	C	+	3	2	WNT5B	1625511	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	3.942000	0.56614	1.392000	0.46585	0.655000	0.94253	TGC	WNT5B	-	pfam_Wnt,smart_Wnt	ENSG00000111186		0.662	WNT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT5B	HGNC	protein_coding	OTTHUMT00000206747.2	14	0.00	0	C			1755250	1755250	+1	no_errors	ENST00000310594	ensembl	human	known	69_37n	missense	32	50.00	32	SNP	1.000	G
XPO1	7514	genome.wustl.edu	37	2	61720102	61720102	+	Missense_Mutation	SNP	G	G	T	rs375587928		TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr2:61720102G>T	ENST00000401558.2	-	13	2059	c.1332C>A	c.(1330-1332)ttC>ttA	p.F444L	XPO1_ENST00000406957.1_Missense_Mutation_p.F444L|XPO1_ENST00000404992.2_Missense_Mutation_p.F444L	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	444	Interaction with RANBP3.|Interaction with Ran and nuclear export complex formation.|Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			TATCCTTCATGAATTCTCTCA	0.323			Mis		CLL																																	dbGAP	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	0													105.0	108.0	107.0					2																	61720102		2203	4299	6502	-	-	-	SO:0001583	missense	0			Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.1332C>A	2.37:g.61720102G>T	ENSP00000384863:p.Phe444Leu		A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	pfam_CRM1_C_dom,pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.F444L	ENST00000401558.2	37	c.1332	CCDS33205.1	2	.	.	.	.	.	.	.	.	.	.	G	15.59	2.879558	0.51801	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	T;T;T	0.68331	-0.32;-0.32;-0.32	5.46	3.63	0.41609	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59905	0.2228	L	0.50919	1.6	0.49798	D	0.999829	B	0.14438	0.01	B	0.10450	0.005	T	0.60271	-0.7296	10	0.49607	T	0.09	-11.0209	12.5863	0.56419	0.1415:0.0:0.8585:0.0	.	444	O14980	XPO1_HUMAN	L	444	ENSP00000384863:F444L;ENSP00000385942:F444L;ENSP00000385559:F444L	ENSP00000384863:F444L	F	-	3	2	XPO1	61573606	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.244000	0.51399	1.444000	0.47605	0.491000	0.48974	TTC	XPO1	-	superfamily_ARM-type_fold	ENSG00000082898		0.323	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO1	HGNC	protein_coding	OTTHUMT00000325872.3	568	0.00	0	G	NM_003400		61720102	61720102	-1	no_errors	ENST00000401558	ensembl	human	known	69_37n	missense	187	19.74	46	SNP	1.000	T
ZBTB21	49854	genome.wustl.edu	37	21	43411588	43411588	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A12L-01A-11D-A10Y-09	TCGA-C8-A12L-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	998a465a-d084-4d7f-8c02-8c5be1e1ee27	8fedd128-c3e3-451c-8a22-fc76a2e8103e	g.chr21:43411588G>A	ENST00000310826.5	-	3	2800	c.2617C>T	c.(2617-2619)Caa>Taa	p.Q873*	ZBTB21_ENST00000465968.1_5'UTR|ZBTB21_ENST00000398499.1_Nonsense_Mutation_p.Q873*|ZBTB21_ENST00000398505.3_Nonsense_Mutation_p.Q672*|ZBTB21_ENST00000398511.3_Nonsense_Mutation_p.Q873*	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	873					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)										ATTTTCAGTTGCTTGGAAAGA	0.502																																						dbGAP											0													71.0	73.0	73.0					21																	43411588		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.2617C>T	21.37:g.43411588G>A	ENSP00000308759:p.Gln873*		Q5R2W1|Q5R2W2|Q6P4R0	Nonsense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.Q873*	ENST00000310826.5	37	c.2617	CCDS13678.1	21	.	.	.	.	.	.	.	.	.	.	G	39	7.468824	0.98302	.	.	ENSG00000173276	ENST00000398505;ENST00000310826;ENST00000398499;ENST00000398511	.	.	.	5.86	5.86	0.93980	.	0.254581	0.32608	N	0.005879	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-19.6006	20.1996	0.98256	0.0:0.0:1.0:0.0	.	.	.	.	X	672;873;873;873	.	ENSP00000308759:Q873X	Q	-	1	0	ZNF295	42284657	1.000000	0.71417	0.211000	0.23655	0.815000	0.46073	6.870000	0.75526	2.776000	0.95493	0.650000	0.86243	CAA	ZNF295	-	NULL	ENSG00000173276		0.502	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF295	HGNC	protein_coding	OTTHUMT00000195308.1	93	0.00	0	G	NM_020727		43411588	43411588	-1	no_errors	ENST00000310826	ensembl	human	known	69_37n	nonsense	25	58.33	35	SNP	0.989	A
