#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA4	24	genome.wustl.edu	37	1	94486873	94486873	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:94486873C>A	ENST00000370225.3	-	35	5027	c.4941G>T	c.(4939-4941)agG>agT	p.R1647S	ABCA4_ENST00000536513.1_5'Flank	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1647					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CCTCGGGGCTCCTGTCCTTAG	0.557																																						dbGAP											0													156.0	151.0	153.0					1																	94486873		2203	4300	6503	-	-	-	SO:0001583	missense	0			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.4941G>T	1.37:g.94486873C>A	ENSP00000359245:p.Arg1647Ser		O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.R1647S	ENST00000370225.3	37	c.4941	CCDS747.1	1	.	.	.	.	.	.	.	.	.	.	C	7.592	0.671030	0.14776	.	.	ENSG00000198691	ENST00000546054;ENST00000370225	D	0.86432	-2.12	5.23	4.32	0.51571	.	0.781535	0.11580	U	0.549856	T	0.62307	0.2417	N	0.14661	0.345	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.57688	-0.7768	10	0.29301	T	0.29	.	8.3959	0.32557	0.0:0.7821:0.0:0.2179	.	1647	P78363	ABCA4_HUMAN	S	439;1647	ENSP00000359245:R1647S	ENSP00000359245:R1647S	R	-	3	2	ABCA4	94259461	0.966000	0.33281	0.950000	0.38849	0.637000	0.38172	1.362000	0.34148	1.436000	0.47453	0.650000	0.86243	AGG	ABCA4	-	tigrfam_Rim_ABC_transpt	ENSG00000198691		0.557	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	HGNC	protein_coding	OTTHUMT00000029320.1	281	0.00	0	C	NM_000350		94486873	94486873	-1	no_errors	ENST00000370225	ensembl	human	known	69_37n	missense	255	15.28	46	SNP	0.958	A
ABCC10	89845	genome.wustl.edu	37	6	43409655	43409655	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:43409655G>C	ENST00000372530.4	+	9	2398	c.2183G>C	c.(2182-2184)gGa>gCa	p.G728A	ABCC10_ENST00000244533.3_Missense_Mutation_p.G700A	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	728	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	ACCCTTAGCGGAGGACAGCGT	0.612																																						dbGAP											0													121.0	86.0	98.0					6																	43409655		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.2183G>C	6.37:g.43409655G>C	ENSP00000361608:p.Gly728Ala		Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.G728A	ENST00000372530.4	37	c.2183	CCDS56430.1	6	.	.	.	.	.	.	.	.	.	.	G	20.4	3.976385	0.74360	.	.	ENSG00000124574	ENST00000372530;ENST00000244533	D;D	0.95069	-3.6;-3.6	5.13	5.13	0.70059	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.97576	0.9206	M	0.90425	3.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97972	1.0344	9	.	.	.	-17.986	17.1172	0.86692	0.0:0.0:1.0:0.0	.	700;728	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	A	728;700	ENSP00000361608:G728A;ENSP00000244533:G700A	.	G	+	2	0	ABCC10	43517633	1.000000	0.71417	0.995000	0.50966	0.277000	0.26821	7.559000	0.82265	2.564000	0.86499	0.563000	0.77884	GGA	ABCC10	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000124574		0.612	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC10	HGNC	protein_coding	OTTHUMT00000040603.2	162	0.00	0	G	NM_033450		43409655	43409655	+1	no_errors	ENST00000372530	ensembl	human	known	69_37n	missense	190	12.44	27	SNP	1.000	C
ABCF2	10061	genome.wustl.edu	37	7	150922031	150922031	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr7:150922031C>G	ENST00000287844.2	-	3	307	c.198G>C	c.(196-198)aaG>aaC	p.K66N	ABCF2_ENST00000222388.2_Missense_Mutation_p.K66N|ABCF2_ENST00000473874.1_5'Flank	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	66					transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGCAGCTTTCTTCATCTCAA	0.502																																						dbGAP											0													131.0	129.0	130.0					7																	150922031		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.198G>C	7.37:g.150922031C>G	ENSP00000287844:p.Lys66Asn		O60864|Q75MJ0|Q75MJ1|Q96TE8	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.K66N	ENST00000287844.2	37	c.198	CCDS5923.1	7	.	.	.	.	.	.	.	.	.	.	C	12.08	1.830078	0.32329	.	.	ENSG00000033050	ENST00000222388;ENST00000287844;ENST00000468073;ENST00000441774	D;D;D	0.91686	-2.84;-2.89;-1.69	5.81	5.81	0.92471	.	0.213810	0.49916	D	0.000140	D	0.85371	0.5681	N	0.08118	0	0.49582	D	0.999803	B;B	0.28470	0.213;0.05	B;B	0.35770	0.21;0.21	T	0.81595	-0.0861	10	0.18276	T	0.48	-9.8524	17.2385	0.87006	0.0:1.0:0.0:0.0	.	66;66	Q9UG63;Q75MJ1	ABCF2_HUMAN;.	N	66	ENSP00000222388:K66N;ENSP00000287844:K66N;ENSP00000419720:K66N	ENSP00000222388:K66N	K	-	3	2	ABCF2	150552964	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.656000	0.54467	2.746000	0.94184	0.655000	0.94253	AAG	ABCF2	-	NULL	ENSG00000033050		0.502	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF2	HGNC	protein_coding	OTTHUMT00000336086.1	252	0.00	0	C	NM_005692		150922031	150922031	-1	no_errors	ENST00000222388	ensembl	human	known	69_37n	missense	182	20.52	47	SNP	1.000	G
ABHD12	26090	genome.wustl.edu	37	20	25281495	25281495	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr20:25281495C>G	ENST00000339157.5	-	13	1455	c.1183G>C	c.(1183-1185)Gag>Cag	p.E395Q	ABHD12_ENST00000376542.3_Intron	NM_001042472.2	NP_001035937.1	Q8N2K0	ABD12_HUMAN	abhydrolase domain containing 12	395					adult walking behavior (GO:0007628)|phosphatidylserine catabolic process (GO:0006660)|response to auditory stimulus (GO:0010996)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)	acylglycerol lipase activity (GO:0047372)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(1)|skin(1)|urinary_tract(1)	12						TGCTGGTGCTCAGGCTCCGAC	0.582																																						dbGAP											0													57.0	64.0	62.0					20																	25281495		2086	4212	6298	-	-	-	SO:0001583	missense	0			AL117442	CCDS13172.1, CCDS42857.1	20p11.21	2007-04-24	2006-03-10	2006-03-10	ENSG00000100997	ENSG00000100997		"""Abhydrolase domain containing"""	15868	protein-coding gene	gene with protein product		613599	"""chromosome 20 open reading frame 22"""	C20orf22			Standard	NM_015600		Approved	DKFZP434P106, dJ965G21.2, BEM46L2, ABHD12A	uc002wuq.3	Q8N2K0	OTTHUMG00000032121	ENST00000339157.5:c.1183G>C	20.37:g.25281495C>G	ENSP00000341408:p.Glu395Gln		A6NED4|A6NJ90|A8K450|B4DE71|Q5T710|Q5T711|Q96CR1|Q9BX05|Q9NPX7|Q9UFV6	Missense_Mutation	SNP	pfam_AB_hydrolase_1,pfam_AB_hydrolase_3	p.E395Q	ENST00000339157.5	37	c.1183	CCDS42857.1	20	.	.	.	.	.	.	.	.	.	.	C	11.81	1.750038	0.30955	.	.	ENSG00000100997	ENST00000339157;ENST00000526543	T	0.21031	2.03	5.29	5.29	0.74685	.	.	.	.	.	T	0.13713	0.0332	N	0.16478	0.41	0.09310	N	1	B;B	0.17667	0.002;0.023	B;B	0.16289	0.005;0.015	T	0.10823	-1.0613	9	0.35671	T	0.21	.	10.0374	0.42137	0.0:0.9084:0.0:0.0916	.	357;395	Q8N2K0-3;Q8N2K0	.;ABD12_HUMAN	Q	395;357	ENSP00000341408:E395Q	ENSP00000341408:E395Q	E	-	1	0	ABHD12	25229495	0.049000	0.20398	0.012000	0.15200	0.962000	0.63368	2.057000	0.41365	2.478000	0.83669	0.561000	0.74099	GAG	ABHD12	-	NULL	ENSG00000100997		0.582	ABHD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD12	HGNC	protein_coding	OTTHUMT00000078423.2	156	0.00	0	C	NM_015600		25281495	25281495	-1	no_errors	ENST00000339157	ensembl	human	known	69_37n	missense	148	10.30	17	SNP	0.074	G
ACSM1	116285	genome.wustl.edu	37	16	20636769	20636769	+	Silent	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr16:20636769G>C	ENST00000307493.4	-	11	1570	c.1503C>G	c.(1501-1503)ggC>ggG	p.G501G	ACSM1_ENST00000520010.1_Silent_p.G501G|ACSM1_ENST00000219151.4_Silent_p.G152G	NM_052956.2	NP_443188.2	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member 1	501					benzoate metabolic process (GO:0018874)|butyrate metabolic process (GO:0019605)|cholesterol homeostasis (GO:0042632)|energy derivation by oxidation of organic compounds (GO:0015980)|fatty acid biosynthetic process (GO:0006633)|fatty acid oxidation (GO:0019395)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	acyl-CoA ligase activity (GO:0003996)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(23)|skin(3)|upper_aerodigestive_tract(2)	42						GGTCTGGGCTGCCCACCACGG	0.597																																						dbGAP											0													64.0	54.0	57.0					16																	20636769		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			AB059429	CCDS10587.1	16p12.3	2008-02-05	2005-09-08	2005-09-08	ENSG00000166743	ENSG00000166743	6.2.1.2	"""Acyl-CoA synthetase family"""	18049	protein-coding gene	gene with protein product		614357	"""butyryl Coenzyme A synthetase 1"""	BUCS1		11470804, 12654705	Standard	NM_052956		Approved	MACS1	uc002dhm.1	Q08AH1	OTTHUMG00000131550	ENST00000307493.4:c.1503C>G	16.37:g.20636769G>C			Q08AH2|Q96A20	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.A173G	ENST00000307493.4	37	c.518	CCDS10587.1	16	.	.	.	.	.	.	.	.	.	.	g	4.565	0.104916	0.08731	.	.	ENSG00000166743	ENST00000524149	.	.	.	4.57	3.6	0.41247	.	.	.	.	.	T	0.67767	0.2928	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66709	-0.5855	4	.	.	.	.	13.2561	0.60079	0.0:0.0:0.8395:0.1604	.	.	.	.	G	173	.	.	A	-	2	0	ACSM1	20544270	1.000000	0.71417	1.000000	0.80357	0.450000	0.32258	5.302000	0.65733	1.260000	0.44134	0.655000	0.94253	GCA	ACSM1	-	NULL	ENSG00000166743		0.597	ACSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM1	HGNC	protein_coding	OTTHUMT00000254412.1	81	0.00	0	G	NM_052956		20636769	20636769	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000524149	ensembl	human	novel	69_37n	missense	125	11.35	16	SNP	1.000	C
ADAD1	132612	genome.wustl.edu	37	4	123332460	123332460	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr4:123332460C>G	ENST00000296513.2	+	9	1117	c.932C>G	c.(931-933)tCt>tGt	p.S311C	ADAD1_ENST00000388724.2_Missense_Mutation_p.S300C|ADAD1_ENST00000388725.2_Missense_Mutation_p.S293C	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	311	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						GAACCAACTTCTAATCTACTC	0.323																																						dbGAP											0													86.0	85.0	85.0					4																	123332460		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.932C>G	4.37:g.123332460C>G	ENSP00000296513:p.Ser311Cys		A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Missense_Mutation	SNP	pfam_A_deamin,pfam_Ds-RNA-bd,smart_Ds-RNA-bd,smart_A_deamin,pfscan_Ds-RNA-bd,pfscan_A_deamin	p.S311C	ENST00000296513.2	37	c.932	CCDS34058.1	4	.	.	.	.	.	.	.	.	.	.	C	21.7	4.189509	0.78789	.	.	ENSG00000164113	ENST00000296513;ENST00000388724;ENST00000388725	D;D;D	0.93859	-3.3;-3.3;-3.3	5.74	5.74	0.90152	Adenosine deaminase/editase (3);	0.187202	0.47852	D	0.000214	D	0.96237	0.8773	M	0.61703	1.905	0.46725	D	0.999177	D;D	0.89917	0.996;1.0	D;D	0.74023	0.927;0.982	D	0.96167	0.9120	10	0.72032	D	0.01	-22.2588	19.9151	0.97057	0.0:1.0:0.0:0.0	.	300;311	Q96M93-2;Q96M93	.;ADAD1_HUMAN	C	311;300;293	ENSP00000296513:S311C;ENSP00000373376:S300C;ENSP00000373377:S293C	ENSP00000296513:S311C	S	+	2	0	ADAD1	123551910	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.698000	0.74608	2.716000	0.92895	0.591000	0.81541	TCT	ADAD1	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin	ENSG00000164113		0.323	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAD1	HGNC	protein_coding	OTTHUMT00000316452.1	283	0.00	0	C	NM_139243		123332460	123332460	+1	no_errors	ENST00000296513	ensembl	human	known	69_37n	missense	602	11.70	80	SNP	1.000	G
ADAM29	11086	genome.wustl.edu	37	4	175896863	175896863	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr4:175896863C>T	ENST00000359240.3	+	5	857	c.187C>T	c.(187-189)Cac>Tac	p.H63Y	RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000514159.1_Missense_Mutation_p.H63Y|ADAM29_ENST00000404450.4_Missense_Mutation_p.H63Y|ADAM29_ENST00000445694.1_Missense_Mutation_p.H63Y	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	63					spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		AGGCCAGAAACACATTATCCA	0.512																																					Ovarian(140;1727 1835 21805 25838 41440)	dbGAP											0													49.0	47.0	48.0					4																	175896863		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.187C>T	4.37:g.175896863C>T	ENSP00000352177:p.His63Tyr		Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.H63Y	ENST00000359240.3	37	c.187	CCDS3823.1	4	.	.	.	.	.	.	.	.	.	.	C	4.422	0.078011	0.08485	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000502940;ENST00000404450;ENST00000514159	T;T;T;T;T	0.05717	3.4;3.4;3.4;3.4;3.4	3.77	2.02	0.26589	Peptidase M12B, propeptide (1);	0.568629	0.13560	N	0.378891	T	0.06554	0.0168	L	0.39397	1.21	0.09310	N	1	P	0.45283	0.855	B	0.43728	0.429	T	0.32214	-0.9915	9	.	.	.	.	5.6948	0.17849	0.0:0.7543:0.0:0.2457	.	63	Q9UKF5	ADA29_HUMAN	Y	63	ENSP00000352177:H63Y;ENSP00000414544:H63Y;ENSP00000427674:H63Y;ENSP00000384229:H63Y;ENSP00000423517:H63Y	.	H	+	1	0	ADAM29	176133438	0.000000	0.05858	0.001000	0.08648	0.029000	0.11900	-0.326000	0.07965	0.565000	0.29255	0.637000	0.83480	CAC	ADAM29	-	pfam_Peptidase_M12B_N	ENSG00000168594		0.512	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	HGNC	protein_coding		104	0.00	0	C			175896863	175896863	+1	no_errors	ENST00000359240	ensembl	human	known	69_37n	missense	28	31.71	13	SNP	0.001	T
ADAMTS18	170692	genome.wustl.edu	37	16	77375627	77375627	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr16:77375627C>T	ENST00000282849.5	-	11	2102	c.1684G>A	c.(1684-1686)Gaa>Aaa	p.E562K		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	562	Disintegrin.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ACGGTCCCTTCTGCTGCGGGC	0.413																																						dbGAP											0													84.0	79.0	80.0					16																	77375627		2198	4300	6498	-	-	-	SO:0001583	missense	0			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.1684G>A	16.37:g.77375627C>T	ENSP00000282849:p.Glu562Lys		Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.E562K	ENST00000282849.5	37	c.1684	CCDS10926.1	16	.	.	.	.	.	.	.	.	.	.	C	25.9	4.688972	0.88735	.	.	ENSG00000140873	ENST00000282849	T	0.68025	-0.3	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.86112	0.5855	M	0.91768	3.24	0.58432	D	0.999999	D;D	0.89917	0.995;1.0	D;D	0.76071	0.948;0.987	D	0.88476	0.3065	10	0.87932	D	0	.	18.6782	0.91537	0.0:1.0:0.0:0.0	.	562;562	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	K	562	ENSP00000282849:E562K	ENSP00000282849:E562K	E	-	1	0	ADAMTS18	75933128	1.000000	0.71417	0.892000	0.35008	0.415000	0.31203	7.288000	0.78691	2.760000	0.94817	0.655000	0.94253	GAA	ADAMTS18	-	NULL	ENSG00000140873		0.413	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	HGNC	protein_coding	OTTHUMT00000269037.1	261	0.00	0	C			77375627	77375627	-1	no_errors	ENST00000282849	ensembl	human	known	69_37n	missense	236	29.97	101	SNP	1.000	T
ADD2	119	genome.wustl.edu	37	2	70917942	70917942	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:70917942C>G	ENST00000264436.4	-	8	1269	c.825G>C	c.(823-825)caG>caC	p.Q275H	ADD2_ENST00000413157.2_Missense_Mutation_p.Q275H|AC007395.3_ENST00000457851.1_RNA|ADD2_ENST00000430656.1_Missense_Mutation_p.Q291H|ADD2_ENST00000355733.3_Missense_Mutation_p.Q275H|ADD2_ENST00000407644.2_Missense_Mutation_p.Q275H	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	275					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						CAAGGCACTTCTGCAGGTTGA	0.507																																						dbGAP											0													104.0	94.0	97.0					2																	70917942		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.825G>C	2.37:g.70917942C>G	ENSP00000264436:p.Gln275His		A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.Q275H	ENST00000264436.4	37	c.825	CCDS1906.1	2	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958435	0.92726	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000456320;ENST00000355733;ENST00000356565;ENST00000413157;ENST00000430656	T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95	5.43	5.43	0.79202	Class II aldolase/adducin, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.55321	0.1913	M	0.89904	3.07	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.999;0.999;0.998	D;D;D;D	0.85130	0.997;0.973;0.976;0.996	T	0.63220	-0.6686	10	0.87932	D	0	-29.3148	16.7875	0.85577	0.0:1.0:0.0:0.0	.	291;275;275;275	B4DM17;P35612-4;P35612;P35612-3	.;.;ADDB_HUMAN;.	H	275;275;275;275;275;275;291	ENSP00000264436:Q275H;ENSP00000384677:Q275H;ENSP00000347972:Q275H;ENSP00000388072:Q275H;ENSP00000398112:Q291H	ENSP00000264436:Q275H	Q	-	3	2	ADD2	70771450	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.745000	0.62125	2.823000	0.97156	0.650000	0.86243	CAG	ADD2	-	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	ENSG00000075340		0.507	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADD2	HGNC	protein_coding	OTTHUMT00000251918.4	136	0.00	0	C	NM_001617		70917942	70917942	-1	no_errors	ENST00000264436	ensembl	human	known	69_37n	missense	120	21.05	32	SNP	1.000	G
ADPRM	56985	genome.wustl.edu	37	17	10608733	10608733	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:10608733G>C	ENST00000379774.4	+	2	581	c.490G>C	c.(490-492)Gat>Cat	p.D164H	ADPRM_ENST00000609540.1_Missense_Mutation_p.D164H	NM_020233.4	NP_064618.3	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent	164							ADP-ribose diphosphatase activity (GO:0047631)|CDP-glycerol diphosphatase activity (GO:0047734)|metal ion binding (GO:0046872)										CATTTTACTTGATGCATATGA	0.393																																						dbGAP											0													161.0	153.0	156.0					17																	10608733		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC070155	CCDS11159.2	17p13.1	2012-07-20	2012-07-20	2012-07-20	ENSG00000170222	ENSG00000170222	3.6.1.13, 3.6.1.16, 3.6.1.53		30925	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 48"""	C17orf48		18352857	Standard	XM_005256738		Approved	MDS006	uc002gmt.3	Q3LIE5	OTTHUMG00000130366	ENST00000379774.4:c.490G>C	17.37:g.10608733G>C	ENSP00000369099:p.Asp164His		A8K9B4|D3DTS4|Q9BVD4|Q9NRU8	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom	p.D164H	ENST00000379774.4	37	c.490	CCDS11159.2	17	.	.	.	.	.	.	.	.	.	.	G	21.3	4.124054	0.77436	.	.	ENSG00000170222	ENST00000379774	D	0.96745	-4.11	5.5	5.5	0.81552	Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	D	0.98378	0.9461	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98863	1.0763	10	0.72032	D	0.01	0.9585	19.1995	0.93707	0.0:0.0:1.0:0.0	.	164	Q3LIE5	ADPRM_HUMAN	H	164	ENSP00000369099:D164H	ENSP00000369099:D164H	D	+	1	0	C17orf48	10549458	1.000000	0.71417	0.924000	0.36721	0.757000	0.42996	8.915000	0.92740	2.861000	0.98227	0.655000	0.94253	GAT	ADPRM	-	pfam_Metallo_PEstase_dom	ENSG00000170222		0.393	ADPRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPRM	HGNC	protein_coding	OTTHUMT00000252732.2	327	0.00	0	G	NM_020233		10608733	10608733	+1	no_errors	ENST00000379774	ensembl	human	known	69_37n	missense	181	42.95	137	SNP	1.000	C
AFF3	3899	genome.wustl.edu	37	2	100210557	100210557	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:100210557C>T	ENST00000409236.2	-	13	1678	c.1566G>A	c.(1564-1566)gaG>gaA	p.E522E	AFF3_ENST00000317233.4_Silent_p.E522E|AFF3_ENST00000356421.2_Silent_p.E547E|AFF3_ENST00000409579.1_Silent_p.E547E			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	522					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						TGCTCTTGATCTCCTTCTCTC	0.602																																						dbGAP											0													116.0	110.0	112.0					2																	100210557		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.1566G>A	2.37:g.100210557C>T			B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Silent	SNP	pfam_TF_AF4/FMR2	p.E547	ENST00000409236.2	37	c.1641	CCDS42723.1	2																																																																																			AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.602	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	152	0.00	0	C	NM_002285		100210557	100210557	-1	no_errors	ENST00000356421	ensembl	human	known	69_37n	silent	115	29.88	49	SNP	0.001	T
AGTR2	186	genome.wustl.edu	37	X	115304469	115304469	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chrX:115304469C>T	ENST00000371906.4	+	3	1126	c.936C>T	c.(934-936)tgC>tgT	p.C312C		NM_000686.4	NP_000677.2	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	312					aldosterone secretion (GO:0035932)|angiotensin-activated signaling pathway (GO:0038166)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|brain renin-angiotensin system (GO:0002035)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell surface receptor signaling pathway (GO:0007166)|cellular response to dexamethasone stimulus (GO:0071549)|cellular sodium ion homeostasis (GO:0006883)|cerebellar cortex development (GO:0021695)|dopamine biosynthetic process (GO:0042416)|exploration behavior (GO:0035640)|extracellular negative regulation of signal transduction (GO:1900116)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of heart rate (GO:0010459)|negative regulation of icosanoid secretion (GO:0032304)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of norepinephrine secretion (GO:0010700)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|regulation of metanephros size (GO:0035566)|regulation of systemic arterial blood pressure by circulatory renin-angiotensin (GO:0001991)|regulation of transcription factor import into nucleus (GO:0042990)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to organonitrogen compound (GO:0010243)|vasodilation by angiotensin involved in regulation of systemic arterial blood pressure (GO:0002033)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)|peptide hormone binding (GO:0017046)|receptor antagonist activity (GO:0048019)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|skin(1)	24					Tasosartan(DB01349)	CCAACAGCTGCGTTAATCCGT	0.468																																						dbGAP											0													222.0	194.0	203.0					X																	115304469		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY324607	CCDS14569.1	Xq22-q23	2012-08-08			ENSG00000180772	ENSG00000180772		"""GPCR / Class A : Angiotensin receptors"""	338	protein-coding gene	gene with protein product		300034	"""angiotensin receptor 2"""			1550596	Standard	NM_000686		Approved	AT2, MRX88	uc004eqh.4	P50052	OTTHUMG00000022243	ENST00000371906.4:c.936C>T	X.37:g.115304469C>T			B2R9V1|Q13016|Q6FGY7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_ATII_AT2_rcpt,prints_7TM_GPCR_Rhodpsn,prints_ATII_rcpt,prints_Brdyknn_rcpt,prints_P2_purnocptor,prints_Chemokine_rcpt	p.C312	ENST00000371906.4	37	c.936	CCDS14569.1	X																																																																																			AGTR2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000180772		0.468	AGTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGTR2	HGNC	protein_coding	OTTHUMT00000057984.1	494	0.20	1	C	NM_000686		115304469	115304469	+1	no_errors	ENST00000371906	ensembl	human	known	69_37n	silent	162	62.36	270	SNP	0.782	T
AHCTF1	25909	genome.wustl.edu	37	1	247067320	247067320	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:247067320C>G	ENST00000391829.2	-	7	1020	c.897G>C	c.(895-897)ttG>ttC	p.L299F	AHCTF1_ENST00000366508.1_Missense_Mutation_p.L334F|AHCTF1_ENST00000326225.3_Missense_Mutation_p.L308F			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	299	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			GATGCAAACTCAAAACATCCC	0.358																																					Colon(145;197 1800 4745 15099 26333)	dbGAP											0													80.0	75.0	77.0					1																	247067320		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.897G>C	1.37:g.247067320C>G	ENSP00000375705:p.Leu299Phe		A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like	p.L308F	ENST00000391829.2	37	c.924		1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.030577	0.54790	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.24908	1.83;1.83;1.83	5.37	4.46	0.54185	.	0.266441	0.32161	N	0.006492	T	0.25494	0.0620	N	0.14661	0.345	0.45330	D	0.998325	D;D	0.67145	0.996;0.981	P;P	0.62298	0.9;0.708	T	0.08827	-1.0703	10	0.52906	T	0.07	-2.0415	5.3583	0.16073	0.1451:0.6314:0.0:0.2234	.	334;299	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	F	334;308;299	ENSP00000355464:L334F;ENSP00000355465:L308F;ENSP00000375705:L299F	ENSP00000355465:L308F	L	-	3	2	AHCTF1	245133943	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	1.387000	0.34430	1.261000	0.44149	0.557000	0.71058	TTG	AHCTF1	-	NULL	ENSG00000153207		0.358	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		246	0.00	0	C	NM_015446		247067320	247067320	-1	no_errors	ENST00000326225	ensembl	human	known	69_37n	missense	210	45.74	177	SNP	1.000	G
AKAP11	11215	genome.wustl.edu	37	13	42882612	42882612	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr13:42882612C>T	ENST00000025301.2	+	9	5315	c.5140C>T	c.(5140-5142)Cag>Tag	p.Q1714*		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1714	Ser-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		AGAAGACTTTCAGTCAACCGA	0.358																																						dbGAP											0													87.0	84.0	85.0					13																	42882612		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.5140C>T	13.37:g.42882612C>T	ENSP00000025301:p.Gln1714*		O75124|Q9NUK7	Nonsense_Mutation	SNP	NULL	p.Q1714*	ENST00000025301.2	37	c.5140	CCDS9383.1	13	.	.	.	.	.	.	.	.	.	.	C	41	8.697142	0.98918	.	.	ENSG00000023516	ENST00000025301	.	.	.	5.03	3.25	0.37280	.	0.202187	0.42964	D	0.000625	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	9.8758	0.41202	0.0:0.6634:0.2648:0.0718	.	.	.	.	X	1714	.	ENSP00000025301:Q1714X	Q	+	1	0	AKAP11	41780612	1.000000	0.71417	0.020000	0.16555	0.011000	0.07611	4.677000	0.61634	0.593000	0.29745	-0.181000	0.13052	CAG	AKAP11	-	NULL	ENSG00000023516		0.358	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP11	HGNC	protein_coding	OTTHUMT00000044700.2	115	0.00	0	C	NM_016248		42882612	42882612	+1	no_errors	ENST00000025301	ensembl	human	known	69_37n	nonsense	102	15.00	18	SNP	0.997	T
AKT2	208	genome.wustl.edu	37	19	40741906	40741906	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:40741906C>T	ENST00000392038.2	-	11	1364	c.1066G>A	c.(1066-1068)Gag>Aag	p.E356K	AKT2_ENST00000311278.6_Missense_Mutation_p.E313K|AKT2_ENST00000424901.1_Missense_Mutation_p.E356K|AKT2_ENST00000579047.1_Missense_Mutation_p.E294K	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2	356	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			AAGAGGCGCTCGTGGTCCTGG	0.632			A		"""ovarian, pancreatic """																																	dbGAP		Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	0													86.0	77.0	80.0					19																	40741906		2203	4300	6503	-	-	-	SO:0001583	missense	0			M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.1066G>A	19.37:g.40741906C>T	ENSP00000375892:p.Glu356Lys		B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom	p.E356K	ENST00000392038.2	37	c.1066	CCDS12552.1	19	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000562	0.74818	.	.	ENSG00000105221	ENST00000392038;ENST00000391844;ENST00000424901;ENST00000311278;ENST00000391845	T;T;T	0.64803	-0.12;-0.12;0.49	5.41	5.41	0.78517	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.64159	0.2573	N	0.12527	0.23	0.80722	D	1	P;D;D	0.76494	0.898;0.995;0.999	B;P;D	0.63957	0.376;0.85;0.92	T	0.71269	-0.4643	10	0.72032	D	0.01	.	17.9622	0.89089	0.0:1.0:0.0:0.0	.	294;313;356	B4DG79;Q0VAN0;P31751	.;.;AKT2_HUMAN	K	356;257;356;313;176	ENSP00000375892:E356K;ENSP00000399532:E356K;ENSP00000309428:E313K	ENSP00000309428:E313K	E	-	1	0	AKT2	45433746	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.765000	0.85310	2.553000	0.86117	0.555000	0.69702	GAG	AKT2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000105221		0.632	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKT2	HGNC	protein_coding	OTTHUMT00000268029.1	132	0.00	0	C	NM_001626		40741906	40741906	-1	no_errors	ENST00000392038	ensembl	human	known	69_37n	missense	107	36.47	62	SNP	1.000	T
ANAPC7	51434	genome.wustl.edu	37	12	110815414	110815414	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:110815414C>T	ENST00000455511.3	-	9	1243	c.1243G>A	c.(1243-1245)Gaa>Aaa	p.E415K	ANAPC7_ENST00000481473.1_5'UTR|ANAPC7_ENST00000450008.2_Missense_Mutation_p.E415K	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	415					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						AAGTAACATTCGATAAGACCT	0.418																																						dbGAP											0													138.0	118.0	125.0					12																	110815414		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.1243G>A	12.37:g.110815414C>T	ENSP00000394394:p.Glu415Lys		Q96AC4|Q96GF4|Q9BU24|Q9NT16	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E415K	ENST00000455511.3	37	c.1243	CCDS9145.2	12	.	.	.	.	.	.	.	.	.	.	C	22.8	4.333571	0.81801	.	.	ENSG00000196510	ENST00000455511;ENST00000486321;ENST00000450008;ENST00000471602;ENST00000548234	T;T	0.78246	-1.16;0.66	6.03	6.03	0.97812	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.043766	0.85682	D	0.000000	T	0.68220	0.2977	L	0.40543	1.245	0.80722	D	1	P;P	0.43885	0.82;0.618	B;B	0.31101	0.124;0.058	T	0.67852	-0.5563	10	0.27082	T	0.32	-32.7303	20.5568	0.99304	0.0:1.0:0.0:0.0	.	415;415	Q9UJX3-2;Q9UJX3	.;APC7_HUMAN	K	415;13;415;108;117	ENSP00000394394:E415K;ENSP00000402314:E415K	ENSP00000402314:E415K	E	-	1	0	ANAPC7	109299797	1.000000	0.71417	0.997000	0.53966	0.882000	0.50991	7.487000	0.81328	2.861000	0.98227	0.655000	0.94253	GAA	ANAPC7	-	pfscan_TPR-contain_dom	ENSG00000196510		0.418	ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANAPC7	HGNC	protein_coding	OTTHUMT00000347075.3	317	0.00	0	C	NM_016238		110815414	110815414	-1	no_errors	ENST00000455511	ensembl	human	known	69_37n	missense	262	13.73	42	SNP	1.000	T
ANGPT1	284	genome.wustl.edu	37	8	108359272	108359272	+	IGR	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr8:108359272C>G								ANGPT1 (10522 upstream) : RNA5SP275 (537449 downstream)																							GAACTGCATTCTGCTGTATCT	0.463																																						dbGAP											0													170.0	152.0	158.0					8																	108359272		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0																															8.37:g.108359272C>G				Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.Q117H		37	c.351		8	.	.	.	.	.	.	.	.	.	.	C	11.84	1.759588	0.31137	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000520033	D;D	0.83914	-1.78;-1.78	5.95	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.80188	0.4577	M	0.65975	2.015	0.80722	D	1	B;B	0.32620	0.378;0.378	B;B	0.28232	0.087;0.087	T	0.80099	-0.1524	10	0.62326	D	0.03	.	12.0945	0.53747	0.0:0.8627:0.0:0.1373	.	117;117	Q5HYA0;Q15389	.;ANGP1_HUMAN	H	117;117;10	ENSP00000428340:Q117H;ENSP00000297450:Q117H	ENSP00000297450:Q117H	Q	-	3	2	ANGPT1	108428448	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.004000	0.40854	1.523000	0.49018	0.655000	0.94253	CAG	ANGPT1	-	NULL	ENSG00000154188	0	0.463					ANGPT1	HGNC			439	0.00	0	C			108359272	108359272	-1	no_errors	ENST00000517746	ensembl	human	known	69_37n	missense	528	13.42	82	SNP	1.000	G
AP4B1	10717	genome.wustl.edu	37	1	114445417	114445417	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:114445417C>G	ENST00000369569.1	-	2	461	c.181G>C	c.(181-183)Gat>Cat	p.D61H	AP4B1_ENST00000369566.3_Missense_Mutation_p.D61H|AP4B1-AS1_ENST00000419536.1_RNA|AP4B1_ENST00000369567.1_Intron|DCLRE1B_ENST00000369563.3_5'Flank|AP4B1_ENST00000256658.4_Missense_Mutation_p.D61H	NM_001253852.1	NP_001240781.1	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1 subunit	61					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|trans-Golgi network (GO:0005802)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|prostate(3)	25	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGGACAATATCTACAGTGGCA	0.453																																						dbGAP											0													155.0	129.0	138.0					1																	114445417		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF092094	CCDS865.1	1p13.2	2012-03-30			ENSG00000134262	ENSG00000134262			572	protein-coding gene	gene with protein product	"""beta 4 subunit of AP-4"""	607245	"""spastic paraplegia 47"""	SPG47		10066790	Standard	NM_006594		Approved	BETA-4	uc001eeb.3	Q9Y6B7	OTTHUMG00000011943	ENST00000369569.1:c.181G>C	1.37:g.114445417C>G	ENSP00000358582:p.Asp61His		B7Z4X3|Q59EJ4|Q96CL6	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_B-adaptin_app_sub_C,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,pirsf_AP_complex_bsu	p.D61H	ENST00000369569.1	37	c.181	CCDS865.1	1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.603029	0.87157	.	.	ENSG00000134262	ENST00000369569;ENST00000256658;ENST00000369566;ENST00000369571	T;T;T;T	0.18338	2.22;2.22;2.22;2.22	4.96	4.96	0.65561	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.43897	0.1268	M	0.88310	2.945	0.40975	D	0.984737	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.55927	-0.8063	10	0.87932	D	0	-12.4235	18.5843	0.91182	0.0:1.0:0.0:0.0	.	61;61	B7Z4X3;Q9Y6B7	.;AP4B1_HUMAN	H	61	ENSP00000358582:D61H;ENSP00000256658:D61H;ENSP00000358579:D61H;ENSP00000358584:D61H	ENSP00000256658:D61H	D	-	1	0	AP4B1	114246940	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.062000	0.76706	2.442000	0.82660	0.655000	0.94253	GAT	AP4B1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP_complex_bsu	ENSG00000134262		0.453	AP4B1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AP4B1	HGNC	protein_coding	OTTHUMT00000033037.1	206	0.00	0	C	NM_006594		114445417	114445417	-1	no_errors	ENST00000256658	ensembl	human	known	69_37n	missense	208	13.69	33	SNP	1.000	G
APOB	338	genome.wustl.edu	37	2	21232398	21232398	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:21232398G>C	ENST00000233242.1	-	26	7469	c.7342C>G	c.(7342-7344)Cag>Gag	p.Q2448E		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2448					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGAGTCTCTGAGTCACCTCA	0.373																																						dbGAP											0													133.0	131.0	132.0					2																	21232398		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.7342C>G	2.37:g.21232398G>C	ENSP00000233242:p.Gln2448Glu		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.Q2448E	ENST00000233242.1	37	c.7342	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	G	8.147	0.786579	0.16189	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00724	5.78	5.36	5.36	0.76844	.	0.368164	0.23220	N	0.050578	T	0.01661	0.0053	M	0.75447	2.3	0.35680	D	0.813995	B	0.34015	0.435	B	0.24974	0.057	T	0.51505	-0.8697	10	0.66056	D	0.02	.	19.0919	0.93229	0.0:0.0:1.0:0.0	.	2448	P04114	APOB_HUMAN	E	2448	ENSP00000233242:Q2448E	ENSP00000233242:Q2448E	Q	-	1	0	APOB	21085903	1.000000	0.71417	0.956000	0.39512	0.441000	0.31987	3.000000	0.49481	2.496000	0.84212	0.462000	0.41574	CAG	APOB	-	NULL	ENSG00000084674		0.373	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	273	0.00	0	G			21232398	21232398	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	236	17.42	50	SNP	0.074	C
ARL16	339231	genome.wustl.edu	37	17	79650736	79650736	+	Silent	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:79650736C>G	ENST00000397498.4	-	1	218	c.120G>C	c.(118-120)gtG>gtC	p.V40V	HGS_ENST00000329138.4_5'Flank|ARL16_ENST00000576135.1_5'Flank|ARL16_ENST00000570561.1_5'Flank|ARL16_ENST00000573392.1_5'Flank|ARL16_ENST00000574938.1_5'Flank	NM_001040025.1	NP_001035114.1	Q0P5N6	ARL16_HUMAN	ADP-ribosylation factor-like 16	40					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			central_nervous_system(1)|endometrium(1)|lung(4)|skin(1)	7	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GCAGCCGTTTCACCAGCAGCG	0.716																																						dbGAP											0													12.0	16.0	15.0					17																	79650736		1862	4080	5942	-	-	-	SO:0001819	synonymous_variant	0				CCDS45813.1	17q25.3	2014-05-09				ENSG00000214087		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	27902	protein-coding gene	gene with protein product						12477932	Standard	NM_001040025		Approved		uc002kbf.3	Q0P5N6		ENST00000397498.4:c.120G>C	17.37:g.79650736C>G				Silent	SNP	pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1	p.V40	ENST00000397498.4	37	c.120	CCDS45813.1	17																																																																																			ARL16	-	pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1	ENSG00000214087		0.716	ARL16-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	ARL16	HGNC	protein_coding	OTTHUMT00000440514.1	29	0.00	0	C	XM_290777		79650736	79650736	-1	no_errors	ENST00000397498	ensembl	human	known	69_37n	silent	7	74.07	20	SNP	0.990	G
ASPM	259266	genome.wustl.edu	37	1	197073413	197073413	+	Silent	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:197073413G>C	ENST00000367409.4	-	18	5224	c.4968C>G	c.(4966-4968)ctC>ctG	p.L1656L	ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1656	IQ 4. {ECO:0000255|PROSITE- ProRule:PRU00116}.|IQ 5. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TAACAGATGTGAGGATGTGAA	0.353																																						dbGAP											0													83.0	83.0	83.0					1																	197073413		2202	4295	6497	-	-	-	SO:0001819	synonymous_variant	0			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.4968C>G	1.37:g.197073413G>C			Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.L1656	ENST00000367409.4	37	c.4968	CCDS1389.1	1																																																																																			ASPM	-	superfamily_ARM-type_fold,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000066279		0.353	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	153	0.00	0	G	NM_018136		197073413	197073413	-1	no_errors	ENST00000367409	ensembl	human	known	69_37n	silent	143	11.66	19	SNP	0.036	C
ATAD2	29028	genome.wustl.edu	37	8	124346529	124346529	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr8:124346529C>G	ENST00000287394.5	-	23	3352	c.3245G>C	c.(3244-3246)aGa>aCa	p.R1082T	ATAD2_ENST00000521903.1_Missense_Mutation_p.R400T	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	1082					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GGCAGTATCTCTTAAAGCACA	0.328																																						dbGAP											0													57.0	56.0	56.0					8																	124346529		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.3245G>C	8.37:g.124346529C>G	ENSP00000287394:p.Arg1082Thr		Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R1082T	ENST00000287394.5	37	c.3245	CCDS6343.1	8	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158356	0.78114	.	.	ENSG00000156802	ENST00000287394;ENST00000521903	T;T	0.19250	2.16;2.16	6.07	6.07	0.98685	Bromodomain (3);	0.090025	0.85682	D	0.000000	T	0.32194	0.0821	L	0.53249	1.67	0.41698	D	0.989385	D	0.60160	0.987	P	0.55785	0.784	T	0.01024	-1.1477	10	0.27082	T	0.32	-24.7086	11.8716	0.52523	0.0:0.866:0.0:0.134	.	1082	Q6PL18	ATAD2_HUMAN	T	1082;400	ENSP00000287394:R1082T;ENSP00000429213:R400T	ENSP00000287394:R1082T	R	-	2	0	ATAD2	124415710	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.460000	0.60108	2.885000	0.99019	0.655000	0.94253	AGA	ATAD2	-	superfamily_Bromodomain,smart_Bromodomain	ENSG00000156802		0.328	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	219	0.00	0	C	NM_014109		124346529	124346529	-1	no_errors	ENST00000287394	ensembl	human	known	69_37n	missense	147	58.66	210	SNP	1.000	G
ATP10B	23120	genome.wustl.edu	37	5	160025900	160025900	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr5:160025900C>T	ENST00000327245.5	-	22	4287	c.3441G>A	c.(3439-3441)atG>atA	p.M1147I		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1147					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGAAGAATATCATCTGCCAGT	0.473																																						dbGAP											0													127.0	128.0	128.0					5																	160025900		2023	4187	6210	-	-	-	SO:0001583	missense	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.3441G>A	5.37:g.160025900C>T	ENSP00000313600:p.Met1147Ile		Q9H725	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.M1147I	ENST00000327245.5	37	c.3441	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	C	14.85	2.657568	0.47467	.	.	ENSG00000118322	ENST00000327245	D	0.86497	-2.13	5.42	4.55	0.56014	.	0.141624	0.64402	D	0.000008	T	0.72779	0.3503	N	0.05592	-0.015	0.48901	D	0.999721	B	0.28378	0.209	B	0.23716	0.048	T	0.68025	-0.5518	9	.	.	.	.	13.2317	0.59947	0.0:0.9241:0.0:0.0759	.	1147	O94823	AT10B_HUMAN	I	1147	ENSP00000313600:M1147I	.	M	-	3	0	ATP10B	159958478	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.445000	0.44899	1.294000	0.44707	0.655000	0.94253	ATG	ATP10B	-	tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000118322		0.473	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	186	0.00	0	C	NM_025153		160025900	160025900	-1	no_errors	ENST00000327245	ensembl	human	known	69_37n	missense	142	20.56	37	SNP	1.000	T
ATP1A1	476	genome.wustl.edu	37	1	116941293	116941293	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:116941293G>T	ENST00000295598.5	+	16	2427	c.2175G>T	c.(2173-2175)ttG>ttT	p.L725F	ATP1A1_ENST00000369496.4_Missense_Mutation_p.L694F|ATP1A1_ENST00000537345.1_Missense_Mutation_p.L725F	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	725					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	CTCCAGCTTTGAAGAAAGCAG	0.483																																						dbGAP											0													220.0	210.0	213.0					1																	116941293		2203	4300	6503	-	-	-	SO:0001583	missense	0			D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.2175G>T	1.37:g.116941293G>T	ENSP00000295598:p.Leu725Phe		B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.L725F	ENST00000295598.5	37	c.2175	CCDS887.1	1	.	.	.	.	.	.	.	.	.	.	G	19.82	3.897957	0.72639	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000369496	D;D;D	0.97811	-4.55;-4.55;-4.55	5.23	4.26	0.50523	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.99096	0.9689	H	0.97682	4.055	0.80722	D	1	P;P	0.51537	0.933;0.946	P;P	0.60117	0.793;0.869	D	0.98979	1.0804	10	0.87932	D	0	.	16.4568	0.84021	0.0:0.0:0.8603:0.1397	.	725;725	F5H3A1;P05023	.;AT1A1_HUMAN	F	725;725;694	ENSP00000295598:L725F;ENSP00000445306:L725F;ENSP00000358508:L694F	ENSP00000295598:L725F	L	+	3	2	ATP1A1	116742816	1.000000	0.71417	0.997000	0.53966	0.824000	0.46624	1.656000	0.37355	2.718000	0.92993	0.655000	0.94253	TTG	ATP1A1	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000163399		0.483	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP1A1	HGNC	protein_coding	OTTHUMT00000033481.5	542	0.37	2	G	NM_001160233		116941293	116941293	+1	no_errors	ENST00000295598	ensembl	human	known	69_37n	missense	617	11.84	83	SNP	1.000	T
ATP8A2	51761	genome.wustl.edu	37	13	26535727	26535727	+	Silent	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr13:26535727G>C	ENST00000381655.2	+	34	3340	c.3198G>C	c.(3196-3198)ctG>ctC	p.L1066L	ATP8A2_ENST00000255283.8_Silent_p.L1001L	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	1026					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		CTATGGTCCTGAGCTCCGCAC	0.418																																						dbGAP											0													192.0	175.0	181.0					13																	26535727		1910	4124	6034	-	-	-	SO:0001819	synonymous_variant	0			AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.3198G>C	13.37:g.26535727G>C			Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.L1066	ENST00000381655.2	37	c.3198	CCDS41873.1	13																																																																																			ATP8A2	-	tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000132932		0.418	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8A2	HGNC	protein_coding	OTTHUMT00000044236.2	539	0.00	0	G	NM_016529		26535727	26535727	+1	no_errors	ENST00000381655	ensembl	human	known	69_37n	silent	437	17.86	95	SNP	1.000	C
BCO2	83875	genome.wustl.edu	37	11	112086971	112086971	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:112086971C>G	ENST00000357685.5	+	11	1679	c.1544C>G	c.(1543-1545)tCa>tGa	p.S515*	BCO2_ENST00000532593.1_Nonsense_Mutation_p.S410*|BCO2_ENST00000393032.2_Nonsense_Mutation_p.S481*|BCO2_ENST00000438022.1_Nonsense_Mutation_p.S481*|BCO2_ENST00000361053.4_Nonsense_Mutation_p.S442*|BCO2_ENST00000531169.1_Nonsense_Mutation_p.S481*|BCO2_ENST00000526088.1_Nonsense_Mutation_p.S475*			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	515					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						TTTTATCCCTCAGAACCTGTT	0.413																																					GBM(177;1916 2099 21049 29541 39946)	dbGAP											0													145.0	138.0	140.0					11																	112086971		2201	4297	6498	-	-	-	SO:0001587	stop_gained	0			AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.1544C>G	11.37:g.112086971C>G	ENSP00000350314:p.Ser515*		B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Nonsense_Mutation	SNP	pfam_Carotenoid_Oase	p.S515*	ENST00000357685.5	37	c.1544	CCDS8358.2	11	.	.	.	.	.	.	.	.	.	.	C	38	7.100613	0.98063	.	.	ENSG00000197580	ENST00000357685;ENST00000393032;ENST00000361053;ENST00000438022;ENST00000526088;ENST00000532593;ENST00000531169	.	.	.	5.94	4.09	0.47781	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-9.7964	11.4564	0.50185	0.0:0.8544:0.0:0.1456	.	.	.	.	X	515;481;442;481;475;410;481	.	ENSP00000350314:S515X	S	+	2	0	BCO2	111592181	1.000000	0.71417	0.961000	0.40146	0.978000	0.69477	6.792000	0.75125	0.861000	0.35504	0.650000	0.86243	TCA	BCO2	-	pfam_Carotenoid_Oase	ENSG00000197580		0.413	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCO2	HGNC	protein_coding	OTTHUMT00000256570.3	488	0.00	0	C	NM_001037290		112086971	112086971	+1	no_errors	ENST00000357685	ensembl	human	known	69_37n	nonsense	357	27.24	134	SNP	1.000	G
BEND5	79656	genome.wustl.edu	37	1	49193689	49193689	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:49193689C>G	ENST00000371833.3	-	6	1221	c.1135G>C	c.(1135-1137)Gaa>Caa	p.E379Q	BEND5_ENST00000476096.1_5'UTR|AGBL4_ENST00000371838.1_Intron|AGBL4_ENST00000371839.1_Intron	NM_024603.2	NP_078879.2	Q7L4P6	BEND5_HUMAN	BEN domain containing 5	379	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.					Golgi apparatus (GO:0005794)				large_intestine(5)|lung(2)|skin(1)	8						TCCACAGTTTCTTGTGCTATT	0.353																																						dbGAP											0													125.0	118.0	120.0					1																	49193689		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007932	CCDS552.2	1p33	2012-11-22	2008-10-03	2008-10-03	ENSG00000162373	ENSG00000162373		"""BEN domain containing"""	25668	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 165"""	C1orf165		12477932	Standard	NM_024603		Approved	FLJ11588	uc001crx.4	Q7L4P6	OTTHUMG00000008153	ENST00000371833.3:c.1135G>C	1.37:g.49193689C>G	ENSP00000360899:p.Glu379Gln		D3DQ27|Q96A62|Q9HAI3	Missense_Mutation	SNP	pfam_BEN_domain	p.E379Q	ENST00000371833.3	37	c.1135	CCDS552.2	1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.875527	0.91664	.	.	ENSG00000162373	ENST00000371833;ENST00000294347	T	0.44482	0.92	5.74	5.74	0.90152	BEN domain (2);	0.000000	0.85682	D	0.000000	T	0.52917	0.1764	L	0.27053	0.805	0.58432	D	0.999999	D	0.69078	0.997	D	0.81914	0.995	T	0.44982	-0.9292	9	.	.	.	-7.3298	18.8993	0.92435	0.0:1.0:0.0:0.0	.	379	Q7L4P6	BEND5_HUMAN	Q	379;91	ENSP00000360899:E379Q	.	E	-	1	0	BEND5	48966276	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.440000	0.80464	2.722000	0.93159	0.591000	0.81541	GAA	BEND5	-	pfam_BEN_domain	ENSG00000162373		0.353	BEND5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND5	HGNC	protein_coding	OTTHUMT00000022323.1	453	0.22	1	C	NM_024603		49193689	49193689	-1	no_errors	ENST00000371833	ensembl	human	known	69_37n	missense	310	22.11	88	SNP	1.000	G
BLNK	29760	genome.wustl.edu	37	10	97983711	97983711	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr10:97983711G>A	ENST00000224337.5	-	6	537	c.396C>T	c.(394-396)ttC>ttT	p.F132F	BLNK_ENST00000427367.2_Silent_p.F132F|BLNK_ENST00000413476.2_Silent_p.F132F|BLNK_ENST00000371176.2_Silent_p.F132F	NM_013314.3	NP_037446.1	Q8WV28	BLNK_HUMAN	B-cell linker	132	Pro-rich.				B cell differentiation (GO:0030183)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(2)|stomach(1)	14		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)		GTGTCTTGCTGAAGGGTGGGG	0.512																																						dbGAP											0													121.0	116.0	118.0					10																	97983711		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF068180	CCDS7446.1, CCDS44464.1, CCDS58091.1, CCDS73171.1	10q23.2-q23.33	2014-09-17			ENSG00000095585	ENSG00000095585		"""SH2 domain containing"""	14211	protein-coding gene	gene with protein product	"""B-cell adapter containing a SH2 domain protein"", ""B-cell activation"", ""Src homology [SH2] domain-containing leukocyte protein of 65 kD"", ""B cell adaptor containing SH2 domain"""	604515				9697839, 10583958	Standard	NM_013314		Approved	SLP65, Ly57, SLP-65, BLNK-s, BASH, bca	uc001kls.4	Q8WV28	OTTHUMG00000018827	ENST00000224337.5:c.396C>T	10.37:g.97983711G>A			O75498|O75499|Q2MD49	Silent	SNP	pfam_SH2,smart_SH2,pfscan_SH2	p.F132	ENST00000224337.5	37	c.396	CCDS7446.1	10																																																																																			BLNK	-	NULL	ENSG00000095585		0.512	BLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLNK	HGNC	protein_coding	OTTHUMT00000049593.1	273	0.00	0	G	NM_013314		97983711	97983711	-1	no_errors	ENST00000224337	ensembl	human	known	69_37n	silent	185	11.85	25	SNP	0.999	A
BSX	390259	genome.wustl.edu	37	11	122850093	122850093	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:122850093T>A	ENST00000343035.2	-	2	383	c.335A>T	c.(334-336)aAa>aTa	p.K112I		NM_001098169.1	NP_001091639.1	Q3C1V8	BSH_HUMAN	brain-specific homeobox	112					eating behavior (GO:0042755)|locomotory behavior (GO:0007626)|mammary gland involution (GO:0060056)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	10		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)		CGTGCGGGCTTTGCGGCGGCG	0.657																																						dbGAP											0													37.0	47.0	44.0					11																	122850093		2041	4191	6232	-	-	-	SO:0001583	missense	0				CCDS41728.1	11q24.1	2011-07-19			ENSG00000188909	ENSG00000188909		"""Homeoboxes / ANTP class : NKL subclass"""	20450	protein-coding gene	gene with protein product		611074					Standard	NM_001098169		Approved	BSX1	uc010rzs.2	Q3C1V8	OTTHUMG00000150247	ENST00000343035.2:c.335A>T	11.37:g.122850093T>A	ENSP00000344285:p.Lys112Ile			Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_Homeobox_metazoa,pfscan_Homeodomain	p.K112I	ENST00000343035.2	37	c.335	CCDS41728.1	11	.	.	.	.	.	.	.	.	.	.	T	33	5.273532	0.95459	.	.	ENSG00000188909	ENST00000343035	D	0.97138	-4.26	5.22	5.22	0.72569	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.094233	0.64402	D	0.000001	D	0.98692	0.9561	M	0.90922	3.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99793	1.1032	10	0.87932	D	0	.	15.1036	0.72303	0.0:0.0:0.0:1.0	.	112	Q3C1V8	BSH_HUMAN	I	112	ENSP00000344285:K112I	ENSP00000344285:K112I	K	-	2	0	BSX	122355303	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.862000	0.87013	1.986000	0.57962	0.533000	0.62120	AAA	BSX	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000188909		0.657	BSX-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	BSX	HGNC	protein_coding	OTTHUMT00000317076.1	48	0.00	0	T	NM_001098169		122850093	122850093	-1	no_errors	ENST00000343035	ensembl	human	known	69_37n	missense	43	32.81	21	SNP	1.000	A
C1orf95	375057	genome.wustl.edu	37	1	226736785	226736785	+	Silent	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:226736785C>G	ENST00000366788.3	+	1	285	c.180C>G	c.(178-180)ctC>ctG	p.L60L	C1orf95_ENST00000366789.4_Silent_p.L60L	NM_001003665.3	NP_001003665.1	Q69YW2	STUM_HUMAN	chromosome 1 open reading frame 95	60						integral component of membrane (GO:0016021)				large_intestine(1)|lung(4)|ovary(3)	8	Breast(184;0.133)	Prostate(94;0.0885)		GBM - Glioblastoma multiforme(131;0.113)		GCCTCTTCCTCAACACTTTCG	0.721																																						dbGAP											0													30.0	34.0	32.0					1																	226736785		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF035308	CCDS31044.1	1q42.12	2012-06-26			ENSG00000203685	ENSG00000203685			30491	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001003665		Approved	DKFZp761P211	uc021pjw.1	Q69YW2	OTTHUMG00000037583	ENST00000366788.3:c.180C>G	1.37:g.226736785C>G			A6NGL2	Silent	SNP	NULL	p.L60	ENST00000366788.3	37	c.180	CCDS31044.1	1																																																																																			C1orf95	-	NULL	ENSG00000203685		0.721	C1orf95-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C1orf95	HGNC	protein_coding	OTTHUMT00000091634.1	20	0.00	0	C	NM_001003665		226736785	226736785	+1	no_errors	ENST00000366788	ensembl	human	known	69_37n	silent	28	34.09	15	SNP	1.000	G
C20orf173	140873	genome.wustl.edu	37	20	34116530	34116530	+	Splice_Site	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr20:34116530C>T	ENST00000246199.2	-	2	607	c.329G>A	c.(328-330)aGg>aAg	p.R110K	C20orf173_ENST00000374345.4_Splice_Site_p.R163K|RP3-477O4.5_ENST00000422009.1_RNA|C20orf173_ENST00000444723.1_Splice_Site_p.R163K			Q96LM9	CT173_HUMAN	chromosome 20 open reading frame 173	110										haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						CAGCACCCACCTGAAAACCAC	0.597																																						dbGAP											0													20.0	19.0	20.0					20																	34116530		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0			AL121586	CCDS46594.1	20q11.22	2012-10-30			ENSG00000125975	ENSG00000125975			16166	protein-coding gene	gene with protein product							Standard	NM_001145350		Approved	dJ477O4.4	uc010zvf.1	Q96LM9	OTTHUMG00000032340	ENST00000246199.2:c.329+1G>A	20.37:g.34116530C>T			A6PVJ1|Q2M293|Q5JWS4|Q9H449	Missense_Mutation	SNP	NULL	p.R163K	ENST00000246199.2	37	c.488		20	.	.	.	.	.	.	.	.	.	.	C	22.9	4.353729	0.82243	.	.	ENSG00000125975	ENST00000246199;ENST00000444723	T;T	0.40756	1.02;1.02	3.92	3.92	0.45320	.	.	.	.	.	T	0.37732	0.1014	L	0.48642	1.525	0.25867	N	0.983753	P;P	0.46784	0.884;0.884	B;B	0.40477	0.219;0.33	T	0.23619	-1.0183	8	.	.	.	.	13.8082	0.63246	0.0:1.0:0.0:0.0	.	163;110	E9PFA0;Q96LM9	.;CT173_HUMAN	K	110;163	ENSP00000246199:R110K;ENSP00000403566:R163K	.	R	-	2	0	C20orf173	33579944	0.999000	0.42202	0.357000	0.25798	0.124000	0.20399	3.591000	0.53986	2.185000	0.69588	0.563000	0.77884	AGG	C20orf173	-	NULL	ENSG00000125975		0.597	C20orf173-001	KNOWN	basic	protein_coding	C20orf173	HGNC	protein_coding	OTTHUMT00000078874.6	74	0.00	0	C	NM_001145350	Missense_Mutation	34116530	34116530	-1	no_errors	ENST00000444723	ensembl	human	known	69_37n	missense	68	35.24	37	SNP	0.990	T
C4orf17	84103	genome.wustl.edu	37	4	100460508	100460508	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr4:100460508G>C	ENST00000326581.4	+	7	1179	c.817G>C	c.(817-819)Gaa>Caa	p.E273Q	C4orf17_ENST00000514652.1_Missense_Mutation_p.E273Q	NM_032149.2	NP_115525.2	Q53FE4	CD017_HUMAN	chromosome 4 open reading frame 17	273										central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|prostate(1)|urinary_tract(3)	18				OV - Ovarian serous cystadenocarcinoma(123;2.08e-08)		CAGAGATACAGAAGGGGATCA	0.433																																						dbGAP											0													71.0	75.0	73.0					4																	100460508		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136838	CCDS3649.1	4q23	2008-02-05			ENSG00000138813	ENSG00000138813			25274	protein-coding gene	gene with protein product						11230166	Standard	NM_032149		Approved	DKFZP434G072	uc003huw.3	Q53FE4	OTTHUMG00000131027	ENST00000326581.4:c.817G>C	4.37:g.100460508G>C	ENSP00000322582:p.Glu273Gln		Q6FI84|Q6IS77|Q8NA78|Q9H0D9	Missense_Mutation	SNP	NULL	p.E273Q	ENST00000326581.4	37	c.817	CCDS3649.1	4	.	.	.	.	.	.	.	.	.	.	G	12.31	1.898731	0.33535	.	.	ENSG00000138813	ENST00000326581;ENST00000514652	T;T	0.29917	1.55;1.56	4.94	4.94	0.65067	.	0.242318	0.29451	N	0.012108	T	0.43033	0.1229	L	0.35723	1.085	0.09310	N	0.999996	D	0.71674	0.998	D	0.68943	0.961	T	0.18618	-1.0331	10	0.40728	T	0.16	-15.2999	13.844	0.63457	0.0:0.0:1.0:0.0	.	273	Q53FE4	CD017_HUMAN	Q	273	ENSP00000322582:E273Q;ENSP00000427663:E273Q	ENSP00000322582:E273Q	E	+	1	0	C4orf17	100679531	0.458000	0.25760	0.086000	0.20670	0.012000	0.07955	2.337000	0.43947	2.718000	0.92993	0.655000	0.94253	GAA	C4orf17	-	NULL	ENSG00000138813		0.433	C4orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf17	HGNC	protein_coding	OTTHUMT00000253670.2	233	0.00	0	G	NM_032149		100460508	100460508	+1	no_errors	ENST00000326581	ensembl	human	known	69_37n	missense	151	21.76	42	SNP	0.178	C
C5orf51	285636	genome.wustl.edu	37	5	41909903	41909903	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr5:41909903C>T	ENST00000381647.2	+	3	282	c.263C>T	c.(262-264)cCt>cTt	p.P88L	C5orf51_ENST00000505931.2_3'UTR	NM_175921.4	NP_787117.3	A6NDU8	CE051_HUMAN	chromosome 5 open reading frame 51	88										endometrium(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						GAAGATTTTCCTGAAGACTCT	0.279																																						dbGAP											0													45.0	49.0	48.0					5																	41909903		2196	4285	6481	-	-	-	SO:0001583	missense	0			AL833916, AK094002	CCDS34151.1	5p13.1	2008-07-18			ENSG00000205765	ENSG00000205765			27750	protein-coding gene	gene with protein product						14702039	Standard	NM_175921		Approved	LOC285636	uc003jmo.3	A6NDU8	OTTHUMG00000162084	ENST00000381647.2:c.263C>T	5.37:g.41909903C>T	ENSP00000371061:p.Pro88Leu		A2RRM9	Missense_Mutation	SNP	NULL	p.P88L	ENST00000381647.2	37	c.263	CCDS34151.1	5	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962897	0.92791	.	.	ENSG00000205765	ENST00000381647	T	0.36699	1.24	5.18	5.18	0.71444	.	0.054644	0.85682	D	0.000000	T	0.49133	0.1539	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	T	0.51942	-0.8641	10	0.72032	D	0.01	-9.2411	16.9054	0.86126	0.0:1.0:0.0:0.0	.	88	A6NDU8	CE051_HUMAN	L	88	ENSP00000371061:P88L	ENSP00000371061:P88L	P	+	2	0	C5orf51	41945660	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.595000	0.74109	2.420000	0.82092	0.655000	0.94253	CCT	C5orf51	-	NULL	ENSG00000205765		0.279	C5orf51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf51	HGNC	protein_coding	OTTHUMT00000367144.1	122	0.00	0	C	NM_175921		41909903	41909903	+1	no_errors	ENST00000381647	ensembl	human	known	69_37n	missense	90	15.89	17	SNP	1.000	T
CA11	770	genome.wustl.edu	37	19	49143054	49143054	+	Silent	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:49143054G>C	ENST00000084798.4	-	5	1237	c.558C>G	c.(556-558)ctC>ctG	p.L186L	DBP_ENST00000601104.1_5'Flank|SEC1P_ENST00000430145.2_RNA|DBP_ENST00000222122.5_5'Flank	NM_001217.3	NP_001208.2	O75493	CAH11_HUMAN	carbonic anhydrase XI	186						basolateral plasma membrane (GO:0016323)|extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)	14		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000103)|all cancers(93;0.000119)|GBM - Glioblastoma multiforme(486;0.00634)|Epithelial(262;0.016)	Zonisamide(DB00909)	CGTTGACAAAGAGGCTGAGAA	0.627																																						dbGAP											0													61.0	66.0	64.0					19																	49143054		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF067662	CCDS12729.1	19q13.3	2012-07-02			ENSG00000063180	ENSG00000063180		"""Carbonic anhydrases"""	1370	protein-coding gene	gene with protein product	"""CA-RP XI"", ""carbonic anhydrase-related protein XI"", ""carbonic anhydrase-related protein 2"""	604644				9878252	Standard	XR_243956		Approved	CARP2, CARPX1	uc002pjz.1	O75493		ENST00000084798.4:c.558C>G	19.37:g.49143054G>C			O60596|Q6FHI1|Q9UEC4	Silent	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.L186	ENST00000084798.4	37	c.558	CCDS12729.1	19																																																																																			CA11	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000063180		0.627	CA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA11	HGNC	protein_coding	OTTHUMT00000466172.1	114	0.00	0	G	NM_001217		49143054	49143054	-1	no_errors	ENST00000084798	ensembl	human	known	69_37n	silent	148	33.03	73	SNP	0.987	C
CACNA1D	776	genome.wustl.edu	37	3	53707806	53707806	+	Intron	SNP	T	T	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr3:53707806T>A	ENST00000350061.5	+	8	1731				CACNA1D_ENST00000498251.1_Intron|CACNA1D_ENST00000288139.4_Missense_Mutation_p.F395I|CACNA1D_ENST00000422281.2_Intron	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCTTGGCTCATTTTTCGTCCT	0.468																																						dbGAP											0													379.0	278.0	313.0					3																	53707806		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.1220+653T>A	3.37:g.53707806T>A			B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.F395I	ENST00000350061.5	37	c.1183	CCDS46848.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	28.6|28.6	4.936231|4.936231	0.92458|0.92458	.|.	.|.	ENSG00000157388|ENSG00000157388	ENST00000288139|ENST00000481085	D|.	0.98684|.	-5.07|.	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87305|0.87305	0.6144|0.6144	H|H	0.96301|0.96301	3.8|3.8	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.91369|0.91369	0.5118|0.5118	10|5	0.87932|.	D|.	0|.	.|.	15.2187|15.2187	0.73292|0.73292	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	395|.	Q01668-2|.	.|.	I|Q	395|80	ENSP00000288139:F395I|.	ENSP00000288139:F395I|.	F|H	+|+	1|3	0|2	CACNA1D|CACNA1D	53682846|53682846	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.868000|7.868000	0.87116|0.87116	2.178000|2.178000	0.69098|0.69098	0.529000|0.529000	0.55759|0.55759	TTT|CAT	CACNA1D	-	pfam_Ion_trans_dom	ENSG00000157388		0.468	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	HGNC	protein_coding	OTTHUMT00000350557.1	529	0.00	0	T	NM_000720		53707806	53707806	+1	no_errors	ENST00000288139	ensembl	human	known	69_37n	missense	393	19.47	95	SNP	1.000	A
RANBP3	8498	genome.wustl.edu	37	19	5914426	5914426	+	IGR	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:5914426C>T	ENST00000340578.6	-	0	3233				CAPS_ENST00000452990.2_Silent_p.A3A|AC104532.4_ENST00000591109.1_RNA|CAPS_ENST00000588776.1_Silent_p.A89A|CAPS_ENST00000222125.5_Silent_p.A3A|AC104532.2_ENST00000588891.1_3'UTR	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3						intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						GCATGGACGCCGTGGATGCCA	0.667																																						dbGAP											0													55.0	57.0	57.0					19																	5914426		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4			19.37:g.5914426C>T			B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Silent	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.A3	ENST00000340578.6	37	c.9	CCDS42478.1	19																																																																																			CAPS	-	NULL	ENSG00000105519		0.667	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAPS	HGNC	protein_coding	OTTHUMT00000452304.1	41	0.00	0	C	NM_007322		5914426	5914426	+1	no_errors	ENST00000222125	ensembl	human	known	69_37n	silent	29	34.09	15	SNP	0.000	T
CAV1	857	genome.wustl.edu	37	7	116199333	116199333	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr7:116199333G>C	ENST00000341049.2	+	3	807	c.529G>C	c.(529-531)Gaa>Caa	p.E177Q	CAV1_ENST00000393470.1_Missense_Mutation_p.E166Q|CAV1_ENST00000405348.1_Missense_Mutation_p.E146Q|CAV1_ENST00000393468.1_Missense_Mutation_p.E146Q|CAV1_ENST00000393467.1_Missense_Mutation_p.E146Q	NM_001753.4	NP_001744.2	Q03135	CAV1_HUMAN	caveolin 1, caveolae protein, 22kDa	177					angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion transport (GO:0006816)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cellular calcium ion homeostasis (GO:0006874)|cellular response to hyperoxia (GO:0071455)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol transport (GO:0030301)|cytosolic calcium ion homeostasis (GO:0051480)|inactivation of MAPK activity (GO:0000188)|lactation (GO:0007595)|leukocyte migration (GO:0050900)|lipid storage (GO:0019915)|maintenance of protein location in cell (GO:0032507)|mammary gland development (GO:0030879)|mammary gland involution (GO:0060056)|MAPK cascade (GO:0000165)|membrane depolarization (GO:0051899)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of pinocytosis (GO:0048550)|negative regulation of protein binding (GO:0032091)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|nitric oxide homeostasis (GO:0033484)|nitric oxide metabolic process (GO:0046209)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of vasoconstriction (GO:0045907)|protein homooligomerization (GO:0051260)|protein localization (GO:0008104)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)|regulation of blood coagulation (GO:0030193)|regulation of fatty acid metabolic process (GO:0019217)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidase activity (GO:0052547)|regulation of smooth muscle contraction (GO:0006940)|regulation of the force of heart contraction by chemical signal (GO:0003057)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to ischemia (GO:0002931)|response to progesterone (GO:0032570)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|vasculogenesis (GO:0001570)|vasoconstriction (GO:0042310)|vesicle organization (GO:0016050)|viral process (GO:0016032)	acrosomal membrane (GO:0002080)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell cortex (GO:0005938)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lipid particle (GO:0005811)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cholesterol binding (GO:0015485)|enzyme binding (GO:0019899)|nitric-oxide synthase binding (GO:0050998)|patched binding (GO:0005113)|peptidase activator activity (GO:0016504)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)			CTTGCAGAAAGAAATATAAAT	0.388																																						dbGAP											0													59.0	55.0	57.0					7																	116199333		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF125348	CCDS5767.1, CCDS55156.1	7q31	2006-02-09	2002-08-29		ENSG00000105974	ENSG00000105974			1527	protein-coding gene	gene with protein product		601047	"""caveolin 1, caveolae protein, 22kD"""	CAV		10087206	Standard	NM_001753		Approved		uc003vif.2	Q03135	OTTHUMG00000023413	ENST00000341049.2:c.529G>C	7.37:g.116199333G>C	ENSP00000339191:p.Glu177Gln		Q9UGP1|Q9UNG1|Q9UQH6	Missense_Mutation	SNP	pfam_Caveolin	p.E177Q	ENST00000341049.2	37	c.529	CCDS5767.1	7	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995950	0.74703	.	.	ENSG00000105974	ENST00000341049;ENST00000393470;ENST00000405348;ENST00000393468;ENST00000393467	D;D;D;D;D	0.94457	-3.43;-3.41;-3.34;-3.34;-3.34	5.64	5.64	0.86602	.	0.197039	0.52532	D	0.000065	D	0.95928	0.8674	M	0.66297	2.02	0.80722	D	1	P	0.37636	0.603	P	0.48738	0.588	D	0.95566	0.8634	10	0.59425	D	0.04	-2.9059	19.7053	0.96070	0.0:0.0:1.0:0.0	.	177	Q03135	CAV1_HUMAN	Q	177;166;146;146;146	ENSP00000339191:E177Q;ENSP00000377113:E166Q;ENSP00000384348:E146Q;ENSP00000377111:E146Q;ENSP00000377110:E146Q	ENSP00000339191:E177Q	E	+	1	0	CAV1	115986569	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.834000	0.92094	2.653000	0.90120	0.655000	0.94253	GAA	CAV1	-	NULL	ENSG00000105974		0.388	CAV1-001	KNOWN	basic|CCDS	protein_coding	CAV1	HGNC	protein_coding	OTTHUMT00000059734.4	161	0.00	0	G	NM_001753		116199333	116199333	+1	no_errors	ENST00000341049	ensembl	human	known	69_37n	missense	112	17.65	24	SNP	1.000	C
CCDC138	165055	genome.wustl.edu	37	2	109404510	109404510	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:109404510A>G	ENST00000295124.4	+	2	176	c.116A>G	c.(115-117)cAg>cGg	p.Q39R	CCDC138_ENST00000412964.2_Missense_Mutation_p.Q39R|CCDC138_ENST00000470608.1_3'UTR	NM_144978.1	NP_659415.1	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	39										endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	14						AATTTTTATCAGTCTAAGTAT	0.313																																						dbGAP											0													24.0	28.0	27.0					2																	109404510		2175	4293	6468	-	-	-	SO:0001583	missense	0			AK057307	CCDS2080.1	2q13	2008-02-05			ENSG00000163006	ENSG00000163006			26531	protein-coding gene	gene with protein product						12477932	Standard	NM_144978		Approved	FLJ32745	uc002ten.1	Q96M89	OTTHUMG00000130980	ENST00000295124.4:c.116A>G	2.37:g.109404510A>G	ENSP00000295124:p.Gln39Arg		Q05DF1|Q4ZG07|Q53TE1|Q6ZUY5|Q86VL7	Missense_Mutation	SNP	NULL	p.Q39R	ENST00000295124.4	37	c.116	CCDS2080.1	2	.	.	.	.	.	.	.	.	.	.	A	0.007	-2.006568	0.00426	.	.	ENSG00000163006	ENST00000412964;ENST00000295124	D;D	0.87334	-2.24;-2.24	3.88	1.46	0.22682	.	0.827245	0.10476	N	0.670180	T	0.77519	0.4142	L	0.36672	1.1	0.09310	N	0.999994	B;B	0.21905	0.062;0.0	B;B	0.24269	0.052;0.001	T	0.58929	-0.7549	10	0.12430	T	0.62	-4.5258	5.2267	0.15399	0.7223:0.18:0.0977:0.0	.	39;39	Q96M89-2;Q96M89	.;CC138_HUMAN	R	39	ENSP00000411800:Q39R;ENSP00000295124:Q39R	ENSP00000295124:Q39R	Q	+	2	0	CCDC138	108770942	0.968000	0.33430	0.568000	0.28447	0.001000	0.01503	0.660000	0.25009	0.301000	0.22738	-0.274000	0.10170	CAG	CCDC138	-	NULL	ENSG00000163006		0.313	CCDC138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC138	HGNC	protein_coding	OTTHUMT00000253593.1	65	0.00	0	A	NM_144978		109404510	109404510	+1	no_errors	ENST00000295124	ensembl	human	known	69_37n	missense	47	24.19	15	SNP	0.430	G
CCDC64B	146439	genome.wustl.edu	37	16	3081079	3081079	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr16:3081079C>T	ENST00000572449.1	-	3	417	c.355G>A	c.(355-357)Gtg>Atg	p.V119M	RP11-473M20.5_ENST00000382225.3_RNA|CCDC64B_ENST00000389347.4_Missense_Mutation_p.V119M|CCDC64B_ENST00000573514.1_De_novo_Start_InFrame			A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B	119										breast(1)|endometrium(2)|large_intestine(1)	4						TCCAGCTCCACGGCCCGGGCC	0.731																																						dbGAP											0													5.0	7.0	6.0					16																	3081079		1725	3629	5354	-	-	-	SO:0001583	missense	0			BC128602	CCDS45393.1	16p13.3	2008-07-04				ENSG00000162069			33584	protein-coding gene	gene with protein product							Standard	NM_001103175		Approved		uc002ctf.4	A1A5D9		ENST00000572449.1:c.355G>A	16.37:g.3081079C>T	ENSP00000459043:p.Val119Met		Q658L9	Missense_Mutation	SNP	superfamily_Sig_transdc_His_kinase_dimeric	p.V119M	ENST00000572449.1	37	c.355	CCDS45393.1	16	.	.	.	.	.	.	.	.	.	.	C	15.39	2.820197	0.50633	.	.	ENSG00000162069	ENST00000389347	T	0.04706	3.57	5.4	4.45	0.53987	.	0.493534	0.18295	N	0.145609	T	0.03095	0.0091	N	0.08118	0	0.29193	N	0.875701	B	0.28760	0.221	B	0.21546	0.035	T	0.27640	-1.0068	10	0.52906	T	0.07	-31.8483	11.8415	0.52357	0.0:0.9141:0.0:0.0859	.	119	A1A5D9	BICR2_HUMAN	M	119	ENSP00000373998:V119M	ENSP00000373998:V119M	V	-	1	0	CCDC64B	3021080	0.883000	0.30277	0.949000	0.38748	0.637000	0.38172	1.803000	0.38863	1.280000	0.44463	0.561000	0.74099	GTG	CCDC64B	-	NULL	ENSG00000162069		0.731	CCDC64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC64B	HGNC	protein_coding	OTTHUMT00000436991.1	13	0.00	0	C			3081079	3081079	-1	no_errors	ENST00000389347	ensembl	human	known	69_37n	missense	12	47.83	11	SNP	0.990	T
CCDC80	151887	genome.wustl.edu	37	3	112357123	112357123	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr3:112357123C>G	ENST00000206423.3	-	2	2583	c.1630G>C	c.(1630-1632)Gag>Cag	p.E544Q	CCDC80_ENST00000475181.1_5'Flank|CCDC80_ENST00000439685.2_Missense_Mutation_p.E544Q	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	544	Lys-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						tCTGGTTTCTCAAGCTTTTCA	0.433																																						dbGAP											0													77.0	66.0	70.0					3																	112357123		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.1630G>C	3.37:g.112357123C>G	ENSP00000206423:p.Glu544Gln		D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	NULL	p.E544Q	ENST00000206423.3	37	c.1630	CCDS2968.1	3	.	.	.	.	.	.	.	.	.	.	C	14.82	2.648898	0.47362	.	.	ENSG00000091986	ENST00000206423;ENST00000439685;ENST00000444594	T;T	0.47869	0.83;0.83	5.39	3.44	0.39384	.	0.529195	0.20708	N	0.087143	T	0.35008	0.0917	N	0.24115	0.695	0.29129	N	0.879753	B;B;B	0.23806	0.091;0.055;0.055	B;B;B	0.28849	0.095;0.044;0.044	T	0.33189	-0.9878	10	0.42905	T	0.14	-29.7982	11.709	0.51614	0.1391:0.7269:0.134:0.0	.	555;544;544	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	Q	544;544;172	ENSP00000206423:E544Q;ENSP00000411814:E544Q	ENSP00000206423:E544Q	E	-	1	0	CCDC80	113839813	0.997000	0.39634	0.843000	0.33291	0.993000	0.82548	3.748000	0.55142	1.252000	0.44001	0.555000	0.69702	GAG	CCDC80	-	NULL	ENSG00000091986		0.433	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC80	HGNC	protein_coding	OTTHUMT00000354219.1	372	0.00	0	C	NM_199511		112357123	112357123	-1	no_errors	ENST00000206423	ensembl	human	known	69_37n	missense	187	41.38	132	SNP	0.978	G
CD163L1	283316	genome.wustl.edu	37	12	7550886	7550886	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:7550886C>G	ENST00000313599.3	-	7	1760	c.1703G>C	c.(1702-1704)aGa>aCa	p.R568T	CD163L1_ENST00000416109.2_Missense_Mutation_p.R578T|CD163L1_ENST00000396630.1_Missense_Mutation_p.R568T			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	568	SRCR 5. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CACATCCTCTCTGTGTACACA	0.408																																						dbGAP											0													171.0	163.0	166.0					12																	7550886		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.1703G>C	12.37:g.7550886C>G	ENSP00000315945:p.Arg568Thr		B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Srcr_rcpt	p.R568T	ENST00000313599.3	37	c.1703	CCDS8577.1	12	.	.	.	.	.	.	.	.	.	.	C	13.97	2.394692	0.42512	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.34472	1.36;1.36;1.36	2.77	-3.58	0.04597	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.528260	0.04959	U	0.461687	T	0.27697	0.0681	N	0.17594	0.5	0.09310	N	1	P;P	0.45986	0.87;0.87	P;P	0.49421	0.61;0.492	T	0.29488	-1.0010	10	0.14656	T	0.56	.	9.2504	0.37551	0.0:0.6567:0.2018:0.1416	.	578;568	E7EVK4;Q9NR16	.;C163B_HUMAN	T	568;578;568	ENSP00000315945:R568T;ENSP00000393474:R578T;ENSP00000379871:R568T	ENSP00000315945:R568T	R	-	2	0	CD163L1	7442153	0.000000	0.05858	0.000000	0.03702	0.939000	0.58152	-3.472000	0.00459	-0.396000	0.07703	0.460000	0.39030	AGA	CD163L1	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000177675		0.408	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD163L1	HGNC	protein_coding	OTTHUMT00000399329.1	318	0.00	0	C	NM_174941		7550886	7550886	-1	no_errors	ENST00000313599	ensembl	human	known	69_37n	missense	471	11.13	59	SNP	0.000	G
CD2AP	23607	genome.wustl.edu	37	6	47541929	47541929	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:47541929C>G	ENST00000359314.5	+	6	1127	c.671C>G	c.(670-672)tCt>tGt	p.S224C		NM_012120.2	NP_036252.1	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	224					mitotic nuclear division (GO:0007067)|negative regulation of transforming growth factor beta1 production (GO:0032911)|positive regulation of protein localization to nucleus (GO:1900182)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of receptor-mediated endocytosis (GO:0048259)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|substrate-dependent cell migration, cell extension (GO:0006930)|vesicle organization (GO:0016050)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	20			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			AAAGAAGGCTCTGTGAAACTT	0.388																																						dbGAP											0													99.0	105.0	103.0					6																	47541929		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF146277	CCDS34472.1	6p12	2008-02-05			ENSG00000198087	ENSG00000198087			14258	protein-coding gene	gene with protein product		604241				10339567	Standard	NM_012120		Approved	CMS	uc003oyw.3	Q9Y5K6	OTTHUMG00000014799	ENST00000359314.5:c.671C>G	6.37:g.47541929C>G	ENSP00000352264:p.Ser224Cys		A6NL34|Q5VYA3|Q9UG97	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	p.S224C	ENST00000359314.5	37	c.671	CCDS34472.1	6	.	.	.	.	.	.	.	.	.	.	C	24.1	4.492372	0.84962	.	.	ENSG00000198087	ENST00000359314	T	0.27720	1.65	5.97	5.97	0.96955	.	1.290940	0.05456	N	0.550368	T	0.57844	0.2081	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.47459	-0.9116	10	0.59425	D	0.04	-16.3863	20.4135	0.99023	0.0:1.0:0.0:0.0	.	224	Q9Y5K6	CD2AP_HUMAN	C	224	ENSP00000352264:S224C	ENSP00000352264:S224C	S	+	2	0	CD2AP	47649888	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.547000	0.73892	2.835000	0.97688	0.591000	0.81541	TCT	CD2AP	-	NULL	ENSG00000198087		0.388	CD2AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD2AP	HGNC	protein_coding	OTTHUMT00000040817.2	226	0.00	0	C			47541929	47541929	+1	no_errors	ENST00000359314	ensembl	human	known	69_37n	missense	211	14.23	35	SNP	1.000	G
CENPE	1062	genome.wustl.edu	37	4	104061230	104061230	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr4:104061230C>G	ENST00000265148.3	-	38	6009	c.5920G>C	c.(5920-5922)Gaa>Caa	p.E1974Q	CENPE_ENST00000380026.3_Intron	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1974					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTCTGAAGTTCTTGGATCTTG	0.308																																						dbGAP											0													87.0	61.0	70.0					4																	104061230		2198	4297	6495	-	-	-	SO:0001583	missense	0			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.5920G>C	4.37:g.104061230C>G	ENSP00000265148:p.Glu1974Gln		A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.E1974Q	ENST00000265148.3	37	c.5920	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	C	13.13	2.145813	0.37923	.	.	ENSG00000138778	ENST00000265148;ENST00000394771	T	0.71698	-0.59	5.57	4.72	0.59763	.	.	.	.	.	T	0.55481	0.1923	L	0.44542	1.39	0.80722	D	1	P	0.38922	0.651	B	0.27608	0.081	T	0.53774	-0.8391	9	0.14656	T	0.56	.	13.1029	0.59231	0.1607:0.8393:0.0:0.0	.	1974	Q02224	CENPE_HUMAN	Q	1974	ENSP00000265148:E1974Q	ENSP00000265148:E1974Q	E	-	1	0	CENPE	104280679	1.000000	0.71417	0.994000	0.49952	0.965000	0.64279	0.832000	0.27490	1.331000	0.45412	0.643000	0.83706	GAA	CENPE	-	NULL	ENSG00000138778		0.308	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		199	0.00	0	C			104061230	104061230	-1	no_errors	ENST00000265148	ensembl	human	known	69_37n	missense	145	11.04	18	SNP	1.000	G
CEP89	84902	genome.wustl.edu	37	19	33417111	33417111	+	Silent	SNP	G	G	C	rs577830794		TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:33417111G>C	ENST00000305768.5	-	11	1237	c.1149C>G	c.(1147-1149)ctC>ctG	p.L383L		NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	383					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						GGGTGGCATTGAGCTCGTCCT	0.368													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17130	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													214.0	212.0	213.0					19																	33417111		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.1149C>G	19.37:g.33417111G>C			B9EGA6|Q8N5J8	Silent	SNP	NULL	p.L383	ENST00000305768.5	37	c.1149	CCDS32987.1	19																																																																																			CEP89	-	NULL	ENSG00000121289		0.368	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP89	HGNC	protein_coding	OTTHUMT00000451300.2	249	0.00	0	G	NM_032816		33417111	33417111	-1	no_errors	ENST00000305768	ensembl	human	known	69_37n	silent	241	15.73	45	SNP	0.004	C
CHCHD3	54927	genome.wustl.edu	37	7	132470412	132470412	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr7:132470412C>G	ENST00000262570.5	-	8	814	c.670G>C	c.(670-672)Gag>Cag	p.E224Q	CHCHD3_ENST00000448878.1_Missense_Mutation_p.E229Q|CHCHD3_ENST00000476546.1_5'UTR	NM_017812.2	NP_060282.1	Q9NX63	MIC19_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 3	224					inner mitochondrial membrane organization (GO:0007007)|mitochondrial fusion (GO:0008053)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein complex scaffold (GO:0032947)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	7						CCTCCCTTCTCAAGCATGCTC	0.353																																						dbGAP											0													99.0	94.0	96.0					7																	132470412		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC011596	CCDS5828.1	7q33	2012-10-02			ENSG00000106554	ENSG00000106554		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21906	protein-coding gene	gene with protein product	"""mitochondrial inner membrane organizing system 3"", ""protein phosphatase 1, regulatory subunit 22"""	613748				22252321, 23019327, 21081504, 17624330	Standard	NM_017812		Approved	FLJ20420, MINOS3, PPP1R22	uc003vre.3	Q9NX63	OTTHUMG00000155231	ENST00000262570.5:c.670G>C	7.37:g.132470412C>G	ENSP00000262570:p.Glu224Gln			Missense_Mutation	SNP	pfam_DUF737	p.E224Q	ENST00000262570.5	37	c.670	CCDS5828.1	7	.	.	.	.	.	.	.	.	.	.	C	7.762	0.705572	0.15172	.	.	ENSG00000106554	ENST00000262570;ENST00000448878	T;T	0.45276	0.9;0.9	5.81	3.96	0.45880	.	0.908342	0.09610	N	0.778988	T	0.35068	0.0919	L	0.36672	1.1	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.10450	0.005;0.001	T	0.04781	-1.0927	10	0.14252	T	0.57	-3.9101	13.9837	0.64321	0.0:0.7121:0.2879:0.0	.	229;224	C9JRZ6;Q9NX63	.;CHCH3_HUMAN	Q	224;229	ENSP00000262570:E224Q;ENSP00000389297:E229Q	ENSP00000262570:E224Q	E	-	1	0	CHCHD3	132120952	1.000000	0.71417	0.753000	0.31225	0.913000	0.54294	2.082000	0.41605	0.759000	0.33084	0.655000	0.94253	GAG	CHCHD3	-	NULL	ENSG00000106554		0.353	CHCHD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHCHD3	HGNC	protein_coding	OTTHUMT00000338899.1	461	0.00	0	C	NM_017812		132470412	132470412	-1	no_errors	ENST00000262570	ensembl	human	known	69_37n	missense	181	52.85	204	SNP	0.991	G
CHD4	1108	genome.wustl.edu	37	12	6680157	6680157	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:6680157C>T	ENST00000357008.2	-	39	5762	c.5599G>A	c.(5599-5601)Gat>Aat	p.D1867N	NOP2_ENST00000399466.2_5'Flank|NOP2_ENST00000541778.1_5'Flank|NOP2_ENST00000545915.1_5'Flank|CHD4_ENST00000309577.6_Missense_Mutation_p.D1895N|CHD4_ENST00000544040.1_Missense_Mutation_p.D1860N|NOP2_ENST00000382421.3_5'Flank|CHD4_ENST00000544484.1_Missense_Mutation_p.D1892N|NOP2_ENST00000542015.1_5'Flank|NOP2_ENST00000322166.5_5'Flank|NOP2_ENST00000545200.1_5'Flank|NOP2_ENST00000540228.1_5'Flank	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1867	Required for interaction with PCNT.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						CGAGTCACATCAGCTTTCATG	0.542																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													230.0	227.0	228.0					12																	6680157		2203	4300	6503	-	-	-	SO:0001583	missense	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.5599G>A	12.37:g.6680157C>T	ENSP00000349508:p.Asp1867Asn		Q8IXZ5	Missense_Mutation	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.D1895N	ENST00000357008.2	37	c.5683	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	C	27.4	4.827656	0.90955	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.96073	-3.9;-3.78;-3.89;-3.8	5.54	5.54	0.83059	CHD, C-terminal 2 (1);	0.000000	0.85682	D	0.000000	D	0.97914	0.9314	M	0.82923	2.615	0.80722	D	1	D;D;D	0.89917	0.998;0.997;1.0	D;D;D	0.91635	0.991;0.992;0.999	D	0.98485	1.0607	10	0.87932	D	0	-7.8215	19.4957	0.95072	0.0:1.0:0.0:0.0	.	1895;1867;1860	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	N	1892;1860;1895;1867;1841	ENSP00000440392:D1892N;ENSP00000440542:D1860N;ENSP00000312419:D1895N;ENSP00000349508:D1867N	ENSP00000312419:D1895N	D	-	1	0	CHD4	6550418	1.000000	0.71417	0.946000	0.38457	0.934000	0.57294	7.487000	0.81328	2.620000	0.88729	0.561000	0.74099	GAT	CHD4	-	pfam_CHD_C2	ENSG00000111642		0.542	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		325	0.00	0	C	NM_001273		6680157	6680157	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	missense	397	19.14	94	SNP	1.000	T
CHD8	57680	genome.wustl.edu	37	14	21867782	21867782	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr14:21867782G>C	ENST00000557364.1	-	26	5163	c.4900C>G	c.(4900-4902)Ctc>Gtc	p.L1634V	SNORD8_ENST00000363915.1_RNA|CHD8_ENST00000555962.1_5'UTR|CHD8_ENST00000430710.3_Missense_Mutation_p.L1355V|CHD8_ENST00000399982.2_Missense_Mutation_p.L1634V			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1634					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		ACTCCAATGAGCAGCGACTTG	0.443																																						dbGAP											0													115.0	111.0	112.0					14																	21867782		1972	4145	6117	-	-	-	SO:0001583	missense	0			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.4900C>G	14.37:g.21867782G>C	ENSP00000451601:p.Leu1634Val		Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.L1634V	ENST00000557364.1	37	c.4900	CCDS53885.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.4|20.4	3.975923|3.975923	0.74360|0.74360	.|.	.|.	ENSG00000100888|ENSG00000100888	ENST00000555935|ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	.|D;D;D	.|0.91686	.|-2.89;-2.89;-2.89	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.96485|0.96485	0.8853|0.8853	M|M	0.88775|0.88775	2.98|2.98	0.80722|0.80722	D|D	1|1	.|P	.|0.50066	.|0.931	.|D	.|0.63033	.|0.91	D|D	0.96596|0.96596	0.9441|0.9441	5|10	.|0.66056	.|D	.|0.02	-9.6885|-9.6885	18.199|18.199	0.89832|0.89832	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1355	.|Q9HCK8-2	.|.	G|V	867|1355;1634;1354;1634	.|ENSP00000406288:L1355V;ENSP00000382863:L1634V;ENSP00000451601:L1634V	.|ENSP00000262707:L1354V	A|L	-|-	2|1	0|0	CHD8|CHD8	20937622|20937622	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	5.545000|5.545000	0.67237|0.67237	2.828000|2.828000	0.97474|0.97474	0.655000|0.655000	0.94253|0.94253	GCT|CTC	CHD8	-	NULL	ENSG00000100888		0.443	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1	198	0.00	0	G	NM_020920		21867782	21867782	-1	no_errors	ENST00000399982	ensembl	human	known	69_37n	missense	205	28.07	80	SNP	1.000	C
CHTF18	63922	genome.wustl.edu	37	16	839677	839677	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr16:839677C>T	ENST00000262315.9	+	4	631	c.568C>T	c.(568-570)Ctg>Ttg	p.L190L	CHTF18_ENST00000455171.2_Silent_p.L218L|RPUSD1_ENST00000567114.1_5'Flank|RPUSD1_ENST00000565809.1_5'Flank|CHTF18_ENST00000317063.6_Silent_p.L387L|RPUSD1_ENST00000007264.2_5'Flank|RPUSD1_ENST00000561734.1_5'Flank|CHTF18_ENST00000491530.1_3'UTR	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	190					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				CCGGGCTTATCTGGTGCTGCG	0.682																																						dbGAP											0													30.0	35.0	33.0					16																	839677		2133	4231	6364	-	-	-	SO:0001819	synonymous_variant	0			BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.568C>T	16.37:g.839677C>T			B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Missense_Mutation	SNP	NULL	p.S60F	ENST00000262315.9	37	c.179	CCDS45371.1	16	.	.	.	.	.	.	.	.	.	.	C	2.871	-0.233985	0.05983	.	.	ENSG00000127586	ENST00000426047	.	.	.	5.22	0.615	0.17608	.	.	.	.	.	T	0.44117	0.1278	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28004	-1.0057	4	.	.	.	-24.8475	3.4937	0.07648	0.2937:0.3984:0.0:0.3079	.	.	.	.	F	60	.	.	S	+	2	0	CHTF18	779678	0.992000	0.36948	0.996000	0.52242	0.028000	0.11728	0.343000	0.19944	0.584000	0.29591	-0.284000	0.09977	TCT	CHTF18	-	NULL	ENSG00000127586		0.682	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHTF18	HGNC	protein_coding	OTTHUMT00000109061.3	59	0.00	0	C	NM_022092		839677	839677	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000426047	ensembl	human	novel	69_37n	missense	68	23.60	21	SNP	0.996	T
CIRH1A	84916	genome.wustl.edu	37	16	69191112	69191112	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr16:69191112C>G	ENST00000314423.7	+	12	1590	c.1413C>G	c.(1411-1413)ttC>ttG	p.F471L	CIRH1A_ENST00000563094.1_Missense_Mutation_p.F471L|CIRH1A_ENST00000352319.4_Intron			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	471					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		GAGGAAGCTTCAAGCACCTGC	0.453																																					Melanoma(69;1156 1278 4951 8715 52012)	dbGAP											0													59.0	54.0	56.0					16																	69191112		2198	4300	6498	-	-	-	SO:0001583	missense	0			AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.1413C>G	16.37:g.69191112C>G	ENSP00000327179:p.Phe471Leu		Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.F471L	ENST00000314423.7	37	c.1413	CCDS10872.1	16	.	.	.	.	.	.	.	.	.	.	C	3.490	-0.104013	0.06967	.	.	ENSG00000141076	ENST00000314423	T	0.25749	1.78	5.9	2.66	0.31614	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.190210	0.56097	D	0.000029	T	0.07818	0.0196	N	0.02539	-0.55	0.30263	N	0.792981	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.29366	-1.0014	10	0.09590	T	0.72	.	6.3402	0.21319	0.0:0.605:0.1479:0.2471	.	471;471	Q969X6;Q969X6-3	CIR1A_HUMAN;.	L	471	ENSP00000327179:F471L	ENSP00000327179:F471L	F	+	3	2	CIRH1A	67748613	1.000000	0.71417	0.998000	0.56505	0.792000	0.44763	0.750000	0.26334	0.834000	0.34852	0.455000	0.32223	TTC	CIRH1A	-	superfamily_Quinonprotein_ADH-like,smart_WD40_repeat	ENSG00000141076		0.453	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIRH1A	HGNC	protein_coding	OTTHUMT00000268950.2	191	0.00	0	C	NM_032830		69191112	69191112	+1	no_errors	ENST00000314423	ensembl	human	known	69_37n	missense	164	19.12	39	SNP	0.999	G
CISD3	284106	genome.wustl.edu	37	17	36887606	36887606	+	Missense_Mutation	SNP	G	G	C	rs563305407		TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:36887606G>C	ENST00000439660.2	+	3	242	c.118G>C	c.(118-120)Gtg>Ctg	p.V40L	CISD3_ENST00000578573.1_3'UTR|RNA5SP440_ENST00000363245.1_RNA	NM_001136498.1	NP_001129970.1	P0C7P0	CISD3_HUMAN	CDGSH iron sulfur domain 3	40						mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)			endometrium(2)	2						AGCCAGGTCCGTGGTGGCCCT	0.637																																						dbGAP											0													69.0	77.0	75.0					17																	36887606		692	1591	2283	-	-	-	SO:0001583	missense	0			AK097047	CCDS45662.1	17q12	2007-08-10				ENSG00000277972		"""CDGSH iron sulfur domain containing"""	27578	protein-coding gene	gene with protein product	"""mitoNEET related 2"""	611933				17376863, 17584744	Standard	NM_001136498		Approved	Miner2	uc010wds.1	P0C7P0		ENST00000439660.2:c.118G>C	17.37:g.36887606G>C	ENSP00000391402:p.Val40Leu			Missense_Mutation	SNP	pfam_FeS-contain_CDGSH-typ,smart_FeS-contain_CDGSH-typ_subfam	p.V40L	ENST00000439660.2	37	c.118	CCDS45662.1	17	.	.	.	.	.	.	.	.	.	.	G	11.86	1.763694	0.31228	.	.	ENSG00000230055	ENST00000439660	.	.	.	4.86	3.85	0.44370	.	.	.	.	.	T	0.23886	0.0578	N	0.08118	0	0.28971	N	0.88923	B	0.24882	0.113	B	0.22880	0.042	T	0.09271	-1.0682	8	0.37606	T	0.19	-6.6761	11.2822	0.49201	0.0:0.1832:0.8168:0.0	.	40	P0C7P0	CISD3_HUMAN	L	40	.	ENSP00000391402:V40L	V	+	1	0	CISD3	34141132	1.000000	0.71417	0.925000	0.36789	0.171000	0.22731	3.563000	0.53784	2.264000	0.75181	0.555000	0.69702	GTG	CISD3	-	NULL	ENSG00000230055		0.637	CISD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CISD3	HGNC	protein_coding	OTTHUMT00000441921.1	188	0.00	0	G			36887606	36887606	+1	no_errors	ENST00000439660	ensembl	human	known	69_37n	missense	72	60.44	110	SNP	0.787	C
CLIC5	53405	genome.wustl.edu	37	6	46047913	46047914	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:46047913_46047914insGG	ENST00000185206.6	-	1	218_219	c.66_67insCC	c.(64-69)ccagacfs	p.D23fs		NM_001114086.1	NP_001107558.1	Q9NZA1	CLIC5_HUMAN	chloride intracellular channel 5	23					auditory receptor cell stereocilium organization (GO:0060088)|chloride transport (GO:0006821)|diet induced thermogenesis (GO:0002024)|female pregnancy (GO:0007565)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|sensory perception of sound (GO:0007605)|transport (GO:0006810)	actin cytoskeleton (GO:0015629)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|stereocilium (GO:0032420)	voltage-gated chloride channel activity (GO:0005247)			endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	13						TCTGGCTGGTCTGGAACCTCAT	0.421																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF216941	CCDS4914.1, CCDS47438.1, CCDS59022.1	6p12.3	2014-03-14			ENSG00000112782	ENSG00000112782		"""Ion channels / Chloride channels : Intracellular"""	13517	protein-coding gene	gene with protein product		607293				10793131	Standard	NM_001114086		Approved		uc003oxv.3	Q9NZA1	OTTHUMG00000014775	ENST00000185206.6:c.66_67insCC	6.37:g.46047913_46047914insGG	ENSP00000185206:p.Asp23fs		B3KUF1|Q5T4Z0|Q8NBY3|Q96JT5|Q9BWZ0	Frame_Shift_Ins	INS	superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_Int_Cl_channel,tigrfam_Int_Cl_channel	p.D22fs	ENST00000185206.6	37	c.67_66	CCDS47438.1	6																																																																																			CLIC5	-	NULL	ENSG00000112782		0.421	CLIC5-002	KNOWN	basic|CCDS	protein_coding	CLIC5	HGNC	protein_coding	OTTHUMT00000040761.1	240	0.00	0	-			46047913	46047914	-1	no_errors	ENST00000185206	ensembl	human	known	69_37n	frame_shift_ins	157	33.47	79	INS	0.909:0.932	GG
CLIC5	53405	genome.wustl.edu	37	6	46047914	46047915	+	Frame_Shift_Ins	INS	-	-	CG			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:46047914_46047915insCG	ENST00000185206.6	-	1	217_218	c.65_66insCG	c.(64-66)ccafs	p.P22fs		NM_001114086.1	NP_001107558.1	Q9NZA1	CLIC5_HUMAN	chloride intracellular channel 5	22					auditory receptor cell stereocilium organization (GO:0060088)|chloride transport (GO:0006821)|diet induced thermogenesis (GO:0002024)|female pregnancy (GO:0007565)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|sensory perception of sound (GO:0007605)|transport (GO:0006810)	actin cytoskeleton (GO:0015629)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|stereocilium (GO:0032420)	voltage-gated chloride channel activity (GO:0005247)			endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	13						CTGGCTGGTCTGGAACCTCATA	0.426																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF216941	CCDS4914.1, CCDS47438.1, CCDS59022.1	6p12.3	2014-03-14			ENSG00000112782	ENSG00000112782		"""Ion channels / Chloride channels : Intracellular"""	13517	protein-coding gene	gene with protein product		607293				10793131	Standard	NM_001114086		Approved		uc003oxv.3	Q9NZA1	OTTHUMG00000014775	ENST00000185206.6:c.65_66insCG	6.37:g.46047914_46047915insCG	ENSP00000185206:p.Pro22fs		B3KUF1|Q5T4Z0|Q8NBY3|Q96JT5|Q9BWZ0	Frame_Shift_Ins	INS	superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_Int_Cl_channel,tigrfam_Int_Cl_channel	p.D23fs	ENST00000185206.6	37	c.66_65	CCDS47438.1	6																																																																																			CLIC5	-	NULL	ENSG00000112782		0.426	CLIC5-002	KNOWN	basic|CCDS	protein_coding	CLIC5	HGNC	protein_coding	OTTHUMT00000040761.1	239	0.00	0	-			46047914	46047915	-1	no_errors	ENST00000185206	ensembl	human	known	69_37n	frame_shift_ins	145	34.98	78	INS	0.932:0.946	CG
COL12A1	1303	genome.wustl.edu	37	6	75893674	75893674	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:75893674G>A	ENST00000322507.8	-	9	1493	c.1184C>T	c.(1183-1185)tCa>tTa	p.S395L	COL12A1_ENST00000483888.2_Missense_Mutation_p.S395L|COL12A1_ENST00000416123.2_Missense_Mutation_p.S395L|COL12A1_ENST00000345356.6_Intron	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	395	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TGTGTCTGCTGAGAGGTCGCG	0.502																																						dbGAP											0													168.0	163.0	165.0					6																	75893674		2024	4192	6216	-	-	-	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.1184C>T	6.37:g.75893674G>A	ENSP00000325146:p.Ser395Leu		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.S395L	ENST00000322507.8	37	c.1184	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	G	25.5	4.644627	0.87859	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.56611	0.45;0.45;0.45	5.31	4.43	0.53597	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.215065	0.32068	N	0.006626	T	0.42585	0.1209	L	0.48986	1.54	0.40053	D	0.975807	B;P	0.36110	0.394;0.537	B;B	0.43018	0.19;0.405	T	0.45600	-0.9250	10	0.45353	T	0.12	.	14.3199	0.66479	0.0729:0.0:0.9271:0.0	.	395;395	D6RGG3;Q99715	.;COCA1_HUMAN	L	395	ENSP00000325146:S395L;ENSP00000412864:S395L;ENSP00000421216:S395L	ENSP00000325146:S395L	S	-	2	0	COL12A1	75950394	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	4.646000	0.61411	2.481000	0.83766	0.655000	0.94253	TCA	COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.502	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	229	0.00	0	G	NM_004370		75893674	75893674	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	missense	281	14.59	48	SNP	0.999	A
COL4A6	1288	genome.wustl.edu	37	X	107436904	107436904	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chrX:107436904C>T	ENST00000372216.4	-	17	1129	c.1029G>A	c.(1027-1029)ctG>ctA	p.L343L	COL4A6_ENST00000545689.1_Silent_p.L342L|COL4A6_ENST00000394872.2_Silent_p.L343L|COL4A6_ENST00000334504.7_Silent_p.L342L|COL4A6_ENST00000538570.1_Silent_p.L342L	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	343	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CTGGGCCTGGCAGGCCAATGT	0.383									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)	dbGAP											0													116.0	112.0	114.0					X																	107436904		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.1029G>A	X.37:g.107436904C>T			Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Silent	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.L343	ENST00000372216.4	37	c.1029	CCDS14541.1	X																																																																																			COL4A6	-	NULL	ENSG00000197565		0.383	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	HGNC	protein_coding	OTTHUMT00000057875.2	187	0.00	0	C			107436904	107436904	-1	no_errors	ENST00000372216	ensembl	human	known	69_37n	silent	187	10.53	22	SNP	0.958	T
COQ6	51004	genome.wustl.edu	37	14	74428017	74428017	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr14:74428017C>A	ENST00000334571.2	+	9	1073	c.1033C>A	c.(1033-1035)Ctg>Atg	p.L345M	COQ6_ENST00000554920.1_Intron|COQ6_ENST00000394026.4_Missense_Mutation_p.L320M|ENTPD5_ENST00000557325.1_Intron|COQ6_ENST00000238709.4_Missense_Mutation_p.L270M	NM_182476.2	NP_872282.1	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 monooxygenase	345					small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(234;0.00337)		AAGCCGAGTTCTGTTTCCTCT	0.582																																						dbGAP											0													116.0	85.0	95.0					14																	74428017		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132944	CCDS9823.1, CCDS9824.1, CCDS9824.2	14q24.1	2013-05-01	2013-05-01		ENSG00000119723	ENSG00000119723			20233	protein-coding gene	gene with protein product		614647	"""coenzyme Q6 homolog (yeast)"", ""coenzyme Q6 homolog, monooxygenase (yeast)"", ""coenzyme Q6 homolog, monooxygenase (S. cerevisiae)"""			21540551	Standard	NM_182476		Approved	CGI-10	uc001xph.3	Q9Y2Z9	OTTHUMG00000171260	ENST00000334571.2:c.1033C>A	14.37:g.74428017C>A	ENSP00000333946:p.Leu345Met		B7Z3K8|Q53GG6|Q86U30|Q96CA1|Q96CK2	Missense_Mutation	SNP	pfam_mOase_FAD-bd,prints_Rng_hydrolase-like,tigrfam_UbQ_biosynth_mOase,tigrfam_Ubi_Hdrxlases	p.L345M	ENST00000334571.2	37	c.1033	CCDS9823.1	14	.	.	.	.	.	.	.	.	.	.	C	10.48	1.360744	0.24598	.	.	ENSG00000119723	ENST00000394026;ENST00000555376;ENST00000238709;ENST00000334571;ENST00000557780;ENST00000556299	T;T;T	0.45276	0.9;0.9;0.9	5.33	4.45	0.53987	.	0.254112	0.42294	D	0.000740	T	0.20170	0.0485	N	0.11724	0.165	0.33269	D	0.560748	B;B;B;B	0.12013	0.005;0.002;0.004;0.002	B;B;B;B	0.17098	0.017;0.003;0.01;0.003	T	0.13255	-1.0516	10	0.27785	T	0.31	-0.1683	2.6201	0.04914	0.1361:0.5004:0.2075:0.1559	.	320;345;270;270	B7Z3K8;Q9Y2Z9;G3XA86;Q86U30	.;COQ6_HUMAN;.;.	M	320;270;270;345;33;33	ENSP00000377594:L320M;ENSP00000238709:L270M;ENSP00000333946:L345M	ENSP00000238709:L270M	L	+	1	2	COQ6	73497770	0.119000	0.22226	0.823000	0.32752	0.977000	0.68977	0.694000	0.25512	1.481000	0.48307	0.655000	0.94253	CTG	COQ6	-	tigrfam_UbQ_biosynth_mOase,tigrfam_Ubi_Hdrxlases	ENSG00000119723		0.582	COQ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ6	HGNC	protein_coding	OTTHUMT00000412616.1	221	0.45	1	C			74428017	74428017	+1	no_errors	ENST00000334571	ensembl	human	known	69_37n	missense	145	21.20	39	SNP	0.346	A
CPQ	10404	genome.wustl.edu	37	8	98155248	98155248	+	Splice_Site	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr8:98155248G>A	ENST00000220763.5	+	8	1466	c.1256G>A	c.(1255-1257)gGa>gAa	p.G419E	KB-1958F4.1_ENST00000602771.1_RNA	NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	419					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										TTATCCCCAGGAGCCAGTCTA	0.438																																						dbGAP											0													94.0	91.0	92.0					8																	98155248		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.1256-1G>A	8.37:g.98155248G>A			B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	pfam_Peptidase_M28,pfam_Peptidase_M20	p.G419E	ENST00000220763.5	37	c.1256	CCDS6273.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.6|24.6	4.553476|4.553476	0.86127|0.86127	.|.	.|.	ENSG00000104324|ENSG00000104324	ENST00000522617|ENST00000220763	.|T	.|0.54071	.|0.59	5.8|5.8	5.8|5.8	0.92144|0.92144	.|Peptidase M28 (1);	.|0.064589	.|0.64402	.|D	.|0.000011	T|T	0.77110|0.77110	0.4082|0.4082	M|M	0.87547|0.87547	2.89|2.89	0.80722|0.80722	D|D	1|1	.|D	.|0.63046	.|0.992	.|D	.|0.71414	.|0.973	T|T	0.78912|0.78912	-0.2017|-0.2017	5|9	.|.	.|.	.|.	.|.	19.1066|19.1066	0.93299|0.93299	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|419	.|Q9Y646	.|PGCP_HUMAN	K|E	77|419	.|ENSP00000220763:G419E	.|.	E|G	+|+	1|2	0|0	AC010859.1|AC010859.1	98224424|98224424	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.800000|0.800000	0.45204|0.45204	8.465000|8.465000	0.90383|0.90383	2.775000|2.775000	0.95449|0.95449	0.650000|0.650000	0.86243|0.86243	GAG|GGA	CPQ	-	pfam_Peptidase_M28	ENSG00000104324		0.438	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPQ	HGNC	protein_coding	OTTHUMT00000379757.2	247	0.00	0	G	NM_016134	Missense_Mutation	98155248	98155248	+1	no_errors	ENST00000220763	ensembl	human	known	69_37n	missense	281	19.02	66	SNP	1.000	A
CREBRF	153222	genome.wustl.edu	37	5	172550082	172550082	+	Splice_Site	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr5:172550082G>A	ENST00000296953.2	+	8	2000		c.e8-1		CREBRF_ENST00000540014.1_Splice_Site	NM_153607.2	NP_705835.2	Q8IUR6	CRERF_HUMAN	CREB3 regulatory factor						negative regulation of endoplasmic reticulum unfolded protein response (GO:1900102)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular transport (GO:0032388)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein transport (GO:0051222)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CTGTCTTACAGATAATTTATT	0.353																																						dbGAP											0													77.0	87.0	84.0					5																	172550082		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AY139008	CCDS34293.1, CCDS54948.1	5q35.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164463	ENSG00000164463			24050	protein-coding gene	gene with protein product	"""luman/CREB3 recruitment factor"""		"""chromosome 5 open reading frame 41"""	C5orf41		18391022	Standard	NM_153607		Approved	LRF	uc003mch.3	Q8IUR6	OTTHUMG00000163322	ENST00000296953.2:c.1682-1G>A	5.37:g.172550082G>A			B3DFH2|B3KW49|D3DQM2|F5GXN3|Q5HYG4|Q5HYK0|Q86YR3|Q8IZG1	Splice_Site	SNP	-	e8-1	ENST00000296953.2	37	c.1688-1	CCDS34293.1	5	.	.	.	.	.	.	.	.	.	.	G	23.1	4.370074	0.82573	.	.	ENSG00000164463	ENST00000296953;ENST00000540014;ENST00000538538;ENST00000393776	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9074	0.92467	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C5orf41	172482688	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.995000	0.76257	2.650000	0.89964	0.655000	0.94253	.	CREBRF	-	-	ENSG00000164463		0.353	CREBRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBRF	HGNC	protein_coding	OTTHUMT00000372667.1	166	0.00	0	G	NM_153607	Intron	172550082	172550082	+1	no_errors	ENST00000540014	ensembl	human	known	69_37n	splice_site	105	23.36	32	SNP	1.000	A
CRHR2	1395	genome.wustl.edu	37	7	30706918	30706918	+	Missense_Mutation	SNP	G	G	C	rs141646899		TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr7:30706918G>C	ENST00000471646.1	-	3	658	c.241C>G	c.(241-243)Cga>Gga	p.R81G	CRHR2_ENST00000506074.2_Missense_Mutation_p.R81G|CRHR2_ENST00000348438.4_Missense_Mutation_p.R108G|CRHR2_ENST00000341843.4_Missense_Mutation_p.R67G	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	81					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AAGCATTCTCGATAGGCATTC	0.537																																						dbGAP											0													177.0	137.0	151.0					7																	30706918		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.241C>G	7.37:g.30706918G>C	ENSP00000418722:p.Arg81Gly		B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CRF2_rcpt,prints_GPCR_2_diuretic_rcpt	p.R108G	ENST00000471646.1	37	c.322	CCDS5429.1	7	.	.	.	.	.	.	.	.	.	.	G	17.42	3.385395	0.61956	.	.	ENSG00000106113	ENST00000471646;ENST00000348438;ENST00000341843;ENST00000506074	T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43	5.44	3.56	0.40772	GPCR, family 2, extracellular hormone receptor domain (3);	0.000000	0.85682	D	0.000000	D	0.86556	0.5961	H	0.96576	3.845	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.998;0.993;0.989;0.998	D	0.88852	0.3320	10	0.87932	D	0	.	11.7687	0.51945	0.0:0.0:0.5215:0.4785	.	81;81;108;67;81	B3SXT0;B3SXS6;Q13324-2;Q13324-3;Q13324	.;.;.;.;CRFR2_HUMAN	G	81;108;67;81	ENSP00000418722:R81G;ENSP00000340943:R108G;ENSP00000344304:R67G;ENSP00000426498:R81G	ENSP00000344304:R67G	R	-	1	2	CRHR2	30673443	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	2.454000	0.44979	0.724000	0.32296	0.561000	0.74099	CGA	CRHR2	-	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_diuretic_rcpt	ENSG00000106113		0.537	CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CRHR2	HGNC	protein_coding	OTTHUMT00000250448.3	277	0.00	0	G			30706918	30706918	-1	no_errors	ENST00000348438	ensembl	human	known	69_37n	missense	199	37.03	117	SNP	1.000	C
CTNND1	1500	genome.wustl.edu	37	11	57563948	57563948	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:57563948C>G	ENST00000399050.4	+	6	976	c.440C>G	c.(439-441)aCt>aGt	p.T147S	CTNND1_ENST00000426142.2_Missense_Mutation_p.T46S|CTNND1_ENST00000532787.1_Missense_Mutation_p.T46S|CTNND1_ENST00000525902.1_Intron|CTNND1_ENST00000358694.6_Missense_Mutation_p.T147S|CTNND1_ENST00000529919.1_Missense_Mutation_p.T147S|CTNND1_ENST00000532844.1_Missense_Mutation_p.T93S|CTNND1_ENST00000534579.1_Missense_Mutation_p.T93S|CTNND1_ENST00000529526.1_Missense_Mutation_p.T93S|CTNND1_ENST00000526772.1_Intron|CTNND1_ENST00000361332.4_Missense_Mutation_p.T147S|CTNND1_ENST00000524630.1_Missense_Mutation_p.T147S|CTNND1_ENST00000532245.1_Missense_Mutation_p.T46S|CTNND1_ENST00000428599.2_Missense_Mutation_p.T147S|CTNND1_ENST00000361796.4_Missense_Mutation_p.T147S|CTNND1_ENST00000527467.1_Intron|CTNND1_ENST00000530094.1_Missense_Mutation_p.T46S|CTNND1_ENST00000526938.1_Missense_Mutation_p.T147S|CTNND1_ENST00000528621.1_Missense_Mutation_p.T93S|CTNND1_ENST00000526357.1_Missense_Mutation_p.T93S|CTNND1_ENST00000532463.1_Missense_Mutation_p.T46S|CTNND1_ENST00000399039.4_Missense_Mutation_p.T147S|CTNND1_ENST00000360682.6_Missense_Mutation_p.T147S|CTNND1_ENST00000533667.1_Intron|CTNND1_ENST00000415361.2_Missense_Mutation_p.T46S|CTNND1_ENST00000529986.1_Missense_Mutation_p.T46S|CTNND1_ENST00000532649.1_Missense_Mutation_p.T93S|CTNND1_ENST00000529873.1_Missense_Mutation_p.T93S|CTNND1_ENST00000530748.1_Missense_Mutation_p.T93S|CTNND1_ENST00000531014.1_Intron|CTNND1_ENST00000361391.6_Missense_Mutation_p.T147S|CTNND1_ENST00000528232.1_Missense_Mutation_p.T46S	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	147					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				GTAGTGAAGACTGTGACAACA	0.403																																						dbGAP											0													52.0	53.0	53.0					11																	57563948		1937	4160	6097	-	-	-	SO:0001583	missense	0			AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.440C>G	11.37:g.57563948C>G	ENSP00000382004:p.Thr147Ser		A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.T147S	ENST00000399050.4	37	c.440	CCDS44604.1	11	.	.	.	.	.	.	.	.	.	.	C	24.6	4.552633	0.86127	.	.	ENSG00000198561	ENST00000524630;ENST00000529919;ENST00000399039;ENST00000360682;ENST00000361796;ENST00000529526;ENST00000426142;ENST00000399050;ENST00000361391;ENST00000361332;ENST00000532463;ENST00000529986;ENST00000358694;ENST00000532787;ENST00000532649;ENST00000528621;ENST00000530748;ENST00000428599;ENST00000528232;ENST00000529873;ENST00000532844;ENST00000526357;ENST00000530094;ENST00000415361;ENST00000532245;ENST00000534579;ENST00000526938;ENST00000530068;ENST00000534647	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.80033	1.52;1.52;1.52;1.52;1.52;-1.0;-0.87;1.52;1.52;1.52;-0.87;-0.87;1.52;-1.18;-1.0;-1.0;-1.01;1.52;-0.88;-1.33;-1.05;-1.04;-0.99;-0.99;-0.87;-1.0;1.52;1.52;1.36	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.88358	0.6415	L	0.59436	1.845	0.48236	D	0.999615	D;D;D;D;D;D;D;D	0.69078	0.996;0.996;0.993;0.996;0.996;0.997;0.996;0.993	D;D;D;D;D;D;D;D	0.73380	0.98;0.98;0.956;0.98;0.98;0.96;0.98;0.956	D	0.85152	0.0987	10	0.35671	T	0.21	0.0464	20.4745	0.99168	0.0:1.0:0.0:0.0	.	147;147;147;93;93;147;147;147	O60716-3;O60716-2;O60716;O60716-14;O60716-10;O60716-5;F8WA43;C9JZR2	.;.;CTND1_HUMAN;.;.;.;.;.	S	147;147;147;147;147;93;46;147;147;147;46;46;147;46;93;93;93;147;46;93;93;93;46;46;46;93;147;93;69	ENSP00000436543:T147S;ENSP00000434808:T147S;ENSP00000381996:T147S;ENSP00000353902:T147S;ENSP00000354907:T147S;ENSP00000436323:T93S;ENSP00000409930:T46S;ENSP00000382004:T147S;ENSP00000354785:T147S;ENSP00000354823:T147S;ENSP00000432075:T46S;ENSP00000437156:T46S;ENSP00000351527:T147S;ENSP00000434949:T46S;ENSP00000435379:T93S;ENSP00000432243:T93S;ENSP00000436744:T93S;ENSP00000413586:T147S;ENSP00000435266:T46S;ENSP00000435494:T93S;ENSP00000433276:T93S;ENSP00000433334:T93S;ENSP00000437327:T46S;ENSP00000403518:T46S;ENSP00000434017:T46S;ENSP00000435789:T93S;ENSP00000432041:T147S;ENSP00000431600:T93S;ENSP00000434202:T69S	ENSP00000351527:T147S	T	+	2	0	CTNND1	57320524	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.378000	0.79679	2.941000	0.99782	0.655000	0.94253	ACT	CTNND1	-	NULL	ENSG00000198561		0.403	CTNND1-006	KNOWN	basic|CCDS	protein_coding	CTNND1	HGNC	protein_coding	OTTHUMT00000393944.1	85	0.00	0	C	NM_001331		57563948	57563948	+1	no_errors	ENST00000399050	ensembl	human	known	69_37n	missense	78	18.75	18	SNP	0.999	G
CYP11B2	1585	genome.wustl.edu	37	8	143993476	143993476	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr8:143993476G>C	ENST00000323110.2	-	9	1434	c.1432C>G	c.(1432-1434)Caa>Gaa	p.Q478E		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	478					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	ATGTCCTCTTGAGTTAGTGTC	0.552									Familial Hyperaldosteronism type I																													dbGAP											0													193.0	159.0	170.0					8																	143993476		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1432C>G	8.37:g.143993476G>C	ENSP00000325822:p.Gln478Glu		B0ZBE4|Q16726	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.Q478E	ENST00000323110.2	37	c.1432	CCDS6393.1	8	.	.	.	.	.	.	.	.	.	.	G	6.338	0.430410	0.12045	.	.	ENSG00000179142	ENST00000323110	T	0.66638	-0.22	3.03	0.95	0.19572	.	0.713789	0.12031	N	0.505939	T	0.49098	0.1537	L	0.41632	1.29	0.09310	N	1	B	0.21821	0.061	B	0.25759	0.063	T	0.37842	-0.9688	10	0.02654	T	1	.	7.1558	0.25637	0.0:0.0:0.5148:0.4852	.	478	P19099	C11B2_HUMAN	E	478	ENSP00000325822:Q478E	ENSP00000325822:Q478E	Q	-	1	0	CYP11B2	143990478	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	0.026000	0.13599	0.607000	0.29982	-0.217000	0.12591	CAA	CYP11B2	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000179142		0.552	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B2	HGNC	protein_coding	OTTHUMT00000359904.1	381	0.00	0	G			143993476	143993476	-1	no_errors	ENST00000323110	ensembl	human	known	69_37n	missense	318	49.20	309	SNP	0.001	C
DCAF8L2	347442	genome.wustl.edu	37	X	27765804	27765804	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chrX:27765804G>A	ENST00000451261.2	+	5	1191	c.792G>A	c.(790-792)ctG>ctA	p.L264L		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	264										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						GGCCAGTACTGAACTTTGAAA	0.527																																						dbGAP											0													176.0	134.0	147.0					X																	27765804		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.792G>A	X.37:g.27765804G>A			B2RXH9|J3KT06	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L264	ENST00000451261.2	37	c.792	CCDS59162.1	X																																																																																			DCAF8L2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000189186		0.527	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	HGNC	protein_coding	OTTHUMT00000056143.4	208	0.00	0	G	XM_293354		27765804	27765804	+1	no_errors	ENST00000451261	ensembl	human	known	69_37n	silent	196	10.45	23	SNP	0.053	A
DMD	1756	genome.wustl.edu	37	X	32429984	32429984	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chrX:32429984T>C	ENST00000357033.4	-	30	4324	c.4118A>G	c.(4117-4119)cAg>cGg	p.Q1373R	DMD_ENST00000378677.2_Missense_Mutation_p.Q1369R	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1373					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTCAGTCTCCTGGGCAGACTG	0.418																																						dbGAP											0													110.0	87.0	95.0					X																	32429984		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.4118A>G	X.37:g.32429984T>C	ENSP00000354923:p.Gln1373Arg		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.Q1373R	ENST00000357033.4	37	c.4118	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	T	10.10	1.256649	0.22965	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.20738	2.05;2.05	5.68	5.68	0.88126	.	0.000000	0.33712	U	0.004638	T	0.18341	0.0440	L	0.46614	1.455	0.80722	D	1	P;P;B;B;B	0.36535	0.557;0.476;0.421;0.18;0.18	B;B;B;B;B	0.36845	0.234;0.122;0.118;0.06;0.06	T	0.02307	-1.1179	10	0.05351	T	0.99	.	14.9143	0.70781	0.0:0.0:0.0:1.0	.	1365;1373;1369;32;29	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	R	1365;32;29;1369;1373;1373;1250	ENSP00000367948:Q1369R;ENSP00000354923:Q1373R	ENSP00000354923:Q1373R	Q	-	2	0	DMD	32339905	1.000000	0.71417	0.995000	0.50966	0.963000	0.63663	6.522000	0.73783	1.904000	0.55121	0.412000	0.27726	CAG	DMD	-	pirsf_Dystrophin/utrophin	ENSG00000198947		0.418	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	299	0.00	0	T	NM_004006		32429984	32429984	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	missense	251	22.70	74	SNP	1.000	C
DNAH1	25981	genome.wustl.edu	37	3	52430733	52430733	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr3:52430733G>C	ENST00000420323.2	+	72	11791	c.11530G>C	c.(11530-11532)Gag>Cag	p.E3844Q		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3909	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CATCCCCTATGAGTTCACGGA	0.557																																						dbGAP											0													137.0	137.0	137.0					3																	52430733		2005	4181	6186	-	-	-	SO:0001583	missense	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.11530G>C	3.37:g.52430733G>C	ENSP00000401514:p.Glu3844Gln		B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA	p.E3844Q	ENST00000420323.2	37	c.11530	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	G	23.0	4.367290	0.82463	.	.	ENSG00000114841	ENST00000420323;ENST00000273600	T	0.11712	2.75	4.49	4.49	0.54785	.	0.000000	0.64402	D	0.000002	T	0.40067	0.1102	M	0.89095	3.005	0.58432	D	0.999999	D;D	0.71674	0.986;0.998	D;D	0.80764	0.93;0.994	T	0.48139	-0.9061	10	0.51188	T	0.08	.	17.3681	0.87369	0.0:0.0:1.0:0.0	.	3844;3909	C9JXH6;Q9P2D7-2	.;.	Q	3844;597	ENSP00000401514:E3844Q	ENSP00000273600:E597Q	E	+	1	0	DNAH1	52405773	1.000000	0.71417	0.996000	0.52242	0.937000	0.57800	9.511000	0.98006	2.326000	0.78906	0.591000	0.81541	GAG	DNAH1	-	pfam_Dynein_heavy	ENSG00000114841		0.557	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	153	0.00	0	G	NM_015512		52430733	52430733	+1	no_errors	ENST00000420323	ensembl	human	known	69_37n	missense	114	10.94	14	SNP	1.000	C
DNAH9	1770	genome.wustl.edu	37	17	11543625	11543625	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:11543625G>A	ENST00000262442.4	+	10	1893	c.1825G>A	c.(1825-1827)Ggc>Agc	p.G609S	DNAH9_ENST00000454412.2_Missense_Mutation_p.G609S	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	609	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CACCGTGGCTGGCGGCCTCCG	0.597																																						dbGAP											0													120.0	116.0	117.0					17																	11543625		2203	4300	6503	-	-	-	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.1825G>A	17.37:g.11543625G>A	ENSP00000262442:p.Gly609Ser		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.G609S	ENST00000262442.4	37	c.1825	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	G	23.7	4.448884	0.84101	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	T;T	0.70164	-0.46;-0.46	5.27	5.27	0.74061	Dynein heavy chain, domain-1 (1);	0.200328	0.42821	D	0.000658	D	0.82674	0.5088	M	0.84082	2.675	0.80722	D	1	D	0.71674	0.998	D	0.71870	0.975	D	0.85012	0.0906	10	0.62326	D	0.03	.	16.649	0.85184	0.0:0.0:1.0:0.0	.	609	Q9NYC9	DYH9_HUMAN	S	609	ENSP00000262442:G609S;ENSP00000414874:G609S	ENSP00000262442:G609S	G	+	1	0	DNAH9	11484350	1.000000	0.71417	0.920000	0.36463	0.615000	0.37417	7.131000	0.77243	2.465000	0.83290	0.557000	0.71058	GGC	DNAH9	-	pfam_Dynein_heavy_dom-1	ENSG00000007174		0.597	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	98	0.00	0	G	NM_001372		11543625	11543625	+1	no_errors	ENST00000262442	ensembl	human	known	69_37n	missense	33	54.17	39	SNP	0.989	A
DNAJC28	54943	genome.wustl.edu	37	21	34861131	34861131	+	Missense_Mutation	SNP	C	C	G	rs527606897	byFrequency	TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr21:34861131C>G	ENST00000314399.3	-	2	1008	c.570G>C	c.(568-570)caG>caC	p.Q190H	DNAJC28_ENST00000381947.3_Missense_Mutation_p.Q190H|DNAJC28_ENST00000402202.1_Missense_Mutation_p.Q190H	NM_017833.3	NP_060303.2	Q9NX36	DJC28_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 28	190										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(5)|skin(1)|urinary_tract(1)	18						GCTGTTTGCTCTGTCTTATAT	0.393																																						dbGAP											0													162.0	154.0	157.0					21																	34861131		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000468	CCDS13626.1	21q22.11	2011-09-02	2008-06-17	2008-06-17	ENSG00000177692	ENSG00000177692		"""Heat shock proteins / DNAJ (HSP40)"""	1297	protein-coding gene	gene with protein product	"""Orf28"""		"""chromosome 21 open reading frame 55"""	C21orf55			Standard	NM_017833		Approved	C21orf78	uc002yrw.3	Q9NX36	OTTHUMG00000065531	ENST00000314399.3:c.570G>C	21.37:g.34861131C>G	ENSP00000320303:p.Gln190His		D3DSF2	Missense_Mutation	SNP	pfam_DnaJ_homolog_subfam-C_membr-28,pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N	p.Q190H	ENST00000314399.3	37	c.570	CCDS13626.1	21	.	.	.	.	.	.	.	.	.	.	C	3.359	-0.130789	0.06753	.	.	ENSG00000177692	ENST00000381947;ENST00000314399;ENST00000402202	.	.	.	5.38	-0.499	0.12015	.	0.119175	0.56097	N	0.000029	T	0.31857	0.0810	L	0.43646	1.37	0.30132	N	0.8047	B	0.14012	0.009	B	0.14023	0.01	T	0.12041	-1.0563	9	0.32370	T	0.25	-0.1799	5.4423	0.16515	0.1124:0.2857:0.4859:0.116	.	190	Q9NX36	DJC28_HUMAN	H	190	.	ENSP00000320303:Q190H	Q	-	3	2	DNAJC28	33783001	0.997000	0.39634	0.331000	0.25455	0.315000	0.28087	0.497000	0.22514	-0.013000	0.14199	-0.165000	0.13383	CAG	DNAJC28	-	NULL	ENSG00000177692		0.393	DNAJC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC28	HGNC	protein_coding	OTTHUMT00000140454.3	408	0.00	0	C			34861131	34861131	-1	no_errors	ENST00000314399	ensembl	human	known	69_37n	missense	389	23.68	121	SNP	0.993	G
DRG1	4733	genome.wustl.edu	37	22	31819322	31819322	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr22:31819322G>C	ENST00000331457.4	+	6	800	c.639G>C	c.(637-639)aaG>aaC	p.K213N	DRG1_ENST00000433341.1_3'UTR	NM_004147.3	NP_004138.1	Q9Y295	DRG1_HUMAN	developmentally regulated GTP binding protein 1	213	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|polysome (GO:0005844)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|urinary_tract(1)	11						CTGAATACAAGATTCATAATG	0.453																																						dbGAP											0													151.0	121.0	131.0					22																	31819322		2203	4297	6500	-	-	-	SO:0001583	missense	0			AJ005940	CCDS13897.1	22q12.2	2010-02-26	2001-11-28		ENSG00000185721	ENSG00000185721			3029	protein-coding gene	gene with protein product		603952	"""developmentally regulated GTP-binding protein 1"""	NEDD3		7929244, 1449490	Standard	NM_004147		Approved		uc003aku.3	Q9Y295	OTTHUMG00000030792	ENST00000331457.4:c.639G>C	22.37:g.31819322G>C	ENSP00000329715:p.Lys213Asn		B2RDS8|Q6FGP8|Q8WW69|Q9UGF2	Missense_Mutation	SNP	pfam_TGS,pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,superfamily_TGS-like,prints_GTP_binding_domain,tigrfam_Small_GTP-bd_dom	p.K213N	ENST00000331457.4	37	c.639	CCDS13897.1	22	.	.	.	.	.	.	.	.	.	.	G	18.92	3.726503	0.69074	.	.	ENSG00000185721	ENST00000331457	T	0.34472	1.36	5.2	0.477	0.16784	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.59715	0.2214	M	0.90425	3.115	0.58432	D	0.999999	D	0.53745	0.962	D	0.65010	0.931	T	0.61222	-0.7106	10	0.87932	D	0	-7.6575	9.244	0.37513	0.6022:0.0:0.3978:0.0	.	213	Q9Y295	DRG1_HUMAN	N	213	ENSP00000329715:K213N	ENSP00000329715:K213N	K	+	3	2	DRG1	30149322	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	2.213000	0.42844	-0.182000	0.10602	-0.471000	0.05019	AAG	DRG1	-	tigrfam_Small_GTP-bd_dom	ENSG00000185721		0.453	DRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRG1	HGNC	protein_coding	OTTHUMT00000075680.5	198	0.00	0	G	NM_004147		31819322	31819322	+1	no_errors	ENST00000331457	ensembl	human	known	69_37n	missense	70	57.32	94	SNP	1.000	C
DSCAM	1826	genome.wustl.edu	37	21	42064818	42064818	+	Silent	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr21:42064818G>C	ENST00000400454.1	-	3	903	c.426C>G	c.(424-426)gtC>gtG	p.V142V		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	142	Ig-like C2-type 2.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.V142V(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TGCACTTGAAGACCGCAACAT	0.522																																					Melanoma(134;970 1778 1785 21664 32388)	dbGAP											1	Substitution - coding silent(1)	lung(1)											153.0	147.0	149.0					21																	42064818		2029	4175	6204	-	-	-	SO:0001819	synonymous_variant	0			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.426C>G	21.37:g.42064818G>C			O60468	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V142	ENST00000400454.1	37	c.426	CCDS42929.1	21																																																																																			DSCAM	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000171587		0.522	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1	182	0.00	0	G	NM_001389		42064818	42064818	-1	no_errors	ENST00000400454	ensembl	human	known	69_37n	silent	235	12.96	35	SNP	1.000	C
ECHDC3	79746	genome.wustl.edu	37	10	11791544	11791544	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr10:11791544G>C	ENST00000379215.4	+	3	554	c.343G>C	c.(343-345)Gag>Cag	p.E115Q	ECHDC3_ENST00000496136.1_3'UTR	NM_024693.4	NP_078969	Q96DC8	ECHD3_HUMAN	enoyl CoA hydratase domain containing 3	115						mitochondrion (GO:0005739)	catalytic activity (GO:0003824)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)	4						GCTGACAGAGGAGCAAGGCCG	0.438																																						dbGAP											0													142.0	129.0	133.0					10																	11791544		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF275677	CCDS7084.1	10p14	2010-04-30	2010-04-30		ENSG00000134463	ENSG00000134463			23489	protein-coding gene	gene with protein product			"""enoyl Coenzyme A hydratase domain containing 3"""			12477932	Standard	NM_024693		Approved	FLJ20909	uc001ikw.4	Q96DC8	OTTHUMG00000017675	ENST00000379215.4:c.343G>C	10.37:g.11791544G>C	ENSP00000368517:p.Glu115Gln		Q53HR9|Q5W0J7|Q8WYY8|Q9BVL8|Q9H7G4	Missense_Mutation	SNP	pfam_Crotonase_core	p.E115Q	ENST00000379215.4	37	c.343	CCDS7084.1	10	.	.	.	.	.	.	.	.	.	.	G	6.560	0.471537	0.12461	.	.	ENSG00000134463	ENST00000379215;ENST00000420401;ENST00000422887	T;T;T	0.68624	-0.34;-0.34;-0.34	5.17	5.17	0.71159	Crotonase, core (1);	0.754405	0.12810	N	0.437265	T	0.60932	0.2307	L	0.47190	1.495	0.09310	N	0.999998	B	0.02656	0.0	B	0.09377	0.004	T	0.47459	-0.9116	10	0.24483	T	0.36	.	14.9175	0.70810	0.0:0.1435:0.8565:0.0	.	115	Q96DC8	ECHD3_HUMAN	Q	115;168;42	ENSP00000368517:E115Q;ENSP00000405584:E168Q;ENSP00000398429:E42Q	ENSP00000368517:E115Q	E	+	1	0	ECHDC3	11831550	0.864000	0.29904	0.103000	0.21229	0.085000	0.17905	2.065000	0.41442	2.406000	0.81754	0.579000	0.79373	GAG	ECHDC3	-	pfam_Crotonase_core	ENSG00000134463		0.438	ECHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECHDC3	HGNC	protein_coding	OTTHUMT00000046771.1	316	0.00	0	G	NM_024693		11791544	11791544	+1	no_errors	ENST00000379215	ensembl	human	known	69_37n	missense	385	10.85	47	SNP	0.244	C
EFEMP1	2202	genome.wustl.edu	37	2	56094242	56094242	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:56094242C>G	ENST00000394555.2	-	11	1883	c.1448G>C	c.(1447-1449)aGa>aCa	p.R483T	EFEMP1_ENST00000424836.2_Missense_Mutation_p.R345T|EFEMP1_ENST00000355426.3_Missense_Mutation_p.R483T|EFEMP1_ENST00000394554.1_Missense_Mutation_p.R483T	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	483	Mediates interaction with TIMP3.				epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)			NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TATTGTCAATCTTAACACAGA	0.418																																					GBM(92;934 1319 7714 28760 40110)	dbGAP											0													134.0	122.0	126.0					2																	56094242		2203	4300	6503	-	-	-	SO:0001583	missense	0			U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.1448G>C	2.37:g.56094242C>G	ENSP00000378058:p.Arg483Thr		A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	p.R483T	ENST00000394555.2	37	c.1448	CCDS1857.1	2	.	.	.	.	.	.	.	.	.	.	C	23.2	4.382968	0.82792	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000405693;ENST00000424836;ENST00000355426	D;D;T;D	0.84589	-1.87;-1.87;-1.33;-1.87	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000003	D	0.91788	0.7402	M	0.69358	2.11	0.58432	D	0.999998	D;D	0.76494	0.995;0.999	D;D	0.81914	0.972;0.995	D	0.92124	0.5706	10	0.66056	D	0.02	.	19.2437	0.93893	0.0:1.0:0.0:0.0	.	345;483	B4DW75;Q12805	.;FBLN3_HUMAN	T	483;483;339;345;483	ENSP00000378058:R483T;ENSP00000378057:R483T;ENSP00000399145:R345T;ENSP00000347596:R483T	ENSP00000347596:R483T	R	-	2	0	EFEMP1	55947746	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.228000	0.78079	2.623000	0.88846	0.585000	0.79938	AGA	EFEMP1	-	NULL	ENSG00000115380		0.418	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFEMP1	HGNC	protein_coding	OTTHUMT00000251491.2	272	0.00	0	C			56094242	56094242	-1	no_errors	ENST00000355426	ensembl	human	known	69_37n	missense	205	32.68	100	SNP	1.000	G
AGO3	192669	genome.wustl.edu	37	1	36479639	36479639	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:36479639G>C	ENST00000373191.4	+	11	1745	c.1396G>C	c.(1396-1398)Gaa>Caa	p.E466Q	RP4-665N4.8_ENST00000479395.2_RNA|RP4-665N4.8_ENST00000466576.2_RNA|AGO3_ENST00000246314.6_Missense_Mutation_p.E232Q	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	466					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										GTGCAGAGAAGAAATATTGAA	0.393																																						dbGAP											0													156.0	151.0	153.0					1																	36479639		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.1396G>C	1.37:g.36479639G>C	ENSP00000362287:p.Glu466Gln		B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.E466Q	ENST00000373191.4	37	c.1396	CCDS399.1	1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.244556	0.59103	.	.	ENSG00000126070	ENST00000373191;ENST00000246314	T;T	0.08193	3.12;3.12	5.65	5.65	0.86999	.	0.097704	0.64402	D	0.000001	T	0.06142	0.0159	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.47548	-0.9109	10	0.25751	T	0.34	-12.6055	19.7916	0.96461	0.0:0.0:1.0:0.0	.	466	Q9H9G7	AGO3_HUMAN	Q	466;232	ENSP00000362287:E466Q;ENSP00000246314:E232Q	ENSP00000246314:E232Q	E	+	1	0	EIF2C3	36252226	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.858000	0.99539	2.685000	0.91497	0.650000	0.86243	GAA	EIF2C3	-	NULL	ENSG00000126070		0.393	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C3	HGNC	protein_coding	OTTHUMT00000019831.4	287	0.00	0	G	NM_024852		36479639	36479639	+1	no_errors	ENST00000373191	ensembl	human	known	69_37n	missense	115	50.22	116	SNP	1.000	C
ELAC2	60528	genome.wustl.edu	37	17	12897061	12897061	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:12897061G>A	ENST00000338034.4	-	23	2435	c.2196C>T	c.(2194-2196)gtC>gtT	p.V732V	ELAC2_ENST00000395962.2_Silent_p.V713V|ELAC2_ENST00000426905.3_Silent_p.V692V	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	732					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						TGAAGAGGGGGACCTTGGCAT	0.587																																						dbGAP											0													181.0	131.0	148.0					17																	12897061		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.2196C>T	17.37:g.12897061G>A			B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Missense_Mutation	SNP	pfam_Beta-lactamas-like	p.S532F	ENST00000338034.4	37	c.1595	CCDS11164.1	17																																																																																			ELAC2	-	NULL	ENSG00000006744		0.587	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELAC2	HGNC	protein_coding	OTTHUMT00000129934.5	205	0.00	0	G			12897061	12897061	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000584650	ensembl	human	novel	69_37n	missense	99	50.99	103	SNP	1.000	A
ELL	8178	genome.wustl.edu	37	19	18562372	18562372	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:18562372G>C	ENST00000262809.4	-	7	1027	c.956C>G	c.(955-957)tCg>tGg	p.S319W	ELL_ENST00000596124.3_Missense_Mutation_p.S186W	NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II	319					gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		CTGTGGGGGCGAGGCCGAGCG	0.652			T	MLL	AL																																	dbGAP		Dom	yes		19	19p13.1	8178	ELL gene (11-19 lysine-rich leukemia gene)		L	0													7.0	7.0	7.0					19																	18562372		1954	3764	5718	-	-	-	SO:0001583	missense	0			U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.956C>G	19.37:g.18562372G>C	ENSP00000262809:p.Ser319Trp			Missense_Mutation	SNP	pfam_RNA_pol_II_elong_fac_ELL,pfam_Occludin_RNApol2_elong_fac_ELL	p.S319W	ENST00000262809.4	37	c.956	CCDS12380.1	19	.	.	.	.	.	.	.	.	.	.	G	18.72	3.683336	0.68157	.	.	ENSG00000105656	ENST00000262809	T	0.28895	1.59	4.26	4.26	0.50523	.	0.633514	0.15311	N	0.269108	T	0.48150	0.1484	M	0.62723	1.935	0.80722	D	1	D;D	0.76494	0.997;0.999	P;P	0.57776	0.827;0.818	T	0.51841	-0.8654	10	0.87932	D	0	-36.007	14.5211	0.67851	0.0:0.0:1.0:0.0	.	263;319	Q59HG4;P55199	.;ELL_HUMAN	W	319	ENSP00000262809:S319W	ENSP00000262809:S319W	S	-	2	0	ELL	18423372	0.998000	0.40836	0.033000	0.17914	0.003000	0.03518	3.517000	0.53443	2.100000	0.63781	0.549000	0.68633	TCG	ELL	-	NULL	ENSG00000105656		0.652	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL	HGNC	protein_coding	OTTHUMT00000466362.1	22	0.00	0	G	NM_006532		18562372	18562372	-1	no_errors	ENST00000262809	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	0.674	C
EPHB4	2050	genome.wustl.edu	37	7	100405049	100405049	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr7:100405049C>G	ENST00000358173.3	-	13	2740	c.2272G>C	c.(2272-2274)Gac>Cac	p.D758H	EPHB4_ENST00000360620.3_Missense_Mutation_p.D758H	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	758	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					AGGCCAAAGTCAGACACTTTG	0.567																																					GBM(200;2113 3072 25865 52728)	dbGAP											0													174.0	135.0	149.0					7																	100405049		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.2272G>C	7.37:g.100405049C>G	ENSP00000350896:p.Asp758His		B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.D758H	ENST00000358173.3	37	c.2272	CCDS5706.1	7	.	.	.	.	.	.	.	.	.	.	C	24.8	4.568566	0.86439	.	.	ENSG00000196411	ENST00000360620;ENST00000358173	D;D	0.88354	-2.37;-2.37	4.65	4.65	0.58169	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.50627	D	0.000105	D	0.96716	0.8928	H	0.98612	4.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.98290	1.0513	10	0.87932	D	0	.	15.0272	0.71680	0.0:1.0:0.0:0.0	.	758;758	Q96L35;P54760	.;EPHB4_HUMAN	H	758	ENSP00000353833:D758H;ENSP00000350896:D758H	ENSP00000350896:D758H	D	-	1	0	EPHB4	100242985	1.000000	0.71417	0.911000	0.35937	0.970000	0.65996	7.818000	0.86416	2.124000	0.65301	0.313000	0.20887	GAC	EPHB4	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000196411		0.567	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB4	HGNC	protein_coding	OTTHUMT00000347222.1	233	0.00	0	C	NM_004444		100405049	100405049	-1	no_errors	ENST00000358173	ensembl	human	known	69_37n	missense	112	42.00	84	SNP	0.999	G
ERC2	26059	genome.wustl.edu	37	3	56026144	56026144	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr3:56026144G>A	ENST00000288221.6	-	11	2451	c.2196C>T	c.(2194-2196)atC>atT	p.I732I		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	732						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		CCTCCTTGAGGATCTCCAGCA	0.468																																						dbGAP											0													197.0	195.0	195.0					3																	56026144		1928	4139	6067	-	-	-	SO:0001819	synonymous_variant	0			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2196C>T	3.37:g.56026144G>A			Q2T9F6|Q86TK4	Missense_Mutation	SNP	pfam_CAZ_cplx_RIM-bd_prot,superfamily_Prefoldin	p.S383F	ENST00000288221.6	37	c.1148	CCDS46851.1	3	.	.	.	.	.	.	.	.	.	.	G	7.235	0.600173	0.13939	.	.	ENSG00000187672	ENST00000492584	.	.	.	5.69	4.83	0.62350	.	.	.	.	.	T	0.59155	0.2173	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57418	-0.7815	4	.	.	.	-12.7318	8.3936	0.32544	0.1362:0.0:0.736:0.1278	.	.	.	.	F	383	.	.	S	-	2	0	ERC2	56001184	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.600000	0.67599	1.426000	0.47256	-0.216000	0.12614	TCC	ERC2	-	pfam_CAZ_cplx_RIM-bd_prot	ENSG00000187672		0.468	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2	345	0.29	1	G	NM_015576		56026144	56026144	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000492584	ensembl	human	known	69_37n	missense	262	13.77	42	SNP	1.000	A
ERMAP	114625	genome.wustl.edu	37	1	43305956	43305956	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:43305956G>A	ENST00000372517.2	+	11	945	c.701G>A	c.(700-702)cGg>cAg	p.R234Q	RP11-342M1.3_ENST00000444563.1_RNA|RP11-342M1.3_ENST00000416809.2_RNA|RP11-342M1.3_ENST00000425076.1_RNA|RP11-342M1.3_ENST00000414798.1_RNA|ERMAP_ENST00000372514.3_Missense_Mutation_p.R234Q|ERMAP_ENST00000328249.3_Missense_Mutation_p.R144Q|ERMAP_ENST00000487556.1_3'UTR	NM_001017922.1	NP_001017922.1	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein (Scianna blood group)	234	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.		Missing (in Sc-3 allele).			cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AGAAGAGCCCGGTTGCATTTT	0.423																																						dbGAP											0													136.0	132.0	133.0					1																	43305956		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF311284	CCDS475.1	1p34	2014-07-19	2006-02-23		ENSG00000164010	ENSG00000164010		"""Blood group antigens"", ""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	15743	protein-coding gene	gene with protein product		609017	"""Radin blood group"", ""Scianna blood group"", ""erythroblast membrane-associated protein"", ""erythroblast membrane-associated protein (RD and SC blood groups)"""	RD, SC		11549310	Standard	XM_005270415		Approved	BTN5	uc001cie.1	Q96PL5	OTTHUMG00000007619	ENST00000372517.2:c.701G>A	1.37:g.43305956G>A	ENSP00000361595:p.Arg234Gln		D3DPW8|Q5VV53|Q6DUE0|Q7Z3X0|Q8NCV8|Q8NCW2|Q8NCW3|Q96PL6	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like,prints_Butyrophylin	p.R234Q	ENST00000372517.2	37	c.701	CCDS475.1	1	.	.	.	.	.	.	.	.	.	.	G	10.85	1.466938	0.26335	.	.	ENSG00000164010	ENST00000372517;ENST00000372514;ENST00000328249	T;T;T	0.60920	0.15;0.15;0.15	5.53	2.6	0.31112	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.393276	0.20622	N	0.088756	T	0.26774	0.0655	N	0.02765	-0.5	0.25454	N	0.987979	B	0.16166	0.016	B	0.06405	0.002	T	0.17868	-1.0355	10	0.13470	T	0.59	.	8.1842	0.31328	0.2585:0.0:0.7415:0.0	.	234	Q96PL5	ERMAP_HUMAN	Q	234;234;144	ENSP00000361595:R234Q;ENSP00000361592:R234Q;ENSP00000332439:R144Q	ENSP00000332439:R144Q	R	+	2	0	ERMAP	43078543	0.916000	0.31088	0.998000	0.56505	0.859000	0.49053	1.681000	0.37618	0.714000	0.32081	0.456000	0.33151	CGG	ERMAP	-	superfamily_ConA-like_lec_gl,pfscan_B30.2/SPRY	ENSG00000164010		0.423	ERMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERMAP	HGNC	protein_coding	OTTHUMT00000020180.1	472	0.00	0	G	NM_018538		43305956	43305956	+1	no_errors	ENST00000372514	ensembl	human	known	69_37n	missense	329	15.38	60	SNP	0.835	A
ETS1	2113	genome.wustl.edu	37	11	128350168	128350168	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:128350168G>A	ENST00000319397.6	-	6	1218	c.909C>T	c.(907-909)acC>acT	p.T303T	ETS1_ENST00000535549.1_Silent_p.T87T|ETS1_ENST00000392668.4_Silent_p.T347T|ETS1_ENST00000531611.1_Intron|ETS1_ENST00000345075.4_Intron|ETS1_ENST00000526145.2_Intron	NM_005238.3	NP_005229.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1	303					angiogenesis involved in wound healing (GO:0060055)|cell motility (GO:0048870)|cellular response to hydrogen peroxide (GO:0070301)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|pituitary gland development (GO:0021983)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of apoptotic process (GO:0042981)|regulation of extracellular matrix disassembly (GO:0010715)|response to antibiotic (GO:0046677)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to laminar fluid shear stress (GO:0034616)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		AGTCCTTGAAGGTGCCCTTGG	0.592																																						dbGAP											0													137.0	116.0	124.0					11																	128350168		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0				CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954			3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2		1522903	Standard	NM_005238		Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000319397.6:c.909C>T	11.37:g.128350168G>A			A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	Silent	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pirsf_Transforming_factor_C-ets,pfscan_Ets,prints_Ets	p.T347	ENST00000319397.6	37	c.1041	CCDS8475.1	11																																																																																			ETS1	-	pirsf_Transforming_factor_C-ets	ENSG00000134954		0.592	ETS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ETS1	HGNC	protein_coding	OTTHUMT00000386269.2	203	0.00	0	G	NM_005238		128350168	128350168	-1	no_errors	ENST00000392668	ensembl	human	known	69_37n	silent	148	32.11	70	SNP	1.000	A
EXOC3	11336	genome.wustl.edu	37	5	453877	453877	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr5:453877G>C	ENST00000512944.1	+	4	946	c.757G>C	c.(757-759)Gag>Cag	p.E253Q	EXOC3_ENST00000315013.5_Missense_Mutation_p.E253Q	NM_007277.4	NP_009208.2	O60645	EXOC3_HUMAN	exocyst complex component 3	264					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|secretory granule membrane (GO:0030667)				breast(2)|cervix(1)|endometrium(4)|large_intestine(1)|lung(13)|ovary(1)|urinary_tract(1)	23		Ovarian(839;0.0563)	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			CACCATCTTGGAGAGGACTGT	0.483																																						dbGAP											0													75.0	74.0	75.0					5																	453877		1937	4143	6080	-	-	-	SO:0001583	missense	0			BC034427	CCDS54830.1	5p15.33	2013-01-22	2005-11-01	2005-11-01	ENSG00000180104	ENSG00000180104			30378	protein-coding gene	gene with protein product		608186	"""SEC6-like 1 (S. cerevisiae)"""	SEC6L1		8619474	Standard	XM_005248238		Approved	Sec6p	uc003jba.3	O60645	OTTHUMG00000162205	ENST00000512944.1:c.757G>C	5.37:g.453877G>C	ENSP00000425587:p.Glu253Gln		Q6P2E8|Q8TEN6|Q8WUW0|Q96DI4	Missense_Mutation	SNP	pfam_Sec6	p.E253Q	ENST00000512944.1	37	c.757	CCDS54830.1	5	.	.	.	.	.	.	.	.	.	.	G	15.31	2.796274	0.50208	.	.	ENSG00000180104	ENST00000512944;ENST00000315013;ENST00000340158	T;T	0.06768	3.26;3.26	5.45	5.45	0.79879	.	0.242800	0.47852	D	0.000209	T	0.08223	0.0205	N	0.25890	0.77	0.58432	D	0.999999	B	0.14438	0.01	B	0.28638	0.092	T	0.32375	-0.9909	10	0.13108	T	0.6	-21.197	16.7689	0.85532	0.0:0.0:1.0:0.0	.	264	O60645	EXOC3_HUMAN	Q	253;253;263	ENSP00000425587:E253Q;ENSP00000323377:E253Q	ENSP00000323377:E253Q	E	+	1	0	EXOC3	506877	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	9.488000	0.97947	2.572000	0.86782	0.462000	0.41574	GAG	EXOC3	-	pfam_Sec6	ENSG00000180104		0.483	EXOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3	HGNC	protein_coding	OTTHUMT00000367882.1	212	0.00	0	G	NM_007277		453877	453877	+1	no_errors	ENST00000315013	ensembl	human	known	69_37n	missense	182	12.02	25	SNP	1.000	C
EXOC4	60412	genome.wustl.edu	37	7	133160142	133160142	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr7:133160142C>G	ENST00000253861.4	+	8	1272	c.1243C>G	c.(1243-1245)Caa>Gaa	p.Q415E	EXOC4_ENST00000393161.2_Missense_Mutation_p.Q415E|EXOC4_ENST00000539845.1_Missense_Mutation_p.Q314E	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	415					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				ACCATCAGCTCAACTAAGCTA	0.373																																						dbGAP											0													131.0	134.0	133.0					7																	133160142		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.1243C>G	7.37:g.133160142C>G	ENSP00000253861:p.Gln415Glu		E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	pfam_Sec8_exocyst	p.Q415E	ENST00000253861.4	37	c.1243	CCDS5829.1	7	.	.	.	.	.	.	.	.	.	.	C	14.75	2.628504	0.46944	.	.	ENSG00000131558	ENST00000253861;ENST00000393161;ENST00000546185;ENST00000539845	.	.	.	5.34	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.43964	0.1271	L	0.50333	1.59	0.80722	D	1	P;B	0.43231	0.801;0.016	B;B	0.37780	0.258;0.015	T	0.30736	-0.9968	9	0.16896	T	0.51	.	13.6365	0.62225	0.0:0.9244:0.0:0.0756	.	415;415	Q96A65;Q8TAR2	EXOC4_HUMAN;.	E	415;415;34;314	.	ENSP00000253861:Q415E	Q	+	1	0	EXOC4	132810682	1.000000	0.71417	0.930000	0.37139	0.620000	0.37586	7.154000	0.77437	1.249000	0.43950	-0.262000	0.10625	CAA	EXOC4	-	NULL	ENSG00000131558		0.373	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC4	HGNC	protein_coding	OTTHUMT00000339182.1	184	0.00	0	C	NM_021807		133160142	133160142	+1	no_errors	ENST00000253861	ensembl	human	known	69_37n	missense	172	15.27	31	SNP	1.000	G
EXPH5	23086	genome.wustl.edu	37	11	108384923	108384923	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:108384923C>G	ENST00000265843.4	-	6	1421	c.1311G>C	c.(1309-1311)atG>atC	p.M437I	EXPH5_ENST00000428840.1_Missense_Mutation_p.M361I|EXPH5_ENST00000524840.1_5'UTR|EXPH5_ENST00000525344.1_Missense_Mutation_p.M430I|EXPH5_ENST00000443411.1_Missense_Mutation_p.M249I	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	437					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TGTCGGGACTCATTGCATTCT	0.418																																						dbGAP											0													146.0	141.0	143.0					11																	108384923		2201	4298	6499	-	-	-	SO:0001583	missense	0				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.1311G>C	11.37:g.108384923C>G	ENSP00000265843:p.Met437Ile		Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	p.M437I	ENST00000265843.4	37	c.1311	CCDS8341.1	11	.	.	.	.	.	.	.	.	.	.	C	8.362	0.833282	0.16820	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956;ENST00000526312;ENST00000533052	T;T;T;T;T;T	0.03982	4.33;4.26;4.11;4.33;4.18;3.74	5.8	3.89	0.44902	.	0.463445	0.22343	N	0.061304	T	0.05823	0.0152	M	0.67953	2.075	0.18873	N	0.999982	B	0.28933	0.228	B	0.24155	0.051	T	0.31971	-0.9924	10	0.52906	T	0.07	-4.9383	3.6771	0.08297	0.1455:0.5521:0.2101:0.0923	.	437	Q8NEV8	EXPH5_HUMAN	I	437;361;249;430;281;361;249	ENSP00000265843:M437I;ENSP00000391966:M361I;ENSP00000411390:M249I;ENSP00000432546:M430I;ENSP00000432683:M361I;ENSP00000446434:M249I	ENSP00000265843:M437I	M	-	3	0	EXPH5	107890133	0.895000	0.30542	0.971000	0.41717	0.189000	0.23516	0.754000	0.26390	1.456000	0.47831	0.591000	0.81541	ATG	EXPH5	-	NULL	ENSG00000110723		0.418	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXPH5	HGNC	protein_coding	OTTHUMT00000390279.1	242	0.00	0	C	NM_015065		108384923	108384923	-1	no_errors	ENST00000265843	ensembl	human	known	69_37n	missense	90	61.11	143	SNP	0.381	G
EYS	346007	genome.wustl.edu	37	6	64940650	64940650	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:64940650C>A	ENST00000370621.3	-	31	6785	c.6259G>T	c.(6259-6261)Gat>Tat	p.D2087Y	EYS_ENST00000503581.1_Missense_Mutation_p.D2087Y|EYS_ENST00000370616.2_Missense_Mutation_p.D2087Y			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	2087					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CACATGGTATCAACCCCTTGT	0.478																																						dbGAP											0													104.0	99.0	101.0					6																	64940650		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.6259G>T	6.37:g.64940650C>A	ENSP00000359655:p.Asp2087Tyr		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.D2087Y	ENST00000370621.3	37	c.6259		6	.	.	.	.	.	.	.	.	.	.	C	13.88	2.368054	0.42003	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.84370	-1.84;-1.78;-1.78	4.84	3.97	0.46021	.	.	.	.	.	T	0.79227	0.4410	L	0.29908	0.895	0.18873	N	0.999981	D;D	0.58620	0.983;0.971	P;P	0.58873	0.847;0.707	T	0.70475	-0.4861	9	0.59425	D	0.04	.	9.5214	0.39138	0.0:0.9005:0.0:0.0995	.	2087;2087	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	Y	2087	ENSP00000424243:D2087Y;ENSP00000359655:D2087Y;ENSP00000359650:D2087Y	ENSP00000359650:D2087Y	D	-	1	0	EYS	64998609	0.000000	0.05858	0.013000	0.15412	0.014000	0.08584	0.620000	0.24403	2.244000	0.73946	0.650000	0.86243	GAT	EYS	-	NULL	ENSG00000188107		0.478	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	123	0.00	0	C	XM_294050		64940650	64940650	-1	no_errors	ENST00000370616	ensembl	human	known	69_37n	missense	130	13.33	20	SNP	0.004	A
F7	2155	genome.wustl.edu	37	13	113772894	113772894	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr13:113772894G>A	ENST00000375581.3	+	9	1008	c.973G>A	c.(973-975)Gaa>Aaa	p.E325K	F7_ENST00000541084.1_Missense_Mutation_p.E256K|F7_ENST00000346342.3_Missense_Mutation_p.E303K	NM_000131.4	NP_000122.1	P08709	FA7_HUMAN	coagulation factor VII (serum prothrombin conversion accelerator)	325	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		E -> K (in FA7D). {ECO:0000269|PubMed:10862079, ECO:0000269|PubMed:18976247, ECO:0000269|PubMed:8844208}.		blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|cellular protein metabolic process (GO:0044267)|circadian rhythm (GO:0007623)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell migration (GO:0030335)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to growth hormone (GO:0060416)|response to vitamin K (GO:0032571)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	CTGCCTGCCCGAACGGACGTT	0.677																																						dbGAP											0			GRCh37	CM960529	F7	M							71.0	58.0	62.0					13																	113772894		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS9528.1, CCDS9529.1, CCDS73602.1	13q34	2014-02-03			ENSG00000057593	ENSG00000057593	3.4.21.21		3544	protein-coding gene	gene with protein product	"""eptacog alfa"", ""FVII coagulation protein"", ""factor VII"""	613878				3264725, 2511201	Standard	NM_000131		Approved		uc001vsv.4	P08709	OTTHUMG00000017373	ENST00000375581.3:c.973G>A	13.37:g.113772894G>A	ENSP00000364731:p.Glu325Lys		B0YJC8|Q14339|Q5JVF1|Q5JVF2|Q9UD52|Q9UD53|Q9UD54	Missense_Mutation	SNP	pirsf_Pept_S1A_FX,pfam_Peptidase_S1_S6,pfam_GLA_domain,pfam_Peptidase_S1A_nudel,pfam_EGF-like_dom,superfamily_Pept_cys/ser_Trypsin-like,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,prints_GLA_domain,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Peptidase_S1_S6	p.E325K	ENST00000375581.3	37	c.973	CCDS9528.1	13	.	.	.	.	.	.	.	.	.	.	G	12.30	1.897751	0.33535	.	.	ENSG00000057593	ENST00000346342;ENST00000541084;ENST00000375581	D;D;D	0.88818	-2.43;-2.43;-2.43	4.41	3.56	0.40772	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.333184	0.31519	N	0.007506	D	0.86180	0.5871	N	0.11818	0.18	0.09310	N	0.999999	D;D;D	0.89917	0.968;0.999;1.0	P;P;D	0.66979	0.793;0.905;0.948	T	0.76997	-0.2751	10	0.38643	T	0.18	.	8.9172	0.35590	0.0824:0.1496:0.768:0.0	.	256;303;325	F5H8B0;P08709-2;P08709	.;.;FA7_HUMAN	K	303;256;325	ENSP00000329546:E303K;ENSP00000442051:E256K;ENSP00000364731:E325K	ENSP00000329546:E303K	E	+	1	0	F7	112820895	0.907000	0.30839	0.057000	0.19452	0.016000	0.09150	2.884000	0.48562	1.067000	0.40740	0.467000	0.42956	GAA	F7	-	pirsf_Pept_S1A_FX,pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000057593		0.677	F7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	F7	HGNC	protein_coding	OTTHUMT00000045838.4	27	0.00	0	G	NM_000131		113772894	113772894	+1	no_errors	ENST00000375581	ensembl	human	known	69_37n	missense	17	41.38	12	SNP	0.019	A
FAM129C	199786	genome.wustl.edu	37	19	17660294	17660294	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:17660294C>G	ENST00000335393.4	+	15	1939	c.1801C>G	c.(1801-1803)Ctg>Gtg	p.L601V	FAM129C_ENST00000601861.1_Missense_Mutation_p.L570V|FAM129C_ENST00000332386.5_Missense_Mutation_p.L601V|FAM129C_ENST00000599164.1_Missense_Mutation_p.L570V|FAM129C_ENST00000600871.1_Intron|FAM129C_ENST00000599124.1_Missense_Mutation_p.L534V|FAM129C_ENST00000352727.3_Missense_Mutation_p.L565V|FAM129C_ENST00000449408.2_Missense_Mutation_p.L327V|FAM129C_ENST00000595684.1_Missense_Mutation_p.L601V	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C	601										autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						ATCCTGCACTCTGGACGGCTG	0.557																																						dbGAP											0													124.0	119.0	121.0					19																	17660294		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.1801C>G	19.37:g.17660294C>G	ENSP00000335040:p.Leu601Val		B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Missense_Mutation	SNP	smart_Pleckstrin_homology	p.L601V	ENST00000335393.4	37	c.1801	CCDS12362.1	19	.	.	.	.	.	.	.	.	.	.	C	10.47	1.359801	0.24598	.	.	ENSG00000167483	ENST00000335393;ENST00000332386;ENST00000352727;ENST00000449408	T;T;T;T	0.27402	2.12;2.14;1.67;1.77	2.87	1.83	0.25207	.	1.051830	0.07658	N	0.933142	T	0.31918	0.0812	M	0.63428	1.95	0.09310	N	1	P;P;P;P	0.50819	0.939;0.844;0.844;0.844	B;B;B;B	0.44278	0.445;0.366;0.366;0.445	T	0.20075	-1.0286	10	0.31617	T	0.26	-4.3611	5.9659	0.19325	0.0:0.8545:0.0:0.1455	.	601;601;565;601	Q86XR2;Q86XR2-3;Q86XR2-4;Q86XR2-2	NIBL2_HUMAN;.;.;.	V	601;601;565;327	ENSP00000335040:L601V;ENSP00000333447:L601V;ENSP00000341067:L565V;ENSP00000394929:L327V	ENSP00000333447:L601V	L	+	1	2	FAM129C	17521294	0.008000	0.16893	0.001000	0.08648	0.002000	0.02628	1.513000	0.35823	0.795000	0.33922	0.557000	0.71058	CTG	FAM129C	-	NULL	ENSG00000167483		0.557	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM129C	HGNC	protein_coding	OTTHUMT00000464206.1	192	0.00	0	C	NM_173544		17660294	17660294	+1	no_errors	ENST00000335393	ensembl	human	known	69_37n	missense	107	41.85	77	SNP	0.001	G
FAM26F	441168	genome.wustl.edu	37	6	116784770	116784770	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:116784770G>C	ENST00000368605.1	+	3	945	c.850G>C	c.(850-852)Gag>Cag	p.E284Q	RP1-93H18.6_ENST00000476099.1_RNA|FAM26F_ENST00000368606.3_Missense_Mutation_p.E112Q	NM_001010919.1	NP_001010919.1	Q5R3K3	FA26F_HUMAN	family with sequence similarity 26, member F	284					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				large_intestine(2)|lung(1)	3				GBM - Glioblastoma multiforme(226;0.0402)|all cancers(137;0.0627)|OV - Ovarian serous cystadenocarcinoma(136;0.0655)|Epithelial(106;0.231)		CAACAGAAAAGAGAAGACTCA	0.423																																						dbGAP											0													175.0	183.0	180.0					6																	116784770		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF086130	CCDS34519.1, CCDS64506.1	6q22.1	2007-06-20			ENSG00000188820	ENSG00000188820			33391	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 187"""	C6orf187			Standard	NM_001010919		Approved	RP1-93H18.5, OTTHUMP00000017061, OTTHUMP00000017062, dJ93H18.5	uc003pwv.4	Q5R3K3	OTTHUMG00000015438	ENST00000368605.1:c.850G>C	6.37:g.116784770G>C	ENSP00000357594:p.Glu284Gln		B9EJB0|Q5R3K4	Missense_Mutation	SNP	NULL	p.E284Q	ENST00000368605.1	37	c.850	CCDS34519.1	6	.	.	.	.	.	.	.	.	.	.	G	7.494	0.651260	0.14516	.	.	ENSG00000188820	ENST00000368606;ENST00000368605;ENST00000368604	T;T;T	0.31247	1.52;2.52;1.5	5.21	3.32	0.38043	.	0.707271	0.13807	N	0.361398	T	0.06371	0.0164	N	0.20401	0.57	0.09310	N	1	B	0.20052	0.041	B	0.14578	0.011	T	0.36359	-0.9751	10	0.25751	T	0.34	-6.8618	7.393	0.26921	0.1589:0.1369:0.7042:0.0	.	284	Q5R3K3	FA26F_HUMAN	Q	112;284;127	ENSP00000357595:E112Q;ENSP00000357594:E284Q;ENSP00000357593:E127Q	ENSP00000357593:E127Q	E	+	1	0	FAM26F	116891463	0.018000	0.18449	0.004000	0.12327	0.001000	0.01503	1.681000	0.37618	0.691000	0.31592	-0.345000	0.07892	GAG	FAM26F	-	NULL	ENSG00000188820		0.423	FAM26F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM26F	HGNC	protein_coding	OTTHUMT00000041946.1	181	0.00	0	G	NM_001010919		116784770	116784770	+1	no_errors	ENST00000368605	ensembl	human	known	69_37n	missense	120	49.79	119	SNP	0.002	C
FAM47C	442444	genome.wustl.edu	37	X	37028630	37028630	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chrX:37028630C>T	ENST00000358047.3	+	1	2199	c.2147C>T	c.(2146-2148)gCg>gTg	p.A716V		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	716										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						AGTCTCCACGCGGAGCCTCCT	0.632																																						dbGAP											0													45.0	45.0	45.0					X																	37028630		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2147C>T	X.37:g.37028630C>T	ENSP00000367913:p.Ala716Val		Q6ZU46	Missense_Mutation	SNP	NULL	p.A716V	ENST00000358047.3	37	c.2147	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	-	6.960	0.547108	0.13312	.	.	ENSG00000198173	ENST00000358047	T	0.13420	2.59	0.99	-1.41	0.08941	.	.	.	.	.	T	0.06142	0.0159	N	0.08118	0	0.09310	N	1	P	0.41159	0.74	B	0.38985	0.287	T	0.33624	-0.9861	9	0.52906	T	0.07	.	5.5471	0.17069	0.0:0.3859:0.614:0.0	.	716	Q5HY64	FA47C_HUMAN	V	716	ENSP00000367913:A716V	ENSP00000367913:A716V	A	+	2	0	FAM47C	36938551	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-1.504000	0.02275	0.354000	0.24105	0.354000	0.21935	GCG	FAM47C	-	NULL	ENSG00000198173		0.632	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	168	0.00	0	C	NM_001013736		37028630	37028630	+1	no_errors	ENST00000358047	ensembl	human	known	69_37n	missense	111	23.97	35	SNP	0.003	T
FAM65A	79567	genome.wustl.edu	37	16	67577132	67577132	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr16:67577132G>C	ENST00000379312.3	+	13	2576	c.2455G>C	c.(2455-2457)Gag>Cag	p.E819Q	FAM65A_ENST00000042381.4_Missense_Mutation_p.E815Q|FAM65A_ENST00000428437.2_Missense_Mutation_p.E829Q|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000540839.3_Missense_Mutation_p.E835Q|FAM65A_ENST00000422602.2_Missense_Mutation_p.E835Q|CTD-2012K14.3_ENST00000563083.1_RNA	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	819						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		GCAGGGCCTGGAGCAGGAGGT	0.677																																						dbGAP											0													14.0	12.0	13.0					16																	67577132		2197	4294	6491	-	-	-	SO:0001583	missense	0			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.2455G>C	16.37:g.67577132G>C	ENSP00000368614:p.Glu819Gln		B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_HR1_rho-bd	p.E835Q	ENST00000379312.3	37	c.2503	CCDS54028.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.278432|5.278432	0.95459|0.95459	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839|ENST00000428437	T;T;T|T	0.53857|0.37235	0.6;0.6;0.6|1.21	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.59918|0.59918	0.2229|0.2229	M|M	0.77103|0.77103	2.36|2.36	0.51012|0.51012	D|D	0.999907|0.999907	D;D;D;D|.	0.89917|.	0.999;0.999;0.999;1.0|.	D;D;D;D|.	0.83275|.	0.993;0.993;0.993;0.996|.	T|T	0.59118|0.59118	-0.7514|-0.7514	10|6	0.72032|.	D|.	0.01|.	-18.1856|-18.1856	19.4508|19.4508	0.94865|0.94865	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	829;835;819;835|.	B4DIM2;E9PBS3;Q6ZS17;B4DEQ9|.	.;.;FA65A_HUMAN;.|.	Q|A	819;815;835;829|809	ENSP00000368614:E819Q;ENSP00000042381:E815Q;ENSP00000400099:E835Q|ENSP00000389456:G809A	ENSP00000042381:E815Q|.	E|G	+|+	1|2	0|0	FAM65A|FAM65A	66134633|66134633	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	4.451000|4.451000	0.60047|0.60047	2.624000|2.624000	0.88883|0.88883	0.555000|0.555000	0.69702|0.69702	GAG|GGA	FAM65A	-	NULL	ENSG00000039523		0.677	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM65A	HGNC	protein_coding	OTTHUMT00000268866.3	39	0.00	0	G	NM_024519		67577132	67577132	+1	no_errors	ENST00000422602	ensembl	human	known	69_37n	missense	23	23.33	7	SNP	1.000	C
FAM65A	79567	genome.wustl.edu	37	16	67578233	67578233	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr16:67578233G>A	ENST00000379312.3	+	15	2765	c.2644G>A	c.(2644-2646)Gac>Aac	p.D882N	FAM65A_ENST00000042381.4_Missense_Mutation_p.D878N|FAM65A_ENST00000428437.2_Missense_Mutation_p.D892N|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000540839.3_Missense_Mutation_p.D897N|FAM65A_ENST00000422602.2_Missense_Mutation_p.D898N|CTD-2012K14.3_ENST00000563083.1_RNA	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	882						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		TGGGGCTGAGGACAGCATAGA	0.622																																						dbGAP											0													72.0	71.0	72.0					16																	67578233		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.2644G>A	16.37:g.67578233G>A	ENSP00000368614:p.Asp882Asn		B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_HR1_rho-bd	p.D898N	ENST00000379312.3	37	c.2692	CCDS54028.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.6|25.6	4.651799|4.651799	0.88056|0.88056	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839|ENST00000428437	T;T;T|.	0.15256|.	2.44;2.44;2.44|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.516121|.	0.22280|.	N|.	0.062124|.	T|T	0.51500|0.51500	0.1678|0.1678	N|N	0.16478|0.16478	0.41|0.41	0.47374|0.47374	D|D	0.999401|0.999401	B;B;B|.	0.18166|.	0.026;0.026;0.026|.	B;B;B|.	0.15870|.	0.008;0.014;0.014|.	T|T	0.45804|0.45804	-0.9236|-0.9236	10|5	0.45353|.	T|.	0.12|.	-9.59|-9.59	17.6813|17.6813	0.88243|0.88243	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	892;898;882|.	B4DIM2;E9PBS3;Q6ZS17|.	.;.;FA65A_HUMAN|.	N|E	882;878;898;892|871	ENSP00000368614:D882N;ENSP00000042381:D878N;ENSP00000400099:D898N|.	ENSP00000042381:D878N|.	D|G	+|+	1|2	0|0	FAM65A|FAM65A	66135734|66135734	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.948000|0.948000	0.59901|0.59901	5.127000|5.127000	0.64727|0.64727	2.620000|2.620000	0.88729|0.88729	0.655000|0.655000	0.94253|0.94253	GAC|GGA	FAM65A	-	NULL	ENSG00000039523		0.622	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM65A	HGNC	protein_coding	OTTHUMT00000268866.3	30	0.00	0	G	NM_024519		67578233	67578233	+1	no_errors	ENST00000422602	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	1.000	A
FARP1	10160	genome.wustl.edu	37	13	98865603	98865603	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr13:98865603C>G	ENST00000319562.6	+	2	372	c.107C>G	c.(106-108)tCa>tGa	p.S36*	FARP1_ENST00000376581.5_Nonsense_Mutation_p.S36*|FARP1_ENST00000595437.1_Nonsense_Mutation_p.S36*|FARP1_ENST00000376586.2_Nonsense_Mutation_p.S36*	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	36					dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			CCAACACCTTCAGGAAAACTC	0.547																																						dbGAP											0													142.0	155.0	151.0					13																	98865603		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.107C>G	13.37:g.98865603C>G	ENSP00000322926:p.Ser36*		Q5JVI9|Q6IQ29	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM-adjacent,pfam_FERM_central,superfamily_DH-domain,superfamily_FERM_central,smart_Band_41_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_FERM_domain,pfscan_Pleckstrin_homology,pfscan_DH-domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.S36*	ENST00000319562.6	37	c.107	CCDS9487.1	13	.	.	.	.	.	.	.	.	.	.	C	39	7.448778	0.98292	.	.	ENSG00000152767	ENST00000376581;ENST00000376586;ENST00000319562	.	.	.	5.75	5.75	0.90469	.	0.373971	0.23865	N	0.043817	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	14.7455	0.69488	0.1447:0.8553:0.0:0.0	.	.	.	.	X	36	.	ENSP00000322926:S36X	S	+	2	0	FARP1	97663604	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.283000	0.65621	2.725000	0.93324	0.655000	0.94253	TCA	FARP1	-	smart_Band_41_domain	ENSG00000152767		0.547	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP1	HGNC	protein_coding	OTTHUMT00000045541.3	167	0.00	0	C	NM_005766		98865603	98865603	+1	no_errors	ENST00000376586	ensembl	human	known	69_37n	nonsense	127	16.45	25	SNP	1.000	G
FBXO28	23219	genome.wustl.edu	37	1	224301869	224301869	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:224301869G>A	ENST00000366862.5	+	1	81	c.38G>A	c.(37-39)gGa>gAa	p.G13E	FBXO28_ENST00000424254.2_Missense_Mutation_p.G13E	NM_015176.3	NP_055991.1	Q9NVF7	FBX28_HUMAN	F-box protein 28	13										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(2)|skin(1)	10	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.0363)		GCAGAGGAAGGAGGCGGCGGC	0.692																																						dbGAP											0													9.0	11.0	10.0					1																	224301869		2075	4084	6159	-	-	-	SO:0001583	missense	0			AK001628	CCDS1539.1, CCDS44320.1	1q42.12	2011-08-12			ENSG00000143756	ENSG00000143756		"""F-boxes /  ""other"""""	29046	protein-coding gene	gene with protein product	"""centromere protein 30"""	609100				9455484	Standard	NM_015176		Approved	FLJ10766, KIAA0483, Fbx28, CENP-30	uc001hoh.3	Q9NVF7	OTTHUMG00000037495	ENST00000366862.5:c.38G>A	1.37:g.224301869G>A	ENSP00000355827:p.Gly13Glu		E9PEM8|O75070	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.G13E	ENST00000366862.5	37	c.38	CCDS1539.1	1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.146912	0.57151	.	.	ENSG00000143756	ENST00000366862;ENST00000424254	.	.	.	4.64	4.64	0.57946	.	0.102582	0.38436	N	0.001689	T	0.41328	0.1154	N	0.19112	0.55	0.37991	D	0.933913	B;B	0.12013	0.005;0.0	B;B	0.08055	0.003;0.002	T	0.46176	-0.9210	9	0.87932	D	0	-12.4923	10.1783	0.42952	0.1036:0.0:0.8964:0.0	.	13;13	E9PEM8;Q9NVF7	.;FBX28_HUMAN	E	13	.	ENSP00000355827:G13E	G	+	2	0	FBXO28	222368492	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	4.362000	0.59467	2.106000	0.64143	0.462000	0.41574	GGA	FBXO28	-	NULL	ENSG00000143756		0.692	FBXO28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO28	HGNC	protein_coding	OTTHUMT00000091283.2	22	0.00	0	G	NM_015176		224301869	224301869	+1	no_errors	ENST00000366862	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	1.000	A
FGFR4	2264	genome.wustl.edu	37	5	176523632	176523632	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr5:176523632G>A	ENST00000292408.4	+	16	2288	c.2043G>A	c.(2041-2043)gaG>gaA	p.E681E	FGFR4_ENST00000393637.1_Silent_p.E641E|FGFR4_ENST00000292410.3_Silent_p.E641E|FGFR4_ENST00000502906.1_Silent_p.E681E|FGFR4_ENST00000393648.2_Silent_p.E613E	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	681	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	TGCTATGGGAGATCTTCACCC	0.672										TSP Lung(9;0.080)																												dbGAP											0													77.0	77.0	77.0					5																	176523632		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.2043G>A	5.37:g.176523632G>A			G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_fibroblast_GF_rcpt,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E681	ENST00000292408.4	37	c.2043	CCDS4410.1	5																																																																																			FGFR4	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_fibroblast_GF_rcpt,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000160867		0.672	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFR4	HGNC	protein_coding	OTTHUMT00000253410.1	98	0.00	0	G			176523632	176523632	+1	no_errors	ENST00000292408	ensembl	human	known	69_37n	silent	49	31.94	23	SNP	1.000	A
FIGN	55137	genome.wustl.edu	37	2	164467534	164467534	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:164467534G>A	ENST00000333129.3	-	3	1122	c.808C>T	c.(808-810)Ccg>Tcg	p.P270S	FIGN_ENST00000482917.1_5'Flank|FIGN_ENST00000409634.1_Intron	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	270	Pro-rich.				mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						GCTGAAGGCGGAGGCGGTGCC	0.597																																						dbGAP											0													35.0	40.0	39.0					2																	164467534		2014	4164	6178	-	-	-	SO:0001583	missense	0			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.808C>T	2.37:g.164467534G>A	ENSP00000333836:p.Pro270Ser		B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.P270S	ENST00000333129.3	37	c.808	CCDS2221.2	2	.	.	.	.	.	.	.	.	.	.	G	11.35	1.613425	0.28712	.	.	ENSG00000182263	ENST00000333129	T	0.38240	1.15	6.07	6.07	0.98685	.	0.202893	0.43110	D	0.000601	T	0.59715	0.2214	L	0.56769	1.78	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.53344	-0.8452	10	0.48119	T	0.1	-14.0811	20.6512	0.99593	0.0:0.0:1.0:0.0	.	270	Q5HY92	FIGN_HUMAN	S	270	ENSP00000333836:P270S	ENSP00000333836:P270S	P	-	1	0	FIGN	164175780	1.000000	0.71417	1.000000	0.80357	0.026000	0.11368	9.732000	0.98816	2.882000	0.98803	0.655000	0.94253	CCG	FIGN	-	NULL	ENSG00000182263		0.597	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGN	HGNC	protein_coding	OTTHUMT00000157220.2	86	0.00	0	G	NM_018086		164467534	164467534	-1	no_errors	ENST00000333129	ensembl	human	known	69_37n	missense	60	31.03	27	SNP	1.000	A
FREM3	166752	genome.wustl.edu	37	4	144617778	144617778	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr4:144617778G>A	ENST00000329798.5	-	1	4050	c.4051C>T	c.(4051-4053)Caa>Taa	p.Q1351*		NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	1351					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						AGCCCTTGTTGAGGCCCAGAA	0.463																																						dbGAP											0													118.0	102.0	107.0					4																	144617778		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.4051C>T	4.37:g.144617778G>A	ENSP00000332886:p.Gln1351*			Nonsense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.Q1351*	ENST00000329798.5	37	c.4051	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	G	42	9.808520	0.99270	.	.	ENSG00000183090	ENST00000329798	.	.	.	4.33	1.41	0.22369	.	0.395190	0.24472	N	0.038222	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-2.1155	7.3278	0.26566	0.0:0.1402:0.3251:0.5347	.	.	.	.	X	1351	.	ENSP00000332886:Q1351X	Q	-	1	0	FREM3	144837228	0.000000	0.05858	0.889000	0.34880	0.988000	0.76386	0.583000	0.23849	0.986000	0.38683	0.655000	0.94253	CAA	FREM3	-	NULL	ENSG00000183090		0.463	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	377	0.00	0	G	XM_094074		144617778	144617778	-1	no_errors	ENST00000329798	ensembl	human	putative	69_37n	nonsense	236	17.19	49	SNP	0.950	A
FXR2	9513	genome.wustl.edu	37	17	7495896	7495896	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:7495896C>T	ENST00000250113.7	-	15	2085	c.1751G>A	c.(1750-1752)cGt>cAt	p.R584H	FXR2_ENST00000573057.1_5'Flank|SOX15_ENST00000570788.1_5'Flank|SOX15_ENST00000538513.2_5'Flank|SOX15_ENST00000250055.2_5'Flank|MPDU1_ENST00000423172.2_3'UTR	NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	584	Poly-Arg.					cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		GCGATTACGACGTTGAGGTCT	0.542																																						dbGAP											0													131.0	136.0	134.0					17																	7495896		2025	4159	6184	-	-	-	SO:0001583	missense	0			U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.1751G>A	17.37:g.7495896C>T	ENSP00000250113:p.Arg584His		B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet,smart_KH_dom,pfscan_KH_dom_type_1	p.R584H	ENST00000250113.7	37	c.1751	CCDS45604.1	17	.	.	.	.	.	.	.	.	.	.	C	27.4	4.824909	0.90955	.	.	ENSG00000129245	ENST00000250113	T	0.58210	0.35	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.63046	0.2478	L	0.39898	1.24	0.54753	D	0.99998	D	0.76494	0.999	D	0.73380	0.98	T	0.64626	-0.6363	10	0.72032	D	0.01	0.0185	13.7386	0.62833	0.0:1.0:0.0:0.0	.	584	P51116	FXR2_HUMAN	H	584	ENSP00000250113:R584H	ENSP00000250113:R584H	R	-	2	0	FXR2	7436621	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.206000	0.72154	2.709000	0.92574	0.655000	0.94253	CGT	FXR2	-	NULL	ENSG00000129245		0.542	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR2	HGNC	protein_coding	OTTHUMT00000441084.1	133	0.00	0	C			7495896	7495896	-1	no_errors	ENST00000250113	ensembl	human	known	69_37n	missense	51	56.78	67	SNP	1.000	T
GALK2	2585	genome.wustl.edu	37	15	49509389	49509389	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr15:49509389G>A	ENST00000560031.1	+	3	452	c.145G>A	c.(145-147)Gag>Aag	p.E49K	GALK2_ENST00000559454.1_Missense_Mutation_p.E25K|GALK2_ENST00000327171.3_Missense_Mutation_p.E38K|GALK2_ENST00000544523.1_Missense_Mutation_p.E25K|GALK2_ENST00000543495.1_5'UTR|GALK2_ENST00000396509.2_Missense_Mutation_p.E25K			Q01415	GALK2_HUMAN	galactokinase 2	49	Substrate binding.				carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)		TTTTCTAGGAGAGCATATAGA	0.368																																						dbGAP											0													78.0	80.0	79.0					15																	49509389		2196	4295	6491	-	-	-	SO:0001583	missense	0				CCDS32236.1, CCDS42034.1, CCDS73724.1	15q21.1-q21.2	2013-09-20			ENSG00000156958	ENSG00000156958	2.7.1.6		4119	protein-coding gene	gene with protein product		137028					Standard	XM_005254279		Approved	GK2	uc001zxj.1	Q01415	OTTHUMG00000172325	ENST00000560031.1:c.145G>A	15.37:g.49509389G>A	ENSP00000453129:p.Glu49Lys		Q7Z4Q4	Missense_Mutation	SNP	pfam_GalKase_gal-bd,pfam_GHMP_kinase_N_dom,pfam_GHMP_kinase_C_dom,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_Galactokinase,prints_Mevalonate/galactokinase,prints_Galactokinase,tigrfam_Galactokinase	p.E49K	ENST00000560031.1	37	c.145	CCDS42034.1	15	.	.	.	.	.	.	.	.	.	.	G	29.9	5.042689	0.93685	.	.	ENSG00000156958	ENST00000327171;ENST00000396509;ENST00000544523	D;D	0.96041	-3.89;-3.89	5.23	5.23	0.72850	Ribosomal protein S5 domain 2-type fold (1);Galactokinase, conserved site (1);Galactokinase galactose-binding domain (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.98448	0.9483	H	0.94423	3.535	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99679	1.0998	10	0.87932	D	0	-8.0301	18.4019	0.90519	0.0:0.0:1.0:0.0	.	49;38	Q01415;Q7Z4Q4	GALK2_HUMAN;.	K	38;49;25	ENSP00000316632:E38K;ENSP00000440312:E25K	ENSP00000316632:E38K	E	+	1	0	GALK2	47296681	1.000000	0.71417	0.998000	0.56505	0.937000	0.57800	7.921000	0.87530	2.436000	0.82500	0.655000	0.94253	GAG	GALK2	-	pfam_GalKase_gal-bd,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_Galactokinase,prints_Mevalonate/galactokinase,prints_Galactokinase,tigrfam_Galactokinase	ENSG00000156958		0.368	GALK2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GALK2	HGNC	protein_coding	OTTHUMT00000417854.1	260	0.00	0	G			49509389	49509389	+1	no_errors	ENST00000560031	ensembl	human	known	69_37n	missense	215	22.94	64	SNP	1.000	A
GARNL3	84253	genome.wustl.edu	37	9	130097556	130097556	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr9:130097556G>C	ENST00000373387.4	+	10	1169	c.817G>C	c.(817-819)Gag>Cag	p.E273Q	GARNL3_ENST00000314904.5_Missense_Mutation_p.E273Q|GARNL3_ENST00000435213.2_Missense_Mutation_p.E251Q	NM_032293.4	NP_115669.3	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	273	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)|small GTPase regulator activity (GO:0005083)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(24)|ovary(1)|skin(1)|urinary_tract(2)	41						CCAAGGGCATGAGATCATGTT	0.388																																						dbGAP											0													244.0	215.0	225.0					9																	130097556		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC034983	CCDS6869.2, CCDS69663.1	9q34.13	2009-09-14	2004-08-09		ENSG00000136895	ENSG00000136895			25425	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 3"""			11230166	Standard	NM_032293		Approved	DKFZp761J1523, bA356B19.1	uc011mae.2	Q5VVW2	OTTHUMG00000020700	ENST00000373387.4:c.817G>C	9.37:g.130097556G>C	ENSP00000362485:p.Glu273Gln		B4DEP7|B7Z3Q6|Q8IYU1|Q8N951|Q8ND89|Q9BQH6	Missense_Mutation	SNP	pfam_Citron,pfam_Rap_GAP,smart_Citron,pfscan_Rap_GAP	p.E273Q	ENST00000373387.4	37	c.817	CCDS6869.2	9	.	.	.	.	.	.	.	.	.	.	G	19.23	3.788192	0.70337	.	.	ENSG00000136895	ENST00000435213;ENST00000314904;ENST00000373387	D;D;D	0.96365	-3.99;-3.99;-3.99	5.16	5.16	0.70880	Rap/ran-GAP (2);	0.049466	0.85682	D	0.000000	D	0.97340	0.9130	M	0.65975	2.015	0.58432	D	0.999999	D;D;P	0.59357	0.985;0.985;0.626	P;P;B	0.61397	0.888;0.888;0.383	D	0.97121	0.9811	9	.	.	.	.	17.228	0.86977	0.0:0.0:1.0:0.0	.	273;251;214	Q5VVW2;B7Z3Q6;Q5VVW4	GARL3_HUMAN;.;.	Q	251;273;273	ENSP00000396205:E251Q;ENSP00000313970:E273Q;ENSP00000362485:E273Q	.	E	+	1	0	GARNL3	129137377	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.059000	0.93902	2.413000	0.81919	0.585000	0.79938	GAG	GARNL3	-	pfam_Rap_GAP,pfscan_Rap_GAP	ENSG00000136895		0.388	GARNL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GARNL3	HGNC	protein_coding	OTTHUMT00000054151.3	352	0.00	0	G	NM_032293		130097556	130097556	+1	no_errors	ENST00000373387	ensembl	human	known	69_37n	missense	285	29.73	121	SNP	1.000	C
GBP7	388646	genome.wustl.edu	37	1	89607275	89607275	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:89607275G>C	ENST00000294671.2	-	9	1560	c.1422C>G	c.(1420-1422)atC>atG	p.I474M		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	474						membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		CTGACTGCAGGATGGATTCCT	0.537																																						dbGAP											0													153.0	135.0	141.0					1																	89607275		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.1422C>G	1.37:g.89607275G>C	ENSP00000294671:p.Ile474Met			Missense_Mutation	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	p.I474M	ENST00000294671.2	37	c.1422	CCDS720.1	1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.080173	0.76528	.	.	ENSG00000213512	ENST00000294671	T	0.03035	4.07	4.14	0.0139	0.14098	Guanylate-binding protein, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.10680	0.0261	H	0.95884	3.735	0.27270	N	0.958395	D	0.71674	0.998	D	0.85130	0.997	T	0.02150	-1.1205	10	0.87932	D	0	.	3.6208	0.08094	0.4107:0.0:0.4175:0.1718	.	474	Q8N8V2	GBP7_HUMAN	M	474	ENSP00000294671:I474M	ENSP00000294671:I474M	I	-	3	3	GBP7	89379863	1.000000	0.71417	0.963000	0.40424	0.966000	0.64601	0.721000	0.25911	0.087000	0.17167	0.585000	0.79938	ATC	GBP7	-	pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	ENSG00000213512		0.537	GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP7	HGNC	protein_coding	OTTHUMT00000029401.1	363	0.00	0	G	NM_207398		89607275	89607275	-1	no_errors	ENST00000294671	ensembl	human	known	69_37n	missense	319	13.55	50	SNP	0.998	C
GCN1L1	10985	genome.wustl.edu	37	12	120575105	120575105	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:120575105G>A	ENST00000300648.6	-	50	6694	c.6682C>T	c.(6682-6684)Cag>Tag	p.Q2228*		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	2228					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGTGCCAACTGGTTGCCAGCA	0.527																																						dbGAP											0													100.0	100.0	100.0					12																	120575105		1962	4146	6108	-	-	-	SO:0001587	stop_gained	0			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.6682C>T	12.37:g.120575105G>A	ENSP00000300648:p.Gln2228*		A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Nonsense_Mutation	SNP	pfam_DUF3554,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.Q2228*	ENST00000300648.6	37	c.6682	CCDS41847.1	12	.	.	.	.	.	.	.	.	.	.	G	48	14.296639	0.99789	.	.	ENSG00000089154	ENST00000300648	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	18.6976	0.91607	0.0:0.0:1.0:0.0	.	.	.	.	X	2228	.	ENSP00000300648:Q2228X	Q	-	1	0	GCN1L1	119059488	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.897000	0.92532	2.661000	0.90470	0.650000	0.86243	CAG	GCN1L1	-	superfamily_ARM-type_fold	ENSG00000089154		0.527	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCN1L1	HGNC	protein_coding	OTTHUMT00000403592.1	254	0.00	0	G			120575105	120575105	-1	no_errors	ENST00000300648	ensembl	human	known	69_37n	nonsense	162	28.32	64	SNP	1.000	A
GLUD2	2747	genome.wustl.edu	37	X	120182613	120182613	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chrX:120182613C>T	ENST00000328078.1	+	1	1152	c.1075C>T	c.(1075-1077)Ctg>Ttg	p.L359L		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	359					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						TGGGTCCATTCTGGGCTTCCC	0.468																																						dbGAP											0													189.0	174.0	179.0					X																	120182613		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.1075C>T	X.37:g.120182613C>T			B2R8G0|Q9UDQ4	Silent	SNP	pfam_Glu/Leu/Phe/Val_DH_C,pfam_Glu/Leu/Phe/Val_DH_dimer_dom,smart_Glu/Leu/Phe/Val_DH_C,prints_Glu/Leu/Phe/Val_DH	p.L359	ENST00000328078.1	37	c.1075	CCDS14603.1	X																																																																																			GLUD2	-	pfam_Glu/Leu/Phe/Val_DH_C,smart_Glu/Leu/Phe/Val_DH_C	ENSG00000182890		0.468	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUD2	HGNC	protein_coding	OTTHUMT00000058133.1	578	0.00	0	C	NM_012084		120182613	120182613	+1	no_errors	ENST00000328078	ensembl	human	known	69_37n	silent	631	11.00	78	SNP	0.988	T
GPLD1	2822	genome.wustl.edu	37	6	24472849	24472849	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:24472849C>G	ENST00000230036.1	-	7	616	c.506G>C	c.(505-507)aGc>aCc	p.S169T	GPLD1_ENST00000474784.1_5'UTR	NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	169					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)			breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						TTCAAACTGGCTCAACACATC	0.373																																						dbGAP											0													119.0	111.0	113.0					6																	24472849		2203	4300	6503	-	-	-	SO:0001583	missense	0			L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.506G>C	6.37:g.24472849C>G	ENSP00000230036:p.Ser169Thr		Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Missense_Mutation	SNP	pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Gprt_PLipase_D	p.S169T	ENST00000230036.1	37	c.506	CCDS4553.1	6	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461448	0.63513	.	.	ENSG00000112293	ENST00000230036	T	0.41400	1.0	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.48624	0.1510	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.37150	-0.9718	10	0.11485	T	0.65	-34.0195	16.6533	0.85222	0.0:1.0:0.0:0.0	.	169	P80108	PHLD_HUMAN	T	169	ENSP00000230036:S169T	ENSP00000230036:S169T	S	-	2	0	GPLD1	24580828	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.755000	0.62198	2.672000	0.90937	0.655000	0.94253	AGC	GPLD1	-	prints_Gprt_PLipase_D	ENSG00000112293		0.373	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPLD1	HGNC	protein_coding	OTTHUMT00000043315.1	222	0.00	0	C	NM_001503		24472849	24472849	-1	no_errors	ENST00000230036	ensembl	human	known	69_37n	missense	189	25.30	64	SNP	1.000	G
GPR83	10888	genome.wustl.edu	37	11	94134208	94134208	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:94134208G>A	ENST00000243673.2	-	1	377	c.206C>T	c.(205-207)aCg>aTg	p.T69M	GPR83_ENST00000539203.2_Missense_Mutation_p.T69M	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	69					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GGCTTTCACCGTGGGGTTCTG	0.532																																						dbGAP											0													90.0	88.0	89.0					11																	94134208		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.206C>T	11.37:g.94134208G>A	ENSP00000243673:p.Thr69Met		B0M0K5|Q6NWR4|Q9P1Y8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.T69M	ENST00000243673.2	37	c.206	CCDS8297.1	11	.	.	.	.	.	.	.	.	.	.	G	10.93	1.489713	0.26686	.	.	ENSG00000123901	ENST00000243673;ENST00000539203	T;T	0.38077	1.16;1.16	4.88	1.31	0.21738	.	0.455794	0.24983	N	0.034052	T	0.13756	0.0333	N	0.10809	0.05	0.30680	N	0.752393	B	0.33103	0.397	B	0.18561	0.022	T	0.12344	-1.0551	10	0.33141	T	0.24	.	6.1289	0.20194	0.2598:0.1469:0.5933:0.0	.	69	Q9NYM4	GPR83_HUMAN	M	69	ENSP00000243673:T69M;ENSP00000441550:T69M	ENSP00000243673:T69M	T	-	2	0	GPR83	93773856	1.000000	0.71417	0.989000	0.46669	0.985000	0.73830	4.215000	0.58534	0.444000	0.26612	0.455000	0.32223	ACG	GPR83	-	NULL	ENSG00000123901		0.532	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR83	HGNC	protein_coding	OTTHUMT00000396232.1	192	0.52	1	G	NM_016540		94134208	94134208	-1	no_errors	ENST00000243673	ensembl	human	known	69_37n	missense	207	12.18	29	SNP	0.826	A
GPRASP1	9737	genome.wustl.edu	37	X	101910384	101910384	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chrX:101910384G>C	ENST00000361600.5	+	5	2344	c.1543G>C	c.(1543-1545)Gag>Cag	p.E515Q	RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000415986.1_Missense_Mutation_p.E515Q|GPRASP1_ENST00000537097.1_Missense_Mutation_p.E515Q|GPRASP1_ENST00000444152.1_Missense_Mutation_p.E515Q	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	515	Glu-rich.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GGCTGAGGAAGAGACCATTTT	0.512																																						dbGAP											0													110.0	98.0	102.0					X																	101910384		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.1543G>C	X.37:g.101910384G>C	ENSP00000355146:p.Glu515Gln		O43168|Q96LA1	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.E515Q	ENST00000361600.5	37	c.1543	CCDS35352.1	X	.	.	.	.	.	.	.	.	.	.	G	12.54	1.967806	0.34754	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.10763	2.84;2.84;2.84;2.84	2.78	2.78	0.32641	.	.	.	.	.	T	0.27169	0.0666	M	0.75615	2.305	0.21184	N	0.999768	D	0.76494	0.999	P	0.61275	0.886	T	0.02991	-1.1085	9	0.44086	T	0.13	-5.8112	10.8234	0.46619	0.0:0.0:1.0:0.0	.	515	Q5JY77	GASP1_HUMAN	Q	515	ENSP00000393691:E515Q;ENSP00000409420:E515Q;ENSP00000355146:E515Q;ENSP00000445683:E515Q	ENSP00000355146:E515Q	E	+	1	0	GPRASP1	101797040	0.957000	0.32711	0.652000	0.29579	0.844000	0.47949	2.192000	0.42649	1.672000	0.50884	0.519000	0.50382	GAG	GPRASP1	-	NULL	ENSG00000198932		0.512	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP1	HGNC	protein_coding	OTTHUMT00000057634.2	219	0.00	0	G	NM_014710		101910384	101910384	+1	no_errors	ENST00000361600	ensembl	human	known	69_37n	missense	178	23.28	54	SNP	0.982	C
GRIA3	2892	genome.wustl.edu	37	X	122561910	122561910	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chrX:122561910G>T	ENST00000371251.1	+	12	2048	c.1996G>T	c.(1996-1998)Gag>Tag	p.E666*	GRIA3_ENST00000264357.5_Nonsense_Mutation_p.E666*|GRIA3_ENST00000542149.1_Nonsense_Mutation_p.E666*|GRIA3_ENST00000371256.5_Nonsense_Mutation_p.E666*			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	666					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)	p.E666K(2)		breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	TTCTCCCATAGAGAGTGCTGA	0.443																																						dbGAP											2	Substitution - Missense(2)	ovary(2)											144.0	122.0	129.0					X																	122561910		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.1996G>T	X.37:g.122561910G>T	ENSP00000360297:p.Glu666*		D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Nonsense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E666*	ENST00000371251.1	37	c.1996	CCDS14604.1	X	.	.	.	.	.	.	.	.	.	.	G	40	8.011731	0.98610	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.4594	0.87616	0.0:0.0:1.0:0.0	.	.	.	.	X	666	.	ENSP00000264357:E666X	E	+	1	0	GRIA3	122389591	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.813000	0.99286	2.423000	0.82170	0.600000	0.82982	GAG	GRIA3	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000125675		0.443	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA3	HGNC	protein_coding	OTTHUMT00000058854.1	356	0.00	0	G	NM_000828		122561910	122561910	+1	no_errors	ENST00000264357	ensembl	human	known	69_37n	nonsense	199	38.77	126	SNP	1.000	T
GRIP1	23426	genome.wustl.edu	37	12	66742819	66742819	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:66742819C>T	ENST00000398016.3	-	24	3279	c.3211G>A	c.(3211-3213)Gaa>Aaa	p.E1071K	GRIP1_ENST00000286445.7_Missense_Mutation_p.E1108K|GRIP1_ENST00000359742.4_Missense_Mutation_p.E1123K	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TTAGTGGGTTCTCGTGTCTCC	0.403																																						dbGAP											0													263.0	255.0	257.0					12																	66742819		1893	4114	6007	-	-	-	SO:0001583	missense	0			AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.3211G>A	12.37:g.66742819C>T	ENSP00000381098:p.Glu1071Lys		B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E1123K	ENST00000398016.3	37	c.3367	CCDS41807.1	12	.	.	.	.	.	.	.	.	.	.	C	10.96	1.499413	0.26861	.	.	ENSG00000155974	ENST00000398016;ENST00000359742;ENST00000286445;ENST00000538211	T;T;T;T	0.21543	2.04;2.05;2.05;2.0	5.64	5.64	0.86602	.	0.185670	0.44688	D	0.000436	T	0.16300	0.0392	N	0.19112	0.55	0.36751	D	0.882738	B;B	0.26547	0.027;0.152	B;B	0.24394	0.037;0.053	T	0.12785	-1.0534	9	.	.	.	-27.7174	19.6939	0.96016	0.0:1.0:0.0:0.0	.	1071;1108	Q9Y3R0-3;Q9Y3R0-2	.;.	K	1071;1123;1108;1056	ENSP00000381098:E1071K;ENSP00000352780:E1123K;ENSP00000286445:E1108K;ENSP00000446047:E1056K	.	E	-	1	0	GRIP1	65029086	1.000000	0.71417	1.000000	0.80357	0.140000	0.21249	4.516000	0.60496	2.660000	0.90430	0.655000	0.94253	GAA	GRIP1	-	NULL	ENSG00000155974		0.403	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIP1	HGNC	protein_coding	OTTHUMT00000401975.2	509	0.20	1	C			66742819	66742819	-1	no_errors	ENST00000359742	ensembl	human	known	69_37n	missense	380	27.34	143	SNP	1.000	T
GTDC1	79712	genome.wustl.edu	37	2	144714895	144714895	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:144714895C>G	ENST00000392869.2	-	8	1149	c.997G>C	c.(997-999)Gag>Cag	p.E333Q	GTDC1_ENST00000409214.1_Missense_Mutation_p.E333Q|AC016910.1_ENST00000422799.1_RNA|GTDC1_ENST00000344850.4_Missense_Mutation_p.E333Q|GTDC1_ENST00000392867.3_Intron|GTDC1_ENST00000241391.5_Intron|GTDC1_ENST00000409298.1_Missense_Mutation_p.E215Q|GTDC1_ENST00000542155.1_Missense_Mutation_p.E333Q|GTDC1_ENST00000463875.2_Missense_Mutation_p.E204Q	NM_001284234.1	NP_001271163.1	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	333					biosynthetic process (GO:0009058)		transferase activity, transferring glycosyl groups (GO:0016757)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(17)|ovary(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.0914)		TTTTTGGCCTCTGAAAAAATA	0.363																																						dbGAP											0													71.0	66.0	68.0					2																	144714895		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY281366	CCDS2185.1, CCDS33300.1, CCDS63029.1, CCDS74582.1, CCDS74583.1	2q22.3	2013-02-22			ENSG00000121964	ENSG00000121964		"""Glycosyltransferase group 1 domain containing"""	20887	protein-coding gene	gene with protein product	"""mannosyltransferase-like"""	610165				15068588, 21821951	Standard	NM_024659		Approved	FLJ11753, Hmat-Xa	uc010fnn.3	Q4AE62	OTTHUMG00000131835	ENST00000392869.2:c.997G>C	2.37:g.144714895C>G	ENSP00000376608:p.Glu333Gln		A8K5P2|D3DP81|Q53SM7|Q53TC5|Q6P7E7|Q6PJB6|Q6WKW6|Q9HAE5	Missense_Mutation	SNP	pfam_GlycosylTrfase_1_N,pfam_Glyco_trans_1	p.E333Q	ENST00000392869.2	37	c.997	CCDS33300.1	2	.	.	.	.	.	.	.	.	.	.	C	13.54	2.267247	0.40095	.	.	ENSG00000121964	ENST00000392869;ENST00000409214;ENST00000409298;ENST00000542155;ENST00000344850;ENST00000463875	T;T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07	5.8	5.8	0.92144	Glycosyl transferase, family 1 (1);	0.143179	0.64402	D	0.000009	T	0.77903	0.4200	L	0.39397	1.21	0.48135	D	0.999592	P;D;D	0.54397	0.946;0.966;0.957	P;P;P	0.50896	0.618;0.575;0.653	T	0.72040	-0.4410	10	0.16420	T	0.52	.	20.0693	0.97712	0.0:1.0:0.0:0.0	.	333;215;333	G1UFN1;B8ZZ45;Q4AE62	.;.;GTDC1_HUMAN	Q	333;333;215;333;333;204	ENSP00000376608:E333Q;ENSP00000386581:E333Q;ENSP00000386691:E215Q;ENSP00000438323:E333Q;ENSP00000339750:E333Q;ENSP00000437964:E204Q	ENSP00000339750:E333Q	E	-	1	0	GTDC1	144431365	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	4.241000	0.58707	2.758000	0.94735	0.563000	0.77884	GAG	GTDC1	-	pfam_Glyco_trans_1	ENSG00000121964		0.363	GTDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTDC1	HGNC	protein_coding	OTTHUMT00000254779.2	160	0.00	0	C	NM_024659		144714895	144714895	-1	no_errors	ENST00000344850	ensembl	human	known	69_37n	missense	117	20.95	31	SNP	1.000	G
GYS1	2997	genome.wustl.edu	37	19	49494681	49494681	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:49494681C>T	ENST00000323798.3	-	2	374	c.178G>A	c.(178-180)Gac>Aac	p.D60N	RUVBL2_ENST00000413176.2_5'Flank|RUVBL2_ENST00000601968.1_5'Flank|GYS1_ENST00000263276.6_Missense_Mutation_p.D60N|GYS1_ENST00000541188.1_Intron|GYS1_ENST00000544287.1_Intron|RUVBL2_ENST00000595090.1_5'Flank|GYS1_ENST00000457974.1_5'UTR|GYS1_ENST00000540532.1_Intron	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	60					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		AAGTAGTTGTCGCCCCATTCG	0.667																																						dbGAP											0													134.0	146.0	142.0					19																	49494681		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.178G>A	19.37:g.49494681C>T	ENSP00000317904:p.Asp60Asn		Q9BTT9	Missense_Mutation	SNP	pfam_Glycogen_synth,pfam_Glyco_trans_1,pfam_Starch_synth_cat_dom	p.D60N	ENST00000323798.3	37	c.178	CCDS12747.1	19	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168860	0.78339	.	.	ENSG00000104812	ENST00000323798;ENST00000263276;ENST00000457974	T;T	0.74842	-0.88;-0.88	5.15	5.15	0.70609	.	0.179734	0.51477	D	0.000098	D	0.83220	0.5207	M	0.75150	2.29	0.80722	D	1	P;D	0.59767	0.826;0.986	B;P	0.57204	0.276;0.815	D	0.85628	0.1268	10	0.87932	D	0	-28.5057	16.4927	0.84206	0.0:1.0:0.0:0.0	.	60;60	Q9BTT9;P13807	.;GYS1_HUMAN	N	60;60;59	ENSP00000317904:D60N;ENSP00000263276:D60N	ENSP00000263276:D60N	D	-	1	0	GYS1	54186493	1.000000	0.71417	0.976000	0.42696	0.743000	0.42351	7.260000	0.78391	2.570000	0.86706	0.591000	0.81541	GAC	GYS1	-	pfam_Glycogen_synth	ENSG00000104812		0.667	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS1	HGNC	protein_coding	OTTHUMT00000319791.1	91	0.00	0	C	NM_002103		49494681	49494681	-1	no_errors	ENST00000323798	ensembl	human	known	69_37n	missense	152	12.64	22	SNP	1.000	T
H2AFX	3014	genome.wustl.edu	37	11	118965982	118965982	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:118965982G>A	ENST00000530167.1	-	1	195	c.123C>T	c.(121-123)gcC>gcT	p.A41A		NM_002105.2	NP_002096.1	P16104	H2AX_HUMAN	H2A histone family, member X	41					cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|nucleosome assembly (GO:0006334)|positive regulation of DNA repair (GO:0045739)|response to ionizing radiation (GO:0010212)|spermatogenesis (GO:0007283)	condensed nuclear chromosome (GO:0000794)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|replication fork (GO:0005657)|site of double-strand break (GO:0035861)|XY body (GO:0001741)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)			lung(3)	3	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.47e-05)		CAACGCGCTCGGCGTAGTGGC	0.721								Chromatin Structure			OREG0021395	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													17.0	19.0	19.0					11																	118965982		2194	4285	6479	-	-	-	SO:0001819	synonymous_variant	0			X14850	CCDS8410.1	11q23.3	2011-01-27						"""Histones / Replication-independent"""	4739	protein-coding gene	gene with protein product		601772		H2AX		8076949	Standard	NM_002105		Approved		uc001pvg.3	P16104		ENST00000530167.1:c.123C>T	11.37:g.118965982G>A		1492	Q4ZGJ7|Q6IAS5	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.A41	ENST00000530167.1	37	c.123	CCDS8410.1	11																																																																																			H2AFX	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A	ENSG00000188486		0.721	H2AFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H2AFX	HGNC	protein_coding	OTTHUMT00000388330.2	69	0.00	0	G	NM_002105		118965982	118965982	-1	no_errors	ENST00000375167	ensembl	human	known	69_37n	silent	15	66.67	30	SNP	1.000	A
HAND2	9464	genome.wustl.edu	37	4	174449901	174449901	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr4:174449901C>G	ENST00000359562.4	-	1	1479	c.540G>C	c.(538-540)aaG>aaC	p.K180N	HAND2-AS1_ENST00000507571.1_RNA|HAND2-AS1_ENST00000504740.1_RNA|HAND2-AS1_ENST00000512209.2_RNA|HAND2-AS1_ENST00000515310.1_RNA|HAND2-AS1_ENST00000511196.1_RNA|HAND2-AS1_ENST00000510268.1_RNA|HAND2-AS1_ENST00000509640.1_RNA|HAND2-AS1_ENST00000514673.1_RNA|HAND2-AS1_ENST00000505621.1_RNA|HAND2-AS1_ENST00000512246.1_RNA|HAND2-AS1_ENST00000502334.1_RNA|HAND2-AS1_ENST00000510339.1_RNA|HAND2-AS1_ENST00000503474.1_RNA|HAND2-AS1_ENST00000512099.1_RNA|HAND2-AS1_ENST00000507322.1_RNA|HAND2-AS1_ENST00000505817.1_RNA|HAND2-AS1_ENST00000515741.1_RNA|HAND2-AS1_ENST00000515345.1_RNA|HAND2-AS1_ENST00000505032.1_RNA|HAND2-AS1_ENST00000508887.1_RNA|HAND2-AS1_ENST00000502941.1_RNA|HAND2-AS1_ENST00000509866.1_RNA|HAND2-AS1_ENST00000503309.1_RNA|HAND2-AS1_ENST00000514431.1_RNA|HAND2-AS1_ENST00000511728.1_RNA|HAND2-AS1_ENST00000504429.1_RNA|HAND2-AS1_ENST00000512943.1_RNA|HAND2_ENST00000505300.1_5'UTR|HAND2-AS1_ENST00000510221.1_RNA|HAND2-AS1_ENST00000507062.1_RNA|HAND2-AS1_ENST00000512929.1_RNA|HAND2-AS1_ENST00000515376.1_RNA|HAND2-AS1_ENST00000503198.1_RNA|HAND2-AS1_ENST00000502896.1_RNA|HAND2-AS1_ENST00000515350.1_RNA|HAND2-AS1_ENST00000508534.1_RNA|HAND2-AS1_ENST00000507636.1_RNA	NM_021973.2	NP_068808.1	P61296	HAND2_HUMAN	heart and neural crest derivatives expressed 2	180					adult heart development (GO:0007512)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic process involved in heart morphogenesis (GO:0003278)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cardiac right ventricle formation (GO:0003219)|cartilage morphogenesis (GO:0060536)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|coronary artery morphogenesis (GO:0060982)|embryonic digit morphogenesis (GO:0042733)|heart development (GO:0007507)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mesenchymal cell proliferation (GO:0010463)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural crest cell development (GO:0014032)|noradrenergic neuron differentiation (GO:0003357)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peripheral nervous system neuron development (GO:0048935)|positive regulation of semaphorin-plexin signaling pathway involved in outflow tract morphogenesis (GO:2000764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in norepinephrine biosynthetic process (GO:2000763)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|sympathetic nervous system development (GO:0048485)|thymus development (GO:0048538)|tongue development (GO:0043586)|visceral serous pericardium development (GO:0061032)	nuclear chromatin (GO:0000790)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|E-box binding (GO:0070888)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	13		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		CCTTCTTCCTCTTCTCCTCTT	0.602																																						dbGAP											0													91.0	75.0	81.0					4																	174449901		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF087941	CCDS3819.1	4q34.1	2014-08-12			ENSG00000164107	ENSG00000164107		"""Basic helix-loop-helix proteins"""	4808	protein-coding gene	gene with protein product		602407				9878849	Standard	NM_021973		Approved	dHand, Thing2, Hed, bHLHa26	uc003ith.1	P61296	OTTHUMG00000160775	ENST00000359562.4:c.540G>C	4.37:g.174449901C>G	ENSP00000352565:p.Lys180Asn		B6ECG9|O95300|O95301|P97833|Q494T1	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.K180N	ENST00000359562.4	37	c.540	CCDS3819.1	4	.	.	.	.	.	.	.	.	.	.	C	11.48	1.651456	0.29336	.	.	ENSG00000164107	ENST00000359562;ENST00000393686;ENST00000535864	D	0.96830	-4.14	5.0	2.37	0.29283	.	0.056144	0.64402	D	0.000002	D	0.90964	0.7159	N	0.25890	0.77	0.40733	D	0.98276	B;B	0.13594	0.008;0.008	B;B	0.12156	0.007;0.007	D	0.83637	0.0148	10	0.34782	T	0.22	-18.8195	8.3768	0.32447	0.0:0.6996:0.0:0.3004	.	180;180	B6ECG9;P61296	.;HAND2_HUMAN	N	180;149;128	ENSP00000352565:K180N	ENSP00000352565:K180N	K	-	3	2	HAND2	174686476	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	0.610000	0.24253	0.304000	0.22809	0.561000	0.74099	AAG	HAND2	-	NULL	ENSG00000164107		0.602	HAND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAND2	HGNC	protein_coding	OTTHUMT00000362241.3	330	0.00	0	C			174449901	174449901	-1	no_errors	ENST00000359562	ensembl	human	known	69_37n	missense	141	27.18	53	SNP	0.995	G
HAPLN3	145864	genome.wustl.edu	37	15	89424920	89424920	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr15:89424920G>A	ENST00000359595.3	-	3	375	c.161C>T	c.(160-162)cCc>cTc	p.P54L	HAPLN3_ENST00000562889.1_Missense_Mutation_p.P116L	NM_178232.2	NP_839946.1	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	54	Ig-like V-type. {ECO:0000305}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	17	Lung NSC(78;0.0392)|all_lung(78;0.077)				Hyaluronan(DB08818)	GGTCTCCTCGGGTGTCTCCAC	0.622																																						dbGAP											0													43.0	48.0	46.0					15																	89424920		2200	4299	6499	-	-	-	SO:0001583	missense	0			AY262759	CCDS10346.1	15q26.1	2013-01-11			ENSG00000140511	ENSG00000140511		"""Immunoglobulin superfamily / V-set domain containing"""	21446	protein-coding gene	gene with protein product			"""extracellular link domain containing, 1"""	EXLD1		12663660	Standard	NM_178232		Approved	HsT19883	uc002bnc.3	Q96S86	OTTHUMG00000148680	ENST00000359595.3:c.161C>T	15.37:g.89424920G>A	ENSP00000352606:p.Pro54Leu		A8K7P0	Missense_Mutation	SNP	pfam_Link,pfam_Ig_V-set,superfamily_C-type_lectin_fold,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,prints_Link,pfscan_Link,pfscan_Ig-like	p.P54L	ENST00000359595.3	37	c.161	CCDS10346.1	15	.	.	.	.	.	.	.	.	.	.	G	15.38	2.817347	0.50633	.	.	ENSG00000140511	ENST00000359595	T	0.65549	-0.16	4.22	4.22	0.49857	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.315427	0.33712	N	0.004633	T	0.64349	0.2590	M	0.77103	2.36	0.58432	D	0.999999	B;B	0.14012	0.009;0.009	B;B	0.20384	0.029;0.013	T	0.64609	-0.6367	10	0.37606	T	0.19	-7.3598	15.5912	0.76530	0.0:0.0:1.0:0.0	.	54;54	A8K7T8;Q96S86	.;HPLN3_HUMAN	L	54	ENSP00000352606:P54L	ENSP00000352606:P54L	P	-	2	0	HAPLN3	87225924	1.000000	0.71417	0.474000	0.27266	0.684000	0.39900	6.890000	0.75633	1.874000	0.54306	0.655000	0.94253	CCC	HAPLN3	-	pfam_Ig_V-set,pfscan_Ig-like	ENSG00000140511		0.622	HAPLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN3	HGNC	protein_coding	OTTHUMT00000309070.1	45	0.00	0	G	NM_178232		89424920	89424920	-1	no_errors	ENST00000359595	ensembl	human	known	69_37n	missense	36	30.77	16	SNP	0.951	A
HCFC2	29915	genome.wustl.edu	37	12	104461863	104461863	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:104461863G>C	ENST00000229330.4	+	3	555	c.451G>C	c.(451-453)Gat>Cat	p.D151H		NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	151					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						CGAAAGCGAAGATTCAAACAA	0.373																																					Esophageal Squamous(184;1814 2036 4771 6974 15702)	dbGAP											0													168.0	163.0	165.0					12																	104461863		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.451G>C	12.37:g.104461863G>C	ENSP00000229330:p.Asp151His		B2R8Q5|C0H5X3	Missense_Mutation	SNP	pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.D151H	ENST00000229330.4	37	c.451	CCDS9097.1	12	.	.	.	.	.	.	.	.	.	.	G	26.6	4.753188	0.89753	.	.	ENSG00000111727	ENST00000229330;ENST00000550444	T;T	0.73258	-0.73;-0.35	5.45	5.45	0.79879	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.89217	0.6652	H	0.94582	3.555	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91670	0.5349	10	0.87932	D	0	-25.4308	19.6392	0.95751	0.0:0.0:1.0:0.0	.	151	Q9Y5Z7	HCFC2_HUMAN	H	151;62	ENSP00000229330:D151H;ENSP00000447952:D62H	ENSP00000229330:D151H	D	+	1	0	HCFC2	102985993	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.869000	0.99810	2.722000	0.93159	0.491000	0.48974	GAT	HCFC2	-	NULL	ENSG00000111727		0.373	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC2	HGNC	protein_coding	OTTHUMT00000407780.1	348	0.00	0	G	NM_013320		104461863	104461863	+1	no_errors	ENST00000229330	ensembl	human	known	69_37n	missense	319	12.12	44	SNP	1.000	C
HCRTR2	3062	genome.wustl.edu	37	6	55142342	55142342	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:55142342G>A	ENST00000370862.3	+	5	1263	c.927G>A	c.(925-927)gtG>gtA	p.V309V		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	309					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)			breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TGATGATTGTGCTTTTGGTAT	0.448																																						dbGAP											0													125.0	122.0	123.0					6																	55142342		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.927G>A	6.37:g.55142342G>A			Q5VTM0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_Orexin_rcpt_2,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Orexin_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Orexin_rcpt_2,prints_NPY_rcpt	p.V309	ENST00000370862.3	37	c.927	CCDS4956.1	6																																																																																			HCRTR2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000137252		0.448	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCRTR2	HGNC	protein_coding	OTTHUMT00000043392.1	298	0.00	0	G			55142342	55142342	+1	no_errors	ENST00000370862	ensembl	human	known	69_37n	silent	264	20.18	67	SNP	1.000	A
HERC6	55008	genome.wustl.edu	37	4	89345780	89345780	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr4:89345780A>G	ENST00000264346.7	+	15	1920	c.1861A>G	c.(1861-1863)Agt>Ggt	p.S621G	HERC6_ENST00000380265.5_Intron	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	621					hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		TGTTATTTTCAGTGATTTTCC	0.279																																						dbGAP											0													67.0	62.0	64.0					4																	89345780		1785	4055	5840	-	-	-	SO:0001583	missense	0			AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.1861A>G	4.37:g.89345780A>G	ENSP00000264346:p.Ser621Gly		B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Missense_Mutation	SNP	pfam_HECT,pfam_Reg_chr_condens,superfamily_HECT,superfamily_Reg_csome_cond/b-lactamase_inh,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.S621G	ENST00000264346.7	37	c.1861	CCDS47098.1	4	.	.	.	.	.	.	.	.	.	.	A	15.02	2.710596	0.48517	.	.	ENSG00000138642	ENST00000264346	T	0.76578	-1.03	4.51	1.89	0.25635	.	0.536106	0.18036	N	0.153764	T	0.66944	0.2841	M	0.66939	2.045	0.80722	D	1	P	0.39782	0.688	B	0.28849	0.095	T	0.63373	-0.6652	10	0.66056	D	0.02	.	5.0167	0.14339	0.6238:0.192:0.0:0.1842	.	621	Q8IVU3	HERC6_HUMAN	G	621	ENSP00000264346:S621G	ENSP00000264346:S621G	S	+	1	0	HERC6	89564803	0.998000	0.40836	0.994000	0.49952	0.897000	0.52465	1.014000	0.29950	0.290000	0.22444	0.402000	0.26972	AGT	HERC6	-	NULL	ENSG00000138642		0.279	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HERC6	HGNC	protein_coding	OTTHUMT00000363259.2	208	0.00	0	A			89345780	89345780	+1	no_errors	ENST00000264346	ensembl	human	known	69_37n	missense	108	32.92	53	SNP	0.989	G
HGS	9146	genome.wustl.edu	37	17	79661866	79661866	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:79661866G>A	ENST00000329138.4	+	12	1093	c.958G>A	c.(958-960)Gag>Aag	p.E320K		NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	320	Interaction with SNX1. {ECO:0000250}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			GCCTCTGGCTGAGGACATCGA	0.612																																						dbGAP											0													157.0	137.0	144.0					17																	79661866		2203	4300	6503	-	-	-	SO:0001583	missense	0			D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		ENST00000329138.4:c.958G>A	17.37:g.79661866G>A	ENSP00000331201:p.Glu320Lys		Q9NR36	Missense_Mutation	SNP	pfam_VHS,pfam_HRS_helical,pfam_Znf_FYVE,superfamily_ENTH_VHS,superfamily_Znf_FYVE_PHD,smart_VHS_subgr,smart_Znf_FYVE,pirsf_Ubi-bd_Hrs_VPS27,pfscan_Ubiquitin-int_motif,pfscan_VHS,pfscan_Znf_FYVE-rel	p.E320K	ENST00000329138.4	37	c.958	CCDS11784.1	17	.	.	.	.	.	.	.	.	.	.	G	30	5.054897	0.93793	.	.	ENSG00000185359	ENST00000329138;ENST00000442335	T	0.39592	1.07	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.51227	0.1662	M	0.70595	2.14	0.80722	D	1	P	0.43352	0.804	P	0.44732	0.459	T	0.59139	-0.7510	10	0.72032	D	0.01	-29.8975	17.3061	0.87195	0.0:0.0:1.0:0.0	.	320	O14964	HGS_HUMAN	K	320	ENSP00000331201:E320K	ENSP00000331201:E320K	E	+	1	0	HGS	77272271	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	8.980000	0.93460	2.303000	0.77524	0.462000	0.41574	GAG	HGS	-	pirsf_Ubi-bd_Hrs_VPS27	ENSG00000185359		0.612	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGS	HGNC	protein_coding	OTTHUMT00000440541.1	217	0.00	0	G	NM_004712		79661866	79661866	+1	no_errors	ENST00000329138	ensembl	human	known	69_37n	missense	233	19.66	57	SNP	1.000	A
HIST1H4E	8367	genome.wustl.edu	37	6	26205022	26205022	+	Silent	SNP	C	C	T	rs145281411	byFrequency	TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:26205022C>T	ENST00000360441.4	+	1	165	c.150C>T	c.(148-150)ctC>ctT	p.L50L		NM_003545.3	NP_003536.1	P62805	H4_HUMAN	histone cluster 1, H4e	50					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	18		all_hematologic(11;0.196)				TTTCTGGTCTCATCTACGAGG	0.562													C|||	2	0.000399361	0.0	0.0	5008	,	,		17204	0.0		0.001	False		,,,				2504	0.001					dbGAP											0													99.0	96.0	97.0					6																	26205022		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z80787	CCDS4593.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198518	ENSG00000276966		"""Histones / Replication-dependent"""	4790	protein-coding gene	gene with protein product		602830	"""H4 histone family, member J"", ""histone 1, H4e"""	H4FJ		9119399, 12408966	Standard	NM_003545		Approved	H4/j	uc003ngy.3	P62805	OTTHUMG00000014441	ENST00000360441.4:c.150C>T	6.37:g.26205022C>T			A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.L50	ENST00000360441.4	37	c.150	CCDS4593.1	6																																																																																			HIST1H4E	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	ENSG00000198518		0.562	HIST1H4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4E	HGNC	protein_coding	OTTHUMT00000040104.1	259	0.00	0	C	NM_003545		26205022	26205022	+1	no_errors	ENST00000360441	ensembl	human	known	69_37n	silent	248	15.36	45	SNP	0.997	T
HMGCS1	3157	genome.wustl.edu	37	5	43294891	43294891	+	Silent	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr5:43294891G>C	ENST00000325110.6	-	7	1184	c.978C>G	c.(976-978)ctC>ctG	p.L326L	HMGCS1_ENST00000433297.2_Silent_p.L326L	NM_001098272.2	NP_001091742.1	Q01581	HMCS1_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)	326					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|lipid metabolic process (GO:0006629)|liver development (GO:0001889)|male gonad development (GO:0008584)|response to acid chemical (GO:0001101)|response to drug (GO:0042493)|response to lipoprotein particle (GO:0055094)|response to low light intensity stimulus (GO:0009645)|response to purine-containing compound (GO:0014074)|response to tellurium ion (GO:0046690)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hydroxymethylglutaryl-CoA synthase activity (GO:0004421)|isomerase activity (GO:0016853)|organic acid binding (GO:0043177)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|stomach(1)|urinary_tract(1)	15						TCTGACTGAAGAGTTCAGAGC	0.353																																						dbGAP											0													184.0	182.0	183.0					5																	43294891		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34154.1	5p14-p13	2012-10-02	2010-04-30			ENSG00000112972	2.3.3.10		5007	protein-coding gene	gene with protein product	"""3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase"""	142940	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)"""	HMGCS			Standard	NM_001098272		Approved		uc003jnq.5	Q01581		ENST00000325110.6:c.978C>G	5.37:g.43294891G>C			B2RDL8	Silent	SNP	pfam_HMG_CoA_synt_C,pfam_HMG_CoA_synth_N,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	p.L326	ENST00000325110.6	37	c.978	CCDS34154.1	5																																																																																			HMGCS1	-	pfam_HMG_CoA_synt_C,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	ENSG00000112972		0.353	HMGCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGCS1	HGNC	protein_coding	OTTHUMT00000368022.1	473	0.00	0	G			43294891	43294891	-1	no_errors	ENST00000325110	ensembl	human	known	69_37n	silent	484	17.26	101	SNP	1.000	C
HOMER2	9455	genome.wustl.edu	37	15	83518649	83518649	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr15:83518649C>T	ENST00000304231.8	-	9	1075	c.883G>A	c.(883-885)Gag>Aag	p.E295K	HOMER2_ENST00000426485.1_Missense_Mutation_p.E240K|HOMER2_ENST00000450735.2_Missense_Mutation_p.E284K|HOMER2_ENST00000399166.2_Missense_Mutation_p.E229K	NM_199330.2	NP_955362.1	Q9NSB8	HOME2_HUMAN	homer homolog 2 (Drosophila)	295					behavioral response to cocaine (GO:0048148)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|chemical homeostasis within a tissue (GO:0048875)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				cervix(1)|endometrium(2)|lung(6)	9						TTGTCTCTCTCTGCCGCCTGG	0.488											OREG0023389	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													78.0	79.0	79.0					15																	83518649		1963	4158	6121	-	-	-	SO:0001583	missense	0			AF093264	CCDS45334.1, CCDS45336.1	15q24.3	2008-02-05				ENSG00000103942			17513	protein-coding gene	gene with protein product		604799				9808459, 9808458	Standard	NM_199330		Approved	CPD, Cupidin, Vesl-2, HOMER-2B, HOMER-2, HOMER-2A	uc002bjg.3	Q9NSB8		ENST00000304231.8:c.883G>A	15.37:g.83518649C>T	ENSP00000305632:p.Glu295Lys	1222	O95269|O95349|Q9NSB6|Q9NSB7|Q9UNT7	Missense_Mutation	SNP	pfam_EVH1,smart_EVH1,pfscan_EVH1	p.E295K	ENST00000304231.8	37	c.883	CCDS45334.1	15	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530825	0.85706	.	.	ENSG00000103942	ENST00000304231;ENST00000450735;ENST00000426485;ENST00000399166	T;D;T;T	0.82167	1.98;-1.58;1.98;1.98	5.94	5.94	0.96194	.	0.095687	0.64402	D	0.000001	D	0.89681	0.6785	M	0.66939	2.045	0.80722	D	1	D;P;P;P	0.61697	0.99;0.926;0.944;0.926	P;B;P;B	0.60789	0.879;0.355;0.453;0.355	D	0.89765	0.3950	10	0.72032	D	0.01	.	19.3475	0.94370	0.0:1.0:0.0:0.0	.	229;240;284;295	F8W826;E9PAZ1;Q9NSB8-2;Q9NSB8	.;.;.;HOME2_HUMAN	K	295;284;240;229	ENSP00000305632:E295K;ENSP00000407634:E284K;ENSP00000394293:E240K;ENSP00000382119:E229K	ENSP00000305632:E295K	E	-	1	0	HOMER2	81315703	1.000000	0.71417	0.984000	0.44739	0.549000	0.35272	6.793000	0.75130	2.816000	0.96949	0.563000	0.77884	GAG	HOMER2	-	NULL	ENSG00000103942		0.488	HOMER2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HOMER2	HGNC	protein_coding	OTTHUMT00000418689.1	150	0.00	0	C			83518649	83518649	-1	no_errors	ENST00000304231	ensembl	human	known	69_37n	missense	117	20.27	30	SNP	1.000	T
HSD17B7P2	158160	genome.wustl.edu	37	10	38654451	38654451	+	RNA	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr10:38654451C>T	ENST00000494540.1	+	0	618					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		AATCTAATTTCAGCCTCGAGG	0.483																																						dbGAP											0																																										-	-	-			0					10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38654451C>T				RNA	SNP	-	NULL	ENST00000494540.1	37	NULL		10																																																																																			HSD17B7P2	-	-	ENSG00000099251		0.483	HSD17B7P2-001	KNOWN	basic	processed_transcript	HSD17B7P2	HGNC	pseudogene	OTTHUMT00000047631.2	236	0.00	0	C	NR_003086		38654451	38654451	+1	no_errors	ENST00000494540	ensembl	human	known	69_37n	rna	117	38.10	72	SNP	0.997	T
HPSE2	60495	genome.wustl.edu	37	10	100374727	100374727	+	Silent	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr10:100374727C>G	ENST00000370552.3	-	9	1313	c.1254G>C	c.(1252-1254)gtG>gtC	p.V418V	HPSE2_ENST00000370546.1_Silent_p.V418V|HPSE2_ENST00000370549.1_Silent_p.V360V|HPSE2_ENST00000404542.1_Silent_p.V306V	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	418					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		AGTGCCGTATCACGACATCAA	0.388																																						dbGAP											0													196.0	168.0	178.0					10																	100374727		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.1254G>C	10.37:g.100374727C>G			Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Silent	SNP	pfam_Glyco_hydro_79,superfamily_Glycoside_hydrolase_SF	p.V418	ENST00000370552.3	37	c.1254	CCDS7477.1	10																																																																																			HPSE2	-	superfamily_Glycoside_hydrolase_SF	ENSG00000172987		0.388	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HPSE2	HGNC	protein_coding	OTTHUMT00000049789.1	299	0.00	0	C	NM_021828		100374727	100374727	-1	no_errors	ENST00000370552	ensembl	human	known	69_37n	silent	220	15.00	39	SNP	1.000	G
HSP90AA1	3320	genome.wustl.edu	37	14	102549629	102549629	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr14:102549629C>G	ENST00000216281.8	-	9	1702	c.1497G>C	c.(1495-1497)aaG>aaC	p.K499N	HSP90AA1_ENST00000334701.7_Missense_Mutation_p.K621N|HSP90AA1_ENST00000441629.2_Missense_Mutation_p.K320N	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	499					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	CTACCTGGTCCTTGGTCTCAC	0.423																																						dbGAP											0													114.0	109.0	111.0					14																	102549629		2203	4300	6503	-	-	-	SO:0001583	missense	0			M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.1497G>C	14.37:g.102549629C>G	ENSP00000216281:p.Lys499Asn		A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Missense_Mutation	SNP	pirsf_Hsp90,pfam_Hsp90,pfam_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,prints_Hsp90_N	p.K621N	ENST00000216281.8	37	c.1863	CCDS9967.1	14	.	.	.	.	.	.	.	.	.	.	c	17.37	3.373412	0.61624	.	.	ENSG00000080824	ENST00000216281;ENST00000334701;ENST00000441629	T;T;T	0.12984	2.63;2.63;2.63	4.44	3.55	0.40652	Ribosomal protein S5 domain 2-type fold (1);	0.056384	0.64402	U	0.000002	T	0.43787	0.1263	H	0.94925	3.6	0.80722	D	1	D;D;D	0.71674	0.994;0.998;0.997	D;D;D	0.76071	0.93;0.962;0.987	T	0.48258	-0.9051	10	0.87932	D	0	-32.529	7.6296	0.28232	0.0:0.7403:0.0:0.2597	.	320;621;499	Q86U12;P07900-2;P07900	.;.;HS90A_HUMAN	N	499;621;320	ENSP00000216281:K499N;ENSP00000335153:K621N;ENSP00000396189:K320N	ENSP00000216281:K499N	K	-	3	2	HSP90AA1	101619382	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.288000	0.33296	0.999000	0.39023	0.655000	0.94253	AAG	HSP90AA1	-	pirsf_Hsp90,pfam_Hsp90,superfamily_Ribosomal_S5_D2-typ_fold	ENSG00000080824		0.423	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HSP90AA1	HGNC	protein_coding	OTTHUMT00000414952.2	295	0.00	0	C	NM_005348		102549629	102549629	-1	no_errors	ENST00000334701	ensembl	human	known	69_37n	missense	90	59.46	132	SNP	1.000	G
HSPA14	51182	genome.wustl.edu	37	10	14891732	14891732	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr10:14891732C>G	ENST00000378372.3	+	6	628	c.389C>G	c.(388-390)tCt>tGt	p.S130C		NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14	130					'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)			breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						ACGGCACATTCTGTATTGGGC	0.323																																						dbGAP											0													96.0	98.0	97.0					10																	14891732		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.389C>G	10.37:g.14891732C>G	ENSP00000367623:p.Ser130Cys		A8K8F8|B0YIY9|Q9P0X2|Q9UI07	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.S130C	ENST00000378372.3	37	c.389	CCDS7103.1	10	.	.	.	.	.	.	.	.	.	.	C	21.2	4.119782	0.77323	.	.	ENSG00000187522	ENST00000378372	T	0.01113	5.32	5.49	4.59	0.56863	.	0.055638	0.85682	D	0.000000	T	0.07143	0.0181	M	0.90483	3.12	0.80722	D	1	D	0.53151	0.958	P	0.57057	0.812	T	0.01524	-1.1333	10	0.87932	D	0	-15.93	14.3159	0.66450	0.0:0.9287:0.0:0.0713	.	130	Q0VDF9	HSP7E_HUMAN	C	130	ENSP00000367623:S130C	ENSP00000367623:S130C	S	+	2	0	HSPA14	14931738	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.668000	0.68074	1.315000	0.45114	0.650000	0.86243	TCT	HSPA14	-	pfam_Hsp_70_fam,pfam_MreB_Mrl	ENSG00000187522		0.323	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA14	HGNC	protein_coding	OTTHUMT00000046910.1	295	0.00	0	C	NM_016299		14891732	14891732	+1	no_errors	ENST00000378372	ensembl	human	known	69_37n	missense	245	28.99	100	SNP	1.000	G
IL20RA	53832	genome.wustl.edu	37	6	137323193	137323193	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:137323193G>A	ENST00000316649.5	-	7	1399	c.1164C>T	c.(1162-1164)ctC>ctT	p.L388L	IL20RA_ENST00000468393.1_5'Flank|RP11-204P2.3_ENST00000458017.1_RNA|IL20RA_ENST00000367748.1_Silent_p.L277L|IL20RA_ENST00000541547.1_Silent_p.L339L	NM_001278722.1|NM_014432.2	NP_001265651.1|NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha	388					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of bone resorption (GO:0045124)	integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		TTGTTCTGCTGAGGGACTCTT	0.448																																						dbGAP											0													83.0	77.0	79.0					6																	137323193		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF184971	CCDS5181.1, CCDS64535.1, CCDS64536.1	6q23.3	2008-02-05			ENSG00000016402	ENSG00000016402		"""Interleukins and interleukin receptors"""	6003	protein-coding gene	gene with protein product		605620				10875937, 11163236	Standard	NM_001278724		Approved	ZCYTOR7, IL-20R1	uc003qhj.3	Q9UHF4	OTTHUMG00000015654	ENST00000316649.5:c.1164C>T	6.37:g.137323193G>A			B4DLR5|F5H675|Q14CW2|Q6UWA9|Q96SH8	Silent	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3	p.L388	ENST00000316649.5	37	c.1164	CCDS5181.1	6																																																																																			IL20RA	-	NULL	ENSG00000016402		0.448	IL20RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL20RA	HGNC	protein_coding	OTTHUMT00000042393.1	127	0.00	0	G	NM_014432		137323193	137323193	-1	no_errors	ENST00000316649	ensembl	human	known	69_37n	silent	93	12.26	13	SNP	0.000	A
IL5RA	3568	genome.wustl.edu	37	3	3137081	3137081	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr3:3137081G>A	ENST00000446632.2	-	8	1331	c.757C>T	c.(757-759)Cgt>Tgt	p.R253C	IL5RA_ENST00000256452.3_Missense_Mutation_p.R253C|IL5RA_ENST00000418488.2_Intron|IL5RA_ENST00000438560.1_Missense_Mutation_p.R253C|IL5RA_ENST00000311981.8_Missense_Mutation_p.R253C|IL5RA_ENST00000430514.2_Missense_Mutation_p.R253C|IL5RA_ENST00000445864.2_Intron|IL5RA_ENST00000456302.1_Missense_Mutation_p.R253C|IL5RA_ENST00000383846.1_Missense_Mutation_p.R253C	NM_175726.3	NP_783853.1	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha	253	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell proliferation (GO:0008283)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-5-mediated signaling pathway (GO:0038043)|regulation of interleukin-5 production (GO:0032674)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-5 receptor activity (GO:0004914)			cervix(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	24				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		ATAGAGAGACGAGTTCCTTCA	0.358																																					GBM(169;430 2801 24955 28528)	dbGAP											0													102.0	101.0	101.0					3																	3137081		2203	4300	6503	-	-	-	SO:0001583	missense	0			M96652	CCDS2559.1, CCDS2560.1, CCDS46739.1, CCDS58813.1	3p26-p24	2008-01-11			ENSG00000091181	ENSG00000091181		"""Interleukins and interleukin receptors"", ""CD molecules"""	6017	protein-coding gene	gene with protein product		147851		IL5R		1732409	Standard	NM_175727		Approved	CDw125, CD125	uc010hbs.3	Q01344	OTTHUMG00000090245	ENST00000446632.2:c.757C>T	3.37:g.3137081G>A	ENSP00000412209:p.Arg253Cys		B3IU77|B4E2G0|Q14633|Q15469|Q6ISX9	Missense_Mutation	SNP	pfam_IL6_recept-bd,superfamily_Fibronectin_type3	p.R253C	ENST00000446632.2	37	c.757	CCDS2559.1	3	.	.	.	.	.	.	.	.	.	.	G	9.257	1.042112	0.19748	.	.	ENSG00000091181	ENST00000446632;ENST00000438560;ENST00000256452;ENST00000383846;ENST00000311981;ENST00000430514;ENST00000456302	D;D;D;D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04	5.0	-2.88	0.05682	Fibronectin, type III (1);Immunoglobulin-like fold (1);	1.674050	0.02815	N	0.124883	T	0.71281	0.3321	N	0.12182	0.205	0.09310	N	1	B;B;B;B	0.16603	0.011;0.015;0.018;0.008	B;B;B;B	0.09377	0.002;0.002;0.004;0.001	T	0.58025	-0.7709	10	0.41790	T	0.15	0.7631	6.2678	0.20936	0.527:0.2549:0.2181:0.0	.	253;253;253;253	B4E2G0;Q01344-3;Q01344-2;Q01344	.;.;.;IL5RA_HUMAN	C	253	ENSP00000412209:R253C;ENSP00000390753:R253C;ENSP00000256452:R253C;ENSP00000373358:R253C;ENSP00000309196:R253C;ENSP00000400400:R253C;ENSP00000392059:R253C	ENSP00000256452:R253C	R	-	1	0	IL5RA	3112081	0.000000	0.05858	0.000000	0.03702	0.701000	0.40568	-1.803000	0.01740	-0.772000	0.04602	0.655000	0.94253	CGT	IL5RA	-	superfamily_Fibronectin_type3	ENSG00000091181		0.358	IL5RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL5RA	HGNC	protein_coding	OTTHUMT00000337537.2	288	0.00	0	G			3137081	3137081	-1	no_errors	ENST00000256452	ensembl	human	known	69_37n	missense	346	11.87	47	SNP	0.000	A
IRAK1	3654	genome.wustl.edu	37	X	153278076	153278076	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chrX:153278076T>C	ENST00000369980.3	-	13	2151	c.1984A>G	c.(1984-1986)Atc>Gtc	p.I662V	IRAK1_ENST00000429936.2_Missense_Mutation_p.I658V|IRAK1_ENST00000477274.1_Intron|IRAK1_ENST00000393687.2_Missense_Mutation_p.I632V|IRAK1_ENST00000369974.2_Missense_Mutation_p.I583V|IRAK1_ENST00000393682.1_Missense_Mutation_p.I643V	NM_001025242.1|NM_001569.3	NP_001020413.1|NP_001560.2	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1	662					activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to hypoxia (GO:0071456)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|interleukin-1 receptor complex (GO:0045323)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|NF-kappaB-inducing kinase activity (GO:0004704)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(15)|ovary(2)	25	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCAGGGTTGATGATAATCTGC	0.627													T|||	1	0.000264901	0.0008	0.0	3775	,	,		12908	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													118.0	89.0	99.0					X																	153278076		2203	4300	6503	-	-	-	SO:0001583	missense	0			L76191	CCDS14740.1, CCDS35443.1, CCDS35444.1	Xq28	2011-07-08			ENSG00000184216	ENSG00000184216			6112	protein-coding gene	gene with protein product		300283				9374458, 8599092	Standard	XM_005274668		Approved	IRAK, pelle	uc004fjs.1	P51617	OTTHUMG00000024228	ENST00000369980.3:c.1984A>G	X.37:g.153278076T>C	ENSP00000358997:p.Ile662Val		D3DWW3|D3DWW4|Q7Z5V4|Q96C06|Q96RL2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.I662V	ENST00000369980.3	37	c.1984	CCDS14740.1	X	.	.	.	.	.	.	.	.	.	.	T	20.0	3.929723	0.73327	.	.	ENSG00000184216	ENST00000369980;ENST00000369974;ENST00000393682;ENST00000393687;ENST00000429936	T;T;T;T;T	0.26810	1.71;1.71;1.71;1.71;1.71	5.96	5.96	0.96718	.	0.114545	0.38959	N	0.001520	T	0.39600	0.1084	L	0.32530	0.975	0.37090	D	0.899404	D;D;D	0.69078	0.994;0.995;0.997	P;D;D	0.80764	0.876;0.984;0.994	T	0.46005	-0.9222	10	0.62326	D	0.03	-19.8813	12.784	0.57493	0.0:0.0:0.0:1.0	.	583;662;632	P51617-4;P51617;P51617-2	.;IRAK1_HUMAN;.	V	662;583;643;632;658	ENSP00000358997:I662V;ENSP00000358991:I583V;ENSP00000377287:I643V;ENSP00000377291:I632V;ENSP00000392662:I658V	ENSP00000358991:I583V	I	-	1	0	IRAK1	152931270	1.000000	0.71417	0.983000	0.44433	0.724000	0.41520	4.861000	0.62969	2.008000	0.58898	0.481000	0.45027	ATC	IRAK1	-	NULL	ENSG00000184216		0.627	IRAK1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK1	HGNC	protein_coding	OTTHUMT00000061143.3	93	0.00	0	T			153278076	153278076	-1	no_errors	ENST00000369980	ensembl	human	known	69_37n	missense	42	61.11	66	SNP	1.000	C
ITGA6	3655	genome.wustl.edu	37	2	173349861	173349861	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:173349861G>A	ENST00000264106.6	+	14	2043	c.1840G>A	c.(1840-1842)Gat>Aat	p.D614N	ITGA6_ENST00000409080.1_Missense_Mutation_p.D575N|ITGA6_ENST00000343713.4_Missense_Mutation_p.D570N|ITGA6_ENST00000409532.1_Missense_Mutation_p.D456N|ITGA6_ENST00000375221.2_Missense_Mutation_p.D614N|ITGA6_ENST00000264107.7_Missense_Mutation_p.D575N|AC093818.1_ENST00000442417.1_RNA			P23229	ITA6_HUMAN	integrin, alpha 6	614					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			TAATATCAGAGATAAACTGCG	0.423																																						dbGAP											0													87.0	84.0	85.0					2																	173349861		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.1840G>A	2.37:g.173349861G>A	ENSP00000264106:p.Asp614Asn		B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.D614N	ENST00000264106.6	37	c.1840		2	.	.	.	.	.	.	.	.	.	.	G	35	5.475412	0.96291	.	.	ENSG00000091409	ENST00000409532;ENST00000264107;ENST00000264106;ENST00000375221;ENST00000343713;ENST00000409080;ENST00000442250;ENST00000458358	T;T;T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.90841	0.7123	M	0.89904	3.07	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.996;1.0;0.998;1.0	D	0.91949	0.5569	10	0.87932	D	0	.	19.6734	0.95921	0.0:0.0:1.0:0.0	.	570;614;575;575	P23229-4;P23229-9;G5E9H1;P23229-2	.;.;.;.	N	456;575;614;614;570;575;614;570	ENSP00000386614:D456N;ENSP00000264107:D575N;ENSP00000264106:D614N;ENSP00000364369:D614N;ENSP00000341078:D570N;ENSP00000386896:D575N;ENSP00000406694:D614N;ENSP00000394169:D570N	ENSP00000264106:D614N	D	+	1	0	ITGA6	173058107	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.640000	0.91028	2.735000	0.93741	0.655000	0.94253	GAT	ITGA6	-	pfam_Integrin_alpha-2,prints_Integrin_alpha	ENSG00000091409		0.423	ITGA6-201	KNOWN	basic	protein_coding	ITGA6	HGNC	protein_coding		145	0.00	0	G			173349861	173349861	+1	no_errors	ENST00000264106	ensembl	human	known	69_37n	missense	96	28.15	38	SNP	1.000	A
ITPKC	80271	genome.wustl.edu	37	19	41224139	41224139	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:41224139G>C	ENST00000263370.2	+	1	1132	c.1099G>C	c.(1099-1101)Gag>Cag	p.E367Q	ADCK4_ENST00000450541.1_5'Flank|ADCK4_ENST00000324464.3_5'Flank	NM_025194.2	NP_079470.1	Q96DU7	IP3KC_HUMAN	inositol-trisphosphate 3-kinase C	367					inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	14			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CGACGAGTCTGAGGATGACGT	0.672																																						dbGAP											0													33.0	41.0	38.0					19																	41224139		2202	4294	6496	-	-	-	SO:0001583	missense	0			Y11999	CCDS12563.1	19q13.1	2011-04-28	2011-04-28		ENSG00000086544	ENSG00000086544	2.7.1.127		14897	protein-coding gene	gene with protein product		606476	"""inositol 1,4,5-trisphosphate 3-kinase C"""			11085927	Standard	NM_025194		Approved	IP3KC, IP3-3KC	uc002oot.3	Q96DU7		ENST00000263370.2:c.1099G>C	19.37:g.41224139G>C	ENSP00000263370:p.Glu367Gln		Q9UE25|Q9Y475	Missense_Mutation	SNP	pfam_IPK	p.E367Q	ENST00000263370.2	37	c.1099	CCDS12563.1	19	.	.	.	.	.	.	.	.	.	.	G	17.83	3.485155	0.63962	.	.	ENSG00000086544	ENST00000263370	.	.	.	5.27	5.27	0.74061	.	0.278560	0.33591	N	0.004747	T	0.77075	0.4077	M	0.72894	2.215	0.58432	D	0.999993	D	0.89917	1.0	D	0.80764	0.994	T	0.77544	-0.2548	9	0.48119	T	0.1	-27.8026	14.3925	0.66989	0.0:0.0:1.0:0.0	.	367	Q96DU7	IP3KC_HUMAN	Q	367	.	ENSP00000263370:E367Q	E	+	1	0	ITPKC	45915979	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.018000	0.64054	2.477000	0.83638	0.491000	0.48974	GAG	ITPKC	-	NULL	ENSG00000086544		0.672	ITPKC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKC	HGNC	protein_coding	OTTHUMT00000463104.1	21	0.00	0	G	NM_025194		41224139	41224139	+1	no_errors	ENST00000263370	ensembl	human	known	69_37n	missense	16	33.33	8	SNP	1.000	C
ITPR3	3710	genome.wustl.edu	37	6	33662776	33662776	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:33662776G>A	ENST00000374316.5	+	58	8921	c.7861G>A	c.(7861-7863)Gag>Aag	p.E2621K	ITPR3_ENST00000605930.1_Missense_Mutation_p.E2621K			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2621					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GGAGCAGAATGAGATTCGGAT	0.572																																						dbGAP											0													101.0	74.0	83.0					6																	33662776		2203	4300	6503	-	-	-	SO:0001583	missense	0			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.7861G>A	6.37:g.33662776G>A	ENSP00000363435:p.Glu2621Lys		Q14649|Q5TAQ2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,pfscan_MIR_motif,prints_InsP3_rcpt-bd	p.E2621K	ENST00000374316.5	37	c.7861	CCDS4783.1	6	.	.	.	.	.	.	.	.	.	.	G	36	5.646679	0.96704	.	.	ENSG00000096433	ENST00000374316	T	0.41758	0.99	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.63965	0.2556	M	0.82132	2.575	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	T	0.67643	-0.5618	10	0.87932	D	0	-43.8887	19.7706	0.96363	0.0:0.0:1.0:0.0	.	2621	Q14573	ITPR3_HUMAN	K	2621	ENSP00000363435:E2621K	ENSP00000363435:E2621K	E	+	1	0	ITPR3	33770754	1.000000	0.71417	0.968000	0.41197	0.658000	0.38924	9.869000	0.99810	2.697000	0.92050	0.655000	0.94253	GAG	ITPR3	-	NULL	ENSG00000096433		0.572	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR3	HGNC	protein_coding	OTTHUMT00000040204.2	97	0.00	0	G	NM_002224		33662776	33662776	+1	no_errors	ENST00000374316	ensembl	human	known	69_37n	missense	45	59.09	65	SNP	1.000	A
KANK2	25959	genome.wustl.edu	37	19	11287449	11287449	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:11287449G>C	ENST00000586659.1	-	7	1879	c.1565C>G	c.(1564-1566)tCa>tGa	p.S522*	KANK2_ENST00000589359.1_Nonsense_Mutation_p.S530*|KANK2_ENST00000432929.2_Nonsense_Mutation_p.S530*|KANK2_ENST00000589894.1_Nonsense_Mutation_p.S522*|KANK2_ENST00000355150.5_Nonsense_Mutation_p.S522*			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	522					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GTCGTTGTCTGAGATGTTCTC	0.642																																						dbGAP											0													101.0	87.0	92.0					19																	11287449		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.1565C>G	19.37:g.11287449G>C	ENSP00000465650:p.Ser522*		B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S530*	ENST00000586659.1	37	c.1589	CCDS12255.1	19	.	.	.	.	.	.	.	.	.	.	G	37	6.345952	0.97494	.	.	ENSG00000197256	ENST00000432929;ENST00000355150	.	.	.	5.61	4.56	0.56223	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-13.1699	12.7068	0.57065	0.0:0.0:0.8289:0.1711	.	.	.	.	X	530;522	.	ENSP00000347276:S522X	S	-	2	0	KANK2	11148449	1.000000	0.71417	0.967000	0.41034	0.513000	0.34164	5.659000	0.68010	1.310000	0.45006	0.462000	0.41574	TCA	KANK2	-	NULL	ENSG00000197256		0.642	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KANK2	HGNC	protein_coding	OTTHUMT00000453066.2	315	0.00	0	G	NM_015493		11287449	11287449	-1	no_errors	ENST00000432929	ensembl	human	known	69_37n	nonsense	232	13.33	36	SNP	0.985	C
KCNB2	9312	genome.wustl.edu	37	8	73480416	73480416	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr8:73480416C>T	ENST00000523207.1	+	2	1035	c.447C>T	c.(445-447)aaC>aaT	p.N149N		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	149					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	AACAAATGAACGAAGAACTGA	0.458																																						dbGAP											0													123.0	130.0	128.0					8																	73480416		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.447C>T	8.37:g.73480416C>T			Q7Z7D0|Q9BXD3	Silent	SNP	pfam_K_chnl_volt-dep_Kv2,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv2.2,prints_K_chnl_volt-dep_Kv2,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv8	p.N149	ENST00000523207.1	37	c.447	CCDS6209.1	8																																																																																			KCNB2	-	NULL	ENSG00000182674		0.458	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNB2	HGNC	protein_coding	OTTHUMT00000378998.1	180	0.00	0	C	NM_004770		73480416	73480416	+1	no_errors	ENST00000523207	ensembl	human	known	69_37n	silent	115	48.90	111	SNP	0.175	T
KCNT2	343450	genome.wustl.edu	37	1	196397237	196397237	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:196397237G>A	ENST00000294725.9	-	10	1897	c.982C>T	c.(982-984)Cag>Tag	p.Q328*	KCNT2_ENST00000367431.4_Nonsense_Mutation_p.Q328*|KCNT2_ENST00000367433.5_Nonsense_Mutation_p.Q328*|KCNT2_ENST00000451324.2_Intron|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000609185.1_Nonsense_Mutation_p.Q328*			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	328					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						AAATGTACCTGGAGCCTAGGA	0.378																																						dbGAP											0													90.0	89.0	89.0					1																	196397237		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.982C>T	1.37:g.196397237G>A	ENSP00000294725:p.Gln328*		Q3SY59|Q5VTN1|Q6ZMT3	Nonsense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2	p.Q328*	ENST00000294725.9	37	c.982	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.805669	0.96967	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000535608;ENST00000294725	.	.	.	5.72	5.72	0.89469	.	0.000000	0.56097	D	0.000022	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-13.1697	19.8937	0.96942	0.0:0.0:1.0:0.0	.	.	.	.	X	328;328;149;328	.	ENSP00000294725:Q328X	Q	-	1	0	KCNT2	194663860	1.000000	0.71417	0.969000	0.41365	0.097000	0.18754	9.837000	0.99465	2.716000	0.92895	0.650000	0.86243	CAG	KCNT2	-	NULL	ENSG00000162687		0.378	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	215	0.00	0	G	NM_198503		196397237	196397237	-1	no_errors	ENST00000294725	ensembl	human	known	69_37n	nonsense	233	11.36	30	SNP	1.000	A
KIT	3815	genome.wustl.edu	37	4	55561716	55561716	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr4:55561716C>A	ENST00000288135.5	+	2	203	c.106C>A	c.(106-108)Cca>Aca	p.P36T		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	36	Ig-like C2-type 1.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGAACCGTCTCCACCATCCAT	0.473		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																													dbGAP	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	0													84.0	75.0	78.0					4																	55561716		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.106C>A	4.37:g.55561716C>A	ENSP00000288135:p.Pro36Thr		B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.P36T	ENST00000288135.5	37	c.106	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	C	3.081	-0.189006	0.06299	.	.	ENSG00000157404	ENST00000288135;ENST00000412167;ENST00000536403	T;T	0.57595	0.39;0.39	5.36	0.499	0.16914	Immunoglobulin-like fold (1);	1.154120	0.06543	N	0.743508	T	0.41419	0.1158	L	0.40543	1.245	0.09310	N	1	B;B	0.25351	0.05;0.124	B;B	0.26864	0.033;0.074	T	0.29792	-1.0000	10	0.29301	T	0.29	.	5.4921	0.16781	0.0:0.5006:0.2676:0.2318	.	36;36	P10721-2;P10721	.;KIT_HUMAN	T	36	ENSP00000288135:P36T;ENSP00000390987:P36T	ENSP00000288135:P36T	P	+	1	0	KIT	55256473	0.602000	0.26916	0.058000	0.19502	0.043000	0.13939	0.382000	0.20635	0.090000	0.17273	0.650000	0.86243	CCA	KIT	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt	ENSG00000157404		0.473	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1	247	0.00	0	C			55561716	55561716	+1	no_errors	ENST00000288135	ensembl	human	known	69_37n	missense	194	20.82	51	SNP	0.051	A
KLF6	1316	genome.wustl.edu	37	10	3824269	3824269	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr10:3824269C>G	ENST00000497571.1	-	2	500	c.240G>C	c.(238-240)aaG>aaC	p.K80N	KLF6_ENST00000173785.4_5'Flank|KLF6_ENST00000469435.1_Missense_Mutation_p.K80N|KLF6_ENST00000542957.1_Missense_Mutation_p.K80N	NM_001160124.1|NM_001300.5	NP_001153596.1|NP_001291.3	Q99612	KLF6_HUMAN	Kruppel-like factor 6	80					B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				Colorectal(1;0.238)		TGGAAGATATCTTCAGTTCGG	0.473											OREG0019980	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													147.0	158.0	154.0					10																	3824269		2203	4300	6503	-	-	-	SO:0001583	missense	0			U51869	CCDS7060.1, CCDS53490.1	10p15	2013-01-08	2004-11-29	2004-12-01	ENSG00000067082	ENSG00000067082		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	2235	protein-coding gene	gene with protein product	"""GC-rich binding factor"""	602053	"""core promoter element binding protein"""	BCD1, ST12, COPEB		9503030, 9685731	Standard	NM_001300		Approved	CPBP, GBF, Zf9, PAC1	uc001iha.3	Q99612	OTTHUMG00000017567	ENST00000497571.1:c.240G>C	10.37:g.3824269C>G	ENSP00000419923:p.Lys80Asn	614	B2RE86|B4DDN0|D3DRR1|F5H3M5|Q5VUT7|Q5VUT8|Q9BT79	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K80N	ENST00000497571.1	37	c.240	CCDS7060.1	10	.	.	.	.	.	.	.	.	.	.	C	3.327	-0.137471	0.06711	.	.	ENSG00000067082	ENST00000497571;ENST00000542957;ENST00000469435	T;T;T	0.53857	3.37;0.6;0.82	4.91	2.61	0.31194	.	0.101591	0.64402	D	0.000002	T	0.45657	0.1353	L	0.41027	1.25	0.38683	D	0.952582	B;B;P;B	0.49783	0.001;0.033;0.928;0.0	B;B;P;B	0.47573	0.002;0.027;0.55;0.001	T	0.40327	-0.9569	10	0.29301	T	0.29	.	9.513	0.39089	0.145:0.7666:0.0:0.0884	.	80;80;80;80	D3GC14;F5H3M5;Q99612-2;Q99612	.;.;.;KLF6_HUMAN	N	80	ENSP00000419923:K80N;ENSP00000445301:K80N;ENSP00000419079:K80N	ENSP00000419079:K80N	K	-	3	2	KLF6	3814269	1.000000	0.71417	0.409000	0.26459	0.344000	0.29017	1.445000	0.35079	1.009000	0.39289	0.561000	0.74099	AAG	KLF6	-	NULL	ENSG00000067082		0.473	KLF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF6	HGNC	protein_coding	OTTHUMT00000046495.1	304	0.00	0	C			3824269	3824269	-1	no_errors	ENST00000497571	ensembl	human	known	69_37n	missense	148	30.84	66	SNP	0.880	G
KNTC1	9735	genome.wustl.edu	37	12	123089155	123089155	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:123089155G>T	ENST00000333479.7	+	49	5323	c.5146G>T	c.(5146-5148)Gag>Tag	p.E1716*	KNTC1_ENST00000537348.1_Nonsense_Mutation_p.E141*|KNTC1_ENST00000436959.3_5'UTR|KNTC1_ENST00000450485.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1716					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TTATTTAGCTGAGAGATGGCT	0.318																																						dbGAP											0													83.0	73.0	76.0					12																	123089155		1811	4069	5880	-	-	-	SO:0001587	stop_gained	0				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.5146G>T	12.37:g.123089155G>T	ENSP00000328236:p.Glu1716*		A7E2C4|B3KSG2	Nonsense_Mutation	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.E1716*	ENST00000333479.7	37	c.5146	CCDS45002.1	12	.	.	.	.	.	.	.	.	.	.	G	28.9	4.961982	0.92791	.	.	ENSG00000184445	ENST00000333479;ENST00000537348	.	.	.	5.26	5.26	0.73747	.	0.049532	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-21.9616	16.0097	0.80391	0.0:0.0:1.0:0.0	.	.	.	.	X	1716;141	.	ENSP00000328236:E1716X	E	+	1	0	KNTC1	121655108	0.962000	0.33011	0.993000	0.49108	0.408000	0.30992	1.468000	0.35332	2.443000	0.82685	0.536000	0.68110	GAG	KNTC1	-	pfam_RZZ-complex_KNTC1/ROD_C	ENSG00000184445		0.318	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	276	0.00	0	G			123089155	123089155	+1	no_errors	ENST00000333479	ensembl	human	known	69_37n	nonsense	213	14.80	37	SNP	1.000	T
KRTAP26-1	388818	genome.wustl.edu	37	21	31692282	31692282	+	Silent	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr21:31692282G>C	ENST00000360542.3	-	1	325	c.72C>G	c.(70-72)ctC>ctG	p.L24L		NM_203405.1	NP_981950.1	Q6PEX3	KR261_HUMAN	keratin associated protein 26-1	24						intermediate filament (GO:0005882)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16						CGATGGAGGTGAGAGGAATAT	0.537																																						dbGAP											0													61.0	64.0	63.0					21																	31692282		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB096936	CCDS13588.1	21q22.11	2007-11-23			ENSG00000197683	ENSG00000197683		"""Keratin associated proteins"""	33760	protein-coding gene	gene with protein product							Standard	NM_203405		Approved		uc002ynw.3	Q6PEX3	OTTHUMG00000057766	ENST00000360542.3:c.72C>G	21.37:g.31692282G>C			B0RZD3	Silent	SNP	pfam_PMG	p.L24	ENST00000360542.3	37	c.72	CCDS13588.1	21																																																																																			KRTAP26-1	-	pfam_PMG	ENSG00000197683		0.537	KRTAP26-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP26-1	HGNC	protein_coding	OTTHUMT00000128218.1	288	0.00	0	G	NM_203405		31692282	31692282	-1	no_errors	ENST00000360542	ensembl	human	known	69_37n	silent	267	14.70	46	SNP	0.000	C
LAMB1	3912	genome.wustl.edu	37	7	107577624	107577624	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr7:107577624G>A	ENST00000222399.6	-	26	4090	c.3860C>T	c.(3859-3861)tCt>tTt	p.S1287F	LAMB1_ENST00000474380.1_5'Flank|LAMB1_ENST00000393561.1_Missense_Mutation_p.S1311F	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1287	Domain II.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						TGTCTGTAGAGAATCCAGTTC	0.393																																						dbGAP											0													261.0	220.0	234.0					7																	107577624		2203	4300	6503	-	-	-	SO:0001583	missense	0			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.3860C>T	7.37:g.107577624G>A	ENSP00000222399:p.Ser1287Phe		Q14D91	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.S1287F	ENST00000222399.6	37	c.3860	CCDS5750.1	7	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222157	0.58560	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	T;T	0.34667	1.35;1.35	5.62	4.74	0.60224	.	.	.	.	.	T	0.32071	0.0817	L	0.38175	1.15	0.80722	D	1	B;P	0.38922	0.071;0.651	B;B	0.38616	0.057;0.277	T	0.12091	-1.0561	9	0.56958	D	0.05	.	14.3267	0.66526	0.071:0.0:0.929:0.0	.	1287;1311	P07942;G3XAI2	LAMB1_HUMAN;.	F	1311;1287	ENSP00000377191:S1311F;ENSP00000222399:S1287F	ENSP00000222399:S1287F	S	-	2	0	LAMB1	107364860	0.988000	0.35896	0.174000	0.22961	0.995000	0.86356	6.268000	0.72552	1.383000	0.46405	0.655000	0.94253	TCT	LAMB1	-	superfamily_t-SNARE	ENSG00000091136		0.393	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	HGNC	protein_coding	OTTHUMT00000314584.1	623	0.00	0	G	NM_002291		107577624	107577624	-1	no_errors	ENST00000222399	ensembl	human	known	69_37n	missense	283	54.41	339	SNP	0.658	A
LAMC1	3915	genome.wustl.edu	37	1	183097764	183097764	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:183097764G>A	ENST00000258341.4	+	18	3416	c.3159G>A	c.(3157-3159)gaG>gaA	p.E1053E	LAMC1_ENST00000466964.1_3'UTR	NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	1053	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						AGGAATTAGAGAGTCTCATAG	0.433																																						dbGAP											0													111.0	102.0	105.0					1																	183097764		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.3159G>A	1.37:g.183097764G>A			Q5VYE7	Silent	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_Laminin_B_type_IV,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.E1053	ENST00000258341.4	37	c.3159	CCDS1351.1	1																																																																																			LAMC1	-	NULL	ENSG00000135862		0.433	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	HGNC	protein_coding	OTTHUMT00000085954.2	293	0.00	0	G	NM_002293		183097764	183097764	+1	no_errors	ENST00000258341	ensembl	human	known	69_37n	silent	469	12.66	68	SNP	0.985	A
LHX2	9355	genome.wustl.edu	37	9	126794835	126794835	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr9:126794835C>G	ENST00000373615.4	+	5	1809	c.1070C>G	c.(1069-1071)tCg>tGg	p.S357W	RP11-85O21.5_ENST00000429482.1_RNA	NM_004789.3	NP_004780.3	P50458	LHX2_HUMAN	LIM homeobox 2	357					axon extension (GO:0048675)|axon guidance (GO:0007411)|cerebral cortex development (GO:0021987)|dorsal/ventral pattern formation (GO:0009953)|mesoderm development (GO:0007498)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural tube closure (GO:0001843)|olfactory bulb development (GO:0021772)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|retina development in camera-type eye (GO:0060041)|telencephalon regionalization (GO:0021978)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)	10						TCCAACGCCTCGCTCAGCCCC	0.642																																						dbGAP											0													65.0	67.0	66.0					9																	126794835		2203	4300	6503	-	-	-	SO:0001583	missense	0			U11701	CCDS6853.1	9q33.3	2011-06-20			ENSG00000106689	ENSG00000106689		"""Homeoboxes / LIM class"""	6594	protein-coding gene	gene with protein product		603759				8649822, 10051612	Standard	NM_004789		Approved	LH-2, hLhx2	uc004boe.1	P50458	OTTHUMG00000020647	ENST00000373615.4:c.1070C>G	9.37:g.126794835C>G	ENSP00000362717:p.Ser357Trp		O95860|Q52M57|Q8N1Z3	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeodomain,pfscan_Znf_LIM,pfscan_Homeodomain	p.S357W	ENST00000373615.4	37	c.1070	CCDS6853.1	9	.	.	.	.	.	.	.	.	.	.	C	21.0	4.082047	0.76528	.	.	ENSG00000106689	ENST00000373615	D	0.85411	-1.98	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.88093	0.6344	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.89259	0.3596	10	0.62326	D	0.03	.	18.7592	0.91843	0.0:1.0:0.0:0.0	.	357;357	B3KNJ5;P50458	.;LHX2_HUMAN	W	357	ENSP00000362717:S357W	ENSP00000362717:S357W	S	+	2	0	LHX2	125834656	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.449000	0.80643	2.655000	0.90218	0.655000	0.94253	TCG	LHX2	-	NULL	ENSG00000106689		0.642	LHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHX2	HGNC	protein_coding	OTTHUMT00000054010.2	101	0.00	0	C			126794835	126794835	+1	no_errors	ENST00000373615	ensembl	human	known	69_37n	missense	60	31.03	27	SNP	1.000	G
LILRB3	11025	genome.wustl.edu	37	19	54723032	54723032	+	Silent	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:54723032G>C	ENST00000391750.1	-	9	1528	c.1392C>G	c.(1390-1392)ctC>ctG	p.L464L	LILRA6_ENST00000440558.2_Silent_p.L464L|LILRB3_ENST00000407860.2_Silent_p.L481L|LILRB3_ENST00000245620.9_Silent_p.L464L|LILRA6_ENST00000270464.5_Silent_p.L464L|LILRB3_ENST00000346401.6_Silent_p.L476L|LILRA6_ENST00000419410.2_Silent_p.L464L|LILRB3_ENST00000469273.1_5'UTR|LILRB3_ENST00000424807.1_Silent_p.L464L|LILRA6_ENST00000391735.3_3'UTR			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	464					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GCTGACGTCggaggaggagga	0.602																																						dbGAP											0													174.0	124.0	141.0					19																	54723032		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.1392C>G	19.37:g.54723032G>C			C9J1P3|C9JIP1|O15471|Q86U49	Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L481	ENST00000391750.1	37	c.1443	CCDS33105.1	19																																																																																			LILRB3	-	NULL	ENSG00000204577		0.602	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB3	HGNC	protein_coding	OTTHUMT00000142844.5	289	0.00	0	G	NM_006864		54723032	54723032	-1	no_errors	ENST00000407860	ensembl	human	known	69_37n	silent	354	15.91	67	SNP	0.000	C
LRP1	4035	genome.wustl.edu	37	12	57592378	57592378	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:57592378G>T	ENST00000243077.3	+	60	10067	c.9601G>T	c.(9601-9603)Gag>Tag	p.E3201*		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3201					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CTATGTCACTGAGCGCATCTA	0.597																																						dbGAP											0													88.0	65.0	73.0					12																	57592378		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.9601G>T	12.37:g.57592378G>T	ENSP00000243077:p.Glu3201*		Q2PP12|Q86SW0|Q8IVG8	Nonsense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.E3201*	ENST00000243077.3	37	c.9601	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	G	53	20.235930	0.99928	.	.	ENSG00000123384	ENST00000243077	.	.	.	4.39	4.39	0.52855	.	0.069408	0.56097	D	0.000036	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.9522	0.41645	0.0956:0.0:0.9044:0.0	.	.	.	.	X	3201	.	ENSP00000243077:E3201X	E	+	1	0	LRP1	55878645	0.976000	0.34144	0.995000	0.50966	0.902000	0.53008	1.860000	0.39428	2.434000	0.82447	0.561000	0.74099	GAG	LRP1	-	superfamily_Growth_fac_rcpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000123384		0.597	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	84	0.00	0	G	NM_002332		57592378	57592378	+1	no_errors	ENST00000243077	ensembl	human	known	69_37n	nonsense	84	14.29	14	SNP	1.000	T
LRP2	4036	genome.wustl.edu	37	2	169995097	169995097	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:169995097G>A	ENST00000263816.3	-	75	13793	c.13508C>T	c.(13507-13509)tCa>tTa	p.S4503L		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4503					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CATTGCCATTGACCTGTCAAT	0.383																																						dbGAP											0													99.0	80.0	87.0					2																	169995097		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.13508C>T	2.37:g.169995097G>A	ENSP00000263816:p.Ser4503Leu		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.S4503L	ENST00000263816.3	37	c.13508	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	G	17.85	3.489736	0.64074	.	.	ENSG00000081479	ENST00000263816	D	0.89552	-2.53	5.24	5.24	0.73138	.	0.238996	0.41712	D	0.000827	T	0.78349	0.4269	N	0.14661	0.345	0.80722	D	1	P	0.36222	0.544	B	0.33339	0.162	T	0.77419	-0.2595	10	0.28530	T	0.3	.	12.5375	0.56150	0.0763:0.0:0.9237:0.0	.	4503	P98164	LRP2_HUMAN	L	4503	ENSP00000263816:S4503L	ENSP00000263816:S4503L	S	-	2	0	LRP2	169703343	1.000000	0.71417	0.955000	0.39395	0.996000	0.88848	5.921000	0.70028	2.615000	0.88500	0.655000	0.94253	TCA	LRP2	-	NULL	ENSG00000081479		0.383	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	143	0.00	0	G	NM_004525		169995097	169995097	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	missense	229	13.81	37	SNP	1.000	A
LRRC48	83450	genome.wustl.edu	37	17	17910739	17910739	+	Intron	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:17910739G>C	ENST00000399187.1	+	12	1544				LRRC48_ENST00000313838.8_Intron|LRRC48_ENST00000411504.2_Missense_Mutation_p.E452Q|LRRC48_ENST00000399182.1_Missense_Mutation_p.E452Q|LRRC48_ENST00000584166.1_Missense_Mutation_p.E452Q	NM_031294.3	NP_112584.3	Q9H069	LRC48_HUMAN	leucine rich repeat containing 48							cytoplasm (GO:0005737)				breast(1)|large_intestine(2)|lung(2)|pancreas(1)|urinary_tract(1)	7	all_neural(463;0.228)					CAATTATGTGGAGGCTTCTGG	0.453																																						dbGAP											0													173.0	154.0	160.0					17																	17910739		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AK093317	CCDS45622.1, CCDS45623.1	17p11.2	2014-07-18			ENSG00000171962	ENSG00000171962			25384	protein-coding gene	gene with protein product						11997338, 23354437	Standard	NM_001130090		Approved	DKFZP586M1120	uc021trk.1	Q9H069	OTTHUMG00000059355	ENST00000399187.1:c.1326+278G>C	17.37:g.17910739G>C			A8KAE6|Q86SF9|Q86W73|Q8IWG0	Missense_Mutation	SNP	NULL	p.E452Q	ENST00000399187.1	37	c.1354	CCDS45622.1	17	.	.	.	.	.	.	.	.	.	.	G	8.509	0.866014	0.17250	.	.	ENSG00000171962	ENST00000411504;ENST00000399184;ENST00000399182	T;T	0.44482	0.92;0.92	3.22	1.21	0.21127	.	.	.	.	.	T	0.29028	0.0721	.	.	.	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.27468	-1.0073	8	0.87932	D	0	.	5.3605	0.16085	0.2651:0.0:0.7349:0.0	.	452	Q9H069-2	.	Q	452	ENSP00000394020:E452Q;ENSP00000382136:E452Q	ENSP00000382136:E452Q	E	+	1	0	LRRC48	17851464	0.000000	0.05858	0.002000	0.10522	0.016000	0.09150	0.308000	0.19314	0.412000	0.25729	-0.274000	0.10170	GAG	LRRC48	-	NULL	ENSG00000171962		0.453	LRRC48-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	LRRC48	HGNC	protein_coding	OTTHUMT00000131945.3	436	0.00	0	G	NM_031294		17910739	17910739	+1	no_errors	ENST00000399182	ensembl	human	known	69_37n	missense	187	42.11	136	SNP	0.002	C
MCF2L	23263	genome.wustl.edu	37	13	113719306	113719306	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr13:113719306C>T	ENST00000375608.3	+	8	811	c.753C>T	c.(751-753)ttC>ttT	p.F251F	MCF2L_ENST00000375601.3_Silent_p.F225F|MCF2L_ENST00000442652.2_Silent_p.F251F|MCF2L_ENST00000423482.2_Silent_p.F219F|MCF2L_ENST00000421756.1_Silent_p.F225F|MCF2L_ENST00000434480.2_Silent_p.F227F|MCF2L_ENST00000375604.2_Silent_p.F278F|MCF2L_ENST00000535094.2_Silent_p.F221F|MCF2L_ENST00000397030.1_Silent_p.F254F|MCF2L_ENST00000375597.4_Silent_p.F219F			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	251					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				TGCAGTCCTTCGGGACCGAGC	0.552																																						dbGAP											0													94.0	75.0	81.0					13																	113719306		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.753C>T	13.37:g.113719306C>T			A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Silent	SNP	pfam_DH-domain,pfam_Spectrin_repeat,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.F278	ENST00000375608.3	37	c.834		13																																																																																			MCF2L	-	NULL	ENSG00000126217		0.552	MCF2L-001	KNOWN	basic	protein_coding	MCF2L	HGNC	protein_coding	OTTHUMT00000045849.4	105	0.00	0	C			113719306	113719306	+1	no_errors	ENST00000375604	ensembl	human	known	69_37n	silent	47	48.94	46	SNP	0.990	T
MCTP1	79772	genome.wustl.edu	37	5	94353075	94353075	+	Silent	SNP	T	T	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr5:94353075T>G	ENST00000515393.1	-	2	833	c.834A>C	c.(832-834)cgA>cgC	p.R278R	MCTP1_ENST00000312216.8_Silent_p.R57R|MCTP1_ENST00000429576.2_Silent_p.R57R|MCTP1_ENST00000505208.1_Silent_p.R57R	NM_024717.4	NP_078993.4	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1	278	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(13)|liver(2)|lung(13)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	41		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		TCTTACCTCCTCGATCTCGAG	0.413																																						dbGAP											0													146.0	138.0	141.0					5																	94353075		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34203.1, CCDS47247.1, CCDS75275.1	5q15	2008-02-05			ENSG00000175471	ENSG00000175471			26183	protein-coding gene	gene with protein product						15528213	Standard	XM_005272082		Approved	FLJ22344	uc003kkx.2	Q6DN14	OTTHUMG00000162742	ENST00000515393.1:c.834A>C	5.37:g.94353075T>G			Q6DN13|Q8N2W1|Q8NBA2|Q96LX0|Q9H6E8	Silent	SNP	pfam_C2_Ca-dep,pfam_PRibTrfase_C,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_C2_dom	p.R278	ENST00000515393.1	37	c.834	CCDS34203.1	5																																																																																			MCTP1	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000175471		0.413	MCTP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCTP1	HGNC	protein_coding	OTTHUMT00000370280.3	217	0.00	0	T	NM_024717		94353075	94353075	-1	no_errors	ENST00000515393	ensembl	human	known	69_37n	silent	151	16.48	30	SNP	1.000	G
MEN1	4221	genome.wustl.edu	37	11	64577195	64577195	+	Silent	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:64577195G>C	ENST00000337652.1	-	2	890	c.387C>G	c.(385-387)ctC>ctG	p.L129L	MEN1_ENST00000377326.3_Silent_p.L129L|MEN1_ENST00000443283.1_Silent_p.L129L|MEN1_ENST00000377316.2_Silent_p.L129L|MEN1_ENST00000315422.4_Silent_p.L129L|MEN1_ENST00000394376.1_Silent_p.L129L|MEN1_ENST00000377321.1_Silent_p.L129L|MEN1_ENST00000312049.6_Silent_p.L129L|MEN1_ENST00000377313.1_Silent_p.L129L|MEN1_ENST00000394374.2_Silent_p.L129L	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	129					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)	p.I125fs*53(1)		NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						AGGAGCGGCTGAGGCTGTTCC	0.572			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated																												Esophageal Squamous(1;83 158 15500 18603 18803 29295)	dbGAP	yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	multiple endocrine neoplasia type 1 gene		E	1	Deletion - Frameshift(1)	parathyroid(1)											115.0	116.0	116.0					11																	64577195		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.387C>G	11.37:g.64577195G>C			A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Silent	SNP	pfam_Menin	p.L129	ENST00000337652.1	37	c.387	CCDS8083.1	11																																																																																			MEN1	-	pfam_Menin	ENSG00000133895		0.572	MEN1-201	KNOWN	basic|CCDS	protein_coding	MEN1	HGNC	protein_coding	OTTHUMT00000143881.1	167	0.60	1	G			64577195	64577195	-1	no_errors	ENST00000337652	ensembl	human	known	69_37n	silent	60	67.03	122	SNP	0.994	C
METTL17	64745	genome.wustl.edu	37	14	21464955	21464955	+	Missense_Mutation	SNP	G	G	A	rs199822122		TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr14:21464955G>A	ENST00000339374.6	+	14	1510	c.1277G>A	c.(1276-1278)cGt>cAt	p.R426H	SLC39A2_ENST00000554422.1_5'Flank|RP11-84C10.4_ENST00000557335.1_RNA|SLC39A2_ENST00000298681.4_5'Flank|METTL17_ENST00000382985.4_Silent_p.S450S|METTL17_ENST00000556670.2_Intron	NM_001029991.1|NM_022734.2	NP_001025162.1|NP_073571.1	Q9H7H0	MET17_HUMAN	methyltransferase like 17	426					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	copper ion binding (GO:0005507)|methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20						GATTTGTATCGTTGTGCCCGT	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		16010	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													191.0	167.0	175.0					14																	21464955		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024512	CCDS9562.1, CCDS41913.1	14q11.2	2011-03-03	2011-03-02	2011-03-02	ENSG00000165792	ENSG00000165792			19280	protein-coding gene	gene with protein product			"""methyltransferase 11 domain containing 1"""	METT11D1		11278769	Standard	XM_006720235		Approved	FLJ20859	uc001vyn.3	Q9H7H0	OTTHUMG00000029610	ENST00000339374.6:c.1277G>A	14.37:g.21464955G>A	ENSP00000343041:p.Arg426His		Q9BSH1|Q9BZH2|Q9BZH3	Missense_Mutation	SNP	pfam_Ribosomal_Rsm22_bac-type,pfam_Methyltransf_11	p.R426H	ENST00000339374.6	37	c.1277	CCDS9562.1	14	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	25.4	4.635718	0.87760	.	.	ENSG00000165792	ENST00000339374	T	0.33216	1.42	5.37	5.37	0.77165	.	.	.	.	.	T	0.52980	0.1768	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.44620	-0.9316	8	0.31617	T	0.26	.	16.5997	0.84810	0.0:0.0:1.0:0.0	.	426	Q9H7H0	MET17_HUMAN	H	426	ENSP00000343041:R426H	ENSP00000343041:R426H	R	+	2	0	METTL17	20534795	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.772000	0.68889	2.539000	0.85634	0.655000	0.94253	CGT	METTL17	-	pfam_Ribosomal_Rsm22_bac-type	ENSG00000165792		0.572	METTL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL17	HGNC	protein_coding	OTTHUMT00000073804.4	383	0.00	0	G	NM_022734		21464955	21464955	+1	no_errors	ENST00000339374	ensembl	human	known	69_37n	missense	339	24.83	112	SNP	1.000	A
MICAL2	9645	genome.wustl.edu	37	11	12263947	12263947	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:12263947C>T	ENST00000256194.4	+	19	2812	c.2524C>T	c.(2524-2526)Cgg>Tgg	p.R842W	MICAL2_ENST00000342902.5_Missense_Mutation_p.R842W|MICAL2_ENST00000537344.1_Intron|MICAL2_ENST00000379612.3_Intron|MICAL2_ENST00000527546.1_Intron	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	842					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		GGTGCTGTGGCGGCTGCAGCA	0.587																																						dbGAP											0													41.0	37.0	38.0					11																	12263947		2201	4294	6495	-	-	-	SO:0001583	missense	0			AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.2524C>T	11.37:g.12263947C>T	ENSP00000256194:p.Arg842Trp		B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,pfam_FAD_bind_dom,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,prints_Rng_hydrolase-like,pfscan_CH-domain,pfscan_Znf_LIM	p.R842W	ENST00000256194.4	37	c.2524	CCDS7809.1	11	.	.	.	.	.	.	.	.	.	.	C	21.9	4.216931	0.79352	.	.	ENSG00000133816	ENST00000256194;ENST00000342902	T;T	0.63255	-0.03;-0.03	5.79	3.88	0.44766	.	0.000000	0.56097	D	0.000025	T	0.66247	0.2770	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.965	T	0.67975	-0.5531	10	0.62326	D	0.03	.	10.1203	0.42616	0.1382:0.7903:0.0:0.0715	.	842;842	G3XAC8;O94851	.;MICA2_HUMAN	W	842	ENSP00000256194:R842W;ENSP00000344894:R842W	ENSP00000256194:R842W	R	+	1	2	MICAL2	12220523	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.290000	0.51755	1.399000	0.46721	0.563000	0.77884	CGG	MICAL2	-	NULL	ENSG00000133816		0.587	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL2	HGNC	protein_coding	OTTHUMT00000385993.1	71	0.00	0	C	NM_014632		12263947	12263947	+1	no_errors	ENST00000256194	ensembl	human	known	69_37n	missense	39	41.79	28	SNP	1.000	T
MKL2	57496	genome.wustl.edu	37	16	14334208	14334208	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr16:14334208G>A	ENST00000341243.5	+	8	913	c.913G>A	c.(913-915)Gag>Aag	p.E305K	MKL2_ENST00000573051.1_Missense_Mutation_p.E265K|MKL2_ENST00000318282.5_Missense_Mutation_p.E316K|MKL2_ENST00000572567.1_Missense_Mutation_p.E305K|MKL2_ENST00000574045.1_Missense_Mutation_p.E316K|MKL2_ENST00000571589.1_Missense_Mutation_p.E316K			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	305					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TCAGAAGGGTGAGAAGAATGA	0.493																																						dbGAP											0													95.0	90.0	92.0					16																	14334208		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.913G>A	16.37:g.14334208G>A	ENSP00000345841:p.Glu305Lys		A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_DNA-bd,smart_RPEL_repeat,smart_SAP_DNA-bd,pfscan_RPEL_repeat,pfscan_SAP_DNA-bd	p.E305K	ENST00000341243.5	37	c.913		16	.	.	.	.	.	.	.	.	.	.	G	32	5.186233	0.94885	.	.	ENSG00000186260	ENST00000318282;ENST00000389126;ENST00000341243	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.79958	0.4536	M	0.76838	2.35	0.80722	D	1	D;D;D;D	0.76494	0.998;0.999;0.998;0.999	D;D;D;D	0.80764	0.994;0.994;0.99;0.994	T	0.77308	-0.2636	9	0.34782	T	0.22	-29.0284	18.9873	0.92777	0.0:0.0:1.0:0.0	.	265;316;305;316	Q9ULH7-2;B4DGT8;Q9ULH7;Q9ULH7-4	.;.;MKL2_HUMAN;.	K	316;305;305	.	ENSP00000339086:E316K	E	+	1	0	MKL2	14241709	1.000000	0.71417	0.993000	0.49108	0.727000	0.41649	9.869000	0.99810	2.724000	0.93272	0.655000	0.94253	GAG	MKL2	-	NULL	ENSG00000186260		0.493	MKL2-202	KNOWN	basic	protein_coding	MKL2	HGNC	protein_coding		174	0.00	0	G	NM_014048		14334208	14334208	+1	no_errors	ENST00000341243	ensembl	human	known	69_37n	missense	150	33.04	74	SNP	1.000	A
KMT2D	8085	genome.wustl.edu	37	12	49426957	49426957	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:49426957C>A	ENST00000301067.7	-	39	11530	c.11531G>T	c.(11530-11532)gGt>gTt	p.G3844V	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3844	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										AAGGCCCTGACCCTGCTGTGC	0.637																																						dbGAP											0													13.0	16.0	15.0					12																	49426957		1941	3904	5845	-	-	-	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11531G>T	12.37:g.49426957C>A	ENSP00000301067:p.Gly3844Val		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.G3844V	ENST00000301067.7	37	c.11531	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	8.509	0.866084	0.17250	.	.	ENSG00000167548	ENST00000301067	T	0.78364	-1.17	5.33	4.38	0.52667	.	0.224065	0.23051	N	0.052484	T	0.56262	0.1973	N	0.08118	0	0.43018	D	0.994569	B	0.33694	0.421	B	0.25140	0.058	T	0.64334	-0.6432	10	0.87932	D	0	.	11.4498	0.50145	0.0:0.7225:0.2775:0.0	.	3844	O14686	MLL2_HUMAN	V	3844	ENSP00000301067:G3844V	ENSP00000301067:G3844V	G	-	2	0	MLL2	47713224	0.128000	0.22383	1.000000	0.80357	0.970000	0.65996	0.355000	0.20163	2.657000	0.90304	0.563000	0.77884	GGT	MLL2	-	NULL	ENSG00000167548		0.637	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	73	0.00	0	C			49426957	49426957	-1	no_errors	ENST00000301067	ensembl	human	known	69_37n	missense	70	12.50	10	SNP	1.000	A
MLXIPL	51085	genome.wustl.edu	37	7	73011917	73011917	+	Missense_Mutation	SNP	G	G	A	rs186788005	byFrequency	TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr7:73011917G>A	ENST00000313375.3	-	9	1245	c.1198C>T	c.(1198-1200)Ccc>Tcc	p.P400S	MLXIPL_ENST00000429400.2_Missense_Mutation_p.P400S|MLXIPL_ENST00000414749.2_Missense_Mutation_p.P400S|MLXIPL_ENST00000395189.1_Missense_Mutation_p.P307S|MLXIPL_ENST00000434326.1_Missense_Mutation_p.P307S|MLXIPL_ENST00000354613.1_Missense_Mutation_p.P400S	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	400					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				TTGGCAGGGGGAGGGTAATGC	0.647																																						dbGAP											0													16.0	14.0	15.0					7																	73011917		2096	4077	6173	-	-	-	SO:0001583	missense	0			AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.1198C>T	7.37:g.73011917G>A	ENSP00000320886:p.Pro400Ser		C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.P400S	ENST00000313375.3	37	c.1198	CCDS5553.1	7	.	.	.	.	.	.	.	.	.	.	G	0.067	-1.210995	0.01555	.	.	ENSG00000009950	ENST00000414749;ENST00000429400;ENST00000313375;ENST00000354613;ENST00000395189;ENST00000434326	T;T;T;T;T;T	0.20463	2.64;2.64;2.64;2.64;2.07;2.07	4.14	-8.28	0.01013	.	2.261540	0.02005	N	0.046593	T	0.08846	0.0219	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.0;0.001;0.0;0.001;0.001;0.001	T	0.24261	-1.0165	10	0.11485	T	0.65	-0.0173	9.1388	0.36890	0.0:0.467:0.3551:0.1779	.	307;307;400;400;400;400	C5HU01;Q9NP71-6;Q9NP71;Q9NP71-2;Q9NP71-3;Q9NP71-4	.;.;MLXPL_HUMAN;.;.;.	S	400;400;400;400;307;307	ENSP00000412330:P400S;ENSP00000406296:P400S;ENSP00000320886:P400S;ENSP00000346629:P400S;ENSP00000378616:P307S;ENSP00000392636:P307S	ENSP00000320886:P400S	P	-	1	0	MLXIPL	72649853	0.000000	0.05858	0.000000	0.03702	0.191000	0.23601	-2.981000	0.00662	-1.388000	0.02092	0.423000	0.28283	CCC	MLXIPL	-	NULL	ENSG00000009950		0.647	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLXIPL	HGNC	protein_coding	OTTHUMT00000252262.1	18	0.00	0	G	NM_032951		73011917	73011917	-1	no_errors	ENST00000313375	ensembl	human	known	69_37n	missense	20	28.57	8	SNP	0.000	A
MRPL2	51069	genome.wustl.edu	37	6	43025966	43025966	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:43025966C>T	ENST00000388752.3	-	2	526	c.102G>A	c.(100-102)atG>atA	p.M34I	MRPL2_ENST00000487429.1_Missense_Mutation_p.E70K|KLC4_ENST00000259708.3_5'Flank|MRPL2_ENST00000489623.1_Missense_Mutation_p.M34I|KLC4_ENST00000479388.1_5'Flank|MRPL2_ENST00000468957.1_Missense_Mutation_p.M34I|KLC4_ENST00000347162.5_5'Flank|KLC4_ENST00000458460.2_5'Flank|KLC4_ENST00000453940.2_5'Flank|KLC4_ENST00000394058.1_5'Flank|MRPL2_ENST00000230413.5_Missense_Mutation_p.M34I|KLC4_ENST00000394056.2_5'Flank	NM_015950.3	NP_057034.2	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2	34					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(2)	9		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		GGCCATTGTTCATCATCTAGG	0.463																																						dbGAP											0													117.0	116.0	116.0					6																	43025966		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051617	CCDS34454.1, CCDS75458.1	6p21.3	2012-09-13			ENSG00000112651	ENSG00000112651		"""Mitochondrial ribosomal proteins / large subunits"""	14056	protein-coding gene	gene with protein product		611822					Standard	XM_005249161		Approved	MRP-L14, RPML14, CGI-22	uc003ots.1	Q5T653	OTTHUMG00000014719	ENST00000388752.3:c.102G>A	6.37:g.43025966C>T	ENSP00000373404:p.Met34Ile		B2RC56|Q8WUL1|Q96Q56|Q9Y311	Missense_Mutation	SNP	pfam_Ribosomal_L2_C,pfam_Rbsml_prot_L2_RNA-bd_dom,superfamily_Translation_prot_SH3-like,superfamily_NA-bd_OB-fold-like	p.M34I	ENST00000388752.3	37	c.102	CCDS34454.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.284|0.284	-0.984576|-0.984576	0.02180|0.02180	.|.	.|.	ENSG00000112651|ENSG00000112651	ENST00000487429|ENST00000388752;ENST00000230413;ENST00000489623;ENST00000468957	.|T	.|0.40756	.|1.02	4.99|4.99	-1.95|-1.95	0.07548|0.07548	.|.	.|1.107280	.|0.06624	.|N	.|0.758013	T|T	0.07279|0.07279	0.0184|0.0184	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B|B;B;B	0.06786|0.09022	0.001|0.0;0.002;0.0	B|B;B;B	0.06405|0.06405	0.002|0.001;0.002;0.0	T|T	0.24905|0.24905	-1.0147|-1.0147	8|10	0.87932|0.17369	D|T	0|0.5	1.0846|1.0846	1.2975|1.2975	0.02073|0.02073	0.1451:0.3116:0.1462:0.3971|0.1451:0.3116:0.1462:0.3971	.|.	70|34;34;34	C9J5E0|B4DVE2;C9JZW2;Q5T653	.|.;.;RM02_HUMAN	K|I	70|34	.|ENSP00000373404:M34I	ENSP00000417101:E70K|ENSP00000230413:M34I	E|M	-|-	1|3	0|0	MRPL2|MRPL2	43133944|43133944	0.044000|0.044000	0.20184|0.20184	0.141000|0.141000	0.22245|0.22245	0.040000|0.040000	0.13550|0.13550	-0.006000|-0.006000	0.12833|0.12833	-0.176000|-0.176000	0.10707|0.10707	0.462000|0.462000	0.41574|0.41574	GAA|ATG	MRPL2	-	NULL	ENSG00000112651		0.463	MRPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL2	HGNC	protein_coding	OTTHUMT00000040577.2	429	0.00	0	C			43025966	43025966	-1	no_errors	ENST00000388752	ensembl	human	known	69_37n	missense	382	13.18	58	SNP	0.008	T
MTPAP	55149	genome.wustl.edu	37	10	30602867	30602867	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr10:30602867G>C	ENST00000263063.4	-	9	1463	c.1420C>G	c.(1420-1422)Ctg>Gtg	p.L474V	MTPAP_ENST00000488290.1_5'UTR|MTPAP_ENST00000358107.4_Missense_Mutation_p.L604V	NM_018109.3	NP_060579.3	Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	474	PAP-associated.				cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						TGAATGTACAGAGGAGAAGAA	0.353																																						dbGAP											0													44.0	46.0	45.0					10																	30602867		2203	4299	6502	-	-	-	SO:0001583	missense	0			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000263063.4:c.1420C>G	10.37:g.30602867G>C	ENSP00000263063:p.Leu474Val		D3DRX0|Q659E3|Q6P7E5|Q9HA74	Missense_Mutation	SNP	pfam_PAP_assoc	p.L604V	ENST00000263063.4	37	c.1810	CCDS7165.1	10	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483310	0.63962	.	.	ENSG00000107951	ENST00000358107;ENST00000263063	D;D	0.82711	-1.64;-1.64	5.76	2.56	0.30785	PAP/25A-associated (1);	0.162046	0.41823	D	0.000804	D	0.87561	0.6208	M	0.76328	2.33	0.39902	D	0.973916	D;D	0.63046	0.992;0.981	P;D	0.64776	0.869;0.929	D	0.86152	0.1588	10	0.49607	T	0.09	-11.293	7.72	0.28727	0.1339:0.0:0.6168:0.2493	.	604;474	Q9NVV4-2;Q9NVV4	.;PAPD1_HUMAN	V	604;474	ENSP00000350820:L604V;ENSP00000263063:L474V	ENSP00000263063:L474V	L	-	1	2	MTPAP	30642873	0.859000	0.29813	0.984000	0.44739	0.990000	0.78478	1.121000	0.31283	0.764000	0.33197	0.655000	0.94253	CTG	MTPAP	-	pfam_PAP_assoc	ENSG00000107951		0.353	MTPAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTPAP	HGNC	protein_coding	OTTHUMT00000047426.2	55	0.00	0	G	NM_018109		30602867	30602867	-1	no_errors	ENST00000358107	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	0.762	C
MUC12	10071	genome.wustl.edu	37	7	100635956	100635956	+	Silent	SNP	C	C	T	rs566955309	byFrequency	TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr7:100635956C>T	ENST00000379442.3	+	5	2541	c.2541C>T	c.(2539-2541)agC>agT	p.S847S	MUC12_ENST00000536621.1_Silent_p.S704S			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	847	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						TCCCTGAAAGCGACACAACTT	0.522													-|||	8	0.00159744	0.0053	0.0	5008	,	,		48139	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													71.0	84.0	80.0					7																	100635956		692	1578	2270	-	-	-	SO:0001819	synonymous_variant	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.2541C>T	7.37:g.100635956C>T			A6ND38|F5GWV9|Q9UKN0	Silent	SNP	pfam_SEA	p.S847	ENST00000379442.3	37	c.2541		7																																																																																			MUC12	-	NULL	ENSG00000205277		0.522	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	1022	0.10	1	C	XM_379904		100635956	100635956	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	silent	656	20.53	170	SNP	0.002	T
MUC16	94025	genome.wustl.edu	37	19	9059268	9059268	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:9059268G>A	ENST00000397910.4	-	3	28381	c.28178C>T	c.(28177-28179)cCa>cTa	p.P9393L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9395	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGAGTTCCTGGCCAGGAGGC	0.532																																						dbGAP											0													125.0	123.0	123.0					19																	9059268		2006	4176	6182	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28178C>T	19.37:g.9059268G>A	ENSP00000381008:p.Pro9393Leu		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.P9393L	ENST00000397910.4	37	c.28178	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	7.235	0.600013	0.13939	.	.	ENSG00000181143	ENST00000397910	T	0.26067	1.76	2.1	-0.293	0.12835	.	.	.	.	.	T	0.14056	0.0340	N	0.24115	0.695	.	.	.	B	0.31174	0.311	B	0.30646	0.118	T	0.24440	-1.0160	8	0.87932	D	0	.	2.7038	0.05156	0.173:0.0:0.5509:0.276	.	9393	B5ME49	.	L	9393	ENSP00000381008:P9393L	ENSP00000381008:P9393L	P	-	2	0	MUC16	8920268	0.000000	0.05858	0.000000	0.03702	0.259000	0.26198	-1.518000	0.02246	0.011000	0.14865	0.306000	0.20318	CCA	MUC16	-	NULL	ENSG00000181143		0.532	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	358	0.00	0	G	NM_024690		9059268	9059268	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	228	14.93	40	SNP	0.000	A
MYH2	4620	genome.wustl.edu	37	17	10435109	10435109	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:10435109C>T	ENST00000245503.5	-	22	2922	c.2538G>A	c.(2536-2538)ttG>ttA	p.L846L	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000532183.2_Intron|MYH2_ENST00000397183.2_Silent_p.L846L|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	846					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CTGCACTCTTCAACAGAGGCT	0.443																																						dbGAP											0													118.0	114.0	115.0					17																	10435109		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.2538G>A	17.37:g.10435109C>T			A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L846	ENST00000245503.5	37	c.2538	CCDS11156.1	17																																																																																			MYH2	-	NULL	ENSG00000125414		0.443	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	497	0.20	1	C	NM_017534		10435109	10435109	-1	no_errors	ENST00000245503	ensembl	human	known	69_37n	silent	336	18.05	74	SNP	0.861	T
MYO1E	4643	genome.wustl.edu	37	15	59515261	59515261	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr15:59515261C>G	ENST00000288235.4	-	9	1306	c.907G>C	c.(907-909)Gag>Cag	p.E303Q	MYO1E_ENST00000558814.1_5'UTR	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	303	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		TACGCACACTCTTCACTCTCC	0.493																																						dbGAP											0													160.0	130.0	140.0					15																	59515261		2190	4290	6480	-	-	-	SO:0001583	missense	0			U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.907G>C	15.37:g.59515261C>G	ENSP00000288235:p.Glu303Gln		Q14778	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_SH3_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_SH3_domain,prints_Myosin_head_motor_dom,prints_SH3_domain	p.E303Q	ENST00000288235.4	37	c.907	CCDS32254.1	15	.	.	.	.	.	.	.	.	.	.	C	17.16	3.319578	0.60524	.	.	ENSG00000157483	ENST00000288235	D	0.88201	-2.35	4.66	4.66	0.58398	Myosin head, motor domain (2);	0.095533	0.64402	D	0.000001	D	0.82893	0.5136	L	0.28274	0.84	0.80722	D	1	B	0.09022	0.002	B	0.14023	0.01	T	0.77091	-0.2716	10	0.23891	T	0.37	.	18.0787	0.89436	0.0:1.0:0.0:0.0	.	303	Q12965	MYO1E_HUMAN	Q	303	ENSP00000288235:E303Q	ENSP00000288235:E303Q	E	-	1	0	MYO1E	57302553	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.573000	0.82421	2.564000	0.86499	0.573000	0.79308	GAG	MYO1E	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000157483		0.493	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1E	HGNC	protein_coding	OTTHUMT00000416024.1	148	0.00	0	C	NM_004998		59515261	59515261	-1	no_errors	ENST00000288235	ensembl	human	known	69_37n	missense	163	11.89	22	SNP	1.000	G
MYT1L	23040	genome.wustl.edu	37	2	1795704	1795704	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:1795704G>C	ENST00000399161.2	-	25	4243	c.3496C>G	c.(3496-3498)Cag>Gag	p.Q1166E	MYT1L_ENST00000407844.1_Missense_Mutation_p.Q164E|MYT1L_ENST00000428368.2_Missense_Mutation_p.Q1164E	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1166					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TCTGGACTCTGATAACGATCT	0.358																																						dbGAP											0													120.0	106.0	110.0					2																	1795704		1838	4077	5915	-	-	-	SO:0001583	missense	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3496C>G	2.37:g.1795704G>C	ENSP00000382114:p.Gln1166Glu		A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.Q1166E	ENST00000399161.2	37	c.3496		2	.	.	.	.	.	.	.	.	.	.	G	18.70	3.679892	0.68042	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000407844;ENST00000428368	T;T	0.46451	0.87;0.87	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.64549	0.2608	M	0.66939	2.045	0.80722	D	1	P;D;D	0.58268	0.954;0.982;0.979	D;D;D	0.67900	0.954;0.952;0.946	T	0.58640	-0.7601	10	0.41790	T	0.15	-50.5875	20.6013	0.99457	0.0:0.0:1.0:0.0	.	164;1166;1164	Q9UL68-3;Q9UL68;Q9UL68-4	.;MYT1L_HUMAN;.	E	1166;1112;164;1164	ENSP00000382114:Q1166E;ENSP00000396103:Q1164E	ENSP00000295067:Q1112E	Q	-	1	0	MYT1L	1774711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.774000	0.98992	2.878000	0.98634	0.650000	0.86243	CAG	MYT1L	-	NULL	ENSG00000186487		0.358	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	421	0.00	0	G	NM_015025		1795704	1795704	-1	no_errors	ENST00000399161	ensembl	human	known	69_37n	missense	245	30.59	108	SNP	1.000	C
NR1H2	7376	genome.wustl.edu	37	19	50840292	50840292	+	Intron	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:50840292C>G	ENST00000600978.1	+	2	74				NAPSB_ENST00000527780.1_RNA|NR1H2_ENST00000542413.1_Intron			P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2						cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		TGTCCTCACTCAGGATTCCAT	0.552																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000600978.1:c.75-967C>G	19.37:g.50840292C>G			A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	RNA	SNP	-	NULL	ENST00000600978.1	37	NULL		19																																																																																			NAPSB	-	-	ENSG00000131401		0.552	NR1H2-012	KNOWN	basic	processed_transcript	NAPSB	HGNC	protein_coding	OTTHUMT00000464783.1	107	0.00	0	C			50840292	50840292	-1	no_errors	ENST00000527780	ensembl	human	known	69_37n	rna	168	16.42	33	SNP	1.000	G
NARFL	64428	genome.wustl.edu	37	16	787197	787197	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr16:787197C>G	ENST00000251588.2	-	3	311	c.295G>C	c.(295-297)Gat>Cat	p.D99H	NARFL_ENST00000562862.1_5'Flank|NARFL_ENST00000301694.5_Missense_Mutation_p.D99H|NARFL_ENST00000568545.1_5'UTR|NARFL_ENST00000540986.1_5'UTR	NM_022493.1	NP_071938.1	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like	99					hematopoietic progenitor cell differentiation (GO:0002244)|iron-sulfur cluster assembly (GO:0016226)|oxygen homeostasis (GO:0032364)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	CIA complex (GO:0097361)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|large_intestine(1)|lung(7)	9		Hepatocellular(780;0.0218)				TTGTTAGCATCTAGAACCTTC	0.577																																						dbGAP											0													192.0	159.0	170.0					16																	787197		2200	4299	6499	-	-	-	SO:0001583	missense	0			AY129231	CCDS10425.1	16p13.3	2009-12-17			ENSG00000103245	ENSG00000103245			14179	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 1"""	611118				16956324	Standard	NM_022493		Approved	FLJ21988, PRN, HPRN, IOP1	uc002cjr.3	Q9H6Q4	OTTHUMG00000122093	ENST00000251588.2:c.295G>C	16.37:g.787197C>G	ENSP00000251588:p.Asp99His		A1L385|B3KTJ3|Q53GC6|Q96S10|Q9H6J8	Missense_Mutation	SNP	pfam_Fe_hydrogenase_lsu_C,pfam_Fe_hydrogenase_ssu-like,superfamily_Fe_hydrogenase,smart_Fe_hydrogenase_ssu-like	p.D99H	ENST00000251588.2	37	c.295	CCDS10425.1	16	.	.	.	.	.	.	.	.	.	.	C	6.085	0.383958	0.11524	.	.	ENSG00000103245	ENST00000251588;ENST00000301694	T;T	0.31510	1.49;1.49	4.85	-1.54	0.08584	Iron hydrogenase (1);	1.101710	0.06672	N	0.766363	T	0.31482	0.0798	L	0.59436	1.845	0.09310	N	1	P;P;B	0.37423	0.594;0.594;0.016	B;B;B	0.40565	0.333;0.236;0.015	T	0.40905	-0.9538	10	0.56958	D	0.05	-1.1812	6.6893	0.23161	0.0:0.4884:0.1221:0.3895	.	99;99;99	B4DT78;B4DEE7;Q9H6Q4	.;.;NARFL_HUMAN	H	99	ENSP00000251588:D99H;ENSP00000301694:D99H	ENSP00000251588:D99H	D	-	1	0	NARFL	727198	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.485000	0.22324	-0.106000	0.12110	-0.409000	0.06214	GAT	NARFL	-	superfamily_Fe_hydrogenase	ENSG00000103245		0.577	NARFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARFL	HGNC	protein_coding	OTTHUMT00000242855.1	154	0.00	0	C	NM_022493		787197	787197	-1	no_errors	ENST00000251588	ensembl	human	known	69_37n	missense	121	31.25	55	SNP	0.000	G
NDUFA9	4704	genome.wustl.edu	37	12	4796219	4796219	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:4796219G>A	ENST00000266544.5	+	11	1099	c.1079G>A	c.(1078-1080)cGc>cAc	p.R360H	NDUFA9_ENST00000540688.1_Missense_Mutation_p.R119H|RP11-234B24.6_ENST00000544741.2_Intron	NM_005002.4	NP_004993.1	Q16795	NDUA9_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa	360					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|sodium ion transport (GO:0006814)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21						CGCACTTACCGCTGGCTGTCT	0.542																																					Colon(75;996 1244 23946 25294 29232)	dbGAP											0													98.0	73.0	82.0					12																	4796219		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF050641	CCDS8532.1	12p13.3	2011-09-14	2002-08-29		ENSG00000139180	ENSG00000139180		"""Mitochondrial respiratory chain complex / Complex I"", ""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	7693	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 22E, member 1"", ""complex I 39kDa subunit"""	603834	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9 (39kD)"""	NDUFS2L		8486360, 19027726	Standard	NM_005002		Approved	SDR22E1, CI-39k	uc001qnc.3	Q16795		ENST00000266544.5:c.1079G>A	12.37:g.4796219G>A	ENSP00000266544:p.Arg360His		Q14076|Q2NKX0	Missense_Mutation	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_NmrA	p.R360H	ENST00000266544.5	37	c.1079	CCDS8532.1	12	.	.	.	.	.	.	.	.	.	.	G	26.4	4.735871	0.89482	.	.	ENSG00000139180	ENST00000266544;ENST00000540688	T;T	0.80480	-1.15;-1.38	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	D	0.88592	0.6478	M	0.83012	2.62	0.80722	D	1	D	0.76494	0.999	P	0.62740	0.906	D	0.85784	0.1363	10	0.15066	T	0.55	-11.3972	17.9297	0.88993	0.0:0.0:1.0:0.0	.	360	Q16795	NDUA9_HUMAN	H	360;119	ENSP00000266544:R360H;ENSP00000439818:R119H	ENSP00000266544:R360H	R	+	2	0	NDUFA9	4666480	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	6.810000	0.75216	2.599000	0.87857	0.655000	0.94253	CGC	NDUFA9	-	NULL	ENSG00000139180		0.542	NDUFA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFA9	HGNC	protein_coding	OTTHUMT00000398900.2	162	0.61	1	G	NM_005002		4796219	4796219	+1	no_errors	ENST00000266544	ensembl	human	known	69_37n	missense	197	21.96	56	SNP	1.000	A
NEBL	10529	genome.wustl.edu	37	10	21186095	21186095	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr10:21186095C>T	ENST00000377122.4	-	1	436	c.40G>A	c.(40-42)Gaa>Aaa	p.E14K	NEBL_ENST00000417816.2_Intron|NEBL_ENST00000377119.1_Missense_Mutation_p.E14K|NEBL_ENST00000377159.4_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	14					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						ttttcttcttcagtttcatct	0.343																																						dbGAP											0													140.0	128.0	132.0					10																	21186095		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.40G>A	10.37:g.21186095C>T	ENSP00000366326:p.Glu14Lys		B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_SH3_domain	p.E14K	ENST00000377122.4	37	c.40	CCDS7134.1	10	.	.	.	.	.	.	.	.	.	.	C	13.55	2.271532	0.40194	.	.	ENSG00000078114	ENST00000377122;ENST00000377119	T;T	0.16897	3.47;2.31	5.76	3.92	0.45320	.	0.312185	0.29587	N	0.011728	T	0.23806	0.0576	L	0.29908	0.895	0.22796	N	0.998728	D	0.60160	0.987	P	0.61722	0.893	T	0.04029	-1.0983	10	0.41790	T	0.15	.	10.1471	0.42771	0.0:0.7924:0.1363:0.0713	.	14	O76041	NEBL_HUMAN	K	14	ENSP00000366326:E14K;ENSP00000366323:E14K	ENSP00000366323:E14K	E	-	1	0	NEBL	21226101	0.402000	0.25311	0.046000	0.18839	0.060000	0.15804	1.920000	0.40025	0.780000	0.33566	0.655000	0.94253	GAA	NEBL	-	NULL	ENSG00000078114		0.343	NEBL-004	KNOWN	basic|CCDS	protein_coding	NEBL	HGNC	protein_coding	OTTHUMT00000047113.1	509	0.00	0	C	NM_006393		21186095	21186095	-1	no_errors	ENST00000377122	ensembl	human	known	69_37n	missense	411	27.89	159	SNP	0.105	T
NEDD4L	23327	genome.wustl.edu	37	18	55833023	55833023	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr18:55833023G>C	ENST00000400345.3	+	2	335	c.52G>C	c.(52-54)Gag>Cag	p.E18Q	NEDD4L_ENST00000382850.4_Missense_Mutation_p.E18Q|NEDD4L_ENST00000588516.1_3'UTR|NEDD4L_ENST00000256832.7_5'UTR|NEDD4L_ENST00000356462.6_Missense_Mutation_p.E18Q|NEDD4L_ENST00000586263.1_Missense_Mutation_p.E10Q|NEDD4L_ENST00000456986.1_5'UTR|NEDD4L_ENST00000357895.5_Missense_Mutation_p.E10Q|NEDD4L_ENST00000435432.2_5'UTR|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000256830.9_Missense_Mutation_p.E18Q	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	18	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						CTCACAGGGAGAGTCCCGTAT	0.378																																						dbGAP											0													133.0	121.0	125.0					18																	55833023		1828	4079	5907	-	-	-	SO:0001583	missense	0			AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.52G>C	18.37:g.55833023G>C	ENSP00000383199:p.Glu18Gln		O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Splice_Site	SNP	-	NULL	ENST00000400345.3	37	c.NULL	CCDS45872.1	18	.	.	.	.	.	.	.	.	.	.	G	12.47	1.946412	0.34377	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000357895	T;T;T;T;T	0.33654	1.43;1.43;1.4;1.42;1.8	5.92	5.92	0.95590	C2 membrane targeting protein (1);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.44498	0.1296	N	0.25825	0.765	0.80722	D	1	B;B;D;P;B	0.55172	0.139;0.139;0.97;0.83;0.081	B;B;P;B;B	0.57283	0.013;0.007;0.817;0.115;0.02	T	0.13845	-1.0494	9	0.38643	T	0.18	.	19.0955	0.93249	0.0:0.0:1.0:0.0	.	10;10;18;18;18	Q96PU5-6;Q96PU5-7;Q96PU5-2;Q96PU5;Q96PU5-5	.;.;.;NED4L_HUMAN;.	Q	18;18;18;18;10	ENSP00000383199:E18Q;ENSP00000372301:E18Q;ENSP00000348847:E18Q;ENSP00000256830:E18Q;ENSP00000350569:E10Q	ENSP00000256830:E18Q	E	+	1	0	NEDD4L	53984021	1.000000	0.71417	1.000000	0.80357	0.417000	0.31264	5.215000	0.65241	2.812000	0.96745	0.563000	0.77884	GAG	NEDD4L	-	-	ENSG00000049759		0.378	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEDD4L	HGNC	protein_coding	OTTHUMT00000448749.1	509	0.00	0	G			55833023	55833023	+1	no_errors	ENST00000591989	ensembl	human	known	69_37n	splice_site	187	48.48	176	SNP	1.000	C
NEIL1	79661	genome.wustl.edu	37	15	75641571	75641571	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr15:75641571C>T	ENST00000564784.1	+	3	954	c.325C>T	c.(325-327)Cgg>Tgg	p.R109W	NEIL1_ENST00000355059.4_Missense_Mutation_p.R109W|NEIL1_ENST00000567959.1_Intron|NEIL1_ENST00000569035.1_Missense_Mutation_p.R109W			Q96FI4	NEIL1_HUMAN	nei endonuclease VIII-like 1 (E. coli)	109					base-excision repair (GO:0006284)|negative regulation of nuclease activity (GO:0032074)|nucleotide-excision repair (GO:0006289)|response to oxidative stress (GO:0006979)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)	13						GCCTGGCCCCCGGCTCGCCCT	0.687								Base excision repair (BER), DNA glycosylases																														dbGAP											0													22.0	25.0	24.0					15																	75641571		2193	4289	6482	-	-	-	SO:0001583	missense	0			AK026055	CCDS10278.1	15q33.33	2008-07-18			ENSG00000140398	ENSG00000140398			18448	protein-coding gene	gene with protein product		608844				11904416	Standard	NM_024608		Approved	FLJ22402, hFPG1, NEI1, FPG1	uc002bae.4	Q96FI4	OTTHUMG00000142821	ENST00000564784.1:c.325C>T	15.37:g.75641571C>T	ENSP00000457352:p.Arg109Trp		D3DW75|Q6ZRA7|Q86XW7|Q9H6C3	Missense_Mutation	SNP	pfam_Endonuclease-VIII_DNA-bd,pfam_DNA_glycosylase/AP_lyase_cat,pfam_DNA_glyclase/AP_lyase_DNA-bd,superfamily_DNA_glycosylase/AP_lyase_cat,superfamily_Ribosomal_S13-like_H2TH,smart_DNA_glycosylase/AP_lyase_cat,pfscan_DNA_glycosylase/AP_lyase_cat	p.R109W	ENST00000564784.1	37	c.325	CCDS10278.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.94|12.94	2.089277|2.089277	0.36855|0.36855	.|.	.|.	ENSG00000140398|ENSG00000140398	ENST00000336572|ENST00000355059	.|T	.|0.30981	.|1.51	5.4|5.4	3.42|3.42	0.39159|0.39159	.|DNA glycosylase/AP lyase, catalytic domain (4);	.|0.610924	.|0.19541	.|N	.|0.111811	T|T	0.36908|0.36908	0.0984|0.0984	L|L	0.57536|0.57536	1.79|1.79	0.19945|0.19945	N|N	0.999941|0.999941	.|D	.|0.76494	.|0.999	.|P	.|0.53689	.|0.732	T|T	0.16188|0.16188	-1.0411|-1.0411	6|10	0.87932|0.51188	D|T	0|0.08	-2.9169|-2.9169	5.4578|5.4578	0.16600|0.16600	0.1483:0.6334:0.1427:0.0756|0.1483:0.6334:0.1427:0.0756	.|.	.|109	.|Q96FI4	.|NEIL1_HUMAN	L|W	94|109	.|ENSP00000347170:R109W	ENSP00000338328:P94L|ENSP00000347170:R109W	P|R	+|+	2|1	0|2	NEIL1|NEIL1	73428624|73428624	0.050000|0.050000	0.20438|0.20438	0.004000|0.004000	0.12327|0.12327	0.034000|0.034000	0.12701|0.12701	0.441000|0.441000	0.21611|0.21611	1.249000|1.249000	0.43950|0.43950	0.561000|0.561000	0.74099|0.74099	CCG|CGG	NEIL1	-	pfam_DNA_glycosylase/AP_lyase_cat,superfamily_DNA_glycosylase/AP_lyase_cat,smart_DNA_glycosylase/AP_lyase_cat,pfscan_DNA_glycosylase/AP_lyase_cat	ENSG00000140398		0.687	NEIL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NEIL1	HGNC	protein_coding	OTTHUMT00000419885.1	20	0.00	0	C	NM_024608		75641571	75641571	+1	no_errors	ENST00000355059	ensembl	human	known	69_37n	missense	11	60.71	17	SNP	0.401	T
NES	10763	genome.wustl.edu	37	1	156639318	156639318	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:156639318C>A	ENST00000368223.3	-	4	4794	c.4662G>T	c.(4660-4662)atG>atT	p.M1554I		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1554	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCAGCCCGTTCATCACTCCCC	0.597																																						dbGAP											0													120.0	100.0	107.0					1																	156639318		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.4662G>T	1.37:g.156639318C>A	ENSP00000357206:p.Met1554Ile		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	pfam_F	p.M1554I	ENST00000368223.3	37	c.4662	CCDS1151.1	1	.	.	.	.	.	.	.	.	.	.	C	1.917	-0.449373	0.04572	.	.	ENSG00000132688	ENST00000368223	D	0.84873	-1.91	4.31	0.099	0.14501	.	.	.	.	.	T	0.40196	0.1107	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28267	-1.0049	9	0.14656	T	0.56	.	2.328	0.04228	0.1403:0.4153:0.2742:0.1702	.	1554	P48681	NEST_HUMAN	I	1554	ENSP00000357206:M1554I	ENSP00000357206:M1554I	M	-	3	0	NES	154905942	0.000000	0.05858	0.002000	0.10522	0.286000	0.27126	-0.430000	0.06973	-0.022000	0.13986	-0.823000	0.03104	ATG	NES	-	NULL	ENSG00000132688		0.597	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	HGNC	protein_coding	OTTHUMT00000082844.2	50	0.00	0	C	NM_006617		156639318	156639318	-1	no_errors	ENST00000368223	ensembl	human	known	69_37n	missense	83	17.00	17	SNP	0.000	A
NES	10763	genome.wustl.edu	37	1	156641606	156641606	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:156641606C>G	ENST00000368223.3	-	4	2506	c.2374G>C	c.(2374-2376)Gac>Cac	p.D792H		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	792	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ATCTCCTGGTCAAGAGACTTC	0.423																																						dbGAP											0													73.0	70.0	71.0					1																	156641606		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.2374G>C	1.37:g.156641606C>G	ENSP00000357206:p.Asp792His		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	pfam_F	p.D792H	ENST00000368223.3	37	c.2374	CCDS1151.1	1	.	.	.	.	.	.	.	.	.	.	C	13.86	2.363786	0.41902	.	.	ENSG00000132688	ENST00000368223	D	0.88586	-2.4	4.24	1.17	0.20885	.	0.228496	0.22348	N	0.061254	D	0.86531	0.5955	L	0.52573	1.65	0.09310	N	1	D	0.89917	1.0	D	0.71184	0.972	T	0.78607	-0.2138	10	0.87932	D	0	.	7.7322	0.28793	0.0:0.7003:0.0:0.2997	.	792	P48681	NEST_HUMAN	H	792	ENSP00000357206:D792H	ENSP00000357206:D792H	D	-	1	0	NES	154908230	0.018000	0.18449	0.035000	0.18076	0.052000	0.14988	0.669000	0.25142	0.348000	0.23949	0.563000	0.77884	GAC	NES	-	NULL	ENSG00000132688		0.423	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	HGNC	protein_coding	OTTHUMT00000082844.2	254	0.00	0	C	NM_006617		156641606	156641606	-1	no_errors	ENST00000368223	ensembl	human	known	69_37n	missense	213	12.35	30	SNP	0.001	G
NFATC2	4773	genome.wustl.edu	37	20	50090599	50090599	+	Silent	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr20:50090599C>G	ENST00000396009.3	-	5	1845	c.1626G>C	c.(1624-1626)gtG>gtC	p.V542V	NFATC2_ENST00000609507.1_Silent_p.V323V|NFATC2_ENST00000414705.1_Silent_p.V522V|NFATC2_ENST00000610033.1_Silent_p.V323V|NFATC2_ENST00000609943.1_Silent_p.V522V|NFATC2_ENST00000371564.3_Silent_p.V542V	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	542	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					AAACCAGTCTCACCCGCGTGT	0.542																																						dbGAP											0													175.0	135.0	149.0					20																	50090599		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.1626G>C	20.37:g.50090599C>G			B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Silent	SNP	pfam_RHD,pfam_IPT_TIG_rcpt,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,prints_NFAT,pfscan_RHD	p.V542	ENST00000396009.3	37	c.1626	CCDS13437.1	20																																																																																			NFATC2	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD	ENSG00000101096		0.542	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFATC2	HGNC	protein_coding	OTTHUMT00000079730.2	199	0.00	0	C	NM_012340		50090599	50090599	-1	no_errors	ENST00000396009	ensembl	human	known	69_37n	silent	284	10.94	35	SNP	1.000	G
NLRC5	84166	genome.wustl.edu	37	16	57075485	57075485	+	Splice_Site	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr16:57075485G>A	ENST00000262510.6	+	18	3253	c.3028G>A	c.(3028-3030)Gac>Aac	p.D1010N	NLRC5_ENST00000436936.1_Splice_Site_p.D1010N|NLRC5_ENST00000308149.7_Splice_Site_p.D1010N|NLRC5_ENST00000539144.1_Splice_Site_p.D1010N	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1010					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CCTCCACCTCGAGTGAGTGGT	0.527																																						dbGAP											0													70.0	67.0	68.0					16																	57075485		2198	4300	6498	-	-	-	SO:0001630	splice_region_variant	0			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.3029+1G>A	16.37:g.57075485G>A			B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_NACHT_NTPase	p.D1010N	ENST00000262510.6	37	c.3028	CCDS10773.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.0|20.0	3.930943|3.930943	0.73327|0.73327	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030|ENST00000538805	T;T;D;T;T;T|.	0.83075|.	-1.16;-1.03;-1.68;-1.03;0.56;1.63|.	3.84|3.84	3.84|3.84	0.44239|0.44239	.|.	0.485871|.	0.15277|.	N|.	0.270885|.	T|T	0.51227|0.51227	0.1662|0.1662	L|L	0.41710|0.41710	1.295|1.295	0.35103|0.35103	D|D	0.765444|0.765444	P;P;B;D|.	0.57571|.	0.948;0.938;0.325;0.98|.	P;B;B;P|.	0.51895|.	0.469;0.241;0.063;0.683|.	T|T	0.58572|0.58572	-0.7613|-0.7613	10|5	0.48119|.	T|.	0.1|.	.|.	11.5689|11.5689	0.50822|0.50822	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1010;1010;1010;1010|.	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3|.	.;.;.;NLRC5_HUMAN|.	N|Q	1010;1010;1010;484;1010;517;309|762	ENSP00000262510:D1010N;ENSP00000308886:D1010N;ENSP00000389739:D1010N;ENSP00000441727:D1010N;ENSP00000441597:D517N;ENSP00000440153:D309N|.	ENSP00000262510:D1010N|.	D|R	+|+	1|2	0|0	NLRC5|NLRC5	55632986|55632986	0.983000|0.983000	0.35010|0.35010	0.967000|0.967000	0.41034|0.41034	0.131000|0.131000	0.20780|0.20780	2.240000|2.240000	0.43088|0.43088	2.428000|2.428000	0.82296|0.82296	0.655000|0.655000	0.94253|0.94253	GAC|CGA	NLRC5	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000140853		0.527	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1	133	0.00	0	G	NM_032206	Missense_Mutation	57075485	57075485	+1	no_errors	ENST00000262510	ensembl	human	known	69_37n	missense	68	42.37	50	SNP	0.971	A
NLRP1	22861	genome.wustl.edu	37	17	5418221	5418221	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:5418221C>G	ENST00000572272.1	-	17	4274	c.4275G>C	c.(4273-4275)caG>caC	p.Q1425H	NLRP1_ENST00000262467.5_Intron|RNU7-31P_ENST00000517262.1_RNA|NLRP1_ENST00000345221.3_Missense_Mutation_p.Q1381H|NLRP1_ENST00000354411.3_Missense_Mutation_p.Q1395H|NLRP1_ENST00000577119.1_Missense_Mutation_p.Q1351H|NLRP1_ENST00000269280.4_Missense_Mutation_p.Q1381H			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	1425	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				GCTTCCGCATCTGGCTGGGCC	0.567																																						dbGAP											0													72.0	77.0	75.0					17																	5418221		2103	4224	6327	-	-	-	SO:0001583	missense	0			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.4275G>C	17.37:g.5418221C>G	ENSP00000460475:p.Gln1425His		E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	pfam_CARD,pfam_DAPIN,pfam_Leu-rich_rpt,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD,pfscan_DAPIN,prints_Disease_R	p.Q1425H	ENST00000572272.1	37	c.4275	CCDS42246.1	17	.	.	.	.	.	.	.	.	.	.	C	16.50	3.140737	0.56936	.	.	ENSG00000091592	ENST00000269280;ENST00000354411;ENST00000345221	T;T	0.22539	1.95;1.95	5.07	3.05	0.35203	DEATH-like (2);Caspase Recruitment (2);	0.681943	0.12147	N	0.495287	T	0.33235	0.0856	L	0.54323	1.7	0.25140	N	0.990508	D;D;D;D	0.55800	0.966;0.966;0.973;0.966	P;P;P;P	0.57960	0.739;0.739;0.83;0.739	T	0.07888	-1.0749	10	0.72032	D	0.01	.	7.5769	0.27942	0.0:0.7281:0.0:0.2719	.	1351;1395;1425;1381	Q9C000-3;Q9C000-4;Q9C000;Q9C000-2	.;.;NALP1_HUMAN;.	H	1425;1395;1381	ENSP00000346390:Q1395H;ENSP00000324366:Q1381H	ENSP00000269280:Q1425H	Q	-	3	2	NLRP1	5358945	0.901000	0.30685	0.704000	0.30370	0.587000	0.36485	0.657000	0.24963	1.288000	0.44600	0.650000	0.86243	CAG	NLRP1	-	pfam_CARD,superfamily_DEATH-like,pfscan_CARD	ENSG00000091592		0.567	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP1	HGNC	protein_coding	OTTHUMT00000439517.1	211	0.00	0	C	NM_033004		5418221	5418221	-1	no_errors	ENST00000572272	ensembl	human	known	69_37n	missense	121	19.33	29	SNP	0.907	G
NMRK2	27231	genome.wustl.edu	37	19	3938653	3938653	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:3938653G>A	ENST00000168977.2	+	5	509	c.219G>A	c.(217-219)ctG>ctA	p.L73L	NMRK2_ENST00000593949.1_Silent_p.L78L|NMRK2_ENST00000599576.1_Silent_p.L64L	NM_170678.2	NP_733778.1	Q9NPI5	NRK2_HUMAN	nicotinamide riboside kinase 2	73					NAD biosynthetic process (GO:0009435)|negative regulation of myoblast differentiation (GO:0045662)	intracellular (GO:0005622)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|ribosylnicotinamide kinase activity (GO:0050262)										AGGCCTGGCTGAGCAGCCCGC	0.647																																						dbGAP											0													53.0	45.0	47.0					19																	3938653		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF190819	CCDS12115.1, CCDS74259.1	19p13.3	2013-10-28	2012-05-31	2012-05-31	ENSG00000077009	ENSG00000077009			17871	protein-coding gene	gene with protein product	"""muscle-specific beta 1 integrin binding protein"", ""nicotinamide riboside kinase 2"""	608705	"""integrin beta 1 binding protein 3"""	ITGB1BP3		10613898, 15137942	Standard	NM_170678		Approved	MIBP, NRK2	uc002lyz.4	Q9NPI5	OTTHUMG00000181758	ENST00000168977.2:c.219G>A	19.37:g.3938653G>A			B7ZKR3|Q52M81|Q9NZK3	Silent	SNP	NULL	p.L73	ENST00000168977.2	37	c.219	CCDS12115.1	19																																																																																			NMRK2	-	NULL	ENSG00000077009		0.647	NMRK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NMRK2	HGNC	protein_coding	OTTHUMT00000457492.1	42	0.00	0	G	NM_014446, NM_170678		3938653	3938653	+1	no_errors	ENST00000168977	ensembl	human	known	69_37n	silent	15	70.59	36	SNP	0.009	A
NREP	9315	genome.wustl.edu	37	5	111311071	111311071	+	Intron	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr5:111311071C>T	ENST00000450761.2	-	1	141				NREP-AS1_ENST00000503242.1_RNA|NREP-AS1_ENST00000507222.1_RNA|NREP_ENST00000395634.3_Missense_Mutation_p.R12Q			Q16612	NREP_HUMAN	neuronal regeneration related protein						axon regeneration (GO:0031103)|regulation of neuron differentiation (GO:0045664)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											ATCTTCTCTTCGGCTCTGCAG	0.498																																						dbGAP											0													277.0	240.0	251.0					5																	111311071		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF119859	CCDS4105.1, CCDS47255.1	5q22.1	2012-12-07	2012-12-07	2012-01-23	ENSG00000134986	ENSG00000134986			16834	protein-coding gene	gene with protein product	"""neuronal protein 3.1"""	607332	"""chromosome 5 open reading frame 13"", ""neuronal regeneration related protein homolog (rat)"""	C5orf13		8261136, 10981724, 15485502	Standard	NM_004772		Approved	P311, D4S114, PRO1873, PTZ17, SEZ17	uc011cvr.2	Q16612	OTTHUMG00000128795	ENST00000450761.2:c.57+21949G>A	5.37:g.111311071C>T			B2RDN8|B7Z5D2|D3DSZ8	Missense_Mutation	SNP	pfam_Neuronal_3.1	p.R12Q	ENST00000450761.2	37	c.35	CCDS4105.1	5	.	.	.	.	.	.	.	.	.	.	C	9.857	1.195220	0.22037	.	.	ENSG00000134986	ENST00000395634	T	0.52754	0.65	2.57	-2.1	0.07210	.	.	.	.	.	T	0.32675	0.0837	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.21759	-1.0236	8	0.87932	D	0	.	5.1964	0.15241	0.0:0.4239:0.3254:0.2507	.	12	B7Z5D2	.	Q	12	ENSP00000378996:R12Q	ENSP00000378996:R12Q	R	-	2	0	C5orf13	111338970	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.454000	0.06770	-1.033000	0.03299	-2.034000	0.00421	CGA	NREP	-	NULL	ENSG00000134986		0.498	NREP-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NREP	HGNC	protein_coding	OTTHUMT00000370888.1	365	0.00	0	C	NM_004772		111311071	111311071	-1	no_errors	ENST00000395634	ensembl	human	known	69_37n	missense	285	15.63	53	SNP	0.000	T
NRG3	10718	genome.wustl.edu	37	10	84738797	84738797	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr10:84738797C>G	ENST00000404547.1	+	8	1504	c.1504C>G	c.(1504-1506)Cta>Gta	p.L502V	NRG3_ENST00000404576.2_Missense_Mutation_p.L306V|NRG3_ENST00000537893.1_Missense_Mutation_p.L152V|NRG3_ENST00000372142.2_Missense_Mutation_p.L281V|NRG3_ENST00000556918.1_Missense_Mutation_p.L332V|NRG3_ENST00000545131.1_Missense_Mutation_p.L152V|NRG3_ENST00000372141.2_Missense_Mutation_p.L502V			P56975	NRG3_HUMAN	neuregulin 3	502					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		CCGAAGTAGGCTAGGTGGAAT	0.537																																						dbGAP											0													104.0	91.0	95.0					10																	84738797		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1504C>G	10.37:g.84738797C>G	ENSP00000384796:p.Leu502Val		A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	pfscan_EG-like_dom	p.L502V	ENST00000404547.1	37	c.1504	CCDS31233.1	10	.	.	.	.	.	.	.	.	.	.	C	18.13	3.556179	0.65425	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	T;T;T;T;T;T;T	0.62941	0.54;0.86;0.84;-0.01;-0.01;-0.01;-0.01	5.79	4.89	0.63831	.	0.460849	0.18152	N	0.150076	T	0.74696	0.3750	L	0.54323	1.7	0.41430	D	0.987853	D;P;D;D	0.71674	0.998;0.792;0.998;0.998	D;B;D;D	0.83275	0.99;0.342;0.996;0.99	T	0.76484	-0.2942	10	0.87932	D	0	-44.195	12.9889	0.58608	0.0:0.9218:0.0:0.0782	.	501;502;281;502	B9EGV5;P56975;P56975-3;P56975-4	.;NRG3_HUMAN;.;.	V	502;502;501;281;306;332;152;152	ENSP00000361214:L502V;ENSP00000384796:L502V;ENSP00000361215:L281V;ENSP00000385804:L306V;ENSP00000451376:L332V;ENSP00000441201:L152V;ENSP00000440377:L152V	ENSP00000361214:L502V	L	+	1	2	NRG3	84728777	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	1.932000	0.40143	1.475000	0.48197	0.558000	0.71614	CTA	NRG3	-	NULL	ENSG00000185737		0.537	NRG3-005	KNOWN	basic|CCDS	protein_coding	NRG3	HGNC	protein_coding	OTTHUMT00000412262.1	179	0.00	0	C	XM_166086		84738797	84738797	+1	no_errors	ENST00000404547	ensembl	human	known	69_37n	missense	338	11.52	44	SNP	1.000	G
NUP107	57122	genome.wustl.edu	37	12	69103830	69103830	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:69103830G>A	ENST00000229179.4	+	10	1179	c.847G>A	c.(847-849)Gaa>Aaa	p.E283K	NUP107_ENST00000539906.1_Missense_Mutation_p.E254K|NUP107_ENST00000378905.2_Missense_Mutation_p.E132K	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	283					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)		NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			TGAAATTGGAGAATTTTCTGA	0.284																																						dbGAP											0													81.0	85.0	84.0					12																	69103830		2202	4297	6499	-	-	-	SO:0001583	missense	0			AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.847G>A	12.37:g.69103830G>A	ENSP00000229179:p.Glu283Lys		B4DZ67|Q6PJE1	Missense_Mutation	SNP	pfam_Nup84_Nup100	p.E283K	ENST00000229179.4	37	c.847	CCDS8985.1	12	.	.	.	.	.	.	.	.	.	.	G	15.69	2.909110	0.52439	.	.	ENSG00000111581	ENST00000229179;ENST00000378905;ENST00000539906	.	.	.	5.22	5.22	0.72569	.	0.190151	0.53938	D	0.000049	T	0.45175	0.1329	L	0.27053	0.805	0.44359	D	0.997258	B;B;B	0.19583	0.037;0.002;0.037	B;B;B	0.27170	0.077;0.027;0.041	T	0.30937	-0.9961	8	.	.	.	-11.2662	13.5074	0.61491	0.0777:0.0:0.9223:0.0	.	254;132;283	B4DZ67;Q6PJE1;P57740	.;.;NU107_HUMAN	K	283;132;254	.	.	E	+	1	0	NUP107	67390097	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.334000	0.79224	2.601000	0.87937	0.557000	0.71058	GAA	NUP107	-	pfam_Nup84_Nup100	ENSG00000111581		0.284	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP107	HGNC	protein_coding	OTTHUMT00000403195.1	316	0.00	0	G	NM_020401		69103830	69103830	+1	no_errors	ENST00000229179	ensembl	human	known	69_37n	missense	260	10.31	30	SNP	1.000	A
OASL	8638	genome.wustl.edu	37	12	121469412	121469412	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:121469412G>T	ENST00000257570.5	-	3	760	c.490C>A	c.(490-492)Ctt>Att	p.L164I	OASL_ENST00000339275.5_Missense_Mutation_p.L164I	NM_003733.3	NP_003724.1	Q15646	OASL_HUMAN	2'-5'-oligoadenylate synthetase-like	164					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|transferase activity (GO:0016740)			NS(1)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GAGTTGGGAAGAGAAGGCCCT	0.542																																					Colon(192;517 2041 31392 31913 39966)	dbGAP											0													53.0	53.0	53.0					12																	121469412		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF063611	CCDS9211.1, CCDS9212.1, CCDS73536.1	12q24.2	2008-08-05			ENSG00000135114	ENSG00000135114			8090	protein-coding gene	gene with protein product		603281				10087211	Standard	NM_003733		Approved	TRIP14, p59OASL	uc001tzj.2	Q15646	OTTHUMG00000154981	ENST00000257570.5:c.490C>A	12.37:g.121469412G>T	ENSP00000257570:p.Leu164Ile		B2RAZ2|I1YDD2|O75686|Q17R95|Q9Y6K6|Q9Y6K7	Missense_Mutation	SNP	pfam_2-5-oligoAdlate_synth_1_dom2/C,pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_2-5-oligoadenylate_synth_N,pfscan_Ubiquitin_supergroup	p.L164I	ENST00000257570.5	37	c.490	CCDS9211.1	12	.	.	.	.	.	.	.	.	.	.	G	10.47	1.359996	0.24598	.	.	ENSG00000135114	ENST00000257570;ENST00000339275	T;T	0.08282	3.11;3.11	5.52	-4.8	0.03190	.	3.179800	0.01603	N	0.022161	T	0.03564	0.0102	N	0.03608	-0.345	0.09310	N	1	B;B	0.23735	0.09;0.002	B;B	0.22880	0.042;0.008	T	0.36286	-0.9754	10	0.29301	T	0.29	-10.1732	5.2047	0.15285	0.3158:0.1767:0.4357:0.0718	.	164;164	Q15646-2;Q15646	.;OASL_HUMAN	I	164	ENSP00000257570:L164I;ENSP00000341125:L164I	ENSP00000257570:L164I	L	-	1	0	OASL	119953795	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.310000	0.08135	-0.673000	0.05259	-0.256000	0.11100	CTT	OASL	-	NULL	ENSG00000135114		0.542	OASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OASL	HGNC	protein_coding	OTTHUMT00000337875.2	88	0.00	0	G	NM_003733		121469412	121469412	-1	no_errors	ENST00000257570	ensembl	human	known	69_37n	missense	79	17.71	17	SNP	0.000	T
OBSL1	23363	genome.wustl.edu	37	2	220416900	220416900	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:220416900C>T	ENST00000404537.1	-	19	5403	c.5347G>A	c.(5347-5349)Gag>Aag	p.E1783K	OBSL1_ENST00000373876.1_Missense_Mutation_p.E1691K|OBSL1_ENST00000265318.4_3'UTR	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	1783					cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CCGGCGTCCTCGGCGCGCAGC	0.662																																						dbGAP											0													15.0	17.0	17.0					2																	220416900		1895	4095	5990	-	-	-	SO:0001583	missense	0			BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.5347G>A	2.37:g.220416900C>T	ENSP00000385636:p.Glu1783Lys		A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E1783K	ENST00000404537.1	37	c.5347	CCDS46520.1	2	.	.	.	.	.	.	.	.	.	.	C	15.98	2.992738	0.54041	.	.	ENSG00000124006	ENST00000404537;ENST00000373876	T;T	0.47528	0.84;0.84	4.76	4.76	0.60689	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.62307	0.2417	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.55970	-0.8056	9	0.17832	T	0.49	.	15.2908	0.73865	0.0:1.0:0.0:0.0	.	1783	O75147	OBSL1_HUMAN	K	1783;1691	ENSP00000385636:E1783K;ENSP00000362983:E1691K	ENSP00000362983:E1691K	E	-	1	0	OBSL1	220125144	1.000000	0.71417	0.932000	0.37286	0.407000	0.30961	6.393000	0.73217	2.456000	0.83038	0.655000	0.94253	GAG	OBSL1	-	pfam_Ig_I-set,smart_Ig_sub	ENSG00000124006		0.662	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	OBSL1	HGNC	protein_coding	OTTHUMT00000322012.1	32	0.00	0	C			220416900	220416900	-1	no_errors	ENST00000404537	ensembl	human	known	69_37n	missense	41	41.43	29	SNP	0.998	T
TENM4	26011	genome.wustl.edu	37	11	78380233	78380233	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:78380233C>A	ENST00000278550.7	-	32	7619	c.7157G>T	c.(7156-7158)gGg>gTg	p.G2386V		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2386					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GTAGATCTCCCCATAGGCTGT	0.488																																						dbGAP											0													63.0	63.0	63.0					11																	78380233		1954	4149	6103	-	-	-	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.7157G>T	11.37:g.78380233C>A	ENSP00000278550:p.Gly2386Val		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.G2386V	ENST00000278550.7	37	c.7157	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	C	18.17	3.564795	0.65651	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;D	0.99194	-5.54;-2.81	5.67	4.76	0.60689	Rhs repeat-associated core (1);	0.000000	0.85682	D	0.000000	D	0.99465	0.9810	H	0.95004	3.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98300	1.0518	9	.	.	.	.	14.7195	0.69294	0.0:0.9307:0.0:0.0693	.	2386	Q6N022	TEN4_HUMAN	V	2386;850	ENSP00000278550:G2386V;ENSP00000431711:G850V	.	G	-	2	0	ODZ4	78057881	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.818000	0.86416	1.405000	0.46838	0.655000	0.94253	GGG	ODZ4	-	tigrfam_Rhs_assc_core	ENSG00000149256		0.488	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ4	HGNC	protein_coding	OTTHUMT00000391406.2	228	0.00	0	C			78380233	78380233	-1	no_errors	ENST00000278550	ensembl	human	known	69_37n	missense	89	56.37	115	SNP	1.000	A
OPLAH	26873	genome.wustl.edu	37	8	145112528	145112528	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr8:145112528G>A	ENST00000426825.1	-	10	1326	c.1245C>T	c.(1243-1245)aaC>aaT	p.N415N	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	415					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			AAAGTGGTTGGTTCTCTCCCG	0.652																																						dbGAP											0													18.0	23.0	22.0					8																	145112528		2016	4160	6176	-	-	-	SO:0001819	synonymous_variant	0			AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.1245C>T	8.37:g.145112528G>A			A5PKY8|Q75W65|Q9Y4Q0	RNA	SNP	-	NULL	ENST00000426825.1	37	NULL		8																																																																																			OPLAH	-	-	ENSG00000178814		0.652	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	OPLAH	HGNC	protein_coding		38	0.00	0	G	NM_017570		145112528	145112528	-1	no_errors	ENST00000426825	ensembl	human	known	69_37n	rna	27	47.17	25	SNP	1.000	A
OR10J3	441911	genome.wustl.edu	37	1	159283656	159283656	+	Missense_Mutation	SNP	G	G	C	rs201200946		TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:159283656G>C	ENST00000332217.5	-	1	793	c.794C>G	c.(793-795)tCc>tGc	p.S265C		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					GGAACTCTGGGACTTAGGCTT	0.537																																						dbGAP											0													123.0	108.0	113.0					1																	159283656		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.794C>G	1.37:g.159283656G>C	ENSP00000331789:p.Ser265Cys			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S265C	ENST00000332217.5	37	c.794	CCDS30909.1	1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.309472	0.60414	.	.	ENSG00000196266	ENST00000332217	T	0.00277	8.34	5.34	5.34	0.76211	.	0.000000	0.32624	U	0.005846	T	0.00608	0.0020	M	0.93420	3.415	0.35895	D	0.829967	D	0.89917	1.0	D	0.79108	0.992	T	0.53627	-0.8412	10	0.87932	D	0	.	16.5708	0.84612	0.0:0.0:1.0:0.0	.	265	Q5JRS4	O10J3_HUMAN	C	265	ENSP00000331789:S265C	ENSP00000331789:S265C	S	-	2	0	OR10J3	157550280	0.070000	0.21116	1.000000	0.80357	0.808000	0.45660	2.604000	0.46274	2.765000	0.95021	0.655000	0.94253	TCC	OR10J3	-	pfam_7TM_GPCR_Rhodpsn	ENSG00000196266		0.537	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J3	HGNC	protein_coding	OTTHUMT00000090629.1	255	0.00	0	G			159283656	159283656	-1	no_errors	ENST00000332217	ensembl	human	known	69_37n	missense	203	43.92	159	SNP	0.997	C
OR2D3	120775	genome.wustl.edu	37	11	6942948	6942948	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:6942948C>A	ENST00000317834.3	+	1	744	c.716C>A	c.(715-717)tCc>tAc	p.S239Y		NM_001004684.1	NP_001004684.1	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D, member 3	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|prostate(3)|skin(1)|stomach(1)	27		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AATATTATCTCCACTGTTATC	0.463																																						dbGAP											0													110.0	96.0	101.0					11																	6942948		2201	4296	6497	-	-	-	SO:0001583	missense	0			BK004294	CCDS31417.1	11p15.4	2012-08-09			ENSG00000178358	ENSG00000178358		"""GPCR / Class A : Olfactory receptors"""	15146	protein-coding gene	gene with protein product							Standard	NM_001004684		Approved		uc010rav.2	Q8NGH3	OTTHUMG00000165742	ENST00000317834.3:c.716C>A	11.37:g.6942948C>A	ENSP00000320560:p.Ser239Tyr		B2RP06|Q6IFG8|Q96R51	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S239Y	ENST00000317834.3	37	c.716	CCDS31417.1	11	.	.	.	.	.	.	.	.	.	.	C	4.295	0.054046	0.08291	.	.	ENSG00000178358	ENST00000317834	T	0.36699	1.24	5.17	1.18	0.20946	GPCR, rhodopsin-like superfamily (1);	0.592517	0.14459	N	0.318307	T	0.25938	0.0632	L	0.56280	1.765	0.26501	N	0.974767	B	0.20459	0.045	B	0.23852	0.049	T	0.30794	-0.9966	10	0.08837	T	0.75	-32.9494	4.4668	0.11692	0.0:0.4277:0.3351:0.2372	.	239	Q8NGH3	OR2D3_HUMAN	Y	239	ENSP00000320560:S239Y	ENSP00000320560:S239Y	S	+	2	0	OR2D3	6899524	0.000000	0.05858	0.998000	0.56505	0.548000	0.35241	-1.389000	0.02530	0.420000	0.25954	-0.140000	0.14226	TCC	OR2D3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000178358		0.463	OR2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2D3	HGNC	protein_coding	OTTHUMT00000385987.1	381	0.00	0	C	NM_001004684		6942948	6942948	+1	no_errors	ENST00000317834	ensembl	human	known	69_37n	missense	262	37.38	157	SNP	0.671	A
OR2M4	26245	genome.wustl.edu	37	1	248402510	248402510	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:248402510C>T	ENST00000306687.1	+	1	280	c.280C>T	c.(280-282)Ctg>Ttg	p.L94L		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	94					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ATCTATCTCTCTGGCAGGTTG	0.468																																						dbGAP											0													150.0	131.0	137.0					1																	248402510		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.280C>T	1.37:g.248402510C>T			Q15611|Q8NG82	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L94	ENST00000306687.1	37	c.280	CCDS31108.1	1																																																																																			OR2M4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000171180		0.468	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M4	HGNC	protein_coding	OTTHUMT00000097352.1	625	0.00	0	C	NM_017504		248402510	248402510	+1	no_errors	ENST00000306687	ensembl	human	known	69_37n	silent	591	36.85	346	SNP	0.000	T
OR4C16	219428	genome.wustl.edu	37	11	55340352	55340352	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:55340352G>T	ENST00000314634.3	+	1	749	c.749G>T	c.(748-750)gGa>gTa	p.G250V		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				TTGTTCTTTGGACCTTGCATA	0.408																																						dbGAP											0													173.0	144.0	154.0					11																	55340352		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.749G>T	11.37:g.55340352G>T	ENSP00000324913:p.Gly250Val		Q6IEV8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G250V	ENST00000314634.3	37	c.749	CCDS31502.1	11	.	.	.	.	.	.	.	.	.	.	G	0.593	-0.832188	0.02713	.	.	ENSG00000181935	ENST00000314634	T	0.35605	1.3	4.68	-1.41	0.08941	GPCR, rhodopsin-like superfamily (1);	0.308881	0.28031	N	0.016864	T	0.25494	0.0620	L	0.46614	1.455	0.20403	N	0.999903	B	0.23854	0.092	B	0.33339	0.162	T	0.39078	-0.9631	10	0.02654	T	1	.	9.6359	0.39806	0.0:0.1079:0.393:0.4991	.	250	Q8NGL9	OR4CG_HUMAN	V	250	ENSP00000324913:G250V	ENSP00000324913:G250V	G	+	2	0	OR4C16	55096928	0.000000	0.05858	0.354000	0.25760	0.990000	0.78478	-3.583000	0.00423	-0.055000	0.13244	0.549000	0.68633	GGA	OR4C16	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181935		0.408	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C16	HGNC	protein_coding	OTTHUMT00000382627.1	332	0.00	0	G	NM_001004701		55340352	55340352	+1	no_errors	ENST00000314634	ensembl	human	known	69_37n	missense	299	16.71	60	SNP	0.008	T
OR4K1	79544	genome.wustl.edu	37	14	20404299	20404299	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr14:20404299C>T	ENST00000285600.4	+	1	533	c.474C>T	c.(472-474)agC>agT	p.S158S		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		ATTCTGTGAGCCACTTGGCTT	0.478																																						dbGAP											0													130.0	129.0	130.0					14																	20404299		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.474C>T	14.37:g.20404299C>T			B9EKV9|Q8NGD6|Q96R73	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S158	ENST00000285600.4	37	c.474	CCDS32025.1	14																																																																																			OR4K1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000155249		0.478	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K1	HGNC	protein_coding	OTTHUMT00000409881.1	393	0.00	0	C			20404299	20404299	+1	no_errors	ENST00000285600	ensembl	human	known	69_37n	silent	386	27.56	148	SNP	0.006	T
OR52E4	390081	genome.wustl.edu	37	11	5905606	5905606	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:5905606G>A	ENST00000316987.2	+	1	106	c.84G>A	c.(82-84)tgG>tgA	p.W28*		NM_001005165.1	NP_001005165.1	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E, member 4	28						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(2)|prostate(1)|skin(2)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TACATATCTGGATTTCTTTCC	0.443																																						dbGAP											0													203.0	193.0	196.0					11																	5905606		2201	4296	6497	-	-	-	SO:0001587	stop_gained	0			AB065817	CCDS31401.1	11p15.4	2012-08-09			ENSG00000180974	ENSG00000180974		"""GPCR / Class A : Olfactory receptors"""	15213	protein-coding gene	gene with protein product							Standard	NM_001005165		Approved		uc010qzs.2	Q8NGH9	OTTHUMG00000168804	ENST00000316987.2:c.84G>A	11.37:g.5905606G>A	ENSP00000321426:p.Trp28*		Q6IFG0	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.W28*	ENST00000316987.2	37	c.84	CCDS31401.1	11	.	.	.	.	.	.	.	.	.	.	G	18.34	3.602125	0.66445	.	.	ENSG00000180974	ENST00000316987	.	.	.	5.04	4.13	0.48395	.	0.000000	0.47093	D	0.000248	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.7829	0.34802	0.0845:0.1524:0.7632:0.0	.	.	.	.	X	28	.	ENSP00000321426:W28X	W	+	3	0	OR52E4	5862182	1.000000	0.71417	1.000000	0.80357	0.675000	0.39556	1.187000	0.32090	1.340000	0.45581	0.643000	0.83706	TGG	OR52E4	-	prints_7TM_GPCR_Rhodpsn	ENSG00000180974		0.443	OR52E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E4	HGNC	protein_coding	OTTHUMT00000401146.1	332	0.00	0	G	NM_001005165		5905606	5905606	+1	no_errors	ENST00000316987	ensembl	human	known	69_37n	nonsense	205	40.23	138	SNP	0.999	A
OR5M8	219484	genome.wustl.edu	37	11	56258639	56258639	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:56258639G>A	ENST00000327216.2	-	1	232	c.208C>T	c.(208-210)Ctg>Ttg	p.L70L		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					GAGAAGCACAGATCCACGAAG	0.488																																						dbGAP											0													80.0	77.0	78.0					11																	56258639		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.208C>T	11.37:g.56258639G>A			B2RNM5|Q6IEW3|Q96RB8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L70	ENST00000327216.2	37	c.208	CCDS31533.1	11																																																																																			OR5M8	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000181371		0.488	OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M8	HGNC	protein_coding	OTTHUMT00000391641.1	107	0.00	0	G	NM_001005282		56258639	56258639	-1	no_errors	ENST00000327216	ensembl	human	known	69_37n	silent	42	58.00	58	SNP	0.378	A
OR6P1	128366	genome.wustl.edu	37	1	158532579	158532579	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:158532579C>T	ENST00000334632.1	-	1	815	c.816G>A	c.(814-816)aaG>aaA	p.K272K		NM_001160325.1	NP_001153797.1	Q8NGX9	OR6P1_HUMAN	olfactory receptor, family 6, subfamily P, member 1	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|lung(1)	6						CAGAGATAATCTTGTTGTGGT	0.507																																						dbGAP											0													174.0	139.0	150.0					1																	158532579		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BK004193	CCDS53391.1	1q23.1	2012-08-09			ENSG00000186440	ENSG00000186440		"""GPCR / Class A : Olfactory receptors"""	15036	protein-coding gene	gene with protein product							Standard	NM_001160325		Approved		uc010pim.2	Q8NGX9	OTTHUMG00000019633	ENST00000334632.1:c.816G>A	1.37:g.158532579C>T			Q6IFR9	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.K272	ENST00000334632.1	37	c.816	CCDS53391.1	1																																																																																			OR6P1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000186440		0.507	OR6P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6P1	HGNC	protein_coding	OTTHUMT00000051848.1	292	0.00	0	C			158532579	158532579	-1	no_errors	ENST00000334632	ensembl	human	known	69_37n	silent	272	35.39	149	SNP	0.069	T
OSBP2	23762	genome.wustl.edu	37	22	31301872	31301872	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr22:31301872C>T	ENST00000332585.6	+	13	2528	c.2424C>T	c.(2422-2424)ctC>ctT	p.L808L	OSBP2_ENST00000403222.3_Silent_p.L642L|OSBP2_ENST00000535268.1_Silent_p.L352L|OSBP2_ENST00000382310.3_Silent_p.L759L|OSBP2_ENST00000407373.1_Silent_p.L635L|OSBP2_ENST00000437268.2_Silent_p.L550L|OSBP2_ENST00000401475.1_Silent_p.L441L|OSBP2_ENST00000446658.2_Silent_p.L807L	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	808					lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						CCCTGACCCTCAACGAGCACG	0.667																																						dbGAP											0													26.0	35.0	32.0					22																	31301872		2160	4258	6418	-	-	-	SO:0001819	synonymous_variant	0				CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.2424C>T	22.37:g.31301872C>T			B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Nonsense_Mutation	SNP	pfam_Oxysterol-bd	p.Q378*	ENST00000332585.6	37	c.1132	CCDS43002.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.01|18.01	3.527957|3.527957	0.64860|0.64860	.|.	.|.	ENSG00000184792|ENSG00000184792	ENST00000452656|ENST00000431368	.|.	.|.	.|.	4.64|4.64	1.1|1.1	0.20463|0.20463	.|.	.|.	.|.	.|.	.|.	.|T	.|0.58380	.|0.2118	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.52094	.|-0.8621	.|4	0.29301|.	T|.	0.29|.	-19.7823|-19.7823	10.263|10.263	0.43438|0.43438	0.11:0.2475:0.6425:0.0|0.11:0.2475:0.6425:0.0	.|.	.|.	.|.	.|.	X|L	378|480	.|.	ENSP00000409838:Q378X|.	Q|S	+|+	1|2	0|0	OSBP2|OSBP2	29631872|29631872	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.869000|0.869000	0.49853|0.49853	0.365000|0.365000	0.20348|0.20348	0.158000|0.158000	0.19367|0.19367	0.555000|0.555000	0.69702|0.69702	CAA|TCA	OSBP2	-	NULL	ENSG00000184792		0.667	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBP2	HGNC	protein_coding	OTTHUMT00000321547.2	22	0.00	0	C	NM_030758		31301872	31301872	+1	no_start_codon	ENST00000452656	ensembl	human	novel	69_37n	nonsense	20	25.93	7	SNP	1.000	T
PADI3	51702	genome.wustl.edu	37	1	17599840	17599840	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:17599840G>C	ENST00000375460.3	+	10	1093	c.1053G>C	c.(1051-1053)gaG>gaC	p.E351D		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	351					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	TGCAGGATGAGATGGAGCTGG	0.597																																						dbGAP											0													58.0	56.0	57.0					1																	17599840		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.1053G>C	1.37:g.17599840G>C	ENSP00000364609:p.Glu351Asp		Q58EY7|Q70SX5	Missense_Mutation	SNP	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.E351D	ENST00000375460.3	37	c.1053	CCDS179.1	1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.194447	0.78902	.	.	ENSG00000142619	ENST00000375460	T	0.31769	1.48	5.41	3.55	0.40652	Protein-arginine deiminase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.49508	0.1561	M	0.90977	3.165	0.41571	D	0.988681	P	0.38745	0.645	P	0.47118	0.538	T	0.52351	-0.8587	10	0.54805	T	0.06	-29.6271	8.9742	0.35926	0.2421:0.0:0.7579:0.0	.	351	Q9ULW8	PADI3_HUMAN	D	351	ENSP00000364609:E351D	ENSP00000364609:E351D	E	+	3	2	PADI3	17472427	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	2.981000	0.49329	0.662000	0.31006	0.511000	0.50034	GAG	PADI3	-	pfam_PAD_C,pirsf_Protein-arginine_deiminase_sub	ENSG00000142619		0.597	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI3	HGNC	protein_coding	OTTHUMT00000006805.1	102	0.00	0	G			17599840	17599840	+1	no_errors	ENST00000375460	ensembl	human	known	69_37n	missense	60	15.28	11	SNP	1.000	C
PAGE2	203569	genome.wustl.edu	37	X	55117845	55117845	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chrX:55117845G>A	ENST00000374968.4	+	4	378	c.274G>A	c.(274-276)Gag>Aag	p.E92K	PAGE2_ENST00000374965.1_Missense_Mutation_p.E75K	NM_207339.2	NP_997222.1	Q7Z2X7	PAGE2_HUMAN	P antigen family, member 2 (prostate associated)	92										endometrium(1)|large_intestine(2)|lung(1)|ovary(2)	6						TGATGTCAGGGAGGGTATTAT	0.398																																						dbGAP											0													165.0	182.0	176.0					X																	55117845		2172	4296	6468	-	-	-	SO:0001583	missense	0			BC054022	CCDS14367.1	Xp11.22	2009-06-17			ENSG00000234068	ENSG00000234068			31804	protein-coding gene	gene with protein product		300738	"""G antigen, family C, 2"""	GAGEC2		9724777	Standard	NM_207339		Approved	MGC62094, PAGE-2, CT16.4		Q7Z2X7	OTTHUMG00000021648	ENST00000374968.4:c.274G>A	X.37:g.55117845G>A	ENSP00000364107:p.Glu92Lys		Q5JRK7|Q5JRK8	Missense_Mutation	SNP	pfam_GAGE	p.E92K	ENST00000374968.4	37	c.274	CCDS14367.1	X	.	.	.	.	.	.	.	.	.	.	g	6.387	0.439477	0.12104	.	.	ENSG00000234068	ENST00000374968;ENST00000374965	T;T	0.10668	2.85;2.85	0.916	-1.17	0.09648	.	.	.	.	.	T	0.10380	0.0254	M	0.74258	2.255	0.09310	N	1	B	0.15719	0.014	B	0.17098	0.017	T	0.47129	-0.9141	9	0.11182	T	0.66	.	3.9602	0.09407	0.5515:0.0:0.4485:0.0	.	92	Q7Z2X7	GGEE2_HUMAN	K	92;75	ENSP00000364107:E92K;ENSP00000364104:E75K	ENSP00000364104:E75K	E	+	1	0	PAGE2	55134570	0.002000	0.14202	0.000000	0.03702	0.007000	0.05969	0.450000	0.21762	-0.588000	0.05882	0.287000	0.19450	GAG	PAGE2	-	pfam_GAGE	ENSG00000234068		0.398	PAGE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAGE2	HGNC	protein_coding	OTTHUMT00000056857.1	747	0.00	0	G	NM_207339		55117845	55117845	+1	no_errors	ENST00000374968	ensembl	human	known	69_37n	missense	522	53.42	601	SNP	0.000	A
PAK1	5058	genome.wustl.edu	37	11	77036380	77036380	+	Intron	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:77036380C>G	ENST00000356341.3	-	15	2083				PAK1_ENST00000278568.4_Missense_Mutation_p.M531I|PAK1_ENST00000530617.1_Intron|PAK1_ENST00000525542.1_Intron|PAK1_ENST00000528203.1_Missense_Mutation_p.M433I	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1						actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					taccagctatcatggaaaagt	0.388																																						dbGAP											0													127.0	116.0	119.0					11																	77036380		1565	3574	5139	-	-	-	SO:0001627	intron_variant	0			U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.1552-1975G>C	11.37:g.77036380C>G			O75561|Q13567|Q32M53|Q32M54|Q86W79	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAK_box_Rho-bd,superfamily_Kinase-like_dom,superfamily_WASP_C,smart_PAK_box_Rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAK_box_Rho-bd,pfscan_Prot_kinase_cat_dom	p.M531I	ENST00000356341.3	37	c.1593	CCDS8250.1	11	.	.	.	.	.	.	.	.	.	.	C	9.171	1.021137	0.19433	.	.	ENSG00000149269	ENST00000278568;ENST00000528203	T;T	0.70045	-0.45;-0.45	3.31	0.369	0.16151	.	.	.	.	.	T	0.39708	0.1088	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.20840	-1.0263	9	0.44086	T	0.13	.	2.75	0.05277	0.2243:0.5253:0.0:0.2504	.	433;531	E9PM17;Q13153-2	.;.	I	531;433	ENSP00000278568:M531I;ENSP00000433211:M433I	ENSP00000278568:M531I	M	-	3	0	PAK1	76714028	0.009000	0.17119	0.011000	0.14972	0.768000	0.43524	-0.093000	0.11111	0.073000	0.16731	-0.152000	0.13540	ATG	PAK1	-	NULL	ENSG00000149269		0.388	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAK1	HGNC	protein_coding	OTTHUMT00000382083.2	172	0.00	0	C	NM_002576		77036380	77036380	-1	no_errors	ENST00000278568	ensembl	human	known	69_37n	missense	75	60.94	117	SNP	0.017	G
PANK4	55229	genome.wustl.edu	37	1	2447048	2447048	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:2447048G>T	ENST00000378466.3	-	10	1339	c.1327C>A	c.(1327-1329)Ctg>Atg	p.L443M	PANK4_ENST00000435556.3_Missense_Mutation_p.L404M	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4	443					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		TTTCGGGCCAGAGCGTCATCG	0.657																																						dbGAP											0													80.0	75.0	76.0					1																	2447048		2201	4299	6500	-	-	-	SO:0001583	missense	0			AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881			19366	protein-coding gene	gene with protein product		606162				11479594	Standard	XR_241034		Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.1327C>A	1.37:g.2447048G>T	ENSP00000367727:p.Leu443Met		B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	Missense_Mutation	SNP	pfam_Type_II_PanK,pfam_DUF89,superfamily_DUF89,pirsf_PanK_long,tigrfam_Type_II_PanK	p.L443M	ENST00000378466.3	37	c.1327	CCDS42.1	1	.	.	.	.	.	.	.	.	.	.	G	7.069	0.567882	0.13560	.	.	ENSG00000157881	ENST00000378466;ENST00000435556	T;T	0.06933	3.24;3.24	5.35	2.1	0.27182	Domain of unknown function DUF89 (1);	0.232126	0.42964	N	0.000638	T	0.03959	0.0111	N	0.08118	0	0.36944	D	0.892509	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.35301	-0.9794	10	0.46703	T	0.11	-5.3673	6.8686	0.24108	0.0942:0.0:0.3538:0.552	.	404;443	E9PHT6;Q9NVE7	.;PANK4_HUMAN	M	443;404	ENSP00000367727:L443M;ENSP00000421433:L404M	ENSP00000367727:L443M	L	-	1	2	PANK4	2436908	0.982000	0.34865	0.728000	0.30774	0.103000	0.19146	1.122000	0.31295	0.604000	0.29930	0.561000	0.74099	CTG	PANK4	-	superfamily_DUF89,pirsf_PanK_long	ENSG00000157881		0.657	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANK4	HGNC	protein_coding	OTTHUMT00000002082.1	99	0.00	0	G			2447048	2447048	-1	no_errors	ENST00000378466	ensembl	human	known	69_37n	missense	80	12.09	11	SNP	0.763	T
PARK2	5071	genome.wustl.edu	37	6	161969928	161969928	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:161969928C>G	ENST00000366898.1	-	9	1143	c.1041G>C	c.(1039-1041)caG>caC	p.Q347H	PARK2_ENST00000366892.1_Missense_Mutation_p.Q347H|PARK2_ENST00000366897.1_Missense_Mutation_p.Q319H|PARK2_ENST00000366896.1_Missense_Mutation_p.Q198H|PARK2_ENST00000338468.3_Missense_Mutation_p.Q156H|PARK2_ENST00000366894.1_Missense_Mutation_p.Q156H	NM_004562.2	NP_004553.2	O60260	PRKN2_HUMAN	parkin RBR E3 ubiquitin protein ligase	347					adult locomotory behavior (GO:0008344)|aggresome assembly (GO:0070842)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to toxic substance (GO:0097237)|cellular response to unfolded protein (GO:0034620)|central nervous system development (GO:0007417)|dopamine metabolic process (GO:0042417)|dopamine uptake involved in synaptic transmission (GO:0051583)|learning (GO:0007612)|mitochondrion degradation (GO:0000422)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell death (GO:0060548)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of insulin secretion (GO:0046676)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|norepinephrine metabolic process (GO:0042415)|positive regulation of DNA binding (GO:0043388)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fusion (GO:0010636)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor-mediated signaling pathway (GO:1903265)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of autophagy (GO:0010506)|regulation of dopamine secretion (GO:0014059)|regulation of glucose metabolic process (GO:0010906)|regulation of lipid transport (GO:0032368)|regulation of mitochondrion degradation (GO:1903146)|regulation of mitochondrion organization (GO:0010821)|regulation of neurotransmitter secretion (GO:0046928)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to endoplasmic reticulum stress (GO:0034976)|startle response (GO:0001964)|synaptic transmission, glutamatergic (GO:0035249)|transcription, DNA-templated (GO:0006351)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Lewy body (GO:0097413)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|perinuclear region of cytoplasm (GO:0048471)|ubiquitin ligase complex (GO:0000151)	chaperone binding (GO:0051087)|cullin family protein binding (GO:0097602)|F-box domain binding (GO:1990444)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|ligase activity (GO:0016874)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|ubiquitin binding (GO:0043130)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease binding (GO:1990381)|zinc ion binding (GO:0008270)	p.Q347H(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		TGACTTTCCTCTGGTCAGGCT	0.632																																						dbGAP											1	Substitution - Missense(1)	lung(1)											68.0	71.0	70.0					6																	161969928		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5281.1, CCDS5282.1, CCDS5283.1	6q25.2-q27	2013-10-03	2013-10-03		ENSG00000185345	ENSG00000185345		"""Parkinson disease"""	8607	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase"""	602544	"""Parkinson disease (autosomal recessive, juvenile) 2, parkin"", ""parkinson protein 2, E3 ubiquitin protein ligase (parkin)"""			9560156, 9570960	Standard	NM_004562		Approved	PDJ, AR-JP, parkin	uc003qtx.4	O60260	OTTHUMG00000015970	ENST00000366898.1:c.1041G>C	6.37:g.161969928C>G	ENSP00000355865:p.Gln347His		A3FG77|A8K975|D3JZW7|D3K2X0|Q5TFV8|Q5VVX4|Q6Q2I6|Q8NI41|Q8NI43|Q8NI44|Q8WW07	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_Znf_C6HC,pfam_SUMO,smart_Ubiquitin,smart_Znf_C6HC,pirsf_Parkin,prints_Parkin,prints_Ubiquitin_subgr,pfscan_Ubiquitin_supergroup	p.Q347H	ENST00000366898.1	37	c.1041	CCDS5281.1	6	.	.	.	.	.	.	.	.	.	.	C	11.50	1.658349	0.29425	.	.	ENSG00000185345	ENST00000366898;ENST00000366897;ENST00000366896;ENST00000366894;ENST00000338468;ENST00000392134;ENST00000366892	T;T;T;T;T;D	0.89810	-0.04;-0.04;-0.04;-0.04;-0.04;-2.57	5.72	2.92	0.33932	Zinc finger, C6HC-type (2);	1.255620	0.05400	N	0.540547	D	0.83848	0.5343	L	0.29908	0.895	0.09310	N	1	D;P;P;P;P	0.56287	0.975;0.47;0.915;0.915;0.937	P;B;P;P;P	0.60345	0.743;0.273;0.544;0.643;0.873	T	0.73811	-0.3865	10	0.45353	T	0.12	.	8.1479	0.31124	0.0:0.7321:0.1277:0.1402	.	366;198;319;347;156	O60260-5;Q5VVX3;Q5VVX4;O60260;Q8NI42	.;.;.;PRKN2_HUMAN;.	H	347;319;198;156;156;156;347	ENSP00000355865:Q347H;ENSP00000355863:Q319H;ENSP00000355862:Q198H;ENSP00000355860:Q156H;ENSP00000343589:Q156H;ENSP00000355858:Q347H	ENSP00000343589:Q156H	Q	-	3	2	PARK2	161889918	0.967000	0.33354	0.000000	0.03702	0.012000	0.07955	1.370000	0.34238	0.735000	0.32537	-0.133000	0.14855	CAG	PARK2	-	pfam_Znf_C6HC,smart_Znf_C6HC,pirsf_Parkin	ENSG00000185345		0.632	PARK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PARK2	HGNC	protein_coding	OTTHUMT00000042995.1	58	0.00	0	C			161969928	161969928	-1	no_errors	ENST00000366898	ensembl	human	known	69_37n	missense	26	39.53	17	SNP	0.004	G
PARP1	142	genome.wustl.edu	37	1	226568860	226568860	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:226568860C>T	ENST00000366794.5	-	9	1352	c.1209G>A	c.(1207-1209)cgG>cgA	p.R403R		NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	403	Automodification domain.|BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.				base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		CATCCTTGTTCCGGGACAGCT	0.522								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																														dbGAP											0													107.0	90.0	96.0					1																	226568860		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.1209G>A	1.37:g.226568860C>T			B1ANJ4|Q8IUZ9	Silent	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_Poly(ADP-ribose)pol_reg_dom,pfam_Znf_PARP,pfam_PADR1,pfam_WGR_domain,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_WGR_domain,superfamily_BRCT_dom,smart_BRCT_dom,smart_WGR_domain,pirsf_NAD_ADPRT,pfscan_BRCT_dom,pfscan_Znf_PARP,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.R403	ENST00000366794.5	37	c.1209	CCDS1554.1	1																																																																																			PARP1	-	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pirsf_NAD_ADPRT,pfscan_BRCT_dom	ENSG00000143799		0.522	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP1	HGNC	protein_coding	OTTHUMT00000091519.1	294	0.00	0	C	NM_001618		226568860	226568860	-1	no_errors	ENST00000366794	ensembl	human	known	69_37n	silent	409	13.29	63	SNP	0.989	T
PBK	55872	genome.wustl.edu	37	8	27668640	27668640	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr8:27668640C>T	ENST00000301905.4	-	7	1070	c.607G>A	c.(607-609)Gag>Aag	p.E203K	PBK_ENST00000522944.1_Missense_Mutation_p.E214K|ESCO2_ENST00000397418.2_Intron	NM_018492.2	NP_060962.2	Q96KB5	TOPK_HUMAN	PDZ binding kinase	203	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitotic nuclear division (GO:0007067)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|large_intestine(2)|lung(1)	4		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|KIRC - Kidney renal clear cell carcinoma(542;0.101)|Kidney(114;0.121)|Colorectal(74;0.141)		TAACAAGCCTCAGGGTCAGTC	0.463																																						dbGAP											0													97.0	86.0	90.0					8																	27668640		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB027249	CCDS6063.1, CCDS64858.1	8p21.2	2009-08-06			ENSG00000168078	ENSG00000168078			18282	protein-coding gene	gene with protein product	"""T-LAK cell-originated protein kinase"", ""cancer/testis antigen 84"""	611210				10781613, 10779557	Standard	NM_018492		Approved	TOPK, FLJ14385, Nori-3, SPK, CT84	uc003xgi.3	Q96KB5	OTTHUMG00000102113	ENST00000301905.4:c.607G>A	8.37:g.27668640C>T	ENSP00000301905:p.Glu203Lys		B4DX68|D3DST2|Q9NPD9|Q9NYL7|Q9NZK6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E203K	ENST00000301905.4	37	c.607	CCDS6063.1	8	.	.	.	.	.	.	.	.	.	.	C	13.10	2.135583	0.37728	.	.	ENSG00000168078	ENST00000301905;ENST00000522944	T;T	0.64438	-0.1;-0.1	6.01	5.13	0.70059	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.187329	0.56097	D	0.000032	T	0.33702	0.0872	N	0.04387	-0.21	0.38557	D	0.949614	B;B	0.06786	0.001;0.001	B;B	0.19666	0.006;0.026	T	0.34129	-0.9841	10	0.07990	T	0.79	-23.8134	8.2288	0.31587	0.0:0.8366:0.0:0.1634	.	214;203	B4DX68;Q96KB5	.;TOPK_HUMAN	K	203;214	ENSP00000301905:E203K;ENSP00000428489:E214K	ENSP00000301905:E203K	E	-	1	0	PBK	27724559	0.988000	0.35896	1.000000	0.80357	0.982000	0.71751	1.932000	0.40143	2.860000	0.98153	0.655000	0.94253	GAG	PBK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000168078		0.463	PBK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PBK	HGNC	protein_coding	OTTHUMT00000219952.2	229	0.00	0	C	NM_018492		27668640	27668640	-1	no_errors	ENST00000301905	ensembl	human	known	69_37n	missense	143	20.99	38	SNP	1.000	T
PCBP1	5093	genome.wustl.edu	37	2	70314894	70314894	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:70314894G>C	ENST00000303577.5	+	1	310	c.19G>C	c.(19-21)Gaa>Caa	p.E7Q	PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000449178.1_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000458686.1_RNA|PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000437019.1_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000458698.2_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000425333.1_RNA|PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000596665.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	7					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						CGGTGTGACTGAAAGTGGACT	0.582																																					Colon(85;1146 1307 3484 18706 25380)	dbGAP											0													77.0	79.0	78.0					2																	70314894		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.19G>C	2.37:g.70314894G>C	ENSP00000305556:p.Glu7Gln		Q13157|Q14975	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_KH_dom_type_2,smart_KH_dom,pfscan_KH_dom_type_1	p.E7Q	ENST00000303577.5	37	c.19	CCDS1898.1	2	.	.	.	.	.	.	.	.	.	.	G	20.4	3.978064	0.74360	.	.	ENSG00000169564	ENST00000303577	T	0.35605	1.3	4.14	3.26	0.37387	.	0.000000	0.85682	D	0.000000	T	0.54679	0.1873	M	0.83692	2.655	0.50039	D	0.999848	D	0.59357	0.985	P	0.58130	0.833	T	0.61520	-0.7046	10	0.72032	D	0.01	.	10.4859	0.44722	0.0974:0.0:0.9026:0.0	.	7	Q15365	PCBP1_HUMAN	Q	7	ENSP00000305556:E7Q	ENSP00000305556:E7Q	E	+	1	0	PCBP1	70168398	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	9.189000	0.94928	1.347000	0.45714	0.650000	0.86243	GAA	PCBP1	-	NULL	ENSG00000169564		0.582	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCBP1	HGNC	protein_coding	OTTHUMT00000251844.1	120	0.00	0	G	NM_006196		70314894	70314894	+1	no_errors	ENST00000303577	ensembl	human	known	69_37n	missense	104	16.13	20	SNP	1.000	C
PCDH10	57575	genome.wustl.edu	37	4	134073569	134073569	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr4:134073569C>T	ENST00000264360.5	+	1	3100	c.2274C>T	c.(2272-2274)ctC>ctT	p.L758L		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	758	Cys-rich.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		ATTGCTGCCTCTGCTGCTGCT	0.577																																						dbGAP											0													42.0	47.0	45.0					4																	134073569		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2274C>T	4.37:g.134073569C>T			Q4W5F6|Q96SF0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L758	ENST00000264360.5	37	c.2274	CCDS34063.1	4																																																																																			PCDH10	-	NULL	ENSG00000138650		0.577	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	54	0.00	0	C	NM_032961		134073569	134073569	+1	no_errors	ENST00000264360	ensembl	human	known	69_37n	silent	68	13.75	11	SNP	0.999	T
PCDHA7	56141	genome.wustl.edu	37	5	140215216	140215216	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr5:140215216G>C	ENST00000525929.1	+	1	1248	c.1248G>C	c.(1246-1248)gaG>gaC	p.E416D	PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.E416D|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	416	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGACCGCGAGAGTGTGTCCG	0.617																																					NSCLC(160;258 2013 5070 22440 28951)	dbGAP											0													121.0	121.0	121.0					5																	140215216		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1248G>C	5.37:g.140215216G>C	ENSP00000436426:p.Glu416Asp		O75282	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E416D	ENST00000525929.1	37	c.1248	CCDS54918.1	5	.	.	.	.	.	.	.	.	.	.	G	11.58	1.679717	0.29783	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.72394	-0.65;-0.65	4.04	3.17	0.36434	Cadherin (4);Cadherin-like (1);	0.000000	0.31936	U	0.006824	D	0.85982	0.5824	H	0.95004	3.61	0.26632	N	0.972459	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77943	-0.2398	10	0.87932	D	0	.	7.9458	0.29985	0.194:0.0:0.806:0.0	.	416;416	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	D	416	ENSP00000436426:E416D;ENSP00000367365:E416D	ENSP00000367365:E416D	E	+	3	2	PCDHA7	140195400	0.009000	0.17119	0.834000	0.33040	0.111000	0.19643	0.121000	0.15667	0.809000	0.34255	0.305000	0.20034	GAG	PCDHA7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204963		0.617	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	93	0.00	0	G	NM_018910		140215216	140215216	+1	no_errors	ENST00000525929	ensembl	human	known	69_37n	missense	86	19.63	21	SNP	0.798	C
PCLO	27445	genome.wustl.edu	37	7	82784780	82784780	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr7:82784780G>A	ENST00000333891.9	-	2	1514	c.1177C>T	c.(1177-1179)Cag>Tag	p.Q393*	PCLO_ENST00000423517.2_Nonsense_Mutation_p.Q393*	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CCAGGAGGCTGAGCTAAAGCC	0.587																																						dbGAP											0													75.0	76.0	75.0					7																	82784780		1982	4163	6145	-	-	-	SO:0001587	stop_gained	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.1177C>T	7.37:g.82784780G>A	ENSP00000334319:p.Gln393*			Nonsense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.Q393*	ENST00000333891.9	37	c.1177	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	40	8.034071	0.98621	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	.	.	.	4.32	4.32	0.51571	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.2738	0.82634	0.0:0.0:1.0:0.0	.	.	.	.	X	393	.	ENSP00000334319:Q393X	Q	-	1	0	PCLO	82622716	0.122000	0.22280	0.559000	0.28332	0.669000	0.39330	1.605000	0.36815	2.360000	0.80028	0.655000	0.94253	CAG	PCLO	-	NULL	ENSG00000186472		0.587	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	238	0.00	0	G	NM_014510		82784780	82784780	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	nonsense	159	13.59	25	SNP	0.846	A
PDCD11	22984	genome.wustl.edu	37	10	105200072	105200072	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr10:105200072G>T	ENST00000369797.3	+	29	4268	c.4174G>T	c.(4174-4176)Gag>Tag	p.E1392*		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	1392	S1 motif 12. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GAACCTGGTAGAGCTGTCTTT	0.522																																						dbGAP											0													90.0	100.0	96.0					10																	105200072		2203	4297	6500	-	-	-	SO:0001587	stop_gained	0			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.4174G>T	10.37:g.105200072G>T	ENSP00000358812:p.Glu1392*		Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Nonsense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Suf,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,smart_HAT,pfscan_TPR-contain_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,prints_Ribosomal_S1	p.E1392*	ENST00000369797.3	37	c.4174	CCDS31276.1	10	.	.	.	.	.	.	.	.	.	.	G	42	9.193701	0.99096	.	.	ENSG00000148843	ENST00000369797	.	.	.	6.04	2.57	0.30868	.	0.669254	0.16923	N	0.193994	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-15.895	7.6124	0.28137	0.0741:0.1106:0.6884:0.1269	.	.	.	.	X	1392	.	ENSP00000358812:E1392X	E	+	1	0	PDCD11	105190062	0.987000	0.35691	0.926000	0.36857	0.846000	0.48090	1.866000	0.39489	0.755000	0.32990	0.561000	0.74099	GAG	PDCD11	-	superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	ENSG00000148843		0.522	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD11	HGNC	protein_coding	OTTHUMT00000050151.1	171	0.00	0	G			105200072	105200072	+1	no_errors	ENST00000369797	ensembl	human	known	69_37n	nonsense	101	18.55	23	SNP	0.588	T
PDCL3	79031	genome.wustl.edu	37	2	101186079	101186079	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:101186079G>A	ENST00000264254.6	+	4	642	c.264G>A	c.(262-264)aaG>aaA	p.K88K		NM_024065.4	NP_076970.1	Q9H2J4	PDCL3_HUMAN	phosducin-like 3	88					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|protein folding (GO:0006457)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|viral process (GO:0016032)	cytoplasm (GO:0005737)	protein binding involved in protein folding (GO:0044183)			endometrium(3)|large_intestine(2)|liver(1)|lung(6)	12						CTAAACTGAAGAATAAATTCG	0.448																																						dbGAP											0													75.0	79.0	78.0					2																	101186079		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF267853	CCDS33261.1	2q12	2008-02-05			ENSG00000115539	ENSG00000115539			28860	protein-coding gene	gene with protein product		611678					Standard	NM_024065		Approved	VIAF1	uc002tao.2	Q9H2J4	OTTHUMG00000153141	ENST00000264254.6:c.264G>A	2.37:g.101186079G>A			B2RA00|Q53S68	Missense_Mutation	SNP	pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold,tigrfam_Antitoxin_Phd/YefM	p.R36K	ENST00000264254.6	37	c.107	CCDS33261.1	2	.	.	.	.	.	.	.	.	.	.	.	9.776	1.173886	0.21704	.	.	ENSG00000115539	ENST00000450127	.	.	.	4.59	3.71	0.42584	.	.	.	.	.	T	0.59569	0.2203	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55909	-0.8066	4	.	.	.	-13.2006	9.4876	0.38940	0.0797:0.1433:0.777:0.0	.	.	.	.	K	36	.	.	R	+	2	0	PDCL3	100552511	1.000000	0.71417	0.996000	0.52242	0.970000	0.65996	3.776000	0.55356	1.039000	0.40074	-0.266000	0.10368	AGA	PDCL3	-	pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold,tigrfam_Antitoxin_Phd/YefM	ENSG00000115539		0.448	PDCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCL3	HGNC	protein_coding	OTTHUMT00000329734.1	244	0.00	0	G	NM_024065		101186079	101186079	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000450127	ensembl	human	putative	69_37n	missense	210	27.08	78	SNP	1.000	A
PDK1	5163	genome.wustl.edu	37	2	173423483	173423483	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:173423483G>C	ENST00000282077.3	+	2	426	c.244G>C	c.(244-246)Gag>Cag	p.E82Q	PDK1_ENST00000410055.1_Missense_Mutation_p.E82Q|AC093818.1_ENST00000444919.1_RNA|PDK1_ENST00000392571.2_Missense_Mutation_p.E82Q|PDK1_ENST00000544863.1_5'UTR|PDK1_ENST00000543905.1_Missense_Mutation_p.E6Q|Y_RNA_ENST00000362996.1_RNA|AC093818.1_ENST00000450443.1_RNA|AC093818.1_ENST00000436922.1_RNA|AC093818.1_ENST00000442417.1_RNA			Q15118	PDK1_HUMAN	pyruvate dehydrogenase kinase, isozyme 1	82					cell proliferation (GO:0008283)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.12)			TCTGCGGCAAGAGTTGCCTGT	0.398									Autosomal Dominant Polycystic Kidney Disease																													dbGAP											0													139.0	136.0	137.0					2																	173423483		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	ADPKD	L42450	CCDS2250.1, CCDS63059.1	2q31.1	2008-05-23	2005-11-16		ENSG00000152256	ENSG00000152256			8809	protein-coding gene	gene with protein product		602524	"""pyruvate dehydrogenase kinase, isoenzyme 1"""			7499431	Standard	NR_103731		Approved		uc002uhs.3	Q15118	OTTHUMG00000132285	ENST00000282077.3:c.244G>C	2.37:g.173423483G>C	ENSP00000282077:p.Glu82Gln		B2R6T1|B7Z937|D3DPD8|E9PD65|Q308M4	Missense_Mutation	SNP	pfam_BCDHK/PDK_N,pfam_ATPase-like_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core	p.E82Q	ENST00000282077.3	37	c.244	CCDS2250.1	2	.	.	.	.	.	.	.	.	.	.	G	34	5.305665	0.95601	.	.	ENSG00000152256	ENST00000443353;ENST00000543905;ENST00000282077;ENST00000392571;ENST00000410055;ENST00000416991;ENST00000439519	T;T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06;1.06	5.55	5.55	0.83447	Branched-chain alpha-ketoacid dehydrogenase kinase/Pyruvate dehydrogenase kinase, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.79131	0.4394	H	0.97940	4.11	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.76575	0.988;0.976	D	0.86963	0.2093	10	0.87932	D	0	-25.261	19.5001	0.95090	0.0:0.0:1.0:0.0	.	82;82	Q15118;E9PD65	PDK1_HUMAN;.	Q	6;6;82;82;82;24;6	ENSP00000399558:E6Q;ENSP00000438567:E6Q;ENSP00000282077:E82Q;ENSP00000376352:E82Q;ENSP00000386985:E82Q;ENSP00000399160:E24Q;ENSP00000388366:E6Q	ENSP00000282077:E82Q	E	+	1	0	PDK1	173131729	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.627000	0.88993	0.655000	0.94253	GAG	PDK1	-	pfam_BCDHK/PDK_N,superfamily_BCDHK/PDK_N	ENSG00000152256		0.398	PDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDK1	HGNC	protein_coding	OTTHUMT00000255380.3	448	0.00	0	G	NM_002610		173423483	173423483	+1	no_errors	ENST00000282077	ensembl	human	known	69_37n	missense	339	30.18	147	SNP	1.000	C
PEX3	8504	genome.wustl.edu	37	6	143806383	143806383	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:143806383C>G	ENST00000367591.4	+	11	1099	c.1036C>G	c.(1036-1038)Cag>Gag	p.Q346E	RP1-20N2.6_ENST00000591892.1_RNA	NM_003630.2	NP_003621.1	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3	346					peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)|protein-lipid complex (GO:0032994)	lipid binding (GO:0008289)|protein dimerization activity (GO:0046983)			endometrium(1)|large_intestine(9)|lung(4)|ovary(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)		TCATTTTGTTCAGGTAAGAAG	0.373																																						dbGAP											0													120.0	122.0	121.0					6																	143806383		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ001625	CCDS5199.1	6q24.2	2008-05-15			ENSG00000034693	ENSG00000034693			8858	protein-coding gene	gene with protein product		603164				9657383	Standard	NM_003630		Approved		uc003qjl.3	P56589	OTTHUMG00000015730	ENST00000367591.4:c.1036C>G	6.37:g.143806383C>G	ENSP00000356563:p.Gln346Glu		Q6FGP5	Missense_Mutation	SNP	pfam_Peroxin-3	p.Q346E	ENST00000367591.4	37	c.1036	CCDS5199.1	6	.	.	.	.	.	.	.	.	.	.	C	18.87	3.715571	0.68844	.	.	ENSG00000034693	ENST00000367591	T	0.41400	1.0	5.45	4.56	0.56223	.	0.106414	0.64402	D	0.000003	T	0.47377	0.1442	L	0.58810	1.83	0.58432	D	0.999999	D	0.71674	0.998	D	0.67725	0.953	T	0.43212	-0.9405	10	0.33141	T	0.24	-8.3972	14.9919	0.71396	0.0:0.8564:0.1436:0.0	.	346	P56589	PEX3_HUMAN	E	346	ENSP00000356563:Q346E	ENSP00000356563:Q346E	Q	+	1	0	PEX3	143848076	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.691000	0.74573	1.257000	0.44085	0.650000	0.86243	CAG	PEX3	-	pfam_Peroxin-3	ENSG00000034693		0.373	PEX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX3	HGNC	protein_coding	OTTHUMT00000042525.1	302	0.00	0	C			143806383	143806383	+1	no_errors	ENST00000367591	ensembl	human	known	69_37n	missense	192	49.35	189	SNP	1.000	G
PHC3	80012	genome.wustl.edu	37	3	169847313	169847313	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr3:169847313G>C	ENST00000494943.1	-	8	979	c.911C>G	c.(910-912)tCt>tGt	p.S304C	PHC3_ENST00000467570.1_Missense_Mutation_p.S263C|PHC3_ENST00000495893.2_Missense_Mutation_p.S316C			Q8NDX5	PHC3_HUMAN	polyhomeotic homolog 3 (Drosophila)	304					multicellular organismal development (GO:0007275)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|upper_aerodigestive_tract(2)	26	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			TTTTATTAGAGAATGAGGCTG	0.343																																						dbGAP											0													140.0	135.0	137.0					3																	169847313		1863	4098	5961	-	-	-	SO:0001583	missense	0				CCDS46952.1	3q26.32	2014-01-28	2006-09-12		ENSG00000173889	ENSG00000173889		"""Sterile alpha motif (SAM) domain containing"""	15682	protein-coding gene	gene with protein product	"""early development regulator 3"", ""polyhomeotic like 3"""		"""polyhomeotic like 3 (Drosophila)"""			12167701, 12384788	Standard	NM_024947		Approved	EDR3, FLJ12967, FLJ12729, HPH3	uc003fgl.2	Q8NDX5	OTTHUMG00000158777	ENST00000494943.1:c.911C>G	3.37:g.169847313G>C	ENSP00000420271:p.Ser304Cys		A2RRP9|Q5HYF0|Q6NSG2|Q8NFT7|Q8NFZ1|Q8TBM2|Q9H971|Q9H9I4	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.S316C	ENST00000494943.1	37	c.947		3	.	.	.	.	.	.	.	.	.	.	G	16.29	3.082468	0.55861	.	.	ENSG00000173889	ENST00000494943;ENST00000495893;ENST00000467570;ENST00000484931	T;T	0.34667	1.37;1.35	5.41	5.41	0.78517	.	0.077463	0.56097	D	0.000035	T	0.48114	0.1482	L	0.50333	1.59	0.80722	D	1	D;D;D;P	0.69078	0.997;0.963;0.983;0.878	P;P;P;P	0.53450	0.726;0.601;0.635;0.473	T	0.37663	-0.9696	10	0.42905	T	0.14	-5.6452	18.8093	0.92052	0.0:0.0:1.0:0.0	.	263;263;304;316	B4E2T1;E7EX82;Q8NDX5;Q8NDX5-7	.;.;PHC3_HUMAN;.	C	304;316;263;142	ENSP00000420271:S304C;ENSP00000420294:S316C	ENSP00000419089:S263C	S	-	2	0	PHC3	171330007	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.374000	0.66167	2.549000	0.85964	0.561000	0.74099	TCT	PHC3	-	NULL	ENSG00000173889		0.343	PHC3-004	KNOWN	basic	protein_coding	PHC3	HGNC	protein_coding	OTTHUMT00000352182.3	425	0.00	0	G	NM_024947		169847313	169847313	-1	no_errors	ENST00000495893	ensembl	human	known	69_37n	missense	328	39.85	218	SNP	1.000	C
PHF20L1	51105	genome.wustl.edu	37	8	133836315	133836315	+	Intron	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr8:133836315G>C	ENST00000395386.2	+	13	1935				CTC-137K3.1_ENST00000602328.1_RNA|PHF20L1_ENST00000220847.7_Intron|PHF20L1_ENST00000395390.2_Intron	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1								zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			GGTATGAACAGAAAGTAATCT	0.363																																						dbGAP											0													72.0	71.0	71.0					8																	133836315		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.1636+10G>C	8.37:g.133836315G>C			A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Missense_Mutation	SNP	pfam_DUF3776,smart_Tudor,smart_Tudor-like_plant	p.R553T	ENST00000395386.2	37	c.1658	CCDS6367.2	8	.	.	.	.	.	.	.	.	.	.	G	19.05	3.750944	0.69533	.	.	ENSG00000129292	ENST00000395383	T	0.48522	0.81	5.87	5.0	0.66597	.	.	.	.	.	T	0.45816	0.1361	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29731	-1.0002	6	0.19590	T	0.45	.	10.8312	0.46661	0.0861:0.0:0.9139:0.0	.	.	.	.	T	553	ENSP00000378781:R553T	ENSP00000378781:R553T	R	+	2	0	PHF20L1	133905497	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.102000	0.50291	1.486000	0.48398	0.650000	0.86243	AGA	PHF20L1	-	NULL	ENSG00000129292		0.363	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	PHF20L1	HGNC	protein_coding	OTTHUMT00000308949.3	233	0.00	0	G	NM_016018		133836315	133836315	+1	no_errors	ENST00000395383	ensembl	human	novel	69_37n	missense	271	18.86	63	SNP	1.000	C
PI4K2A	55361	genome.wustl.edu	37	10	99416641	99416641	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr10:99416641G>A	ENST00000370631.3	+	4	889	c.832G>A	c.(832-834)Gaa>Aaa	p.E278K	PI4K2A_ENST00000370649.3_Missense_Mutation_p.E248K|PI4K2A_ENST00000555577.1_Missense_Mutation_p.E248K	NM_018425.2	NP_060895.1	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha	278	PI3K/PI4K.				basophil degranulation (GO:0002561)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endosome (GO:0005768)|exocytic vesicle (GO:0070382)|Golgi apparatus (GO:0005794)|growing cell tip (GO:0035838)|host cell presynaptic membrane (GO:0044231)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|AP-3 adaptor complex binding (GO:0035651)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		GCGGCGTTTTGAAGCAGAACC	0.493																																						dbGAP											0													139.0	132.0	134.0					10																	99416641		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF070611	CCDS7469.1	10q24	2011-02-09			ENSG00000155252	ENSG00000155252			30031	protein-coding gene	gene with protein product		609763				11244087, 11279162	Standard	NM_018425		Approved	PI4KII, DKFZP761G1923, PIK42A	uc001kog.1	Q9BTU6	OTTHUMG00000018863	ENST00000370631.3:c.832G>A	10.37:g.99416641G>A	ENSP00000359665:p.Glu278Lys		D3DR59|Q9NSG8	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom	p.E278K	ENST00000370631.3	37	c.832	CCDS7469.1	10	.	.	.	.	.	.	.	.	.	.	G	24.1	4.497700	0.85069	.	.	ENSG00000155252;ENSG00000155252;ENSG00000249967	ENST00000555577;ENST00000370631;ENST00000370649	D;D	0.86432	-2.12;-2.12	5.35	5.35	0.76521	Phosphatidylinositol 3-/4-kinase, catalytic (1);	0.000000	0.85682	D	0.000000	D	0.94515	0.8234	M	0.89904	3.07	0.80722	D	1	D;P	0.76494	0.999;0.786	D;P	0.87578	0.998;0.733	D	0.93063	0.6476	10	0.23891	T	0.37	-13.4121	19.1115	0.93318	0.0:0.0:1.0:0.0	.	248;278	E9PAM4;Q9BTU6	.;P4K2A_HUMAN	K	248;278;248	ENSP00000452243:E248K;ENSP00000359683:E248K	ENSP00000359665:E278K	E	+	1	0	PI4K2A;RP11-548K23.11	99406631	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.869000	0.99810	2.527000	0.85204	0.585000	0.79938	GAA	PI4K2A	-	pfam_PI3/4_kinase_cat_dom	ENSG00000155252		0.493	PI4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PI4K2A	HGNC	protein_coding	OTTHUMT00000049735.1	181	0.00	0	G	NM_018425		99416641	99416641	+1	no_errors	ENST00000370631	ensembl	human	known	69_37n	missense	158	19.00	38	SNP	1.000	A
PKHD1L1	93035	genome.wustl.edu	37	8	110523136	110523136	+	Silent	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr8:110523136G>C	ENST00000378402.5	+	71	11630	c.11526G>C	c.(11524-11526)ctG>ctC	p.L3842L		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3842					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATCTTCGACTGATGTTGCTTA	0.403										HNSCC(38;0.096)																												dbGAP											0													149.0	146.0	147.0					8																	110523136		1921	4136	6057	-	-	-	SO:0001819	synonymous_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.11526G>C	8.37:g.110523136G>C			Q567P2|Q9UF27	Silent	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.L3842	ENST00000378402.5	37	c.11526	CCDS47911.1	8																																																																																			PKHD1L1	-	NULL	ENSG00000205038		0.403	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	268	0.00	0	G	NM_177531		110523136	110523136	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	silent	133	55.92	170	SNP	0.999	C
PLA2G4A	5321	genome.wustl.edu	37	1	186908212	186908212	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:186908212G>T	ENST00000367466.3	+	9	920	c.768G>T	c.(766-768)atG>atT	p.M256I	PLA2G4A_ENST00000442353.2_Missense_Mutation_p.M196I|PLA2G4A_ENST00000466600.1_3'UTR	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	256	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	AAGAACTAATGAAAAATGTTA	0.368																																						dbGAP											0													144.0	138.0	140.0					1																	186908212		2203	4300	6503	-	-	-	SO:0001583	missense	0			M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.768G>T	1.37:g.186908212G>T	ENSP00000356436:p.Met256Ile		B1AKG4|Q29R80	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_Ca-dep,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_LysoPLipase_cat_dom,pfscan_C2_membr_targeting,pfscan_LysoPLipase_cat_dom	p.M256I	ENST00000367466.3	37	c.768	CCDS1372.1	1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.013369	0.93346	.	.	ENSG00000116711	ENST00000367466;ENST00000442353	T;T	0.10288	2.89;2.89	5.93	5.93	0.95920	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.15609	0.0376	L	0.48362	1.52	0.80722	D	1	P;P	0.44877	0.754;0.845	B;B	0.42214	0.38;0.38	T	0.00252	-1.1876	10	0.54805	T	0.06	-28.0411	19.3388	0.94332	0.0:0.0:1.0:0.0	.	196;256	E7EU42;P47712	.;PA24A_HUMAN	I	256;196	ENSP00000356436:M256I;ENSP00000406892:M196I	ENSP00000356436:M256I	M	+	3	0	PLA2G4A	185174835	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.897000	0.87356	2.808000	0.96608	0.655000	0.94253	ATG	PLA2G4A	-	pfam_LysoPLipase_cat_dom,superfamily_Acyl_Trfase/lysoPLipase,smart_LysoPLipase_cat_dom,pfscan_LysoPLipase_cat_dom	ENSG00000116711		0.368	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G4A	HGNC	protein_coding	OTTHUMT00000086236.1	458	0.00	0	G	NM_024420		186908212	186908212	+1	no_errors	ENST00000367466	ensembl	human	known	69_37n	missense	470	13.87	76	SNP	1.000	T
PLA2G4A	5321	genome.wustl.edu	37	1	186925342	186925342	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:186925342G>C	ENST00000367466.3	+	14	1597	c.1445G>C	c.(1444-1446)aGa>aCa	p.R482T	PLA2G4A_ENST00000442353.2_Missense_Mutation_p.R422T	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	482	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	TTCAATACCAGAGAAGGACGT	0.428																																						dbGAP											0													160.0	142.0	148.0					1																	186925342		2203	4300	6503	-	-	-	SO:0001583	missense	0			M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.1445G>C	1.37:g.186925342G>C	ENSP00000356436:p.Arg482Thr		B1AKG4|Q29R80	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_Ca-dep,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_LysoPLipase_cat_dom,pfscan_C2_membr_targeting,pfscan_LysoPLipase_cat_dom	p.R482T	ENST00000367466.3	37	c.1445	CCDS1372.1	1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.430547	0.83776	.	.	ENSG00000116711	ENST00000367466;ENST00000442353	T;T	0.12465	2.68;2.68	5.45	5.45	0.79879	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.39963	0.1098	M	0.76328	2.33	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.05209	-1.0899	10	0.45353	T	0.12	-19.2859	18.6433	0.91402	0.0:0.0:1.0:0.0	.	422;482	E7EU42;P47712	.;PA24A_HUMAN	T	482;422	ENSP00000356436:R482T;ENSP00000406892:R422T	ENSP00000356436:R482T	R	+	2	0	PLA2G4A	185191965	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.223000	0.95203	2.725000	0.93324	0.655000	0.94253	AGA	PLA2G4A	-	pfam_LysoPLipase_cat_dom,superfamily_Acyl_Trfase/lysoPLipase,smart_LysoPLipase_cat_dom,pfscan_LysoPLipase_cat_dom	ENSG00000116711		0.428	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G4A	HGNC	protein_coding	OTTHUMT00000086236.1	377	0.00	0	G	NM_024420		186925342	186925342	+1	no_errors	ENST00000367466	ensembl	human	known	69_37n	missense	402	32.55	194	SNP	0.999	C
PLD3	23646	genome.wustl.edu	37	19	40880424	40880424	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:40880424C>G	ENST00000409587.1	+	10	1313	c.916C>G	c.(916-918)Cca>Gca	p.P306A	PLD3_ENST00000409419.1_Missense_Mutation_p.P306A|PLD3_ENST00000356508.5_Missense_Mutation_p.P306A|PLD3_ENST00000409735.4_Missense_Mutation_p.P306A|PLD3_ENST00000409281.1_Missense_Mutation_p.P306A			Q8IV08	PLD3_HUMAN	phospholipase D family, member 3	306					cell death (GO:0008219)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phospholipase D activity (GO:0004630)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20			Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)			TGGCCGCACTCCAGACCTGAA	0.597																																						dbGAP											0													122.0	112.0	115.0					19																	40880424		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000553	CCDS33027.1	19q13.2	2014-03-14	2005-05-20		ENSG00000105223	ENSG00000105223			17158	protein-coding gene	gene with protein product		615698	"""phospholipase D3"""			9140189, 15794758	Standard	XM_005258704		Approved	HU-K4	uc002onj.4	Q8IV08	OTTHUMG00000152736	ENST00000409587.1:c.916C>G	19.37:g.40880424C>G	ENSP00000387050:p.Pro306Ala		Q92853|Q9BW87	Missense_Mutation	SNP	pfam_PLipase_D/transphosphatidylase,smart_PLipase_D/transphosphatidylase,pfscan_PLipase_D/transphosphatidylase	p.P306A	ENST00000409587.1	37	c.916	CCDS33027.1	19	.	.	.	.	.	.	.	.	.	.	C	10.56	1.384969	0.25031	.	.	ENSG00000105223	ENST00000409419;ENST00000409587;ENST00000356508;ENST00000536031;ENST00000409735;ENST00000409281	T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09	6.08	6.08	0.98989	Phospholipase D/viral envelope (1);	0.183972	0.47455	D	0.000231	T	0.32704	0.0838	L	0.40543	1.245	0.40093	D	0.976276	B	0.02656	0.0	B	0.10450	0.005	T	0.13098	-1.0522	10	0.09084	T	0.74	-15.7021	13.706	0.62639	0.0:0.8458:0.1542:0.0	.	306	Q8IV08	PLD3_HUMAN	A	306;306;306;287;306;306	ENSP00000386293:P306A;ENSP00000387050:P306A;ENSP00000348901:P306A;ENSP00000386938:P306A;ENSP00000387022:P306A	ENSP00000348901:P306A	P	+	1	0	PLD3	45572264	0.000000	0.05858	1.000000	0.80357	0.992000	0.81027	0.464000	0.21988	2.894000	0.99253	0.655000	0.94253	CCA	PLD3	-	NULL	ENSG00000105223		0.597	PLD3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLD3	HGNC	protein_coding	OTTHUMT00000327721.1	173	0.00	0	C	NM_012268		40880424	40880424	+1	no_errors	ENST00000356508	ensembl	human	known	69_37n	missense	115	26.58	42	SNP	1.000	G
PLEKHM1	9842	genome.wustl.edu	37	17	43545712	43545712	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:43545712C>G	ENST00000430334.3	-	5	1304	c.1171G>C	c.(1171-1173)Gag>Cag	p.E391Q	RN7SL730P_ENST00000583727.1_RNA|PLEKHM1_ENST00000421073.2_Missense_Mutation_p.E302Q	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	391					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					GAGGTGCTCTCTACAGGCTGC	0.642																																						dbGAP											0													20.0	21.0	21.0					17																	43545712		2203	4298	6501	-	-	-	SO:0001583	missense	0			X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.1171G>C	17.37:g.43545712C>G	ENSP00000389913:p.Glu391Gln		Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	pfam_Run,superfamily_Znf_FYVE_PHD,smart_Run,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Pleckstrin_homology,pfscan_Run,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.E391Q	ENST00000430334.3	37	c.1171	CCDS32671.1	17	.	.	.	.	.	.	.	.	.	.	C	5.128	0.209212	0.09757	.	.	ENSG00000225190	ENST00000430334;ENST00000446609;ENST00000421073	T;T	0.64085	-0.08;-0.08	4.51	2.47	0.30058	.	1.154980	0.06586	N	0.751131	T	0.32882	0.0844	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.23368	-1.0190	10	0.16420	T	0.52	.	6.4988	0.22158	0.0:0.7172:0.1823:0.1005	.	302;391	F8W648;Q9Y4G2	.;PKHM1_HUMAN	Q	391;340;302	ENSP00000389913:E391Q;ENSP00000414352:E302Q	ENSP00000414352:E302Q	E	-	1	0	PLEKHM1	40901495	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.120000	0.10660	0.606000	0.29965	0.655000	0.94253	GAG	PLEKHM1	-	NULL	ENSG00000225190		0.642	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM1	HGNC	protein_coding	OTTHUMT00000444659.1	169	0.00	0	C	NM_014798		43545712	43545712	-1	no_errors	ENST00000430334	ensembl	human	known	69_37n	missense	160	10.61	19	SNP	0.001	G
PLSCR2	57047	genome.wustl.edu	37	3	146173028	146173028	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr3:146173028C>T	ENST00000497985.1	-	6	977	c.538G>A	c.(538-540)Gag>Aag	p.E180K	PLSCR2_ENST00000336685.2_Missense_Mutation_p.E107K	NM_001199978.1	NP_001186907.1	Q9NRY7	PLS2_HUMAN	phospholipid scramblase 2	180					phospholipid scrambling (GO:0017121)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid scramblase activity (GO:0017128)			endometrium(2)|large_intestine(5)|lung(7)|stomach(1)	15						TCACATACCTCCTGAAGGCAG	0.368																																						dbGAP											0													97.0	90.0	93.0					3																	146173028		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS56284.1, CCDS3134.1, CCDS75029.1	3q24	2008-07-18			ENSG00000163746	ENSG00000163746			16494	protein-coding gene	gene with protein product		607610				10930526	Standard	NM_001199978		Approved		uc003evw.2	Q9NRY7	OTTHUMG00000159429	ENST00000497985.1:c.538G>A	3.37:g.146173028C>T	ENSP00000420132:p.Glu180Lys		B4DXC3|J3KR76|Q0VAQ1|Q6NSW9|Q7Z4L7	Missense_Mutation	SNP	pfam_Scramblase,superfamily_Tubby_C-like	p.E107K	ENST00000497985.1	37	c.319	CCDS56284.1	3	.	.	.	.	.	.	.	.	.	.	.	15.06	2.722043	0.48728	.	.	ENSG00000163746	ENST00000336685;ENST00000535500;ENST00000497985;ENST00000489015	T;T;T	0.23552	1.9;1.9;1.9	2.9	-1.09	0.09904	.	0.172085	0.20496	N	0.091185	T	0.16428	0.0395	L	0.33339	1.005	0.27464	N	0.953074	B;B	0.31655	0.334;0.005	B;B	0.38225	0.268;0.021	T	0.24512	-1.0158	10	0.21540	T	0.41	.	4.6908	0.12780	0.0:0.4868:0.1513:0.3619	.	200;107	Q7Z4L7;Q9NRY7	.;PLS2_HUMAN	K	107;199;180;107	ENSP00000338707:E107K;ENSP00000420132:E180K;ENSP00000418444:E107K	ENSP00000338707:E107K	E	-	1	0	PLSCR2	147655718	0.614000	0.27017	0.968000	0.41197	0.911000	0.54048	1.341000	0.33907	-0.285000	0.09089	-0.224000	0.12420	GAG	PLSCR2	-	pfam_Scramblase	ENSG00000163746		0.368	PLSCR2-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	PLSCR2	HGNC	protein_coding	OTTHUMT00000355264.1	248	0.00	0	C	NM_020359		146173028	146173028	-1	no_errors	ENST00000336685	ensembl	human	known	69_37n	missense	275	16.92	56	SNP	0.998	T
PMFBP1	83449	genome.wustl.edu	37	16	72188209	72188209	+	Missense_Mutation	SNP	C	C	G	rs199738157		TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr16:72188209C>G	ENST00000237353.10	-	4	576	c.315G>C	c.(313-315)caG>caC	p.Q105H	PMFBP1_ENST00000537465.1_Missense_Mutation_p.Q105H|PMFBP1_ENST00000355636.6_5'UTR|PMFBP1_ENST00000543746.1_5'UTR	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	105						cytoplasm (GO:0005737)		p.Q105H(1)		NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				AGTAAGAAGTCTGCAACTCCT	0.458																																						dbGAP											1	Substitution - Missense(1)	lung(1)											205.0	185.0	192.0					16																	72188209		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.315G>C	16.37:g.72188209C>G	ENSP00000237353:p.Gln105His		B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	NULL	p.Q105H	ENST00000237353.10	37	c.315	CCDS32483.1	16	.	.	.	.	.	.	.	.	.	.	C	15.56	2.868388	0.51588	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000535461;ENST00000539172	T;T	0.78364	-1.17;-1.17	5.63	2.6	0.31112	.	0.000000	0.44902	D	0.000404	T	0.77294	0.4109	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.76399	-0.2973	10	0.66056	D	0.02	-25.0242	8.0818	0.30750	0.0:0.7411:0.0:0.2589	.	105;105	Q8TBY8-2;G3V1Q7	.;.	H	105	ENSP00000443817:Q105H;ENSP00000237353:Q105H	ENSP00000237353:Q105H	Q	-	3	2	PMFBP1	70745710	0.968000	0.33430	0.986000	0.45419	0.889000	0.51656	0.289000	0.18957	0.747000	0.32809	-0.140000	0.14226	CAG	PMFBP1	-	NULL	ENSG00000118557		0.458	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PMFBP1	HGNC	protein_coding	OTTHUMT00000396473.2	341	0.00	0	C	NM_031293		72188209	72188209	-1	no_errors	ENST00000537465	ensembl	human	known	69_37n	missense	244	30.51	108	SNP	0.984	G
POR	5447	genome.wustl.edu	37	7	75609733	75609735	+	In_Frame_Del	DEL	CCA	CCA	-			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	CCA	CCA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr7:75609733_75609735delCCA	ENST00000461988.1	+	5	548_550	c.443_445delCCA	c.(442-447)cccacc>ccc	p.T149del	POR_ENST00000394893.1_In_Frame_Del_p.T149del|POR_ENST00000419840.1_5'UTR|POR_ENST00000450476.1_5'Flank|POR_ENST00000545601.1_5'UTR|POR_ENST00000439269.1_5'Flank	NM_000941.2	NP_000932.3	P16435	NCPR_HUMAN	P450 (cytochrome) oxidoreductase	146	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				carnitine metabolic process (GO:0009437)|cellular organofluorine metabolic process (GO:0090346)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to peptide hormone stimulus (GO:0071375)|demethylation (GO:0070988)|fatty acid oxidation (GO:0019395)|flavonoid metabolic process (GO:0009812)|internal peptidyl-lysine acetylation (GO:0018393)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of lipase activity (GO:0060192)|nitrate catabolic process (GO:0043602)|nitric oxide catabolic process (GO:0046210)|oxidation-reduction process (GO:0055114)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|hydrolase activity (GO:0016787)|iron ion binding (GO:0005506)|iron-cytochrome-c reductase activity (GO:0047726)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric oxide dioxygenase activity (GO:0008941)			central_nervous_system(1)|endometrium(2)|kidney(2)|lung(3)|ovary(1)	9					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Ethylmorphine(DB01466)|Flavin adenine dinucleotide(DB03147)|Lipoic Acid(DB00166)|Mitomycin(DB00305)|Nilutamide(DB00665)|Nitrofurantoin(DB00698)	GAGGGAGACCCCACCGACAATGC	0.611																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF258341	CCDS5579.1	7q11.2	2006-12-05			ENSG00000127948	ENSG00000127948			9208	protein-coding gene	gene with protein product		124015				2516426	Standard	NM_000941		Approved	CYPOR, FLJ26468	uc003udy.3	P16435	OTTHUMG00000130413	ENST00000461988.1:c.443_445delCCA	7.37:g.75609733_75609735delCCA	ENSP00000419970:p.Thr149del		Q16455|Q197M5|Q8N181|Q9H3M8|Q9UDT3	In_Frame_Del	DEL	pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin,pfscan_Flavodoxin/NO_synth	p.T149in_frame_del	ENST00000461988.1	37	c.443_445	CCDS5579.1	7																																																																																			POR	-	pfam_Flavodoxin/NO_synth,pfscan_Flavodoxin/NO_synth	ENSG00000127948		0.611	POR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POR	HGNC	protein_coding	OTTHUMT00000252796.7	55	0.00	0	CCA	NM_000941		75609733	75609735	+1	no_errors	ENST00000461988	ensembl	human	known	69_37n	in_frame_del	59	13.04	9	DEL	1.000:0.998:1.000	-
PPM1L	151742	genome.wustl.edu	37	3	160786638	160786638	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr3:160786638G>A	ENST00000498165.1	+	4	877	c.776G>A	c.(775-777)gGa>gAa	p.G259E	PPM1L_ENST00000464260.1_Missense_Mutation_p.G80E|PPM1L_ENST00000295839.9_Missense_Mutation_p.G132E|PPM1L_ENST00000480117.1_3'UTR	NM_139245.2	NP_640338.2	Q5SGD2	PPM1L_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1L	259	PP2C-like.				MAPK cascade (GO:0000165)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(1)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			AGGGTCCAGGGAATCCTGGCC	0.507																																					Pancreas(86;250 1994 13715 43211)	dbGAP											0													81.0	79.0	80.0					3																	160786638		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055115	CCDS33886.1	3q26.1	2012-04-17	2010-03-05		ENSG00000163590	ENSG00000163590	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	16381	protein-coding gene	gene with protein product	"""PP2Cepsilon"", ""Protein phosphatase 2C epsilon isoform"""	611931	"""protein phosphatase 1 (formerly 2C)-like"""			12556533	Standard	XM_006713507		Approved	PP2CE	uc003fdr.3	Q5SGD2	OTTHUMG00000159048	ENST00000498165.1:c.776G>A	3.37:g.160786638G>A	ENSP00000417659:p.Gly259Glu		Q2M3J2|Q96NM7	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.G259E	ENST00000498165.1	37	c.776	CCDS33886.1	3	.	.	.	.	.	.	.	.	.	.	G	27.3	4.820969	0.90873	.	.	ENSG00000163590	ENST00000498165;ENST00000464260;ENST00000295839	T;T;T	0.15017	2.46;2.46;2.46	5.27	5.27	0.74061	Protein phosphatase 2C-like (5);	0.045384	0.85682	D	0.000000	T	0.51500	0.1678	M	0.89785	3.06	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.62091	-0.6927	10	0.87932	D	0	.	17.8556	0.88761	0.0:0.0:1.0:0.0	.	132;259	Q5SGD2-3;Q5SGD2	.;PPM1L_HUMAN	E	259;80;132	ENSP00000417659:G259E;ENSP00000420746:G80E;ENSP00000295839:G132E	ENSP00000295839:G132E	G	+	2	0	PPM1L	162269332	1.000000	0.71417	0.983000	0.44433	0.997000	0.91878	9.447000	0.97595	2.476000	0.83614	0.555000	0.69702	GGA	PPM1L	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000163590		0.507	PPM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1L	HGNC	protein_coding	OTTHUMT00000353019.1	211	0.00	0	G	NM_139245		160786638	160786638	+1	no_errors	ENST00000498165	ensembl	human	known	69_37n	missense	208	26.92	77	SNP	1.000	A
PPP4R4	57718	genome.wustl.edu	37	14	94744955	94744955	+	Splice_Site	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr14:94744955G>C	ENST00000304338.3	+	25	2751		c.e25-1			NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4						negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						tcttccCAAAGAAAATCCAGA	0.378																																						dbGAP											0													38.0	38.0	38.0					14																	94744955		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.2598-1G>C	14.37:g.94744955G>C			Q9BUF8|Q9HCF0	Splice_Site	SNP	-	e25-1	ENST00000304338.3	37	c.2598-1	CCDS9921.1	14	.	.	.	.	.	.	.	.	.	.	G	18.45	3.626583	0.66901	.	.	ENSG00000119698	ENST00000304338	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5271	0.84334	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PPP4R4	93814708	1.000000	0.71417	0.997000	0.53966	0.886000	0.51366	5.795000	0.69074	2.623000	0.88846	0.555000	0.69702	.	PPP4R4	-	-	ENSG00000119698		0.378	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP4R4	HGNC	protein_coding	OTTHUMT00000413056.1	197	0.00	0	G	NM_058237	Intron	94744955	94744955	+1	no_errors	ENST00000304338	ensembl	human	known	69_37n	splice_site	80	60.59	123	SNP	1.000	C
PREPL	9581	genome.wustl.edu	37	2	44548923	44548923	+	Intron	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:44548923C>T	ENST00000409936.1	-	14	2532				PREPL_ENST00000409957.1_Intron|PREPL_ENST00000378520.3_Intron|PREPL_ENST00000541738.1_Intron|PREPL_ENST00000410081.1_Intron|PREPL_ENST00000409272.1_Intron|PREPL_ENST00000378511.3_Intron|PREPL_ENST00000409411.1_Intron|PREPL_ENST00000260648.6_Intron	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like							cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CAACATGTATCTAGTTCGGGA	0.433																																						dbGAP											0													69.0	68.0	68.0					2																	44548923		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.2094+42G>A	2.37:g.44548923C>T			A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Silent	SNP	NULL	p.*94	ENST00000409936.1	37	c.282	CCDS33190.1	2																																																																																			PREPL	-	NULL	ENSG00000138078		0.433	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PREPL	HGNC	protein_coding	OTTHUMT00000327900.1	197	0.00	0	C	NM_006036		44548923	44548923	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000420756	ensembl	human	novel	69_37n	silent	126	17.11	26	SNP	0.000	T
PRPF8	10594	genome.wustl.edu	37	17	1564924	1564924	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:1564924C>G	ENST00000572621.1	-	25	4448	c.4183G>C	c.(4183-4185)Gag>Cag	p.E1395Q	PRPF8_ENST00000304992.6_Missense_Mutation_p.E1395Q			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1395	Linker.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GCAATGGCCTCTTGCCTCTTG	0.577																																						dbGAP											0													97.0	79.0	85.0					17																	1564924		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.4183G>C	17.37:g.1564924C>G	ENSP00000460348:p.Glu1395Gln		O14547|O75965	Missense_Mutation	SNP	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_Pre-mRNA-splicing_factor-8,pfam_Prp8_U5-snRNA-bd,pfam_PRO_C,pfam_RRM_spliceosomal_PrP8,pfam_JAB1_Mov34_MPN_PAD1,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB1_Mov34_MPN_PAD1	p.E1395Q	ENST00000572621.1	37	c.4183	CCDS11010.1	17	.	.	.	.	.	.	.	.	.	.	c	24.9	4.583066	0.86748	.	.	ENSG00000174231	ENST00000304992	D	0.84800	-1.9	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.91818	0.7411	M	0.73372	2.23	0.80722	D	1	D	0.69078	0.997	D	0.63113	0.911	D	0.91085	0.4902	10	0.62326	D	0.03	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1395	Q6P2Q9	PRP8_HUMAN	Q	1395	ENSP00000304350:E1395Q	ENSP00000304350:E1395Q	E	-	1	0	PRPF8	1511674	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.792000	0.85828	2.941000	0.99782	0.655000	0.94253	GAG	PRPF8	-	NULL	ENSG00000174231		0.577	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	HGNC	protein_coding	OTTHUMT00000438412.2	121	0.00	0	C			1564924	1564924	-1	no_errors	ENST00000304992	ensembl	human	known	69_37n	missense	94	19.49	23	SNP	1.000	G
PTDSS1	9791	genome.wustl.edu	37	8	97274286	97274286	+	Silent	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr8:97274286G>C	ENST00000517309.1	+	1	344	c.18G>C	c.(16-18)ggG>ggC	p.G6G	MTERFD1_ENST00000523821.1_5'Flank|MTERFD1_ENST00000287025.3_5'Flank|PTDSS1_ENST00000455950.2_5'UTR	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	6					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	CCTGCGTGGGGAGCCGGACCC	0.637																																						dbGAP											0													114.0	91.0	99.0					8																	97274286		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	ENST00000517309.1:c.18G>C	8.37:g.97274286G>C			E5RFC5|Q9BUQ5	Silent	SNP	pfam_PSS	p.G6	ENST00000517309.1	37	c.18	CCDS6271.1	8																																																																																			PTDSS1	-	NULL	ENSG00000156471		0.637	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTDSS1	HGNC	protein_coding	OTTHUMT00000379743.2	100	0.00	0	G			97274286	97274286	+1	no_errors	ENST00000517309	ensembl	human	known	69_37n	silent	129	22.29	37	SNP	1.000	C
PTK2	5747	genome.wustl.edu	37	8	141900716	141900716	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr8:141900716G>A	ENST00000522684.1	-	3	350	c.121C>T	c.(121-123)Cat>Tat	p.H41Y	PTK2_ENST00000520892.1_Missense_Mutation_p.H41Y|PTK2_ENST00000521059.1_Missense_Mutation_p.H41Y|PTK2_ENST00000340930.3_Missense_Mutation_p.H41Y|PTK2_ENST00000519419.1_Missense_Mutation_p.H85Y|PTK2_ENST00000535192.1_Missense_Mutation_p.H41Y|PTK2_ENST00000519881.1_Missense_Mutation_p.H41Y|PTK2_ENST00000517887.1_Missense_Mutation_p.H85Y|PTK2_ENST00000395218.2_Missense_Mutation_p.H41Y	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	41	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			TCAAAATAATGAAAGACCTTT	0.448																																						dbGAP											0													114.0	101.0	106.0					8																	141900716		2203	4300	6503	-	-	-	SO:0001583	missense	0			L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.121C>T	8.37:g.141900716G>A	ENSP00000429911:p.His41Tyr		B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Focal_adhesion_kin_target_dom,pfam_Prot_kinase_cat_dom,pfam_FERM_central,superfamily_Kinase-like_dom,superfamily_Focal_adhesion_kin_target_dom,superfamily_FERM_central,smart_Band_41_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.H41Y	ENST00000522684.1	37	c.121	CCDS6381.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.8|29.8	5.038992|5.038992	0.93630|0.93630	.|.	.|.	ENSG00000169398|ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000517887;ENST00000521059;ENST00000395218;ENST00000340930;ENST00000519419;ENST00000524357;ENST00000520475;ENST00000519881;ENST00000520892;ENST00000523803;ENST00000521907;ENST00000517453;ENST00000520045;ENST00000521395;ENST00000521332;ENST00000524040|ENST00000519654	T;T;T;T;T;T;T|.	0.77098|.	-0.99;-0.96;-1.07;-0.99;-0.98;-0.99;-1.07|.	5.69|5.69	5.69|5.69	0.88448|0.88448	Band 4.1 domain (1);FERM domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75679|0.75679	0.3882|0.3882	M|M	0.68593|0.68593	2.085|2.085	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;0.999;0.992;1.0|.	D;D;P;D|.	0.81914|.	0.995;0.981;0.734;0.99|.	T|T	0.73132|0.73132	-0.4079|-0.4079	10|5	0.59425|.	D|.	0.04|.	.|.	19.8165|19.8165	0.96571|0.96571	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	41;41;63;41|.	B4E2N6;Q05397;Q658W2;Q8IYN9|.	.;FAK1_HUMAN;.;.|.	Y|L	41;41;85;41;41;41;85;41;41;41;41;41;41;41;41;41;41;41|51	ENSP00000429911:H41Y;ENSP00000438009:H41Y;ENSP00000429082:H85Y;ENSP00000429474:H41Y;ENSP00000378644:H41Y;ENSP00000341189:H41Y;ENSP00000429129:H85Y|.	ENSP00000341189:H41Y|.	H|S	-|-	1|2	0|0	PTK2|PTK2	141969898|141969898	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.001000|9.001000	0.93568|0.93568	2.683000|2.683000	0.91414|0.91414	0.655000|0.655000	0.94253|0.94253	CAT|TCA	PTK2	-	smart_Band_41_domain,pfscan_FERM_domain	ENSG00000169398		0.448	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK2	HGNC	protein_coding	OTTHUMT00000378054.5	143	0.00	0	G	NM_005607		141900716	141900716	-1	no_errors	ENST00000395218	ensembl	human	known	69_37n	missense	209	18.99	49	SNP	1.000	A
PTPN22	26191	genome.wustl.edu	37	1	114380359	114380359	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:114380359C>G	ENST00000359785.5	-	13	1798	c.1663G>C	c.(1663-1665)Gag>Cag	p.E555Q	PTPN22_ENST00000420377.2_Missense_Mutation_p.E555Q|PTPN22_ENST00000528414.1_Missense_Mutation_p.E500Q|PTPN22_ENST00000525799.1_Missense_Mutation_p.E428Q|PTPN22_ENST00000460620.1_Intron|PTPN22_ENST00000538253.1_Missense_Mutation_p.E311Q	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	555					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCTTGCTTCTCAGGTAAATCA	0.373																																						dbGAP											0													137.0	132.0	134.0					1																	114380359		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.1663G>C	1.37:g.114380359C>G	ENSP00000352833:p.Glu555Gln		A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Non-rcpt_Tyr_Pase_8/22,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.E555Q	ENST00000359785.5	37	c.1663	CCDS863.1	1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.974178	0.34848	.	.	ENSG00000134242	ENST00000359785;ENST00000528414;ENST00000538253;ENST00000420377;ENST00000525799;ENST00000354605	T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09	5.96	2.02	0.26589	.	0.372260	0.26268	N	0.025352	T	0.23210	0.0561	L	0.40543	1.245	0.09310	N	1	B;P;B;B;B;B	0.35507	0.176;0.506;0.08;0.062;0.13;0.08	B;B;B;B;B;B	0.25759	0.031;0.063;0.011;0.017;0.026;0.011	T	0.03969	-1.0988	10	0.30078	T	0.28	.	6.503	0.22180	0.0:0.6529:0.1384:0.2087	.	311;428;555;500;555;555	F5H2S8;E9PPI1;E9PMT0;E9PLD8;G5E984;Q9Y2R2	.;.;.;.;.;PTN22_HUMAN	Q	555;500;311;555;428;555	ENSP00000352833:E555Q;ENSP00000435176:E500Q;ENSP00000439372:E311Q;ENSP00000388229:E555Q;ENSP00000432674:E428Q	ENSP00000346621:E555Q	E	-	1	0	PTPN22	114181882	0.023000	0.18921	0.749000	0.31150	0.977000	0.68977	0.414000	0.21164	0.862000	0.35528	0.655000	0.94253	GAG	PTPN22	-	pirsf_Non-rcpt_Tyr_Pase_8/22	ENSG00000134242		0.373	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN22	HGNC	protein_coding	OTTHUMT00000033015.1	303	0.00	0	C	NM_015967		114380359	114380359	-1	no_errors	ENST00000359785	ensembl	human	known	69_37n	missense	340	16.26	66	SNP	0.008	G
PTPN6	5777	genome.wustl.edu	37	12	7064127	7064127	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:7064127C>T	ENST00000318974.9	+	4	730	c.486C>T	c.(484-486)ctC>ctT	p.L162L	PTPN6_ENST00000456013.1_Silent_p.L162L|PTPN6_ENST00000447931.2_Silent_p.L123L|PTPN6_ENST00000399448.1_Silent_p.L164L	NM_002831.5	NP_002822.2	P29350	PTN6_HUMAN	protein tyrosine phosphatase, non-receptor type 6	162	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|apoptotic process (GO:0006915)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|G-protein coupled receptor signaling pathway (GO:0007186)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|natural killer cell mediated cytotoxicity (GO:0042267)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell proliferation (GO:0008285)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein dephosphorylation (GO:0006470)|regulation of B cell differentiation (GO:0045577)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|type I interferon signaling pathway (GO:0060337)	alpha-beta T cell receptor complex (GO:0042105)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|prostate(3)	18						GCTCCCCGCTCAGGGTCACCC	0.642																																						dbGAP											0													50.0	55.0	53.0					12																	7064127		1969	4149	6118	-	-	-	SO:0001819	synonymous_variant	0				CCDS41744.1, CCDS44820.1, CCDS44821.1	12p13.31	2013-02-14			ENSG00000111679	ENSG00000111679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9658	protein-coding gene	gene with protein product		176883				1639416	Standard	NM_080548		Approved	HCP, HCPH, PTP-1C, SHP-1, SHP1	uc001qsa.1	P29350	OTTHUMG00000168518	ENST00000318974.9:c.486C>T	12.37:g.7064127C>T			A8K306|G3V0F8|Q969V8|Q9UK67	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.S129L	ENST00000318974.9	37	c.386	CCDS44820.1	12	.	.	.	.	.	.	.	.	.	.	C	16.35	3.097348	0.56075	.	.	ENSG00000111679	ENST00000541698	T	0.42513	0.97	5.07	3.13	0.36017	.	.	.	.	.	T	0.46092	0.1375	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32666	-0.9898	5	.	.	.	.	9.951	0.41638	0.0:0.7853:0.1388:0.0759	.	.	.	.	L	129	ENSP00000445646:S129L	.	S	+	2	0	PTPN6	6934388	1.000000	0.71417	0.999000	0.59377	0.895000	0.52256	2.147000	0.42226	1.153000	0.42468	0.491000	0.48974	TCA	PTPN6	-	NULL	ENSG00000111679		0.642	PTPN6-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN6	HGNC	protein_coding	OTTHUMT00000400023.1	75	0.00	0	C	NM_002831		7064127	7064127	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000541698	ensembl	human	putative	69_37n	missense	54	40.66	37	SNP	1.000	T
RAB3A	5864	genome.wustl.edu	37	19	18309660	18309660	+	Splice_Site	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:18309660C>G	ENST00000222256.4	-	4	526		c.e4-1		RAB3A_ENST00000464076.3_Splice_Site	NM_002866.4	NP_002857.1	P20336	RAB3A_HUMAN	RAB3A, member RAS oncogene family						axonogenesis (GO:0007409)|constitutive secretory pathway (GO:0045054)|glutamate secretion (GO:0014047)|GTP catabolic process (GO:0006184)|lung development (GO:0030324)|maintenance of presynaptic active zone structure (GO:0048790)|mitochondrion organization (GO:0007005)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|positive regulation of exocytosis (GO:0045921)|post-embryonic development (GO:0009791)|protein transport (GO:0015031)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|respiratory system process (GO:0003016)|response to electrical stimulus (GO:0051602)|sensory perception of touch (GO:0050975)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle recycling (GO:0036465)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			NS(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	8						CTGGGTGGACCTATAGGAGGC	0.572																																						dbGAP											0													98.0	75.0	83.0					19																	18309660		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS12372.1	19p13.2	2008-07-17			ENSG00000105649	ENSG00000105649		"""RAB, member RAS oncogene"""	9777	protein-coding gene	gene with protein product	"""RAS-associated protein RAB3A"""	179490				2687157, 7532276	Standard	NM_002866		Approved		uc002nie.2	P20336	OTTHUMG00000137378	ENST00000222256.4:c.348-1G>C	19.37:g.18309660C>G			A8K0J4|Q9NYE1	Splice_Site	SNP	-	e3-1	ENST00000222256.4	37	c.348-1	CCDS12372.1	19	.	.	.	.	.	.	.	.	.	.	C	16.21	3.058583	0.55325	.	.	ENSG00000105649	ENST00000222256	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1636	0.81734	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RAB3A	18170660	1.000000	0.71417	0.997000	0.53966	0.552000	0.35366	7.636000	0.83301	2.409000	0.81822	0.561000	0.74099	.	RAB3A	-	-	ENSG00000105649		0.572	RAB3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3A	HGNC	protein_coding	OTTHUMT00000268056.2	150	0.00	0	C	NM_002866	Intron	18309660	18309660	-1	no_errors	ENST00000222256	ensembl	human	known	69_37n	splice_site	111	21.68	31	SNP	1.000	G
RAB3GAP2	25782	genome.wustl.edu	37	1	220330691	220330691	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:220330691G>C	ENST00000358951.2	-	31	3592	c.3476C>G	c.(3475-3477)tCc>tGc	p.S1159C		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	1159					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)	p.S1159F(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		GCACAGGATGGAGTGGTGCTC	0.498																																						dbGAP											1	Substitution - Missense(1)	prostate(1)											104.0	92.0	96.0					1																	220330691		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.3476C>G	1.37:g.220330691G>C	ENSP00000351832:p.Ser1159Cys		A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.S1159C	ENST00000358951.2	37	c.3476	CCDS31028.1	1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.644167	0.29246	.	.	ENSG00000118873	ENST00000358951	T	0.30714	1.52	5.47	5.47	0.80525	.	0.217334	0.49916	D	0.000139	T	0.17959	0.0431	N	0.14661	0.345	0.33173	D	0.548521	B;B	0.10296	0.003;0.003	B;B	0.09377	0.004;0.004	T	0.11591	-1.0581	10	0.38643	T	0.18	.	9.6123	0.39670	0.1606:0.0:0.8394:0.0	.	1159;1159	Q9H2M9;A6H8V0	RBGPR_HUMAN;.	C	1159	ENSP00000351832:S1159C	ENSP00000351832:S1159C	S	-	2	0	RAB3GAP2	218397314	0.980000	0.34600	0.578000	0.28575	0.985000	0.73830	2.090000	0.41682	2.566000	0.86566	0.655000	0.94253	TCC	RAB3GAP2	-	NULL	ENSG00000118873		0.498	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP2	HGNC	protein_coding	OTTHUMT00000090205.2	153	0.00	0	G	NM_012414		220330691	220330691	-1	no_errors	ENST00000358951	ensembl	human	known	69_37n	missense	239	11.40	31	SNP	0.744	C
RBM44	375316	genome.wustl.edu	37	2	238725683	238725683	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:238725683G>A	ENST00000409864.1	+	3	378	c.124G>A	c.(124-126)Ggt>Agt	p.G42S	RBM44_ENST00000444524.2_Intron|RBM44_ENST00000316997.4_Missense_Mutation_p.G42S			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	41						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		ATCCTCCAATGGTTGTGATGA	0.303																																						dbGAP											0													53.0	51.0	52.0					2																	238725683		1820	4072	5892	-	-	-	SO:0001583	missense	0			AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.124G>A	2.37:g.238725683G>A	ENSP00000386727:p.Gly42Ser		A0AUW3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G42S	ENST00000409864.1	37	c.124	CCDS46554.1	2	.	.	.	.	.	.	.	.	.	.	G	12.16	1.853352	0.32791	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.29917	1.55;1.55	5.47	1.1	0.20463	.	0.267871	0.26836	N	0.022257	T	0.20088	0.0483	L	0.52573	1.65	0.09310	N	1	B	0.32302	0.363	B	0.28232	0.087	T	0.23368	-1.0190	10	0.87932	D	0	-5.8184	1.1639	0.01811	0.1979:0.1641:0.4441:0.1938	.	41	Q6ZP01	RBM44_HUMAN	S	42	ENSP00000321179:G42S;ENSP00000386727:G42S	ENSP00000321179:G42S	G	+	1	0	RBM44	238390422	0.001000	0.12720	0.006000	0.13384	0.224000	0.24922	0.539000	0.23175	0.622000	0.30249	0.557000	0.71058	GGT	RBM44	-	NULL	ENSG00000177483		0.303	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM44	HGNC	protein_coding	OTTHUMT00000328733.2	156	0.00	0	G	NM_001080504		238725683	238725683	+1	no_errors	ENST00000316997	ensembl	human	known	69_37n	missense	64	24.71	21	SNP	0.000	A
RETNLB	84666	genome.wustl.edu	37	3	108475375	108475375	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr3:108475375C>G	ENST00000295755.6	-	2	386	c.188G>C	c.(187-189)aGa>aCa	p.R63T	RETNLB_ENST00000482939.1_5'UTR	NM_032579.2	NP_115968.1	Q9BQ08	RETNB_HUMAN	resistin like beta	63					cell proliferation (GO:0008283)	extracellular region (GO:0005576)				endometrium(1)|kidney(3)|lung(10)|prostate(1)|skin(1)	16						GGAGGACGGTCTGCCTTGGCT	0.537																																						dbGAP											0													162.0	128.0	139.0					3																	108475375		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF290873	CCDS2953.1	3q13.1	2008-02-05			ENSG00000163515	ENSG00000163515			20388	protein-coding gene	gene with protein product		605645				10921885, 12574343	Standard	NM_032579		Approved	HXCP2, FIZZ2, RELMb	uc003dxh.2	Q9BQ08	OTTHUMG00000159393	ENST00000295755.6:c.188G>C	3.37:g.108475375C>G	ENSP00000295755:p.Arg63Thr		Q14D27	Missense_Mutation	SNP	pfam_Resistin,superfamily_Resistin	p.R63T	ENST00000295755.6	37	c.188	CCDS2953.1	3	.	.	.	.	.	.	.	.	.	.	C	2.641	-0.284244	0.05605	.	.	ENSG00000163515	ENST00000295755	T	0.41400	1.0	4.06	-6.79	0.01715	.	1.215720	0.06045	N	0.655587	T	0.24005	0.0581	N	0.24115	0.695	0.09310	N	1	B	0.18013	0.025	B	0.12156	0.007	T	0.25117	-1.0141	10	0.22109	T	0.4	.	9.4648	0.38806	0.0:0.6125:0.1454:0.2421	.	63	Q9BQ08	RETNB_HUMAN	T	63	ENSP00000295755:R63T	ENSP00000295755:R63T	R	-	2	0	RETNLB	109958065	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.615000	0.00882	-0.848000	0.04163	-0.323000	0.08544	AGA	RETNLB	-	pfam_Resistin,superfamily_Resistin	ENSG00000163515		0.537	RETNLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RETNLB	HGNC	protein_coding	OTTHUMT00000355093.1	165	0.00	0	C			108475375	108475375	-1	no_errors	ENST00000295755	ensembl	human	known	69_37n	missense	161	19.50	39	SNP	0.000	G
RIPK1	8737	genome.wustl.edu	37	6	3111036	3111036	+	Splice_Site	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:3111036G>A	ENST00000259808.4	+	10	1874		c.e10-1		RIPK1_ENST00000380409.2_Splice_Site|RIPK1_ENST00000541791.1_Splice_Site			Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine kinase 1						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|amyloid fibril formation (GO:1990000)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to tumor necrosis factor (GO:0071356)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of ATP:ADP antiporter activity (GO:0070926)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to tumor necrosis factor (GO:0034612)|ripoptosome assembly (GO:0097343)|ripoptosome assembly involved in necroptotic process (GO:1901026)|T cell apoptotic process (GO:0070231)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|death domain binding (GO:0070513)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				TCTCTATGCAGATGAATCTAT	0.358																																						dbGAP											0													71.0	76.0	74.0					6																	3111036		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U25994	CCDS4482.1	6p25.2	2008-02-05			ENSG00000137275	ENSG00000137275			10019	protein-coding gene	gene with protein product		603453				7538908, 8612133	Standard	XM_005249458		Approved	RIP	uc003mux.3	Q13546	OTTHUMG00000014134	ENST00000259808.4:c.1577-1G>A	6.37:g.3111036G>A			A0AV89|B2RAG1|B4E3F9|Q13180|Q59H33	Splice_Site	SNP	-	e9-1	ENST00000259808.4	37	c.1577-1	CCDS4482.1	6	.	.	.	.	.	.	.	.	.	.	G	11.61	1.690288	0.29962	.	.	ENSG00000137275	ENST00000259808;ENST00000541791;ENST00000380409;ENST00000453483	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7165	0.96122	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RIPK1	3056035	1.000000	0.71417	0.961000	0.40146	0.021000	0.10359	5.151000	0.64875	2.820000	0.97059	0.655000	0.94253	.	RIPK1	-	-	ENSG00000137275		0.358	RIPK1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPK1	HGNC	protein_coding	OTTHUMT00000039659.2	196	0.00	0	G	NM_003804	Intron	3111036	3111036	+1	no_errors	ENST00000259808	ensembl	human	known	69_37n	splice_site	156	12.71	23	SNP	0.999	A
RNF182	221687	genome.wustl.edu	37	6	13978083	13978083	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:13978083C>A	ENST00000488300.1	+	3	1256	c.733C>A	c.(733-735)Cct>Act	p.P245T	RNF182_ENST00000537663.1_Missense_Mutation_p.P245T|RNF182_ENST00000537388.1_Missense_Mutation_p.P245T|RNF182_ENST00000544682.1_Missense_Mutation_p.P245T	NM_152737.3	NP_689950.1	Q8N6D2	RN182_HUMAN	ring finger protein 182	245					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|large_intestine(7)|liver(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(50;0.00405)|Ovarian(93;0.0964)	all_hematologic(90;0.135)	Epithelial(50;0.195)			CTGTATGGCACCTCCTTCTTA	0.373																																						dbGAP											0													148.0	141.0	143.0					6																	13978083		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090576	CCDS4531.1	6p23	2013-01-09			ENSG00000180537	ENSG00000180537		"""RING-type (C3HC4) zinc fingers"""	28522	protein-coding gene	gene with protein product						12477932	Standard	NM_152737		Approved	MGC33993	uc003nbg.3	Q8N6D2	OTTHUMG00000014280	ENST00000488300.1:c.733C>A	6.37:g.13978083C>A	ENSP00000420465:p.Pro245Thr		B2RDG2|Q8NBG3	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.P245T	ENST00000488300.1	37	c.733	CCDS4531.1	6	.	.	.	.	.	.	.	.	.	.	C	5.005	0.186559	0.09495	.	.	ENSG00000180537	ENST00000537663;ENST00000488300;ENST00000544682;ENST00000537388	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.21	4.09	0.47781	.	0.547984	0.20500	N	0.091120	T	0.52613	0.1745	N	0.12182	0.205	0.26624	N	0.972592	B	0.02656	0.0	B	0.01281	0.0	T	0.26985	-1.0087	9	.	.	.	-2.6678	2.5491	0.04744	0.2941:0.5145:0.0:0.1914	.	245	Q8N6D2	RN182_HUMAN	T	245	ENSP00000443228:P245T;ENSP00000420465:P245T;ENSP00000442021:P245T;ENSP00000441271:P245T	.	P	+	1	0	RNF182	14086062	0.265000	0.24102	0.923000	0.36655	0.865000	0.49528	1.480000	0.35464	2.580000	0.87095	0.557000	0.71058	CCT	RNF182	-	NULL	ENSG00000180537		0.373	RNF182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF182	HGNC	protein_coding	OTTHUMT00000039911.2	340	0.00	0	C	NM_152737		13978083	13978083	+1	no_errors	ENST00000488300	ensembl	human	known	69_37n	missense	268	14.33	45	SNP	0.982	A
RIMS1	22999	genome.wustl.edu	37	6	73110378	73110378	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:73110378C>G	ENST00000521978.1	+	34	5041	c.5041C>G	c.(5041-5043)Ctg>Gtg	p.L1681V	RIMS1_ENST00000431478.2_3'UTR|RIMS1_ENST00000523963.1_Missense_Mutation_p.L806V|RIMS1_ENST00000348717.5_Missense_Mutation_p.L1464V|RIMS1_ENST00000264839.7_Missense_Mutation_p.L1530V|RIMS1_ENST00000522291.1_Missense_Mutation_p.L1280V|RIMS1_ENST00000401910.3_Missense_Mutation_p.L1001V|RIMS1_ENST00000517827.1_Missense_Mutation_p.L815V|RIMS1_ENST00000538414.1_Missense_Mutation_p.L487V|RIMS1_ENST00000518273.1_Missense_Mutation_p.L1360V|RIMS1_ENST00000425662.2_Missense_Mutation_p.L749V|RIMS1_ENST00000517960.1_Missense_Mutation_p.L1464V|RIMS1_ENST00000491071.2_Missense_Mutation_p.L1470V|RIMS1_ENST00000414192.2_Missense_Mutation_p.L208V|RIMS1_ENST00000520567.1_Missense_Mutation_p.L1331V	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1681					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CCAGTCATCTCTGGAAAGTTC	0.493																																						dbGAP											0													77.0	78.0	78.0					6																	73110378		1882	4118	6000	-	-	-	SO:0001583	missense	0			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.5041C>G	6.37:g.73110378C>G	ENSP00000428417:p.Leu1681Val		A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ,pfscan_Rab-bd_domain,pfscan_Znf_FYVE-rel	p.L1681V	ENST00000521978.1	37	c.5041	CCDS47449.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.9|20.9	4.074159|4.074159	0.76415|0.76415	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000517827;ENST00000370420;ENST00000538414;ENST00000414192|ENST00000517433	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|T	0.40476|0.20881	1.99;1.47;1.44;1.47;1.9;1.91;1.93;1.37;1.43;1.81;2.17;1.72;1.03;1.33;1.84|2.04	5.48|5.48	3.65|3.65	0.41850|0.41850	.|.	0.000000|.	0.47093|.	D|.	0.000256|.	T|T	0.28466|0.28466	0.0704|0.0704	M|M	0.81497|0.81497	2.545|2.545	0.54753|0.54753	D|D	0.999982|0.999982	D;D;D;P;D;D;B;D;D;P;P;P;D|.	0.76494|.	0.999;0.998;0.997;0.754;0.982;0.998;0.282;0.997;0.982;0.629;0.956;0.935;0.982|.	D;D;D;P;D;D;B;D;D;B;D;P;D|.	0.85130|.	0.997;0.989;0.992;0.594;0.952;0.997;0.134;0.956;0.952;0.307;0.931;0.492;0.952|.	T|T	0.07501|0.07501	-1.0769|-1.0769	10|7	0.66056|0.87932	D|D	0.02|0	-13.0952|-13.0952	10.5446|10.5446	0.45052|0.45052	0.1334:0.7973:0.0:0.0693|0.1334:0.7973:0.0:0.0693	.|.	305;487;815;806;1530;1001;1280;584;1360;1464;757;1470;1681|.	B7Z6K9;B7Z7W2;B7Z3S3;E9PHF5;E9PHR1;E9PF48;E7EX08;Q5JY22;E7ERQ1;E7ENC2;Q5JY21;C9JNW6;Q86UR5|.	.;.;.;.;.;.;.;.;.;.;.;.;RIMS1_HUMAN|.	V|C	1470;1530;1470;1464;1360;1280;1530;1464;1360;1331;1280;1681;1001;806;749;815;729;487;208|1026	ENSP00000430101:L1470V;ENSP00000275037:L1464V;ENSP00000264839:L1530V;ENSP00000429959:L1464V;ENSP00000430408:L1360V;ENSP00000430502:L1331V;ENSP00000430932:L1280V;ENSP00000428417:L1681V;ENSP00000385649:L1001V;ENSP00000428328:L806V;ENSP00000411235:L749V;ENSP00000428367:L815V;ENSP00000359448:L729V;ENSP00000439730:L487V;ENSP00000402273:L208V|ENSP00000430359:S1026C	ENSP00000264839:L1530V|ENSP00000430359:S1026C	L|S	+|+	1|2	2|0	RIMS1|RIMS1	73167099|73167099	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.716000|7.716000	0.84723|0.84723	0.733000|0.733000	0.32492|0.32492	0.655000|0.655000	0.94253|0.94253	CTG|TCT	RIMS1	-	NULL	ENSG00000079841		0.493	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	HGNC	protein_coding	OTTHUMT00000374968.1	168	0.00	0	C			73110378	73110378	+1	no_errors	ENST00000521978	ensembl	human	known	69_37n	missense	124	22.98	37	SNP	1.000	G
RPE65	6121	genome.wustl.edu	37	1	68895512	68895512	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:68895512C>A	ENST00000262340.5	-	14	1602	c.1549G>T	c.(1549-1551)Gaa>Taa	p.E517*		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	517					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)			central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						ATCTCCACTTCAGCCCGGGCA	0.448																																						dbGAP											0													88.0	82.0	84.0					1																	68895512		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.1549G>T	1.37:g.68895512C>A	ENSP00000262340:p.Glu517*		A8K1L0|Q5T9U3	Nonsense_Mutation	SNP	pfam_Carotenoid_Oase	p.E517*	ENST00000262340.5	37	c.1549	CCDS643.1	1	.	.	.	.	.	.	.	.	.	.	C	38	6.942383	0.97952	.	.	ENSG00000116745	ENST00000262340	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-0.0845	19.0455	0.93018	0.0:1.0:0.0:0.0	.	.	.	.	X	517	.	ENSP00000262340:E517X	E	-	1	0	RPE65	68668100	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.888000	0.69758	2.597000	0.87782	0.655000	0.94253	GAA	RPE65	-	pfam_Carotenoid_Oase	ENSG00000116745		0.448	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPE65	HGNC	protein_coding	OTTHUMT00000025509.1	203	0.00	0	C	NM_000329		68895512	68895512	-1	no_errors	ENST00000262340	ensembl	human	known	69_37n	nonsense	78	52.73	87	SNP	1.000	A
RPS2	6187	genome.wustl.edu	37	16	2014292	2014292	+	Missense_Mutation	SNP	G	G	T	rs140539932		TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr16:2014292G>T	ENST00000343262.4	-	3	308	c.252C>A	c.(250-252)ttC>ttA	p.F84L	SNHG9_ENST00000459373.1_lincRNA|RNF151_ENST00000569714.1_5'Flank|SNORA64_ENST00000384674.1_RNA|RNF151_ENST00000569210.2_5'Flank|RPS2_ENST00000529806.1_Intron|RNF151_ENST00000321392.3_5'Flank|RPS2_ENST00000530225.1_Missense_Mutation_p.F84L|SNORA10_ENST00000384084.1_RNA|RPS2_ENST00000526522.1_Missense_Mutation_p.F84L	NM_002952.3	NP_002943.2	P15880	RS2_HUMAN	ribosomal protein S2	84					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of transferase activity (GO:0051347)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						TAGGCAGGGAGAAGAGATAGA	0.557																																						dbGAP											0													50.0	54.0	53.0					16																	2014292		2199	4300	6499	-	-	-	SO:0001583	missense	0			AB007147	CCDS10452.1	16p13.3	2011-04-05			ENSG00000140988	ENSG00000140988		"""S ribosomal proteins"""	10404	protein-coding gene	gene with protein product		603624				9582194	Standard	NM_002952		Approved	LLREP3, S2	uc002cno.2	P15880	OTTHUMG00000128708	ENST00000343262.4:c.252C>A	16.37:g.2014292G>T	ENSP00000341885:p.Phe84Leu		B2R5G0|D3DU82|Q3MIB1	Missense_Mutation	SNP	pfam_Ribosomal_S5_N,pfam_Ribosomal_S5_C,superfamily_Ribosomal_S5_D2-typ_fold,pfscan_Ribosomal_S5_N,tigrfam_Ribosomal_S5_euk/arc	p.F84L	ENST00000343262.4	37	c.252	CCDS10452.1	16	.	.	.	.	.	.	.	.	.	.	g	12.96	2.095697	0.36952	.	.	ENSG00000140988	ENST00000526522;ENST00000533186;ENST00000530225;ENST00000343262;ENST00000527302	.	.	.	4.22	0.052	0.14300	.	0.079153	0.51477	U	0.000083	T	0.51958	0.1705	M	0.75150	2.29	0.80722	D	1	B;P	0.37548	0.01;0.599	B;B	0.35607	0.032;0.206	T	0.51348	-0.8717	9	0.87932	D	0	.	8.4183	0.32685	0.3284:0.0:0.6716:0.0	.	84;84	P15880;E9PQD7	RS2_HUMAN;.	L	84;22;84;84;84	.	ENSP00000341885:F84L	F	-	3	2	RPS2	1954293	1.000000	0.71417	0.109000	0.21407	0.030000	0.12068	1.883000	0.39658	-0.116000	0.11893	0.591000	0.81541	TTC	RPS2	-	tigrfam_Ribosomal_S5_euk/arc	ENSG00000140988		0.557	RPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS2	HGNC	protein_coding	OTTHUMT00000250613.2	100	0.00	0	G	NM_002952		2014292	2014292	-1	no_errors	ENST00000343262	ensembl	human	known	69_37n	missense	76	30.28	33	SNP	1.000	T
RPS27	6232	genome.wustl.edu	37	1	153963702	153963702	+	Intron	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:153963702G>C	ENST00000368567.4	+	2	153				RPS27_ENST00000392558.4_Missense_Mutation_p.E40Q|RPS27_ENST00000493224.1_Intron	NM_001030.4	NP_001021.1	P42677	RS27_HUMAN	ribosomal protein S27						cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|nucleus (GO:0005634)|ribosome (GO:0005840)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)|zinc ion binding (GO:0008270)			kidney(1)	1	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ATGCCCAGGTGAGGAGACGGC	0.502																																						dbGAP											0													23.0	21.0	22.0					1																	153963702		2203	4298	6501	-	-	-	SO:0001627	intron_variant	0			U57847	CCDS1059.1	1q21	2011-04-06	2008-08-29		ENSG00000177954	ENSG00000177954		"""S ribosomal proteins"""	10416	protein-coding gene	gene with protein product	"""metallopanstimulin 1"""	603702	"""ribosomal protein S27 (metallopanstimulin 1)"""			8908372, 8407955	Standard	NM_001030		Approved	MPS-1, MPS1, S27	uc001fdv.3	P42677	OTTHUMG00000036591	ENST00000368567.4:c.115+3G>C	1.37:g.153963702G>C			Q5T4L6	Missense_Mutation	SNP	NULL	p.E40Q	ENST00000368567.4	37	c.118	CCDS1059.1	1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.904290	0.52333	.	.	ENSG00000177954	ENST00000392558	.	.	.	4.77	1.67	0.24075	.	.	.	.	.	T	0.15089	0.0364	.	.	.	0.22693	N	0.998843	.	.	.	.	.	.	T	0.26849	-1.0091	4	.	.	.	.	7.389	0.26899	0.4709:0.0:0.5291:0.0	.	.	.	.	Q	40	.	.	E	+	1	0	RPS27	152230326	1.000000	0.71417	0.996000	0.52242	0.554000	0.35429	0.956000	0.29202	0.170000	0.19704	-0.377000	0.06932	GAG	RPS27	-	NULL	ENSG00000177954		0.502	RPS27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS27	HGNC	protein_coding	OTTHUMT00000088997.1	103	0.96	1	G	NM_001030		153963702	153963702	+1	no_errors	ENST00000392558	ensembl	human	known	69_37n	missense	102	29.66	43	SNP	0.998	C
SCAF11	9169	genome.wustl.edu	37	12	46320776	46320776	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:46320776G>A	ENST00000369367.3	-	11	2941	c.2708C>T	c.(2707-2709)cCa>cTa	p.P903L	SCAF11_ENST00000465950.1_Missense_Mutation_p.P588L|SCAF11_ENST00000550629.1_5'Flank|SCAF11_ENST00000419565.2_Missense_Mutation_p.P903L|SCAF11_ENST00000549162.1_Missense_Mutation_p.P711L	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	903	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						TTTTTCTCCTGGGGAAGAATC	0.458																																						dbGAP											0													121.0	128.0	126.0					12																	46320776		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.2708C>T	12.37:g.46320776G>A	ENSP00000358374:p.Pro903Leu		A6NEU9|A6NLW5|Q8IW59	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.P903L	ENST00000369367.3	37	c.2708	CCDS8748.2	12	.	.	.	.	.	.	.	.	.	.	G	20.8	4.043534	0.75732	.	.	ENSG00000139218	ENST00000465950;ENST00000369367;ENST00000549162;ENST00000419565;ENST00000547018	T;T;T;T;T	0.55760	1.26;1.99;1.26;1.99;0.5	5.93	5.93	0.95920	.	0.276454	0.31784	N	0.007062	T	0.67534	0.2903	L	0.54323	1.7	0.45662	D	0.998582	D;D	0.63046	0.992;0.986	D;P	0.64410	0.925;0.726	T	0.62011	-0.6944	10	0.35671	T	0.21	-0.4462	18.5344	0.91004	0.0:0.0:1.0:0.0	.	711;903	F8VXG7;Q99590	.;SCAFB_HUMAN	L	588;903;711;903;843	ENSP00000449812:P588L;ENSP00000358374:P903L;ENSP00000448864:P711L;ENSP00000413036:P903L;ENSP00000446746:P843L	ENSP00000358374:P903L	P	-	2	0	SCAF11	44607043	1.000000	0.71417	0.579000	0.28588	0.978000	0.69477	7.797000	0.85911	2.826000	0.97356	0.655000	0.94253	CCA	SCAF11	-	NULL	ENSG00000139218		0.458	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF11	HGNC	protein_coding	OTTHUMT00000313992.2	183	0.00	0	G	NM_004719		46320776	46320776	-1	no_errors	ENST00000369367	ensembl	human	known	69_37n	missense	176	17.37	37	SNP	0.997	A
ZBED9	114821	genome.wustl.edu	37	6	28540923	28540923	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:28540923G>C	ENST00000452236.2	-	4	3360	c.2743C>G	c.(2743-2745)Ctt>Gtt	p.L915V	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						tagactaaaagaattatcatg	0.328																																						dbGAP											0													62.0	58.0	59.0					6																	28540923		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000452236.2:c.2743C>G	6.37:g.28540923G>C	ENSP00000395259:p.Leu915Val			Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Integrase_cat-core,pfam_HATC,superfamily_Retrov_capsid_C,superfamily_RNaseH-like_dom,smart_Tscrpt_reg_SCAN,pfscan_Integrase_cat-core,pfscan_Tscrpt_reg_SCAN	p.L915V	ENST00000452236.2	37	c.2743	CCDS34355.1	6	.	.	.	.	.	.	.	.	.	.	G	14.08	2.427809	0.43122	.	.	ENSG00000232040	ENST00000452236	T	0.26373	1.74	2.14	2.14	0.27477	Ribonuclease H-like (1);	0.127754	0.31246	U	0.007984	T	0.32315	0.0825	M	0.75447	2.3	0.24714	N	0.993182	P	0.51057	0.941	D	0.71414	0.973	T	0.01652	-1.1303	10	0.87932	D	0	.	7.8439	0.29414	0.0:0.0:1.0:0.0	.	915	Q6R2W3	SCND3_HUMAN	V	915	ENSP00000395259:L915V	ENSP00000395259:L915V	L	-	1	0	SCAND3	28648902	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	2.318000	0.43779	1.507000	0.48752	0.561000	0.74099	CTT	SCAND3	-	superfamily_RNaseH-like_dom	ENSG00000232040		0.328	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	HGNC	protein_coding	OTTHUMT00000043551.3	220	0.00	0	G			28540923	28540923	-1	no_errors	ENST00000452236	ensembl	human	known	69_37n	missense	174	29.84	74	SNP	1.000	C
SCARB2	950	genome.wustl.edu	37	4	77100771	77100771	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr4:77100771G>C	ENST00000264896.2	-	4	860	c.511C>G	c.(511-513)Cac>Gac	p.H171D	SCARB2_ENST00000452464.2_Intron	NM_005506.3	NP_005497.1	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2	171	Important for interaction with GBA.				cell adhesion (GO:0007155)|protein targeting to lysosome (GO:0006622)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(3)|prostate(2)|skin(1)	22			Lung(101;0.196)			TCAACTGTGTGAGTCACAAAG	0.483																																						dbGAP											0													219.0	209.0	212.0					4																	77100771		2203	4300	6503	-	-	-	SO:0001583	missense	0			D12676	CCDS3577.1, CCDS56335.1	4q21.1	2014-07-11	2002-09-06	2002-09-06	ENSG00000138760	ENSG00000138760			1665	protein-coding gene	gene with protein product		602257	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II)"""	CD36L2		1374238	Standard	NM_005506		Approved	HLGP85, LIMPII, SR-BII, LIMP-2	uc003hju.2	Q14108	OTTHUMG00000130099	ENST00000264896.2:c.511C>G	4.37:g.77100771G>C	ENSP00000264896:p.His171Asp		B4DKD8|E7EM68|Q53Y63	Missense_Mutation	SNP	pfam_CD36,superfamily_NA-bd_OB-fold-like,prints_LimpII,prints_CD36,prints_CD36_antigen	p.H171D	ENST00000264896.2	37	c.511	CCDS3577.1	4	.	.	.	.	.	.	.	.	.	.	G	17.31	3.358514	0.61403	.	.	ENSG00000138760	ENST00000264896	T	0.71817	-0.6	5.95	5.95	0.96441	.	0.271232	0.46145	D	0.000304	T	0.81269	0.4787	M	0.77616	2.38	0.80722	D	1	P	0.49961	0.93	P	0.52554	0.702	T	0.82774	-0.0291	10	0.72032	D	0.01	.	19.1412	0.93446	0.0:0.0:1.0:0.0	.	171	Q14108	SCRB2_HUMAN	D	171	ENSP00000264896:H171D	ENSP00000264896:H171D	H	-	1	0	SCARB2	77319795	1.000000	0.71417	0.738000	0.30950	0.047000	0.14425	8.388000	0.90170	2.811000	0.96726	0.655000	0.94253	CAC	SCARB2	-	pfam_CD36,prints_LimpII	ENSG00000138760		0.483	SCARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCARB2	HGNC	protein_coding	OTTHUMT00000252403.1	173	0.00	0	G	NM_005506		77100771	77100771	-1	no_errors	ENST00000264896	ensembl	human	known	69_37n	missense	310	25.42	106	SNP	0.995	C
SCGB1D2	10647	genome.wustl.edu	37	11	62009821	62009821	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:62009821C>T	ENST00000244926.3	+	1	140	c.42C>T	c.(40-42)ctC>ctT	p.L14L	RP11-703H8.9_ENST00000529875.1_RNA	NM_006551.3	NP_006542.1	O95969	SG1D2_HUMAN	secretoglobin, family 1D, member 2	14						extracellular space (GO:0005615)				breast(1)|endometrium(1)|lung(1)	3						CGCTGGCCCTCTGCTGCTACC	0.552																																						dbGAP											0													167.0	126.0	140.0					11																	62009821		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AJ224172	CCDS8017.1	11q13	2011-12-14			ENSG00000124935	ENSG00000124935		"""Secretoglobins"""	18396	protein-coding gene	gene with protein product	"""prostatein-like lipophilin B"", ""lipophilin B (uteroglobin family member), prostatein-like"""	615061				10066439, 9720917, 22155607	Standard	XM_006718422		Approved	LPHB, LIPB	uc001ntb.3	O95969	OTTHUMG00000167508	ENST00000244926.3:c.42C>T	11.37:g.62009821C>T			Q2M3N9	Silent	SNP	pfam_Uteroglobin-like_superfam,superfamily_Secretoglobin	p.L14	ENST00000244926.3	37	c.42	CCDS8017.1	11																																																																																			SCGB1D2	-	pfam_Uteroglobin-like_superfam	ENSG00000124935		0.552	SCGB1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCGB1D2	HGNC	protein_coding	OTTHUMT00000394859.1	241	0.00	0	C	NM_006551		62009821	62009821	+1	no_errors	ENST00000244926	ensembl	human	known	69_37n	silent	105	65.00	195	SNP	0.994	T
SCML4	256380	genome.wustl.edu	37	6	108041958	108041958	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:108041958G>C	ENST00000369020.3	-	6	1167	c.922C>G	c.(922-924)Cca>Gca	p.P308A	SCML4_ENST00000369022.2_Missense_Mutation_p.P250A|SCML4_ENST00000369021.3_Missense_Mutation_p.P279A|SCML4_ENST00000369025.2_Missense_Mutation_p.P66A|SCML4_ENST00000479803.1_5'UTR	NM_198081.3	NP_932347.2	Q8N228	SCML4_HUMAN	sex comb on midleg-like 4 (Drosophila)	308	SAM.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(1)	25		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)		CTGGAGGCTGGAGGCCTCAGC	0.597																																						dbGAP											0													77.0	82.0	81.0					6																	108041958		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5060.2, CCDS69163.1, CCDS75500.1	6q21	2013-01-10			ENSG00000146285	ENSG00000146285		"""Sterile alpha motif (SAM) domain containing"""	21397	protein-coding gene	gene with protein product							Standard	NM_001286409		Approved	dJ47M23.1	uc010kdf.3	Q8N228	OTTHUMG00000015313	ENST00000369020.3:c.922C>G	6.37:g.108041958G>C	ENSP00000358016:p.Pro308Ala		B0QZ10|B0QZ11|B7ZBX3|Q5JXD0|Q5T0T6|Q8IYY6	Missense_Mutation	SNP	pfam_DUF3588	p.P279A	ENST00000369020.3	37	c.835	CCDS5060.2	6	.	.	.	.	.	.	.	.	.	.	G	4.610	0.113339	0.08831	.	.	ENSG00000146285	ENST00000369022;ENST00000369025;ENST00000369020;ENST00000369021	T;T;T	0.46063	0.89;0.88;0.9	5.19	4.33	0.51752	.	0.219173	0.32258	N	0.006341	T	0.15392	0.0371	L	0.31294	0.92	0.30564	N	0.764205	P;B;B	0.37781	0.608;0.0;0.0	B;B;B	0.30401	0.115;0.001;0.002	T	0.03514	-1.1029	10	0.27785	T	0.31	.	18.8374	0.92168	0.0:0.1184:0.8816:0.0	.	308;308;279	B4E0X3;Q8N228;Q8N228-3	.;SCML4_HUMAN;.	A	250;66;308;279	ENSP00000358018:P250A;ENSP00000358016:P308A;ENSP00000358017:P279A	ENSP00000358016:P308A	P	-	1	0	SCML4	108148651	1.000000	0.71417	0.998000	0.56505	0.168000	0.22595	2.855000	0.48333	0.776000	0.33473	-0.810000	0.03169	CCA	SCML4	-	NULL	ENSG00000146285		0.597	SCML4-005	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	SCML4	HGNC	protein_coding	OTTHUMT00000041700.3	96	0.00	0	G	XM_171128		108041958	108041958	-1	no_errors	ENST00000369021	ensembl	human	known	69_37n	missense	111	11.20	14	SNP	0.999	C
SDCCAG8	10806	genome.wustl.edu	37	1	243449584	243449584	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:243449584C>G	ENST00000366541.3	+	5	549	c.431C>G	c.(430-432)tCt>tGt	p.S144C	SDCCAG8_ENST00000343783.6_5'UTR|SDCCAG8_ENST00000391846.1_Missense_Mutation_p.S144C|SDCCAG8_ENST00000355875.4_Missense_Mutation_p.S144C	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	144					establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		GAGGAACTCTCTGGAATGAAA	0.353																																						dbGAP											0													70.0	78.0	76.0					1																	243449584		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.431C>G	1.37:g.243449584C>G	ENSP00000355499:p.Ser144Cys		O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	NULL	p.S144C	ENST00000366541.3	37	c.431	CCDS31075.1	1	.	.	.	.	.	.	.	.	.	.	C	10.85	1.467009	0.26335	.	.	ENSG00000054282	ENST00000355875;ENST00000391846;ENST00000366541	T;T;T	0.29142	1.58;1.58;1.58	4.77	3.86	0.44501	.	0.187520	0.48767	D	0.000163	T	0.32346	0.0826	M	0.68952	2.095	0.80722	D	1	B	0.17852	0.024	B	0.19148	0.024	T	0.15037	-1.0451	10	0.52906	T	0.07	-2.1612	11.281	0.49195	0.0:0.9093:0.0:0.0907	.	144	Q86SQ7	SDCG8_HUMAN	C	144	ENSP00000348137:S144C;ENSP00000375721:S144C;ENSP00000355499:S144C	ENSP00000348137:S144C	S	+	2	0	SDCCAG8	241516207	1.000000	0.71417	1.000000	0.80357	0.532000	0.34746	1.599000	0.36751	1.146000	0.42352	-0.137000	0.14449	TCT	SDCCAG8	-	NULL	ENSG00000054282		0.353	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDCCAG8	HGNC	protein_coding	OTTHUMT00000096485.1	158	0.00	0	C	NM_006642		243449584	243449584	+1	no_errors	ENST00000366541	ensembl	human	known	69_37n	missense	156	24.88	52	SNP	1.000	G
SEC14L1	6397	genome.wustl.edu	37	17	75196587	75196587	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:75196587C>G	ENST00000413679.2	+	9	1144	c.841C>G	c.(841-843)Ctt>Gtt	p.L281V	SEC14L1_ENST00000436233.4_Missense_Mutation_p.L281V|SEC14L1_ENST00000431431.2_Missense_Mutation_p.L247V|SEC14L1_ENST00000430767.4_Missense_Mutation_p.L281V|SEC14L1_ENST00000585618.1_Missense_Mutation_p.L281V|SEC14L1_ENST00000443798.4_Missense_Mutation_p.L281V|SEC14L1_ENST00000591437.1_Missense_Mutation_p.L247V|SEC14L1_ENST00000392476.2_Missense_Mutation_p.L281V	NM_001143998.1|NM_001143999.1|NM_003003.3	NP_001137470|NP_001137471|NP_002994	Q92503	S14L1_HUMAN	SEC14-like 1 (S. cerevisiae)	281					transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(2)	31						TGAGCATATTCTTCGGTTCCT	0.428																																						dbGAP											0													124.0	122.0	123.0					17																	75196587		2203	4300	6503	-	-	-	SO:0001583	missense	0			D67029	CCDS11752.1, CCDS42385.1, CCDS45789.1	17q25.2	2008-02-01	2001-11-28			ENSG00000129657			10698	protein-coding gene	gene with protein product		601504	"""SEC14 (S. cerevisiae)-like 1"""	SEC14L		8697811	Standard	NM_001143998		Approved	PRELID4A	uc002jto.3	Q92503		ENST00000413679.2:c.841C>G	17.37:g.75196587C>G	ENSP00000394716:p.Leu281Val		A8K4E8|B4DDI5|D5G3K1|Q99780	Missense_Mutation	SNP	pfam_PRELI/MSF1,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,superfamily_GOLD,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,pfscan_PRELI/MSF1	p.L281V	ENST00000413679.2	37	c.841	CCDS11752.1	17	.	.	.	.	.	.	.	.	.	.	C	19.76	3.887562	0.72410	.	.	ENSG00000129657	ENST00000392476;ENST00000443798;ENST00000436233;ENST00000430767;ENST00000413679;ENST00000431431	D;D;D;D;D;D	0.92348	-3.02;-3.02;-3.02;-3.02;-3.02;-3.02	5.4	5.4	0.78164	Phosphatidylinositol transfer protein-like, N-terminal (1);Cellular retinaldehyde-binding/triple function, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94338	0.8180	M	0.76170	2.325	0.80722	D	1	D;D	0.65815	0.994;0.995	P;D	0.63283	0.858;0.913	D	0.93975	0.7253	10	0.72032	D	0.01	-30.2487	8.2133	0.31496	0.0:0.8303:0.0:0.1697	.	281;281	Q92503-2;Q92503	.;S14L1_HUMAN	V	281;281;281;281;281;247	ENSP00000376268:L281V;ENSP00000406030:L281V;ENSP00000390392:L281V;ENSP00000408169:L281V;ENSP00000394716:L281V;ENSP00000389838:L247V	ENSP00000376268:L281V	L	+	1	0	SEC14L1	72708182	0.989000	0.36119	0.998000	0.56505	0.930000	0.56654	2.734000	0.47368	2.683000	0.91414	0.655000	0.94253	CTT	SEC14L1	-	pfam_CRAL/TRIO_N_dom,superfamily_CRAL/TRIO_N_dom	ENSG00000129657		0.428	SEC14L1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC14L1	HGNC	protein_coding	OTTHUMT00000436240.1	234	0.00	0	C	NM_003003		75196587	75196587	+1	no_errors	ENST00000392476	ensembl	human	known	69_37n	missense	263	11.45	34	SNP	1.000	G
SEC24A	10802	genome.wustl.edu	37	5	134011803	134011803	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr5:134011803C>T	ENST00000398844.2	+	7	1530	c.1242C>T	c.(1240-1242)ttC>ttT	p.F414F	SEC24A_ENST00000322887.4_Silent_p.F414F	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	414					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTCATCCTTTCAAAGACTTAG	0.443																																						dbGAP											0													74.0	75.0	75.0					5																	134011803		2001	4204	6205	-	-	-	SO:0001819	synonymous_variant	0			AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.1242C>T	5.37:g.134011803C>T			A8MVW3|Q8WUV2|Q96GP7	Silent	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom	p.F414	ENST00000398844.2	37	c.1242	CCDS43363.1	5																																																																																			SEC24A	-	NULL	ENSG00000113615		0.443	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24A	HGNC	protein_coding	OTTHUMT00000371563.1	254	0.00	0	C			134011803	134011803	+1	no_errors	ENST00000398844	ensembl	human	known	69_37n	silent	161	15.62	30	SNP	1.000	T
SEC24B	10427	genome.wustl.edu	37	4	110384524	110384524	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr4:110384524C>T	ENST00000265175.5	+	2	656	c.601C>T	c.(601-603)Ctg>Ttg	p.L201L	SEC24B_ENST00000399100.2_Silent_p.L201L|SEC24B_ENST00000504968.2_Silent_p.L232L	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	201					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		ATATCCCTCTCTGCCTGCTGG	0.433																																						dbGAP											0													237.0	224.0	228.0					4																	110384524		2047	4207	6254	-	-	-	SO:0001819	synonymous_variant	0			AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.601C>T	4.37:g.110384524C>T			B7ZKM8|B7ZKN4|Q0VG08	Silent	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.L201	ENST00000265175.5	37	c.601	CCDS47124.1	4																																																																																			SEC24B	-	NULL	ENSG00000138802		0.433	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24B	HGNC	protein_coding	OTTHUMT00000364693.2	649	0.00	0	C			110384524	110384524	+1	no_errors	ENST00000265175	ensembl	human	known	69_37n	silent	394	32.42	189	SNP	0.998	T
SERPINI2	5276	genome.wustl.edu	37	3	167184951	167184951	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr3:167184951G>C	ENST00000476257.1	-	4	668	c.370C>G	c.(370-372)Ctc>Gtc	p.L124V	SERPINI2_ENST00000465031.1_5'Flank|SERPINI2_ENST00000461846.1_Missense_Mutation_p.L124V|SERPINI2_ENST00000264677.4_Missense_Mutation_p.L124V|SERPINI2_ENST00000471111.1_Missense_Mutation_p.L124V			O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin), member 2	124					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(20)|prostate(1)|skin(5)|urinary_tract(1)	41						TTGCCATGGAGATACTGTTCT	0.378																																						dbGAP											0													120.0	120.0	120.0					3																	167184951		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006423	CCDS3200.1, CCDS75047.1	3q26.1	2014-02-18	2005-08-18		ENSG00000114204	ENSG00000114204		"""Serine (or cysteine) peptidase inhibitors"""	8945	protein-coding gene	gene with protein product		605587	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2"", ""serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2"""	PI14		9624529, 24172014	Standard	NM_006217		Approved	PANCPIN, TSA2004, MEPI, pancpin	uc003fes.2	O75830	OTTHUMG00000158231	ENST00000476257.1:c.370C>G	3.37:g.167184951G>C	ENSP00000420621:p.Leu124Val			Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.L124V	ENST00000476257.1	37	c.370	CCDS3200.1	3	.	.	.	.	.	.	.	.	.	.	G	17.76	3.468228	0.63625	.	.	ENSG00000114204	ENST00000476257;ENST00000461846;ENST00000264677;ENST00000471111;ENST00000466903;ENST00000467583	T;T;T;T;T;D	0.83419	-0.93;-0.93;-0.93;-0.93;-0.93;-1.72	5.55	5.55	0.83447	Serpin domain (3);	0.000000	0.85682	D	0.000000	D	0.88683	0.6503	L	0.59967	1.855	0.35548	D	0.803616	D;D	0.76494	0.999;0.999	D;D	0.79108	0.992;0.992	D	0.91530	0.5241	10	0.59425	D	0.04	.	13.2363	0.59971	0.0822:0.0:0.9178:0.0	.	124;124	B4DDY9;O75830	.;SPI2_HUMAN	V	124;124;124;124;124;109	ENSP00000420621:L124V;ENSP00000417692:L124V;ENSP00000264677:L124V;ENSP00000419407:L124V;ENSP00000417752:L124V;ENSP00000419255:L109V	ENSP00000264677:L124V	L	-	1	0	SERPINI2	168667645	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.477000	0.66799	2.615000	0.88500	0.655000	0.94253	CTC	SERPINI2	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000114204		0.378	SERPINI2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINI2	HGNC	protein_coding	OTTHUMT00000350450.1	320	0.00	0	G	NM_006217		167184951	167184951	-1	no_errors	ENST00000264677	ensembl	human	known	69_37n	missense	340	26.82	125	SNP	1.000	C
SFTPD	6441	genome.wustl.edu	37	10	81706230	81706230	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr10:81706230C>A	ENST00000372292.3	-	2	226	c.186G>T	c.(184-186)gaG>gaT	p.E62D		NM_003019.4	NP_003010.4	P35247	SFTPD_HUMAN	surfactant protein D	62	Collagen-like.				defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|lung alveolus development (GO:0048286)|macrophage chemotaxis (GO:0048246)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of phagocytosis (GO:0050766)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|regulation of cytokine production (GO:0001817)|respiratory gaseous exchange (GO:0007585)|surfactant homeostasis (GO:0043129)	collagen trimer (GO:0005581)|endocytic vesicle (GO:0030139)|extracellular region (GO:0005576)|lysosome (GO:0005764)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|skin(4)|urinary_tract(1)	17	Breast(12;0.000615)|Prostate(51;0.0095)|all_epithelial(25;0.027)		Epithelial(14;0.0244)|all cancers(16;0.0558)|Colorectal(32;0.109)			GGTCCCCCTTCTCGCCCCGAG	0.602																																						dbGAP											0													42.0	41.0	41.0					10																	81706230		2203	4300	6503	-	-	-	SO:0001583	missense	0			L05485	CCDS7362.1	10q22.2-q23.1	2012-11-02	2008-08-26		ENSG00000133661	ENSG00000133661		"""Collectins"""	10803	protein-coding gene	gene with protein product		178635	"""surfactant, pulmonary-associated protein D"""	SFTP4		1898081, 1339284	Standard	NM_003019		Approved	SP-D, COLEC7	uc001kbh.3	P35247	OTTHUMG00000018590	ENST00000372292.3:c.186G>T	10.37:g.81706230C>A	ENSP00000361366:p.Glu62Asp		Q5T0M3|Q6FH08|Q86YK9|Q8TCD8|Q9UCJ2|Q9UCJ3	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Collagen,pfam_Surfac_D-trimer,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.E62D	ENST00000372292.3	37	c.186	CCDS7362.1	10	.	.	.	.	.	.	.	.	.	.	C	16.92	3.256297	0.59321	.	.	ENSG00000133661	ENST00000372292;ENST00000444384	D;D	0.94232	-3.38;-3.38	5.59	3.51	0.40186	.	0.000000	0.56097	D	0.000021	D	0.90992	0.7167	N	0.25031	0.7	0.29306	N	0.868327	P	0.51240	0.943	P	0.60541	0.876	D	0.84887	0.0834	10	0.44086	T	0.13	-17.6626	4.9892	0.14205	0.0:0.6396:0.0:0.3604	.	62	P35247	SFTPD_HUMAN	D	62;75	ENSP00000361366:E62D;ENSP00000394325:E75D	ENSP00000361366:E62D	E	-	3	2	SFTPD	81696210	1.000000	0.71417	1.000000	0.80357	0.725000	0.41563	1.032000	0.30178	1.367000	0.46095	0.655000	0.94253	GAG	SFTPD	-	pfam_Collagen	ENSG00000133661		0.602	SFTPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFTPD	HGNC	protein_coding	OTTHUMT00000049011.1	113	0.00	0	C			81706230	81706230	-1	no_errors	ENST00000372292	ensembl	human	known	69_37n	missense	143	15.88	27	SNP	1.000	A
SGK1	6446	genome.wustl.edu	37	6	134498933	134498933	+	5'Flank	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:134498933C>T	ENST00000237305.7	-	0	0				SGK1_ENST00000413996.3_5'Flank|SGK1_ENST00000367858.5_Intron|SGK1_ENST00000475719.2_5'Flank|SGK1_ENST00000367857.5_5'Flank|SGK1_ENST00000528577.1_Missense_Mutation_p.E10K	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1						apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		CTACATGCCTCTGATAAGCTG	0.488																																						dbGAP											0													81.0	72.0	75.0					6																	134498933		1568	3582	5150	-	-	-	SO:0001631	upstream_gene_variant	0			AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613		6.37:g.134498933C>T	Exception_encountered		B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_Phox,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.E10K	ENST00000237305.7	37	c.28	CCDS5170.1	6	.	.	.	.	.	.	.	.	.	.	C	19.16	3.773052	0.69992	.	.	ENSG00000118515	ENST00000528577	T	0.71579	-0.58	4.59	-1.14	0.09741	.	.	.	.	.	T	0.28962	0.0719	.	.	.	0.20196	N	0.999922	B	0.02656	0.0	B	0.04013	0.001	T	0.17107	-1.0380	8	0.31617	T	0.26	.	4.9158	0.13846	0.0:0.4531:0.296:0.251	.	10	O00141-5	.	K	10	ENSP00000434450:E10K	ENSP00000434450:E10K	E	-	1	0	SGK1	134540626	0.267000	0.24122	0.050000	0.19076	0.716000	0.41182	-0.565000	0.05929	-0.283000	0.09115	0.655000	0.94253	GAG	SGK1	-	NULL	ENSG00000118515		0.488	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK1	HGNC	protein_coding	OTTHUMT00000042312.2	240	0.00	0	C			134498933	134498933	-1	no_errors	ENST00000528577	ensembl	human	known	69_37n	missense	282	12.69	41	SNP	0.038	T
SHCBP1L	81626	genome.wustl.edu	37	1	182898837	182898837	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:182898837C>G	ENST00000367547.3	-	6	1363	c.1127G>C	c.(1126-1128)aGa>aCa	p.R376T	SHCBP1L_ENST00000423786.1_Missense_Mutation_p.R257T|SHCBP1L_ENST00000488956.1_5'UTR	NM_030933.2	NP_112195.2	Q9BZQ2	SHP1L_HUMAN	SHC SH2-domain binding protein 1-like	448										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|pancreas(1)|prostate(1)|skin(2)	15						TCCAAATTCTCTTTTTCCTTT	0.279																																						dbGAP											0													104.0	103.0	103.0					1																	182898837		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF288397	CCDS30955.1	1q25	2011-01-24	2011-01-24	2011-01-24	ENSG00000157060	ENSG00000157060			16788	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 14"""	C1orf14		11318611	Standard	NM_030933		Approved		uc001gpu.3	Q9BZQ2	OTTHUMG00000035419	ENST00000367547.3:c.1127G>C	1.37:g.182898837C>G	ENSP00000356518:p.Arg376Thr		Q4G195|Q9BZQ3|Q9H2B6	Missense_Mutation	SNP	superfamily_Pectin_lyase_fold/virulence,smart_Carb-bd_sugar_hydrolysis-dom,smart_PbH1	p.R376T	ENST00000367547.3	37	c.1127	CCDS30955.1	1	.	.	.	.	.	.	.	.	.	.	C	19.23	3.786766	0.70337	.	.	ENSG00000157060	ENST00000367547;ENST00000287709;ENST00000423786	T;T	0.61510	0.1;0.12	5.88	5.88	0.94601	Carbohydrate-binding/sugar hydrolysis domain (1);	0.287039	0.30210	N	0.010159	T	0.64505	0.2604	M	0.65975	2.015	0.33531	D	0.593603	B;P;B	0.37370	0.321;0.592;0.449	B;B;B	0.42959	0.101;0.403;0.205	T	0.75889	-0.3158	10	0.87932	D	0	-10.8964	17.1981	0.86899	0.0:1.0:0.0:0.0	.	448;257;376	Q9BZQ2;Q9BZQ2-2;Q9BZQ2-3	SHP1L_HUMAN;.;.	T	376;445;257	ENSP00000356518:R376T;ENSP00000397308:R257T	ENSP00000287709:R445T	R	-	2	0	SHCBP1L	181165460	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	4.458000	0.60095	2.800000	0.96347	0.644000	0.83932	AGA	SHCBP1L	-	smart_Carb-bd_sugar_hydrolysis-dom	ENSG00000157060		0.279	SHCBP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHCBP1L	HGNC	protein_coding	OTTHUMT00000085956.1	433	0.00	0	C	NM_030933		182898837	182898837	-1	no_errors	ENST00000367547	ensembl	human	known	69_37n	missense	409	31.21	186	SNP	1.000	G
SIGLEC7	27036	genome.wustl.edu	37	19	51649334	51649334	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:51649334C>T	ENST00000317643.6	+	4	1052	c.983C>T	c.(982-984)tCc>tTc	p.S328F	SIGLEC7_ENST00000600577.1_Intron|SIGLEC7_ENST00000305628.7_Missense_Mutation_p.S235F	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	328	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		TCTCTGGGTTCCCAGCACGTT	0.597																																						dbGAP											0													90.0	85.0	86.0					19																	51649334		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.983C>T	19.37:g.51649334C>T	ENSP00000323328:p.Ser328Phe		Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S328F	ENST00000317643.6	37	c.983	CCDS12826.1	19	.	.	.	.	.	.	.	.	.	.	.	14.38	2.519491	0.44866	.	.	ENSG00000168995	ENST00000317643;ENST00000305628	T;T	0.09073	3.02;3.02	2.32	2.32	0.28847	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.221474	0.23155	N	0.051310	T	0.25938	0.0632	M	0.84585	2.705	0.45883	D	0.998732	D;D	0.65815	0.995;0.991	P;D	0.64595	0.815;0.927	T	0.02893	-1.1097	10	0.87932	D	0	.	8.259	0.31773	0.0:1.0:0.0:0.0	.	235;328	Q9Y286-2;Q9Y286	.;SIGL7_HUMAN	F	328;235	ENSP00000323328:S328F;ENSP00000306757:S235F	ENSP00000306757:S235F	S	+	2	0	SIGLEC7	56341146	0.040000	0.19996	0.373000	0.26003	0.188000	0.23474	0.165000	0.16564	1.337000	0.45525	0.420000	0.28162	TCC	SIGLEC7	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000168995		0.597	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC7	HGNC	protein_coding	OTTHUMT00000464226.2	209	0.00	0	C	NM_016543		51649334	51649334	+1	no_errors	ENST00000317643	ensembl	human	known	69_37n	missense	213	39.49	139	SNP	0.604	T
SIGLEC5	8778	genome.wustl.edu	37	19	52132711	52132711	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:52132711G>A	ENST00000534261.2	-	4	999	c.600C>T	c.(598-600)ctC>ctT	p.L200L	SIGLEC5_ENST00000429354.3_Silent_p.L200L|SIGLEC5_ENST00000222107.4_Silent_p.L200L|SIGLEC5_ENST00000570106.2_Silent_p.L200L|SIGLEC5_ENST00000599649.1_Silent_p.L200L			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	200	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		GCCTGGGGGTGAGGGTGAGCT	0.627																																						dbGAP											0													42.0	41.0	42.0					19																	52132711		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.600C>T	19.37:g.52132711G>A				Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L200	ENST00000534261.2	37	c.600	CCDS33088.1	19																																																																																			SIGLEC5	-	pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000105501		0.627	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	SIGLEC5	HGNC	protein_coding	OTTHUMT00000466897.2	293	0.00	0	G	NM_003830		52132711	52132711	-1	no_errors	ENST00000222107	ensembl	human	known	69_37n	silent	477	13.25	73	SNP	0.082	A
SIRPG	55423	genome.wustl.edu	37	20	1617003	1617003	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr20:1617003C>G	ENST00000303415.3	-	3	643	c.579G>C	c.(577-579)caG>caC	p.Q193H	RP11-77C3.3_ENST00000437384.1_RNA|SIRPG_ENST00000381583.2_Missense_Mutation_p.Q193H|SIRPG_ENST00000216927.4_Missense_Mutation_p.Q193H|SIRPG_ENST00000381580.1_Missense_Mutation_p.Q160H|SIRPG_ENST00000344103.4_Intron|RP11-77C3.3_ENST00000456177.1_RNA	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	193	Ig-like C1-type 1.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						CCACGTTGGTCTGGAAGTCTG	0.557																																						dbGAP											0													200.0	176.0	184.0					20																	1617003		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.579G>C	20.37:g.1617003C>G	ENSP00000305529:p.Gln193His		B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like	p.Q193H	ENST00000303415.3	37	c.579	CCDS13020.2	20	.	.	.	.	.	.	.	.	.	.	.	10.71	1.427735	0.25726	.	.	ENSG00000089012	ENST00000381580;ENST00000303415;ENST00000381583;ENST00000216927	T;T;T;T	0.03004	4.08;4.08;4.08;4.08	2.09	1.1	0.20463	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.500646	0.18456	N	0.140694	T	0.10766	0.0263	M	0.62209	1.925	0.09310	N	1	D;D	0.89917	0.997;1.0	P;D	0.74674	0.902;0.984	T	0.09443	-1.0674	10	0.59425	D	0.04	.	4.6894	0.12772	0.0:0.7987:0.0:0.2013	.	193;193	Q9P1W8-4;Q9P1W8	.;SIRPG_HUMAN	H	160;193;193;193	ENSP00000370992:Q160H;ENSP00000305529:Q193H;ENSP00000370995:Q193H;ENSP00000216927:Q193H	ENSP00000216927:Q193H	Q	-	3	2	SIRPG	1565003	0.057000	0.20700	0.016000	0.15963	0.010000	0.07245	0.193000	0.17116	0.201000	0.20466	-0.490000	0.04691	CAG	SIRPG	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000089012		0.557	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRPG	HGNC	protein_coding	OTTHUMT00000077566.2	617	0.00	0	C	NM_018556		1617003	1617003	-1	no_errors	ENST00000303415	ensembl	human	known	69_37n	missense	533	23.86	167	SNP	0.023	G
SLC13A2	9058	genome.wustl.edu	37	17	26824217	26824217	+	Missense_Mutation	SNP	C	C	G	rs376190729		TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:26824217C>G	ENST00000314669.5	+	12	2129	c.1709C>G	c.(1708-1710)tCc>tGc	p.S570C	SLC13A2_ENST00000537681.1_Missense_Mutation_p.S499C|SLC13A2_ENST00000444914.3_Missense_Mutation_p.S619C|SLC13A2_ENST00000545060.1_Missense_Mutation_p.S527C	NM_003984.3	NP_003975.1	Q13183	S13A2_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2	570					dicarboxylic acid transport (GO:0006835)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	low-affinity sodium:dicarboxylate symporter activity (GO:0015361)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	TCTTTCCCCTCCTGGGCACAG	0.627																																						dbGAP											0													146.0	126.0	133.0					17																	26824217		2203	4300	6503	-	-	-	SO:0001583	missense	0			U26209	CCDS11231.1, CCDS54098.1	17p13.2	2013-05-22			ENSG00000007216	ENSG00000007216		"""Solute carriers"""	10917	protein-coding gene	gene with protein product		604148				8967342, 10343111	Standard	NM_001145975		Approved	NaDC-1	uc010wan.2	Q13183	OTTHUMG00000132523	ENST00000314669.5:c.1709C>G	17.37:g.26824217C>G	ENSP00000316202:p.Ser570Cys		B2RBI9|B4DPL1|E7ETH5|Q4VAR7	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.S619C	ENST00000314669.5	37	c.1856	CCDS11231.1	17	.	.	.	.	.	.	.	.	.	.	C	15.85	2.955562	0.53293	.	.	ENSG00000007216	ENST00000314669;ENST00000444914;ENST00000545060;ENST00000537681	T;T;T;T	0.72505	-0.34;-0.36;-0.66;-0.66	5.45	-0.77	0.11005	.	1.319300	0.04675	N	0.411385	T	0.80747	0.4682	M	0.81112	2.525	0.19775	N	0.999959	D;P;D;D	0.71674	0.998;0.669;0.995;0.991	P;P;D;P	0.63703	0.893;0.469;0.917;0.765	T	0.62803	-0.6777	10	0.72032	D	0.01	-10.5829	3.6114	0.08062	0.2197:0.5361:0.1119:0.1324	.	527;619;499;570	F5GWV6;E7ETH5;G3V1L2;Q13183	.;.;.;S13A2_HUMAN	C	570;619;527;499	ENSP00000316202:S570C;ENSP00000392411:S619C;ENSP00000441935:S527C;ENSP00000440802:S499C	ENSP00000316202:S570C	S	+	2	0	SLC13A2	23848344	0.000000	0.05858	0.440000	0.26846	0.008000	0.06430	0.689000	0.25437	0.251000	0.21505	-0.291000	0.09656	TCC	SLC13A2	-	NULL	ENSG00000007216		0.627	SLC13A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A2	HGNC	protein_coding	OTTHUMT00000255722.1	131	0.00	0	C	NM_003984		26824217	26824217	+1	no_errors	ENST00000444914	ensembl	human	known	69_37n	missense	161	10.56	19	SNP	0.124	G
SLC28A1	9154	genome.wustl.edu	37	15	85431031	85431031	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr15:85431031C>G	ENST00000286749.3	+	2	130	c.40C>G	c.(40-42)Ctc>Gtc	p.L14V	SLC28A1_ENST00000338602.2_Missense_Mutation_p.L14V|SLC28A1_ENST00000537624.1_Missense_Mutation_p.L14V|SLC28A1_ENST00000537216.1_Missense_Mutation_p.L14V|SLC28A1_ENST00000538177.1_Missense_Mutation_p.L14V|SLC28A1_ENST00000537703.1_5'UTR|SLC28A1_ENST00000394573.1_Missense_Mutation_p.L14V			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	14					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	GTCCATCTCTCTCACACCTGT	0.572																																						dbGAP											0													176.0	153.0	161.0					15																	85431031		2203	4299	6502	-	-	-	SO:0001583	missense	0			U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.40C>G	15.37:g.85431031C>G	ENSP00000286749:p.Leu14Val		A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Missense_Mutation	SNP	pfam_Nucleos_tra2_C,pfam_Nuclsd_transpt2,pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac	p.L14V	ENST00000286749.3	37	c.40	CCDS10334.1	15	.	.	.	.	.	.	.	.	.	.	C	14.39	2.522459	0.44866	.	.	ENSG00000156222	ENST00000338602;ENST00000537216;ENST00000538177;ENST00000537624;ENST00000286749;ENST00000394573	T;T;T;T;T;T	0.15139	2.45;4.41;4.13;4.59;4.6;4.6	4.21	2.28	0.28536	.	0.110961	0.36628	N	0.002499	T	0.33265	0.0857	M	0.74258	2.255	0.18873	N	0.999981	D;D;D;D;P	0.76494	0.999;0.998;0.999;0.997;0.75	D;D;D;P;B	0.67382	0.951;0.949;0.942;0.89;0.217	T	0.05971	-1.0853	10	0.48119	T	0.1	-7.0639	5.9444	0.19211	0.0:0.6999:0.1935:0.1066	.	14;14;14;14;14	B7Z533;F5H560;B7Z3L6;O00337;O00337-2	.;.;.;S28A1_HUMAN;.	V	14	ENSP00000341629:L14V;ENSP00000440546:L14V;ENSP00000443752:L14V;ENSP00000444700:L14V;ENSP00000286749:L14V;ENSP00000378074:L14V	ENSP00000286749:L14V	L	+	1	0	SLC28A1	83232035	0.129000	0.22400	0.037000	0.18230	0.012000	0.07955	0.974000	0.29436	0.503000	0.28060	0.563000	0.77884	CTC	SLC28A1	-	NULL	ENSG00000156222		0.572	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC28A1	HGNC	protein_coding	OTTHUMT00000308998.2	206	0.00	0	C			85431031	85431031	+1	no_errors	ENST00000286749	ensembl	human	known	69_37n	missense	264	12.29	37	SNP	0.020	G
SLC2A1	6513	genome.wustl.edu	37	1	43393372	43393372	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:43393372G>A	ENST00000426263.3	-	9	1360	c.1182C>T	c.(1180-1182)ctC>ctT	p.L394L	SLC2A1_ENST00000475162.1_Intron	NM_006516.2	NP_006507.2	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 1	394					carbohydrate metabolic process (GO:0005975)|cellular response to glucose starvation (GO:0042149)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|protein complex assembly (GO:0006461)|regulation of insulin secretion (GO:0050796)|response to osmotic stress (GO:0006970)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|female pronucleus (GO:0001939)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|midbody (GO:0030496)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|identical protein binding (GO:0042802)|protein self-association (GO:0043621)|xenobiotic transporter activity (GO:0042910)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|pancreas(2)	13	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	CCTGGCTGAAGAGTTCAGCCA	0.542																																						dbGAP											0													73.0	68.0	70.0					1																	43393372		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			K03195	CCDS477.1	1p34.2	2013-05-22			ENSG00000117394	ENSG00000117394		"""Solute carriers"""	11005	protein-coding gene	gene with protein product		138140	"""human T-cell leukemia virus (I and II) receptor"""	GLUT1, GLUT, HTLVR		8839927, 14622599, 18451999	Standard	NM_006516		Approved	DYT18	uc001cik.2	P11166	OTTHUMG00000007657	ENST00000426263.3:c.1182C>T	1.37:g.43393372G>A			A8K9S6|B2R620|D3DPX0|O75535|Q147X2	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,prints_Glu_transpt_1,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.L394	ENST00000426263.3	37	c.1182	CCDS477.1	1																																																																																			SLC2A1	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000117394		0.542	SLC2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A1	HGNC	protein_coding	OTTHUMT00000020358.2	112	0.00	0	G	NM_006516		43393372	43393372	-1	no_errors	ENST00000426263	ensembl	human	known	69_37n	silent	96	16.24	19	SNP	0.997	A
SLC38A9	153129	genome.wustl.edu	37	5	54931483	54931483	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr5:54931483C>T	ENST00000396865.2	-	13	1761	c.1170G>A	c.(1168-1170)gtG>gtA	p.V390V	SLC38A9_ENST00000416547.2_Silent_p.V266V|SLC38A9_ENST00000318672.3_Silent_p.V390V|SLC38A9_ENST00000515629.1_Silent_p.V327V|SLC38A9_ENST00000539768.1_Silent_p.V390V|SLC38A9_ENST00000512595.1_Silent_p.V327V	NM_173514.3	NP_775785.2	Q8NBW4	S38A9_HUMAN	solute carrier family 38, member 9	390					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8		Lung NSC(810;0.00122)|Prostate(74;0.0376)|Breast(144;0.181)				ACAAGTCCCTCACCTGTAAAT	0.348																																						dbGAP											0													82.0	77.0	78.0					5																	54931483		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3968.1, CCDS58947.1, CCDS58948.1, CCDS75243.1	5q11.2	2013-05-22			ENSG00000177058	ENSG00000177058		"""Solute carriers"""	26907	protein-coding gene	gene with protein product							Standard	NM_173514		Approved	FLJ90709	uc003jqf.3	Q8NBW4	OTTHUMG00000131189	ENST00000396865.2:c.1170G>A	5.37:g.54931483C>T			B3KXV1|B7Z7D0|Q0P5S0|Q6MZJ8	Silent	SNP	pfam_AA_transpt_TM	p.V390	ENST00000396865.2	37	c.1170	CCDS3968.1	5																																																																																			SLC38A9	-	pfam_AA_transpt_TM	ENSG00000177058		0.348	SLC38A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC38A9	HGNC	protein_coding	OTTHUMT00000253912.2	239	0.00	0	C	NM_173514		54931483	54931483	-1	no_errors	ENST00000318672	ensembl	human	known	69_37n	silent	227	25.49	78	SNP	0.989	T
SLC44A1	23446	genome.wustl.edu	37	9	108127819	108127819	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr9:108127819C>T	ENST00000374720.3	+	11	1556	c.1309C>T	c.(1309-1311)Cgt>Tgt	p.R437C	SLC44A1_ENST00000374724.1_Missense_Mutation_p.R437C|SLC44A1_ENST00000374723.1_Missense_Mutation_p.R437C|SLC44A1_ENST00000343170.7_Missense_Mutation_p.R229C	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	437					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)	p.R437C(1)		breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	TCGCCTTATTCGTTACCACCT	0.348																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											115.0	109.0	111.0					9																	108127819		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.1309C>T	9.37:g.108127819C>T	ENSP00000363852:p.Arg437Cys		A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Missense_Mutation	SNP	pfam_Choline_transptr-like	p.R437C	ENST00000374720.3	37	c.1309	CCDS6763.1	9	.	.	.	.	.	.	.	.	.	.	C	16.40	3.112251	0.56398	.	.	ENSG00000070214	ENST00000374723;ENST00000374720;ENST00000374724;ENST00000343170	T;T;T;T	0.25414	1.8;1.8;1.8;1.8	5.82	5.82	0.92795	.	0.049237	0.85682	D	0.000000	T	0.25644	0.0624	L	0.58583	1.82	0.80722	D	1	B;B;B	0.20671	0.002;0.002;0.047	B;B;B	0.17433	0.001;0.001;0.018	T	0.02983	-1.1086	10	0.31617	T	0.26	-16.2355	11.0818	0.48064	0.0:0.8888:0.0:0.1112	.	437;437;437	Q8WWI5-3;Q8WWI5-2;Q8WWI5	.;.;CTL1_HUMAN	C	437;437;437;229	ENSP00000363855:R437C;ENSP00000363852:R437C;ENSP00000363856:R437C;ENSP00000341856:R229C	ENSP00000341856:R229C	R	+	1	0	SLC44A1	107167640	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.995000	0.70631	2.745000	0.94114	0.650000	0.86243	CGT	SLC44A1	-	pfam_Choline_transptr-like	ENSG00000070214		0.348	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC44A1	HGNC	protein_coding	OTTHUMT00000053500.1	290	0.00	0	C	NM_080546		108127819	108127819	+1	no_errors	ENST00000374720	ensembl	human	known	69_37n	missense	113	60.21	171	SNP	1.000	T
SLC4A2	6522	genome.wustl.edu	37	7	150765003	150765003	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr7:150765003G>A	ENST00000485713.1	+	8	2049	c.1009G>A	c.(1009-1011)Gag>Aag	p.E337K	SLC4A2_ENST00000392826.2_Missense_Mutation_p.E328K|SLC4A2_ENST00000413384.2_Missense_Mutation_p.E337K|SLC4A2_ENST00000310317.5_Missense_Mutation_p.E255K|SLC4A2_ENST00000461735.1_Missense_Mutation_p.E323K	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	337					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAAAAACCAGGAGCCCCAGTG	0.597																																						dbGAP											0													37.0	44.0	41.0					7																	150765003		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.1009G>A	7.37:g.150765003G>A	ENSP00000419412:p.Glu337Lys		B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_2,tigrfam_HCO3_transpt_euk	p.E337K	ENST00000485713.1	37	c.1009	CCDS5917.1	7	.	.	.	.	.	.	.	.	.	.	G	27.8	4.860689	0.91433	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.4;-1.4	4.9	4.9	0.64082	Bicarbonate transporter, cytoplasmic (1);Phosphotransferase/anion transporter (1);	0.000000	0.85682	D	0.000000	T	0.80336	0.4604	M	0.64404	1.975	0.53688	D	0.999974	P;P;P	0.39920	0.554;0.695;0.569	P;B;B	0.44359	0.447;0.304;0.16	T	0.81508	-0.0901	10	0.56958	D	0.05	.	10.3513	0.43937	0.0908:0.0:0.9092:0.0	.	328;323;337	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	K	337;337;255;328;323	ENSP00000419412:E337K;ENSP00000405600:E337K;ENSP00000311402:E255K;ENSP00000376571:E328K;ENSP00000419164:E323K	ENSP00000311402:E255K	E	+	1	0	SLC4A2	150395936	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.057000	0.89457	2.279000	0.76181	0.462000	0.41574	GAG	SLC4A2	-	superfamily_PTrfase/Anion_transptr,tigrfam_HCO3_transpt_euk	ENSG00000164889		0.597	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC4A2	HGNC	protein_coding	OTTHUMT00000351039.1	99	0.00	0	G	NM_003040		150765003	150765003	+1	no_errors	ENST00000413384	ensembl	human	known	69_37n	missense	83	24.55	27	SNP	1.000	A
SLC9C2	284525	genome.wustl.edu	37	1	173493933	173493933	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:173493933G>A	ENST00000367714.3	-	20	2921	c.2499C>T	c.(2497-2499)gtC>gtT	p.V833V	SLC9C2_ENST00000466087.1_5'UTR	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	833					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										TTATCTCAATGACTTCATGCT	0.373																																						dbGAP											0													183.0	176.0	178.0					1																	173493933		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.2499C>T	1.37:g.173493933G>A			Q86UF3	Silent	SNP	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.V833	ENST00000367714.3	37	c.2499	CCDS1308.1	1																																																																																			SLC9C2	-	NULL	ENSG00000162753		0.373	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C2	HGNC	protein_coding	OTTHUMT00000084205.1	386	0.00	0	G	NM_178527		173493933	173493933	-1	no_errors	ENST00000367714	ensembl	human	known	69_37n	silent	440	28.80	178	SNP	0.001	A
SLCO1B1	10599	genome.wustl.edu	37	12	21353576	21353576	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:21353576C>T	ENST00000256958.2	+	9	1201	c.1105C>T	c.(1105-1107)Cag>Tag	p.Q369*		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	369					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	ACAGTATGGTCAGCCTTCATC	0.338																																						dbGAP											0													100.0	93.0	95.0					12																	21353576		2202	4298	6500	-	-	-	SO:0001587	stop_gained	0				CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.1105C>T	12.37:g.21353576C>T	ENSP00000256958:p.Gln369*		B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Nonsense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.Q369*	ENST00000256958.2	37	c.1105	CCDS8685.1	12	.	.	.	.	.	.	.	.	.	.	C	18.56	3.650454	0.67472	.	.	ENSG00000134538	ENST00000256958	.	.	.	3.34	1.37	0.22104	.	0.502768	0.21816	N	0.068697	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	9.0464	0.36349	0.3986:0.6014:0.0:0.0	.	.	.	.	X	369	.	ENSP00000256958:Q369X	Q	+	1	0	SLCO1B1	21244843	0.002000	0.14202	0.018000	0.16275	0.046000	0.14306	0.809000	0.27168	0.194000	0.20326	0.491000	0.48974	CAG	SLCO1B1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000134538		0.338	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1B1	HGNC	protein_coding	OTTHUMT00000402070.1	355	0.00	0	C	NM_006446		21353576	21353576	+1	no_errors	ENST00000256958	ensembl	human	known	69_37n	nonsense	376	28.60	151	SNP	0.019	T
SMARCC1	6599	genome.wustl.edu	37	3	47719698	47719698	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr3:47719698C>A	ENST00000254480.5	-	16	1680	c.1561G>T	c.(1561-1563)Gct>Tct	p.A521S	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	521	SWIRM. {ECO:0000255|PROSITE- ProRule:PRU00247}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		CTCATCACAGCACACACATCT	0.383																																						dbGAP											0													155.0	151.0	152.0					3																	47719698		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.1561G>T	3.37:g.47719698C>A	ENSP00000254480:p.Ala521Ser		Q17RS0|Q6P172|Q8IWH2	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.A521S	ENST00000254480.5	37	c.1561	CCDS2758.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.414498	0.96092	.	.	ENSG00000173473	ENST00000254480	T	0.50813	0.73	5.76	5.76	0.90799	Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);SWIRM (2);	0.000000	0.85682	D	0.000000	T	0.54615	0.1869	N	0.25245	0.725	0.80722	D	1	D	0.59767	0.986	P	0.61874	0.895	T	0.55173	-0.8182	10	0.51188	T	0.08	-20.6413	18.5388	0.91020	0.0:1.0:0.0:0.0	.	521	Q92922	SMRC1_HUMAN	S	521	ENSP00000254480:A521S	ENSP00000254480:A521S	A	-	1	0	SMARCC1	47694702	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.580000	0.82523	2.724000	0.93272	0.585000	0.79938	GCT	SMARCC1	-	pfam_SWIRM,superfamily_Homeodomain-like,pfscan_SWIRM	ENSG00000173473		0.383	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCC1	HGNC	protein_coding	OTTHUMT00000257491.1	326	0.31	1	C			47719698	47719698	-1	no_errors	ENST00000254480	ensembl	human	known	69_37n	missense	260	12.46	37	SNP	1.000	A
SMARCC2	6601	genome.wustl.edu	37	12	56561849	56561849	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:56561849C>T	ENST00000267064.4	-	25	2838	c.2752G>A	c.(2752-2754)Gaa>Aaa	p.E918K	SMARCC2_ENST00000550164.1_Missense_Mutation_p.E949K|SMARCC2_ENST00000394023.3_Missense_Mutation_p.E949K|SMARCC2_ENST00000347471.4_Missense_Mutation_p.E949K|RP11-977G19.5_ENST00000553176.1_RNA	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	918					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CTCACTGCTTCTCGCTCCCGG	0.542																																						dbGAP											0													125.0	119.0	121.0					12																	56561849		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.2752G>A	12.37:g.56561849C>T	ENSP00000267064:p.Glu918Lys		F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.E918K	ENST00000267064.4	37	c.2752	CCDS8907.1	12	.	.	.	.	.	.	.	.	.	.	C	28.8	4.955235	0.92726	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T;T	0.52983	1.15;0.64;0.69;0.69	4.04	4.04	0.47022	.	0.000000	0.64402	D	0.000002	T	0.59046	0.2165	L	0.41027	1.25	0.58432	D	0.999997	D;D;D;P;D	0.57257	0.979;0.971;0.979;0.951;0.971	D;D;D;P;D	0.74348	0.983;0.956;0.983;0.904;0.956	T	0.60301	-0.7290	10	0.48119	T	0.1	-12.5437	15.5033	0.75716	0.0:1.0:0.0:0.0	.	838;949;953;918;949	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	K	949;949;949;918	ENSP00000377591:E949K;ENSP00000449396:E949K;ENSP00000302919:E949K;ENSP00000267064:E918K	ENSP00000267064:E918K	E	-	1	0	SMARCC2	54848116	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.428000	0.80296	2.272000	0.75746	0.655000	0.94253	GAA	SMARCC2	-	NULL	ENSG00000139613		0.542	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	HGNC	protein_coding	OTTHUMT00000408370.1	243	0.00	0	C			56561849	56561849	-1	no_errors	ENST00000267064	ensembl	human	known	69_37n	missense	278	12.85	41	SNP	1.000	T
SMG6	23293	genome.wustl.edu	37	17	2203954	2203954	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:2203954G>T	ENST00000263073.6	-	2	143	c.93C>A	c.(91-93)aaC>aaA	p.N31K	SMG6_ENST00000544865.1_5'UTR	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	31					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						ATTCCTTCATGTTTTCTGTTA	0.438																																					Melanoma(59;28 1088 11621 25887 46638 50814)	dbGAP											0													33.0	37.0	35.0					17																	2203954		2187	4289	6476	-	-	-	SO:0001583	missense	0			AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.93C>A	17.37:g.2203954G>T	ENSP00000263073:p.Asn31Lys		B7Z874|O94837|Q86VH6|Q9UF60	Missense_Mutation	SNP	pfam_EST1,smart_PINc_nuc-bd	p.N31K	ENST00000263073.6	37	c.93	CCDS11016.1	17	.	.	.	.	.	.	.	.	.	.	G	10.91	1.483983	0.26598	.	.	ENSG00000070366	ENST00000263073	T	0.08370	3.1	5.5	4.53	0.55603	.	0.376051	0.27210	N	0.020416	T	0.05593	0.0147	N	0.24115	0.695	0.80722	D	1	P	0.38922	0.651	B	0.30401	0.115	T	0.38908	-0.9639	10	0.62326	D	0.03	-9.4746	10.5066	0.44836	0.1478:0.0:0.8522:0.0	.	31	Q86US8	EST1A_HUMAN	K	31	ENSP00000263073:N31K	ENSP00000263073:N31K	N	-	3	2	SMG6	2150704	1.000000	0.71417	0.998000	0.56505	0.948000	0.59901	2.409000	0.44583	1.320000	0.45209	0.655000	0.94253	AAC	SMG6	-	NULL	ENSG00000070366		0.438	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG6	HGNC	protein_coding	OTTHUMT00000437826.3	80	0.00	0	G			2203954	2203954	-1	no_errors	ENST00000263073	ensembl	human	known	69_37n	missense	43	10.20	5	SNP	1.000	T
SNRNP35	11066	genome.wustl.edu	37	12	123950359	123950359	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:123950359C>G	ENST00000526639.2	+	2	851	c.272C>G	c.(271-273)tCa>tGa	p.S91*	SNRNP35_ENST00000412157.2_Nonsense_Mutation_p.S96*|SNRNP35_ENST00000527158.2_Intron|SNRNP35_ENST00000350887.5_Nonsense_Mutation_p.S91*	NM_022717.3	NP_073208.1	Q16560	U1SBP_HUMAN	small nuclear ribonucleoprotein 35kDa (U11/U12)	91	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	8						ACAGGTTTTTCAAAGGGCTAC	0.498																																						dbGAP											0													71.0	69.0	69.0					12																	123950359		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC054034	CCDS9249.1, CCDS45005.1	12q24.31	2013-02-12				ENSG00000184209		"""RNA binding motif (RRM) containing"""	30852	protein-coding gene	gene with protein product	"""U1 snRNP binding protein homolog"""					10520751, 8889548	Standard	XM_005253545		Approved	U1SNRNPBP	uc001ufb.1	Q16560		ENST00000526639.2:c.272C>G	12.37:g.123950359C>G	ENSP00000432595:p.Ser91*		A8K262|Q5XKN9	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S96*	ENST00000526639.2	37	c.287	CCDS9249.1	12	.	.	.	.	.	.	.	.	.	.	C	42	9.413396	0.99164	.	.	ENSG00000184209	ENST00000526639;ENST00000412157;ENST00000350887	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-14.9121	19.4858	0.95028	0.0:1.0:0.0:0.0	.	.	.	.	X	91;96;91	.	ENSP00000340774:S91X	S	+	2	0	SNRNP35	122516312	1.000000	0.71417	0.973000	0.42090	0.947000	0.59692	7.446000	0.80609	2.609000	0.88269	0.555000	0.69702	TCA	SNRNP35	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000184209		0.498	SNRNP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP35	HGNC	protein_coding	OTTHUMT00000395197.2	123	0.00	0	C	NM_007020		123950359	123950359	+1	no_errors	ENST00000412157	ensembl	human	known	69_37n	nonsense	134	14.65	23	SNP	1.000	G
SNRNP35	11066	genome.wustl.edu	37	12	123950612	123950612	+	Silent	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:123950612C>G	ENST00000526639.2	+	2	1104	c.525C>G	c.(523-525)ctC>ctG	p.L175L	SNRNP35_ENST00000412157.2_Silent_p.L180L|SNRNP35_ENST00000527158.2_Intron|SNRNP35_ENST00000350887.5_Silent_p.L175L	NM_022717.3	NP_073208.1	Q16560	U1SBP_HUMAN	small nuclear ribonucleoprotein 35kDa (U11/U12)	175	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	8						AAAACGACCTCTATAGAGAGG	0.542																																						dbGAP											0													41.0	50.0	47.0					12																	123950612		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC054034	CCDS9249.1, CCDS45005.1	12q24.31	2013-02-12				ENSG00000184209		"""RNA binding motif (RRM) containing"""	30852	protein-coding gene	gene with protein product	"""U1 snRNP binding protein homolog"""					10520751, 8889548	Standard	XM_005253545		Approved	U1SNRNPBP	uc001ufb.1	Q16560		ENST00000526639.2:c.525C>G	12.37:g.123950612C>G			A8K262|Q5XKN9	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L180	ENST00000526639.2	37	c.540	CCDS9249.1	12																																																																																			SNRNP35	-	NULL	ENSG00000184209		0.542	SNRNP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP35	HGNC	protein_coding	OTTHUMT00000395197.2	93	0.00	0	C	NM_007020		123950612	123950612	+1	no_errors	ENST00000412157	ensembl	human	known	69_37n	silent	93	14.68	16	SNP	0.000	G
SNX6	58533	genome.wustl.edu	37	14	35077312	35077312	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr14:35077312G>A	ENST00000362031.4	-	4	260	c.230C>T	c.(229-231)tCa>tTa	p.S77L	SNX6_ENST00000396526.3_5'UTR|SNX6_ENST00000396534.3_5'UTR|SNX6_ENST00000355110.5_5'UTR	NM_152233.2	NP_689419.2	Q9UNH7	SNX6_HUMAN	sorting nexin 6	65	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|intracellular (GO:0005622)|nucleus (GO:0005634)	phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			endometrium(4)|lung(1)|ovary(1)	6	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		CCGAACAACTGAAAACTCGTT	0.303																																						dbGAP											0													85.0	80.0	82.0					14																	35077312		1864	4081	5945	-	-	-	SO:0001583	missense	0			AF121856	CCDS9648.1, CCDS41942.1	14q13	2010-08-05			ENSG00000129515	ENSG00000129515		"""Sorting nexins"""	14970	protein-coding gene	gene with protein product		606098				11279102	Standard	XM_006720224		Approved		uc001wsf.1	Q9UNH7	OTTHUMG00000140213	ENST00000362031.4:c.230C>T	14.37:g.35077312G>A	ENSP00000355217:p.Ser77Leu		C0H5W9|Q9Y449	Nonsense_Mutation	SNP	pfam_Phox,superfamily_Phox,pfscan_Phox	p.Q71*	ENST00000362031.4	37	c.211	CCDS41942.1	14	.	.	.	.	.	.	.	.	.	.	G	20.6	4.011332	0.75046	.	.	ENSG00000129515	ENST00000362031;ENST00000555648	T;T	0.39229	1.09;1.09	5.17	5.17	0.71159	Phox homologous domain (4);	0.000000	0.85682	D	0.000000	T	0.62974	0.2472	M	0.62088	1.915	0.80722	D	1	D	0.67145	0.996	D	0.74348	0.983	T	0.61441	-0.7062	10	0.44086	T	0.13	-9.8884	19.0532	0.93053	0.0:0.0:1.0:0.0	.	65	Q9UNH7	SNX6_HUMAN	L	77;95	ENSP00000355217:S77L;ENSP00000452520:S95L	ENSP00000355217:S77L	S	-	2	0	SNX6	34147063	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.530000	0.98051	2.575000	0.86900	0.650000	0.86243	TCA	SNX6	-	pfam_Phox,superfamily_Phox,pfscan_Phox	ENSG00000129515		0.303	SNX6-002	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	SNX6	HGNC	protein_coding	OTTHUMT00000276642.3	278	0.00	0	G			35077312	35077312	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000556712	ensembl	human	known	69_37n	nonsense	125	34.55	66	SNP	1.000	A
SOX7	83595	genome.wustl.edu	37	8	10587809	10587809	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr8:10587809G>A	ENST00000304501.1	-	1	213	c.135C>T	c.(133-135)atC>atT	p.I45I	SOX7_ENST00000553390.1_Intron|SOX7_ENST00000554914.1_Intron|CTD-2135J3.3_ENST00000519568.1_RNA|CTD-2135J3.3_ENST00000506149.2_RNA	NM_031439.2	NP_113627.1	Q9BT81	SOX7_HUMAN	SRY (sex determining region Y)-box 7	45					endoderm formation (GO:0001706)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|regulation of canonical Wnt signaling pathway (GO:0060828)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20				COAD - Colon adenocarcinoma(149;0.0732)		TGGGCCGCCGGATACGGCTCT	0.687																																						dbGAP											0													22.0	24.0	24.0					8																	10587809		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AJ409320	CCDS5977.1	8p22	2013-01-25			ENSG00000171056	ENSG00000171056		"""SRY (sex determining region Y)-boxes"""	18196	protein-coding gene	gene with protein product		612202				11691915	Standard	NM_031439		Approved		uc003wtf.3	Q9BT81	OTTHUMG00000090585	ENST00000304501.1:c.135C>T	8.37:g.10587809G>A			B4DKV0|Q53YD0	Silent	SNP	pfam_Sox_C_TAD,pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.I45	ENST00000304501.1	37	c.135	CCDS5977.1	8																																																																																			SOX7	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	ENSG00000171056		0.687	SOX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX7	HGNC	protein_coding	OTTHUMT00000207131.1	12	0.00	0	G			10587809	10587809	-1	no_errors	ENST00000304501	ensembl	human	known	69_37n	silent	9	50.00	9	SNP	1.000	A
SPINK5	11005	genome.wustl.edu	37	5	147493927	147493927	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr5:147493927G>T	ENST00000256084.7	+	21	1932	c.1890G>T	c.(1888-1890)gaG>gaT	p.E630D	SPINK5_ENST00000359874.3_Missense_Mutation_p.E630D|SPINK5_ENST00000398454.1_Missense_Mutation_p.E630D	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	630	Kazal-like 10. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTTTAGGAGACATGCGATG	0.393																																						dbGAP											0													52.0	50.0	51.0					5																	147493927		1816	4082	5898	-	-	-	SO:0001583	missense	0			AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.1890G>T	5.37:g.147493927G>T	ENSP00000256084:p.Glu630Asp		A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal	p.E630D	ENST00000256084.7	37	c.1890	CCDS43382.1	5	.	.	.	.	.	.	.	.	.	.	G	0.565	-0.843723	0.02671	.	.	ENSG00000133710	ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	T;T;T;T	0.06449	3.3;3.3;3.3;3.3	5.42	-2.76	0.05896	.	0.592858	0.16909	N	0.194543	T	0.01421	0.0046	N	0.00436	-1.5	0.09310	N	1	B;B;B;B	0.06786	0.0;0.001;0.0;0.001	B;B;B;B	0.10450	0.0;0.001;0.001;0.005	T	0.46386	-0.9195	10	0.27082	T	0.32	-16.8634	6.846	0.23988	0.0:0.4628:0.158:0.3793	.	611;630;630;630	B4DWS3;Q9NQ38-3;Q9NQ38;Q9NQ38-2	.;.;ISK5_HUMAN;.	D	630;630;611;630	ENSP00000381472:E630D;ENSP00000352936:E630D;ENSP00000421519:E611D;ENSP00000256084:E630D	ENSP00000256084:E630D	E	+	3	2	SPINK5	147474120	0.000000	0.05858	0.022000	0.16811	0.104000	0.19210	-1.004000	0.03678	-0.402000	0.07633	-0.867000	0.03001	GAG	SPINK5	-	NULL	ENSG00000133710		0.393	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPINK5	HGNC	protein_coding	OTTHUMT00000259215.2	117	0.85	1	G	NM_001127698		147493927	147493927	+1	no_errors	ENST00000359874	ensembl	human	known	69_37n	missense	78	12.36	11	SNP	0.016	T
SPRED1	161742	genome.wustl.edu	37	15	38614513	38614513	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr15:38614513G>C	ENST00000299084.4	+	3	1139	c.279G>C	c.(277-279)aaG>aaC	p.K93N	SPRED1_ENST00000561205.1_3'UTR	NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	93	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		ACCACTGGAAGATTGATGACA	0.368									Legius syndrome																												Melanoma(196;2146 2959 7698 16532)	dbGAP											0													136.0	137.0	137.0					15																	38614513		2200	4297	6497	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.279G>C	15.37:g.38614513G>C	ENSP00000299084:p.Lys93Asn		B2RPJ8|Q05D53|Q8N256	Missense_Mutation	SNP	pfam_Sprouty,pfam_EVH1,smart_EVH1,pfscan_EVH1	p.K93N	ENST00000299084.4	37	c.279	CCDS32193.1	15	.	.	.	.	.	.	.	.	.	.	G	28.6	4.936534	0.92458	.	.	ENSG00000166068	ENST00000299084	D	0.98666	-5.06	5.71	5.71	0.89125	EVH1 (2);Pleckstrin homology-type (1);	0.042810	0.85682	D	0.000000	D	0.98880	0.9621	M	0.63843	1.955	0.58432	D	0.999999	D	0.76494	0.999	D	0.65443	0.935	D	0.99895	1.1145	10	0.87932	D	0	-7.517	19.8564	0.96761	0.0:0.0:1.0:0.0	.	93	Q7Z699	SPRE1_HUMAN	N	93	ENSP00000299084:K93N	ENSP00000299084:K93N	K	+	3	2	SPRED1	36401805	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.993000	0.88291	2.704000	0.92352	0.585000	0.79938	AAG	SPRED1	-	pfam_EVH1,smart_EVH1,pfscan_EVH1	ENSG00000166068		0.368	SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRED1	HGNC	protein_coding	OTTHUMT00000418217.1	261	0.00	0	G			38614513	38614513	+1	no_errors	ENST00000299084	ensembl	human	known	69_37n	missense	137	48.89	132	SNP	1.000	C
STK31	56164	genome.wustl.edu	37	7	23809284	23809284	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr7:23809284C>T	ENST00000355870.3	+	13	1741	c.1622C>T	c.(1621-1623)tCa>tTa	p.S541L	STK31_ENST00000405627.3_3'UTR|STK31_ENST00000433467.2_Missense_Mutation_p.S541L|STK31_ENST00000428484.1_Missense_Mutation_p.S518L|STK31_ENST00000354639.3_Missense_Mutation_p.S518L	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	541						acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GTGGAAGGATCACTGATTTCA	0.378																																						dbGAP											0													169.0	165.0	166.0					7																	23809284		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.1622C>T	7.37:g.23809284C>T	ENSP00000348132:p.Ser541Leu		B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	pfam_Tudor,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Tudor,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Tudor,pfscan_Prot_kinase_cat_dom	p.S541L	ENST00000355870.3	37	c.1622	CCDS5386.1	7	.	.	.	.	.	.	.	.	.	.	C	7.896	0.733382	0.15574	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.71341	-0.56;1.17;-0.56;-0.56	5.27	5.27	0.74061	.	1.019870	0.07812	N	0.958252	T	0.68366	0.2993	L	0.55481	1.735	0.09310	N	1	B;B	0.11235	0.004;0.0	B;B	0.12837	0.008;0.003	T	0.54957	-0.8215	10	0.39692	T	0.17	5.4326	11.8764	0.52550	0.0:0.9154:0.0:0.0846	.	541;541	B4DZ06;Q9BXU1	.;STK31_HUMAN	L	541;541;518;518	ENSP00000348132:S541L;ENSP00000411852:S541L;ENSP00000346660:S518L;ENSP00000406146:S518L	ENSP00000346660:S518L	S	+	2	0	STK31	23775809	0.036000	0.19791	0.156000	0.22583	0.082000	0.17680	2.437000	0.44828	2.477000	0.83638	0.655000	0.94253	TCA	STK31	-	NULL	ENSG00000196335		0.378	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK31	HGNC	protein_coding	OTTHUMT00000214036.2	394	0.00	0	C	NM_031414		23809284	23809284	+1	no_errors	ENST00000355870	ensembl	human	known	69_37n	missense	366	15.28	66	SNP	0.048	T
SYNE1	23345	genome.wustl.edu	37	6	152706962	152706962	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:152706962C>T	ENST00000367255.5	-	55	9100	c.8499G>A	c.(8497-8499)agG>agA	p.R2833R	SYNE1_ENST00000341594.5_Silent_p.R2872R|SYNE1_ENST00000265368.4_Silent_p.R2833R|SYNE1_ENST00000448038.1_Silent_p.R2840R|SYNE1_ENST00000423061.1_Silent_p.R2840R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2833					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTTCCACTTTCCTCATTTTTT	0.408										HNSCC(10;0.0054)																												dbGAP											0													126.0	116.0	120.0					6																	152706962		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.8499G>A	6.37:g.152706962C>T			E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.R2833	ENST00000367255.5	37	c.8499	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1	ENSG00000131018		0.408	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	221	0.00	0	C	NM_182961		152706962	152706962	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	silent	239	17.87	52	SNP	1.000	T
SYT17	51760	genome.wustl.edu	37	16	19191817	19191817	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr16:19191817C>T	ENST00000355377.2	+	4	685	c.287C>T	c.(286-288)tCa>tTa	p.S96L	SYT17_ENST00000562711.2_Missense_Mutation_p.S92L|SYT17_ENST00000568115.1_Missense_Mutation_p.S35L|SYT17_ENST00000562034.1_Missense_Mutation_p.S35L	NM_016524.2	NP_057608.2	Q9BSW7	SYT17_HUMAN	synaptotagmin XVII	96					exocytosis (GO:0006887)	membrane (GO:0016020)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)			NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	17						CGCTCGTCCTCAGACACATCC	0.582											OREG0023658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													84.0	70.0	75.0					16																	19191817		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10575.1	16p12.3	2013-01-21			ENSG00000103528	ENSG00000103528		"""Synaptotagmins"""	24119	protein-coding gene	gene with protein product	"""B/K protein"""					10493829	Standard	NM_016524		Approved		uc002dfw.3	Q9BSW7	OTTHUMG00000131461	ENST00000355377.2:c.287C>T	16.37:g.19191817C>T	ENSP00000347538:p.Ser96Leu	731	O43330|Q9NZ18	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin	p.S96L	ENST00000355377.2	37	c.287	CCDS10575.1	16	.	.	.	.	.	.	.	.	.	.	C	22.5	4.302816	0.81136	.	.	ENSG00000103528	ENST00000355377	T	0.17691	2.26	4.73	4.73	0.59995	.	0.117347	0.36167	N	0.002750	T	0.30759	0.0775	L	0.32530	0.975	0.80722	D	1	D;D	0.54601	0.967;0.967	P;D	0.63597	0.879;0.916	T	0.01956	-1.1240	10	0.51188	T	0.08	.	18.2759	0.90083	0.0:1.0:0.0:0.0	.	96;35	Q9BSW7;B4DJB2	SYT17_HUMAN;.	L	96	ENSP00000347538:S96L	ENSP00000347538:S96L	S	+	2	0	SYT17	19099318	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	5.212000	0.65225	2.627000	0.88993	0.655000	0.94253	TCA	SYT17	-	NULL	ENSG00000103528		0.582	SYT17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT17	HGNC	protein_coding	OTTHUMT00000254286.2	80	0.00	0	C	NM_016524		19191817	19191817	+1	no_errors	ENST00000355377	ensembl	human	known	69_37n	missense	72	37.39	43	SNP	1.000	T
TBC1D3P5	440419	genome.wustl.edu	37	17	25748131	25748131	+	RNA	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:25748131G>C	ENST00000586223.1	+	0	518					NR_033892.1				TBC1 domain family, member 3 pseudogene 5																		GCATTACAGTGAGAAGGAACT	0.627																																						dbGAP											0																																										-	-	-			0					17q11.1	2014-03-20			ENSG00000266433	ENSG00000266433			43567	pseudogene	pseudogene							Standard	NR_033892		Approved		uc002gzg.3		OTTHUMG00000179156		17.37:g.25748131G>C				RNA	SNP	-	NULL	ENST00000586223.1	37	NULL		17																																																																																			TBC1D3P5	-	-	ENSG00000266433		0.627	TBC1D3P5-003	KNOWN	non_canonical_TEC|basic	processed_transcript	TBC1D3P5	HGNC	pseudogene	OTTHUMT00000451073.1	41	0.00	0	G	NR_033892		25748131	25748131	+1	no_errors	ENST00000581469	ensembl	human	known	69_37n	rna	53	13.11	8	SNP	0.033	C
TBCCD1	55171	genome.wustl.edu	37	3	186272078	186272078	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr3:186272078G>A	ENST00000424280.1	-	6	1988	c.1509C>T	c.(1507-1509)atC>atT	p.I503I	TBCCD1_ENST00000479590.1_5'UTR|TBCCD1_ENST00000446782.1_Silent_p.I407I|TBCCD1_ENST00000338733.5_Silent_p.I503I	NM_001134415.1	NP_001127887.1	Q9NVR7	TBCC1_HUMAN	TBCC domain containing 1	503					cell morphogenesis (GO:0000902)|cytoskeleton organization (GO:0007010)|maintenance of centrosome location (GO:0051661)|maintenance of Golgi location (GO:0051684)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|spindle pole centrosome (GO:0031616)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|skin(1)	17	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)		TTTTCTGCCAGATCTGTATCT	0.398																																						dbGAP											0													80.0	88.0	85.0					3																	186272078		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC025748	CCDS3276.1, CCDS75061.1	3q27.3	2006-03-09			ENSG00000113838	ENSG00000113838			25546	protein-coding gene	gene with protein product						12477932	Standard	NM_001134415		Approved	FLJ10560	uc003fqg.3	Q9NVR7	OTTHUMG00000156613	ENST00000424280.1:c.1509C>T	3.37:g.186272078G>A			B3KW69|D3DNU6|G5E9J4	Silent	SNP	pfam_Tubulin-bd_cofactor_C,superfamily_Adenylate_cyclase-assoc_CAP_C,smart_CARP_motif	p.I503	ENST00000424280.1	37	c.1509	CCDS3276.1	3																																																																																			TBCCD1	-	NULL	ENSG00000113838		0.398	TBCCD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCCD1	HGNC	protein_coding	OTTHUMT00000344774.1	80	0.00	0	G	NM_018138		186272078	186272078	-1	no_errors	ENST00000338733	ensembl	human	known	69_37n	silent	75	27.88	29	SNP	0.542	A
TEC	7006	genome.wustl.edu	37	4	48141011	48141011	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr4:48141011A>C	ENST00000381501.3	-	16	1721	c.1564T>G	c.(1564-1566)Tct>Gct	p.S522A	TEC_ENST00000511471.2_5'Flank	NM_003215.2	NP_003206.2	P42680	TEC_HUMAN	tec protein tyrosine kinase	522	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell receptor signaling pathway (GO:0050853)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of platelet activation (GO:0010543)|tissue regeneration (GO:0042246)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31						GCACCAGAAGAACTTGTGTAC	0.408																																						dbGAP											0													100.0	92.0	95.0					4																	48141011		2203	4300	6503	-	-	-	SO:0001583	missense	0			D29767	CCDS3481.1	4p12	2013-02-14			ENSG00000135605	ENSG00000135605		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	11719	protein-coding gene	gene with protein product		600583				7934162	Standard	NM_003215		Approved	PSCTK4	uc003gxz.3	P42680	OTTHUMG00000128623	ENST00000381501.3:c.1564T>G	4.37:g.48141011A>C	ENSP00000370912:p.Ser522Ala		B7ZKZ6|Q3MIS5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom	p.S522A	ENST00000381501.3	37	c.1564	CCDS3481.1	4	.	.	.	.	.	.	.	.	.	.	A	18.76	3.693554	0.68386	.	.	ENSG00000135605	ENST00000381501	D	0.82619	-1.63	5.63	5.63	0.86233	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87962	0.6310	L	0.39467	1.215	0.58432	D	0.999995	P	0.50156	0.932	D	0.81914	0.995	D	0.88959	0.3392	10	0.72032	D	0.01	.	16.1371	0.81494	1.0:0.0:0.0:0.0	.	522	P42680	TEC_HUMAN	A	522	ENSP00000370912:S522A	ENSP00000370912:S522A	S	-	1	0	TEC	47835768	1.000000	0.71417	0.994000	0.49952	0.125000	0.20455	7.367000	0.79558	2.271000	0.75665	0.459000	0.35465	TCT	TEC	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000135605		0.408	TEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEC	HGNC	protein_coding	OTTHUMT00000250492.3	181	0.00	0	A			48141011	48141011	-1	no_errors	ENST00000381501	ensembl	human	known	69_37n	missense	153	17.30	32	SNP	1.000	C
TECRL	253017	genome.wustl.edu	37	4	65145813	65145813	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr4:65145813C>A	ENST00000381210.3	-	12	1179	c.1069G>T	c.(1069-1071)Gca>Tca	p.A357S	TECRL_ENST00000507440.1_Intron	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	357					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						GGAATCATTGCTGATTTTCTA	0.264																																						dbGAP											0													36.0	39.0	38.0					4																	65145813		2178	4243	6421	-	-	-	SO:0001583	missense	0			AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.1069G>T	4.37:g.65145813C>A	ENSP00000370607:p.Ala357Ser			Missense_Mutation	SNP	pfam_3-oxo-5_a-steroid_4-DH_C,pfscan_3-oxo-5_a-steroid_4-DH_C	p.A357S	ENST00000381210.3	37	c.1069	CCDS33990.1	4	.	.	.	.	.	.	.	.	.	.	C	17.31	3.356184	0.61293	.	.	ENSG00000205678	ENST00000381210	T	0.34859	1.34	5.09	5.09	0.68999	3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.55862	0.1947	M	0.62266	1.93	0.42629	D	0.993371	D	0.69078	0.997	D	0.80764	0.994	T	0.54036	-0.8353	10	0.41790	T	0.15	-23.1033	14.3347	0.66581	0.0:1.0:0.0:0.0	.	357	Q5HYJ1	TECRL_HUMAN	S	357	ENSP00000370607:A357S	ENSP00000370607:A357S	A	-	1	0	TECRL	64828408	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	4.158000	0.58150	2.516000	0.84829	0.650000	0.86243	GCA	TECRL	-	pfam_3-oxo-5_a-steroid_4-DH_C	ENSG00000205678		0.264	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECRL	HGNC	protein_coding	OTTHUMT00000361705.4	180	0.00	0	C	NM_001010874		65145813	65145813	-1	no_errors	ENST00000381210	ensembl	human	known	69_37n	missense	72	14.94	13	SNP	1.000	A
TEP1	7011	genome.wustl.edu	37	14	20856087	20856087	+	Silent	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr14:20856087G>C	ENST00000262715.5	-	18	2701	c.2661C>G	c.(2659-2661)ccC>ccG	p.P887P	TEP1_ENST00000556935.1_Silent_p.P779P	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	887					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CAGGAGCCAAGGGGCTTGGAG	0.532																																						dbGAP											0													97.0	93.0	94.0					14																	20856087		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.2661C>G	14.37:g.20856087G>C			A0AUV9	Silent	SNP	pfam_TROVE,pfam_TEP1_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_NACHT_NTPase,pfscan_TROVE,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P887	ENST00000262715.5	37	c.2661	CCDS9548.1	14																																																																																			TEP1	-	NULL	ENSG00000129566		0.532	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEP1	HGNC	protein_coding	OTTHUMT00000073563.2	283	0.00	0	G	NM_007110		20856087	20856087	-1	no_errors	ENST00000262715	ensembl	human	known	69_37n	silent	137	49.45	136	SNP	0.580	C
TIAM2	26230	genome.wustl.edu	37	6	155450974	155450974	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:155450974C>T	ENST00000461783.3	+	6	1890	c.617C>T	c.(616-618)tCg>tTg	p.S206L	TIAM2_ENST00000456144.1_Missense_Mutation_p.S206L|TIAM2_ENST00000529824.2_Missense_Mutation_p.S206L|TIAM2_ENST00000360366.4_Missense_Mutation_p.S206L|TIAM2_ENST00000318981.5_Missense_Mutation_p.S206L|TIAM2_ENST00000367174.2_5'UTR			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	206					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		ACCTTAGCATCGGAAACCTCC	0.622																																						dbGAP											0													40.0	38.0	39.0					6																	155450974		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.617C>T	6.37:g.155450974C>T	ENSP00000437188:p.Ser206Leu		B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,superfamily_HR1_rho-bd,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.S206L	ENST00000461783.3	37	c.617	CCDS34558.1	6	.	.	.	.	.	.	.	.	.	.	c	7.910	0.736344	0.15574	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.07908	3.25;3.15;3.22;3.25;3.27;3.22	3.49	1.68	0.24146	.	0.560956	0.18019	N	0.154284	T	0.02156	0.0067	L	0.51422	1.61	0.27136	N	0.961787	P	0.37997	0.614	B	0.24974	0.057	T	0.40701	-0.9549	10	0.54805	T	0.06	.	7.8363	0.29371	0.0:0.7992:0.0:0.2008	.	206	Q8IVF5	TIAM2_HUMAN	L	206;452;206;206;206;206;206	ENSP00000437188:S206L;ENSP00000434901:S206L;ENSP00000407746:S206L;ENSP00000327315:S206L;ENSP00000353528:S206L;ENSP00000433348:S206L	ENSP00000327315:S206L	S	+	2	0	TIAM2	155492666	0.007000	0.16637	0.000000	0.03702	0.006000	0.05464	2.288000	0.43514	0.123000	0.18342	-0.215000	0.12644	TCG	TIAM2	-	NULL	ENSG00000146426		0.622	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	TIAM2	HGNC	protein_coding	OTTHUMT00000387980.2	16	0.00	0	C	NM_012454		155450974	155450974	+1	no_errors	ENST00000456144	ensembl	human	known	69_37n	missense	13	44.00	11	SNP	0.019	T
TJP1	7082	genome.wustl.edu	37	15	30053811	30053811	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr15:30053811C>G	ENST00000346128.6	-	7	1329	c.855G>C	c.(853-855)gaG>gaC	p.E285D	TJP1_ENST00000545208.2_Missense_Mutation_p.E285D|TJP1_ENST00000356107.6_Missense_Mutation_p.E285D|TJP1_ENST00000400011.2_Missense_Mutation_p.E289D|TJP1_ENST00000495972.2_Missense_Mutation_p.E285D	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	285					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		CACCGTCTCTCTCAGAGGCAT	0.383																																					Melanoma(77;681 1843 6309 6570)	dbGAP											0													116.0	109.0	111.0					15																	30053811		1899	4123	6022	-	-	-	SO:0001583	missense	0				CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.855G>C	15.37:g.30053811C>G	ENSP00000281537:p.Glu285Asp		B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	pfam_PDZ,pfam_ZU5,pfam_Guanylate_kin,pfam_SH3_2,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_ZU5,pfscan_PDZ,pfscan_SH3_domain,pfscan_ZU5,pfscan_Guanylate_kin,prints_ZonOcculS1,prints_ZonOcculdens	p.E285D	ENST00000346128.6	37	c.855	CCDS42007.1	15	.	.	.	.	.	.	.	.	.	.	C	11.24	1.581561	0.28180	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T;T;T	0.06768	3.26;3.37;3.28;3.26	5.94	0.801	0.18679	.	0.050136	0.85682	D	0.000000	T	0.03915	0.0110	N	0.11698	0.16	0.42771	D	0.993833	B;B;B;B	0.16166	0.004;0.007;0.001;0.016	B;B;B;B	0.17979	0.008;0.02;0.002;0.011	T	0.46638	-0.9177	9	.	.	.	.	7.8124	0.29239	0.0:0.3095:0.0:0.6905	.	278;285;285;289	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	D	285;289;285;285;285	ENSP00000281537:E285D;ENSP00000382890:E289D;ENSP00000441202:E285D;ENSP00000348416:E285D	.	E	-	3	2	TJP1	27841103	1.000000	0.71417	0.957000	0.39632	0.692000	0.40212	1.739000	0.38217	0.233000	0.21120	0.650000	0.86243	GAG	TJP1	-	NULL	ENSG00000104067		0.383	TJP1-001	KNOWN	basic|CCDS	protein_coding	TJP1	HGNC	protein_coding	OTTHUMT00000268237.3	275	0.00	0	C	NM_003257		30053811	30053811	-1	no_errors	ENST00000346128	ensembl	human	known	69_37n	missense	123	33.33	62	SNP	1.000	G
TMEM120B	144404	genome.wustl.edu	37	12	122186349	122186349	+	Splice_Site	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:122186349G>A	ENST00000449592.2	+	3	406		c.e3+1			NM_001080825.2	NP_001074294.2	A0PK00	T120B_HUMAN	transmembrane protein 120B							integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)	11	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		AGAAGAACGGGTAGGAGCTGG	0.602																																						dbGAP											0													49.0	53.0	52.0					12																	122186349		2066	4189	6255	-	-	-	SO:0001630	splice_region_variant	0			BC127768	CCDS41852.1	12q24.31	2007-08-01			ENSG00000188735	ENSG00000188735			32008	protein-coding gene	gene with protein product							Standard	NM_001080825		Approved		uc001ubc.4	A0PK00	OTTHUMG00000169076	ENST00000449592.2:c.305+1G>A	12.37:g.122186349G>A			A0PK01|B3KX33	Splice_Site	SNP	-	e3+1	ENST00000449592.2	37	c.305+1	CCDS41852.1	12	.	.	.	.	.	.	.	.	.	.	g	20.6	4.021904	0.75275	.	.	ENSG00000188735	ENST00000449592;ENST00000541467	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1369	0.89622	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMEM120B	120670732	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	8.250000	0.89835	2.652000	0.90054	0.567000	0.79289	.	TMEM120B	-	-	ENSG00000188735		0.602	TMEM120B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM120B	HGNC	protein_coding	OTTHUMT00000402158.1	57	0.00	0	G	NM_001080825	Intron	122186349	122186349	+1	no_errors	ENST00000342607	ensembl	human	known	69_37n	splice_site	41	22.64	12	SNP	1.000	A
TMEM167A	153339	genome.wustl.edu	37	5	82360907	82360907	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr5:82360907C>G	ENST00000502346.1	-	2	205	c.33G>C	c.(31-33)ttG>ttC	p.L11F	SCARNA18_ENST00000459004.1_RNA|TMEM167A_ENST00000511450.1_5'UTR	NM_174909.4	NP_777569.1	Q8TBQ9	KISHA_HUMAN	transmembrane protein 167A	11						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				large_intestine(1)|lung(1)	2						AGATTACAGTCAATAGACTCT	0.323																																						dbGAP											0													83.0	88.0	86.0					5																	82360907		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC107575, AK055070	CCDS34198.1	5q14.2	2008-06-06	2008-06-06	2008-06-06	ENSG00000174695	ENSG00000174695			28330	protein-coding gene	gene with protein product			"""transmembrane protein 167"""	TMEM167		1316117	Standard	NM_174909		Approved	FLJ30508, MGC23909	uc003khx.4	Q8TBQ9	OTTHUMG00000162570	ENST00000502346.1:c.33G>C	5.37:g.82360907C>G	ENSP00000424707:p.Leu11Phe		Q0P692	Missense_Mutation	SNP	pfam_DUF1242	p.L11F	ENST00000502346.1	37	c.33	CCDS34198.1	5	.	.	.	.	.	.	.	.	.	.	C	21.6	4.173179	0.78452	.	.	ENSG00000174695	ENST00000502346	.	.	.	5.9	5.9	0.94986	.	0.000000	0.64402	D	0.000001	D	0.83718	0.5315	.	.	.	0.50171	D	0.999856	D	0.69078	0.997	D	0.78314	0.991	D	0.84774	0.0769	8	0.87932	D	0	.	19.8812	0.96900	0.0:1.0:0.0:0.0	.	11	Q8TBQ9	KISHA_HUMAN	F	11	.	ENSP00000424707:L11F	L	-	3	2	TMEM167A	82396663	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.614000	0.54160	2.786000	0.95864	0.650000	0.86243	TTG	TMEM167A	-	pfam_DUF1242	ENSG00000174695		0.323	TMEM167A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM167A	HGNC	protein_coding	OTTHUMT00000369631.2	159	0.00	0	C	NM_174909		82360907	82360907	-1	no_errors	ENST00000502346	ensembl	human	known	69_37n	missense	98	20.97	26	SNP	1.000	G
TMEM245	23731	genome.wustl.edu	37	9	111812870	111812870	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr9:111812870G>A	ENST00000374586.3	-	13	1988	c.1957C>T	c.(1957-1959)Ctc>Ttc	p.L653F		NM_032012.3	NP_114401.2	Q9H330	TM245_HUMAN	transmembrane protein 245	653						integral component of membrane (GO:0016021)											ACAAAATTGAGAAGGGCTGTC	0.453																																						dbGAP											0													130.0	127.0	128.0					9																	111812870		1976	4175	6151	-	-	-	SO:0001583	missense	0			AF153415	CCDS43858.1	9q31	2012-03-06	2012-03-06	2012-03-06	ENSG00000106771	ENSG00000106771			1363	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 5"""	C9orf5		10564813	Standard	NM_032012		Approved	CG-2	uc004bdt.4	Q9H330	OTTHUMG00000020469	ENST00000374586.3:c.1957C>T	9.37:g.111812870G>A	ENSP00000363714:p.Leu653Phe		B4DSW7|Q5JTQ5|Q5SS43|Q6ZME3|Q8NDJ5|Q96CG6	Missense_Mutation	SNP	pfam_UPF0118	p.L653F	ENST00000374586.3	37	c.1957	CCDS43858.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.0|26.0	4.691607|4.691607	0.88735|0.88735	.|.	.|.	ENSG00000106771|ENSG00000106771	ENST00000374586;ENST00000223608|ENST00000413712	T|.	0.47528|.	0.84|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.65512|0.65512	0.2698|0.2698	L|L	0.59436|0.59436	1.845|1.845	0.54753|0.54753	D|D	0.999988|0.999988	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.999|.	T|T	0.62666|0.62666	-0.6806|-0.6806	10|5	0.29301|.	T|.	0.29|.	-18.1031|-18.1031	13.3442|13.3442	0.60561|0.60561	0.0717:0.0:0.9283:0.0|0.0717:0.0:0.9283:0.0	.|.	653;653|.	Q9H330-2;Q9H330|.	.;CI005_HUMAN|.	F|F	653|245	ENSP00000363714:L653F|.	ENSP00000223608:L653F|.	L|S	-|-	1|2	0|0	C9orf5|C9orf5	110852691|110852691	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.935000|0.935000	0.57460|0.57460	8.038000|8.038000	0.88943|0.88943	2.755000|2.755000	0.94549|0.94549	0.650000|0.650000	0.86243|0.86243	CTC|TCT	TMEM245	-	pfam_UPF0118	ENSG00000106771		0.453	TMEM245-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM245	HGNC	protein_coding	OTTHUMT00000053587.2	226	0.00	0	G	NM_032012		111812870	111812870	-1	no_errors	ENST00000374586	ensembl	human	known	69_37n	missense	221	11.20	28	SNP	1.000	A
TMEM59L	25789	genome.wustl.edu	37	19	18729040	18729040	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:18729040C>T	ENST00000600490.1	+	7	925	c.740C>T	c.(739-741)tCt>tTt	p.S247F	TMEM59L_ENST00000262817.3_Missense_Mutation_p.S247F			Q9UK28	TM59L_HUMAN	transmembrane protein 59-like	247						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(2)	13						AAGGTGGAGTCTGAAGAGCCA	0.617																																						dbGAP											0													78.0	59.0	66.0					19																	18729040		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF186264	CCDS12383.1	19p12	2008-02-05	2007-03-14	2007-03-14		ENSG00000105696			13237	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 4"""	C19orf4		10527841	Standard	NM_012109		Approved	BSMAP	uc002njy.4	Q9UK28		ENST00000600490.1:c.740C>T	19.37:g.18729040C>T	ENSP00000470879:p.Ser247Phe			Missense_Mutation	SNP	pfam_Uncharacterised_TMEM59	p.S247F	ENST00000600490.1	37	c.740	CCDS12383.1	19	.	.	.	.	.	.	.	.	.	.	C	13.28	2.188668	0.38609	.	.	ENSG00000105696	ENST00000262817	T	0.47869	0.83	4.35	3.31	0.37934	.	1.042410	0.07555	N	0.916002	T	0.47078	0.1426	L	0.44542	1.39	0.09310	N	1	P	0.43607	0.812	P	0.44811	0.461	T	0.35724	-0.9777	10	0.56958	D	0.05	-2.0468	9.76	0.40526	0.0:0.902:0.0:0.098	.	247	Q9UK28	TM59L_HUMAN	F	247	ENSP00000262817:S247F	ENSP00000262817:S247F	S	+	2	0	TMEM59L	18590040	0.000000	0.05858	0.602000	0.28890	0.830000	0.47004	0.363000	0.20301	0.947000	0.37659	0.561000	0.74099	TCT	TMEM59L	-	pfam_Uncharacterised_TMEM59	ENSG00000105696		0.617	TMEM59L-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	TMEM59L	HGNC	protein_coding	OTTHUMT00000465143.2	83	0.00	0	C			18729040	18729040	+1	no_errors	ENST00000262817	ensembl	human	known	69_37n	missense	84	20.00	21	SNP	0.005	T
TOPBP1	11073	genome.wustl.edu	37	3	133372333	133372333	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr3:133372333G>T	ENST00000260810.5	-	7	909	c.778C>A	c.(778-780)Cac>Aac	p.H260N	TOPBP1_ENST00000511439.1_5'UTR	NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	260	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						GTCACACAGTGTACATTCCAT	0.378								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)	dbGAP											0													135.0	122.0	126.0					3																	133372333		1905	4149	6054	-	-	-	SO:0001583	missense	0			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.778C>A	3.37:g.133372333G>T	ENSP00000260810:p.His260Asn		B7Z7W8|Q7LGC1|Q9UEB9	Nonsense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.Y104*	ENST00000260810.5	37	c.312	CCDS46919.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.6|20.6	4.010450|4.010450	0.75046|0.75046	.|.	.|.	ENSG00000163781|ENSG00000163781	ENST00000260810|ENST00000508524	T|.	0.58060|.	0.36|.	5.78|5.78	5.78|5.78	0.91487|0.91487	BRCT (4);|.	0.099447|.	0.64402|.	D|.	0.000001|.	T|.	0.76842|.	0.4044|.	M|M	0.71581|0.71581	2.175|2.175	0.46416|0.46416	D|D	0.999033|0.999033	D|.	0.89917|.	1.0|.	D|.	0.79108|.	0.992|.	T|.	0.74460|.	-0.3658|.	10|.	0.30078|.	T|.	0.28|.	.|.	20.0059|20.0059	0.97434|0.97434	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	260|.	Q92547|.	TOPB1_HUMAN|.	N|X	260|104	ENSP00000260810:H260N|.	ENSP00000260810:H260N|.	H|Y	-|-	1|3	0|2	TOPBP1|TOPBP1	134855023|134855023	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.299000|6.299000	0.72770|0.72770	2.728000|2.728000	0.93425|0.93425	0.563000|0.563000	0.77884|0.77884	CAC|TAC	TOPBP1	-	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	ENSG00000163781		0.378	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	HGNC	protein_coding	OTTHUMT00000357254.1	336	0.00	0	G	NM_007027		133372333	133372333	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000508524	ensembl	human	putative	69_37n	nonsense	283	15.98	54	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578268	7578268	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:7578268A>G	ENST00000269305.4	-	6	770	c.581T>C	c.(580-582)cTt>cCt	p.L194P	TP53_ENST00000359597.4_Missense_Mutation_p.L194P|TP53_ENST00000445888.2_Missense_Mutation_p.L194P|TP53_ENST00000413465.2_Missense_Mutation_p.L194P|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.L194P|TP53_ENST00000420246.2_Missense_Mutation_p.L194P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	194	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in sporadic cancers; somatic mutation).|L -> I (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763}.|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L194R(47)|p.L194P(8)|p.L194H(8)|p.0?(8)|p.?(6)|p.L101R(5)|p.L62R(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.L194fs*15(1)|p.L194fs*14(1)|p.L101H(1)|p.L194fs*52(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.L62H(1)|p.I195fs*52(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACTCGGATAAGATGCTGAGG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	108	Substitution - Missense(75)|Whole gene deletion(8)|Deletion - Frameshift(6)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Insertion - Frameshift(1)|Complex - frameshift(1)	breast(19)|lung(14)|ovary(14)|large_intestine(11)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(6)|oesophagus(6)|biliary_tract(5)|skin(5)|bone(4)|upper_aerodigestive_tract(3)|stomach(3)|central_nervous_system(2)|pancreas(2)|liver(2)|soft_tissue(1)|prostate(1)											97.0	87.0	90.0					17																	7578268		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.581T>C	17.37:g.7578268A>G	ENSP00000269305:p.Leu194Pro		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.L194P	ENST00000269305.4	37	c.581	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	15.69	2.906791	0.52333	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99857	-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.90425	3.115	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.997;1.0;1.0;1.0;1.0	D	0.96375	0.9277	10	0.87932	D	0	-29.6709	13.709	0.62656	1.0:0.0:0.0:0.0	.	155;194;194;101;194;194;194	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	P	194;194;194;194;194;194;183;101;62;101;62	ENSP00000410739:L194P;ENSP00000352610:L194P;ENSP00000269305:L194P;ENSP00000398846:L194P;ENSP00000391127:L194P;ENSP00000391478:L194P;ENSP00000425104:L62P;ENSP00000423862:L101P	ENSP00000269305:L194P	L	-	2	0	TP53	7518993	1.000000	0.71417	0.300000	0.25030	0.031000	0.12232	9.287000	0.95975	2.183000	0.69458	0.533000	0.62120	CTT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	273	0.00	0	A	NM_000546		7578268	7578268	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	101	58.61	143	SNP	0.996	G
TPD52	7163	genome.wustl.edu	37	8	80965638	80965638	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr8:80965638G>C	ENST00000379097.3	-	3	645	c.283C>G	c.(283-285)Caa>Gaa	p.Q95E	TPD52_ENST00000519303.2_5'UTR|TPD52_ENST00000379096.5_Missense_Mutation_p.Q55E|TPD52_ENST00000520527.1_Missense_Mutation_p.Q95E|TPD52_ENST00000537855.1_Missense_Mutation_p.Q95E|TPD52_ENST00000517427.1_Missense_Mutation_p.Q95E|TPD52_ENST00000448733.2_Missense_Mutation_p.Q95E|TPD52_ENST00000523395.1_5'Flank|TPD52_ENST00000518937.1_Missense_Mutation_p.Q55E	NM_001025252.1	NP_001020423.1	P55327	TPD52_HUMAN	tumor protein D52	95					anatomical structure morphogenesis (GO:0009653)|B cell differentiation (GO:0030183)|positive regulation of cell proliferation (GO:0008284)|secretion (GO:0046903)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)			GCTAACACTTGAGACAGAGTC	0.398																																						dbGAP											0													221.0	198.0	206.0					8																	80965638		2203	4300	6503	-	-	-	SO:0001583	missense	0			U18914	CCDS34912.1, CCDS47879.1, CCDS55249.1, CCDS75757.1, CCDS75758.1, CCDS75759.1	8q21.13	2014-06-24			ENSG00000076554	ENSG00000076554			12005	protein-coding gene	gene with protein product		604068				7796418	Standard	NM_001287144		Approved	D52, hD52, N8L	uc003ybr.1	P55327	OTTHUMG00000164565	ENST00000379097.3:c.283C>G	8.37:g.80965638G>C	ENSP00000368391:p.Gln95Glu		B7Z414|C9J502|D0UFD1|D0UFD2|D0UFD3|D0UFD4|D0UFD5|E5RKB4|Q13056|Q53EK8|Q6FGP3|Q6FGS3|Q86YZ2|Q9UCX8	Nonsense_Mutation	SNP	NULL	p.S16*	ENST00000379097.3	37	c.47	CCDS34912.1	8	.	.	.	.	.	.	.	.	.	.	G	38	6.718453	0.97788	.	.	ENSG00000076554	ENST00000537855;ENST00000379096;ENST00000518937;ENST00000520527;ENST00000517427;ENST00000448733;ENST00000543691;ENST00000379097;ENST00000425513	T;T;T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77;1.77;1.77	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.49201	0.1543	M	0.71920	2.185	0.80722	D	1	P;D;P	0.56287	0.816;0.975;0.847	P;P;P	0.57244	0.469;0.816;0.604	T	0.45205	-0.9277	10	0.87932	D	0	-21.386	20.3754	0.98918	0.0:0.0:1.0:0.0	.	55;55;95	P55327-2;E5RKB4;P55327	.;.;TPD52_HUMAN	E	95;55;55;95;95;95;95;95;55	ENSP00000438113:Q95E;ENSP00000368390:Q55E;ENSP00000429915:Q55E;ENSP00000429309:Q95E;ENSP00000429351:Q95E;ENSP00000410222:Q95E;ENSP00000368391:Q95E	ENSP00000368390:Q55E	Q	-	1	0	TPD52	81128193	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.796000	0.99103	2.894000	0.99253	0.591000	0.81541	CAA	TPD52	-	NULL	ENSG00000076554		0.398	TPD52-006	KNOWN	basic|CCDS	protein_coding	TPD52	HGNC	protein_coding	OTTHUMT00000379539.2	417	0.00	0	G	NM_005079		80965638	80965638	-1	no_errors	ENST00000521354	ensembl	human	known	69_37n	nonsense	561	16.52	111	SNP	1.000	C
TRIM37	4591	genome.wustl.edu	37	17	57126636	57126636	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr17:57126636G>C	ENST00000262294.7	-	15	1692	c.1433C>G	c.(1432-1434)tCt>tGt	p.S478C	TRIM37_ENST00000376149.3_Missense_Mutation_p.S356C|TRIM37_ENST00000393066.3_Missense_Mutation_p.S478C|TRIM37_ENST00000393065.2_Missense_Mutation_p.S444C	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	478					aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					AAGCATGTCAGAGCATGCAGA	0.443									Mulibrey Nanism																													dbGAP											0													148.0	126.0	133.0					17																	57126636		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Perheentupa syndrome	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.1433C>G	17.37:g.57126636G>C	ENSP00000262294:p.Ser478Cys		Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_MATH,superfamily_TRAF-like,smart_Znf_B-box,smart_Bbox_C,smart_MATH,pfscan_MATH,pfscan_Znf_B-box,pfscan_Znf_RING	p.S478C	ENST00000262294.7	37	c.1433	CCDS32694.1	17	.	.	.	.	.	.	.	.	.	.	G	12.78	2.041584	0.35989	.	.	ENSG00000108395	ENST00000393066;ENST00000262294;ENST00000376149;ENST00000393065	T;T;T;T	0.67171	1.52;1.52;-0.25;1.13	5.26	4.22	0.49857	.	0.549181	0.19847	N	0.104732	T	0.45915	0.1366	N	0.08118	0	0.20975	N	0.999811	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.45716	-0.9242	10	0.87932	D	0	-0.0222	11.2777	0.49176	0.0792:0.1399:0.7809:0.0	.	444;356;478	F8WEE6;O94972-2;O94972	.;.;TRI37_HUMAN	C	478;478;356;444	ENSP00000376785:S478C;ENSP00000262294:S478C;ENSP00000365319:S356C;ENSP00000376784:S444C	ENSP00000262294:S478C	S	-	2	0	TRIM37	54481418	0.994000	0.37717	0.934000	0.37439	0.879000	0.50718	2.836000	0.48183	2.441000	0.82636	0.561000	0.74099	TCT	TRIM37	-	NULL	ENSG00000108395		0.443	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM37	HGNC	protein_coding	OTTHUMT00000445930.1	421	0.00	0	G	NM_015294		57126636	57126636	-1	no_errors	ENST00000262294	ensembl	human	known	69_37n	missense	851	13.25	130	SNP	0.496	C
TTN	7273	genome.wustl.edu	37	2	179441677	179441677	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:179441677C>G	ENST00000591111.1	-	274	64686	c.64462G>C	c.(64462-64464)Gaa>Caa	p.E21488Q	TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E14256Q|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E20561Q|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E23129Q|TTN_ENST00000359218.5_Missense_Mutation_p.E14189Q|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E14064Q|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21488	Fibronectin type-III 55. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGACAGGTTCAGACTGTACA	0.413																																						dbGAP											0													203.0	199.0	200.0					2																	179441677		1909	4111	6020	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.64462G>C	2.37:g.179441677C>G	ENSP00000465570:p.Glu21488Gln		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E20561Q	ENST00000591111.1	37	c.61681		2	.	.	.	.	.	.	.	.	.	.	C	15.44	2.834068	0.50951	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66995	-0.24;-0.03;-0.04;-0.06	5.72	5.72	0.89469	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70692	0.3253	M	0.76838	2.35	0.58432	D	0.999997	B;B;B;B	0.31153	0.31;0.31;0.31;0.31	B;B;B;B	0.28638	0.057;0.057;0.057;0.092	T	0.72130	-0.4383	9	0.87932	D	0	.	20.2441	0.98394	0.0:1.0:0.0:0.0	.	14064;14189;14256;21488	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	20561;14064;14256;14189;14062	ENSP00000343764:E20561Q;ENSP00000434586:E14064Q;ENSP00000340554:E14256Q;ENSP00000352154:E14189Q	ENSP00000340554:E14256Q	E	-	1	0	TTN	179149923	1.000000	0.71417	0.975000	0.42487	0.973000	0.67179	6.082000	0.71318	2.865000	0.98341	0.655000	0.94253	GAA	TTN	-	superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,pfscan_Fibronectin_type3	ENSG00000155657		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	209	0.00	0	C	NM_133378		179441677	179441677	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	193	16.09	37	SNP	1.000	G
UBR3	130507	genome.wustl.edu	37	2	170917689	170917689	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:170917689G>C	ENST00000272793.5	+	34	4936	c.4886G>C	c.(4885-4887)tGt>tCt	p.C1629S	UBR3_ENST00000418381.1_Missense_Mutation_p.C1629S|UBR3_ENST00000392631.1_Missense_Mutation_p.C450S			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1629					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						ACTCAGGAATGTGCAATGGTA	0.299																																						dbGAP											0													77.0	81.0	80.0					2																	170917689		2203	4297	6500	-	-	-	SO:0001583	missense	0			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.4886G>C	2.37:g.170917689G>C	ENSP00000272793:p.Cys1629Ser		B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	pfam_Znf_N-recognin,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.C1629S	ENST00000272793.5	37	c.4886		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.180|2.180	-0.387834|-0.387834	0.04932|0.04932	.|.	.|.	ENSG00000144357|ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381;ENST00000392631;ENST00000439681|ENST00000392632	T;T;T;T|.	0.47869|.	0.83;0.83;0.83;0.83|.	6.06|6.06	4.1|4.1	0.47936|0.47936	.|.	0.515035|.	0.23644|.	N|.	0.045982|.	T|T	0.09686|0.09686	0.0238|0.0238	N|N	0.01352|0.01352	-0.895|-0.895	0.25905|0.25905	N|N	0.983303|0.983303	B;B;B|.	0.12630|.	0.0;0.0;0.006|.	B;B;B|.	0.06405|.	0.0;0.002;0.002|.	T|T	0.20438|0.20438	-1.0275|-1.0275	10|5	0.06365|.	T|.	0.9|.	.|.	8.121|8.121	0.30971|0.30971	0.0:0.123:0.5944:0.2826|0.0:0.123:0.5944:0.2826	.|.	1629;450;1658|.	Q6ZT12;Q6ZT12-2;E7EVK3|.	UBR3_HUMAN;.;.|.	S|L	1629;1658;1629;450;329|691	ENSP00000272793:C1629S;ENSP00000396068:C1629S;ENSP00000376408:C450S;ENSP00000389097:C329S|.	ENSP00000272793:C1629S|.	C|V	+|+	2|1	0|0	UBR3|UBR3	170625935|170625935	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.969000|0.969000	0.65631|0.65631	1.740000|1.740000	0.38228|0.38228	1.548000|1.548000	0.49413|0.49413	0.650000|0.650000	0.86243|0.86243	TGT|GTG	UBR3	-	NULL	ENSG00000144357		0.299	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	UBR3	HGNC	protein_coding	OTTHUMT00000255290.2	164	0.00	0	G	NM_172070		170917689	170917689	+1	no_errors	ENST00000272793	ensembl	human	known	69_37n	missense	252	23.64	78	SNP	0.991	C
TTN	7273	genome.wustl.edu	37	2	179605821	179605821	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:179605821C>G	ENST00000591111.1	-	46	11412	c.11188G>C	c.(11188-11190)Gag>Cag	p.E3730Q	TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E3876Q|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.E4047Q|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E3809Q|TTN_ENST00000460472.2_Missense_Mutation_p.E3684Q			Q8WZ42	TITIN_HUMAN	titin	33770					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAGGAGCCTCTGGTGTGGAC	0.488																																						dbGAP											0													144.0	141.0	142.0					2																	179605821		1870	4109	5979	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.11188G>C	2.37:g.179605821C>G	ENSP00000465570:p.Glu3730Gln		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E3876Q	ENST00000591111.1	37	c.11626		2	.	.	.	.	.	.	.	.	.	.	C	9.915	1.210629	0.22289	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.61040	0.18;0.14;0.15	5.65	3.85	0.44370	.	.	.	.	.	T	0.41442	0.1159	N	0.24115	0.695	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.35351	-0.9792	9	0.87932	D	0	.	6.3102	0.21161	0.1317:0.6521:0.1424:0.0738	.	3684;3809;3876	D3DPF9;E7EQE6;E7ET18	.;.;.	Q	3684;3876;3809;3684	ENSP00000434586:E3684Q;ENSP00000340554:E3876Q;ENSP00000352154:E3809Q	ENSP00000340554:E3876Q	E	-	1	0	TTN	179314066	0.003000	0.15002	0.057000	0.19452	0.081000	0.17604	1.219000	0.32479	0.845000	0.35118	-0.211000	0.12701	GAG	TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.488	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	119	0.00	0	C	NM_133378		179605821	179605821	-1	no_errors	ENST00000342175	ensembl	human	known	69_37n	missense	66	22.35	19	SNP	0.008	G
UFL1	23376	genome.wustl.edu	37	6	96997292	96997292	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr6:96997292C>G	ENST00000369278.4	+	14	1591	c.1525C>G	c.(1525-1527)Ctt>Gtt	p.L509V		NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1	509					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										GCACAGACCTCTTAATAAAAC	0.338																																						dbGAP											0													59.0	59.0	59.0					6																	96997292		2202	4299	6501	-	-	-	SO:0001583	missense	0			BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238	ENST00000369278.4:c.1525C>G	6.37:g.96997292C>G	ENSP00000358283:p.Leu509Val		A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	Missense_Mutation	SNP	pfam_E3_UFM1_ligase_1	p.L509V	ENST00000369278.4	37	c.1525	CCDS5034.1	6	.	.	.	.	.	.	.	.	.	.	C	16.93	3.257022	0.59321	.	.	ENSG00000014123	ENST00000369278	T	0.54675	0.56	5.45	3.67	0.42095	.	0.000000	0.85682	D	0.000000	T	0.49558	0.1564	M	0.68593	2.085	0.48762	D	0.999703	D	0.63880	0.993	P	0.55785	0.784	T	0.51317	-0.8721	10	0.40728	T	0.16	-12.9259	9.9488	0.41626	0.0:0.7783:0.0:0.2217	.	509	O94874	UFL1_HUMAN	V	509	ENSP00000358283:L509V	ENSP00000358283:L509V	L	+	1	0	KIAA0776	97104013	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.197000	0.32211	1.318000	0.45170	0.650000	0.86243	CTT	UFL1	-	NULL	ENSG00000014123		0.338	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFL1	HGNC	protein_coding	OTTHUMT00000041557.1	176	0.00	0	C	NM_015323		96997292	96997292	+1	no_errors	ENST00000369278	ensembl	human	known	69_37n	missense	187	11.37	24	SNP	0.999	G
UHRF1	29128	genome.wustl.edu	37	19	4941544	4941544	+	RNA	SNP	G	G	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:4941544G>T	ENST00000592666.1	+	0	1366							Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains 1						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|histone monoubiquitination (GO:0010390)|histone ubiquitination (GO:0016574)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|replication fork (GO:0005657)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|hemi-methylated DNA-binding (GO:0044729)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(2)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		TTGCAGGGATGATTCTCTGAA	0.567																																						dbGAP											0													60.0	65.0	64.0					19																	4941544		1968	4163	6131	-	-	-			0			AF129507	CCDS74262.1, CCDS74263.1	19p13.3	2012-04-20	2008-08-14		ENSG00000034063	ENSG00000276043		"""RING-type (C3HC4) zinc fingers"""	12556	protein-coding gene	gene with protein product		607990				10646863	Standard	NM_001048201		Approved	ICBP90, Np95, FLJ21925, RNF106	uc002mbo.3	Q96T88			19.37:g.4941544G>T			A0JBR2|A8K024|B2RBA9|Q2HIX7|Q8J022|Q9H6S6|Q9P115|Q9P1U7	RNA	SNP	-	NULL	ENST00000592666.1	37	NULL		19	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509073	0.64410	.	.	ENSG00000034063	ENST00000262952;ENST00000455180;ENST00000543616;ENST00000398240	.	.	.	4.58	-2.07	0.07276	.	0.573324	0.18863	N	0.129062	T	0.53690	0.1812	M	0.76574	2.34	0.43657	D	0.996079	P;P	0.36789	0.498;0.57	B;P	0.46339	0.115;0.513	T	0.59526	-0.7438	8	0.72032	D	0.01	-7.2769	5.1154	0.14831	0.2452:0.273:0.4819:0.0	.	277;264	Q2HIX7;Q96T88	.;UHRF1_HUMAN	Y	264;264;264;277	.	ENSP00000262952:D264Y	D	+	1	0	UHRF1	4892544	0.995000	0.38212	0.000000	0.03702	0.296000	0.27459	1.971000	0.40530	-0.427000	0.07350	0.561000	0.74099	GAT	UHRF1	-	-	ENSG00000034063		0.567	UHRF1-006	KNOWN	sequence_error|basic	processed_transcript	UHRF1	HGNC	processed_transcript	OTTHUMT00000450444.1	154	0.00	0	G	NM_001048201		4941544	4941544	+1	no_errors	ENST00000262952	ensembl	human	known	69_37n	rna	77	35.29	42	SNP	0.971	T
UMODL1	89766	genome.wustl.edu	37	21	43505408	43505408	+	Silent	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr21:43505408G>A	ENST00000408910.2	+	4	489	c.489G>A	c.(487-489)gaG>gaA	p.E163E	UMODL1_ENST00000400424.2_Silent_p.E91E|UMODL1_ENST00000400427.1_Silent_p.E91E|UMODL1_ENST00000408989.2_Silent_p.E163E	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	163					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						TAGCTCCAGAGAGGGACCCTG	0.557																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	dbGAP											0													100.0	104.0	103.0					21																	43505408		1907	4129	6036	-	-	-	SO:0001819	synonymous_variant	0				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.489G>A	21.37:g.43505408G>A			C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Silent	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_SEA,pfam_EGF-like_Ca-bd,pfam_EMI_domain,pfam_Whey_acidic_protein_4-diS_core,superfamily_Fibronectin_type3,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_EGF-like_Ca-bd,smart_Fibronectin_type3,smart_Zona_pellucida_Endoglin/CD105,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.E163	ENST00000408910.2	37	c.489	CCDS42936.1	21																																																																																			UMODL1	-	NULL	ENSG00000177398		0.557	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	HGNC	protein_coding	OTTHUMT00000195292.2	121	0.00	0	G			43505408	43505408	+1	no_errors	ENST00000408989	ensembl	human	known	69_37n	silent	131	12.08	18	SNP	0.001	A
UNC13C	440279	genome.wustl.edu	37	15	54919234	54919234	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr15:54919234C>T	ENST00000260323.11	+	32	6568	c.6568C>T	c.(6568-6570)Cag>Tag	p.Q2190*	UNC13C_ENST00000539562.2_Nonsense_Mutation_p.Q111*|UNC13C_ENST00000545554.1_Nonsense_Mutation_p.Q2190*|UNC13C_ENST00000537900.1_Nonsense_Mutation_p.Q2188*	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	2190					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AATACTCTCTCAGAGGACCAG	0.383																																						dbGAP											0													103.0	97.0	99.0					15																	54919234		1864	4096	5960	-	-	-	SO:0001587	stop_gained	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.6568C>T	15.37:g.54919234C>T	ENSP00000260323:p.Gln2190*		Q0P613|Q8ND48|Q96NP3	Nonsense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.Q2190*	ENST00000260323.11	37	c.6568	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	C	46	12.777300	0.99695	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900;ENST00000539562	.	.	.	5.72	5.72	0.89469	.	0.116481	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.8767	0.92341	0.0:1.0:0.0:0.0	.	.	.	.	X	2190;2190;2188;111	.	ENSP00000260323:Q2190X	Q	+	1	0	UNC13C	52706526	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.726000	0.84824	2.700000	0.92200	0.563000	0.77884	CAG	UNC13C	-	NULL	ENSG00000137766		0.383	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	319	0.00	0	C	NM_173166		54919234	54919234	+1	no_errors	ENST00000260323	ensembl	human	known	69_37n	nonsense	283	16.76	57	SNP	1.000	T
UNC80	285175	genome.wustl.edu	37	2	210680045	210680045	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:210680045C>T	ENST00000439458.1	+	9	1345	c.1265C>T	c.(1264-1266)tCa>tTa	p.S422L	UNC80_ENST00000272845.6_Missense_Mutation_p.S422L	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	422					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TCCAAGGTTTCACTGACCAAT	0.408																																						dbGAP											0													143.0	113.0	122.0					2																	210680045		692	1591	2283	-	-	-	SO:0001583	missense	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.1265C>T	2.37:g.210680045C>T	ENSP00000391088:p.Ser422Leu		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.S422L	ENST00000439458.1	37	c.1265	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.118739	0.94385	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.45276	0.9;0.91	5.21	5.21	0.72293	.	.	.	.	.	T	0.52256	0.1723	N	0.24115	0.695	0.80722	D	1	D	0.57899	0.981	D	0.69142	0.962	T	0.55952	-0.8059	9	0.66056	D	0.02	.	18.9418	0.92608	0.0:1.0:0.0:0.0	.	422	Q8N2C7	UNC80_HUMAN	L	422	ENSP00000391088:S422L;ENSP00000272845:S422L	ENSP00000272845:S422L	S	+	2	0	UNC80	210388290	1.000000	0.71417	0.960000	0.40013	0.937000	0.57800	7.622000	0.83099	2.718000	0.92993	0.585000	0.79938	TCA	UNC80	-	NULL	ENSG00000144406		0.408	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		249	0.00	0	C	NM_182587		210680045	210680045	+1	no_errors	ENST00000439458	ensembl	human	known	69_37n	missense	234	18.18	52	SNP	1.000	T
VCPIP1	80124	genome.wustl.edu	37	8	67578968	67578968	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr8:67578968G>C	ENST00000310421.4	-	1	484	c.226C>G	c.(226-228)Cgg>Ggg	p.R76G	C8orf44_ENST00000521889.1_5'Flank|C8orf44-SGK3_ENST00000519289.1_5'Flank|C8orf44_ENST00000519561.1_5'Flank	NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	76					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			TGCTCGTGCCGCTGGCCGCAC	0.642																																					NSCLC(179;265 2915 6144 43644)	dbGAP											0													36.0	34.0	35.0					8																	67578968		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.226C>G	8.37:g.67578968G>C	ENSP00000309031:p.Arg76Gly		Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.R76G	ENST00000310421.4	37	c.226	CCDS6192.1	8	.	.	.	.	.	.	.	.	.	.	G	13.50	2.254877	0.39896	.	.	ENSG00000175073	ENST00000310421	T	0.37915	1.17	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.56601	0.1996	L	0.56769	1.78	0.58432	D	0.999998	D	0.63880	0.993	D	0.74023	0.982	T	0.56269	-0.8007	10	0.87932	D	0	-11.1911	15.1009	0.72276	0.0:0.0:0.8584:0.1416	.	76	Q96JH7	VCIP1_HUMAN	G	76	ENSP00000309031:R76G	ENSP00000309031:R76G	R	-	1	2	VCPIP1	67741522	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.212000	0.58514	2.814000	0.96858	0.655000	0.94253	CGG	VCPIP1	-	NULL	ENSG00000175073		0.642	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCPIP1	HGNC	protein_coding	OTTHUMT00000379227.1	74	0.00	0	G			67578968	67578968	-1	no_errors	ENST00000310421	ensembl	human	known	69_37n	missense	111	18.71	26	SNP	1.000	C
VPS13C	54832	genome.wustl.edu	37	15	62170937	62170937	+	Missense_Mutation	SNP	C	C	G	rs562241298		TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr15:62170937C>G	ENST00000261517.5	-	74	10084	c.10011G>C	c.(10009-10011)ttG>ttC	p.L3337F	VPS13C_ENST00000558919.1_5'UTR|VPS13C_ENST00000249837.3_Missense_Mutation_p.L3294F|VPS13C_ENST00000395898.3_Missense_Mutation_p.L3294F|VPS13C_ENST00000395896.4_Missense_Mutation_p.L3337F	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						AAGACAAACTCAAATGCAACT	0.333																																						dbGAP											0													48.0	43.0	45.0					15																	62170937		2202	4299	6501	-	-	-	SO:0001583	missense	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.10011G>C	15.37:g.62170937C>G	ENSP00000261517:p.Leu3337Phe			Missense_Mutation	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.L3337F	ENST00000261517.5	37	c.10011	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	C	16.86	3.240055	0.58995	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	D;D;D	0.82893	-1.66;-1.66;-1.66	5.61	2.29	0.28610	.	0.000000	0.64402	D	0.000001	D	0.86851	0.6032	M	0.64260	1.97	0.58432	D	0.999999	D;D;D;D	0.76494	0.987;0.999;0.994;0.989	D;D;D;D	0.72338	0.949;0.977;0.949;0.917	D	0.85151	0.0986	10	0.66056	D	0.02	.	7.1062	0.25364	0.1243:0.6538:0.0:0.2219	.	3294;3337;3294;3337	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	F	3294;3337;3337;3337	ENSP00000249837:L3294F;ENSP00000261517:L3337F;ENSP00000379233:L3337F	ENSP00000249837:L3294F	L	-	3	2	VPS13C	59958229	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	1.205000	0.32308	0.745000	0.32763	-0.145000	0.13849	TTG	VPS13C	-	NULL	ENSG00000129003		0.333	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	150	0.00	0	C	NM_017684		62170937	62170937	-1	no_errors	ENST00000261517	ensembl	human	known	69_37n	missense	112	12.50	16	SNP	1.000	G
VPS13C	54832	genome.wustl.edu	37	15	62204183	62204183	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr15:62204183C>T	ENST00000261517.5	-	63	8644	c.8571G>A	c.(8569-8571)atG>atA	p.M2857I	VPS13C_ENST00000249837.3_Missense_Mutation_p.M2814I|VPS13C_ENST00000395898.3_Missense_Mutation_p.M2814I|VPS13C_ENST00000395896.4_Missense_Mutation_p.M2857I|RN7SL613P_ENST00000584412.1_RNA	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TGAAACTGCTCATTTTGATGC	0.373																																						dbGAP											0													114.0	109.0	111.0					15																	62204183		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.8571G>A	15.37:g.62204183C>T	ENSP00000261517:p.Met2857Ile			Missense_Mutation	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.M2857I	ENST00000261517.5	37	c.8571	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	C	22.6	4.310681	0.81358	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.30182	1.54;1.54;1.54	5.8	4.88	0.63580	Vacuolar protein sorting-associated protein (1);	0.081685	0.85682	D	0.000000	T	0.49864	0.1582	M	0.73598	2.24	0.80722	D	1	P;P;P;P;P	0.49961	0.864;0.723;0.93;0.93;0.872	P;P;P;P;P	0.56865	0.561;0.458;0.561;0.729;0.808	T	0.49103	-0.8974	10	0.35671	T	0.21	.	14.7328	0.69393	0.0:0.9305:0.0:0.0695	.	2857;2814;2857;2814;2857	F5GZG8;Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;.;VP13C_HUMAN	I	2814;2857;2857;2857	ENSP00000249837:M2814I;ENSP00000261517:M2857I;ENSP00000379233:M2857I	ENSP00000249837:M2814I	M	-	3	0	VPS13C	59991475	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.595000	0.67563	1.434000	0.47414	0.561000	0.74099	ATG	VPS13C	-	pfam_VPSAP	ENSG00000129003		0.373	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	225	0.00	0	C	NM_017684		62204183	62204183	-1	no_errors	ENST00000261517	ensembl	human	known	69_37n	missense	239	29.20	99	SNP	1.000	T
VPS33A	65082	genome.wustl.edu	37	12	122723195	122723195	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr12:122723195G>C	ENST00000267199.4	-	10	1353	c.1241C>G	c.(1240-1242)tCc>tGc	p.S414C	RP11-512M8.5_ENST00000535844.1_Missense_Mutation_p.S375C	NM_022916.4	NP_075067.2	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33 homolog A (S. cerevisiae)	414					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of developmental pigmentation (GO:0048070)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	28	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		ATTACACACGGATTGGAGGCA	0.363																																						dbGAP											0													179.0	170.0	173.0					12																	122723195		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026048	CCDS9231.1	12q24.31	2008-06-23	2006-04-04		ENSG00000139719	ENSG00000139719			18179	protein-coding gene	gene with protein product		610034	"""vacuolar protein sorting 33A (yeast)"""			11250079	Standard	NM_022916		Approved		uc001ucd.3	Q96AX1	OTTHUMG00000168920	ENST00000267199.4:c.1241C>G	12.37:g.122723195G>C	ENSP00000267199:p.Ser414Cys		Q547V4|Q9H5Q0	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.S414C	ENST00000267199.4	37	c.1241	CCDS9231.1	12	.	.	.	.	.	.	.	.	.	.	G	11.12	1.545216	0.27652	.	.	ENSG00000139719	ENST00000267199	T	0.78816	-1.21	5.4	4.51	0.55191	.	0.000000	0.85682	D	0.000000	T	0.71643	0.3364	L	0.43701	1.375	0.80722	D	1	B	0.21688	0.059	B	0.28638	0.092	T	0.65813	-0.6077	10	0.25751	T	0.34	-22.3379	14.2529	0.66031	0.072:0.0:0.928:0.0	.	414	Q96AX1	VP33A_HUMAN	C	414	ENSP00000267199:S414C	ENSP00000446319:S375C	S	-	2	0	VPS33A	121289148	1.000000	0.71417	0.955000	0.39395	0.568000	0.35870	9.785000	0.99042	1.277000	0.44412	0.557000	0.71058	TCC	VPS33A	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000139719		0.363	VPS33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS33A	HGNC	protein_coding	OTTHUMT00000401607.2	213	0.00	0	G			122723195	122723195	-1	no_errors	ENST00000267199	ensembl	human	known	69_37n	missense	173	13.07	26	SNP	1.000	C
XRCC6	2547	genome.wustl.edu	37	22	42032677	42032677	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr22:42032677G>C	ENST00000359308.4	+	4	1147	c.492G>C	c.(490-492)aaG>aaC	p.K164N	XRCC6_ENST00000428575.2_Missense_Mutation_p.K31N|XRCC6_ENST00000360079.3_Missense_Mutation_p.K164N|XRCC6_ENST00000405878.1_Missense_Mutation_p.K164N|XRCC6_ENST00000402580.3_Missense_Mutation_p.K123N|XRCC6_ENST00000405506.1_Missense_Mutation_p.K114N			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	164					brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						TGAGTCATAAGAGGATCATGC	0.517								Non-homologous end-joining																														dbGAP											0													93.0	85.0	88.0					22																	42032677		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.492G>C	22.37:g.42032677G>C	ENSP00000352257:p.Lys164Asn		B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	pirsf_DNA_helicase_ATP-dep_Ku70,pfam_Ku_N,pfam_DNA_helicase_ATP-dep_Ku,pfam_Ku_C,pfam_SAP_DNA-bd,superfamily_SPOC-like,smart_DNA_helicase_ATP-dep_Ku,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd,tigrfam_DNA_helicase_ATP-dep_Ku70	p.K164N	ENST00000359308.4	37	c.492	CCDS14021.1	22	.	.	.	.	.	.	.	.	.	.	G	23.7	4.452812	0.84209	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000428575;ENST00000359308;ENST00000405878;ENST00000402409;ENST00000405506	.	.	.	5.71	5.71	0.89125	Ku70/Ku80, N-terminal alpha/beta (1);	0.044464	0.85682	D	0.000000	D	0.83580	0.5285	M	0.88906	2.99	0.80722	D	1	D;D;P;D	0.65815	0.983;0.995;0.909;0.983	D;D;P;D	0.69654	0.962;0.965;0.711;0.94	D	0.85438	0.1153	9	0.54805	T	0.06	-18.7188	15.0516	0.71877	0.0696:0.0:0.9304:0.0	.	114;164;123;164	B1AHC9;B1AHC7;B1AHC8;P12956	.;.;.;XRCC6_HUMAN	N	164;123;31;164;164;164;114	.	ENSP00000352257:K164N	K	+	3	2	XRCC6	40362623	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.241000	0.58707	2.709000	0.92574	0.655000	0.94253	AAG	XRCC6	-	pirsf_DNA_helicase_ATP-dep_Ku70,pfam_Ku_N,tigrfam_DNA_helicase_ATP-dep_Ku70	ENSG00000196419		0.517	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	XRCC6	HGNC	protein_coding	OTTHUMT00000321688.1	184	0.00	0	G	NM_001469		42032677	42032677	+1	no_errors	ENST00000359308	ensembl	human	known	69_37n	missense	114	17.39	24	SNP	1.000	C
YEATS2	55689	genome.wustl.edu	37	3	183508603	183508603	+	Missense_Mutation	SNP	G	G	T	rs371883057		TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr3:183508603G>T	ENST00000305135.5	+	21	3127	c.2932G>T	c.(2932-2934)Gtg>Ttg	p.V978L		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	978					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			AATGGCTCCCGTGTCTTCATC	0.572																																						dbGAP											0													91.0	97.0	95.0					3																	183508603		2054	4195	6249	-	-	-	SO:0001583	missense	0			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.2932G>T	3.37:g.183508603G>T	ENSP00000306983:p.Val978Leu		A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.V978L	ENST00000305135.5	37	c.2932	CCDS43175.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	2.499|2.499	-0.315588|-0.315588	0.05422|0.05422	.|.	.|.	ENSG00000163872|ENSG00000163872	ENST00000432781|ENST00000421660;ENST00000305135	.|T	.|0.23147	.|1.92	5.67|5.67	-5.65|-5.65	0.02459|0.02459	.|.	.|1.211720	.|0.05471	.|N	.|0.553053	T|T	0.16342|0.16342	0.0393|0.0393	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	.|B;B	.|0.10296	.|0.0;0.003	.|B;B	.|0.10450	.|0.002;0.005	T|T	0.25222|0.25222	-1.0138|-1.0138	5|10	.|0.37606	.|T	.|0.19	2.4812|2.4812	15.1716|15.1716	0.72878|0.72878	0.4571:0.0:0.5429:0.0|0.4571:0.0:0.5429:0.0	.|.	.|140;978	.|Q8N5H6;Q9ULM3	.|.;YETS2_HUMAN	L|L	163|978	.|ENSP00000306983:V978L	.|ENSP00000306983:V978L	R|V	+|+	2|1	0|0	YEATS2|YEATS2	184991297|184991297	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	0.001000|0.001000	0.13038|0.13038	-1.412000|-1.412000	0.02030|0.02030	-1.931000|-1.931000	0.00510|0.00510	CGT|GTG	YEATS2	-	NULL	ENSG00000163872		0.572	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	HGNC	protein_coding	OTTHUMT00000346507.2	114	0.00	0	G	NM_018023		183508603	183508603	+1	no_errors	ENST00000305135	ensembl	human	known	69_37n	missense	120	30.29	53	SNP	0.000	T
ZC3H6	376940	genome.wustl.edu	37	2	113089587	113089587	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr2:113089587C>T	ENST00000409871.1	+	12	3493	c.3092C>T	c.(3091-3093)tCa>tTa	p.S1031L	AC115115.2_ENST00000607612.1_RNA|ZC3H6_ENST00000343936.4_Missense_Mutation_p.S1031L	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	1031							metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						CTCTCTTCCTCAGCTGGCCTT	0.507																																						dbGAP											0													67.0	62.0	63.0					2																	113089587		1909	4120	6029	-	-	-	SO:0001583	missense	0			AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.3092C>T	2.37:g.113089587C>T	ENSP00000386764:p.Ser1031Leu		A9JR71|Q6ZW96	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.S1031L	ENST00000409871.1	37	c.3092	CCDS46393.1	2	.	.	.	.	.	.	.	.	.	.	C	14.48	2.548979	0.45383	.	.	ENSG00000188177	ENST00000409871;ENST00000343936	T;T	0.19669	2.13;2.13	5.33	5.33	0.75918	.	0.584636	0.16441	N	0.214290	T	0.23846	0.0577	L	0.58101	1.795	0.46279	D	0.998964	B	0.33694	0.421	B	0.25140	0.058	T	0.05954	-1.0854	10	0.87932	D	0	-3.0228	16.5177	0.84305	0.0:1.0:0.0:0.0	.	1031	P61129	ZC3H6_HUMAN	L	1031	ENSP00000386764:S1031L;ENSP00000340298:S1031L	ENSP00000340298:S1031L	S	+	2	0	ZC3H6	112806058	0.999000	0.42202	1.000000	0.80357	0.841000	0.47740	7.291000	0.78721	2.473000	0.83533	0.591000	0.81541	TCA	ZC3H6	-	NULL	ENSG00000188177		0.507	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H6	HGNC	protein_coding	OTTHUMT00000330551.1	197	0.00	0	C	NM_198581		113089587	113089587	+1	no_errors	ENST00000343936	ensembl	human	known	69_37n	missense	188	10.43	22	SNP	0.999	T
ZFPM2	23414	genome.wustl.edu	37	8	106814537	106814537	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr8:106814537G>T	ENST00000407775.2	+	8	2477	c.2227G>T	c.(2227-2229)Gag>Tag	p.E743*	RP11-152P17.2_ENST00000520594.1_RNA|ZFPM2_ENST00000520492.1_Nonsense_Mutation_p.E611*|RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000524045.2_RNA|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000378472.4_Nonsense_Mutation_p.E474*|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000517361.1_Nonsense_Mutation_p.E611*	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	743					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AAAGATGTATGAGATGTGCCT	0.522																																						dbGAP											0													49.0	48.0	48.0					8																	106814537		2079	4221	6300	-	-	-	SO:0001587	stop_gained	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2227G>T	8.37:g.106814537G>T	ENSP00000384179:p.Glu743*		Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E743*	ENST00000407775.2	37	c.2227	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	G	39	7.590559	0.98378	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	.	.	.	5.72	5.72	0.89469	.	0.043766	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	19.88	0.96892	0.0:0.0:1.0:0.0	.	.	.	.	X	743;611;611;474	.	ENSP00000367733:E474X	E	+	1	0	ZFPM2	106883713	1.000000	0.71417	0.995000	0.50966	0.984000	0.73092	9.869000	0.99810	2.708000	0.92522	0.561000	0.74099	GAG	ZFPM2	-	NULL	ENSG00000169946		0.522	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	114	0.00	0	G			106814537	106814537	+1	no_errors	ENST00000407775	ensembl	human	known	69_37n	nonsense	107	12.30	15	SNP	1.000	T
ZNF143	7702	genome.wustl.edu	37	11	9516249	9516249	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr11:9516249G>C	ENST00000396602.2	+	8	821	c.702G>C	c.(700-702)gaG>gaC	p.E234D	ZNF143_ENST00000299606.2_Missense_Mutation_p.E206D|ZNF143_ENST00000396604.1_Missense_Mutation_p.E233D|ZNF143_ENST00000530463.1_Missense_Mutation_p.E233D|ZNF143_ENST00000396597.3_Missense_Mutation_p.E203D	NM_001282656.1|NM_001282657.1|NM_003442.5	NP_001269585.1|NP_001269586.1|NP_003433.3	P52747	ZN143_HUMAN	zinc finger protein 143	234					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	13				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		AGAGTGGAGAGAAGGCATTTC	0.313																																						dbGAP											0													93.0	92.0	92.0					11																	9516249		2201	4294	6495	-	-	-	SO:0001583	missense	0			U09850	CCDS7799.2, CCDS60720.1, CCDS60721.1	11p15.4	2013-01-08	2006-06-13		ENSG00000166478	ENSG00000166478		"""Zinc fingers, C2H2-type"""	12928	protein-coding gene	gene with protein product		603433	"""zinc finger protein 143 (clone pHZ-1)"""				Standard	NM_003442		Approved	SBF, pHZ-1, STAF	uc001mhr.3	P52747	OTTHUMG00000149922	ENST00000396602.2:c.702G>C	11.37:g.9516249G>C	ENSP00000379847:p.Glu234Asp		A8K518|B4DLY5|E7ER34|O75559|Q8WUK9	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E234D	ENST00000396602.2	37	c.702	CCDS7799.2	11	.	.	.	.	.	.	.	.	.	.	G	13.82	2.352488	0.41700	.	.	ENSG00000166478	ENST00000396604;ENST00000396602;ENST00000530463;ENST00000396597;ENST00000299606	T;T;T;T;T	0.11385	2.78;2.79;2.78;2.81;2.84	6.06	-0.521	0.11931	.	0.000000	0.64402	D	0.000002	T	0.08179	0.0204	L	0.38175	1.15	0.54753	D	0.999989	P;B;B	0.35872	0.525;0.39;0.39	B;B;B	0.36092	0.217;0.076;0.076	T	0.26849	-1.0091	10	0.33940	T	0.23	.	9.8791	0.41222	0.4427:0.0:0.5573:0.0	.	203;233;234	P52747-2;E7ER34;P52747	.;.;ZN143_HUMAN	D	233;234;233;203;206	ENSP00000379849:E233D;ENSP00000379847:E234D;ENSP00000432154:E233D;ENSP00000379843:E203D;ENSP00000299606:E206D	ENSP00000299606:E206D	E	+	3	2	ZNF143	9472825	0.977000	0.34250	0.985000	0.45067	0.988000	0.76386	0.147000	0.16202	-0.363000	0.08101	0.655000	0.94253	GAG	ZNF143	-	NULL	ENSG00000166478		0.313	ZNF143-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF143	HGNC	protein_coding	OTTHUMT00000313921.2	315	0.00	0	G	NM_003442		9516249	9516249	+1	no_errors	ENST00000396602	ensembl	human	known	69_37n	missense	318	29.65	134	SNP	1.000	C
ZNF281	23528	genome.wustl.edu	37	1	200377516	200377516	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:200377516C>G	ENST00000294740.3	-	2	1442	c.1318G>C	c.(1318-1320)Gaa>Caa	p.E440Q	ZNF281_ENST00000367352.3_Missense_Mutation_p.E404Q|ZNF281_ENST00000367353.1_Missense_Mutation_p.E440Q	NM_001281293.1|NM_001281294.1|NM_012482.4	NP_001268222.1|NP_001268223.1|NP_036614.1	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	440					embryonic body morphogenesis (GO:0010172)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|endometrium(3)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	27						GTAGGCATTTCTACTGAGTAA	0.368																																						dbGAP											0													127.0	123.0	124.0					1																	200377516		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF125158	CCDS1402.1, CCDS60384.1	1q32.1	2012-08-08			ENSG00000162702	ENSG00000162702		"""Zinc fingers, C2H2-type"""	13075	protein-coding gene	gene with protein product						10448078	Standard	NM_012482		Approved	ZBP-99	uc001gve.3	Q9Y2X9	OTTHUMG00000035724	ENST00000294740.3:c.1318G>C	1.37:g.200377516C>G	ENSP00000294740:p.Glu440Gln		A6NF48|B3KMX2|Q5RKW5|Q9NY92	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E440Q	ENST00000294740.3	37	c.1318	CCDS1402.1	1	.	.	.	.	.	.	.	.	.	.	C	16.34	3.095008	0.56075	.	.	ENSG00000162702	ENST00000294740;ENST00000367353;ENST00000367352;ENST00000537759	T;T;T	0.08807	3.07;3.07;3.05	5.7	5.7	0.88788	.	0.109581	0.64402	D	0.000006	T	0.14570	0.0352	L	0.52573	1.65	0.44469	D	0.997409	P;P	0.49961	0.93;0.838	P;B	0.44860	0.462;0.446	T	0.00269	-1.1861	10	0.72032	D	0.01	-14.078	19.8273	0.96622	0.0:1.0:0.0:0.0	.	404;440	A6NF48;Q9Y2X9	.;ZN281_HUMAN	Q	440;440;404;145	ENSP00000294740:E440Q;ENSP00000356322:E440Q;ENSP00000356321:E404Q	ENSP00000294740:E440Q	E	-	1	0	ZNF281	198644139	1.000000	0.71417	0.983000	0.44433	0.991000	0.79684	4.595000	0.61048	2.665000	0.90641	0.655000	0.94253	GAA	ZNF281	-	NULL	ENSG00000162702		0.368	ZNF281-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF281	HGNC	protein_coding	OTTHUMT00000086879.2	497	0.00	0	C	NM_012482		200377516	200377516	-1	no_errors	ENST00000294740	ensembl	human	known	69_37n	missense	618	10.82	75	SNP	1.000	G
ZNF334	55713	genome.wustl.edu	37	20	45132914	45132914	+	Missense_Mutation	SNP	G	G	C	rs267605963		TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr20:45132914G>C	ENST00000347606.4	-	4	362	c.180C>G	c.(178-180)ttC>ttG	p.F60L	ZNF334_ENST00000457685.2_Missense_Mutation_p.F22L|ZNF334_ENST00000593880.1_Missense_Mutation_p.F83L	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	60	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				GCTCCAATTTGAAAATCACAT	0.398																																						dbGAP											0													115.0	94.0	101.0					20																	45132914		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.180C>G	20.37:g.45132914G>C	ENSP00000255129:p.Phe60Leu		Q5T6U2|Q9NVW4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F60L	ENST00000347606.4	37	c.180	CCDS33480.1	20	.	.	.	.	.	.	.	.	.	.	G	2.952	-0.216508	0.06101	.	.	ENSG00000198185	ENST00000457685;ENST00000347606	T;T	0.45276	5.78;0.9	3.14	1.01	0.19927	Krueppel-associated box (3);	.	.	.	.	T	0.23926	0.0579	L	0.31065	0.9	0.20563	N	0.999884	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.08055	0.003;0.003;0.003	T	0.26326	-1.0106	9	0.13108	T	0.6	.	3.9848	0.09511	0.1248:0.0:0.447:0.4282	.	22;60;83	B3KQ93;Q9HCZ1;Q8N3P8	.;ZN334_HUMAN;.	L	22;60	ENSP00000402582:F22L;ENSP00000255129:F60L	ENSP00000255129:F60L	F	-	3	2	ZNF334	44566321	0.000000	0.05858	0.908000	0.35775	0.932000	0.56968	-0.339000	0.07832	0.143000	0.18926	0.591000	0.81541	TTC	ZNF334	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000198185		0.398	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF334	HGNC	protein_coding	OTTHUMT00000079575.1	344	0.00	0	G			45132914	45132914	-1	no_errors	ENST00000347606	ensembl	human	known	69_37n	missense	592	13.66	94	SNP	0.479	C
ZNF35	7584	genome.wustl.edu	37	3	44692688	44692688	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr3:44692688C>G	ENST00000396056.2	+	2	364	c.129C>G	c.(127-129)atC>atG	p.I43M	RP11-944L7.4_ENST00000457331.1_RNA|ZNF35_ENST00000399560.2_Missense_Mutation_p.I43M|ZNF35_ENST00000453164.1_Missense_Mutation_p.I43M|ZNF35_ENST00000296092.3_Missense_Mutation_p.I43M|ZNF35_ENST00000542250.1_5'UTR	NM_003420.3	NP_003411.3	P13682	ZNF35_HUMAN	zinc finger protein 35	43	Globular domain.				cellular response to retinoic acid (GO:0071300)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cell (GO:0005623)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(3)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	12		Ovarian(412;0.0228)		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)		CCGAGAACATCAAAGTCTGGG	0.547																																						dbGAP											0													67.0	67.0	67.0					3																	44692688		2203	4300	6503	-	-	-	SO:0001583	missense	0			X07289	CCDS2718.2	3p21.32	2013-01-08	2006-05-11		ENSG00000169981	ENSG00000169981		"""Zinc fingers, C2H2-type"""	13099	protein-coding gene	gene with protein product		194533	"""zinc finger protein 35 (clone HF.10)"""			2108922, 1572646	Standard	NM_003420		Approved	HF.10, HF10, Zfp105	uc003cnq.3	P13682	OTTHUMG00000133091	ENST00000396056.2:c.129C>G	3.37:g.44692688C>G	ENSP00000379368:p.Ile43Met		B2RBU6|Q53Y54|Q96D01	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I43M	ENST00000396056.2	37	c.129	CCDS2718.2	3	.	.	.	.	.	.	.	.	.	.	C	11.86	1.764985	0.31228	.	.	ENSG00000169981	ENST00000396056;ENST00000415571;ENST00000432115;ENST00000296092;ENST00000399560;ENST00000453164	T	0.10288	2.89	4.27	3.39	0.38822	.	1.089820	0.07205	N	0.858180	T	0.08846	0.0219	L	0.27053	0.805	0.21762	N	0.999551	B	0.27068	0.167	B	0.23716	0.048	T	0.13629	-1.0502	10	0.54805	T	0.06	0.0429	7.3712	0.26802	0.0:0.8839:0.0:0.1161	.	43	P13682	ZNF35_HUMAN	M	43	ENSP00000379368:I43M	ENSP00000296092:I43M	I	+	3	3	ZNF35	44667692	0.000000	0.05858	0.005000	0.12908	0.273000	0.26683	0.730000	0.26043	2.383000	0.81215	0.563000	0.77884	ATC	ZNF35	-	NULL	ENSG00000169981		0.547	ZNF35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF35	HGNC	protein_coding	OTTHUMT00000256749.4	234	0.00	0	C	NM_003420		44692688	44692688	+1	no_errors	ENST00000396056	ensembl	human	known	69_37n	missense	123	18.00	27	SNP	0.002	G
ZNF462	58499	genome.wustl.edu	37	9	109688576	109688576	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr9:109688576G>A	ENST00000277225.5	+	3	2672	c.2383G>A	c.(2383-2385)Gaa>Aaa	p.E795K	ZNF462_ENST00000441147.2_5'Flank|ZNF462_ENST00000457913.1_Missense_Mutation_p.E795K			Q96JM2	ZN462_HUMAN	zinc finger protein 462	795					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						CACCCTTTCTGAAGATGAAGA	0.458																																						dbGAP											0													70.0	69.0	69.0					9																	109688576		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.2383G>A	9.37:g.109688576G>A	ENSP00000277225:p.Glu795Lys		Q5T0T4|Q8N408	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E795K	ENST00000277225.5	37	c.2383	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152694	0.57259	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.07021	3.23;3.67	5.87	5.87	0.94306	.	0.045686	0.85682	D	0.000000	T	0.12305	0.0299	N	0.24115	0.695	0.80722	D	1	D;P	0.56035	0.974;0.915	P;B	0.50659	0.647;0.23	T	0.10520	-1.0626	9	.	.	.	.	20.2227	0.98327	0.0:0.0:1.0:0.0	.	795;795	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	K	795	ENSP00000277225:E795K;ENSP00000414570:E795K	.	E	+	1	0	ZNF462	108728397	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.294000	0.96088	2.778000	0.95560	0.650000	0.86243	GAA	ZNF462	-	NULL	ENSG00000148143		0.458	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	173	0.00	0	G	NM_021224		109688576	109688576	+1	no_errors	ENST00000457913	ensembl	human	known	69_37n	missense	95	28.57	38	SNP	1.000	A
ZNF625	90589	genome.wustl.edu	37	19	12256762	12256762	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:12256762G>A	ENST00000355738.1	-	4	620	c.271C>T	c.(271-273)Cac>Tac	p.H91Y	ZNF625_ENST00000439556.2_Missense_Mutation_p.H157Y|ZNF625-ZNF20_ENST00000430024.1_Intron|ZNF625_ENST00000542938.1_Missense_Mutation_p.H91Y|ZNF625_ENST00000455799.1_3'UTR|CTC-359D24.3_ENST00000472362.1_RNA			Q96I27	ZN625_HUMAN	zinc finger protein 625	91					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|large_intestine(6)|lung(4)|skin(2)	14						CCCCCAGTGTGAGCCCATTCA	0.433																																						dbGAP											0													134.0	122.0	126.0					19																	12256762		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007868	CCDS12269.1, CCDS12269.2	19p13.2	2013-01-08			ENSG00000257591	ENSG00000257591		"""Zinc fingers, C2H2-type"", ""-"""	30571	protein-coding gene	gene with protein product						12477932	Standard	NM_145233		Approved		uc010dyo.2	Q96I27	OTTHUMG00000156407	ENST00000355738.1:c.271C>T	19.37:g.12256762G>A	ENSP00000347977:p.His91Tyr		A4FU45|I3L0E9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H157Y	ENST00000355738.1	37	c.469		19	.	.	.	.	.	.	.	.	.	.	G	14.99	2.701749	0.48307	.	.	ENSG00000257591	ENST00000542938;ENST00000355738;ENST00000439556	T;T;T	0.67523	-0.27;-0.27;-0.27	0.856	0.856	0.19019	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.81992	0.4940	M	0.92268	3.29	0.30827	N	0.737154	D;D	0.62365	0.991;0.991	D;P	0.67725	0.953;0.807	T	0.77343	-0.2623	9	0.72032	D	0.01	.	7.5453	0.27764	0.0:0.0:1.0:0.0	.	91;91	A8K8U0;Q96I27	.;ZN625_HUMAN	Y	91;91;157	ENSP00000438436:H91Y;ENSP00000347977:H91Y;ENSP00000394380:H157Y	ENSP00000347977:H91Y	H	-	1	0	AC022415.5	12117762	0.999000	0.42202	0.019000	0.16419	0.745000	0.42441	3.814000	0.55643	0.765000	0.33221	0.313000	0.20887	CAC	ZNF625	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000257591		0.433	ZNF625-201	KNOWN	basic	protein_coding	ZNF625	Clone_based_vega_gene	protein_coding		313	0.32	1	G	NM_145233		12256762	12256762	-1	no_errors	ENST00000439556	ensembl	human	known	69_37n	missense	198	12.72	29	SNP	0.991	A
ZNF681	148213	genome.wustl.edu	37	19	23937695	23937695	+	Silent	SNP	C	C	T			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr19:23937695C>T	ENST00000402377.3	-	3	297	c.156G>A	c.(154-156)ctG>ctA	p.L52L	ZNF681_ENST00000395385.3_5'UTR	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	52	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				GACAGGTGATCAGGTCTGGCT	0.398																																						dbGAP											0													106.0	102.0	103.0					19																	23937695		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.156G>A	19.37:g.23937695C>T			B3KVF7	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L52	ENST00000402377.3	37	c.156	CCDS12414.2	19																																																																																			ZNF681	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000196172		0.398	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF681	HGNC	protein_coding	OTTHUMT00000320248.2	513	0.00	0	C	NM_138286		23937695	23937695	-1	no_errors	ENST00000402377	ensembl	human	known	69_37n	silent	387	12.61	56	SNP	0.160	T
ZRANB2	9406	genome.wustl.edu	37	1	71544146	71544146	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HM-01A-12D-A135-09	TCGA-C8-A1HM-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2f9165d-9fe7-492e-9b4c-3cb4200c6e85	96166aa5-1642-4a59-a88e-9b9f9291b453	g.chr1:71544146C>A	ENST00000370920.3	-	3	513	c.212G>T	c.(211-213)tGt>tTt	p.C71F	ZRANB2_ENST00000254821.6_Missense_Mutation_p.C71F|ZRANB2-AS2_ENST00000596952.1_RNA|ZRANB2-AS2_ENST00000455406.1_RNA	NM_203350.2	NP_976225.1	O95218	ZRAB2_HUMAN	zinc finger, RAN-binding domain containing 2	71					mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|stomach(1)	15						ATACGTTTTACATTGCCAGTC	0.373																																						dbGAP											0													98.0	102.0	100.0					1																	71544146		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF065391	CCDS659.1, CCDS660.1	1p31	2008-02-05	2006-06-28	2006-06-28	ENSG00000132485	ENSG00000132485		"""Zinc fingers, RAN-binding domain containing"""	13058	protein-coding gene	gene with protein product		604347	"""zinc finger protein 265"""	ZNF265		9931435	Standard	NM_005455		Approved	ZIS, ZIS1, ZIS2	uc001dft.3	O95218	OTTHUMG00000009660	ENST00000370920.3:c.212G>T	1.37:g.71544146C>A	ENSP00000359958:p.Cys71Phe		D3DQ75|Q53GS3|Q59F92|Q5VV33|Q5VV34|Q8IXN6|Q9UP63	Missense_Mutation	SNP	pfam_Znf_RanBP2,smart_Znf_RanBP2,pirsf_UCP037956_Znf_RanB2,pfscan_Znf_RanBP2	p.C71F	ENST00000370920.3	37	c.212	CCDS659.1	1	.	.	.	.	.	.	.	.	.	.	C	16.71	3.198596	0.58126	.	.	ENSG00000132485	ENST00000370920;ENST00000254821	D;D	0.99797	-6.79;-6.79	5.53	5.53	0.82687	Zinc finger, RanBP2-type (4);	0.000000	0.85682	D	0.000000	D	0.99900	0.9952	H	0.97732	4.065	0.80722	D	1	D;D	0.89917	0.991;1.0	D;D	0.83275	0.99;0.996	D	0.96364	0.9268	10	0.87932	D	0	.	19.4671	0.94946	0.0:1.0:0.0:0.0	.	71;71	O95218;O95218-2	ZRAB2_HUMAN;.	F	71	ENSP00000359958:C71F;ENSP00000254821:C71F	ENSP00000254821:C71F	C	-	2	0	ZRANB2	71316734	1.000000	0.71417	1.000000	0.80357	0.155000	0.21991	7.463000	0.80869	2.614000	0.88457	0.467000	0.42956	TGT	ZRANB2	-	pfam_Znf_RanBP2,smart_Znf_RanBP2,pirsf_UCP037956_Znf_RanB2,pfscan_Znf_RanBP2	ENSG00000132485		0.373	ZRANB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB2	HGNC	protein_coding	OTTHUMT00000026636.1	194	0.00	0	C	NM_203350		71544146	71544146	-1	no_errors	ENST00000370920	ensembl	human	known	69_37n	missense	120	27.71	46	SNP	1.000	A
