#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ARHGAP17	55114	genome.wustl.edu	37	16	24942551	24942551	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr16:24942551G>A	ENST00000289968.6	-	19	2138	c.2069C>T	c.(2068-2070)tCc>tTc	p.S690F	ARHGAP17_ENST00000441763.2_3'UTR|ARHGAP17_ENST00000303665.5_Missense_Mutation_p.S612F	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	690	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		GGAGGGGGCGGAGGGCTGGCC	0.667																																						dbGAP											0													49.0	62.0	57.0					16																	24942551		2197	4300	6497	-	-	-	SO:0001583	missense	0			AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.2069C>T	16.37:g.24942551G>A	ENSP00000289968:p.Ser690Phe		A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	pfam_BAR_dom,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.S690F	ENST00000289968.6	37	c.2069	CCDS32409.1	16	.	.	.	.	.	.	.	.	.	.	G	12.06	1.823983	0.32237	.	.	ENSG00000140750	ENST00000289968;ENST00000303665;ENST00000455311	T;T	0.22539	1.95;2.03	4.88	3.92	0.45320	.	0.521233	0.16209	N	0.224561	T	0.16428	0.0395	L	0.43152	1.355	0.09310	N	0.999997	B;B;B;B	0.32653	0.032;0.019;0.372;0.379	B;B;B;B	0.28305	0.051;0.023;0.088;0.06	T	0.16928	-1.0386	10	0.56958	D	0.05	.	7.0425	0.25029	0.0:0.265:0.5773:0.1578	.	612;690;223;523	Q68EM7-2;Q68EM7;Q68EM7-7;B4DWE9	.;RHG17_HUMAN;.;.	F	690;612;690	ENSP00000289968:S690F;ENSP00000303130:S612F	ENSP00000289968:S690F	S	-	2	0	ARHGAP17	24850052	0.001000	0.12720	0.002000	0.10522	0.986000	0.74619	0.883000	0.28200	1.029000	0.39812	0.462000	0.41574	TCC	ARHGAP17	-	NULL	ENSG00000140750		0.667	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP17	HGNC	protein_coding	OTTHUMT00000436548.3	93	0.00	0	G	NM_018054		24942551	24942551	-1	no_errors	ENST00000289968	ensembl	human	known	69_37n	missense	57	41.84	41	SNP	0.003	A
ARHGAP40	343578	genome.wustl.edu	37	20	37270404	37270404	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr20:37270404C>T	ENST00000373345.4	+	10	1324	c.1156C>T	c.(1156-1158)Cac>Tac	p.H386Y		NM_001164431.1	NP_001157903.1	Q5TG30	RHG40_HUMAN	Rho GTPase activating protein 40	386	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)	1						GCAGGTTCTTCACCTGCTCAT	0.577																																						dbGAP											0													154.0	155.0	155.0					20																	37270404		692	1591	2283	-	-	-	SO:0001583	missense	0			AL035419		20q11.23	2011-06-29	2010-04-14	2010-04-14	ENSG00000124143	ENSG00000124143		"""Rho GTPase activating proteins"""	16226	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 95"""	C20orf95			Standard	NM_001164431		Approved	dJ1100H13.4	uc021wdn.1	Q5TG30	OTTHUMG00000032453	ENST00000373345.4:c.1156C>T	20.37:g.37270404C>T	ENSP00000362442:p.His386Tyr			Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.H386Y	ENST00000373345.4	37	c.1156		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.40|18.40	3.615942|3.615942	0.66672|0.66672	.|.	.|.	ENSG00000124143|ENSG00000124143	ENST00000373345|ENST00000243967	T|.	0.18960|.	2.18|.	4.09|4.09	1.94|1.94	0.25998|0.25998	.|.	0.229630|.	0.42548|.	D|.	0.000684|.	T|T	0.36635|0.36635	0.0974|0.0974	L|L	0.48260|0.48260	1.515|1.515	0.26364|0.26364	N|N	0.977005|0.977005	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.25537|0.25537	-1.0129|-1.0129	8|5	0.66056|.	D|.	0.02|.	.|.	4.5693|4.5693	0.12202|0.12202	0.3232:0.5596:0.0:0.1172|0.3232:0.5596:0.0:0.1172	.|.	.|.	.|.	.|.	Y|L	386|326	ENSP00000362442:H386Y|.	ENSP00000362442:H386Y|.	H|S	+|+	1|2	0|0	ARHGAP40|ARHGAP40	36703818|36703818	0.997000|0.997000	0.39634|0.39634	0.893000|0.893000	0.35052|0.35052	0.871000|0.871000	0.50021|0.50021	3.559000|3.559000	0.53756|0.53756	0.951000|0.951000	0.37770|0.37770	0.435000|0.435000	0.28638|0.28638	CAC|TCA	ARHGAP40	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000124143		0.577	ARHGAP40-201	KNOWN	basic|appris_principal	protein_coding	ARHGAP40	HGNC	protein_coding		306	0.00	0	C	XM_293123		37270404	37270404	+1	no_errors	ENST00000373345	ensembl	human	known	69_37n	missense	193	31.80	90	SNP	0.965	T
MRPS18B	28973	genome.wustl.edu	37	6	30595007	30595007	+	IGR	SNP	C	C	T			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr6:30595007C>T	ENST00000259873.4	+	0	1532				ATAT1_ENST00000376478.2_Intron|ATAT1_ENST00000376485.4_Intron|ATAT1_ENST00000330083.5_Silent_p.F9F|ATAT1_ENST00000329992.8_Intron|ATAT1_ENST00000318999.7_Intron|ATAT1_ENST00000468713.1_Intron|ATAT1_ENST00000376483.4_Intron|ATAT1_ENST00000319027.5_Intron	NM_014046.3	NP_054765.1	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B						translation (GO:0006412)	cell junction (GO:0030054)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(2)	13						CTTTCTGCTTCCTCACAATAA	0.517																																						dbGAP											0													86.0	86.0	86.0					6																	30595007		2099	4244	6343	-	-	-	SO:0001628	intergenic_variant	0			AF100761	CCDS4682.1	6p21	2012-09-13			ENSG00000204568	ENSG00000204568		"""Mitochondrial ribosomal proteins / small subunits"""	14516	protein-coding gene	gene with protein product		611982				11279123	Standard	NM_014046		Approved	MRPS18-2, PTD017, C6orf14, HSPC183	uc003nqo.2	Q9Y676	OTTHUMG00000031268		6.37:g.30595007C>T			A6NDQ0|Q659G4|Q9BS27	Silent	SNP	pfam_Touch_recpt_neuron_Mec-17,superfamily_Acyl_CoA_acyltransferase	p.F9	ENST00000259873.4	37	c.27	CCDS4682.1	6																																																																																			ATAT1	-	NULL	ENSG00000137343		0.517	MRPS18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAT1	HGNC	protein_coding	OTTHUMT00000076584.2	236	0.00	0	C			30595007	30595007	+1	no_errors	ENST00000330083	ensembl	human	known	69_37n	silent	158	36.03	89	SNP	0.001	T
BBS5	129880	genome.wustl.edu	37	2	170343618	170343618	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr2:170343618C>T	ENST00000295240.3	+	3	558	c.182C>T	c.(181-183)tCt>tTt	p.S61F	BBS5_ENST00000392663.2_Missense_Mutation_p.S61F|BBS5_ENST00000554017.1_Missense_Mutation_p.S61F|RP11-724O16.1_ENST00000513963.1_Missense_Mutation_p.S61F	NM_152384.2	NP_689597.1	Q8N3I7	BBS5_HUMAN	Bardet-Biedl syndrome 5	61					cilium assembly (GO:0042384)|heart looping (GO:0001947)|melanosome transport (GO:0032402)|motile cilium assembly (GO:0044458)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphate binding (GO:0032266)|RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						CTCTGGCACTCTTTGGCATTA	0.338									Bardet-Biedl syndrome																													dbGAP											0													159.0	166.0	164.0					2																	170343618		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AY604003	CCDS2233.1	2q31	2011-08-02			ENSG00000163093	ENSG00000163093			970	protein-coding gene	gene with protein product		603650				9888993, 10053027	Standard	NM_152384		Approved	DKFZp762I194		Q8N3I7	OTTHUMG00000132207	ENST00000295240.3:c.182C>T	2.37:g.170343618C>T	ENSP00000295240:p.Ser61Phe		D3DPC3|Q6PKN0	Missense_Mutation	SNP	pfam_BBL5,pfam_Kelch_1,smart_DM16_repeat,smart_Kelch_1	p.S61F	ENST00000295240.3	37	c.182	CCDS2233.1	2	.	.	.	.	.	.	.	.	.	.	C	29.2	4.984246	0.93044	.	.	ENSG00000163093;ENSG00000163093;ENSG00000163093;ENSG00000251569	ENST00000295240;ENST00000554017;ENST00000392663;ENST00000513963	T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.88355	0.6414	M	0.85630	2.765	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.988;0.999;0.999	D	0.89675	0.3886	10	0.87932	D	0	-12.8359	19.5042	0.95108	0.0:1.0:0.0:0.0	.	61;61;61	E9PBE3;Q8N3I7-2;Q8N3I7	.;.;BBS5_HUMAN	F	61	ENSP00000295240:S61F;ENSP00000452313:S61F;ENSP00000376431:S61F;ENSP00000424363:S61F	ENSP00000295240:S61F	S	+	2	0	BBS5;RP11-724O16.1	170051864	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.797000	0.69087	2.590000	0.87494	0.655000	0.94253	TCT	BBS5	-	pfam_BBL5,smart_DM16_repeat	ENSG00000163093		0.338	BBS5-001	KNOWN	basic|CCDS	protein_coding	BBS5	HGNC	protein_coding	OTTHUMT00000255265.2	102	0.00	0	C	NM_152384		170343618	170343618	+1	no_errors	ENST00000554017	ensembl	human	known	69_37n	missense	152	36.13	86	SNP	1.000	T
C11orf21	29125	genome.wustl.edu	37	11	2321978	2321978	+	Intron	SNP	C	C	G			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr11:2321978C>G	ENST00000381153.3	-	2	305				TSPAN32_ENST00000182290.4_5'Flank|C11orf21_ENST00000470369.1_5'UTR|TSPAN32_ENST00000381121.3_5'Flank|TSPAN32_ENST00000451520.2_5'Flank			Q9P2W6	CK021_HUMAN	chromosome 11 open reading frame 21							cytoplasm (GO:0005737)											CCAGGGAGGTCAAGGTTGGAG	0.622																																						dbGAP											0													51.0	59.0	56.0					11																	2321978		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AB029488	CCDS44518.1	11p15.5	2012-08-09			ENSG00000110665	ENSG00000110665			13231	protein-coding gene	gene with protein product		611033				11054561	Standard	NM_001142946		Approved		uc009ydj.2	Q9P2W6	OTTHUMG00000009759	ENST00000381153.3:c.54-135G>C	11.37:g.2321978C>G				Missense_Mutation	SNP	NULL	p.D43H	ENST00000381153.3	37	c.127		11	.	.	.	.	.	.	.	.	.	.	C	8.049	0.765593	0.15914	.	.	ENSG00000110665	ENST00000456145	.	.	.	1.11	0.154	0.14901	.	.	.	.	.	T	0.19087	0.0458	N	0.08118	0	0.09310	N	1	D	0.53462	0.96	P	0.50405	0.64	T	0.10359	-1.0633	8	0.87932	D	0	.	3.3327	0.07091	0.0:0.7065:0.0:0.2935	.	43	E9PAM5	.	H	43	.	ENSP00000406541:D43H	D	-	1	0	C11orf21	2278554	0.000000	0.05858	0.001000	0.08648	0.129000	0.20672	0.280000	0.18790	0.043000	0.15746	0.195000	0.17529	GAC	C11orf21	-	NULL	ENSG00000110665		0.622	C11orf21-001	KNOWN	basic	protein_coding	C11orf21	HGNC	protein_coding	OTTHUMT00000026908.2	77	0.00	0	C	NM_001142946		2321978	2321978	-1	no_errors	ENST00000456145	ensembl	human	known	69_37n	missense	54	30.38	24	SNP	0.002	G
ERICH3	127254	genome.wustl.edu	37	1	75078444	75078444	+	Silent	SNP	G	G	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr1:75078444G>A	ENST00000326665.5	-	9	1268	c.1050C>T	c.(1048-1050)ctC>ctT	p.L350L	RP4-612J11.1_ENST00000416017.1_RNA|C1orf173_ENST00000420661.2_Silent_p.L153L	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		350										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						GGAAAAAGGTGAGACTGAAGG	0.428																																						dbGAP											0													85.0	85.0	85.0					1																	75078444		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000326665.5:c.1050C>T	1.37:g.75078444G>A			Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	NULL	p.L350	ENST00000326665.5	37	c.1050	CCDS30755.1	1																																																																																			C1orf173	-	NULL	ENSG00000178965		0.428	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	108	0.00	0	G			75078444	75078444	-1	no_errors	ENST00000326665	ensembl	human	known	69_37n	silent	113	37.57	68	SNP	1.000	A
C8orf48	157773	genome.wustl.edu	37	8	13425043	13425043	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr8:13425043G>A	ENST00000297324.4	+	1	692	c.543G>A	c.(541-543)atG>atA	p.M181I	RP11-145O15.3_ENST00000529018.1_RNA	NM_001007090.2	NP_001007091	Q96LL4	CH048_HUMAN	chromosome 8 open reading frame 48	181										NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	5						TTAAAAACATGAGGACAACGC	0.443																																						dbGAP											0													155.0	140.0	144.0					8																	13425043		692	1591	2283	-	-	-	SO:0001583	missense	0			AK058131	CCDS47809.1	8p22	2012-04-13			ENSG00000164743	ENSG00000164743			26345	protein-coding gene	gene with protein product						12477932	Standard	NM_001007090		Approved	FLJ25402	uc003wwp.3	Q96LL4	OTTHUMG00000165482	ENST00000297324.4:c.543G>A	8.37:g.13425043G>A	ENSP00000297324:p.Met181Ile		Q96LJ9	Missense_Mutation	SNP	NULL	p.M181I	ENST00000297324.4	37	c.543	CCDS47809.1	8	.	.	.	.	.	.	.	.	.	.	G	10.60	1.396517	0.25205	.	.	ENSG00000164743	ENST00000297324	T	0.28895	1.59	5.22	-1.03	0.10102	.	1.330310	0.05344	N	0.530638	T	0.22589	0.0545	L	0.44542	1.39	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.23583	-1.0184	10	0.16896	T	0.51	0.2237	4.7338	0.12977	0.3252:0.277:0.3978:0.0	.	181	Q96LL4	CH048_HUMAN	I	181	ENSP00000297324:M181I	ENSP00000297324:M181I	M	+	3	0	C8orf48	13469414	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	0.059000	0.14322	-0.293000	0.08986	-0.136000	0.14681	ATG	C8orf48	-	NULL	ENSG00000164743		0.443	C8orf48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8orf48	HGNC	protein_coding	OTTHUMT00000384400.1	99	0.00	0	G	NM_001007090		13425043	13425043	+1	no_errors	ENST00000297324	ensembl	human	known	69_37n	missense	83	32.52	40	SNP	0.000	A
CCT6B	10693	genome.wustl.edu	37	17	33278998	33278998	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr17:33278998C>G	ENST00000314144.5	-	5	700	c.585G>C	c.(583-585)gaG>gaC	p.E195D	CCT6B_ENST00000436961.3_Missense_Mutation_p.E150D|CCT6B_ENST00000421975.3_Missense_Mutation_p.E195D	NM_006584.3	NP_006575.2	Q92526	TCPW_HUMAN	chaperonin containing TCP1, subunit 6B (zeta 2)	195					chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	chaperonin-containing T-complex (GO:0005832)	ATP binding (GO:0005524)|protein transporter activity (GO:0008565)|unfolded protein binding (GO:0051082)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	20		Ovarian(249;0.17)				TATGCTTCATCTCCATTATTT	0.313																																						dbGAP											0													102.0	96.0	98.0					17																	33278998		2203	4300	6503	-	-	-	SO:0001583	missense	0			D78333	CCDS32617.1, CCDS54105.1, CCDS54106.1	17q	2011-09-02			ENSG00000132141	ENSG00000132141		"""Heat Shock Proteins / Chaperonins"""	1621	protein-coding gene	gene with protein product		610730				8812458, 9013858	Standard	NM_006584		Approved	Cctz2, TSA303	uc002hig.3	Q92526		ENST00000314144.5:c.585G>C	17.37:g.33278998C>G	ENSP00000327191:p.Glu195Asp		B4DX20|B4DYB0|Q8TC34	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_zeta	p.E195D	ENST00000314144.5	37	c.585	CCDS32617.1	17	.	.	.	.	.	.	.	.	.	.	C	11.48	1.650340	0.29336	.	.	ENSG00000132141	ENST00000421975;ENST00000314144;ENST00000436961	T;T;T	0.78707	-0.24;-1.2;-1.2	4.75	4.75	0.60458	.	0.047167	0.85682	D	0.000000	T	0.71117	0.3302	L	0.39397	1.21	0.58432	D	0.999994	B;B;B	0.12013	0.002;0.005;0.001	B;B;B	0.15484	0.008;0.013;0.009	T	0.68674	-0.5346	10	0.54805	T	0.06	-14.4654	15.6109	0.76716	0.0:1.0:0.0:0.0	.	150;195;195	B4DYB0;B4DX20;Q92526	.;.;TCPW_HUMAN	D	195;195;150	ENSP00000398044:E195D;ENSP00000327191:E195D;ENSP00000400917:E150D	ENSP00000327191:E195D	E	-	3	2	CCT6B	30303111	1.000000	0.71417	1.000000	0.80357	0.624000	0.37722	1.839000	0.39220	2.627000	0.88993	0.655000	0.94253	GAG	CCT6B	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_zeta	ENSG00000132141		0.313	CCT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT6B	HGNC	protein_coding	OTTHUMT00000448014.1	144	0.00	0	C	NM_006584		33278998	33278998	-1	no_errors	ENST00000314144	ensembl	human	known	69_37n	missense	65	55.48	81	SNP	1.000	G
CLDN24	100132463	genome.wustl.edu	37	4	184243151	184243151	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr4:184243151C>G	ENST00000541814.1	-	1	428	c.429G>C	c.(427-429)aaG>aaC	p.K143N	CLDN22_ENST00000323319.5_5'Flank	NM_001185149.1	NP_001172078.1	A6NM45	CLD24_HUMAN	claudin 24	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	4						CCTGAACCGTCTTGTGGGCAA	0.567																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS54824.1	4q35.1	2012-07-05			ENSG00000185758	ENSG00000185758			37200	protein-coding gene	gene with protein product			"""claudin 21"""	CLDN21		12736707	Standard	NM_001185149		Approved		uc021xva.1	A6NM45	OTTHUMG00000160628	ENST00000541814.1:c.429G>C	4.37:g.184243151C>G	ENSP00000438400:p.Lys143Asn		F5H040	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	p.K143N	ENST00000541814.1	37	c.429	CCDS54824.1	4	.	.	.	.	.	.	.	.	.	.	C	2.538	-0.306856	0.05458	.	.	ENSG00000185758	ENST00000541814;ENST00000514470	D;D	0.89270	-2.49;-2.49	4.9	3.14	0.36123	.	2.268860	0.01408	N	0.013872	T	0.71542	0.3352	N	0.01297	-0.9	0.20821	N	0.999846	.	.	.	.	.	.	T	0.67432	-0.5672	8	0.07990	T	0.79	.	7.0975	0.25317	0.0:0.3112:0.502:0.1868	.	.	.	.	N	143;135	ENSP00000438400:K143N;ENSP00000422519:K135N	ENSP00000422519:K135N	K	-	3	2	CLDN24	184480145	0.003000	0.15002	0.036000	0.18154	0.891000	0.51852	0.022000	0.13511	0.653000	0.30826	0.549000	0.68633	AAG	CLDN24	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000185758		0.567	CLDN24-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN24	HGNC	protein_coding		38	0.00	0	C	XM_001714660		184243151	184243151	-1	no_errors	ENST00000541814	ensembl	human	known	69_37n	missense	36	37.93	22	SNP	0.186	G
COASY	80347	genome.wustl.edu	37	17	40715174	40715174	+	Silent	SNP	C	C	T			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr17:40715174C>T	ENST00000393818.2	+	1	990	c.534C>T	c.(532-534)tcC>tcT	p.S178S	COASY_ENST00000421097.2_Silent_p.S178S|COASY_ENST00000420359.1_Silent_p.S178S|RP11-400F19.8_ENST00000585572.1_RNA|COASY_ENST00000590958.1_Silent_p.S207S|COASY_ENST00000449624.1_5'UTR	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase	178					cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		GGCCAGCTTCCCCCGTGGCCG	0.637																																						dbGAP											0													57.0	62.0	60.0					17																	40715174		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.534C>T	17.37:g.40715174C>T			B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Silent	SNP	pfam_Depp_CoAkinase,pfam_Cytidylyltransf,tigrfam_Depp_CoAkinase	p.S207	ENST00000393818.2	37	c.621	CCDS11429.1	17	.	.	.	.	.	.	.	.	.	.	C	11.53	1.665841	0.29604	.	.	ENSG00000068120	ENST00000426807	.	.	.	5.04	1.98	0.26296	.	.	.	.	.	T	0.54175	0.1842	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43180	-0.9407	4	.	.	.	-22.2502	6.4533	0.21916	0.0:0.679:0.1513:0.1696	.	.	.	.	S	154	.	.	P	+	1	0	COASY	37968700	0.837000	0.29446	0.977000	0.42913	0.960000	0.62799	0.135000	0.15952	0.312000	0.23038	-0.264000	0.10439	CCC	COASY	-	NULL	ENSG00000068120		0.637	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	COASY	HGNC	protein_coding	OTTHUMT00000450409.1	61	0.00	0	C	NM_025233		40715174	40715174	+1	no_errors	ENST00000590958	ensembl	human	known	69_37n	silent	8	73.33	22	SNP	0.998	T
COX5A	9377	genome.wustl.edu	37	15	75221511	75221511	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr15:75221511G>A	ENST00000322347.6	-	2	316	c.163C>T	c.(163-165)Cgc>Tgc	p.R55C	COX5A_ENST00000567270.1_Intron|COX5A_ENST00000568517.1_5'UTR|COX5A_ENST00000562233.1_Missense_Mutation_p.R55C|COX5A_ENST00000564811.1_Missense_Mutation_p.R55C|COX5A_ENST00000568783.1_Missense_Mutation_p.R55C	NM_004255.3	NP_004246.2	P20674	COX5A_HUMAN	cytochrome c oxidase subunit Va	55					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)	cytochrome-c oxidase activity (GO:0004129)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|pancreas(1)	3						GTTACCCAGCGAGCATCAAAC	0.393																																						dbGAP											0													151.0	138.0	143.0					15																	75221511		2197	4295	6492	-	-	-	SO:0001583	missense	0			M22760	CCDS10273.1	15q25	2011-07-04			ENSG00000178741	ENSG00000178741	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2267	protein-coding gene	gene with protein product		603773				10072584, 2853101	Standard	NM_004255		Approved		uc002azi.4	P20674	OTTHUMG00000142825	ENST00000322347.6:c.163C>T	15.37:g.75221511G>A	ENSP00000317780:p.Arg55Cys		P30045|Q8TB65	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su5A/6,superfamily_Cyt_c_oxidase_su5A/6	p.R55C	ENST00000322347.6	37	c.163	CCDS10273.1	15	.	.	.	.	.	.	.	.	.	.	G	22.4	4.290767	0.80914	.	.	ENSG00000178741	ENST00000322347	.	.	.	5.62	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.84415	0.5467	M	0.90977	3.165	0.80722	D	1	D	0.71674	0.998	D	0.67231	0.95	D	0.88331	0.2968	9	0.87932	D	0	-8.467	15.1231	0.72460	0.0:0.1539:0.8461:0.0	.	55	P20674	COX5A_HUMAN	C	55	.	ENSP00000317780:R55C	R	-	1	0	COX5A	73008564	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	9.167000	0.94773	1.368000	0.46115	-0.219000	0.12488	CGC	COX5A	-	pfam_Cyt_c_oxidase_su5A/6,superfamily_Cyt_c_oxidase_su5A/6	ENSG00000178741		0.393	COX5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX5A	HGNC	protein_coding	OTTHUMT00000286417.1	192	0.00	0	G	NM_004255		75221511	75221511	-1	no_errors	ENST00000322347	ensembl	human	known	69_37n	missense	179	32.45	86	SNP	1.000	A
DIRAS3	9077	genome.wustl.edu	37	1	68512642	68512642	+	Silent	SNP	G	G	A	rs372359644		TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr1:68512642G>A	ENST00000370981.1	-	4	975	c.339C>T	c.(337-339)gtC>gtT	p.V113V	GNG12-AS1_ENST00000420587.1_RNA|GNG12-AS1_ENST00000413628.1_RNA|DIRAS3_ENST00000395201.1_Silent_p.V113V			O95661	DIRA3_HUMAN	DIRAS family, GTP-binding RAS-like 3	113					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of gene expression by genetic imprinting (GO:0006349)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						AGTAGACCAGGACGAAGGCGT	0.572																																						dbGAP											0													121.0	131.0	127.0					1																	68512642		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U96750	CCDS641.1	1p31	2014-05-09		2005-01-27	ENSG00000162595	ENSG00000162595			687	protein-coding gene	gene with protein product		605193	"""ras homolog gene family, member I"""	ARHI		9874798	Standard	XM_006711027		Approved	NOEY2	uc001ded.3	O95661	OTTHUMG00000009544	ENST00000370981.1:c.339C>T	1.37:g.68512642G>A			B3KMP3	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.V113	ENST00000370981.1	37	c.339	CCDS641.1	1																																																																																			DIRAS3	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom	ENSG00000162595		0.572	DIRAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIRAS3	HGNC	protein_coding	OTTHUMT00000026354.2	78	0.00	0	G	NM_004675		68512642	68512642	-1	no_errors	ENST00000370981	ensembl	human	known	69_37n	silent	41	43.06	31	SNP	1.000	A
DCST1	149095	genome.wustl.edu	37	1	155018634	155018634	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr1:155018634G>T	ENST00000295542.1	+	12	1402	c.1306G>T	c.(1306-1308)Gag>Tag	p.E436*	RP11-307C12.11_ENST00000452962.1_RNA|DCST1_ENST00000423025.2_Nonsense_Mutation_p.E411*|DCST1_ENST00000392480.1_Nonsense_Mutation_p.E436*|DCST1_ENST00000368419.2_Nonsense_Mutation_p.E436*	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1	436						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			CCGCAAAGCTGAGGAGAAAAC	0.562																																						dbGAP											0													109.0	111.0	111.0					1																	155018634		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.1306G>T	1.37:g.155018634G>T	ENSP00000295542:p.Glu436*		B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	Nonsense_Mutation	SNP	pfam_DC_STAMP-like,pfscan_Znf_RING	p.E436*	ENST00000295542.1	37	c.1306	CCDS1083.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.092808	0.97276	.	.	ENSG00000163357	ENST00000295542;ENST00000392480;ENST00000423025;ENST00000368419	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-34.0345	16.0986	0.81148	0.0:0.0:1.0:0.0	.	.	.	.	X	436;436;411;436	.	ENSP00000295542:E436X	E	+	1	0	DCST1	153285258	1.000000	0.71417	0.083000	0.20561	0.626000	0.37791	6.996000	0.76263	2.664000	0.90586	0.655000	0.94253	GAG	DCST1	-	pfam_DC_STAMP-like	ENSG00000163357		0.562	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCST1	HGNC	protein_coding	OTTHUMT00000099006.1	161	0.00	0	G	NM_152494		155018634	155018634	+1	no_errors	ENST00000295542	ensembl	human	known	69_37n	nonsense	105	38.24	65	SNP	0.814	T
FAHD2A	51011	genome.wustl.edu	37	2	96076768	96076768	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr2:96076768G>A	ENST00000233379.4	+	5	832	c.679G>A	c.(679-681)Gta>Ata	p.V227I	FAHD2A_ENST00000447036.1_Missense_Mutation_p.V227I	NM_016044.2	NP_057128.2	Q96GK7	FAH2A_HUMAN	fumarylacetoacetate hydrolase domain containing 2A	227							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)	8						CAAGGACAGTGTAGCAGGTAG	0.557																																						dbGAP											0													108.0	88.0	95.0					2																	96076768		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151863	CCDS2014.1	2q11.2	2008-02-05			ENSG00000115042	ENSG00000115042			24252	protein-coding gene	gene with protein product							Standard	NM_016044		Approved	CGI-105	uc002sur.3	Q96GK7	OTTHUMG00000130397	ENST00000233379.4:c.679G>A	2.37:g.96076768G>A	ENSP00000233379:p.Val227Ile		Q9Y3B0	Missense_Mutation	SNP	pfam_Fumarylacetoacetase_C,superfamily_Fumarylacetoacetase_C-rel	p.V227I	ENST00000233379.4	37	c.679	CCDS2014.1	2	.	.	.	.	.	.	.	.	.	.	G	1.705	-0.500446	0.04291	.	.	ENSG00000115042	ENST00000447036;ENST00000233379	D;D	0.94793	-3.52;-3.52	3.13	0.141	0.14811	Fumarylacetoacetase, C-terminal-related (2);Fumarylacetoacetase, C-terminal (1);	0.414032	0.24169	N	0.040904	T	0.80732	0.4679	N	0.05280	-0.08	0.28002	N	0.935248	B	0.02656	0.0	B	0.12156	0.007	T	0.69281	-0.5186	10	0.02654	T	1	.	5.2096	0.15308	0.4552:0.0:0.5448:0.0	.	227	Q96GK7	FAH2A_HUMAN	I	227	ENSP00000406424:V227I;ENSP00000233379:V227I	ENSP00000233379:V227I	V	+	1	0	FAHD2A	95440495	0.477000	0.25909	0.953000	0.39169	0.995000	0.86356	0.671000	0.25172	-0.115000	0.11915	0.561000	0.74099	GTA	FAHD2A	-	pfam_Fumarylacetoacetase_C,superfamily_Fumarylacetoacetase_C-rel	ENSG00000115042		0.557	FAHD2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAHD2A	HGNC	protein_coding	OTTHUMT00000252778.1	243	0.00	0	G	NM_016044		96076768	96076768	+1	no_errors	ENST00000233379	ensembl	human	known	69_37n	missense	140	38.05	86	SNP	0.829	A
FAM110B	90362	genome.wustl.edu	37	8	59059479	59059479	+	Silent	SNP	C	C	T			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr8:59059479C>T	ENST00000361488.3	+	5	1570	c.690C>T	c.(688-690)atC>atT	p.I230I	FAM110B_ENST00000520369.1_Intron	NM_147189.2	NP_671722.1	Q8TC76	F110B_HUMAN	family with sequence similarity 110, member B	230						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.I230I(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)	26		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				AGCCCAAAATCGCAGCCATCG	0.627																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											78.0	84.0	82.0					8																	59059479		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U79298	CCDS6170.1	8q12.1	2007-06-21	2007-03-21	2007-03-21		ENSG00000169122			28587	protein-coding gene	gene with protein product		611394	"""chromosome 8 open reading frame 72"""	C8orf72		8619474, 9110174, 17499476	Standard	XM_005251324		Approved	MGC39325	uc003xtj.1	Q8TC76		ENST00000361488.3:c.690C>T	8.37:g.59059479C>T			Q5BM08|Q9Y4K2	Silent	SNP	NULL	p.I230	ENST00000361488.3	37	c.690	CCDS6170.1	8																																																																																			FAM110B	-	NULL	ENSG00000169122		0.627	FAM110B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM110B	HGNC	protein_coding	OTTHUMT00000378095.2	57	0.00	0	C	NM_147189		59059479	59059479	+1	no_errors	ENST00000361488	ensembl	human	known	69_37n	silent	55	61.54	88	SNP	0.507	T
FRMPD1	22844	genome.wustl.edu	37	9	37731074	37731074	+	Missense_Mutation	SNP	G	G	A	rs550566906		TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr9:37731074G>A	ENST00000539465.1	+	9	1425	c.832G>A	c.(832-834)Gtg>Atg	p.V278M	FRMPD1_ENST00000541302.1_Missense_Mutation_p.V147M|RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Missense_Mutation_p.V278M|FRMPD1_ENST00000536622.1_Missense_Mutation_p.V100M			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	278	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		AGAAGACCCCGTGGCCTTTGA	0.507													G|||	1	0.000199681	0.0	0.0	5008	,	,		18153	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													90.0	92.0	91.0					9																	37731074		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.832G>A	9.37:g.37731074G>A	ENSP00000444411:p.Val278Met		B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	pfam_FERM_central,pfam_PDZ,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.V278M	ENST00000539465.1	37	c.832	CCDS6612.1	9	.	.	.	.	.	.	.	.	.	.	G	21.1	4.093888	0.76870	.	.	ENSG00000070601	ENST00000377765;ENST00000539465;ENST00000536622;ENST00000541302	D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52	5.64	5.64	0.86602	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);	0.151669	0.49305	D	0.000146	D	0.85517	0.5715	L	0.43152	1.355	0.58432	D	0.999991	D;D	0.76494	0.986;0.999	P;D	0.64321	0.565;0.924	D	0.86463	0.1780	10	0.72032	D	0.01	-16.0643	17.1917	0.86881	0.0:0.0:1.0:0.0	.	147;278	B4DZC8;Q5SYB0	.;FRPD1_HUMAN	M	278;278;100;147	ENSP00000366995:V278M;ENSP00000444411:V278M;ENSP00000437762:V100M;ENSP00000444804:V147M	ENSP00000366995:V278M	V	+	1	0	FRMPD1	37721074	0.999000	0.42202	0.975000	0.42487	0.991000	0.79684	2.749000	0.47492	2.666000	0.90696	0.655000	0.94253	GTG	FRMPD1	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000070601		0.507	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FRMPD1	HGNC	protein_coding	OTTHUMT00000402969.1	94	0.00	0	G	NM_014907		37731074	37731074	+1	no_errors	ENST00000377765	ensembl	human	known	69_37n	missense	40	52.94	45	SNP	0.990	A
FPGS	2356	genome.wustl.edu	37	9	130575737	130575737	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr9:130575737C>T	ENST00000373247.2	+	15	1668	c.1618C>T	c.(1618-1620)Ccc>Tcc	p.P540S	FPGS_ENST00000373225.3_Missense_Mutation_p.P490S|RP11-228B15.4_ENST00000439298.1_RNA|FPGS_ENST00000393706.2_Missense_Mutation_p.P514S|FPGS_ENST00000460181.1_3'UTR|FPGS_ENST00000373245.1_3'UTR	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	540					brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	GCCACCTAGTCCCCCAAAGGG	0.612																																						dbGAP											0													92.0	91.0	91.0					9																	130575737		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.1618C>T	9.37:g.130575737C>T	ENSP00000362344:p.Pro540Ser		B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	superfamily_Mur_ligase_cen,superfamily_Mur_ligase_C,tigrfam_Folylpolyglutamate_synth	p.P540S	ENST00000373247.2	37	c.1618	CCDS35148.1	9	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.582841	0.00879	.	.	ENSG00000136877	ENST00000373247;ENST00000393706;ENST00000373225	T;T;T	0.12879	3.06;3.05;2.64	5.16	-0.215	0.13157	.	1.008970	0.07955	N	0.981480	T	0.13114	0.0318	M	0.65975	2.015	0.09310	N	0.999997	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.002	T	0.48875	-0.8996	10	0.02654	T	1	-8.2339	9.0741	0.36511	0.0:0.5934:0.0:0.4066	.	514;540	Q05932-4;Q05932	.;FOLC_HUMAN	S	540;514;490	ENSP00000362344:P540S;ENSP00000377309:P514S;ENSP00000362322:P490S	ENSP00000362322:P490S	P	+	1	0	FPGS	129615558	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.147000	0.10234	-0.359000	0.08150	-0.827000	0.03088	CCC	FPGS	-	tigrfam_Folylpolyglutamate_synth	ENSG00000136877		0.612	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	FPGS	HGNC	protein_coding	OTTHUMT00000054251.1	45	0.00	0	C			130575737	130575737	+1	no_errors	ENST00000373247	ensembl	human	known	69_37n	missense	63	20.25	16	SNP	0.000	T
HGS	9146	genome.wustl.edu	37	17	79653400	79653400	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr17:79653400G>T	ENST00000329138.4	+	3	316	c.181G>T	c.(181-183)Gcc>Tcc	p.A61S	ARL16_ENST00000573392.1_5'Flank|ARL16_ENST00000570561.1_5'Flank|ARL16_ENST00000576135.1_5'Flank|ARL16_ENST00000397498.4_5'Flank|ARL16_ENST00000574938.1_5'Flank	NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	61	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			CCCACACGTCGCCTTGTATGC	0.493																																						dbGAP											0													134.0	108.0	116.0					17																	79653400		2203	4300	6503	-	-	-	SO:0001583	missense	0			D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		ENST00000329138.4:c.181G>T	17.37:g.79653400G>T	ENSP00000331201:p.Ala61Ser		Q9NR36	Missense_Mutation	SNP	pfam_VHS,pfam_HRS_helical,pfam_Znf_FYVE,superfamily_ENTH_VHS,superfamily_Znf_FYVE_PHD,smart_VHS_subgr,smart_Znf_FYVE,pirsf_Ubi-bd_Hrs_VPS27,pfscan_Ubiquitin-int_motif,pfscan_VHS,pfscan_Znf_FYVE-rel	p.A61S	ENST00000329138.4	37	c.181	CCDS11784.1	17	.	.	.	.	.	.	.	.	.	.	G	29.2	4.989472	0.93106	.	.	ENSG00000185359	ENST00000329138;ENST00000442335	T	0.23754	1.89	5.39	5.39	0.77823	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.160895	0.53938	D	0.000042	T	0.47783	0.1464	M	0.61703	1.905	0.80722	D	1	P	0.43477	0.808	P	0.60473	0.875	T	0.15178	-1.0446	10	0.31617	T	0.26	-35.4452	18.1316	0.89603	0.0:0.0:1.0:0.0	.	61	O14964	HGS_HUMAN	S	61	ENSP00000331201:A61S	ENSP00000331201:A61S	A	+	1	0	HGS	77263805	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.981000	0.93465	2.526000	0.85167	0.655000	0.94253	GCC	HGS	-	pfam_VHS,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_Ubi-bd_Hrs_VPS27,pfscan_VHS	ENSG00000185359		0.493	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGS	HGNC	protein_coding	OTTHUMT00000440541.1	137	0.00	0	G	NM_004712		79653400	79653400	+1	no_errors	ENST00000329138	ensembl	human	known	69_37n	missense	114	60.69	176	SNP	1.000	T
HSPA4L	22824	genome.wustl.edu	37	4	128751921	128751921	+	Silent	SNP	G	G	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr4:128751921G>A	ENST00000296464.4	+	18	2706	c.2295G>A	c.(2293-2295)gtG>gtA	p.V765V	HSPA4L_ENST00000439123.2_Silent_p.V796V|HSPA4L_ENST00000508776.1_Silent_p.V765V|HSPA4L_ENST00000505726.1_Silent_p.V739V	NM_014278.2	NP_055093.2	O95757	HS74L_HUMAN	heat shock 70kDa protein 4-like	765					protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)			central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						AAGATCCTGTGGTAAAAGTTT	0.323																																						dbGAP											0													82.0	82.0	82.0					4																	128751921		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023421	CCDS3734.1	4q28	2011-09-07			ENSG00000164070	ENSG00000164070		"""Heat shock proteins / HSP70"""	17041	protein-coding gene	gene with protein product						10524232	Standard	NM_014278		Approved	APG-1, Osp94, HSPH3	uc003ifm.3	O95757	OTTHUMG00000133302	ENST00000296464.4:c.2295G>A	4.37:g.128751921G>A			A2ICT2|Q4W5M5|Q8IWA2	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.V796	ENST00000296464.4	37	c.2388	CCDS3734.1	4																																																																																			HSPA4L	-	NULL	ENSG00000164070		0.323	HSPA4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA4L	HGNC	protein_coding	OTTHUMT00000257096.3	81	0.00	0	G	NM_014278		128751921	128751921	+1	no_errors	ENST00000439123	ensembl	human	known	69_37n	silent	86	36.30	49	SNP	1.000	A
ITGAM	3684	genome.wustl.edu	37	16	31341486	31341486	+	Splice_Site	SNP	G	G	T			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr16:31341486G>T	ENST00000287497.8	+	26	3135		c.e26+1		ITGAM_ENST00000544665.3_Splice_Site			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)						activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						CCCCGTGGTGGTGAGAAGCTA	0.607																																						dbGAP											0													27.0	29.0	28.0					16																	31341486		2016	4151	6167	-	-	-	SO:0001630	splice_region_variant	0			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.3060+1G>T	16.37:g.31341486G>T			Q4VAK0|Q4VAK1|Q4VAK2	Splice_Site	SNP	-	e26+1	ENST00000287497.8	37	c.3063+1	CCDS45470.1	16	.	.	.	.	.	.	.	.	.	.	G	10.53	1.375919	0.24857	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8949	0.63766	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ITGAM	31248987	1.000000	0.71417	0.998000	0.56505	0.092000	0.18411	4.665000	0.61547	2.653000	0.90120	0.545000	0.68477	.	ITGAM	-	-	ENSG00000169896		0.607	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAM	HGNC	protein_coding	OTTHUMT00000432816.1	42	0.00	0	G	NM_000632	Intron	31341486	31341486	+1	no_errors	ENST00000544665	ensembl	human	known	69_37n	splice_site	40	38.46	25	SNP	1.000	T
KCTD21	283219	genome.wustl.edu	37	11	77885216	77885216	+	Missense_Mutation	SNP	C	C	T	rs372144983		TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr11:77885216C>T	ENST00000340067.3	-	2	663	c.385G>A	c.(385-387)Gag>Aag	p.E129K	KCTD21-AS1_ENST00000530261.1_RNA|KCTD21-AS1_ENST00000600795.1_RNA|KCTD21-AS1_ENST00000523626.2_RNA|KCTD21-AS1_ENST00000528468.1_RNA	NM_001029859.1	NP_001025030.1	Q4G0X4	KCD21_HUMAN	potassium channel tetramerization domain containing 21	129					protein homooligomerization (GO:0051260)					breast(1)|endometrium(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(2)	11	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.46e-24)			TGGGGTGCCTCGCGCACAGTG	0.562																																						dbGAP											0													131.0	107.0	115.0					11																	77885216		2200	4292	6492	-	-	-	SO:0001583	missense	0			AK095233	CCDS31645.1	11q14.1	2013-06-20	2013-06-20			ENSG00000188997			27452	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 21"""			21472142	Standard	XM_005273925		Approved	KCASH2	uc001ozb.3	Q4G0X4		ENST00000340067.3:c.385G>A	11.37:g.77885216C>T	ENSP00000339340:p.Glu129Lys		B4DTR0	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.E129K	ENST00000340067.3	37	c.385	CCDS31645.1	11	.	.	.	.	.	.	.	.	.	.	C	8.072	0.770447	0.15983	.	.	ENSG00000188997	ENST00000340067;ENST00000526208;ENST00000525447	T;T;T	0.53640	0.61;0.69;0.68	6.03	6.03	0.97812	.	0.000000	0.56097	D	0.000023	T	0.26412	0.0645	N	0.08118	0	0.36704	D	0.880262	P	0.45011	0.848	B	0.30855	0.121	T	0.28839	-1.0031	10	0.35671	T	0.21	.	18.7374	0.91761	0.0:1.0:0.0:0.0	.	129	Q4G0X4	KCD21_HUMAN	K	129	ENSP00000339340:E129K;ENSP00000431789:E129K;ENSP00000434174:E129K	ENSP00000339340:E129K	E	-	1	0	KCTD21	77562864	0.996000	0.38824	0.970000	0.41538	0.811000	0.45836	3.126000	0.50477	2.861000	0.98227	0.655000	0.94253	GAG	KCTD21	-	NULL	ENSG00000188997		0.562	KCTD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD21	HGNC	protein_coding	OTTHUMT00000390057.1	222	0.00	0	C	NM_001029859		77885216	77885216	-1	no_errors	ENST00000340067	ensembl	human	known	69_37n	missense	111	51.10	116	SNP	0.983	T
KNDC1	85442	genome.wustl.edu	37	10	135026343	135026343	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr10:135026343G>A	ENST00000304613.3	+	24	4381	c.4360G>A	c.(4360-4362)Gcc>Acc	p.A1454T	KNDC1_ENST00000368572.2_Missense_Mutation_p.A1456T			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1454					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CGGCCCCTGCGCCAAGACCAG	0.642																																						dbGAP											0													74.0	67.0	69.0					10																	135026343		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.4360G>A	10.37:g.135026343G>A	ENSP00000304437:p.Ala1454Thr		B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_Kinase-like_dom,smart_KIND,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.A1456T	ENST00000304613.3	37	c.4366	CCDS7674.1	10	.	.	.	.	.	.	.	.	.	.	G	6.187	0.402745	0.11696	.	.	ENSG00000171798	ENST00000304613;ENST00000368572	T;T	0.28666	1.6;1.6	3.86	-1.74	0.08056	Ras guanine nucleotide exchange factor, domain (1);	1.337100	0.05047	N	0.477394	T	0.19046	0.0457	N	0.17082	0.46	0.09310	N	0.999999	B	0.21452	0.056	B	0.10450	0.005	T	0.28870	-1.0030	10	0.40728	T	0.16	-2.2861	8.5383	0.33377	0.6083:0.0:0.3917:0.0	.	1454	Q76NI1	VKIND_HUMAN	T	1454;1456	ENSP00000304437:A1454T;ENSP00000357561:A1456T	ENSP00000304437:A1454T	A	+	1	0	KNDC1	134876333	0.000000	0.05858	0.060000	0.19600	0.414000	0.31173	-0.195000	0.09546	-0.333000	0.08476	-0.671000	0.03813	GCC	KNDC1	-	superfamily_Ras_GEF_dom	ENSG00000171798		0.642	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	KNDC1	HGNC	protein_coding	OTTHUMT00000277044.3	86	0.00	0	G	NM_152643		135026343	135026343	+1	no_errors	ENST00000368572	ensembl	human	known	69_37n	missense	39	35.00	21	SNP	0.134	A
KRT81	3887	genome.wustl.edu	37	12	52681912	52681912	+	Silent	SNP	C	C	G	rs551734514	byFrequency	TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr12:52681912C>G	ENST00000327741.5	-	5	824	c.756G>C	c.(754-756)tcG>tcC	p.S252S	KRT86_ENST00000423955.2_Intron|KRT86_ENST00000544024.1_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	252	Coil 1B.|Rod.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		CTGAGATGTGCGACTGGAGAA	0.537													.|||	2	0.000399361	0.0	0.0	5008	,	,		19553	0.0		0.001	False		,,,				2504	0.001					dbGAP											0													133.0	117.0	122.0					12																	52681912		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.756G>C	12.37:g.52681912C>G			Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.S252	ENST00000327741.5	37	c.756	CCDS31805.1	12																																																																																			KRT81	-	pfam_F,superfamily_Prefoldin	ENSG00000205426		0.537	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT81	HGNC	protein_coding	OTTHUMT00000395128.2	229	0.00	0	C	NM_002281		52681912	52681912	-1	no_errors	ENST00000327741	ensembl	human	known	69_37n	silent	124	23.78	39	SNP	0.490	G
LAYN	143903	genome.wustl.edu	37	11	111414717	111414717	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr11:111414717G>A	ENST00000375615.3	+	3	364	c.179G>A	c.(178-180)cGa>cAa	p.R60Q	LAYN_ENST00000525126.1_Missense_Mutation_p.R60Q|LAYN_ENST00000533265.1_Missense_Mutation_p.R52Q|LAYN_ENST00000436913.2_5'UTR|LAYN_ENST00000375614.2_Missense_Mutation_p.R52Q|LAYN_ENST00000528924.1_3'UTR	NM_001258390.1	NP_001245319.1	Q6UX15	LAYN_HUMAN	layilin	60	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|ruffle (GO:0001726)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|skin(1)	14		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)	Hyaluronan(DB08818)	GATACTTCTCGAAGACTGAAC	0.463																																					Ovarian(17;551 586 12136 22082 22900)	dbGAP											0													71.0	72.0	72.0					11																	111414717		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS31676.1, CCDS58178.1, CCDS58179.1	11q23.1	2006-02-09			ENSG00000204381	ENSG00000204381			29471	protein-coding gene	gene with protein product						15913605	Standard	NM_001258390		Approved	FLJ30977, FLJ31092	uc001plr.2	Q6UX15	OTTHUMG00000166721	ENST00000375615.3:c.179G>A	11.37:g.111414717G>A	ENSP00000364765:p.Arg60Gln		A6NJB0|B4DJU0|Q8TAY8|Q96NC5|Q96NF3	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.R60Q	ENST00000375615.3	37	c.179	CCDS58178.1	11	.	.	.	.	.	.	.	.	.	.	G	13.04	2.119620	0.37436	.	.	ENSG00000204381	ENST00000375614;ENST00000375615;ENST00000525126;ENST00000533265;ENST00000541011	T;T;T;T	0.06849	3.25;3.46;3.39;3.25	4.5	0.417	0.16421	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.216604	0.39407	N	0.001362	T	0.04227	0.0117	N	0.13327	0.33	0.80722	D	1	B;B;B;B	0.21905	0.062;0.018;0.03;0.007	B;B;B;B	0.29942	0.109;0.013;0.055;0.006	T	0.46992	-0.9151	10	0.17832	T	0.49	-0.6493	5.1759	0.15135	0.245:0.0:0.6117:0.1434	.	52;60;60;52	E9PMI0;Q6UX15;E9PQU7;Q6UX15-2	.;LAYN_HUMAN;.;.	Q	52;60;60;52;52	ENSP00000364764:R52Q;ENSP00000364765:R60Q;ENSP00000434328:R60Q;ENSP00000434972:R52Q	ENSP00000364764:R52Q	R	+	2	0	LAYN	110919927	0.998000	0.40836	0.997000	0.53966	0.951000	0.60555	3.149000	0.50655	-0.087000	0.12528	-0.448000	0.05591	CGA	LAYN	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000204381		0.463	LAYN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAYN	HGNC	protein_coding	OTTHUMT00000391187.1	63	0.00	0	G	NM_178834		111414717	111414717	+1	no_errors	ENST00000375615	ensembl	human	known	69_37n	missense	37	48.65	36	SNP	0.997	A
LHCGR	3973	genome.wustl.edu	37	2	48915909	48915909	+	Missense_Mutation	SNP	A	A	T	rs121912536		TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr2:48915909A>T	ENST00000294954.7	-	11	1048	c.1027T>A	c.(1027-1029)Tgt>Agt	p.C343S	LHCGR_ENST00000401907.1_Intron|LHCGR_ENST00000405626.1_Missense_Mutation_p.C316S|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000344775.3_Missense_Mutation_p.C281S|LHCGR_ENST00000403273.1_Intron	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	343			C -> S (in LHR; Leydig cell hypoplasia type 1; completely devoided of hormone- induced cAMP reporter gene activation; although initial translocation to the endoplasmic reticulum is normal translocation is halted or misrouted and the mutant does not reach the cell surface and cannot bind hormone). {ECO:0000269|PubMed:12050206}.		activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	TCAGGAGCACATCGGGGTGTC	0.433																																						dbGAP											0			GRCh37	CM003262	LHCGR	M	rs121912536						138.0	136.0	137.0					2																	48915909		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.1027T>A	2.37:g.48915909A>T	ENSP00000294954:p.Cys343Ser		Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_LSH_rcpt,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_TSH_rcpt	p.C343S	ENST00000294954.7	37	c.1027	CCDS1842.1	2	.	.	.	.	.	.	.	.	.	.	A	21.9	4.213320	0.79352	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626	D;D;D	0.91068	-2.78;-2.78;-2.78	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.96765	0.8944	H	0.95079	3.62	0.80722	A	1	D	0.69078	0.997	D	0.77004	0.989	D	0.97845	1.0271	8	.	.	.	.	15.5325	0.75974	1.0:0.0:0.0:0.0	.	343	P22888	LSHR_HUMAN	S	281;343;316	ENSP00000344301:C281S;ENSP00000294954:C343S;ENSP00000386033:C316S	.	C	-	1	0	LHCGR	48769413	1.000000	0.71417	0.986000	0.45419	0.997000	0.91878	9.311000	0.96282	2.252000	0.74401	0.533000	0.62120	TGT	LHCGR	-	prints_LSH_rcpt	ENSG00000138039		0.433	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHCGR	HGNC	protein_coding	OTTHUMT00000251364.4	167	0.00	0	A	NM_000233.3		48915909	48915909	-1	no_errors	ENST00000294954	ensembl	human	known	69_37n	missense	111	41.58	79	SNP	0.999	T
LTBP2	4053	genome.wustl.edu	37	14	74970002	74970002	+	Missense_Mutation	SNP	C	C	T	rs75200417	byFrequency	TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr14:74970002C>T	ENST00000261978.4	-	33	5194	c.4808G>A	c.(4807-4809)cGc>cAc	p.R1603H	LTBP2_ENST00000556690.1_Missense_Mutation_p.R1559H	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1603	TB 4.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GTAGGTGGTGCGGTGCCCACG	0.622																																						dbGAP											0													103.0	86.0	92.0					14																	74970002		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.4808G>A	14.37:g.74970002C>T	ENSP00000261978:p.Arg1603His		Q99907|Q9NS51	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,pfam_EGF-like_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.R1603H	ENST00000261978.4	37	c.4808	CCDS9831.1	14	.	.	.	.	.	.	.	.	.	.	C	9.564	1.119247	0.20877	.	.	ENSG00000119681	ENST00000261978;ENST00000556690	D;D	0.90676	-2.71;-2.71	4.76	-0.52	0.11935	Matrix fibril-associated (3);TGF-beta binding (1);	0.258640	0.23349	N	0.049142	D	0.82342	0.5016	L	0.31065	0.9	0.09310	N	1	B	0.17038	0.02	B	0.14578	0.011	T	0.68640	-0.5355	10	0.39692	T	0.17	.	10.4731	0.44648	0.0:0.3748:0.0:0.6252	.	1603	Q14767	LTBP2_HUMAN	H	1603;1559	ENSP00000261978:R1603H;ENSP00000451477:R1559H	ENSP00000261978:R1603H	R	-	2	0	LTBP2	74039755	0.282000	0.24268	0.478000	0.27316	0.559000	0.35586	0.222000	0.17699	-0.308000	0.08792	0.561000	0.74099	CGC	LTBP2	-	pfam_TB_dom,superfamily_TB_dom	ENSG00000119681		0.622	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP2	HGNC	protein_coding	OTTHUMT00000413595.1	159	0.00	0	C	NM_000428		74970002	74970002	-1	no_errors	ENST00000261978	ensembl	human	known	69_37n	missense	84	39.13	54	SNP	0.001	T
MAP3K10	4294	genome.wustl.edu	37	19	40711935	40711935	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr19:40711935C>T	ENST00000253055.3	+	5	1594	c.1306C>T	c.(1306-1308)Cgg>Tgg	p.R436W	AC118344.1_ENST00000408124.1_RNA	NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	436	Leucine-zipper 2.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						CATCGTGGAACGGGAGCTGCA	0.677																																						dbGAP											0													28.0	27.0	27.0					19																	40711935		2201	4299	6500	-	-	-	SO:0001583	missense	0			X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.1306C>T	19.37:g.40711935C>T	ENSP00000253055:p.Arg436Trp		Q12761|Q14871	Missense_Mutation	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom	p.R436W	ENST00000253055.3	37	c.1306	CCDS12549.1	19	.	.	.	.	.	.	.	.	.	.	C	17.99	3.524250	0.64747	.	.	ENSG00000130758	ENST00000253055	T	0.12774	2.65	4.53	3.49	0.39957	.	0.000000	0.85682	D	0.000000	T	0.33556	0.0867	M	0.80847	2.515	0.58432	D	0.999993	D	0.71674	0.998	P	0.57057	0.812	T	0.21724	-1.0237	10	0.66056	D	0.02	.	14.7485	0.69508	0.1475:0.8525:0.0:0.0	.	436	Q02779	M3K10_HUMAN	W	436	ENSP00000253055:R436W	ENSP00000253055:R436W	R	+	1	2	MAP3K10	45403775	1.000000	0.71417	0.935000	0.37517	0.890000	0.51754	2.484000	0.45242	0.445000	0.26639	-2.067000	0.00394	CGG	MAP3K10	-	pirsf_MAPKKK9/10/11	ENSG00000130758		0.677	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K10	HGNC	protein_coding	OTTHUMT00000462552.1	34	0.00	0	C	NM_002446		40711935	40711935	+1	no_errors	ENST00000253055	ensembl	human	known	69_37n	missense	21	31.25	10	SNP	0.999	T
MAZ	4150	genome.wustl.edu	37	16	29821526	29821526	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr16:29821526C>T	ENST00000322945.6	+	5	1573	c.1408C>T	c.(1408-1410)Cag>Tag	p.Q470*	MAZ_ENST00000568282.1_3'UTR|MAZ_ENST00000562337.1_Nonsense_Mutation_p.Q165*|MAZ_ENST00000568544.1_Nonsense_Mutation_p.Q71*|MAZ_ENST00000563402.1_Missense_Mutation_p.S126L|MAZ_ENST00000219782.6_3'UTR|MAZ_ENST00000566906.2_Missense_Mutation_p.S124L|AC009133.15_ENST00000566537.1_RNA|AC009133.14_ENST00000563806.1_RNA|PRRT2_ENST00000300797.6_5'Flank|AC009133.14_ENST00000569981.1_RNA|MAZ_ENST00000545521.1_Nonsense_Mutation_p.Q447*|AC009133.20_ENST00000569039.1_RNA|PRRT2_ENST00000358758.7_5'Flank|PRRT2_ENST00000567659.1_5'Flank	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)	470					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						TGTGAGCTCTCAGCCACTTCC	0.672																																					Colon(72;875 1167 15364 30899 37091)	dbGAP											0													9.0	12.0	11.0					16																	29821526		1936	4111	6047	-	-	-	SO:0001587	stop_gained	0			M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.1408C>T	16.37:g.29821526C>T	ENSP00000313362:p.Gln470*		A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q470*	ENST00000322945.6	37	c.1408	CCDS42143.1	16	.	.	.	.	.	.	.	.	.	.	C	14.43	2.534031	0.45073	.	.	ENSG00000103495	ENST00000545521;ENST00000322945;ENST00000544343	.	.	.	3.91	3.91	0.45181	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.7125	0.51633	0.0:1.0:0.0:0.0	.	.	.	.	X	447;470;245	.	ENSP00000313362:Q470X	Q	+	1	0	MAZ	29729027	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.162000	0.50755	2.483000	0.83821	0.555000	0.69702	CAG	MAZ	-	NULL	ENSG00000103495		0.672	MAZ-001	KNOWN	basic|CCDS	protein_coding	MAZ	HGNC	protein_coding	OTTHUMT00000435536.1	16	0.00	0	C	NM_002383		29821526	29821526	+1	no_errors	ENST00000322945	ensembl	human	known	69_37n	nonsense	15	44.44	12	SNP	1.000	T
MBOAT7	79143	genome.wustl.edu	37	19	54691160	54691160	+	Silent	SNP	G	G	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr19:54691160G>A	ENST00000245615.1	-	4	696	c.216C>T	c.(214-216)caC>caT	p.H72H	TSEN34_ENST00000429671.2_5'Flank|MBOAT7_ENST00000431666.2_Intron|MBOAT7_ENST00000391754.1_Silent_p.H72H|MBOAT7_ENST00000338624.6_Intron|TSEN34_ENST00000302937.4_5'Flank|MBOAT7_ENST00000474910.1_5'UTR	NM_024298.3	NP_077274.3	Q96N66	MBOA7_HUMAN	membrane bound O-acyltransferase domain containing 7	72					glycerophospholipid biosynthetic process (GO:0046474)|layer formation in cerebral cortex (GO:0021819)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|ventricular system development (GO:0021591)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipid acyltransferase activity (GO:0071617)			endometrium(4)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	10	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GAGCCAGGGCGTGGCAGGAGC	0.637																																					NSCLC(97;826 2151 10470 22540)	dbGAP											0													49.0	58.0	55.0					19																	54691160		2195	4299	6494	-	-	-	SO:0001819	synonymous_variant	0			AF211969	CCDS12883.1, CCDS54315.1, CCDS54316.1	19q13.4	2008-12-15	2008-01-17	2008-01-17	ENSG00000125505	ENSG00000125505			15505	protein-coding gene	gene with protein product	"""lysophosphatidylinositol acyltransferase"""	606048	"""leukocyte receptor cluster (LRC) member 4"""	LENG4		10941842, 8702217, 18094042	Standard	NM_024298		Approved	BB1, hMBOA-7, LPIAT	uc002qdr.3	Q96N66	OTTHUMG00000066516	ENST00000245615.1:c.216C>T	19.37:g.54691160G>A			A9C4B6|B0V3I5|B4DQ87|Q05DF0|Q7L5N2|Q99908|Q9BPV2|Q9BRE9	Silent	SNP	pfam_MBOAT_fam	p.H72	ENST00000245615.1	37	c.216	CCDS12883.1	19																																																																																			MBOAT7	-	NULL	ENSG00000125505		0.637	MBOAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBOAT7	HGNC	protein_coding	OTTHUMT00000142203.1	135	0.00	0	G	NM_024298		54691160	54691160	-1	no_errors	ENST00000245615	ensembl	human	known	69_37n	silent	76	46.10	65	SNP	0.994	A
MRPS11	64963	genome.wustl.edu	37	15	89020219	89020219	+	Splice_Site	SNP	G	G	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr15:89020219G>A	ENST00000325844.4	+	5	676		c.e5-1		MRPS11_ENST00000353598.6_Splice_Site|MRPS11_ENST00000557974.1_Splice_Site	NM_022839.3	NP_073750.2	P82912	RT11_HUMAN	mitochondrial ribosomal protein S11						DNA damage response, detection of DNA damage (GO:0042769)|translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(3)	3	Lung NSC(78;0.203)		BRCA - Breast invasive adenocarcinoma(143;0.188)			CTTCTCTCCAGAGAGCTAAAC	0.517											OREG0023439	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													100.0	82.0	88.0					15																	89020219		2201	4299	6500	-	-	-	SO:0001630	splice_region_variant	0			AB051349	CCDS10342.1, CCDS10343.1	15q25	2012-09-13			ENSG00000181991	ENSG00000181991		"""Mitochondrial ribosomal proteins / small subunits"""	14050	protein-coding gene	gene with protein product	"""cervical cancer proto-oncogene 2"""	611977				11402041	Standard	NM_022839		Approved	FLJ23406, HCC-2, FLJ22512	uc002bml.3	P82912	OTTHUMG00000148678	ENST00000325844.4:c.412-1G>A	15.37:g.89020219G>A		1264	B2RD52|Q969D7|Q96GI3|Q9BYC3	Splice_Site	SNP	-	e5-1	ENST00000325844.4	37	c.412-1	CCDS10342.1	15	.	.	.	.	.	.	.	.	.	.	G	17.36	3.370049	0.61624	.	.	ENSG00000181991	ENST00000325844;ENST00000353598	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0893	0.86618	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MRPS11	86821223	1.000000	0.71417	1.000000	0.80357	0.680000	0.39746	7.700000	0.84556	2.691000	0.91804	0.655000	0.94253	.	MRPS11	-	-	ENSG00000181991		0.517	MRPS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS11	HGNC	protein_coding	OTTHUMT00000309067.2	143	0.00	0	G	NM_022839	Intron	89020219	89020219	+1	no_errors	ENST00000325844	ensembl	human	known	69_37n	splice_site	104	36.20	59	SNP	1.000	A
OR5I1	10798	genome.wustl.edu	37	11	55703121	55703121	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr11:55703121G>C	ENST00000301532.3	-	1	755	c.756C>G	c.(754-756)atC>atG	p.I252M		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	252					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TCCCTTGGTAGATCGTCACTG	0.433																																						dbGAP											0													76.0	75.0	75.0					11																	55703121		2201	4296	6497	-	-	-	SO:0001583	missense	0			BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.756C>G	11.37:g.55703121G>C	ENSP00000301532:p.Ile252Met		Q6IEU4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I252M	ENST00000301532.3	37	c.756	CCDS7949.1	11	.	.	.	.	.	.	.	.	.	.	G	10.84	1.464678	0.26335	.	.	ENSG00000167825	ENST00000301532	T	0.00198	8.57	5.16	-0.852	0.10713	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000192	T	0.00210	0.0006	N	0.20328	0.56	0.23376	N	0.99781	D	0.76494	0.999	D	0.87578	0.998	T	0.55630	-0.8111	10	0.72032	D	0.01	.	5.7148	0.17954	0.348:0.1323:0.5197:0.0	.	252	Q13606	OR5I1_HUMAN	M	252	ENSP00000301532:I252M	ENSP00000301532:I252M	I	-	3	3	OR5I1	55459697	0.000000	0.05858	0.408000	0.26446	0.110000	0.19582	-5.735000	0.00101	-0.034000	0.13713	0.643000	0.83706	ATC	OR5I1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000167825		0.433	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5I1	HGNC	protein_coding	OTTHUMT00000391528.1	128	0.00	0	G	NM_006637		55703121	55703121	-1	no_errors	ENST00000301532	ensembl	human	known	69_37n	missense	53	50.47	54	SNP	0.566	C
OTOF	9381	genome.wustl.edu	37	2	26707384	26707384	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr2:26707384G>A	ENST00000272371.2	-	12	1289	c.1163C>T	c.(1162-1164)aCg>aTg	p.T388M	OTOF_ENST00000403946.3_Missense_Mutation_p.T388M	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	388					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTGTGGGGCGTCTTGATGTT	0.612																																					GBM(102;732 1451 20652 24062 31372)	dbGAP											0													176.0	136.0	149.0					2																	26707384		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.1163C>T	2.37:g.26707384G>A	ENSP00000272371:p.Thr388Met		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.T388M	ENST00000272371.2	37	c.1163	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	G	19.54	3.846493	0.71603	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	T;T	0.80393	-1.37;-1.37	4.84	4.84	0.62591	FerIin domain (1);	0.000000	0.85682	D	0.000000	D	0.85818	0.5785	L	0.47716	1.5	0.54753	D	0.99998	D	0.89917	1.0	D	0.77557	0.99	D	0.84133	0.0413	10	0.30854	T	0.27	-10.1788	16.4955	0.84242	0.0:0.0:1.0:0.0	.	388	Q9HC10	OTOF_HUMAN	M	388	ENSP00000272371:T388M;ENSP00000385255:T388M	ENSP00000272371:T388M	T	-	2	0	OTOF	26560888	1.000000	0.71417	0.960000	0.40013	0.992000	0.81027	6.660000	0.74417	2.243000	0.73865	0.462000	0.41574	ACG	OTOF	-	pfam_FerIin-domain	ENSG00000115155		0.612	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3	229	0.00	0	G			26707384	26707384	-1	no_errors	ENST00000272371	ensembl	human	known	69_37n	missense	124	30.17	54	SNP	0.997	A
OTOGL	283310	genome.wustl.edu	37	12	80730728	80730728	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr12:80730728A>G	ENST00000547103.1	+	41	4747	c.4741A>G	c.(4741-4743)Aag>Gag	p.K1581E	OTOGL_ENST00000458043.2_Missense_Mutation_p.K1593E			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1581	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TTGTTTTAAGAAGTTAAATGT	0.294																																						dbGAP											0													31.0	29.0	29.0					12																	80730728		1785	4041	5826	-	-	-	SO:0001583	missense	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.4741A>G	12.37:g.80730728A>G	ENSP00000447211:p.Lys1581Glu		F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.K1593E	ENST00000547103.1	37	c.4777		12	.	.	.	.	.	.	.	.	.	.	A	7.827	0.718918	0.15372	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.57107	0.42;0.42	4.92	4.92	0.64577	.	.	.	.	.	T	0.55321	0.1913	M	0.65975	2.015	0.32916	D	0.515198	.	.	.	.	.	.	T	0.59085	-0.7520	7	0.06099	T	0.92	.	14.8351	0.70177	1.0:0.0:0.0:0.0	.	.	.	.	E	1581;1593	ENSP00000447211:K1581E;ENSP00000400895:K1593E	ENSP00000400895:K1593E	K	+	1	0	OTOGL	79254859	1.000000	0.71417	1.000000	0.80357	0.741000	0.42261	4.245000	0.58734	1.954000	0.56735	0.482000	0.46254	AAG	OTOGL	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000165899		0.294	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	38	0.00	0	A	NM_173591		80730728	80730728	+1	no_errors	ENST00000458043	ensembl	human	known	69_37n	missense	36	40.00	24	SNP	1.000	G
P2RY4	5030	genome.wustl.edu	37	X	69479266	69479266	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chrX:69479266G>A	ENST00000374519.2	-	1	388	c.209C>T	c.(208-210)aCg>aTg	p.T70M		NM_002565.3	NP_002556.1	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 4	70					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|transepithelial chloride transport (GO:0030321)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|uridine nucleotide receptor activity (GO:0015065)|UTP-activated nucleotide receptor activity (GO:0045030)			cervix(2)|endometrium(2)|large_intestine(8)|lung(6)	18						GTAGGTGGCCGTTGCATCCCA	0.562																																						dbGAP											0													100.0	71.0	81.0					X																	69479266		2203	4300	6503	-	-	-	SO:0001583	missense	0			X91852	CCDS14398.1	Xq13	2012-08-08			ENSG00000186912	ENSG00000186912		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8542	protein-coding gene	gene with protein product		300038				8537336	Standard	NM_002565		Approved	NRU, P2Y4, UNR, P2P	uc004dxz.1	P51582	OTTHUMG00000021769	ENST00000374519.2:c.209C>T	X.37:g.69479266G>A	ENSP00000363643:p.Thr70Met		Q4VBB7|Q4VBB8|Q502W2|Q5JT22	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_P2Y4_purnocptor,prints_P2_purnocptor,prints_7TM_GPCR_Rhodpsn,prints_P2U_purnocptor,pfscan_GPCR_Rhodpsn_supfam	p.T70M	ENST00000374519.2	37	c.209	CCDS14398.1	X	.	.	.	.	.	.	.	.	.	.	G	9.924	1.213088	0.22289	.	.	ENSG00000186912	ENST00000374519	T	0.36520	1.25	4.14	2.35	0.29111	GPCR, rhodopsin-like superfamily (1);	0.184856	0.45361	N	0.000369	T	0.38639	0.1048	M	0.75264	2.295	0.40916	D	0.984276	B	0.22346	0.068	B	0.29598	0.104	T	0.31503	-0.9941	10	0.66056	D	0.02	.	8.8166	0.35000	0.1871:0.0:0.8129:0.0	.	70	P51582	P2RY4_HUMAN	M	70	ENSP00000363643:T70M	ENSP00000363643:T70M	T	-	2	0	P2RY4	69395991	0.985000	0.35326	0.407000	0.26434	0.686000	0.39977	2.108000	0.41854	0.364000	0.24374	0.517000	0.50305	ACG	P2RY4	-	pfam_7TM_GPCR_Rhodpsn,prints_P2Y4_purnocptor,prints_7TM_GPCR_Rhodpsn,prints_P2U_purnocptor,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186912		0.562	P2RY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY4	HGNC	protein_coding	OTTHUMT00000057058.2	85	0.00	0	G	NM_002565		69479266	69479266	-1	no_errors	ENST00000374519	ensembl	human	known	69_37n	missense	73	35.65	41	SNP	0.732	A
PAX5	5079	genome.wustl.edu	37	9	37020655	37020655	+	Frame_Shift_Del	DEL	A	A	-			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr9:37020655delA	ENST00000358127.4	-	2	264	c.190delT	c.(190-192)tgtfs	p.C64fs	PAX5_ENST00000520154.1_Frame_Shift_Del_p.C64fs|PAX5_ENST00000377847.2_Frame_Shift_Del_p.C64fs|PAX5_ENST00000377852.2_Frame_Shift_Del_p.C64fs|PAX5_ENST00000520281.1_Frame_Shift_Del_p.C64fs|PAX5_ENST00000523145.1_Intron|PAX5_ENST00000414447.1_Frame_Shift_Del_p.C64fs|PAX5_ENST00000377853.2_Frame_Shift_Del_p.C64fs|PAX5_ENST00000446742.1_Frame_Shift_Del_p.C64fs|PAX5_ENST00000523241.1_Frame_Shift_Del_p.C64fs|PAX5_ENST00000522003.1_Intron	NM_001280554.1|NM_001280556.1|NM_016734.1	NP_001267483.1|NP_001267485.1|NP_057953.1	Q02548	PAX5_HUMAN	paired box 5	64	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.?(41)	PAX5/JAK2(18)	NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(151)|kidney(1)|lung(10)|prostate(1)|skin(1)	171		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		TTGCTGACACAACCATGGCTG	0.517			"""T, Mis, D, F, S"""	"""IGH@, ETV6, PML, FOXP1, ZNF521, ELN"""	"""NHL, ALL, B-ALL"""																																	dbGAP		Dom	yes		9	9p13	5079	paired box gene 5 (B-cell lineage specific activator protein)		L	41	Unknown(41)	haematopoietic_and_lymphoid_tissue(41)											120.0	119.0	119.0					9																	37020655		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS6607.1, CCDS65039.1, CCDS65040.1, CCDS65041.1, CCDS65042.1, CCDS65043.1, CCDS65044.1, CCDS65045.1, CCDS65046.1, CCDS65047.1, CCDS65048.1	9p13.2	2011-06-20	2007-07-12		ENSG00000196092	ENSG00000196092		"""Paired boxes"", ""Homeoboxes / PRD class"""	8619	protein-coding gene	gene with protein product	"""B-cell lineage specific activator"""	167414	"""paired box gene 5 (B-cell lineage specific activator protein)"", ""paired box gene 5 (B-cell lineage specific activator)"""			1516825, 8431641	Standard	NM_016734		Approved	BSAP	uc003zzo.1	Q02548	OTTHUMG00000019907	ENST00000358127.4:c.190delT	9.37:g.37020655delA	ENSP00000350844:p.Cys64fs		A3QVP6|A3QVP7|A3QVP8|C0KTF6|C0KTF7|C0KTF8|C0KTF9|C0KTG0|O75933|Q5SFM2|Q6S728|Q6S729|Q6S730|Q6S731|Q6S732	Frame_Shift_Del	DEL	pfam_Paired_dom,pfam_Pax2_C,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	p.C64fs	ENST00000358127.4	37	c.190	CCDS6607.1	9																																																																																			PAX5	-	pfam_Paired_dom,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	ENSG00000196092		0.517	PAX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX5	HGNC	protein_coding	OTTHUMT00000052433.1	126	0.00	0	A			37020655	37020655	-1	no_errors	ENST00000358127	ensembl	human	known	69_37n	frame_shift_del	42	46.34	38	DEL	1.000	-
PCDHAC2	56134	genome.wustl.edu	37	5	140348769	140348769	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr5:140348769C>A	ENST00000289269.5	+	1	2950	c.2418C>A	c.(2416-2418)ttC>ttA	p.F806L	PCDHA13_ENST00000409494.1_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000506939.2_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	806					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGACACTTTCATGTTTTACA	0.542																																					Melanoma(190;638 2083 3390 11909 52360)	dbGAP											0													78.0	77.0	77.0					5																	140348769		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.2418C>A	5.37:g.140348769C>A	ENSP00000289269:p.Phe806Leu		Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.F806L	ENST00000289269.5	37	c.2418	CCDS4242.1	5	.	.	.	.	.	.	.	.	.	.	C	11.00	1.510828	0.27036	.	.	ENSG00000243232	ENST00000289269	T	0.38887	1.11	5.19	4.32	0.51571	.	0.000000	0.44285	D	0.000480	T	0.57095	0.2030	M	0.73598	2.24	0.80722	D	1	P;D	0.69078	0.603;0.997	B;D	0.70716	0.283;0.97	T	0.56637	-0.7946	10	0.15499	T	0.54	.	9.1987	0.37244	0.0:0.7718:0.0:0.2282	.	806;806	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	L	806	ENSP00000289269:F806L	ENSP00000289269:F806L	F	+	3	2	PCDHAC2	140328953	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.009000	0.29886	1.198000	0.43158	0.462000	0.41574	TTC	PCDHAC2	-	NULL	ENSG00000243232		0.542	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHAC2	HGNC	protein_coding	OTTHUMT00000251802.2	65	0.00	0	C	NM_018899		140348769	140348769	+1	no_errors	ENST00000289269	ensembl	human	known	69_37n	missense	55	40.22	37	SNP	1.000	A
PDGFRA	5156	genome.wustl.edu	37	4	55133783	55133783	+	Silent	SNP	C	C	G	rs142498442	byFrequency	TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr4:55133783C>G	ENST00000257290.5	+	7	1327	c.996C>G	c.(994-996)gtC>gtG	p.V332V	FIP1L1_ENST00000507166.1_Intron	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	332	Ig-like C2-type 4.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	TGCATGAAGTCAAACATTTTG	0.433			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)	dbGAP		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	0													78.0	77.0	77.0					4																	55133783		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.996C>G	4.37:g.55133783C>G			B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Silent	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR_rcpt_N	p.V332	ENST00000257290.5	37	c.996	CCDS3495.1	4																																																																																			PDGFRA	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2	ENSG00000134853		0.433	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRA	HGNC	protein_coding	OTTHUMT00000250598.2	43	0.00	0	C	NM_006206		55133783	55133783	+1	no_errors	ENST00000257290	ensembl	human	known	69_37n	silent	45	34.78	24	SNP	0.146	G
QSER1	79832	genome.wustl.edu	37	11	32955061	32955061	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr11:32955061G>T	ENST00000399302.2	+	4	2205	c.1870G>T	c.(1870-1872)Gtt>Ttt	p.V624F	QSER1_ENST00000527788.1_Missense_Mutation_p.V385F	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	624										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					AGTTATTGGGGTTGCTCTGCA	0.383																																						dbGAP											0													88.0	85.0	86.0					11																	32955061		1860	4090	5950	-	-	-	SO:0001583	missense	0			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.1870G>T	11.37:g.32955061G>T	ENSP00000382241:p.Val624Phe		Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	NULL	p.V624F	ENST00000399302.2	37	c.1870	CCDS41631.1	11	.	.	.	.	.	.	.	.	.	.	G	9.137	1.012922	0.19277	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	T;T	0.23950	2.21;1.88	5.01	1.4	0.22301	.	0.491680	0.18595	N	0.136626	T	0.13927	0.0337	N	0.19112	0.55	0.22827	N	0.998684	P;B;B	0.36909	0.573;0.145;0.09	B;B;B	0.36766	0.232;0.107;0.03	T	0.11966	-1.0566	10	0.51188	T	0.08	.	5.1173	0.14840	0.4973:0.2042:0.2985:0.0	.	385;385;624	C9JJ88;Q2KHR3-2;Q2KHR3	.;.;QSER1_HUMAN	F	624;385;385	ENSP00000382241:V624F;ENSP00000432766:V385F	ENSP00000078652:V385F	V	+	1	0	QSER1	32911637	1.000000	0.71417	0.959000	0.39883	0.841000	0.47740	1.327000	0.33746	0.360000	0.24265	-0.469000	0.05056	GTT	QSER1	-	NULL	ENSG00000060749		0.383	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSER1	HGNC	protein_coding	OTTHUMT00000388448.1	52	0.00	0	G	NM_024774		32955061	32955061	+1	no_errors	ENST00000399302	ensembl	human	known	69_37n	missense	44	35.29	24	SNP	0.917	T
SERPINA6	866	genome.wustl.edu	37	14	94770757	94770757	+	Nonstop_Mutation	SNP	A	A	C			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr14:94770757A>C	ENST00000341584.3	-	5	1362	c.1216T>G	c.(1216-1218)Taa>Gaa	p.*406E		NM_001756.3	NP_001747	P08185	CBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6	0					glucocorticoid metabolic process (GO:0008211)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)|steroid binding (GO:0005496)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	26		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	GTGGTCTCTTACACTGGGTTC	0.532																																						dbGAP											0													108.0	100.0	102.0					14																	94770757		2203	4300	6503	-	-	-	SO:0001578	stop_lost	0			J02943	CCDS9924.1	14q32.13	2014-02-18	2005-08-18		ENSG00000170099	ENSG00000170099		"""Serine (or cysteine) peptidase inhibitors"""	1540	protein-coding gene	gene with protein product	"""corticosteroid binding globulin"", ""transcortin"""	122500	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6"""	CBG		3299377, 7912884, 24172014	Standard	NM_001756		Approved		uc001ycv.3	P08185	OTTHUMG00000171346	ENST00000341584.3:c.1216T>G	14.37:g.94770757A>C	ENSP00000342850:p.*406Glnext*44		A8K456|Q7Z2Q9	Nonstop_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom,prints_Prot_inh_Lserp2	p.*406E	ENST00000341584.3	37	c.1216	CCDS9924.1	14	.	.	.	.	.	.	.	.	.	.	A	6.059	0.379178	0.11466	.	.	ENSG00000170099	ENST00000341584	.	.	.	4.83	0.954	0.19595	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.0331	0.14421	0.5065:0.169:0.0:0.3245	.	.	.	.	E	406	.	.	X	-	1	0	SERPINA6	93840510	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.513000	0.22770	0.067000	0.16545	-0.333000	0.08304	TAA	SERPINA6	-	NULL	ENSG00000170099		0.532	SERPINA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA6	HGNC	protein_coding	OTTHUMT00000413065.1	110	0.00	0	A	NM_001756		94770757	94770757	-1	no_errors	ENST00000341584	ensembl	human	known	69_37n	nonstop	80	38.46	50	SNP	0.000	C
SLC2A14	144195	genome.wustl.edu	37	12	7981305	7981305	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr12:7981305G>A	ENST00000543909.1	-	11	1499	c.740C>T	c.(739-741)aCg>aTg	p.T247M	SLC2A14_ENST00000539924.1_Missense_Mutation_p.T262M|SLC2A14_ENST00000340749.5_Missense_Mutation_p.T224M|SLC2A14_ENST00000396589.2_Missense_Mutation_p.T247M|SLC2A14_ENST00000535295.1_Missense_Mutation_p.T138M|SLC2A14_ENST00000542546.1_Missense_Mutation_p.T138M|SLC2A14_ENST00000542505.1_Intron|SLC2A14_ENST00000431042.2_Missense_Mutation_p.T224M			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	247					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		CTCACTCCGCGTAGCATTCTC	0.423																																						dbGAP											0													117.0	111.0	113.0					12																	7981305		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.740C>T	12.37:g.7981305G>A	ENSP00000440480:p.Thr247Met		B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,prints_Glc_transpt_3,tigrfam_Sugar/inositol_transpt	p.T247M	ENST00000543909.1	37	c.740	CCDS8585.1	12	.	.	.	.	.	.	.	.	.	.	G	7.688	0.690375	0.15039	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000396589;ENST00000535295;ENST00000542546;ENST00000539924	T;T;T;T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91	3.92	-6.55	0.01854	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.415190	0.27609	N	0.018602	T	0.53578	0.1805	L	0.31845	0.965	0.20074	N	0.999935	B;B;B;B	0.24043	0.044;0.013;0.01;0.096	B;B;B;B	0.29862	0.069;0.042;0.015;0.108	T	0.42344	-0.9457	10	0.62326	D	0.03	.	3.5822	0.07958	0.1123:0.0972:0.4278:0.3626	.	262;138;224;247	B7ZAC3;B7Z844;Q8TDB8-2;Q8TDB8	.;.;.;GTR14_HUMAN	M	224;247;224;247;138;138;262	ENSP00000340450:T224M;ENSP00000440480:T247M;ENSP00000407287:T224M;ENSP00000379834:T247M;ENSP00000440492:T138M;ENSP00000443903:T138M;ENSP00000445929:T262M	ENSP00000340450:T224M	T	-	2	0	SLC2A14	7872572	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	-0.153000	0.10144	-1.097000	0.03042	-2.451000	0.00208	ACG	SLC2A14	-	pfam_Sub_transporter,pfam_MFS,pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000173262		0.423	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	SLC2A14	HGNC	protein_coding	OTTHUMT00000399836.2	126	0.00	0	G	NM_153449		7981305	7981305	-1	no_errors	ENST00000396589	ensembl	human	known	69_37n	missense	118	37.37	71	SNP	0.000	A
SNX10	29887	genome.wustl.edu	37	7	26404752	26404752	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr7:26404752G>A	ENST00000338523.4	+	5	485	c.298G>A	c.(298-300)Gat>Aat	p.D100N	SNX10_ENST00000396376.1_Missense_Mutation_p.D100N|SNX10_ENST00000409367.1_Missense_Mutation_p.D60N|SNX10_ENST00000409838.1_Missense_Mutation_p.D16N|SNX10_ENST00000446848.2_Missense_Mutation_p.D126N	NM_001199835.1|NM_013322.2	NP_001186764.1|NP_037454.2	Q9Y5X0	SNX10_HUMAN	sorting nexin 10	100	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.|Required for the interaction with ATP6V1D.				cilium assembly (GO:0042384)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|osteoclast differentiation (GO:0030316)|protein localization to centrosome (GO:0071539)|protein localization to cilium (GO:0061512)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extrinsic component of endosome membrane (GO:0031313)|nucleus (GO:0005634)	1-phosphatidylinositol binding (GO:0005545)|ATPase binding (GO:0051117)			endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	6						GGGTCTGGAAGATTTCCTCAG	0.478											OREG0017908	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													56.0	58.0	57.0					7																	26404752		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF121860	CCDS5399.1, CCDS56470.1	7p15.2	2008-05-22			ENSG00000086300	ENSG00000086300		"""Sorting nexins"""	14974	protein-coding gene	gene with protein product		614780				17012226	Standard	NM_013322		Approved		uc010kuu.3	Q9Y5X0	OTTHUMG00000023650	ENST00000338523.4:c.298G>A	7.37:g.26404752G>A	ENSP00000343709:p.Asp100Asn	786	E9PFH5|Q8IYT5	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.D126N	ENST00000338523.4	37	c.376	CCDS5399.1	7	.	.	.	.	.	.	.	.	.	.	G	21.5	4.165073	0.78339	.	.	ENSG00000086300	ENST00000416246;ENST00000338523;ENST00000446848;ENST00000396376;ENST00000409367;ENST00000409838	T;T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14;1.14	6.17	6.17	0.99709	Phox homologous domain (5);	0.193081	0.53938	D	0.000042	T	0.32496	0.0831	N	0.03930	-0.32	0.40096	D	0.976312	P;P	0.51449	0.945;0.77	P;P	0.53313	0.723;0.5	T	0.33650	-0.9860	10	0.33141	T	0.24	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	126;100	B4DJM0;Q9Y5X0	.;SNX10_HUMAN	N	126;100;126;100;60;16	ENSP00000408164:D126N;ENSP00000343709:D100N;ENSP00000395474:D126N;ENSP00000379661:D100N;ENSP00000387274:D60N;ENSP00000386540:D16N	ENSP00000343709:D100N	D	+	1	0	SNX10	26371277	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.481000	0.60250	2.941000	0.99782	0.655000	0.94253	GAT	SNX10	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000086300		0.478	SNX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX10	HGNC	protein_coding	OTTHUMT00000214120.1	93	0.00	0	G			26404752	26404752	+1	no_errors	ENST00000446848	ensembl	human	known	69_37n	missense	74	42.19	54	SNP	1.000	A
TROAP	10024	genome.wustl.edu	37	12	49724652	49724652	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr12:49724652C>G	ENST00000257909.3	+	13	2100	c.2024C>G	c.(2023-2025)tCt>tGt	p.S675C	TROAP_ENST00000547923.1_Missense_Mutation_p.S354C|TROAP_ENST00000551245.1_Missense_Mutation_p.S675C	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	675	Cys-rich.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						CTGATCTTCTCTTCCCAACAC	0.592																																						dbGAP											0													157.0	151.0	153.0					12																	49724652		2203	4300	6503	-	-	-	SO:0001583	missense	0			U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.2024C>G	12.37:g.49724652C>G	ENSP00000257909:p.Ser675Cys		F8VSF9|Q6PJU7|Q8N5B2	Missense_Mutation	SNP	NULL	p.S675C	ENST00000257909.3	37	c.2024	CCDS8784.1	12	.	.	.	.	.	.	.	.	.	.	C	18.32	3.598290	0.66332	.	.	ENSG00000135451	ENST00000551245;ENST00000257909;ENST00000547923	.	.	.	4.96	3.1	0.35709	.	0.000000	0.47455	D	0.000224	T	0.56920	0.2018	L	0.47190	1.495	0.30498	N	0.770725	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.994;0.996;0.994	T	0.57118	-0.7866	9	0.87932	D	0	-14.5806	7.9625	0.30079	0.0:0.7995:0.0:0.2005	.	675;354;675	F8W130;F8W1U0;Q12815	.;.;TROAP_HUMAN	C	675;675;354	.	ENSP00000257909:S675C	S	+	2	0	TROAP	48010919	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	2.019000	0.41001	1.220000	0.43490	0.462000	0.41574	TCT	TROAP	-	NULL	ENSG00000135451		0.592	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TROAP	HGNC	protein_coding	OTTHUMT00000404300.1	215	0.00	0	C	NM_005480		49724652	49724652	+1	no_errors	ENST00000257909	ensembl	human	known	69_37n	missense	159	33.47	80	SNP	0.994	G
TSPAN7	7102	genome.wustl.edu	37	X	38533518	38533518	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chrX:38533518C>A	ENST00000378482.2	+	4	566	c.389C>A	c.(388-390)aCt>aAt	p.T130N	TSPAN7_ENST00000286824.6_Missense_Mutation_p.T147N|TSPAN7_ENST00000422612.2_Missense_Mutation_p.T156N|TSPAN7_ENST00000488893.1_3'UTR|TM4SF2_ENST00000465127.1_Missense_Mutation_p.T160N|TSPAN7_ENST00000545599.1_Missense_Mutation_p.T104N	NM_004615.3	NP_004606.2	P41732	TSN7_HUMAN	tetraspanin 7	130					viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	11						GCTATGCAGACTTACAATGGC	0.517																																						dbGAP											0													116.0	78.0	91.0					X																	38533518		2202	4300	6502	-	-	-	SO:0001583	missense	0			D29808	CCDS14248.1	Xp11.4	2013-02-14	2005-03-21	2005-03-21	ENSG00000156298	ENSG00000156298		"""CD molecules"", ""Tetraspanins"""	11854	protein-coding gene	gene with protein product		300096	"""transmembrane 4 superfamily member 2"", ""mental retardation, X-linked 58"""	MXS1, TM4SF2, MRX58		12070254	Standard	NM_004615		Approved	DXS1692E, TALLA-1, A15, CD231	uc004deg.4	P41732	OTTHUMG00000024090	ENST00000378482.2:c.389C>A	X.37:g.38533518C>A	ENSP00000367743:p.Thr130Asn		B2R5W7|D3DWB1|Q8WVG5|Q9UEY9	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.T156N	ENST00000378482.2	37	c.467	CCDS14248.1	X	.	.	.	.	.	.	.	.	.	.	C	3.767	-0.048431	0.07407	.	.	ENSG00000250349;ENSG00000156298;ENSG00000156298;ENSG00000156298;ENSG00000156298	ENST00000465127;ENST00000378482;ENST00000422612;ENST00000286824;ENST00000545599	D;D;D;D;D	0.86030	-2.06;-2.06;-2.06;-2.06;-2.06	5.91	3.49	0.39957	Tetraspanin, EC2 domain (1);	0.181713	0.64402	N	0.000013	T	0.57388	0.2050	N	0.00504	-1.425	0.21579	N	0.999638	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.47535	-0.9110	9	.	.	.	.	12.241	0.54541	0.7327:0.2673:0.0:0.0	.	147;156;130	B4DDG0;B4DEA5;P41732	.;.;TSN7_HUMAN	N	160;130;156;147;104	ENSP00000417050:T160N;ENSP00000367743:T130N;ENSP00000388954:T156N;ENSP00000286824:T147N;ENSP00000441540:T104N	.	T	+	2	0	RP5-972B16.2;TSPAN7	38418462	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	3.311000	0.51919	0.317000	0.23160	-1.256000	0.01477	ACT	TSPAN7	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000156298		0.517	TSPAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN7	HGNC	protein_coding	OTTHUMT00000356412.1	141	0.00	0	C			38533518	38533518	+1	no_errors	ENST00000422612	ensembl	human	known	69_37n	missense	90	35.71	50	SNP	1.000	A
TWISTNB	221830	genome.wustl.edu	37	7	19739894	19739894	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr7:19739894T>A	ENST00000222567.5	-	3	476	c.406A>T	c.(406-408)Aat>Tat	p.N136Y		NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor	136					transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						GACACTTTATTAACTATACCC	0.398																																						dbGAP											0													60.0	58.0	59.0					7																	19739894		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.406A>T	7.37:g.19739894T>A	ENSP00000222567:p.Asn136Tyr		A0PJ45|B7Z724	Missense_Mutation	SNP	pfam_RNA_pol_Rpb7_N	p.N136Y	ENST00000222567.5	37	c.406	CCDS34606.1	7	.	.	.	.	.	.	.	.	.	.	T	24.2	4.502575	0.85176	.	.	ENSG00000105849	ENST00000222567	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.76758	0.4032	L	0.60904	1.88	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78927	-0.2011	9	0.87932	D	0	-37.3553	16.1894	0.81975	0.0:0.0:0.0:1.0	.	136	Q3B726	RPA43_HUMAN	Y	136	.	ENSP00000222567:N136Y	N	-	1	0	TWISTNB	19706419	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.336000	0.79245	2.217000	0.71921	0.528000	0.53228	AAT	TWISTNB	-	NULL	ENSG00000105849		0.398	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TWISTNB	HGNC	protein_coding	OTTHUMT00000326463.1	70	0.00	0	T			19739894	19739894	-1	no_errors	ENST00000222567	ensembl	human	known	69_37n	missense	93	26.19	33	SNP	1.000	A
UQCRC2	7385	genome.wustl.edu	37	16	21994417	21994417	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr16:21994417G>C	ENST00000268379.4	+	14	2051	c.1287G>C	c.(1285-1287)aaG>aaC	p.K429N	UQCRC2_ENST00000561553.1_Missense_Mutation_p.R378T	NM_003366.2	NP_003357.2	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II	429					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.K429K(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(48;0.0264)		AGGCGGCAAAGAAGTTTGTTT	0.338																																					Colon(123;450 1645 12841 25393 45623)	dbGAP											1	Substitution - coding silent(1)	cervix(1)											98.0	89.0	92.0					16																	21994417		2198	4300	6498	-	-	-	SO:0001583	missense	0			J04973	CCDS10601.1	16p12	2011-07-04			ENSG00000140740	ENSG00000140740	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12586	protein-coding gene	gene with protein product		191329				8288258, 2547763	Standard	NM_003366		Approved	QCR2, UQCR2	uc002djx.3	P22695	OTTHUMG00000131585	ENST00000268379.4:c.1287G>C	16.37:g.21994417G>C	ENSP00000268379:p.Lys429Asn		B3KSN4|Q9BQ05	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	p.K429N	ENST00000268379.4	37	c.1287	CCDS10601.1	16	.	.	.	.	.	.	.	.	.	.	G	12.78	2.040626	0.35989	.	.	ENSG00000140740	ENST00000268379	T	0.48522	0.81	5.13	3.13	0.36017	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.132405	0.64402	D	0.000002	T	0.36138	0.0956	L	0.45581	1.43	0.22639	N	0.998909	B	0.14012	0.009	B	0.19391	0.025	T	0.19549	-1.0302	10	0.14252	T	0.57	-1.7571	9.1063	0.36701	0.1869:0.0:0.8131:0.0	.	429	P22695	QCR2_HUMAN	N	429	ENSP00000268379:K429N	ENSP00000268379:K429N	K	+	3	2	UQCRC2	21901918	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.918000	0.48829	1.125000	0.41998	0.655000	0.94253	AAG	UQCRC2	-	superfamily_Metalloenz_metal-bd	ENSG00000140740		0.338	UQCRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UQCRC2	HGNC	protein_coding	OTTHUMT00000254466.1	68	0.00	0	G	NM_003366		21994417	21994417	+1	no_errors	ENST00000268379	ensembl	human	known	69_37n	missense	85	41.50	61	SNP	1.000	C
ZSCAN25	221785	genome.wustl.edu	37	7	99219167	99219167	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr7:99219167G>T	ENST00000394152.2	+	5	886	c.559G>T	c.(559-561)Gga>Tga	p.G187*	ZSCAN25_ENST00000466948.1_Intron|ZSCAN25_ENST00000334715.3_Nonsense_Mutation_p.G187*|ZSCAN25_ENST00000262941.6_Nonsense_Mutation_p.G187*	NM_145115.2	NP_660090.2	Q6NSZ9	ZSC25_HUMAN	zinc finger and SCAN domain containing 25	187					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TCAGGACCCTGGAGATGAGAC	0.587																																						dbGAP											0													54.0	46.0	49.0					7																	99219167		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0			AK057030	CCDS5671.2	7q22.1	2013-01-09	2013-01-09	2013-01-09	ENSG00000197037	ENSG00000197037		"""-"", ""Zinc fingers, C2H2-type"""	21961	protein-coding gene	gene with protein product			"""zinc finger protein 498"""	ZNF498		11179890	Standard	XM_005250194		Approved	FLJ32468	uc003url.1	Q6NSZ9	OTTHUMG00000074055	ENST00000394152.2:c.559G>T	7.37:g.99219167G>T	ENSP00000377708:p.Gly187*		A4D290|D6W5T5|Q14C82|Q14C99|Q5EBM9|Q6DJZ0|Q6N032|Q6ZML3	Nonsense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.G187*	ENST00000394152.2	37	c.559	CCDS5671.2	7	.	.	.	.	.	.	.	.	.	.	G	16.46	3.129771	0.56721	.	.	ENSG00000197037	ENST00000394152;ENST00000334715;ENST00000262941	.	.	.	5.08	3.27	0.37495	.	0.141960	0.32935	N	0.005463	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-8.9227	6.709	0.23266	0.2026:0.0:0.7974:0.0	.	.	.	.	X	187	.	ENSP00000262941:G187X	G	+	1	0	ZNF498	99057103	0.753000	0.28349	0.988000	0.46212	0.120000	0.20174	0.514000	0.22786	1.455000	0.47813	0.655000	0.94253	GGA	ZNF498	-	NULL	ENSG00000197037		0.587	ZSCAN25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF498	HGNC	protein_coding	OTTHUMT00000157203.4	68	0.00	0	G	NM_145115		99219167	99219167	+1	no_errors	ENST00000334715	ensembl	human	known	69_37n	nonsense	85	21.30	23	SNP	0.984	T
ZSCAN2	54993	genome.wustl.edu	37	15	85164365	85164365	+	Silent	SNP	G	G	A			TCGA-C8-A137-01A-11D-A10Y-09	TCGA-C8-A137-10A-02D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	08778f40-d895-46f1-8e7b-122fc598418b	16cfd410-cb75-4177-884e-c3abf7e4aebb	g.chr15:85164365G>A	ENST00000448803.2	+	3	1231	c.939G>A	c.(937-939)aaG>aaA	p.K313K	ZSCAN2_ENST00000358472.3_Silent_p.K163K|ZSCAN2_ENST00000538076.1_Intron|ZSCAN2_ENST00000546148.1_Silent_p.K313K|ZSCAN2_ENST00000485222.2_Intron|ZSCAN2_ENST00000541040.1_Intron|ZSCAN2_ENST00000327179.6_Silent_p.K312K	NM_181877.3	NP_870992.2	Q7Z7L9	ZSCA2_HUMAN	zinc finger and SCAN domain containing 2	313					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|liver(2)|lung(4)|ovary(1)|pancreas(1)	19				UCEC - Uterine corpus endometrioid carcinoma (272;0.168)|all cancers(203;5.43e-22)		AGTGTGGCAAGAGCTTCAGCA	0.572																																						dbGAP											0													80.0	78.0	78.0					15																	85164365		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC041620	CCDS10329.2, CCDS32315.1, CCDS32316.1	15q25.2	2013-01-08	2004-11-01	2004-11-02	ENSG00000176371	ENSG00000176371		"""-"", ""Zinc fingers, C2H2-type"""	20994	protein-coding gene	gene with protein product			"""zinc finger protein 29"""	ZFP29		1937051	Standard	NM_017894		Approved	FLJ20595, ZNF854	uc002bkr.3	Q7Z7L9	OTTHUMG00000074027	ENST00000448803.2:c.939G>A	15.37:g.85164365G>A			A6NG83|B2RMQ9|Q6ZQY9|Q9NWU4	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.K313	ENST00000448803.2	37	c.939	CCDS10329.2	15																																																																																			ZSCAN2	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000176371		0.572	ZSCAN2-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZSCAN2	HGNC	protein_coding	OTTHUMT00000396956.1	72	0.00	0	G	NM_017894		85164365	85164365	+1	no_errors	ENST00000448803	ensembl	human	known	69_37n	silent	65	26.14	23	SNP	0.877	A
