#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACAP1	9744	genome.wustl.edu	37	17	7247037	7247037	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr17:7247037G>C	ENST00000158762.3	+	7	747	c.541G>C	c.(541-543)Gag>Cag	p.E181Q	ACAP1_ENST00000573893.1_3'UTR	NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1	181	BAR.|Required for formation of endosomal tubules when overexpressed with PIP5K1C.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						CAACGTGATTGAGGACAAGAG	0.542																																						dbGAP											0													275.0	275.0	275.0					17																	7247037		2203	4300	6503	-	-	-	SO:0001583	missense	0			D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.541G>C	17.37:g.7247037G>C	ENSP00000158762:p.Glu181Gln		Q53XN9	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_ArfGAP,prints_ArfGAP	p.E181Q	ENST00000158762.3	37	c.541	CCDS11101.1	17	.	.	.	.	.	.	.	.	.	.	G	2.892	-0.229400	0.06022	.	.	ENSG00000072818	ENST00000158762	T	0.03663	3.85	4.39	3.34	0.38264	.	0.064020	0.64402	D	0.000014	T	0.01353	0.0044	N	0.01789	-0.72	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.45425	-0.9262	10	0.02654	T	1	.	10.3686	0.44039	0.0:0.3114:0.6886:0.0	.	181	Q15027	ACAP1_HUMAN	Q	181	ENSP00000158762:E181Q	ENSP00000158762:E181Q	E	+	1	0	ACAP1	7187761	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.059000	0.49947	2.451000	0.82905	0.563000	0.77884	GAG	ACAP1	-	NULL	ENSG00000072818		0.542	ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAP1	HGNC	protein_coding	OTTHUMT00000220049.4	164	0.60	1	G	NM_014716		7247037	7247037	+1	no_errors	ENST00000158762	ensembl	human	known	69_37n	missense	37	52.50	42	SNP	1.000	C
ACRC	93953	genome.wustl.edu	37	X	70832261	70832261	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chrX:70832261G>C	ENST00000373695.1	+	11	2344	c.1807G>C	c.(1807-1809)Gat>Cat	p.D603H	ACRC_ENST00000471950.1_3'UTR|ACRC_ENST00000373696.3_Missense_Mutation_p.D603H			Q96QF7	ACRC_HUMAN	acidic repeat containing	603	SprT-like.					nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					CTGGCTGATTGATGGTATCCA	0.473																																						dbGAP											0													50.0	42.0	45.0					X																	70832261		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.1807G>C	X.37:g.70832261G>C	ENSP00000362799:p.Asp603His		B9EG62	Missense_Mutation	SNP	pfam_SprT-like_domain,smart_SprT-like_domain	p.D603H	ENST00000373695.1	37	c.1807	CCDS35326.1	X	.	.	.	.	.	.	.	.	.	.	g	13.24	2.176865	0.38413	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.44083	0.93;0.93	4.73	0.608	0.17569	Domain of unknown function SprT-like (2);	.	.	.	.	T	0.50137	0.1598	M	0.86651	2.83	0.22266	N	0.999242	P	0.38729	0.644	B	0.43386	0.418	T	0.47861	-0.9084	9	0.66056	D	0.02	.	6.1054	0.20071	0.2033:0.4983:0.2984:0.0	.	603	Q96QF7	ACRC_HUMAN	H	603	ENSP00000362800:D603H;ENSP00000362799:D603H	ENSP00000362799:D603H	D	+	1	0	ACRC	70748986	0.996000	0.38824	0.039000	0.18376	0.450000	0.32258	3.108000	0.50337	0.089000	0.17243	0.287000	0.19450	GAT	ACRC	-	pfam_SprT-like_domain,smart_SprT-like_domain	ENSG00000147174		0.473	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACRC	HGNC	protein_coding	OTTHUMT00000081856.1	73	0.00	0	G			70832261	70832261	+1	no_errors	ENST00000373695	ensembl	human	known	69_37n	missense	27	27.03	10	SNP	0.237	C
ADAM12	8038	genome.wustl.edu	37	10	127726840	127726840	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr10:127726840C>T	ENST00000368679.4	-	20	2637	c.2328G>A	c.(2326-2328)atG>atA	p.M776I		NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	776					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		GCGGCTTCCTCATCAGGCCTT	0.562																																						dbGAP											0													52.0	43.0	46.0					10																	127726840		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.2328G>A	10.37:g.127726840C>T	ENSP00000357668:p.Met776Ile		O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,prints_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.M776I	ENST00000368679.4	37	c.2328	CCDS7653.1	10	.	.	.	.	.	.	.	.	.	.	C	8.448	0.852395	0.17106	.	.	ENSG00000148848	ENST00000368679	T	0.01446	4.88	4.92	-0.593	0.11667	.	0.719636	0.12650	N	0.450485	T	0.01661	0.0053	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44019	-0.9355	10	0.33141	T	0.24	.	6.9116	0.24338	0.0:0.4194:0.329:0.2516	.	776	O43184	ADA12_HUMAN	I	776	ENSP00000357668:M776I	ENSP00000357668:M776I	M	-	3	0	ADAM12	127716830	0.000000	0.05858	0.000000	0.03702	0.131000	0.20780	-0.350000	0.07721	0.010000	0.14839	0.585000	0.79938	ATG	ADAM12	-	NULL	ENSG00000148848		0.562	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM12	HGNC	protein_coding	OTTHUMT00000050961.1	46	0.00	0	C			127726840	127726840	-1	no_errors	ENST00000368679	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.000	T
ADAMTS13	11093	genome.wustl.edu	37	9	136291377	136291377	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr9:136291377G>A	ENST00000371929.3	+	6	1042	c.598G>A	c.(598-600)Ggt>Agt	p.G200S	ADAMTS13_ENST00000371916.1_Missense_Mutation_p.G200S|ADAMTS13_ENST00000356589.2_Missense_Mutation_p.G200S|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.G200S|ADAMTS13_ENST00000536611.1_5'Flank|ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000371911.3_Missense_Mutation_p.G200S	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	200	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CCAGCTGGGCGGTGCCTGCTC	0.612																																						dbGAP											0													75.0	66.0	69.0					9																	136291377		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.598G>A	9.37:g.136291377G>A	ENSP00000360997:p.Gly200Ser		Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,superfamily_CUB,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.G200S	ENST00000371929.3	37	c.598	CCDS6970.1	9	.	.	.	.	.	.	.	.	.	.	G	18.18	3.566031	0.65651	.	.	ENSG00000160323	ENST00000371929;ENST00000371916;ENST00000355699;ENST00000356589;ENST00000371911;ENST00000338351	D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32	4.69	3.72	0.42706	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	D	0.93197	0.7833	M	0.85859	2.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	1.0;1.0;0.974;1.0	D	0.93685	0.7002	9	0.62326	D	0.03	.	12.6312	0.56659	0.0:0.0:0.8339:0.1661	.	200;200;200;200	Q76LX8;Q76LX8-3;Q76LX8-2;E7EV88	ATS13_HUMAN;.;.;.	S	200;200;200;200;200;70	ENSP00000360997:G200S;ENSP00000360984:G200S;ENSP00000347927:G200S;ENSP00000348997:G200S;ENSP00000360979:G200S	ENSP00000345120:G70S	G	+	1	0	ADAMTS13	135281198	1.000000	0.71417	0.080000	0.20451	0.241000	0.25554	7.226000	0.78060	2.161000	0.67846	0.650000	0.86243	GGT	ADAMTS13	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000160323		0.612	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAMTS13	HGNC	protein_coding	OTTHUMT00000054920.1	41	0.00	0	G	NM_139025		136291377	136291377	+1	no_errors	ENST00000371929	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	0.920	A
ADCY3	109	genome.wustl.edu	37	2	25042837	25042838	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr2:25042837_25042838delAG	ENST00000260600.5	-	21	4249_4250	c.3398_3399delCT	c.(3397-3399)tctfs	p.S1133fs	ADCY3_ENST00000405392.1_Frame_Shift_Del_p.S720fs|CENPO_ENST00000380834.2_3'UTR|CENPO_ENST00000473706.1_3'UTR	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	1133					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GCAGTGTGACAGAGGGGCCATT	0.55																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.3398_3399delCT	2.37:g.25042839_25042840delAG	ENSP00000260600:p.Ser1133fs		B3KT86|Q53T54|Q9UDB1	Frame_Shift_Del	DEL	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.S1133fs	ENST00000260600.5	37	c.3399_3398	CCDS1715.1	2																																																																																			ADCY3	-	NULL	ENSG00000138031		0.550	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY3	HGNC	protein_coding	OTTHUMT00000211574.2	32	0.00	0	AG			25042837	25042838	-1	no_errors	ENST00000260600	ensembl	human	known	69_37n	frame_shift_del	14	22.22	4	DEL	0.001:0.988	-
ADRB2	154	genome.wustl.edu	37	5	148206482	148206482	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr5:148206482G>A	ENST00000305988.4	+	1	327	c.88G>A	c.(88-90)Gag>Aag	p.E30K		NM_000024.5	NP_000015	P07550	ADRB2_HUMAN	adrenoceptor beta 2, surface	30					activation of adenylate cyclase activity (GO:0007190)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|bone resorption (GO:0045453)|brown fat cell differentiation (GO:0050873)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway by arrestin (GO:0002032)|diet induced thermogenesis (GO:0002024)|endosome to lysosome transport (GO:0008333)|heat generation (GO:0031649)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of smooth muscle contraction (GO:0045986)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor-mediated endocytosis (GO:0006898)|regulation of sodium ion transport (GO:0002028)|regulation of vasodilation (GO:0042312)|response to cold (GO:0009409)|vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure (GO:0002025)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	beta2-adrenergic receptor activity (GO:0004941)|norepinephrine binding (GO:0051380)|potassium channel regulator activity (GO:0015459)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(3)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Acebutolol(DB01193)|Alprenolol(DB00866)|Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Arformoterol(DB01274)|Asenapine(DB06216)|Atenolol(DB00335)|Bambuterol(DB01408)|Betaxolol(DB00195)|Bethanidine(DB00217)|Bevantolol(DB01295)|Bisoprolol(DB00612)|Bopindolol(DB08807)|Bupranolol(DB08808)|Cabergoline(DB00248)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Dipivefrin(DB00449)|Dobutamine(DB00841)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Indacaterol(DB05039)|Isoetarine(DB00221)|Isoprenaline(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Mephentermine(DB01365)|Metipranolol(DB01214)|Metoprolol(DB00264)|Mirtazapine(DB00370)|Nadolol(DB01203)|Nebivolol(DB04861)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Phenoxybenzamine(DB00925)|Phenylpropanolamine(DB00397)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Sotalol(DB00489)|Terbutaline(DB00871)|Timolol(DB00373)|Trimipramine(DB00726)	GGAAAGGGACGAGGTGTGGGT	0.622																																						dbGAP											0													172.0	159.0	163.0					5																	148206482		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF022953	CCDS4292.1	5q31-q32	2012-08-08	2012-05-09		ENSG00000169252	ENSG00000169252		"""GPCR / Class A : Adrenoceptors : beta"""	286	protein-coding gene	gene with protein product		109690	"""adrenergic, beta-2-, receptor, surface"""	ADRB2R			Standard	NM_000024		Approved	ADRBR, BAR, B2AR	uc003lpr.2	P07550	OTTHUMG00000129933	ENST00000305988.4:c.88G>A	5.37:g.148206482G>A	ENSP00000305372:p.Glu30Lys		B0LPE4|B2R7X2|O14823|O14824|O14825|O14826|Q4JG18|Q53GA6|Q6GMT4|Q6P4D8|Q8NEQ9|Q96EC3|Q9UCZ0|Q9UCZ1|Q9UCZ2|Q9UCZ3|Q9UH95|Q9UHA1|Q9UMZ5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Adrgc_rcpt_B2,prints_7TM_GPCR_Rhodpsn,prints_Adrnrgc_rcpt	p.E30K	ENST00000305988.4	37	c.88	CCDS4292.1	5	.	.	.	.	.	.	.	.	.	.	G	15.20	2.762805	0.49574	.	.	ENSG00000169252	ENST00000305988	T	0.38401	1.14	5.4	4.53	0.55603	.	0.166518	0.52532	D	0.000076	T	0.28433	0.0703	L	0.29908	0.895	0.45852	D	0.998712	B	0.11235	0.004	B	0.06405	0.002	T	0.04551	-1.0943	10	0.42905	T	0.14	.	14.178	0.65555	0.0716:0.0:0.9284:0.0	.	30	P07550	ADRB2_HUMAN	K	30	ENSP00000305372:E30K	ENSP00000305372:E30K	E	+	1	0	ADRB2	148186675	1.000000	0.71417	0.997000	0.53966	0.792000	0.44763	3.350000	0.52224	1.512000	0.48834	0.655000	0.94253	GAG	ADRB2	-	prints_Adrgc_rcpt_B2	ENSG00000169252		0.622	ADRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRB2	HGNC	protein_coding	OTTHUMT00000252189.1	74	0.00	0	G	NM_000024		148206482	148206482	+1	no_errors	ENST00000305988	ensembl	human	known	69_37n	missense	45	25.00	15	SNP	1.000	A
AKAP1	8165	genome.wustl.edu	37	17	55183786	55183786	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr17:55183786G>C	ENST00000337714.3	+	2	1194	c.961G>C	c.(961-963)Gag>Cag	p.E321Q	AKAP1_ENST00000571629.1_Missense_Mutation_p.E321Q|AKAP1_ENST00000314126.3_Missense_Mutation_p.E321Q|AKAP1_ENST00000572557.1_Missense_Mutation_p.E321Q|AKAP1_ENST00000539273.1_Missense_Mutation_p.E321Q	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	321					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					GGATAGAAATGAGGAGGGCTT	0.512																																						dbGAP											0													92.0	100.0	97.0					17																	55183786		2203	4300	6503	-	-	-	SO:0001583	missense	0			X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.961G>C	17.37:g.55183786G>C	ENSP00000337736:p.Glu321Gln		A8K8Q1|D3DTZ0|Q13320|Q9BW14	Missense_Mutation	SNP	pfam_Tudor,pfam_KH_dom_type_1,smart_KH_dom,smart_Tudor,pfscan_Tudor,pfscan_KH_dom_type_1	p.E321Q	ENST00000337714.3	37	c.961	CCDS11594.1	17	.	.	.	.	.	.	.	.	.	.	G	11.42	1.634720	0.29068	.	.	ENSG00000121057	ENST00000337714;ENST00000314126;ENST00000427138;ENST00000539273	T;T;T	0.19105	2.45;2.17;2.45	2.44	-0.0316	0.13909	.	.	.	.	.	T	0.08626	0.0214	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.11329	0.006	T	0.34329	-0.9833	9	0.29301	T	0.29	.	3.6165	0.08079	0.1707:0.2591:0.5702:0.0	.	321	Q92667	AKAP1_HUMAN	Q	321;321;363;321	ENSP00000337736:E321Q;ENSP00000314075:E321Q;ENSP00000443139:E321Q	ENSP00000314075:E321Q	E	+	1	0	AKAP1	52538785	0.986000	0.35501	0.001000	0.08648	0.140000	0.21249	0.192000	0.17096	0.246000	0.21394	0.205000	0.17691	GAG	AKAP1	-	NULL	ENSG00000121057		0.512	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP1	HGNC	protein_coding	OTTHUMT00000277069.1	91	0.00	0	G			55183786	55183786	+1	no_errors	ENST00000337714	ensembl	human	known	69_37n	missense	210	10.26	24	SNP	0.002	C
ANO6	196527	genome.wustl.edu	37	12	45741997	45741997	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr12:45741997G>C	ENST00000320560.8	+	5	734	c.532G>C	c.(532-534)Gag>Cag	p.E178Q	ANO6_ENST00000426898.2_3'UTR|ANO6_ENST00000435642.1_Missense_Mutation_p.E178Q|ANO6_ENST00000425752.2_Missense_Mutation_p.E178Q|ANO6_ENST00000441606.2_Missense_Mutation_p.E160Q|ANO6_ENST00000423947.3_Missense_Mutation_p.E199Q	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	178					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						CATCAAGCCAGAGCAAGAGTT	0.448																																						dbGAP											0													123.0	126.0	125.0					12																	45741997		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.532G>C	12.37:g.45741997G>C	ENSP00000320087:p.Glu178Gln		A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	pfam_Anoctamin	p.E178Q	ENST00000320560.8	37	c.532	CCDS31782.1	12	.	.	.	.	.	.	.	.	.	.	G	31	5.075203	0.94000	.	.	ENSG00000177119	ENST00000425752;ENST00000423947;ENST00000435642;ENST00000320560;ENST00000441606	T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.83718	0.5315	M	0.72118	2.19	0.80722	D	1	P;P;D;P	0.76494	0.884;0.805;0.999;0.812	B;B;D;B	0.81914	0.41;0.433;0.995;0.396	T	0.82827	-0.0265	10	0.45353	T	0.12	.	19.5934	0.95525	0.0:0.0:1.0:0.0	.	160;199;178;178	E9PB30;B9EGG0;E9PCT2;Q4KMQ2	.;.;.;ANO6_HUMAN	Q	178;199;178;178;160	ENSP00000391417:E178Q;ENSP00000409126:E199Q;ENSP00000413840:E178Q;ENSP00000320087:E178Q;ENSP00000413137:E160Q	ENSP00000320087:E178Q	E	+	1	0	ANO6	44028264	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	9.336000	0.96533	2.802000	0.96397	0.655000	0.94253	GAG	ANO6	-	NULL	ENSG00000177119		0.448	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANO6	HGNC	protein_coding	OTTHUMT00000404822.1	105	0.00	0	G	XM_113743		45741997	45741997	+1	no_errors	ENST00000425752	ensembl	human	known	69_37n	missense	53	14.52	9	SNP	1.000	C
ATG7	10533	genome.wustl.edu	37	3	11421470	11421470	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr3:11421470G>C	ENST00000354449.3	+	17	1925	c.1900G>C	c.(1900-1902)Gat>Cat	p.D634H	ATG7_ENST00000446450.2_Missense_Mutation_p.D595H|ATG7_ENST00000354956.5_Intron	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7	634					adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						TTCACGGTTTGATAATGTCCT	0.393																																						dbGAP											0													141.0	137.0	138.0					3																	11421470		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740	ENST00000354449.3:c.1900G>C	3.37:g.11421470G>C	ENSP00000346437:p.Asp634His		B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_E1-like_Apg7	p.D634H	ENST00000354449.3	37	c.1900	CCDS2605.1	3	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	15.89|15.89|15.89	2.966049|2.966049|2.966049	0.53507|0.53507|0.53507	.|.|.	.|.|.	ENSG00000197548|ENSG00000197548|ENSG00000197548	ENST00000446450;ENST00000354449;ENST00000414717|ENST00000427759|ENST00000446110	T;T|.|.	0.29142|.|.	1.58;1.58|.|.	6.17|6.17|6.17	6.17|6.17|6.17	0.99709|0.99709|0.99709	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|.	0.55033|0.55033|.	0.1895|0.1895|.	N|N|N	0.20766|0.20766|0.20766	0.605|0.605|0.605	0.58432|0.58432|0.58432	D|D|D	0.999998|0.999998|0.999998	B;B|.|.	0.16802|.|.	0.0;0.019|.|.	B;B|.|.	0.14023|.|.	0.001;0.01|.|.	T|T|.	0.45891|0.45891|.	-0.9230|-0.9230|.	10|5|.	0.30854|.|.	T|.|.	0.27|.|.	-21.5458|-21.5458|-21.5458	19.0599|19.0599|19.0599	0.93085|0.93085|0.93085	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	595;634|.|.	E9PB95;O95352|.|.	.;ATG7_HUMAN|.|.	H|F|S	595;634;35|34|34	ENSP00000412580:D595H;ENSP00000346437:D634H|.|.	ENSP00000346437:D634H|.|.	D|L|X	+|+|+	1|3|2	0|2|2	ATG7|ATG7|ATG7	11396470|11396470|11396470	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.999000|0.999000|0.999000	0.98932|0.98932|0.98932	7.695000|7.695000|7.695000	0.84257|0.84257|0.84257	2.941000|2.941000|2.941000	0.99782|0.99782|0.99782	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAT|TTG|TGA	ATG7	-	superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_E1-like_Apg7	ENSG00000197548		0.393	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG7	HGNC	protein_coding	OTTHUMT00000251951.3	187	0.00	0	G	NM_006395		11421470	11421470	+1	no_errors	ENST00000354449	ensembl	human	known	69_37n	missense	92	19.83	23	SNP	1.000	C
AWAT1	158833	genome.wustl.edu	37	X	69459634	69459634	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chrX:69459634C>G	ENST00000374521.3	+	6	723	c.682C>G	c.(682-684)Cag>Gag	p.Q228E		NM_001013579.2	NP_001013597.1	Q58HT5	AWAT1_HUMAN	acyl-CoA wax alcohol acyltransferase 1	228					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)			breast(2)|central_nervous_system(1)|large_intestine(4)|lung(3)|ovary(4)|skin(1)	15						GGTGTATGATCAGGTGCTGTT	0.453																																						dbGAP											0													141.0	131.0	135.0					X																	69459634		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC039181	CCDS35321.1	Xq13.1	2010-01-25	2009-02-23	2009-02-23	ENSG00000204195	ENSG00000204195			23252	protein-coding gene	gene with protein product		300924	"""diacylglycerol O-acyltransferase 2-like 3"""	DGAT2L3		14970677, 15671038	Standard	NM_001013579		Approved		uc004dxy.3	Q58HT5	OTTHUMG00000021773	ENST00000374521.3:c.682C>G	X.37:g.69459634C>G	ENSP00000363645:p.Gln228Glu		Q5JT21|Q6IEE4	Missense_Mutation	SNP	pfam_DAGAT	p.Q228E	ENST00000374521.3	37	c.682	CCDS35321.1	X	.	.	.	.	.	.	.	.	.	.	C	19.47	3.834166	0.71373	.	.	ENSG00000204195	ENST00000374521	T	0.16897	2.31	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000004	T	0.48132	0.1483	H	0.96015	3.755	0.80722	D	1	D	0.61697	0.99	P	0.53006	0.715	T	0.66590	-0.5885	10	0.66056	D	0.02	-14.7058	16.5957	0.84795	0.0:1.0:0.0:0.0	.	228	Q58HT5	AWAT1_HUMAN	E	228	ENSP00000363645:Q228E	ENSP00000363645:Q228E	Q	+	1	0	AWAT1	69376359	1.000000	0.71417	0.039000	0.18376	0.683000	0.39861	5.271000	0.65553	2.490000	0.84030	0.544000	0.68410	CAG	AWAT1	-	pfam_DAGAT	ENSG00000204195		0.453	AWAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AWAT1	HGNC	protein_coding	OTTHUMT00000057066.3	140	0.00	0	C	NM_001013579		69459634	69459634	+1	no_errors	ENST00000374521	ensembl	human	known	69_37n	missense	65	24.42	21	SNP	1.000	G
BNC1	646	genome.wustl.edu	37	15	83933256	83933256	+	Silent	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr15:83933256G>A	ENST00000345382.2	-	4	832	c.747C>T	c.(745-747)ttC>ttT	p.F249F	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Silent_p.F242F	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	249	Hydrophobic.				chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						GCAGAGGGTTGAAGAACTGGA	0.512																																						dbGAP											0													90.0	89.0	90.0					15																	83933256		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.747C>T	15.37:g.83933256G>A			Q15840	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F249	ENST00000345382.2	37	c.747	CCDS10324.1	15																																																																																			BNC1	-	NULL	ENSG00000169594		0.512	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	HGNC	protein_coding	OTTHUMT00000304006.1	59	0.00	0	G	NM_001717		83933256	83933256	-1	no_errors	ENST00000345382	ensembl	human	known	69_37n	silent	30	31.82	14	SNP	1.000	A
BTRC	8945	genome.wustl.edu	37	10	103292145	103292145	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr10:103292145G>A	ENST00000370187.3	+	8	1052	c.934G>A	c.(934-936)Gat>Aat	p.D312N	BTRC_ENST00000393441.4_Missense_Mutation_p.D271N|BTRC_ENST00000408038.2_Missense_Mutation_p.D276N	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	312					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		TTTACAGTATGATGATCAGAA	0.403																																						dbGAP											0													137.0	135.0	135.0					10																	103292145		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.934G>A	10.37:g.103292145G>A	ENSP00000359206:p.Asp312Asn		B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Beta-TrCP_D,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.D312N	ENST00000370187.3	37	c.934	CCDS7512.1	10	.	.	.	.	.	.	.	.	.	.	G	36	5.699810	0.96802	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038	T;T;T	0.59638	1.07;1.07;0.25	5.96	5.96	0.96718	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.74869	0.3773	L	0.60904	1.88	0.80722	D	1	D;D;D	0.89917	1.0;0.981;1.0	D;P;D	0.97110	0.997;0.896;1.0	T	0.72250	-0.4348	10	0.48119	T	0.1	-16.3636	20.4008	0.98991	0.0:0.0:1.0:0.0	.	286;276;312	B7Z3H4;Q9Y297-2;Q9Y297	.;.;FBW1A_HUMAN	N	312;271;276	ENSP00000359206:D312N;ENSP00000377088:D271N;ENSP00000385339:D276N	ENSP00000359206:D312N	D	+	1	0	BTRC	103282135	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	9.869000	0.99810	2.826000	0.97356	0.655000	0.94253	GAT	BTRC	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000166167		0.403	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTRC	HGNC	protein_coding	OTTHUMT00000049936.1	57	0.00	0	G	NM_033637		103292145	103292145	+1	no_errors	ENST00000370187	ensembl	human	known	69_37n	missense	33	31.25	15	SNP	1.000	A
C4orf45	152940	genome.wustl.edu	37	4	159894264	159894264	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr4:159894264G>T	ENST00000434826.2	-	2	348	c.264C>A	c.(262-264)aaC>aaA	p.N88K	C4orf45_ENST00000508011.1_5'UTR	NM_152543.2	NP_689756.2	Q96LM5	CD045_HUMAN	chromosome 4 open reading frame 45	88										large_intestine(2)|lung(3)	5						GTCTTGATTTGTTGATAAAAT	0.338																																						dbGAP											0													86.0	73.0	77.0					4																	159894264		1816	4079	5895	-	-	-	SO:0001583	missense	0				CCDS47156.1	4q32.1	2012-03-02			ENSG00000164123	ENSG00000164123			26342	protein-coding gene	gene with protein product							Standard	NM_152543		Approved	FLJ25371	uc003iqf.1	Q96LM5	OTTHUMG00000161988	ENST00000434826.2:c.264C>A	4.37:g.159894264G>T	ENSP00000412215:p.Asn88Lys		A8MPU3|C9J0T8	Missense_Mutation	SNP	NULL	p.N88K	ENST00000434826.2	37	c.264	CCDS47156.1	4	.	.	.	.	.	.	.	.	.	.	G	16.45	3.127761	0.56721	.	.	ENSG00000164123	ENST00000434826	T	0.13901	2.55	5.69	2.59	0.31030	.	0.260213	0.33670	N	0.004665	T	0.22360	0.0539	M	0.72118	2.19	0.22317	N	0.999207	D	0.57257	0.979	P	0.51615	0.675	T	0.04737	-1.0930	9	.	.	.	-38.9259	8.0758	0.30716	0.2927:0.0:0.7073:0.0	.	88	Q96LM5	CD045_HUMAN	K	88	ENSP00000412215:N88K	.	N	-	3	2	C4orf45	160113714	0.951000	0.32395	0.793000	0.32043	0.873000	0.50193	1.428000	0.34892	0.753000	0.32945	0.655000	0.94253	AAC	C4orf45	-	NULL	ENSG00000164123		0.338	C4orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf45	HGNC	protein_coding	OTTHUMT00000366636.1	135	0.00	0	G	NM_152543		159894264	159894264	-1	no_errors	ENST00000434826	ensembl	human	known	69_37n	missense	46	33.33	23	SNP	0.255	T
CACNG4	27092	genome.wustl.edu	37	17	65026607	65026607	+	Silent	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr17:65026607C>T	ENST00000262138.3	+	4	473	c.471C>T	c.(469-471)atC>atT	p.I157I	RP11-74H8.1_ENST00000579138.1_RNA|AC005544.1_ENST00000375684.1_5'Flank	NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	157					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			TCGGTATCATCGTCTACATTT	0.552																																						dbGAP											0													140.0	138.0	139.0					17																	65026607		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.471C>T	17.37:g.65026607C>T			B2RCK0	Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_g4su,prints_VDCC_gsu,prints_Claudin	p.I157	ENST00000262138.3	37	c.471	CCDS11667.1	17																																																																																			CACNG4	-	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu	ENSG00000075461		0.552	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG4	HGNC	protein_coding	OTTHUMT00000447036.1	58	0.00	0	C	NM_014405		65026607	65026607	+1	no_errors	ENST00000262138	ensembl	human	known	69_37n	silent	30	14.29	5	SNP	0.997	T
CCDC151	115948	genome.wustl.edu	37	19	11537068	11537068	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr19:11537068C>G	ENST00000356392.4	-	7	946	c.859G>C	c.(859-861)Gag>Cag	p.E287Q	CCDC151_ENST00000545100.1_Missense_Mutation_p.E233Q|CCDC151_ENST00000591179.1_Missense_Mutation_p.E227Q|CCDC151_ENST00000586836.1_Missense_Mutation_p.E96Q	NM_145045.4	NP_659482.3	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	287										endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	12						AAGGTCTCCTCTAGGTACTGC	0.622																																						dbGAP											0													43.0	44.0	44.0					19																	11537068		1973	4156	6129	-	-	-	SO:0001583	missense	0				CCDS42501.1	19p13.2	2014-02-20				ENSG00000198003			28303	protein-coding gene	gene with protein product		615956				24067530	Standard	NM_145045		Approved	MGC20983	uc002mrs.3	A5D8V7		ENST00000356392.4:c.859G>C	19.37:g.11537068C>G	ENSP00000348757:p.Glu287Gln		B4DXT0|Q96CG5	Missense_Mutation	SNP	NULL	p.E287Q	ENST00000356392.4	37	c.859	CCDS42501.1	19	.	.	.	.	.	.	.	.	.	.	C	16.42	3.118701	0.56505	.	.	ENSG00000198003	ENST00000545100;ENST00000356392;ENST00000543934	D;D	0.84589	-1.87;-1.87	4.46	4.46	0.54185	.	0.054498	0.64402	D	0.000001	D	0.91570	0.7337	M	0.81341	2.54	0.40113	D	0.976517	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	D	0.91687	0.5363	10	0.42905	T	0.14	-28.2951	12.9572	0.58434	0.0:1.0:0.0:0.0	.	287;287;267	B3KPH7;A5D8V7;B4DG09	.;CC151_HUMAN;.	Q	233;287;266	ENSP00000442987:E233Q;ENSP00000348757:E287Q	ENSP00000348757:E287Q	E	-	1	0	CCDC151	11398068	1.000000	0.71417	1.000000	0.80357	0.480000	0.33159	3.402000	0.52608	2.187000	0.69744	0.561000	0.74099	GAG	CCDC151	-	NULL	ENSG00000198003		0.622	CCDC151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC151	HGNC	protein_coding	OTTHUMT00000458800.1	59	0.00	0	C	NM_145045		11537068	11537068	-1	no_errors	ENST00000356392	ensembl	human	known	69_37n	missense	33	22.73	10	SNP	1.000	G
CCDC8	83987	genome.wustl.edu	37	19	46914605	46914605	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr19:46914605C>A	ENST00000307522.3	-	1	2236	c.1463G>T	c.(1462-1464)tGg>tTg	p.W488L		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	488					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		CTTGCAAAACCACGAAAAGCG	0.627																																						dbGAP											0													58.0	62.0	61.0					19																	46914605		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.1463G>T	19.37:g.46914605C>A	ENSP00000303158:p.Trp488Leu		Q8TB26	Missense_Mutation	SNP	NULL	p.W488L	ENST00000307522.3	37	c.1463	CCDS12685.1	19	.	.	.	.	.	.	.	.	.	.	C	18.45	3.627186	0.66901	.	.	ENSG00000169515	ENST00000307522	T	0.24908	1.83	4.05	4.05	0.47172	.	0.000000	0.34435	N	0.003969	T	0.46870	0.1415	M	0.66939	2.045	0.32707	N	0.512135	D	0.89917	1.0	D	0.87578	0.998	T	0.58352	-0.7651	10	0.72032	D	0.01	-10.9624	12.0116	0.53291	0.0:1.0:0.0:0.0	.	488	Q9H0W5	CCDC8_HUMAN	L	488	ENSP00000303158:W488L	ENSP00000303158:W488L	W	-	2	0	CCDC8	51606445	0.990000	0.36364	0.977000	0.42913	0.526000	0.34562	1.355000	0.34068	2.546000	0.85860	0.455000	0.32223	TGG	CCDC8	-	NULL	ENSG00000169515		0.627	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC8	HGNC	protein_coding	OTTHUMT00000368598.1	36	0.00	0	C	NM_032040		46914605	46914605	-1	no_errors	ENST00000307522	ensembl	human	known	69_37n	missense	96	21.31	26	SNP	0.995	A
CD1E	913	genome.wustl.edu	37	1	158324193	158324193	+	Silent	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr1:158324193C>T	ENST00000368167.3	+	2	324	c.85C>T	c.(85-87)Cta>Tta	p.L29L	CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368155.3_Silent_p.L29L|CD1E_ENST00000368165.3_Silent_p.L29L|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000464822.1_Intron|CD1E_ENST00000434258.1_Silent_p.L27L|CD1E_ENST00000444681.2_Intron|CD1E_ENST00000368163.3_Silent_p.L29L|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368160.3_Silent_p.L29L|CD1E_ENST00000368161.3_Silent_p.L29L|CD1E_ENST00000368156.1_Silent_p.L29L|CD1E_ENST00000368166.3_Intron	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	29					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					ATCCTATCATCTAGCAGCAGA	0.517																																						dbGAP											0													142.0	144.0	143.0					1																	158324193		2117	4254	6371	-	-	-	SO:0001819	synonymous_variant	0			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.85C>T	1.37:g.158324193C>T			B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Silent	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.L29	ENST00000368167.3	37	c.85	CCDS41417.1	1																																																																																			CD1E	-	NULL	ENSG00000158488		0.517	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD1E	HGNC	protein_coding	OTTHUMT00000046353.3	63	0.00	0	C	NM_030893		158324193	158324193	+1	no_errors	ENST00000368167	ensembl	human	known	69_37n	silent	39	30.36	17	SNP	0.000	T
CFLAR	8837	genome.wustl.edu	37	2	201997758	201997758	+	Silent	SNP	G	G	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr2:201997758G>T	ENST00000309955.3	+	3	803	c.288G>T	c.(286-288)ctG>ctT	p.L96L	CFLAR_ENST00000457277.1_Silent_p.L96L|CFLAR_ENST00000494258.1_5'UTR|CFLAR_ENST00000423241.2_Silent_p.L96L|CFLAR_ENST00000341222.6_Silent_p.L96L|CFLAR_ENST00000342795.5_Silent_p.L96L|CFLAR_ENST00000355558.4_Silent_p.L96L|CFLAR_ENST00000340870.5_Silent_p.L96L|CFLAR_ENST00000440180.1_Silent_p.L96L|CFLAR_ENST00000479953.2_5'UTR|CFLAR_ENST00000443227.1_5'UTR|CFLAR_ENST00000341582.6_Silent_p.L96L|CFLAR_ENST00000395148.2_Silent_p.L96L	NM_001202515.1|NM_003879.5	NP_001189444.1|NP_003870.4	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator	96	DED 2. {ECO:0000255|PROSITE- ProRule:PRU00065}.|Interaction with FADD.|Interaction with caspase-8 propeptide.|Interaction with caspase-8.|Not proteolytically processed and involved in apoptosis inhibition.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of myoblast fusion (GO:1901740)|positive regulation of catalytic activity (GO:0043085)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of necroptotic process (GO:0060544)|regulation of satellite cell proliferation (GO:0014842)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|skeletal myofibril assembly (GO:0014866)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|ripoptosome (GO:0097342)	cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|enzyme activator activity (GO:0008047)|protease binding (GO:0002020)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|stomach(1)	13						GCAGAGTGCTGATGGCAGAGA	0.433																																					Pancreas(16;548 657 22190 32864 42338)	dbGAP											0													145.0	126.0	133.0					2																	201997758		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF005774	CCDS2337.1, CCDS46487.1, CCDS56157.1, CCDS56158.1, CCDS59436.1	2q33-q34	2014-01-30			ENSG00000003402	ENSG00000003402		"""Endogenous ligands"""	1876	protein-coding gene	gene with protein product		603599		CASP8AP1		9208847, 9217161	Standard	NM_003879		Approved	CASH, Casper, CLARP, FLAME, FLIP, I-FLICE, MRIT, c-FLIP	uc002uxb.4	O15519	OTTHUMG00000132819	ENST00000309955.3:c.288G>T	2.37:g.201997758G>T			B4DJE0|B7Z9F9|O14673|O14674|O14675|O15137|O15138|O15356|O15510|O43618|O43619|O43620|O60458|O60459|Q53TS6|Q54AF1|Q96TE4|Q9UEW1	Silent	SNP	pfam_DED,pfam_Pept_C14_cat,superfamily_DEATH-like,smart_DED,smart_Pept_C14_p45_core,pfscan_DED,pfscan_Pept_C14_ICE_p20	p.L96	ENST00000309955.3	37	c.288	CCDS2337.1	2																																																																																			CFLAR	-	pfam_DED,superfamily_DEATH-like,smart_DED,pfscan_DED	ENSG00000003402		0.433	CFLAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CFLAR	HGNC	protein_coding	OTTHUMT00000256276.3	121	0.00	0	G	NM_003879		201997758	201997758	+1	no_errors	ENST00000309955	ensembl	human	known	69_37n	silent	53	33.75	27	SNP	0.998	T
CFP	5199	genome.wustl.edu	37	X	47485763	47485763	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chrX:47485763C>T	ENST00000396992.3	-	7	1216	c.1096G>A	c.(1096-1098)Gat>Aat	p.D366N	CFP_ENST00000377005.2_Missense_Mutation_p.D366N|CFP_ENST00000480317.1_5'Flank|CFP_ENST00000247153.3_Missense_Mutation_p.D366N	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin	366	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						TGCCGGATATCCTGCTGTTGC	0.607																																						dbGAP											0													63.0	56.0	58.0					X																	47485763		2203	4300	6503	-	-	-	SO:0001583	missense	0			M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.1096G>A	X.37:g.47485763C>T	ENSP00000380189:p.Asp366Asn		O15134|O15135|O15136|O75826	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.D366N	ENST00000396992.3	37	c.1096	CCDS14282.1	X	.	.	.	.	.	.	.	.	.	.	C	11.69	1.712766	0.30413	.	.	ENSG00000126759	ENST00000396992;ENST00000247153;ENST00000377005	T;T;T	0.53206	0.63;0.63;0.63	5.43	4.56	0.56223	.	0.496534	0.22258	N	0.062449	T	0.59142	0.2172	M	0.83012	2.62	0.09310	N	1	P;B	0.35139	0.486;0.269	P;B	0.45538	0.484;0.353	T	0.58211	-0.7676	10	0.72032	D	0.01	.	9.2525	0.37564	0.0:0.8977:0.0:0.1023	.	302;366	B3KVK6;P27918	.;PROP_HUMAN	N	366	ENSP00000380189:D366N;ENSP00000247153:D366N;ENSP00000366204:D366N	ENSP00000247153:D366N	D	-	1	0	CFP	47370707	0.990000	0.36364	0.170000	0.22879	0.021000	0.10359	1.548000	0.36201	1.193000	0.43086	0.468000	0.43344	GAT	CFP	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000126759		0.607	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFP	HGNC	protein_coding	OTTHUMT00000056435.2	42	0.00	0	C	NM_002621		47485763	47485763	-1	no_errors	ENST00000247153	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	0.050	T
COL24A1	255631	genome.wustl.edu	37	1	86437030	86437030	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr1:86437030C>G	ENST00000370571.2	-	21	2777	c.2411G>C	c.(2410-2412)gGa>gCa	p.G804A	COL24A1_ENST00000436319.1_Missense_Mutation_p.G804A	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	804	Collagen-like 5.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		TACCTGAGTTCCTTTGAGACC	0.363																																						dbGAP											0													70.0	62.0	65.0					1																	86437030		1821	4076	5897	-	-	-	SO:0001583	missense	0			AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.2411G>C	1.37:g.86437030C>G	ENSP00000359603:p.Gly804Ala		C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_Fib_collagen_C	p.G804A	ENST00000370571.2	37	c.2411	CCDS41353.1	1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.897018	0.52121	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	D;D	0.99607	-6.27;-6.27	5.61	5.61	0.85477	.	0.000000	0.36002	N	0.002856	D	0.99632	0.9865	M	0.86651	2.83	0.47476	D	0.999437	D	0.76494	0.999	D	0.80764	0.994	D	0.97922	1.0315	10	0.87932	D	0	.	15.1277	0.72494	0.0:1.0:0.0:0.0	.	804	Q17RW2	COOA1_HUMAN	A	804	ENSP00000359603:G804A;ENSP00000392531:G804A	ENSP00000359603:G804A	G	-	2	0	COL24A1	86209618	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.413000	0.59795	2.637000	0.89404	0.650000	0.86243	GGA	COL24A1	-	pfam_Collagen	ENSG00000171502		0.363	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL24A1	HGNC	protein_coding	OTTHUMT00000029335.4	92	0.00	0	C	NM_152890		86437030	86437030	-1	no_errors	ENST00000370571	ensembl	human	known	69_37n	missense	43	18.87	10	SNP	1.000	G
CSPP1	79848	genome.wustl.edu	37	8	68005824	68005824	+	Frame_Shift_Del	DEL	G	G	-			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr8:68005824delG	ENST00000262210.5	+	5	489	c.458delG	c.(457-459)aggfs	p.R153fs	CSPP1_ENST00000412460.1_5'UTR	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	188					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			CAGTTTCTCAGGGGTAAGGAA	0.338																																						dbGAP											0													159.0	151.0	154.0					8																	68005824		1813	4080	5893	-	-	-	SO:0001589	frameshift_variant	0			AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.458delG	8.37:g.68005824delG	ENSP00000262210:p.Arg153fs		A6ND63|Q70F00|Q8TBC1	Frame_Shift_Del	DEL	NULL	p.G154fs	ENST00000262210.5	37	c.458	CCDS43744.1	8																																																																																			CSPP1	-	NULL	ENSG00000104218		0.338	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSPP1	HGNC	protein_coding	OTTHUMT00000379254.1	185	0.00	0	G	NM_024790		68005824	68005824	+1	no_errors	ENST00000262210	ensembl	human	known	69_37n	frame_shift_del	153	13.56	24	DEL	1.000	-
CXCR3	2833	genome.wustl.edu	37	X	70837215	70837215	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chrX:70837215G>A	ENST00000373693.3	-	2	174	c.107C>T	c.(106-108)tCg>tTg	p.S36L	CXCR3_ENST00000373691.4_Missense_Mutation_p.S83L	NM_001504.1	NP_001495.1	P49682	CXCR3_HUMAN	chemokine (C-X-C motif) receptor 3	36					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|calcium-mediated signaling (GO:0019722)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|chemokine (C-C motif) ligand 11 production (GO:0071954)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of execution phase of apoptosis (GO:1900118)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of leukocyte migration (GO:0002685)|T cell chemotaxis (GO:0010818)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|chemokine binding (GO:0019956)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(2)|lung(3)|ovary(2)	10	Renal(35;0.156)					GGTACAGCACGAGTCACTCTC	0.587																																						dbGAP											0													57.0	60.0	59.0					X																	70837215		2203	4300	6503	-	-	-	SO:0001583	missense	0			U32674	CCDS14416.1, CCDS48135.1	Xq13	2012-08-08	2002-08-22	2002-08-23	ENSG00000186810	ENSG00000186810		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	4540	protein-coding gene	gene with protein product		300574	"""G protein-coupled receptor 9"""	GPR9		8666380, 9064356	Standard	NM_001142797		Approved	CKR-L2, CMKAR3, IP10-R, MigR, CD183	uc011mpx.2	P49682	OTTHUMG00000033326	ENST00000373693.3:c.107C>T	X.37:g.70837215G>A	ENSP00000362797:p.Ser36Leu		B2R982|O15185|Q7Z710|Q9P2T4|Q9P2T5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_CXCR3,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_CXCR4,prints_Chemokine_rcpt,prints_ATII_rcpt	p.S83L	ENST00000373693.3	37	c.248	CCDS14416.1	X	.	.	.	.	.	.	.	.	.	.	G	10.21	1.287646	0.23478	.	.	ENSG00000186810	ENST00000373691;ENST00000373693;ENST00000373687	T;T	0.34859	1.34;1.34	5.28	-5.57	0.02521	.	1.952810	0.03031	N	0.152006	T	0.17408	0.0418	N	0.22421	0.69	0.09310	N	1	B;B	0.17465	0.022;0.002	B;B	0.09377	0.004;0.001	T	0.12993	-1.0526	10	0.11485	T	0.65	.	1.2068	0.01896	0.4352:0.1964:0.1679:0.2004	.	83;36	P49682-2;P49682	.;CXCR3_HUMAN	L	83;36;36	ENSP00000362795:S83L;ENSP00000362797:S36L	ENSP00000362791:S36L	S	-	2	0	CXCR3	70753940	0.001000	0.12720	0.000000	0.03702	0.021000	0.10359	-0.551000	0.06027	-1.396000	0.02071	-0.853000	0.03031	TCG	CXCR3	-	prints_Chemokine_CXCR3	ENSG00000186810		0.587	CXCR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR3	HGNC	protein_coding	OTTHUMT00000144141.1	74	0.00	0	G			70837215	70837215	-1	no_errors	ENST00000373691	ensembl	human	known	69_37n	missense	23	42.50	17	SNP	0.000	A
CYP2A13	1553	genome.wustl.edu	37	19	41595958	41595958	+	Missense_Mutation	SNP	C	C	T	rs75703079		TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr19:41595958C>T	ENST00000330436.3	+	3	350	c.350C>T	c.(349-351)gCg>gTg	p.A117V		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	117					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	CCAGGCGTGGCGTTCAGCAAC	0.692																																						dbGAP											0													14.0	15.0	15.0					19																	41595958		2195	4286	6481	-	-	-	SO:0001583	missense	0			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.350C>T	19.37:g.41595958C>T	ENSP00000332679:p.Ala117Val		Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.A117V	ENST00000330436.3	37	c.350	CCDS12571.1	19	.	.	.	.	.	.	.	.	.	.	.	1.000	-0.691113	0.03303	.	.	ENSG00000197838	ENST00000330436	T	0.67865	-0.29	3.37	2.29	0.28610	.	0.670897	0.14479	N	0.317025	T	0.38453	0.1041	N	0.05012	-0.13	0.09310	N	1	B	0.21520	0.057	B	0.15870	0.014	T	0.17715	-1.0360	10	0.06757	T	0.87	.	10.1062	0.42535	0.0:0.8927:0.0:0.1073	.	117	Q16696	CP2AD_HUMAN	V	117	ENSP00000332679:A117V	ENSP00000332679:A117V	A	+	2	0	CYP2A13	46287798	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	-1.502000	0.02279	0.730000	0.32425	0.282000	0.19409	GCG	CYP2A13	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000197838		0.692	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	11	0.00	0	C	NM_000766		41595958	41595958	+1	no_errors	ENST00000330436	ensembl	human	known	69_37n	missense	5	54.55	6	SNP	0.109	T
DMD	1756	genome.wustl.edu	37	X	32380914	32380914	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chrX:32380914C>G	ENST00000357033.4	-	37	5522	c.5316G>C	c.(5314-5316)aaG>aaC	p.K1772N	DMD_ENST00000378677.2_Missense_Mutation_p.K1768N	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1772	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CCTTTCCAGTCTTAATTCTGT	0.478																																						dbGAP											0													178.0	140.0	153.0					X																	32380914		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5316G>C	X.37:g.32380914C>G	ENSP00000354923:p.Lys1772Asn		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.K1772N	ENST00000357033.4	37	c.5316	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	14.07	2.426010	0.43020	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.52295	0.67;0.67	5.36	4.48	0.54585	.	0.000000	0.36555	U	0.002536	T	0.47691	0.1459	M	0.63843	1.955	0.80722	D	1	B;P;B;B;B	0.48589	0.004;0.912;0.005;0.005;0.005	B;P;B;B;B	0.47603	0.004;0.551;0.007;0.007;0.007	T	0.47086	-0.9144	10	0.51188	T	0.08	.	5.65	0.17610	0.1628:0.6761:0.0:0.1611	.	1764;1772;1768;431;428	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	N	1764;431;428;1768;1772;1772;1649	ENSP00000367948:K1768N;ENSP00000354923:K1772N	ENSP00000354923:K1772N	K	-	3	2	DMD	32290835	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.021000	0.41020	0.993000	0.38866	0.544000	0.68410	AAG	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.478	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	113	0.00	0	C	NM_004006		32380914	32380914	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	missense	36	28.00	14	SNP	1.000	G
DOCK2	1794	genome.wustl.edu	37	5	169145739	169145739	+	Silent	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr5:169145739G>A	ENST00000256935.8	+	22	2291	c.2211G>A	c.(2209-2211)ctG>ctA	p.L737L	DOCK2_ENST00000520908.1_Silent_p.L229L|DOCK2_ENST00000540750.1_5'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	737					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TAAGAACGCTGAAGGCTTTGG	0.403																																						dbGAP											0													142.0	117.0	126.0					5																	169145739		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2211G>A	5.37:g.169145739G>A			Q2M3I0|Q96AK7	Silent	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c_dom,superfamily_ARM-type_fold,superfamily_Ferritin/RR-like,smart_SH3_domain,pfscan_SH3_domain	p.L737	ENST00000256935.8	37	c.2211	CCDS4371.1	5																																																																																			DOCK2	-	superfamily_ARM-type_fold	ENSG00000134516		0.403	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	62	0.00	0	G	NM_004946		169145739	169145739	+1	no_errors	ENST00000256935	ensembl	human	known	69_37n	silent	31	13.89	5	SNP	1.000	A
DOCK7	85440	genome.wustl.edu	37	1	62923257	62923257	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr1:62923257C>T	ENST00000340370.5	-	48	6256	c.6239G>A	c.(6238-6240)aGa>aAa	p.R2080K	DOCK7_ENST00000251157.5_Missense_Mutation_p.R2100K	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	2111	DHR-2.				activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						AGGGATCTTTCTGTTGATCAG	0.408																																						dbGAP											0													179.0	168.0	172.0					1																	62923257		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.6239G>A	1.37:g.62923257C>T	ENSP00000340742:p.Arg2080Lys		Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,superfamily_ARM-type_fold	p.R2100K	ENST00000340370.5	37	c.6299	CCDS30734.1	1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.965528	0.92855	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370;ENST00000395441	T;T	0.13778	2.56;2.56	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.16685	0.0401	L	0.29908	0.895	0.58432	D	0.999999	P;B;P;P;P;P	0.46621	0.485;0.42;0.51;0.51;0.694;0.881	B;B;B;B;P;B	0.44518	0.184;0.312;0.228;0.228;0.452;0.281	T	0.00408	-1.1758	10	0.52906	T	0.07	.	20.2576	0.98430	0.0:1.0:0.0:0.0	.	2111;2100;2080;2069;2071;2102	Q96N67;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	DOCK7_HUMAN;.;.;.;.;.	K	2111;2100;2080;841	ENSP00000251157:R2100K;ENSP00000340742:R2080K	ENSP00000251157:R2100K	R	-	2	0	DOCK7	62695845	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.010000	0.70753	2.783000	0.95769	0.655000	0.94253	AGA	DOCK7	-	NULL	ENSG00000116641		0.408	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	HGNC	protein_coding	OTTHUMT00000036806.1	174	0.00	0	C	NM_033407		62923257	62923257	-1	no_errors	ENST00000251157	ensembl	human	known	69_37n	missense	84	31.71	39	SNP	1.000	T
DYNC1H1	1778	genome.wustl.edu	37	14	102474586	102474586	+	Silent	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr14:102474586G>A	ENST00000360184.4	+	29	6053	c.5889G>A	c.(5887-5889)ctG>ctA	p.L1963L		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1963	AAA 1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TCAACCGCCTGGAGGAGCGGA	0.572																																						dbGAP											0													66.0	62.0	63.0					14																	102474586		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.5889G>A	14.37:g.102474586G>A			B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.L1963	ENST00000360184.4	37	c.5889	CCDS9966.1	14																																																																																			DYNC1H1	-	smart_AAA+_ATPase	ENSG00000197102		0.572	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	47	0.00	0	G	NM_001376		102474586	102474586	+1	no_errors	ENST00000360184	ensembl	human	known	69_37n	silent	30	31.11	14	SNP	1.000	A
ENKUR	219670	genome.wustl.edu	37	10	25273745	25273745	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr10:25273745C>G	ENST00000331161.4	-	5	903	c.684G>C	c.(682-684)caG>caC	p.Q228H	ENKUR_ENST00000376363.1_Missense_Mutation_p.Q228H	NM_145010.3	NP_659447.1	Q8TC29	ENKUR_HUMAN	enkurin, TRPC channel interacting protein	228	Enkurin. {ECO:0000255|PROSITE- ProRule:PRU01000}.					motile cilium (GO:0031514)				endometrium(2)|large_intestine(4)|lung(3)|skin(1)	10						CTTCCAGCCTCTGCTTGCGGA	0.383																																						dbGAP											0													122.0	114.0	117.0					10																	25273745		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095021	CCDS7146.1, CCDS73075.1	10p12.31	2014-08-13	2009-04-28	2009-04-28	ENSG00000151023	ENSG00000151023			28388	protein-coding gene	gene with protein product		611025	"""chromosome 10 open reading frame 63"""	C10orf63		17217053, 15385169	Standard	NM_145010		Approved	MGC26778, enkurin, CFAP106	uc001isg.2	Q8TC29	OTTHUMG00000017827	ENST00000331161.4:c.684G>C	10.37:g.25273745C>G	ENSP00000331044:p.Gln228His		A8K8Y0|D3DRV2	Missense_Mutation	SNP	NULL	p.Q228H	ENST00000331161.4	37	c.684	CCDS7146.1	10	.	.	.	.	.	.	.	.	.	.	C	12.54	1.967953	0.34754	.	.	ENSG00000151023	ENST00000331161;ENST00000376363	.	.	.	5.25	2.64	0.31445	.	0.312348	0.35207	N	0.003374	T	0.38665	0.1049	L	0.51422	1.61	0.29643	N	0.844593	B;B	0.22851	0.076;0.076	B;B	0.25291	0.059;0.059	T	0.40831	-0.9542	9	0.59425	D	0.04	-9.5074	6.7101	0.23272	0.0:0.5664:0.0:0.4336	.	228;228	Q5VV23;Q8TC29	.;ENKUR_HUMAN	H	228	.	ENSP00000331044:Q228H	Q	-	3	2	ENKUR	25313751	0.707000	0.27866	1.000000	0.80357	0.839000	0.47603	0.125000	0.15749	1.083000	0.41159	0.557000	0.71058	CAG	ENKUR	-	NULL	ENSG00000151023		0.383	ENKUR-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENKUR	HGNC	protein_coding	OTTHUMT00000047239.2	161	0.00	0	C	NM_145010		25273745	25273745	-1	no_errors	ENST00000331161	ensembl	human	known	69_37n	missense	72	21.74	20	SNP	0.996	G
PLK1	5347	genome.wustl.edu	37	16	23702226	23702226	+	IGR	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr16:23702226C>G	ENST00000300093.4	+	0	2227				ERN2_ENST00000256797.4_Missense_Mutation_p.E951Q|CTD-2196E14.5_ENST00000566143.1_RNA|ERN2_ENST00000457008.2_Missense_Mutation_p.E851Q	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1						activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.E951K(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		AAGAGGCTCTCAGAGGCGCAG	0.642																																					Colon(12;240 564 27038 33155)	dbGAP											1	Substitution - Missense(1)	NS(1)											52.0	52.0	52.0					16																	23702226		2197	4300	6497	-	-	-	SO:0001628	intergenic_variant	0				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984		16.37:g.23702226C>G			Q15153|Q99746	Missense_Mutation	SNP	pfam_KEN_RNase_activator,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like,smart_PQQ_beta_propeller_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PUG-dom,pfscan_Prot_kinase_cat_dom	p.E951Q	ENST00000300093.4	37	c.2851	CCDS10616.1	16	.	.	.	.	.	.	.	.	.	.	C	17.01	3.278325	0.59758	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.33654	1.4;1.4	5.22	4.25	0.50352	.	0.106321	0.64402	N	0.000008	T	0.53786	0.1818	H	0.95712	3.71	0.58432	D	0.999997	B;B	0.33637	0.207;0.42	B;B	0.35114	0.102;0.196	T	0.65302	-0.6201	10	0.72032	D	0.01	.	13.6947	0.62569	0.0:0.8437:0.1563:0.0	.	851;903	E7ETG2;A5YM65	.;.	Q	951;851	ENSP00000256797:E951Q;ENSP00000413812:E851Q	ENSP00000256797:E951Q	E	-	1	0	ERN2	23609727	1.000000	0.71417	0.711000	0.30485	0.448000	0.32197	4.851000	0.62896	1.292000	0.44672	0.561000	0.74099	GAG	ERN2	-	pfam_KEN_RNase_activator	ENSG00000134398		0.642	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERN2	HGNC	protein_coding	OTTHUMT00000214057.2	46	0.00	0	C	NM_005030		23702226	23702226	-1	no_errors	ENST00000256797	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	0.998	G
FAM20A	54757	genome.wustl.edu	37	17	66538848	66538848	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr17:66538848G>C	ENST00000592554.1	-	6	1637	c.915C>G	c.(913-915)ttC>ttG	p.F305L	FAM20A_ENST00000226094.5_5'UTR|AC079210.1_ENST00000600820.1_5'Flank|PRKAR1A_ENST00000588188.2_Intron	NM_001243746.1|NM_017565.3	NP_001230675.1|NP_060035.2	Q96MK3	FA20A_HUMAN	family with sequence similarity 20, member A	305					calcium ion homeostasis (GO:0055074)|enamel mineralization (GO:0070166)|tooth eruption (GO:0044691)	cell (GO:0005623)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)				cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(1)	9	Breast(10;1.64e-13)					GAGAGACAAAGAAAACACTCT	0.517																																						dbGAP											0													106.0	107.0	107.0					17																	66538848		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056789	CCDS11679.1	17q24.2	2014-02-07			ENSG00000108950	ENSG00000108950			23015	protein-coding gene	gene with protein product		611062					Standard	NM_017565		Approved	DKFZp434F2322	uc002jho.3	Q96MK3	OTTHUMG00000180152	ENST00000592554.1:c.915C>G	17.37:g.66538848G>C	ENSP00000468308:p.Phe305Leu		B2RN47|B2RN49|Q9UF95	Missense_Mutation	SNP	pfam_DUF1193	p.F305L	ENST00000592554.1	37	c.915	CCDS11679.1	17	.	.	.	.	.	.	.	.	.	.	G	29.9	5.048860	0.93740	.	.	ENSG00000108950	ENST00000226094	.	.	.	6.04	6.04	0.98038	.	0.041214	0.85682	D	0.000000	T	0.81781	0.4895	M	0.88241	2.94	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	D	0.84237	0.0470	9	0.72032	D	0.01	-41.9378	14.6935	0.69103	0.0687:0.0:0.9313:0.0	.	305	Q96MK3	FA20A_HUMAN	L	305	.	ENSP00000226094:F305L	F	-	3	2	FAM20A	64050443	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.658000	0.83755	2.873000	0.98535	0.561000	0.74099	TTC	FAM20A	-	pfam_DUF1193	ENSG00000108950		0.517	FAM20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM20A	HGNC	protein_coding	OTTHUMT00000450029.2	129	0.00	0	G	NM_017565		66538848	66538848	-1	no_errors	ENST00000592554	ensembl	human	known	69_37n	missense	66	21.43	18	SNP	1.000	C
FAM20C	56975	genome.wustl.edu	37	7	298645	298645	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr7:298645C>G	ENST00000313766.5	+	9	1710	c.1479C>G	c.(1477-1479)atC>atG	p.I493M		NM_020223.3	NP_064608.2	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C	493	Kinase domain.				dentinogenesis (GO:0097187)|enamel mineralization (GO:0070166)|odontoblast differentiation (GO:0071895)|osteoclast maturation (GO:0036179)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of phosphorus metabolic process (GO:0051174)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|urinary_tract(1)	4		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		AGCTCTCCATCCTGGTGCCGC	0.612																																						dbGAP											0													142.0	137.0	138.0					7																	298645		692	1591	2283	-	-	-	SO:0001583	missense	0			BC040074	CCDS47522.1	7p22.3	2012-11-29			ENSG00000177706	ENSG00000177706			22140	protein-coding gene	gene with protein product	"""dentin matrix protein 4"""	611061				17369251, 17924334	Standard	NM_020223		Approved	IMAGE:4942737, DKFZp547D065, DMP4	uc003sip.3	Q8IXL6	OTTHUMG00000151401	ENST00000313766.5:c.1479C>G	7.37:g.298645C>G	ENSP00000322323:p.Ile493Met		A4D2Q5|L8B5W8|Q5I0W9|Q7Z4I0|Q9NPT2	Missense_Mutation	SNP	pfam_DUF1193	p.I493M	ENST00000313766.5	37	c.1479	CCDS47522.1	7	.	.	.	.	.	.	.	.	.	.	.	12.98	2.100644	0.37048	.	.	ENSG00000177706	ENST00000313766	D	0.83591	-1.74	4.51	-1.67	0.08238	.	.	.	.	.	D	0.90068	0.6898	M	0.91612	3.225	0.52501	D	0.999958	D	0.71674	0.998	D	0.74348	0.983	D	0.87256	0.2276	9	0.87932	D	0	.	6.4919	0.22119	0.1242:0.3962:0.0:0.4796	.	493	Q8IXL6	DMP4_HUMAN	M	493	ENSP00000322323:I493M	ENSP00000322323:I493M	I	+	3	3	FAM20C	.	0.070000	0.21116	0.996000	0.52242	0.574000	0.36063	-0.667000	0.05274	-0.158000	0.11040	0.549000	0.68633	ATC	FAM20C	-	pfam_DUF1193	ENSG00000177706		0.612	FAM20C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM20C	HGNC	protein_coding	OTTHUMT00000322476.2	87	0.00	0	C	NM_020223		298645	298645	+1	no_errors	ENST00000313766	ensembl	human	known	69_37n	missense	46	24.59	15	SNP	0.963	G
FAM71B	153745	genome.wustl.edu	37	5	156593170	156593170	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr5:156593170C>T	ENST00000302938.4	-	1	105	c.10G>A	c.(10-12)Gaa>Aaa	p.E4K		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	4						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAACAAGATTCATTGCTCATG	0.483																																						dbGAP											0													89.0	87.0	88.0					5																	156593170		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.10G>A	5.37:g.156593170C>T	ENSP00000305596:p.Glu4Lys		Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	pfam_DUF3699	p.E4K	ENST00000302938.4	37	c.10	CCDS4335.1	5	.	.	.	.	.	.	.	.	.	.	C	16.96	3.266631	0.59540	.	.	ENSG00000170613	ENST00000302938	T	0.04603	3.59	4.86	4.86	0.63082	.	0.238919	0.34555	N	0.003873	T	0.11922	0.0290	M	0.75447	2.3	0.37906	D	0.931217	P	0.45212	0.853	P	0.46144	0.505	T	0.01222	-1.1414	10	0.62326	D	0.03	-33.7014	14.211	0.65764	0.0:1.0:0.0:0.0	.	4	Q8TC56	FA71B_HUMAN	K	4	ENSP00000305596:E4K	ENSP00000305596:E4K	E	-	1	0	FAM71B	156525748	0.908000	0.30866	0.540000	0.28089	0.218000	0.24690	1.936000	0.40183	2.623000	0.88846	0.650000	0.86243	GAA	FAM71B	-	NULL	ENSG00000170613		0.483	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71B	HGNC	protein_coding	OTTHUMT00000252570.2	58	0.00	0	C	NM_130899		156593170	156593170	-1	no_errors	ENST00000302938	ensembl	human	known	69_37n	missense	31	24.39	10	SNP	0.866	T
RMDN1	51115	genome.wustl.edu	37	8	87489536	87489536	+	Silent	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr8:87489536G>A	ENST00000406452.3	-	8	906	c.747C>T	c.(745-747)caC>caT	p.H249H	RMDN1_ENST00000519966.1_Silent_p.H219H|RMDN1_ENST00000523911.1_Silent_p.H205H|RMDN1_ENST00000430676.2_Silent_p.H219H	NM_016033.2	NP_057117.2	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	249						microtubule (GO:0005874)|mitochondrion (GO:0005739)											GTTCTGCCCTGTGAAAGTAGC	0.294																																						dbGAP											0													38.0	38.0	38.0					8																	87489536		2202	4297	6499	-	-	-	SO:0001819	synonymous_variant	0			AK000672	CCDS34918.1, CCDS69509.1, CCDS69510.1	8q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000176623	ENSG00000176623			24285	protein-coding gene	gene with protein product		611871	"""family with sequence similarity 82, member B"""	FAM82B		10810093	Standard	NM_016033		Approved	CGI-90, FLJ20665, RMD1	uc003ydu.3	Q96DB5	OTTHUMG00000163692	ENST00000406452.3:c.747C>T	8.37:g.87489536G>A			A9UMZ8|B4DNF5|B4DZW6|B5MC61|C9JSC6|E7EVI2|Q9Y398	Nonsense_Mutation	SNP	NULL	p.Q195*	ENST00000406452.3	37	c.583	CCDS34918.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.904|7.904	0.735004|0.735004	0.15574|0.15574	.|.	.|.	ENSG00000176623|ENSG00000176623	ENST00000519789|ENST00000517710;ENST00000519639;ENST00000522942	.|.	.|.	.|.	5.51|5.51	-0.905|-0.905	0.10527|0.10527	.|.	.|.	.|.	.|.	.|.	.|T	.|0.51449	.|0.1675	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.42498	.|-0.9448	.|4	.|.	.|.	.|.	-0.6619|-0.6619	6.5111|6.5111	0.22222|0.22222	0.0672:0.0889:0.3131:0.5308|0.0672:0.0889:0.3131:0.5308	.|.	.|.	.|.	.|.	X|I	195|36;95;55	.|.	.|.	Q|T	-|-	1|2	0|0	FAM82B|FAM82B	87558652|87558652	0.742000|0.742000	0.28228|0.28228	0.995000|0.995000	0.50966|0.50966	0.998000|0.998000	0.95712|0.95712	-0.314000|-0.314000	0.08092|0.08092	0.024000|0.024000	0.15214|0.15214	0.655000|0.655000	0.94253|0.94253	CAG|ACA	FAM82B	-	NULL	ENSG00000176623		0.294	RMDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM82B	HGNC	protein_coding	OTTHUMT00000374770.2	74	0.00	0	G	NM_016033		87489536	87489536	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000519789	ensembl	human	putative	69_37n	nonsense	22	70.67	53	SNP	0.981	A
FAM98C	147965	genome.wustl.edu	37	19	38895681	38895681	+	Silent	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr19:38895681C>G	ENST00000252530.5	+	4	502	c.483C>G	c.(481-483)ctC>ctG	p.L161L	FAM98C_ENST00000588262.1_Intron|FAM98C_ENST00000585954.1_3'UTR|FAM98C_ENST00000343358.7_Silent_p.L161L	NM_174905.3	NP_777565.3	Q17RN3	FA98C_HUMAN	family with sequence similarity 98, member C	161										endometrium(2)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(60;3.95e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			ACCTTACCCTCCAAGCCCTGG	0.642																																						dbGAP											0													55.0	64.0	61.0					19																	38895681		2045	4192	6237	-	-	-	SO:0001819	synonymous_variant	0				CCDS42562.1	19q13.2	2008-02-05				ENSG00000130244			27119	protein-coding gene	gene with protein product						12477932	Standard	NM_174905		Approved	FLJ44669	uc002oin.1	Q17RN3		ENST00000252530.5:c.483C>G	19.37:g.38895681C>G			A6NMW3|Q66K45	Silent	SNP	pfam_Uncharacterised_FAM98	p.L161	ENST00000252530.5	37	c.483	CCDS42562.1	19																																																																																			FAM98C	-	pfam_Uncharacterised_FAM98	ENSG00000130244		0.642	FAM98C-001	KNOWN	basic|CCDS	protein_coding	FAM98C	HGNC	protein_coding	OTTHUMT00000459222.1	28	0.00	0	C	NM_174905		38895681	38895681	+1	no_errors	ENST00000252530	ensembl	human	known	69_37n	silent	46	22.03	13	SNP	0.536	G
FCN2	2220	genome.wustl.edu	37	9	137772751	137772751	+	Silent	SNP	G	G	A	rs533565828		TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr9:137772751G>A	ENST00000291744.6	+	1	94	c.84G>A	c.(82-84)gcG>gcA	p.A28A	FCN2_ENST00000350339.2_Silent_p.A28A	NM_004108.2	NP_004099.2	Q15485	FCN2_HUMAN	ficolin (collagen/fibrinogen domain containing lectin) 2	28					complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|opsonization (GO:0008228)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	20		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.58e-08)|Epithelial(140;6.41e-08)|all cancers(34;3.96e-07)		CTCTCCAGGCGGCAGACACCT	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		17989	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													32.0	36.0	34.0					9																	137772751		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			D49353	CCDS6983.1	9q34	2013-09-12	2013-09-12		ENSG00000160339	ENSG00000160339		"""Fibrinogen C domain containing"""	3624	protein-coding gene	gene with protein product	"""hucolin"", ""collagen/fibrinogen domain-containing protein 2"", ""ficolin B"", ""serum lectin p35"", ""L-ficolin"""	601624	"""ficolin (collagen/fibrinogen domain-containing lectin) 2 (hucolin)"""			8884275	Standard	XM_006717015		Approved	P35, FCNL, EBP-37, ficolin-2	uc004cfg.1	Q15485	OTTHUMG00000020892	ENST00000291744.6:c.84G>A	9.37:g.137772751G>A			A6NFG7|A8K478|Q6IS69|Q7M4P4|Q9UC57	Silent	SNP	pfam_Fibrinogen_a/b/g_C,pfam_Collagen,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.A28	ENST00000291744.6	37	c.84	CCDS6983.1	9																																																																																			FCN2	-	NULL	ENSG00000160339		0.617	FCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCN2	HGNC	protein_coding	OTTHUMT00000054960.1	38	0.00	0	G	NM_004108		137772751	137772751	+1	no_errors	ENST00000291744	ensembl	human	known	69_37n	silent	22	29.03	9	SNP	0.105	A
FCRL5	83416	genome.wustl.edu	37	1	157514217	157514217	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr1:157514217G>A	ENST00000361835.3	-	5	836	c.679C>T	c.(679-681)Cgc>Tgc	p.R227C	FCRL5_ENST00000368190.3_Missense_Mutation_p.R227C|FCRL5_ENST00000368191.3_Missense_Mutation_p.R142C|FCRL5_ENST00000356953.4_Missense_Mutation_p.R227C|FCRL5_ENST00000368189.3_Missense_Mutation_p.R227C	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	227	Ig-like C2-type 2.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CTGAAGAAGCGGAACCGGAGC	0.562																																						dbGAP											0													110.0	117.0	115.0					1																	157514217		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.679C>T	1.37:g.157514217G>A	ENSP00000354691:p.Arg227Cys		A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R227C	ENST00000361835.3	37	c.679	CCDS1165.1	1	.	.	.	.	.	.	.	.	.	.	G	8.684	0.905900	0.17760	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191;ENST00000368189	T;T;T;T;T	0.12774	2.65;2.65;2.65;2.65;2.65	4.23	-6.08	0.02151	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.475521	0.15826	N	0.242755	T	0.00906	0.0030	N	0.01874	-0.695	0.09310	N	0.999999	B;B;B;B;B	0.14805	0.001;0.001;0.005;0.011;0.005	B;B;B;B;B	0.12837	0.003;0.001;0.008;0.003;0.008	T	0.41179	-0.9523	10	0.35671	T	0.21	.	2.9769	0.05941	0.4101:0.112:0.3659:0.1121	.	142;227;227;227;227	F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9-4;Q96RD9	.;.;.;.;FCRL5_HUMAN	C	227;227;227;142;227	ENSP00000354691:R227C;ENSP00000349434:R227C;ENSP00000357173:R227C;ENSP00000357174:R142C;ENSP00000357172:R227C	ENSP00000349434:R227C	R	-	1	0	FCRL5	155780841	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.891000	0.04135	-1.131000	0.02910	-1.525000	0.00928	CGC	FCRL5	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000143297		0.562	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	40	0.00	0	G	NM_031281		157514217	157514217	-1	no_errors	ENST00000356953	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	0.001	A
FETUB	26998	genome.wustl.edu	37	3	186370419	186370419	+	Silent	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr3:186370419G>A	ENST00000265029.3	+	7	1249	c.1148G>A	c.(1147-1149)tGa>tAa	p.*383*	RP11-134F2.2_ENST00000428501.1_RNA|RP11-134F2.2_ENST00000455926.1_RNA|FETUB_ENST00000539949.1_Silent_p.*235*|FETUB_ENST00000450521.1_Silent_p.*383*|FETUB_ENST00000382134.3_Silent_p.*318*|FETUB_ENST00000382136.3_Silent_p.*346*	NM_014375.2	NP_055190.2	Q9UGM5	FETUB_HUMAN	fetuin B	0					binding of sperm to zona pellucida (GO:0007339)|negative regulation of endopeptidase activity (GO:0010951)|single fertilization (GO:0007338)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)	20	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		CTTCCGCCATGAGAATCACAC	0.587																																						dbGAP											0													32.0	34.0	33.0					3																	186370419		2203	4293	6496	-	-	-	SO:0001819	synonymous_variant	0			AJ242928	CCDS3279.1	3q27.3	2008-05-15			ENSG00000090512	ENSG00000090512			3658	protein-coding gene	gene with protein product		605954				10947975	Standard	XM_005247350		Approved		uc003fqn.3	Q9UGM5	OTTHUMG00000156586	ENST00000265029.3:c.1148G>A	3.37:g.186370419G>A			B2RCW6|E9PG06|Q1RMZ0|Q5J876|Q6DK58|Q6GRB6|Q9Y6Z0	Silent	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.*383	ENST00000265029.3	37	c.1148	CCDS3279.1	3																																																																																			FETUB	-	NULL	ENSG00000090512		0.587	FETUB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FETUB	HGNC	protein_coding	OTTHUMT00000344679.1	17	0.00	0	G	NM_014375		186370419	186370419	+1	no_errors	ENST00000265029	ensembl	human	known	69_37n	silent	9	50.00	9	SNP	0.294	A
FGF13	2258	genome.wustl.edu	37	X	137715074	137715074	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chrX:137715074C>G	ENST00000315930.6	-	5	1336	c.675G>C	c.(673-675)aaG>aaC	p.K225N	FGF13_ENST00000441825.2_Missense_Mutation_p.K206N|FGF13_ENST00000305414.4_Missense_Mutation_p.K172N|FGF13_ENST00000370603.3_Missense_Mutation_p.K235N|FGF13_ENST00000541469.1_Missense_Mutation_p.K179N	NM_004114.3	NP_004105.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13	225					cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)	p.K225K(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					CACTTCTGCTCTTGGTTGGGG	0.517																																						dbGAP											1	Substitution - coding silent(1)	ovary(1)											189.0	146.0	161.0					X																	137715074		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000315930.6:c.675G>C	X.37:g.137715074C>G	ENSP00000322390:p.Lys225Asn		B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	Missense_Mutation	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_IL1_HBGF,prints_GF_heparin-bd	p.K235N	ENST00000315930.6	37	c.705	CCDS14665.1	X	.	.	.	.	.	.	.	.	.	.	C	15.89	2.966709	0.53507	.	.	ENSG00000129682	ENST00000315930;ENST00000305414;ENST00000441825;ENST00000370603;ENST00000541469	T;T;T;T;T	0.81247	-1.21;-1.41;-1.43;-1.47;-1.37	5.79	3.78	0.43462	.	0.000000	0.85682	D	0.000000	T	0.81908	0.4922	L	0.42245	1.32	0.52501	D	0.999953	D;P;D;P	0.62365	0.986;0.949;0.991;0.64	P;P;P;B	0.62885	0.856;0.696;0.908;0.347	T	0.80812	-0.1215	10	0.52906	T	0.07	.	7.3109	0.26473	0.0:0.6747:0.0:0.3253	.	179;235;172;225	B7Z8N0;B7Z4M7;Q92913-2;Q92913	.;.;.;FGF13_HUMAN	N	225;172;206;235;179	ENSP00000322390:K225N;ENSP00000303391:K172N;ENSP00000409276:K206N;ENSP00000359635:K235N;ENSP00000437903:K179N	ENSP00000303391:K172N	K	-	3	2	FGF13	137542740	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.961000	0.40432	1.207000	0.43291	0.544000	0.68410	AAG	FGF13	-	NULL	ENSG00000129682		0.517	FGF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF13	HGNC	protein_coding	OTTHUMT00000058534.2	108	0.00	0	C	NM_004114		137715074	137715074	-1	no_errors	ENST00000370603	ensembl	human	known	69_37n	missense	44	32.31	21	SNP	1.000	G
GBAS	2631	genome.wustl.edu	37	7	56051543	56051543	+	Silent	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr7:56051543C>G	ENST00000322090.3	+	6	596	c.567C>G	c.(565-567)ctC>ctG	p.L189L	GBAS_ENST00000446778.1_Silent_p.L150L	NM_001483.2	NP_001474.1	O75323	NIPS2_HUMAN	glioblastoma amplified sequence	189					ATP biosynthetic process (GO:0006754)|negative regulation of ATP citrate synthase activity (GO:2000984)|oxidative phosphorylation (GO:0006119)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TATATGAACTCAGGTCTTACC	0.413																																						dbGAP											0													74.0	74.0	74.0					7																	56051543		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF029786	CCDS5521.1, CCDS56488.1	7p12	2014-03-11			ENSG00000146729	ENSG00000146729			4179	protein-coding gene	gene with protein product		603004				9615231, 9661659, 20888800	Standard	NM_001483		Approved	NIPSNAP2	uc003tre.2	O75323	OTTHUMG00000022932	ENST00000322090.3:c.567C>G	7.37:g.56051543C>G			C9IYJ3|O43801|Q53X96	Missense_Mutation	SNP	pfam_NIPSNAP,superfamily_Dimeric_a/b-barrel	p.Q97E	ENST00000322090.3	37	c.289	CCDS5521.1	7																																																																																			GBAS	-	superfamily_Dimeric_a/b-barrel	ENSG00000146729		0.413	GBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBAS	HGNC	protein_coding	OTTHUMT00000251524.1	65	0.00	0	C	NM_001483		56051543	56051543	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000415967	ensembl	human	known	69_37n	missense	26	27.03	10	SNP	0.994	G
GDA	9615	genome.wustl.edu	37	9	74810496	74810496	+	Silent	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr9:74810496G>C	ENST00000358399.3	+	2	297	c.204G>C	c.(202-204)ctG>ctC	p.L68L	GDA_ENST00000376989.3_Silent_p.L43L|GDA_ENST00000238018.4_Silent_p.L68L|GDA_ENST00000545168.1_5'UTR|GDA_ENST00000376986.1_Silent_p.L26L|GDA_ENST00000477618.1_3'UTR	NM_001242505.2|NM_001242506.2|NM_004293.4	NP_001229434.1|NP_001229435.1|NP_004284.1	Q9Y2T3	GUAD_HUMAN	guanine deaminase	68					guanine catabolic process (GO:0006147)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	guanine deaminase activity (GO:0008892)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(20)|ovary(2)|skin(2)|urinary_tract(1)	32		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		TAAGAGAACTGAGCCACCAGT	0.363																																						dbGAP											0													67.0	65.0	66.0					9																	74810496		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF095286	CCDS6641.1, CCDS56576.1, CCDS56577.1	9q21.13	2008-05-14			ENSG00000119125	ENSG00000119125			4212	protein-coding gene	gene with protein product		139260				10075721, 3966794	Standard	NM_001242507		Approved		uc004air.3	Q9Y2T3	OTTHUMG00000020005	ENST00000358399.3:c.204G>C	9.37:g.74810496G>C			B4DTY5|Q5SZC7|Q9H335|Q9ULG2	Silent	SNP	pfam_Amidohydro_1,tigrfam_Guanine_deaminase	p.L68	ENST00000358399.3	37	c.204	CCDS6641.1	9																																																																																			GDA	-	tigrfam_Guanine_deaminase	ENSG00000119125		0.363	GDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDA	HGNC	protein_coding	OTTHUMT00000052633.1	92	0.00	0	G			74810496	74810496	+1	no_errors	ENST00000238018	ensembl	human	known	69_37n	silent	51	17.74	11	SNP	0.995	C
GGTLC1	92086	genome.wustl.edu	37	20	23966380	23966380	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr20:23966380T>G	ENST00000335694.4	-	5	659	c.455A>C	c.(454-456)aAg>aCg	p.K152T	GGTLC1_ENST00000278765.4_Missense_Mutation_p.K152T|GGTLC1_ENST00000286890.4_Missense_Mutation_p.K152T	NM_178311.2	NP_842563.1	Q9BX51	GGTL1_HUMAN	gamma-glutamyltransferase light chain 1	152					glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)	gamma-glutamyltransferase activity (GO:0003840)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15						CACGGCCCACTTCACGTCATA	0.617																																						dbGAP											0													87.0	89.0	88.0					20																	23966380		2203	4297	6500	-	-	-	SO:0001583	missense	0			AL133466	CCDS13163.1	20p11.21	2010-07-14	2008-03-10	2008-03-10	ENSG00000149435	ENSG00000149435		"""Gamma-glutamyltransferases"""	16437	protein-coding gene	gene with protein product		612338	"""gamma-glutamyltransferase-like activity 4"", ""gamma-glutamyltransferase-like activity 3"""	GGTLA4, GGTLA3		10843999, 18357469	Standard	NM_178311		Approved	dJ831C21.2, dJ831C21.1	uc002wtu.3	Q9BX51	OTTHUMG00000032095	ENST00000335694.4:c.455A>C	20.37:g.23966380T>G	ENSP00000337587:p.Lys152Thr		D3DW43|Q08246	Missense_Mutation	SNP	pfam_GGT_peptidase,prints_GGT_peptidase	p.K152T	ENST00000335694.4	37	c.455	CCDS13163.1	20	.	.	.	.	.	.	.	.	.	.	t	15.90	2.970391	0.53614	.	.	ENSG00000149435	ENST00000286890;ENST00000278765;ENST00000335694	T;T;T	0.07216	3.21;3.21;3.21	0.844	0.844	0.18943	.	0.000000	0.85682	D	0.000000	T	0.10766	0.0263	M	0.76838	2.35	0.39942	D	0.974429	D	0.53745	0.962	B	0.43194	0.411	T	0.11299	-1.0593	10	0.42905	T	0.14	-29.6409	5.802	0.18420	0.0:1.0E-4:0.0:0.9999	.	152	Q9BX51	GGTL1_HUMAN	T	152	ENSP00000286890:K152T;ENSP00000278765:K152T;ENSP00000337587:K152T	ENSP00000278765:K152T	K	-	2	0	GGTLC1	23914380	0.999000	0.42202	0.195000	0.23364	0.197000	0.23852	0.922000	0.28734	0.077000	0.16863	0.076000	0.15429	AAG	GGTLC1	-	pfam_GGT_peptidase	ENSG00000149435		0.617	GGTLC1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	GGTLC1	HGNC	protein_coding	OTTHUMT00000078366.2	107	0.00	0	T	NM_178311.2		23966380	23966380	-1	no_errors	ENST00000278765	ensembl	human	known	69_37n	missense	47	21.67	13	SNP	1.000	G
GNL3L	54552	genome.wustl.edu	37	X	54574726	54574726	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chrX:54574726G>C	ENST00000336470.4	+	9	834	c.695G>C	c.(694-696)gGa>gCa	p.G232A	GNL3L_ENST00000360845.2_Missense_Mutation_p.G232A	NM_019067.5	NP_061940.1	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)-like	232	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	30						GCCTGCTTTGGAGCTGAAAAC	0.493																																						dbGAP											0													94.0	80.0	84.0					X																	54574726		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001475	CCDS14360.1	Xp11.22	2010-03-17			ENSG00000130119	ENSG00000130119			25553	protein-coding gene	gene with protein product		300873				12477932	Standard	NM_019067		Approved	FLJ10613	uc004dth.2	Q9NVN8	OTTHUMG00000021629	ENST00000336470.4:c.695G>C	X.37:g.54574726G>C	ENSP00000338573:p.Gly232Ala			Missense_Mutation	SNP	pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,prints_GTP_binding_domain	p.G232A	ENST00000336470.4	37	c.695	CCDS14360.1	X	.	.	.	.	.	.	.	.	.	.	G	18.65	3.669402	0.67814	.	.	ENSG00000130119	ENST00000336470;ENST00000360845	T;T	0.16897	2.31;2.31	3.94	3.94	0.45596	.	0.000000	0.85682	D	0.000000	T	0.52435	0.1734	H	0.94542	3.55	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.68792	-0.5315	10	0.87932	D	0	-11.108	14.7057	0.69189	0.0:0.0:1.0:0.0	.	232	Q9NVN8	GNL3L_HUMAN	A	232	ENSP00000338573:G232A;ENSP00000354091:G232A	ENSP00000338573:G232A	G	+	2	0	GNL3L	54591451	1.000000	0.71417	1.000000	0.80357	0.597000	0.36814	8.556000	0.90697	1.899000	0.54978	0.538000	0.68166	GGA	GNL3L	-	NULL	ENSG00000130119		0.493	GNL3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL3L	HGNC	protein_coding	OTTHUMT00000056805.1	108	0.00	0	G	NM_019067		54574726	54574726	+1	no_errors	ENST00000336470	ensembl	human	known	69_37n	missense	43	28.33	17	SNP	1.000	C
HCFC1	3054	genome.wustl.edu	37	X	153223547	153223547	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chrX:153223547C>G	ENST00000310441.7	-	11	2923	c.1957G>C	c.(1957-1959)Gtt>Ctt	p.V653L	HCFC1_ENST00000369984.4_Missense_Mutation_p.V653L|HCFC1_ENST00000354233.3_Missense_Mutation_p.V584L|HCFC1_ENST00000461098.1_5'Flank	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	653	Interaction with SIN3A.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCGCCCACAACTGTGGTCACC	0.612																																						dbGAP											0													58.0	59.0	59.0					X																	153223547		2134	4209	6343	-	-	-	SO:0001583	missense	0				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.1957G>C	X.37:g.153223547C>G	ENSP00000309555:p.Val653Leu		Q6P4G5	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.V653L	ENST00000310441.7	37	c.1957	CCDS44020.1	X	.	.	.	.	.	.	.	.	.	.	C	21.6	4.179107	0.78564	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.03496	4.02;4.02;3.91	5.7	4.83	0.62350	.	0.059142	0.64402	D	0.000002	T	0.03651	0.0104	L	0.29908	0.895	0.41054	D	0.985324	B	0.34372	0.451	B	0.30179	0.112	T	0.52540	-0.8562	10	0.48119	T	0.1	.	12.5365	0.56144	0.0:0.9163:0.0:0.0837	.	653	P51610	HCFC1_HUMAN	L	653;653;584	ENSP00000309555:V653L;ENSP00000359001:V653L;ENSP00000346174:V584L	ENSP00000309555:V653L	V	-	1	0	HCFC1	152876741	1.000000	0.71417	0.587000	0.28692	0.919000	0.55068	5.663000	0.68038	1.158000	0.42547	0.544000	0.68410	GTT	HCFC1	-	NULL	ENSG00000172534		0.612	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC1	HGNC	protein_coding	OTTHUMT00000061099.4	31	0.00	0	C	NM_005334		153223547	153223547	-1	no_errors	ENST00000310441	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	0.986	G
HECTD4	283450	genome.wustl.edu	37	12	112686210	112686210	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr12:112686210C>G	ENST00000430131.2	-	25	3936	c.2791G>C	c.(2791-2793)Gaa>Caa	p.E931Q	HECTD4_ENST00000550722.1_Missense_Mutation_p.E1207Q|HECTD4_ENST00000377560.5_Missense_Mutation_p.E1181Q			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	931					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GCATGTTCTTCTTGATATTGG	0.373																																						dbGAP											0													72.0	67.0	68.0					12																	112686210		1857	4099	5956	-	-	-	SO:0001583	missense	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.2791G>C	12.37:g.112686210C>G	ENSP00000404379:p.Glu931Gln		L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl,smart_HECT,pfscan_HECT	p.E1181Q	ENST00000430131.2	37	c.3541		12	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765329	0.69878	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.48522	0.81;0.81;0.81	5.92	5.92	0.95590	.	.	.	.	.	T	0.57607	0.2065	N	0.24115	0.695	0.58432	D	0.999993	D	0.57899	0.981	D	0.67900	0.954	T	0.58109	-0.7694	9	0.54805	T	0.06	.	20.3343	0.98733	0.0:1.0:0.0:0.0	.	931	Q9Y4D8	K0614_HUMAN	Q	1181;931;1207	ENSP00000366783:E1181Q;ENSP00000404379:E931Q;ENSP00000449784:E1207Q	ENSP00000366783:E1181Q	E	-	1	0	C12orf51	111170593	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.471000	0.80985	2.822000	0.97130	0.650000	0.86243	GAA	HECTD4	-	NULL	ENSG00000173064		0.373	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		116	0.00	0	C	NM_173813		112686210	112686210	-1	no_errors	ENST00000377560	ensembl	human	known	69_37n	missense	33	32.65	16	SNP	1.000	G
HNRNPR	10236	genome.wustl.edu	37	1	23660097	23660097	+	Silent	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr1:23660097G>A	ENST00000374612.1	-	5	535	c.412C>T	c.(412-414)Ctg>Ttg	p.L138L	HNRNPR_ENST00000374616.3_Silent_p.L138L|HNRNPR_ENST00000478691.1_Silent_p.L37L|HNRNPR_ENST00000302271.6_Silent_p.L138L|HNRNPR_ENST00000427764.2_Intron|HNRNPR_ENST00000606561.1_Intron|HNRNPR_ENST00000426846.2_Silent_p.L37L	NM_001102398.1|NM_005826.3	NP_001095868.1|NP_005817.1	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R	138	Asp/Glu-rich (acidic).				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		GTTACATCCAGAGTATAACCA	0.418																																						dbGAP											0													112.0	99.0	104.0					1																	23660097		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF000364	CCDS232.1, CCDS44085.1, CCDS60020.1, CCDS72726.1, CCDS72727.1	1p36.12	2013-02-12		2007-08-16	ENSG00000125944	ENSG00000125944		"""RNA binding motif (RRM) containing"""	5047	protein-coding gene	gene with protein product		607201		HNRPR		9421497	Standard	XM_005245711		Approved	hnRNP-R	uc001bgp.4	O43390	OTTHUMG00000003224	ENST00000374612.1:c.412C>T	1.37:g.23660097G>A			Q2L7G6|Q5TEH1|Q9BV64|S4R3J4	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.L138	ENST00000374612.1	37	c.412	CCDS232.1	1																																																																																			HNRNPR	-	tigrfam_HnRNP_R/Q_splicing_fac	ENSG00000125944		0.418	HNRNPR-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	HNRNPR	HGNC	protein_coding	OTTHUMT00000008889.1	48	0.00	0	G	NM_005826		23660097	23660097	-1	no_errors	ENST00000374616	ensembl	human	known	69_37n	silent	29	36.96	17	SNP	1.000	A
HTR3D	200909	genome.wustl.edu	37	3	183754563	183754563	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr3:183754563G>T	ENST00000382489.3	+	5	539	c.539G>T	c.(538-540)aGc>aTc	p.S180I	HTR3D_ENST00000428798.2_Missense_Mutation_p.S132I|HTR3D_ENST00000453435.1_Intron|HTR3D_ENST00000334128.2_Intron	NM_001163646.1	NP_001157118.1	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine (serotonin) receptor 3D, ionotropic	180					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)	10	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Ergoloid mesylate(DB01049)	ATGTCCAGGAGCTTTCAAATA	0.532																																						dbGAP											0													69.0	63.0	65.0					3																	183754563		692	1591	2283	-	-	-	SO:0001583	missense	0			AY159812	CCDS3249.1, CCDS46966.1, CCDS54685.1	3q27	2012-05-22	2012-02-03		ENSG00000186090	ENSG00000186090		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24004	protein-coding gene	gene with protein product		610122	"""5-hydroxytryptamine (serotonin) receptor 3 family member D"""			12801637	Standard	NM_001145143		Approved		uc011bqv.2	Q70Z44	OTTHUMG00000156858	ENST00000382489.3:c.539G>T	3.37:g.183754563G>T	ENSP00000371929:p.Ser180Ile		C9J2I6|J3QT78|Q495N5|Q495N6|Q7Z6B3	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd	p.S180I	ENST00000382489.3	37	c.539	CCDS54685.1	3	.	.	.	.	.	.	.	.	.	.	g	10.42	1.346139	0.24426	.	.	ENSG00000186090	ENST00000428798;ENST00000382489	T;T	0.76968	-1.06;-0.93	5.3	1.19	0.21007	Neurotransmitter-gated ion-channel ligand-binding (1);	1.180070	0.05984	N	0.644847	T	0.61148	0.2324	L	0.29908	0.895	0.18873	N	0.999987	P	0.39831	0.69	B	0.29942	0.109	T	0.54057	-0.8350	10	0.72032	D	0.01	0.0142	3.5836	0.07962	0.2714:0.0:0.5047:0.2239	.	180	Q70Z44	5HT3D_HUMAN	I	132;180	ENSP00000405409:S132I;ENSP00000371929:S180I	ENSP00000371929:S180I	S	+	2	0	HTR3D	185237257	0.594000	0.26849	0.001000	0.08648	0.007000	0.05969	0.613000	0.24299	0.013000	0.14918	-0.198000	0.12761	AGC	HTR3D	-	superfamily_Neur_chan_lig-bd	ENSG00000186090		0.532	HTR3D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HTR3D	HGNC	protein_coding	OTTHUMT00000346289.1	40	0.00	0	G	NM_182537		183754563	183754563	+1	no_errors	ENST00000382489	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.003	T
IBTK	25998	genome.wustl.edu	37	6	82906055	82906055	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr6:82906055G>A	ENST00000306270.7	-	22	3683	c.3134C>T	c.(3133-3135)tCc>tTc	p.S1045F	IBTK_ENST00000503631.1_Missense_Mutation_p.S844F|IBTK_ENST00000510291.1_Missense_Mutation_p.S1030F	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	1045					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		GAAATCAGGGGACTGTAAATC	0.393																																						dbGAP											0													114.0	112.0	113.0					6																	82906055		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.3134C>T	6.37:g.82906055G>A	ENSP00000305721:p.Ser1045Phe		Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like,pfscan_Reg_chr_condens	p.S1045F	ENST00000306270.7	37	c.3134	CCDS34490.1	6	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541212	0.85917	.	.	ENSG00000005700	ENST00000306270;ENST00000503631;ENST00000510291	T;T;T	0.39997	1.51;1.05;1.16	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.56202	0.1969	M	0.65498	2.005	0.80722	D	1	D;P;P;P	0.71674	0.998;0.678;0.776;0.678	D;P;P;P	0.65010	0.931;0.556;0.65;0.556	T	0.52616	-0.8552	10	0.45353	T	0.12	-8.9975	19.8072	0.96535	0.0:0.0:1.0:0.0	.	844;1030;1045;1045	E9PDR5;E7EPI0;Q9P2D0-2;Q9P2D0	.;.;.;IBTK_HUMAN	F	1045;844;1030	ENSP00000305721:S1045F;ENSP00000422762:S844F;ENSP00000426405:S1030F	ENSP00000305721:S1045F	S	-	2	0	IBTK	82962774	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	8.325000	0.90007	2.742000	0.94016	0.558000	0.71614	TCC	IBTK	-	NULL	ENSG00000005700		0.393	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBTK	HGNC	protein_coding	OTTHUMT00000041337.2	91	0.00	0	G	NM_015525		82906055	82906055	-1	no_errors	ENST00000306270	ensembl	human	known	69_37n	missense	47	24.19	15	SNP	1.000	A
ITGAM	3684	genome.wustl.edu	37	16	31341642	31341642	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr16:31341642C>T	ENST00000287497.8	+	27	3149	c.3074C>T	c.(3073-3075)gCt>gTt	p.A1025V	ITGAM_ENST00000544665.3_Missense_Mutation_p.A1026V			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	1025					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						TGCTCCATCGCTGTCTGCCAG	0.547																																						dbGAP											0													72.0	73.0	73.0					16																	31341642		2007	4184	6191	-	-	-	SO:0001583	missense	0			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.3074C>T	16.37:g.31341642C>T	ENSP00000287497:p.Ala1025Val		Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.A1026V	ENST00000287497.8	37	c.3077	CCDS45470.1	16	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394049	0.83011	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.53640	0.61;0.61	5.51	5.51	0.81932	.	.	.	.	.	T	0.72366	0.3451	M	0.86651	2.83	0.35770	D	0.820827	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	T	0.82157	-0.0596	9	0.87932	D	0	.	14.9214	0.70841	0.0:1.0:0.0:0.0	.	1025;1025	Q4VAK1;P11215	.;ITAM_HUMAN	V	1026;1025	ENSP00000441691:A1026V;ENSP00000287497:A1025V	ENSP00000287497:A1025V	A	+	2	0	ITGAM	31249143	0.974000	0.33945	0.186000	0.23195	0.970000	0.65996	3.892000	0.56235	2.594000	0.87642	0.453000	0.30009	GCT	ITGAM	-	NULL	ENSG00000169896		0.547	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAM	HGNC	protein_coding	OTTHUMT00000432816.1	46	0.00	0	C	NM_000632		31341642	31341642	+1	no_errors	ENST00000544665	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	0.723	T
ITSN2	50618	genome.wustl.edu	37	2	24433779	24433779	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr2:24433779G>T	ENST00000355123.4	-	34	4570	c.4127C>A	c.(4126-4128)tCc>tAc	p.S1376Y	ITSN2_ENST00000361999.3_Missense_Mutation_p.S1349Y	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	1376	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTTAGGGAGGAATGGTCTGC	0.587																																						dbGAP											0													82.0	76.0	78.0					2																	24433779		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.4127C>A	2.37:g.24433779G>T	ENSP00000347244:p.Ser1376Tyr		O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,pfam_C2_Ca-dep,superfamily_DH-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain,prints_p67phox	p.S1376Y	ENST00000355123.4	37	c.4127	CCDS1710.2	2	.	.	.	.	.	.	.	.	.	.	G	10.15	1.271898	0.23221	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868	T;T;T	0.64260	-0.09;-0.09;-0.09	4.73	2.9	0.33743	Dbl homology (DH) domain (5);	0.523000	0.14379	U	0.323224	T	0.65004	0.2650	L	0.58101	1.795	0.31066	N	0.713542	D;D	0.69078	0.996;0.997	P;P	0.57244	0.719;0.816	T	0.61143	-0.7122	10	0.23891	T	0.37	.	5.3065	0.15807	0.0803:0.381:0.4147:0.1239	.	1349;1376	Q9NZM3-2;Q9NZM3	.;ITSN2_HUMAN	Y	1349;1376;1349	ENSP00000354561:S1349Y;ENSP00000347244:S1376Y;ENSP00000370250:S1349Y	ENSP00000347244:S1376Y	S	-	2	0	ITSN2	24287283	0.997000	0.39634	0.968000	0.41197	0.648000	0.38561	1.395000	0.34520	0.521000	0.28445	-0.216000	0.12614	TCC	ITSN2	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000198399		0.587	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ITSN2	HGNC	protein_coding	OTTHUMT00000207620.2	44	0.00	0	G	NM_006277		24433779	24433779	-1	no_errors	ENST00000355123	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.620	T
KAT6A	7994	genome.wustl.edu	37	8	41791830	41791830	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr8:41791830T>C	ENST00000396930.3	-	18	4451	c.3908A>G	c.(3907-3909)gAt>gGt	p.D1303G	KAT6A_ENST00000406337.1_Missense_Mutation_p.D1303G|KAT6A_ENST00000265713.2_Missense_Mutation_p.D1303G	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1303					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TGCAGCTGCAtcttcctcctc	0.567																																						dbGAP											0													165.0	141.0	149.0					8																	41791830		2203	4300	6503	-	-	-	SO:0001583	missense	0			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.3908A>G	8.37:g.41791830T>C	ENSP00000380136:p.Asp1303Gly		Q76L81	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.D1303G	ENST00000396930.3	37	c.3908	CCDS6124.1	8	.	.	.	.	.	.	.	.	.	.	T	6.534	0.466818	0.12402	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.61980	0.06;0.06;0.06	5.75	5.75	0.90469	.	0.234180	0.36409	N	0.002613	T	0.46112	0.1376	N	0.08118	0	0.38166	D	0.939172	B	0.21606	0.058	B	0.23419	0.046	T	0.50617	-0.8807	10	0.66056	D	0.02	-2.2952	16.0545	0.80788	0.0:0.0:0.0:1.0	.	1303	Q92794	KAT6A_HUMAN	G	1303	ENSP00000265713:D1303G;ENSP00000385888:D1303G;ENSP00000380136:D1303G	ENSP00000265713:D1303G	D	-	2	0	KAT6A	41910987	1.000000	0.71417	0.634000	0.29324	0.008000	0.06430	4.442000	0.59988	2.195000	0.70347	0.533000	0.62120	GAT	KAT6A	-	NULL	ENSG00000083168		0.567	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6A	HGNC	protein_coding	OTTHUMT00000318163.1	160	0.00	0	T	NM_006766		41791830	41791830	-1	no_errors	ENST00000265713	ensembl	human	known	69_37n	missense	95	24.60	31	SNP	0.997	C
KBTBD2	25948	genome.wustl.edu	37	7	32910255	32910255	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr7:32910255C>T	ENST00000304056.4	-	4	1273	c.574G>A	c.(574-576)Gaa>Aaa	p.E192K	KBTBD2_ENST00000485611.1_5'Flank|AVL9_ENST00000404479.1_Intron	NM_015483.2	NP_056298.2	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	192										endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|urinary_tract(1)	17			GBM - Glioblastoma multiforme(11;0.0499)			CGAACGGTTTCTTCCTTTTCT	0.413																																						dbGAP											0													99.0	98.0	98.0					7																	32910255		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040922	CCDS34614.1	7p14.3	2013-01-08	2003-12-12	2003-12-12	ENSG00000170852	ENSG00000170852		"""BTB/POZ domain containing"""	21751	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 1"""	BKLHD1		10819331	Standard	NM_015483		Approved	DKFZP566C134	uc003tdb.2	Q8IY47	OTTHUMG00000152984	ENST00000304056.4:c.574G>A	7.37:g.32910255C>T	ENSP00000302586:p.Glu192Lys		A8K9T7|Q86Y62|Q9P239|Q9UFM7|Q9Y382	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,pfam_Kelch_1,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.E192K	ENST00000304056.4	37	c.574	CCDS34614.1	7	.	.	.	.	.	.	.	.	.	.	C	24.4	4.527032	0.85706	.	.	ENSG00000170852	ENST00000304056	T	0.70631	-0.5	5.72	5.72	0.89469	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.83482	0.5264	L	0.61036	1.89	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	D	0.83786	0.0228	10	0.87932	D	0	.	20.2441	0.98394	0.0:1.0:0.0:0.0	.	192	Q8IY47	KBTB2_HUMAN	K	192	ENSP00000302586:E192K	ENSP00000302586:E192K	E	-	1	0	KBTBD2	32876780	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.776000	0.85560	2.865000	0.98341	0.655000	0.94253	GAA	KBTBD2	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000170852		0.413	KBTBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD2	HGNC	protein_coding	OTTHUMT00000328890.1	87	0.00	0	C	XM_291224		32910255	32910255	-1	no_errors	ENST00000304056	ensembl	human	known	69_37n	missense	44	13.73	7	SNP	1.000	T
ZSWIM8	23053	genome.wustl.edu	37	10	75552020	75552020	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr10:75552020C>G	ENST00000605216.1	+	10	1940	c.1723C>G	c.(1723-1725)Cta>Gta	p.L575V	ZSWIM8_ENST00000604524.1_Missense_Mutation_p.L575V|ZSWIM8_ENST00000603114.1_Missense_Mutation_p.L575V|ZSWIM8_ENST00000431225.1_3'UTR|ZSWIM8_ENST00000604729.1_Missense_Mutation_p.L575V|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.L575V	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	575	Gly-rich.						zinc ion binding (GO:0008270)										AGATAAAGCTCTACATAAGAT	0.652																																						dbGAP											0													20.0	24.0	23.0					10																	75552020		1932	4122	6054	-	-	-	SO:0001583	missense	0			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.1723C>G	10.37:g.75552020C>G	ENSP00000474748:p.Leu575Val		B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	pfscan_Znf_SWIM	p.L575V	ENST00000605216.1	37	c.1723		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.648|5.648	0.304165|0.304165	0.10678|0.10678	.|.	.|.	ENSG00000214655|ENSG00000214655	ENST00000398706|ENST00000433366	T|.	0.42900|.	0.96|.	5.55|5.55	-3.72|-3.72	0.04411|0.04411	.|.	0.670432|.	0.11794|.	U|.	0.528882|.	T|T	0.15305|0.15305	0.0369|0.0369	N|N	0.17082|0.17082	0.46|0.46	0.09310|0.09310	N|N	1|1	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.04013|.	0.0;0.001;0.0|.	T|T	0.26292|0.26292	-1.0107|-1.0107	10|5	0.26408|.	T|.	0.33|.	-0.0136|-0.0136	0.319|0.319	0.00300|0.00300	0.2484:0.1659:0.2592:0.3266|0.2484:0.1659:0.2592:0.3266	.|.	575;575;575|.	A7E2V4;A7E2V4-5;A7E2V4-4|.	K0913_HUMAN;.;.|.	V|C	575|297	ENSP00000381693:L575V|.	ENSP00000381693:L575V|.	L|S	+|+	1|2	2|0	KIAA0913|KIAA0913	75222026|75222026	0.055000|0.055000	0.20627|0.20627	0.851000|0.851000	0.33527|0.33527	0.778000|0.778000	0.44026|0.44026	-0.120000|-0.120000	0.10660|0.10660	-0.297000|-0.297000	0.08934|0.08934	-0.136000|-0.136000	0.14681|0.14681	CTA|TCT	KIAA0913	-	NULL	ENSG00000214655		0.652	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	KIAA0913	HGNC	protein_coding	OTTHUMT00000468545.1	19	0.00	0	C	NM_001242487		75552020	75552020	+1	no_errors	ENST00000398706	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	0.113	G
MAP10	54627	genome.wustl.edu	37	1	232943549	232943549	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr1:232943549A>G	ENST00000418460.1	+	1	2907	c.2780A>G	c.(2779-2781)gAt>gGt	p.D927G		NM_019090.2	NP_061963.2	Q9P2G4	MAP10_HUMAN	microtubule-associated protein 10	785					cytoplasmic microtubule organization (GO:0031122)|positive regulation of cytokinesis (GO:0032467)|regulation of microtubule-based process (GO:0032886)|spindle midzone assembly involved in mitosis (GO:0051256)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)	microtubule binding (GO:0008017)										AAGACTCAGGATAAAAGTTTG	0.368																																						dbGAP											0													50.0	50.0	50.0					1																	232943549		1823	4079	5902	-	-	-	SO:0001583	missense	0			AB037804	CCDS44334.1	1q42.2	2013-02-12	2013-02-12	2013-02-12	ENSG00000212916	ENSG00000212916			29265	protein-coding gene	gene with protein product	"""microtubule regulator 120 KDa"""		"""KIAA1383"""	KIAA1383		23264731	Standard	NM_019090		Approved	MTR120	uc001hvh.2	Q9P2G4	OTTHUMG00000037819	ENST00000418460.1:c.2780A>G	1.37:g.232943549A>G	ENSP00000403208:p.Asp927Gly		A8K2F1|Q32MI1|Q58EZ9|Q5VV83	Missense_Mutation	SNP	NULL	p.D927G	ENST00000418460.1	37	c.2780	CCDS44334.1	1	.	.	.	.	.	.	.	.	.	.	A	1.793	-0.478964	0.04414	.	.	ENSG00000212916	ENST00000418460	.	.	.	5.94	0.665	0.17896	.	0.192576	0.24191	U	0.040705	T	0.26448	0.0646	L	0.48642	1.525	0.09310	N	1	B	0.18013	0.025	B	0.18561	0.022	T	0.16808	-1.0390	9	0.10111	T	0.7	-8.3027	4.5995	0.12347	0.3686:0.3136:0.3177:0.0	.	785	Q9P2G4	K1383_HUMAN	G	927	.	ENSP00000403208:D927G	D	+	2	0	KIAA1383	231010172	0.000000	0.05858	0.006000	0.13384	0.401000	0.30781	0.290000	0.18975	0.474000	0.27392	0.482000	0.46254	GAT	KIAA1383	-	NULL	ENSG00000212916		0.368	MAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1383	HGNC	protein_coding	OTTHUMT00000092317.3	60	0.00	0	A	NM_019090		232943549	232943549	+1	no_errors	ENST00000418460	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	0.000	G
LAMB4	22798	genome.wustl.edu	37	7	107669499	107669499	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr7:107669499C>T	ENST00000388781.3	-	33	5218	c.5135G>A	c.(5134-5136)aGa>aAa	p.R1712K	LAMB4_ENST00000205386.4_Missense_Mutation_p.R1712K|LAMB4_ENST00000388780.3_Missense_Mutation_p.R1712K|LAMB4_ENST00000483484.1_5'UTR	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1712	Domain I.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						TGTTATTCTTCTTATCTTGGC	0.368																																						dbGAP											0													183.0	172.0	176.0					7																	107669499		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.5135G>A	7.37:g.107669499C>T	ENSP00000373433:p.Arg1712Lys		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.R1712K	ENST00000388781.3	37	c.5135	CCDS34732.1	7	.	.	.	.	.	.	.	.	.	.	C	9.387	1.074458	0.20227	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000422975;ENST00000388780	T;T;T;T	0.77620	1.6;1.6;-1.11;1.62	4.54	-0.936	0.10419	.	0.621647	0.13032	N	0.419280	T	0.59945	0.2231	L	0.34521	1.04	0.22424	N	0.999114	B;B	0.17038	0.013;0.02	B;B	0.21708	0.036;0.012	T	0.40720	-0.9548	10	0.16896	T	0.51	.	4.2393	0.10640	0.0:0.3135:0.1844:0.5021	.	1712;1712	A4D0S4-3;A4D0S4	.;LAMB4_HUMAN	K	1712;1712;738;1712	ENSP00000205386:R1712K;ENSP00000373433:R1712K;ENSP00000416562:R738K;ENSP00000373432:R1712K	ENSP00000205386:R1712K	R	-	2	0	LAMB4	107456735	0.082000	0.21442	0.099000	0.21106	0.970000	0.65996	0.125000	0.15749	-0.066000	0.12998	-0.150000	0.13652	AGA	LAMB4	-	NULL	ENSG00000091128		0.368	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB4	HGNC	protein_coding	OTTHUMT00000337442.1	187	0.00	0	C	XM_209857		107669499	107669499	-1	no_errors	ENST00000205386	ensembl	human	known	69_37n	missense	119	14.39	20	SNP	0.064	T
LOXHD1	125336	genome.wustl.edu	37	18	44190796	44190796	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr18:44190796C>T	ENST00000441551.2	-	6	701	c.702G>A	c.(700-702)atG>atA	p.M234I	LOXHD1_ENST00000536736.1_Missense_Mutation_p.M234I			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	809	PLAT 2. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						CATTGATCTTCATCAGCTGCC	0.527																																						dbGAP											0													109.0	120.0	117.0					18																	44190796		692	1591	2283	-	-	-	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000441551.2:c.702G>A	18.37:g.44190796C>T	ENSP00000387621:p.Met234Ile		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	p.M234I	ENST00000441551.2	37	c.702		18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.393|8.393	0.840235|0.840235	0.16891|0.16891	.|.	.|.	ENSG00000167210|ENSG00000167210	ENST00000441551|ENST00000536736	.|T	.|0.62788	.|0.0	5.55|5.55	0.972|0.972	0.19704|0.19704	.|.	.|.	.|.	.|.	.|.	T|T	0.35998|0.35998	0.0951|0.0951	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.05818|0.05818	-1.0862|-1.0862	5|9	.|0.22706	.|T	.|0.39	.|.	8.2914|8.2914	0.31960|0.31960	0.0:0.5737:0.24:0.1863|0.0:0.5737:0.24:0.1863	.|.	.|234	.|F5GZB4	.|.	K|I	215|234	.|ENSP00000444586:M234I	.|ENSP00000444586:M234I	E|M	-|-	1|3	0|0	LOXHD1|LOXHD1	42444794|42444794	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.404000|0.404000	0.30871|0.30871	0.673000|0.673000	0.25203|0.25203	0.263000|0.263000	0.21812|0.21812	0.467000|0.467000	0.42956|0.42956	GAA|ATG	LOXHD1	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	ENSG00000167210		0.527	LOXHD1-013	NOVEL	not_organism_supported|basic	protein_coding	LOXHD1	HGNC	protein_coding	OTTHUMT00000446054.1	92	0.00	0	C	NM_144612		44190796	44190796	-1	no_errors	ENST00000536736	ensembl	human	known	69_37n	missense	26	43.48	20	SNP	1.000	T
LRIF1	55791	genome.wustl.edu	37	1	111495184	111495184	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr1:111495184G>C	ENST00000369763.4	-	2	712	c.322C>G	c.(322-324)Ctt>Gtt	p.L108V	LRIF1_ENST00000485275.2_Intron|LRIF1_ENST00000494675.1_5'UTR|RP11-96K19.2_ENST00000440689.1_RNA	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	108				LTRT -> PSRP (in Ref. 1; AAO43631). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						GTTCTTGTAAGAAAATAGTTT	0.378																																						dbGAP											0													88.0	92.0	90.0					1																	111495184		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.322C>G	1.37:g.111495184G>C	ENSP00000358778:p.Leu108Val		Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Missense_Mutation	SNP	NULL	p.L108V	ENST00000369763.4	37	c.322	CCDS30800.1	1	.	.	.	.	.	.	.	.	.	.	G	9.970	1.225260	0.22457	.	.	ENSG00000121931	ENST00000369763	T	0.37058	1.22	5.65	3.63	0.41609	.	0.174336	0.38005	N	0.001851	T	0.10937	0.0267	L	0.29908	0.895	0.80722	D	1	P	0.46395	0.877	B	0.38500	0.275	T	0.04796	-1.0926	10	0.66056	D	0.02	-1.1923	5.155	0.15031	0.1876:0.0:0.6537:0.1587	.	108	Q5T3J3	LRIF1_HUMAN	V	108	ENSP00000358778:L108V	ENSP00000358778:L108V	L	-	1	0	LRIF1	111296707	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.101000	0.41787	0.624000	0.30286	0.467000	0.42956	CTT	LRIF1	-	NULL	ENSG00000121931		0.378	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRIF1	HGNC	protein_coding	OTTHUMT00000032932.2	121	0.00	0	G	NM_018372		111495184	111495184	-1	no_errors	ENST00000369763	ensembl	human	known	69_37n	missense	54	15.62	10	SNP	1.000	C
LRRC1	55227	genome.wustl.edu	37	6	53764633	53764633	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr6:53764633C>T	ENST00000370888.1	+	8	1008	c.731C>T	c.(730-732)tCa>tTa	p.S244L		NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	244						cytoplasm (GO:0005737)|membrane (GO:0016020)				cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		GGCCTGACTTCATTAACGGAT	0.398																																						dbGAP											0													127.0	117.0	120.0					6																	53764633		1879	4097	5976	-	-	-	SO:0001583	missense	0			AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.731C>T	6.37:g.53764633C>T	ENSP00000359925:p.Ser244Leu		Q5TGN3|Q9HAC0|Q9NVF1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S244L	ENST00000370888.1	37	c.731	CCDS4953.2	6	.	.	.	.	.	.	.	.	.	.	C	18.49	3.636367	0.67130	.	.	ENSG00000137269	ENST00000370888	T	0.16897	2.31	5.64	5.64	0.86602	.	0.066313	0.64402	D	0.000007	T	0.12646	0.0307	L	0.38649	1.16	0.80722	D	1	P	0.43578	0.811	P	0.45660	0.489	T	0.02588	-1.1137	10	0.33141	T	0.24	.	18.693	0.91590	0.0:1.0:0.0:0.0	.	244	Q9BTT6	LRRC1_HUMAN	L	244	ENSP00000359925:S244L	ENSP00000359925:S244L	S	+	2	0	LRRC1	53872592	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.474000	0.81024	2.654000	0.90174	0.650000	0.86243	TCA	LRRC1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000137269		0.398	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC1	HGNC	protein_coding	OTTHUMT00000040970.2	108	0.00	0	C	NM_025168		53764633	53764633	+1	no_errors	ENST00000370888	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	1.000	T
MAGEC3	139081	genome.wustl.edu	37	X	140983304	140983304	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chrX:140983304G>A	ENST00000298296.1	+	6	1082	c.1082G>A	c.(1081-1083)cGa>cAa	p.R361Q	MAGEC3_ENST00000443323.2_Intron|MAGEC3_ENST00000448920.1_3'UTR|MAGEC3_ENST00000536088.1_Intron|MAGEC3_ENST00000483584.1_Intron|MAGEC3_ENST00000544766.1_Intron|MAGEC3_ENST00000409007.1_5'Flank	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	361	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					GATGGCCGCCGAGGGCTGACC	0.602																																						dbGAP											0													33.0	35.0	34.0					X																	140983304		2200	4297	6497	-	-	-	SO:0001583	missense	0			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1082G>A	X.37:g.140983304G>A	ENSP00000298296:p.Arg361Gln		Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.R361Q	ENST00000298296.1	37	c.1082	CCDS14676.1	X	.	.	.	.	.	.	.	.	.	.	g	6.373	0.437002	0.12104	.	.	ENSG00000165509	ENST00000298296	T	0.03441	3.93	0.614	-1.23	0.09465	.	.	.	.	.	T	0.00967	0.0032	N	0.02011	-0.69	0.09310	N	0.99999	P	0.35011	0.48	B	0.13407	0.009	T	0.43393	-0.9394	8	0.19147	T	0.46	.	.	.	.	.	361	Q8TD91	MAGC3_HUMAN	Q	361	ENSP00000298296:R361Q	ENSP00000298296:R361Q	R	+	2	0	MAGEC3	140810970	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.637000	0.05459	-1.120000	0.02953	0.273000	0.19326	CGA	MAGEC3	-	NULL	ENSG00000165509		0.602	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1	33	0.00	0	G	NM_138702		140983304	140983304	+1	no_errors	ENST00000298296	ensembl	human	known	69_37n	missense	17	34.62	9	SNP	0.000	A
MAP3K9	4293	genome.wustl.edu	37	14	71199275	71199275	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr14:71199275C>G	ENST00000554752.2	-	11	2810	c.2811G>C	c.(2809-2811)ttG>ttC	p.L937F	MAP3K9_ENST00000554146.1_Missense_Mutation_p.L665F|MAP3K9_ENST00000381250.4_Missense_Mutation_p.L914F|MAP3K9_ENST00000553414.1_Missense_Mutation_p.L670F|MAP3K9_ENST00000555993.2_Missense_Mutation_p.L951F	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	937	Pro-rich.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		GACTGGGGCTCAACCCATTGC	0.572																																					GBM(114;411 1587 13539 28235 50070)	dbGAP											0													59.0	68.0	65.0					14																	71199275		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.2811G>C	14.37:g.71199275C>G	ENSP00000451612:p.Leu937Phe		A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_Regulat_G_prot_signal_superfam,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom	p.L951F	ENST00000554752.2	37	c.2853		14	.	.	.	.	.	.	.	.	.	.	C	9.452	1.090733	0.20471	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000553414;ENST00000381250;ENST00000554146;ENST00000542284	T;T;T;T	0.75938	-0.98;-0.97;-0.96;-0.94	4.53	2.71	0.32032	.	0.791938	0.11603	N	0.547618	T	0.59770	0.2218	L	0.29908	0.895	0.26752	N	0.970182	B;B;B;P	0.35077	0.045;0.437;0.078;0.483	B;B;B;B	0.39419	0.045;0.08;0.074;0.299	T	0.48019	-0.9071	10	0.09590	T	0.72	.	5.7057	0.17907	0.0:0.5398:0.0:0.4602	.	665;937;951;670	G3V4P9;P80192;P80192-4;G3V347	.;M3K9_HUMAN;.;.	F	937;951;670;914;665;653	ENSP00000451612:L937F;ENSP00000451038:L670F;ENSP00000370649:L914F;ENSP00000451921:L665F	ENSP00000005198:L951F	L	-	3	2	MAP3K9	70269028	0.987000	0.35691	0.932000	0.37286	0.995000	0.86356	0.558000	0.23469	0.547000	0.28938	0.561000	0.74099	TTG	MAP3K9	-	pirsf_MAPKKK9/10/11	ENSG00000006432		0.572	MAP3K9-001	KNOWN	basic	protein_coding	MAP3K9	HGNC	protein_coding	OTTHUMT00000412550.2	55	0.00	0	C			71199275	71199275	-1	no_errors	ENST00000555993	ensembl	human	known	69_37n	missense	26	29.73	11	SNP	0.894	G
MDN1	23195	genome.wustl.edu	37	6	90400436	90400436	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr6:90400436C>T	ENST00000369393.3	-	64	10820	c.10705G>A	c.(10705-10707)Gag>Aag	p.E3569K	MDN1_ENST00000428876.1_Missense_Mutation_p.E3569K			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	3569	Poly-Glu.				ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CGTTCTTCCTCCTCCTCTTCA	0.507																																						dbGAP											0													142.0	109.0	120.0					6																	90400436		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.10705G>A	6.37:g.90400436C>T	ENSP00000358400:p.Glu3569Lys		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.E3569K	ENST00000369393.3	37	c.10705	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	C	12.47	1.947602	0.34377	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03272	3.99;3.99	5.82	5.82	0.92795	.	0.125800	0.53938	D	0.000048	T	0.02688	0.0081	M	0.74881	2.28	0.45129	D	0.998149	P	0.39282	0.666	B	0.35039	0.194	T	0.32640	-0.9899	10	0.06365	T	0.9	.	20.0809	0.97775	0.0:1.0:0.0:0.0	.	3569	Q9NU22	MDN1_HUMAN	K	3569	ENSP00000358400:E3569K;ENSP00000413970:E3569K	ENSP00000358400:E3569K	E	-	1	0	MDN1	90457157	1.000000	0.71417	1.000000	0.80357	0.214000	0.24535	5.457000	0.66672	2.753000	0.94483	0.460000	0.39030	GAG	MDN1	-	pirsf_Midasin	ENSG00000112159		0.507	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	75	0.00	0	C			90400436	90400436	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	missense	24	29.41	10	SNP	1.000	T
MPO	4353	genome.wustl.edu	37	17	56350265	56350265	+	Missense_Mutation	SNP	T	T	C	rs200618562		TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr17:56350265T>C	ENST00000225275.3	-	10	1812	c.1636A>G	c.(1636-1638)Atc>Gtc	p.I546V	MPO_ENST00000340482.3_Missense_Mutation_p.I578V|MPO_ENST00000578493.1_5'Flank	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	546					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	CCCCGGAGGATGGGGTCAATG	0.567													T|||	1	0.000199681	0.0	0.0	5008	,	,		19706	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													92.0	99.0	96.0					17																	56350265		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.1636A>G	17.37:g.56350265T>C	ENSP00000225275:p.Ile546Val		A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.I578V	ENST00000225275.3	37	c.1732	CCDS11604.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	T	9.305	1.053983	0.19907	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.68765	-0.35;-0.35	5.1	3.99	0.46301	.	0.335909	0.32055	N	0.006651	T	0.59742	0.2216	L	0.35793	1.09	0.34273	D	0.68126	B	0.27286	0.174	B	0.41236	0.351	T	0.62310	-0.6881	10	0.30854	T	0.27	-19.2591	6.0516	0.19789	0.1615:0.0:0.293:0.5455	.	546	P05164	PERM_HUMAN	V	578;546	ENSP00000344419:I578V;ENSP00000225275:I546V	ENSP00000225275:I546V	I	-	1	0	MPO	53705264	0.280000	0.24249	1.000000	0.80357	0.998000	0.95712	-0.068000	0.11561	0.739000	0.32628	0.459000	0.35465	ATC	MPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000005381		0.567	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPO	HGNC	protein_coding	OTTHUMT00000443971.1	20	0.00	0	T			56350265	56350265	-1	no_errors	ENST00000340482	ensembl	human	known	69_37n	missense	57	14.93	10	SNP	0.797	C
MRPS33	51650	genome.wustl.edu	37	7	140706249	140706249	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr7:140706249C>G	ENST00000393008.3	-	3	457	c.302G>C	c.(301-303)aGa>aCa	p.R101T	MRPS33_ENST00000469351.1_Missense_Mutation_p.R101T|MRPS33_ENST00000496958.1_Missense_Mutation_p.R101T|MRPS33_ENST00000472343.1_5'UTR|MRPS33_ENST00000324787.5_Missense_Mutation_p.R101T|MRPS33_ENST00000467334.1_Missense_Mutation_p.R91T|RP4-813F11.4_ENST00000610021.1_lincRNA	NM_016071.3	NP_057155.1	Q9Y291	RT33_HUMAN	mitochondrial ribosomal protein S33	101					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)			breast(2)|endometrium(1)|kidney(1)	4	Melanoma(164;0.00956)					TTTTGCTGCTCTTTTCCCTTC	0.428																																						dbGAP											0													266.0	219.0	235.0					7																	140706249		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF078858	CCDS5864.1	7q34	2012-09-13			ENSG00000090263	ENSG00000090263		"""Mitochondrial ribosomal proteins / small subunits"""	16634	protein-coding gene	gene with protein product		611993				11279123, 10810093	Standard	NM_016071		Approved	CGI-139	uc003vwe.4	Q9Y291	OTTHUMG00000157456	ENST00000393008.3:c.302G>C	7.37:g.140706249C>G	ENSP00000376732:p.Arg101Thr			Missense_Mutation	SNP	pfam_Ribosomal_S27/S33_mit	p.R101T	ENST00000393008.3	37	c.302	CCDS5864.1	7	.	.	.	.	.	.	.	.	.	.	C	19.44	3.827161	0.71143	.	.	ENSG00000090263	ENST00000544013;ENST00000393008;ENST00000324787;ENST00000496958;ENST00000469351;ENST00000467334	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.79941	0.4533	M	0.73598	2.24	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.82297	-0.0527	9	0.87932	D	0	-10.2682	18.8952	0.92420	0.0:1.0:0.0:0.0	.	101	Q9Y291	RT33_HUMAN	T	101;101;101;101;101;91	.	ENSP00000320567:R101T	R	-	2	0	MRPS33	140352718	1.000000	0.71417	0.998000	0.56505	0.858000	0.48976	7.529000	0.81952	2.465000	0.83290	0.555000	0.69702	AGA	MRPS33	-	NULL	ENSG00000090263		0.428	MRPS33-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MRPS33	HGNC	protein_coding	OTTHUMT00000348878.1	219	0.00	0	C	NM_053035		140706249	140706249	-1	no_errors	ENST00000324787	ensembl	human	known	69_37n	missense	87	30.40	38	SNP	1.000	G
MYO3A	53904	genome.wustl.edu	37	10	26310566	26310566	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr10:26310566C>G	ENST00000265944.5	+	8	886	c.720C>G	c.(718-720)ttC>ttG	p.F240L	MYO3A_ENST00000376302.1_Missense_Mutation_p.F240L|MYO3A_ENST00000543632.1_Missense_Mutation_p.F240L	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GAGCACTCTTCAAAATACCAA	0.502																																						dbGAP											0													129.0	112.0	118.0					10																	26310566		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.720C>G	10.37:g.26310566C>G	ENSP00000265944:p.Phe240Leu		Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_cat_dom,prints_Myosin_head_motor_dom	p.F240L	ENST00000265944.5	37	c.720	CCDS7148.1	10	.	.	.	.	.	.	.	.	.	.	C	22.7	4.328652	0.81690	.	.	ENSG00000095777	ENST00000265944;ENST00000376302;ENST00000543632	T;T;T	0.64803	-0.12;2.64;-0.12	6.03	5.13	0.70059	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.66137	0.2759	N	0.21097	0.63	0.80722	D	1	D;D;D;D	0.76494	0.996;0.997;0.999;0.967	D;D;D;P	0.78314	0.987;0.991;0.98;0.745	T	0.70110	-0.4962	10	0.87932	D	0	.	11.3706	0.49697	0.0:0.8624:0.0:0.1376	.	240;240;240;240	F5H0U9;Q0VD65;Q8NEV4;Q4G0X2	.;.;MYO3A_HUMAN;.	L	240	ENSP00000265944:F240L;ENSP00000365479:F240L;ENSP00000445909:F240L	ENSP00000265944:F240L	F	+	3	2	MYO3A	26350572	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.053000	0.41326	1.563000	0.49615	-0.140000	0.14226	TTC	MYO3A	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000095777		0.502	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO3A	HGNC	protein_coding	OTTHUMT00000047259.1	54	0.00	0	C	NM_017433		26310566	26310566	+1	no_errors	ENST00000265944	ensembl	human	known	69_37n	missense	27	30.77	12	SNP	1.000	G
NCS1	23413	genome.wustl.edu	37	9	132982059	132982059	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr9:132982059G>A	ENST00000372398.3	+	4	370	c.284G>A	c.(283-285)gGa>gAa	p.G95E	NCS1_ENST00000458469.1_Missense_Mutation_p.G77E	NM_014286.3	NP_055101.2	P62166	NCS1_HUMAN	neuronal calcium sensor 1	95	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion transmembrane transport (GO:0070588)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of exocytosis (GO:0045921)|regulation of neuron projection development (GO:0010975)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|voltage-gated calcium channel activity (GO:0005245)			large_intestine(1)|lung(4)|stomach(1)	6						ACCTCACGGGGAACCCTGGAT	0.647																																					Melanoma(30;182 1162 22581 33240)	dbGAP											0													127.0	104.0	112.0					9																	132982059		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF186409	CCDS6932.1	9q34.11	2013-01-10	2010-01-27	2010-01-27	ENSG00000107130	ENSG00000107130		"""EF-hand domain containing"""	3953	protein-coding gene	gene with protein product		603315	"""frequenin (Drosophila) homolog"", ""frequenin homolog (Drosophila)"""	FREQ		11092894	Standard	NM_014286		Approved	NCS-1	uc004bzi.2	P62166	OTTHUMG00000020801	ENST00000372398.3:c.284G>A	9.37:g.132982059G>A	ENSP00000361475:p.Gly95Glu		E9PAY3|P36610|Q9UK26	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Recoverin	p.G95E	ENST00000372398.3	37	c.284	CCDS6932.1	9	.	.	.	.	.	.	.	.	.	.	G	17.53	3.413353	0.62511	.	.	ENSG00000107130	ENST00000372398;ENST00000458469	T;T	0.55588	0.51;0.51	4.57	4.57	0.56435	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.83064	0.5173	H	0.98466	4.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.989	D	0.90420	0.4416	10	0.87932	D	0	.	16.3274	0.82990	0.0:0.0:1.0:0.0	.	77;95	E9PAY3;P62166	.;NCS1_HUMAN	E	95;77	ENSP00000361475:G95E;ENSP00000404103:G77E	ENSP00000361475:G95E	G	+	2	0	NCS1	132021880	1.000000	0.71417	0.997000	0.53966	0.020000	0.10135	9.518000	0.98022	2.065000	0.61736	0.563000	0.77884	GGA	NCS1	-	pfscan_EF_HAND_2,prints_Recoverin	ENSG00000107130		0.647	NCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCS1	HGNC	protein_coding	OTTHUMT00000054637.1	28	0.00	0	G	NM_014286		132982059	132982059	+1	no_errors	ENST00000372398	ensembl	human	known	69_37n	missense	18	57.14	24	SNP	1.000	A
NELL1	4745	genome.wustl.edu	37	11	20940827	20940827	+	Silent	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr11:20940827C>T	ENST00000357134.5	+	7	858	c.706C>T	c.(706-708)Ctg>Ttg	p.L236L	NELL1_ENST00000298925.5_Silent_p.L264L|NELL1_ENST00000532434.1_Silent_p.L236L|NELL1_ENST00000325319.5_Silent_p.L179L	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	236					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TTTCTTAAGCCTGGTGCAAGG	0.299																																						dbGAP											0													117.0	113.0	114.0					11																	20940827		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.706C>T	11.37:g.20940827C>T			B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_VWF_C	p.L236	ENST00000357134.5	37	c.706	CCDS7855.1	11																																																																																			NELL1	-	NULL	ENSG00000165973		0.299	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL1	HGNC	protein_coding	OTTHUMT00000387588.1	133	0.00	0	C	NM_006157		20940827	20940827	+1	no_errors	ENST00000357134	ensembl	human	known	69_37n	silent	80	20.00	20	SNP	1.000	T
NLRP12	91662	genome.wustl.edu	37	19	54304506	54304506	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr19:54304506G>T	ENST00000324134.6	-	7	2899	c.2731C>A	c.(2731-2733)Ccc>Acc	p.P911T	NLRP12_ENST00000351894.4_Intron|NLRP12_ENST00000391773.1_Missense_Mutation_p.P912T|NLRP12_ENST00000391775.3_Missense_Mutation_p.P911T|NLRP12_ENST00000354278.3_Intron|NLRP12_ENST00000535162.1_Missense_Mutation_p.P911T|NLRP12_ENST00000345770.5_Missense_Mutation_p.P912T|NLRP12_ENST00000391772.1_Intron	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	911					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.P911S(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TTGCACGTGGGATGCCTGAGG	0.622																																						dbGAP											1	Substitution - Missense(1)	lung(1)											68.0	64.0	65.0					19																	54304506		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.2731C>A	19.37:g.54304506G>T	ENSP00000319377:p.Pro911Thr		A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.P912T	ENST00000324134.6	37	c.2734	CCDS12864.1	19	.	.	.	.	.	.	.	.	.	.	G	13.40	2.226349	0.39300	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000358661;ENST00000391775;ENST00000391773;ENST00000345770	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	5.45	3.28	0.37604	.	0.386982	0.19002	N	0.125305	T	0.65512	0.2698	M	0.85041	2.73	0.29983	N	0.817501	P;B;B;B	0.48640	0.913;0.27;0.27;0.265	P;B;B;B	0.52109	0.69;0.146;0.176;0.309	T	0.67760	-0.5587	10	0.87932	D	0	.	10.2048	0.43107	0.0796:0.1412:0.7792:0.0	.	194;911;911;911	P59046-5;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	T	911;911;194;911;912;912	ENSP00000319377:P911T;ENSP00000438030:P911T;ENSP00000375655:P911T;ENSP00000375653:P912T	ENSP00000319377:P911T	P	-	1	0	NLRP12	58996318	0.848000	0.29623	0.053000	0.19242	0.001000	0.01503	2.151000	0.42263	1.460000	0.47911	-0.292000	0.09595	CCC	NLRP12	-	NULL	ENSG00000142405		0.622	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	HGNC	protein_coding	OTTHUMT00000134340.1	42	0.00	0	G	NM_144687		54304506	54304506	-1	no_errors	ENST00000391773	ensembl	human	known	69_37n	missense	36	36.84	21	SNP	0.759	T
NLRP12	91662	genome.wustl.edu	37	19	54310781	54310781	+	Silent	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr19:54310781G>C	ENST00000324134.6	-	4	2379	c.2211C>G	c.(2209-2211)ctC>ctG	p.L737L	NLRP12_ENST00000351894.4_Silent_p.L737L|NLRP12_ENST00000391773.1_Silent_p.L738L|NLRP12_ENST00000391775.3_Silent_p.L737L|NLRP12_ENST00000354278.3_Silent_p.L737L|NLRP12_ENST00000535162.1_Silent_p.L737L|NLRP12_ENST00000345770.5_Silent_p.L738L|NLRP12_ENST00000391772.1_Silent_p.L738L	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	737					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TGGGGTGTCTGAGTCCTTGAC	0.587																																						dbGAP											0													76.0	65.0	69.0					19																	54310781		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.2211C>G	19.37:g.54310781G>C			A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L738	ENST00000324134.6	37	c.2214	CCDS12864.1	19																																																																																			NLRP12	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000142405		0.587	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	HGNC	protein_coding	OTTHUMT00000134340.1	62	0.00	0	G	NM_144687		54310781	54310781	-1	no_errors	ENST00000391773	ensembl	human	known	69_37n	silent	38	22.45	11	SNP	0.289	C
ENTPD8	377841	genome.wustl.edu	37	9	140328693	140328693	+	IGR	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr9:140328693G>C	ENST00000472938.1	-	0	1749				NOXA1_ENST00000392815.2_Missense_Mutation_p.E389Q|NOXA1_ENST00000341349.2_Missense_Mutation_p.E445Q			Q5MY95	ENTP8_HUMAN	ectonucleoside triphosphate diphosphohydrolase 8						nucleoside diphosphate biosynthetic process (GO:0009133)|nucleoside monophosphate biosynthetic process (GO:0009124)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			biliary_tract(1)|lung(4)|prostate(1)|skin(1)	7	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000224)|Epithelial(140;0.000898)		GGCATGGCTGGAGGGCCACTG	0.701																																						dbGAP											0													51.0	51.0	51.0					9																	140328693		2195	4286	6481	-	-	-	SO:0001628	intergenic_variant	0			AY359088	CCDS7043.1, CCDS43913.1	9q34.3	2013-09-20			ENSG00000188833	ENSG00000188833			24860	protein-coding gene	gene with protein product	"""GLSR2492"""					12975309	Standard	NM_198585		Approved	UNQ2492, NTPDase-8	uc004cmw.3	Q5MY95	OTTHUMG00000131831		9.37:g.140328693G>C			A2BG17|Q6UVZ0	Missense_Mutation	SNP	pfam_OPR_PB1,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_TPR_repeat,smart_OPR_PB1,smart_SH3_domain,pfscan_SH3_domain,pfscan_TPR-contain_dom	p.E445Q	ENST00000472938.1	37	c.1333	CCDS43913.1	9	.	.	.	.	.	.	.	.	.	.	G	16.94	3.259736	0.59321	.	.	ENSG00000188747	ENST00000341349;ENST00000392815	T;T	0.51071	0.72;0.72	4.58	3.67	0.42095	Src homology-3 domain (4);	0.202809	0.45126	D	0.000394	T	0.61223	0.2330	M	0.62209	1.925	0.41085	D	0.985558	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.994;0.994;0.996	T	0.64198	-0.6464	10	0.87932	D	0	.	8.2679	0.31827	0.175:0.0:0.825:0.0	.	389;438;445	Q86UR1-3;Q86UR1;Q86UR1-2	.;NOXA1_HUMAN;.	Q	445;389	ENSP00000342848:E445Q;ENSP00000376562:E389Q	ENSP00000342848:E445Q	E	+	1	0	NOXA1	139448514	1.000000	0.71417	1.000000	0.80357	0.493000	0.33554	3.099000	0.50267	2.096000	0.63516	0.561000	0.74099	GAG	NOXA1	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000188747		0.701	ENTPD8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NOXA1	HGNC	protein_coding	OTTHUMT00000355991.1	11	0.00	0	G	NM_198585		140328693	140328693	+1	no_errors	ENST00000341349	ensembl	human	known	69_37n	missense	3	70.00	7	SNP	1.000	C
NRIP1	8204	genome.wustl.edu	37	21	16337186	16337186	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr21:16337186G>A	ENST00000400202.1	-	3	4040	c.3328C>T	c.(3328-3330)Cct>Tct	p.P1110S	AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000400199.1_Missense_Mutation_p.P1110S|NRIP1_ENST00000318948.4_Missense_Mutation_p.P1110S			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	1110	Interaction with ZNF366.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		TCTGCAGTAGGAAGTAACTCT	0.433																																						dbGAP											0													127.0	126.0	126.0					21																	16337186		2203	4300	6503	-	-	-	SO:0001583	missense	0			X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.3328C>T	21.37:g.16337186G>A	ENSP00000383063:p.Pro1110Ser		Q8IWE8	Missense_Mutation	SNP	NULL	p.P1110S	ENST00000400202.1	37	c.3328	CCDS13568.1	21	.	.	.	.	.	.	.	.	.	.	G	9.015	0.983557	0.18889	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.07800	3.16;3.16;3.16	5.45	4.56	0.56223	.	0.514140	0.17552	N	0.170123	T	0.06600	0.0169	L	0.34521	1.04	0.34606	D	0.717089	B	0.10296	0.003	B	0.13407	0.009	T	0.18871	-1.0323	10	0.24483	T	0.36	-11.6261	6.9239	0.24403	0.1575:0.0:0.6989:0.1436	.	1110	P48552	NRIP1_HUMAN	S	1110	ENSP00000383060:P1110S;ENSP00000383063:P1110S;ENSP00000327213:P1110S	ENSP00000327213:P1110S	P	-	1	0	NRIP1	15259057	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	3.027000	0.49697	1.630000	0.50440	0.655000	0.94253	CCT	NRIP1	-	NULL	ENSG00000180530		0.433	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NRIP1	HGNC	protein_coding	OTTHUMT00000157926.1	110	0.00	0	G	NM_003489		16337186	16337186	-1	no_errors	ENST00000318948	ensembl	human	known	69_37n	missense	55	21.43	15	SNP	0.992	A
NUDT2	318	genome.wustl.edu	37	9	34343328	34343328	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr9:34343328C>G	ENST00000379158.2	+	5	692	c.334C>G	c.(334-336)Caa>Gaa	p.Q112E	NUDT2_ENST00000379155.5_Missense_Mutation_p.Q112E|NUDT2_ENST00000346365.4_Missense_Mutation_p.Q112E	NM_001161.4	NP_001152.1	P50583	AP4A_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 2	112	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				apoptotic process (GO:0006915)|nucleobase-containing compound metabolic process (GO:0006139)	mitochondrion (GO:0005739)	bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity (GO:0004081)|bis(5'-nucleosyl)-tetraphosphatase (symmetrical) activity (GO:0008803)|GTP binding (GO:0005525)			lung(3)	3			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		CCATGAGCACCAAGCCTACCG	0.552																																					Melanoma(95;1683 1957 4276 39813)	dbGAP											0													55.0	54.0	55.0					9																	34343328		2203	4300	6503	-	-	-	SO:0001583	missense	0			U30313	CCDS6552.1	9p13	2008-07-21			ENSG00000164978	ENSG00000164978		"""Nudix motif containing"""	8049	protein-coding gene	gene with protein product	"""Ap4A hydrolase 1"", ""Ap4Aase"", ""bis(5'-nucleosyl)-tetraphosphatase (asymmetrical)"", ""diadenosine tetraphosphatase"", ""diadenosine 5',5''-P1,P4-tetraphosphate pyrophosphohydrolase"""	602852		APAH1		7487923, 9479504	Standard	NM_001161		Approved		uc022bga.1	P50583	OTTHUMG00000019817	ENST00000379158.2:c.334C>G	9.37:g.34343328C>G	ENSP00000368455:p.Gln112Glu		D3DRM0|Q5T589	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,prints_Tetra_PHTase	p.Q112E	ENST00000379158.2	37	c.334	CCDS6552.1	9	.	.	.	.	.	.	.	.	.	.	C	17.74	3.464714	0.63513	.	.	ENSG00000164978	ENST00000337747;ENST00000379154;ENST00000379155;ENST00000346365;ENST00000379158	T;T;T	0.07114	3.22;3.22;3.22	5.88	5.88	0.94601	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.161221	0.64402	D	0.000014	T	0.12475	0.0303	L	0.43646	1.37	0.80722	D	1	P	0.37612	0.602	P	0.47015	0.534	T	0.04017	-1.0984	10	0.06757	T	0.87	-10.7646	15.8032	0.78471	0.1366:0.8634:0.0:0.0	.	112	P50583	AP4A_HUMAN	E	112	ENSP00000368452:Q112E;ENSP00000344187:Q112E;ENSP00000368455:Q112E	ENSP00000338397:Q112E	Q	+	1	0	NUDT2	34333328	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.587000	0.60991	2.797000	0.96272	0.561000	0.74099	CAA	NUDT2	-	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,prints_Tetra_PHTase	ENSG00000164978		0.552	NUDT2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NUDT2	HGNC	protein_coding	OTTHUMT00000052160.2	13	0.00	0	C	NM_001161		34343328	34343328	+1	no_errors	ENST00000337747	ensembl	human	known	69_37n	missense	5	64.29	9	SNP	1.000	G
OPLAH	26873	genome.wustl.edu	37	8	145107776	145107776	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr8:145107776T>A	ENST00000426825.1	-	22	3127	c.3046A>T	c.(3046-3048)Act>Tct	p.T1016S	OPLAH_ENST00000534424.1_5'UTR|CTD-3065J16.6_ENST00000528912.1_RNA|CTD-3065J16.6_ENST00000561181.1_RNA	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	1016					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCCGGCCCAGTGCCGCTGAAG	0.687																																						dbGAP											0													23.0	29.0	27.0					8																	145107776		2013	4059	6072	-	-	-	SO:0001583	missense	0			AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.3046A>T	8.37:g.145107776T>A	ENSP00000475943:p.Thr1016Ser		A5PKY8|Q75W65|Q9Y4Q0	RNA	SNP	-	NULL	ENST00000426825.1	37	NULL		8	.	.	.	.	.	.	.	.	.	.	T	6.852	0.526445	0.13066	.	.	ENSG00000178814	ENST00000426825	.	.	.	4.4	-0.0941	0.13646	.	0.220757	0.46145	N	0.000304	T	0.35970	0.0950	.	.	.	0.35833	D	0.825441	B	0.10296	0.003	B	0.17433	0.018	T	0.30446	-0.9978	7	0.32370	T	0.25	.	8.6115	0.33806	0.64:0.0:0.0:0.36	.	1016	O14841	OPLA_HUMAN	S	1016	.	ENSP00000412071:T1016S	T	-	1	0	OPLAH	145179764	1.000000	0.71417	0.534000	0.28014	0.107000	0.19398	2.025000	0.41059	0.129000	0.18514	0.448000	0.29417	ACT	OPLAH	-	-	ENSG00000178814		0.687	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	OPLAH	HGNC	protein_coding		17	0.00	0	T	NM_017570		145107776	145107776	-1	no_errors	ENST00000426825	ensembl	human	known	69_37n	rna	10	58.33	14	SNP	0.996	A
OPN1LW	5956	genome.wustl.edu	37	X	153418542	153418542	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chrX:153418542C>G	ENST00000369951.4	+	3	599	c.539C>G	c.(538-540)tCt>tGt	p.S180C	OPN1LW_ENST00000463296.1_3'UTR	NM_020061.4	NP_064445.2	P04000	OPSR_HUMAN	opsin 1 (cone pigments), long-wave-sensitive	180			S -> A (in 38% of the population; dbSNP:rs949431). {ECO:0000269|PubMed:1557123}.		phototransduction, visible light (GO:0007603)|positive regulation of cytokinesis (GO:0032467)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	15	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGGATCTGGTCTGCTGTGTGG	0.567																																						dbGAP											0													247.0	146.0	182.0					X																	153418542		2171	3981	6152	-	-	-	SO:0001583	missense	0			Z68193	CCDS14742.1	Xq28	2013-01-08	2008-04-16		ENSG00000102076	ENSG00000102076		"""GPCR / Class A : Opsin receptors"""	9936	protein-coding gene	gene with protein product	"""cone dystrophy 5 (X-linked)"""	300822	"""color blindness, protan"", ""red cone photoreceptor pigment"""	CBBM, RCP, CBP			Standard	NM_020061		Approved	COD5	uc004fjz.4	P04000	OTTHUMG00000034295	ENST00000369951.4:c.539C>G	X.37:g.153418542C>G	ENSP00000358967:p.Ser180Cys			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_supfam,prints_Opsin_red/grn,prints_7TM_GPCR_Rhodpsn,prints_Opsin	p.S180C	ENST00000369951.4	37	c.539	CCDS14742.1	X	.	.	.	.	.	.	.	.	.	.	C	14.32	2.501463	0.44455	.	.	ENSG00000102076	ENST00000369951;ENST00000442922	T;T	0.47177	0.85;0.85	4.57	3.69	0.42338	GPCR, rhodopsin-like superfamily (1);	0.466822	0.23684	N	0.045597	T	0.62478	0.2431	M	0.76727	2.345	0.23120	N	0.998265	D	0.63880	0.993	P	0.61533	0.89	T	0.55049	-0.8201	10	0.87932	D	0	.	10.5653	0.45169	0.0:0.8991:0.0:0.1009	.	180	P04000	OPSR_HUMAN	C	180;43	ENSP00000358967:S180C;ENSP00000402493:S43C	ENSP00000358967:S180C	S	+	2	0	OPN1LW	153071736	0.317000	0.24589	0.821000	0.32701	0.123000	0.20343	4.763000	0.62257	2.028000	0.59812	0.432000	0.28606	TCT	OPN1LW	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000102076		0.567	OPN1LW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPN1LW	HGNC	protein_coding	OTTHUMT00000082839.2	151	0.00	0	C	NM_020061		153418542	153418542	+1	no_errors	ENST00000369951	ensembl	human	known	69_37n	missense	71	35.45	39	SNP	0.989	G
OR2Z1	284383	genome.wustl.edu	37	19	8841852	8841852	+	Silent	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr19:8841852C>G	ENST00000324060.2	+	1	537	c.462C>G	c.(460-462)ctC>ctG	p.L154L		NM_001004699.1	NP_001004699.1	Q8NG97	OR2Z1_HUMAN	olfactory receptor, family 2, subfamily Z, member 1	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TAGGTGTGCTCAACGCCTCCA	0.547																																						dbGAP											0													182.0	159.0	167.0					19																	8841852		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AC008753	CCDS32895.1	19p13.2	2013-09-20	2002-11-13		ENSG00000181733	ENSG00000181733		"""GPCR / Class A : Olfactory receptors"""	15391	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily Z, member 2"""	OR2Z2			Standard	NM_001004699		Approved		uc010xkg.2	Q8NG97	OTTHUMG00000182195	ENST00000324060.2:c.462C>G	19.37:g.8841852C>G			B9EH50|Q6IFK0|Q96R25	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L154	ENST00000324060.2	37	c.462	CCDS32895.1	19																																																																																			OR2Z1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181733		0.547	OR2Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2Z1	HGNC	protein_coding	OTTHUMT00000459954.1	69	0.00	0	C			8841852	8841852	+1	no_errors	ENST00000324060	ensembl	human	known	69_37n	silent	49	28.99	20	SNP	0.025	G
OR4Q3	441669	genome.wustl.edu	37	14	20215639	20215639	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr14:20215639C>G	ENST00000331723.1	+	1	53	c.53C>G	c.(52-54)tCa>tGa	p.S18*		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTGGGCCTATCATCTTCTTGG	0.363																																						dbGAP											0													146.0	149.0	148.0					14																	20215639		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.53C>G	14.37:g.20215639C>G	ENSP00000330049:p.Ser18*		Q6IEX4	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S18*	ENST00000331723.1	37	c.53	CCDS32020.1	14	.	.	.	.	.	.	.	.	.	.	.	28.7	4.945053	0.92593	.	.	ENSG00000182652	ENST00000331723	.	.	.	4.32	4.32	0.51571	.	0.000000	0.34268	U	0.004118	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	14.3262	0.66523	0.0:1.0:0.0:0.0	.	.	.	.	X	18	.	ENSP00000330049:S18X	S	+	2	0	OR4Q3	19285479	0.052000	0.20516	0.997000	0.53966	0.970000	0.65996	3.419000	0.52728	2.238000	0.73509	0.509000	0.49947	TCA	OR4Q3	-	NULL	ENSG00000182652		0.363	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4Q3	HGNC	protein_coding	OTTHUMT00000409818.2	218	0.00	0	C			20215639	20215639	+1	no_errors	ENST00000331723	ensembl	human	known	69_37n	nonsense	103	23.13	31	SNP	0.884	G
PARPBP	55010	genome.wustl.edu	37	12	102569284	102569284	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr12:102569284C>T	ENST00000358383.5	+	7	890	c.845C>T	c.(844-846)tCa>tTa	p.S282L	PARPBP_ENST00000392911.2_Missense_Mutation_p.S201L|PARPBP_ENST00000543784.1_Intron|PARPBP_ENST00000378128.3_Intron|PARPBP_ENST00000327680.2_Missense_Mutation_p.S201L|PARPBP_ENST00000535811.1_Intron|PARPBP_ENST00000541394.1_Missense_Mutation_p.S359L			Q9NWS1	PARI_HUMAN	PARP1 binding protein	282					DNA repair (GO:0006281)|negative regulation of double-strand break repair via homologous recombination (GO:2000042)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(8)|urinary_tract(2)	11						CAAATACTGTCAGTGATAAAG	0.333																																						dbGAP											0													94.0	96.0	95.0					12																	102569284		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000648	CCDS9090.1, CCDS9090.2	12q23.2	2013-03-14	2012-01-24	2012-01-24		ENSG00000185480			26074	protein-coding gene	gene with protein product	"""PARP-1 binding protein"""	613687	"""chromosome 12 open reading frame 48"""	C12orf48		20931645	Standard	NM_017915		Approved	FLJ20641, PARI	uc001tjf.3	Q9NWS1		ENST00000358383.5:c.845C>T	12.37:g.102569284C>T	ENSP00000351153:p.Ser282Leu		B4E0Y0|Q05C00|Q499L8|Q4FZA0|Q4KMW7|Q6NSC6|Q6PJA1|Q86W36	Missense_Mutation	SNP	NULL	p.S282L	ENST00000358383.5	37	c.845	CCDS9090.2	12	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318123	0.81469	.	.	ENSG00000185480	ENST00000327680;ENST00000541394;ENST00000358383;ENST00000392911	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	6.03	6.03	0.97812	.	0.177817	0.51477	D	0.000091	T	0.67268	0.2875	M	0.72118	2.19	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.67313	-0.5702	10	0.87932	D	0	-11.7844	20.5666	0.99351	0.0:1.0:0.0:0.0	.	359;282	B4DZ31;Q9NWS1	.;PR1BP_HUMAN	L	201;359;282;201	ENSP00000332915:S201L;ENSP00000440850:S359L;ENSP00000351153:S282L;ENSP00000376643:S201L	ENSP00000332915:S201L	S	+	2	0	C12orf48	101093414	1.000000	0.71417	0.997000	0.53966	0.738000	0.42128	5.677000	0.68142	2.854000	0.98071	0.655000	0.94253	TCA	PARPBP	-	NULL	ENSG00000185480		0.333	PARPBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARPBP	HGNC	protein_coding	OTTHUMT00000397030.2	88	0.00	0	C	NM_017915		102569284	102569284	+1	no_errors	ENST00000358383	ensembl	human	known	69_37n	missense	19	42.42	14	SNP	1.000	T
PCDH19	57526	genome.wustl.edu	37	X	99551396	99551396	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chrX:99551396G>C	ENST00000373034.4	-	6	5001	c.3326C>G	c.(3325-3327)tCt>tGt	p.S1109C	PCDH19_ENST00000464981.1_5'Flank|PCDH19_ENST00000255531.7_Missense_Mutation_p.S1062C|PCDH19_ENST00000420881.2_Missense_Mutation_p.S1061C	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	1109					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						CTCAGCTTCAGAGGGACGAGT	0.562																																						dbGAP											0													124.0	118.0	120.0					X																	99551396		2037	4174	6211	-	-	-	SO:0001583	missense	0			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.3326C>G	X.37:g.99551396G>C	ENSP00000362125:p.Ser1109Cys		B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S1109C	ENST00000373034.4	37	c.3326	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	G	11.51	1.661157	0.29515	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.55413	0.52;0.59;0.52	5.52	5.52	0.82312	.	0.256704	0.38605	N	0.001632	T	0.35364	0.0929	N	0.08118	0	0.38902	D	0.957338	P;P;P	0.42620	0.679;0.785;0.679	B;B;B	0.41946	0.276;0.371;0.205	T	0.41197	-0.9522	10	0.45353	T	0.12	.	12.7931	0.57545	0.0799:0.0:0.9201:0.0	.	1109;1062;1061	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	C	1061;1109;1062	ENSP00000400327:S1061C;ENSP00000362125:S1109C;ENSP00000255531:S1062C	ENSP00000255531:S1062C	S	-	2	0	PCDH19	99438052	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.063000	0.71162	2.318000	0.78349	0.600000	0.82982	TCT	PCDH19	-	NULL	ENSG00000165194		0.562	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	84	0.00	0	G	NM_020766		99551396	99551396	-1	no_errors	ENST00000373034	ensembl	human	known	69_37n	missense	32	15.38	6	SNP	1.000	C
PHLDB3	653583	genome.wustl.edu	37	19	44006383	44006383	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr19:44006383G>C	ENST00000292140.5	-	3	626	c.266C>G	c.(265-267)tCt>tGt	p.S89C	PHLDB3_ENST00000599242.1_Missense_Mutation_p.S89C	NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	89							enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				TTCCCGCGAAGAGGTGGATGC	0.662																																						dbGAP											0													18.0	14.0	15.0					19																	44006383		2194	4279	6473	-	-	-	SO:0001583	missense	0				CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.266C>G	19.37:g.44006383G>C	ENSP00000292140:p.Ser89Cys		Q8N7Z4	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S89C	ENST00000292140.5	37	c.266	CCDS12621.2	19	.	.	.	.	.	.	.	.	.	.	G	12.64	1.999997	0.35320	.	.	ENSG00000176531	ENST00000292140	T	0.48836	0.8	4.02	0.224	0.15297	.	1.988530	0.03550	U	0.225330	T	0.29620	0.0739	N	0.08118	0	0.09310	N	1	P;B	0.39624	0.681;0.41	B;B	0.40982	0.345;0.124	T	0.21552	-1.0242	10	0.44086	T	0.13	.	4.3608	0.11201	0.1134:0.0:0.4899:0.3966	.	89;89	Q6NSJ2-2;Q6NSJ2	.;PHLB3_HUMAN	C	89	ENSP00000292140:S89C	ENSP00000292140:S89C	S	-	2	0	PHLDB3	48698223	0.000000	0.05858	0.000000	0.03702	0.058000	0.15608	-1.485000	0.02314	0.308000	0.22923	0.306000	0.20318	TCT	PHLDB3	-	NULL	ENSG00000176531		0.662	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB3	HGNC	protein_coding	OTTHUMT00000319643.2	29	0.00	0	G			44006383	44006383	-1	no_errors	ENST00000292140	ensembl	human	known	69_37n	missense	28	17.65	6	SNP	0.000	C
PIK3C2A	5286	genome.wustl.edu	37	11	17124376	17124376	+	Silent	SNP	A	A	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr11:17124376A>G	ENST00000265970.7	-	23	3683	c.3684T>C	c.(3682-3684)gcT>gcC	p.A1228A	PIK3C2A_ENST00000540361.1_Silent_p.A848A|PIK3C2A_ENST00000531428.1_Intron	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	1228	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						AGTTCTCTGAAGCCTATAAAA	0.318																																						dbGAP											0													46.0	43.0	44.0					11																	17124376		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.3684T>C	11.37:g.17124376A>G			B0LPH2|B4E2G4|Q14CQ9	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_C2_Ca-dep,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,pfscan_C2_membr_targeting,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.A1228	ENST00000265970.7	37	c.3684	CCDS7824.1	11																																																																																			PIK3C2A	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000011405		0.318	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2A	HGNC	protein_coding	OTTHUMT00000387553.1	41	0.00	0	A	NM_002645		17124376	17124376	-1	no_errors	ENST00000265970	ensembl	human	known	69_37n	silent	22	35.29	12	SNP	0.999	G
PKDREJ	10343	genome.wustl.edu	37	22	46653441	46653441	+	Silent	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr22:46653441G>A	ENST00000253255.5	-	1	5778	c.5779C>T	c.(5779-5781)Ctg>Ttg	p.L1927L		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1927					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		CTACAGAACAGATTTATATCT	0.383																																						dbGAP											0													82.0	87.0	85.0					22																	46653441		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.5779C>T	22.37:g.46653441G>A			B1AJY3|O95850	Silent	SNP	pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_LipOase_LH2,pfam_Ion_trans_dom,superfamily_Lipase_LipOase,smart_GPS_dom,smart_LipOase_LH2,pfscan_LipOase_LH2,pfscan_REJ-like,prints_PKD_2	p.L1927	ENST00000253255.5	37	c.5779	CCDS14073.1	22																																																																																			PKDREJ	-	pfam_PKD1_2_channel	ENSG00000130943		0.383	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKDREJ	HGNC	protein_coding	OTTHUMT00000318466.1	121	0.00	0	G	NM_006071		46653441	46653441	-1	no_errors	ENST00000253255	ensembl	human	known	69_37n	silent	53	35.71	30	SNP	0.004	A
PKDREJ	10343	genome.wustl.edu	37	22	46655016	46655016	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr22:46655016G>C	ENST00000253255.5	-	1	4203	c.4204C>G	c.(4204-4206)Ctt>Gtt	p.L1402V		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1402					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		ATGTTACAAAGAAGAGAGCTA	0.343																																						dbGAP											0													65.0	66.0	66.0					22																	46655016		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.4204C>G	22.37:g.46655016G>C	ENSP00000253255:p.Leu1402Val		B1AJY3|O95850	Missense_Mutation	SNP	pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_LipOase_LH2,pfam_Ion_trans_dom,superfamily_Lipase_LipOase,smart_GPS_dom,smart_LipOase_LH2,pfscan_LipOase_LH2,pfscan_REJ-like,prints_PKD_2	p.L1402V	ENST00000253255.5	37	c.4204	CCDS14073.1	22	.	.	.	.	.	.	.	.	.	.	G	9.442	1.088269	0.20390	.	.	ENSG00000130943	ENST00000253255	T	0.37752	1.18	5.26	-4.3	0.03710	.	0.524641	0.15907	N	0.238773	T	0.13114	0.0318	N	0.17674	0.51	0.09310	N	1	B	0.32829	0.386	B	0.24269	0.052	T	0.15464	-1.0436	10	0.25106	T	0.35	-4.3984	2.2503	0.04042	0.3136:0.3021:0.2839:0.1003	.	1402	Q9NTG1	PKDRE_HUMAN	V	1402	ENSP00000253255:L1402V	ENSP00000253255:L1402V	L	-	1	0	PKDREJ	45033680	0.199000	0.23386	0.003000	0.11579	0.846000	0.48090	0.037000	0.13840	-0.832000	0.04251	-0.304000	0.09214	CTT	PKDREJ	-	NULL	ENSG00000130943		0.343	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKDREJ	HGNC	protein_coding	OTTHUMT00000318466.1	57	0.00	0	G	NM_006071		46655016	46655016	-1	no_errors	ENST00000253255	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.001	C
PLA2G4E	123745	genome.wustl.edu	37	15	42292464	42292464	+	Silent	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr15:42292464C>T	ENST00000399518.3	-	8	1176	c.690G>A	c.(688-690)gtG>gtA	p.V230V	CTD-2382E5.1_ENST00000499478.2_RNA|PLA2G4E_ENST00000413860.2_Silent_p.V201V	NM_001206670.1	NP_001193599.1	Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	223					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		CGTTCACCATCACCAGGAGGT	0.572																																						dbGAP											0													39.0	44.0	42.0					15																	42292464		2021	4176	6197	-	-	-	SO:0001819	synonymous_variant	0				CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000399518.3:c.690G>A	15.37:g.42292464C>T			Q6ZSC0	Silent	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_Ca-dep,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_LysoPLipase_cat_dom,pfscan_C2_membr_targeting,pfscan_LysoPLipase_cat_dom	p.V201	ENST00000399518.3	37	c.603	CCDS55962.1	15																																																																																			PLA2G4E	-	NULL	ENSG00000188089		0.572	PLA2G4E-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PLA2G4E	HGNC	protein_coding	OTTHUMT00000252738.2	62	0.00	0	C	NM_198442		42292464	42292464	-1	no_errors	ENST00000413860	ensembl	human	known	69_37n	silent	35	16.67	7	SNP	1.000	T
C10orf55	414236	genome.wustl.edu	37	10	75671664	75671664	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr10:75671664G>C	ENST00000409178.1	-	5	575	c.235C>G	c.(235-237)Caa>Gaa	p.Q79E	PLAU_ENST00000372762.4_Intron|PLAU_ENST00000494287.1_Intron|PLAU_ENST00000372764.3_Intron|PLAU_ENST00000446342.1_Missense_Mutation_p.L5F|C10orf55_ENST00000412307.2_Missense_Mutation_p.Q79E	NM_001001791.2	NP_001001791.2	Q5SWW7	CJ055_HUMAN	chromosome 10 open reading frame 55	79										endometrium(1)	1	Prostate(51;0.0112)					TCTTCCATTTGAGAACTAGAT	0.572																																						dbGAP											0													32.0	42.0	38.0					10																	75671664		1327	2309	3636	-	-	-	SO:0001583	missense	0				CCDS53541.1	10q22.2	2012-05-24			ENSG00000222047	ENSG00000222047			31008	protein-coding gene	gene with protein product							Standard	NM_001001791		Approved	bA417O11.3	uc001jvz.2	Q5SWW7	OTTHUMG00000018496	ENST00000409178.1:c.235C>G	10.37:g.75671664G>C	ENSP00000386960:p.Gln79Glu		Q3KRG4|Q8NAK4	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_Kringle,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1_S6,pfscan_EG-like_dom,pfscan_Kringle,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.L5F	ENST00000409178.1	37	c.15	CCDS53541.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.55|12.55	1.970325|1.970325	0.34754|0.34754	.|.	.|.	ENSG00000122861|ENSG00000222047	ENST00000446342|ENST00000409178;ENST00000412307	D|.	0.87729|.	-2.29|.	4.59|4.59	3.56|3.56	0.40772|0.40772	.|.	.|.	.|.	.|.	.|.	T|T	0.27134|0.27134	0.0665|0.0665	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|B	0.29162|0.28760	0.235|0.221	B|B	0.38106|0.34652	0.265|0.187	T|T	0.29792|0.29792	-1.0000|-1.0000	8|8	.|0.87932	.|D	.|0	.|.	9.5189|9.5189	0.39122|0.39122	0.0:0.0:0.7008:0.2992|0.0:0.0:0.7008:0.2992	.|.	5|79	E7ET40|Q5SWW7	.|CJ055_HUMAN	F|E	5|79	ENSP00000388474:L5F|.	.|ENSP00000386960:Q79E	L|Q	+|-	3|1	2|0	PLAU|C10orf55	75341670|75341670	0.020000|0.020000	0.18652|0.18652	0.018000|0.018000	0.16275|0.16275	0.022000|0.022000	0.10575|0.10575	1.258000|1.258000	0.32944|0.32944	1.260000|1.260000	0.44134|0.44134	0.650000|0.650000	0.86243|0.86243	TTG|CAA	PLAU	-	NULL	ENSG00000122861		0.572	C10orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAU	HGNC	protein_coding	OTTHUMT00000048746.1	55	0.00	0	G	NM_001001791		75671664	75671664	+1	no_errors	ENST00000446342	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	0.018	C
POU4F1	5457	genome.wustl.edu	37	13	79176484	79176486	+	In_Frame_Del	DEL	TGG	TGG	-	rs371388366		TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	TGG	TGG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr13:79176484_79176486delTGG	ENST00000377208.5	-	2	535_537	c.324_326delCCA	c.(322-327)caccag>cag	p.H108del	RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000444769.3_RNA|RNF219-AS1_ENST00000606376.1_RNA|RNF219-AS1_ENST00000607860.1_RNA|RNF219-AS1_ENST00000560209.2_RNA|RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000430549.2_RNA|RNF219-AS1_ENST00000607220.1_RNA|RNF219-AS1_ENST00000607205.1_RNA|RP11-52L5.6_ENST00000607269.1_RNA|RNF219-AS1_ENST00000606124.1_RNA	NM_006237.3	NP_006228.3	Q01851	PO4F1_HUMAN	POU class 4 homeobox 1	108	Poly-His.				axonogenesis (GO:0007409)|cell migration in hindbrain (GO:0021535)|central nervous system neuron differentiation (GO:0021953)|habenula development (GO:0021986)|innervation (GO:0060384)|mesoderm development (GO:0007498)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|peripheral nervous system neuron development (GO:0048935)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proprioception involved in equilibrioception (GO:0051355)|regulation of neurogenesis (GO:0050767)|sensory system development (GO:0048880)|suckling behavior (GO:0001967)|synapse assembly (GO:0007416)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)|ventricular compact myocardium morphogenesis (GO:0003223)	neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)	p.H108delH(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)	16		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		TTCGAGCGCCtggtggtggtggt	0.729																																					Melanoma(109;347 2166 14574 42843)|Ovarian(81;1394 1854 22417 48351)	dbGAP											1	Deletion - In frame(1)	central_nervous_system(1)																																								-	-	-	SO:0001651	inframe_deletion	0			X64624	CCDS31996.1	13q31.1	2011-06-20	2007-07-13		ENSG00000152192	ENSG00000152192		"""Homeoboxes / POU class"""	9218	protein-coding gene	gene with protein product		601632	"""POU domain class 4, transcription factor 1"""	BRN3A		1357630	Standard	NM_006237		Approved	RDC-1	uc001vkv.3	Q01851	OTTHUMG00000017119	ENST00000377208.5:c.324_326delCCA	13.37:g.79176493_79176495delTGG	ENSP00000366413:p.His108del		Q14986|Q15318|Q5T227	In_Frame_Del	DEL	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.H108in_frame_del	ENST00000377208.5	37	c.326_324	CCDS31996.1	13																																																																																			POU4F1	-	NULL	ENSG00000152192		0.729	POU4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F1	HGNC	protein_coding	OTTHUMT00000045360.3	11	0.00	0	TGG			79176484	79176486	-1	no_errors	ENST00000377208	ensembl	human	known	69_37n	in_frame_del	14	12.50	2	DEL	1.000:1.000:1.000	-
PPFIA2	8499	genome.wustl.edu	37	12	81657056	81657056	+	Silent	SNP	A	A	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr12:81657056A>G	ENST00000549396.1	-	31	3829	c.3669T>C	c.(3667-3669)ttT>ttC	p.F1223F	PPFIA2_ENST00000407050.4_Silent_p.F1122F|PPFIA2_ENST00000552948.1_Silent_p.F1202F|PPFIA2_ENST00000541570.2_Silent_p.F759F|PPFIA2_ENST00000541017.1_Silent_p.F409F|PPFIA2_ENST00000550584.2_Silent_p.F1223F|PPFIA2_ENST00000550359.2_Silent_p.F1070F|PPFIA2_ENST00000333447.7_Silent_p.F1211F|PPFIA2_ENST00000548586.1_Silent_p.F1217F|PPFIA2_ENST00000549325.1_Silent_p.F1208F|PPFIA2_ENST00000443686.3_Silent_p.F1118F|PPFIA2_ENST00000545296.2_Intron	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	1223					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TGGTTAACCTAAATCCAGCTG	0.448																																						dbGAP											0													118.0	113.0	114.0					12																	81657056		1949	4154	6103	-	-	-	SO:0001819	synonymous_variant	0			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.3669T>C	12.37:g.81657056A>G			B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Silent	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.F1223	ENST00000549396.1	37	c.3669	CCDS55857.1	12																																																																																			PPFIA2	-	NULL	ENSG00000139220		0.448	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	HGNC	protein_coding	OTTHUMT00000408030.1	99	0.00	0	A			81657056	81657056	-1	no_errors	ENST00000549396	ensembl	human	known	69_37n	silent	48	22.58	14	SNP	1.000	G
PPP2R3C	55012	genome.wustl.edu	37	14	35579802	35579802	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr14:35579802A>C	ENST00000261475.5	-	3	573	c.220T>G	c.(220-222)Tta>Gta	p.L74V	PPP2R3C_ENST00000555644.1_Missense_Mutation_p.L74V	NM_017917.2	NP_060387.2	Q969Q6	P2R3C_HUMAN	protein phosphatase 2, regulatory subunit B'', gamma	74					activation of protein kinase activity (GO:0032147)|B cell homeostasis (GO:0001782)|positive regulation of B cell differentiation (GO:0045579)|regulation of antimicrobial humoral response (GO:0002759)|regulation of mitochondrial depolarization (GO:0051900)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)	15	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;8.62e-06)|LUAD - Lung adenocarcinoma(48;1.42e-05)|Epithelial(34;0.0177)|all cancers(34;0.0491)	GBM - Glioblastoma multiforme(112;0.0803)		TCCTCTCTTAATTTCTGTAGT	0.333																																						dbGAP											0													132.0	126.0	128.0					14																	35579802		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK000651	CCDS9654.1	14q13.2	2010-06-18	2010-06-18	2007-01-22	ENSG00000092020	ENSG00000092020		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	17485	protein-coding gene	gene with protein product		615902	"""chromosome 14 open reading frame 10"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma"""	C14orf10		12167160, 16129705	Standard	NM_017917		Approved	FLJ20644, G4-1, G5PR	uc001wss.3	Q969Q6	OTTHUMG00000140224	ENST00000261475.5:c.220T>G	14.37:g.35579802A>C	ENSP00000261475:p.Leu74Val		B4DEN7|D3DS97|D3DS98|Q5GJ55|Q5GJ56|Q6P4G2|Q86TZ3|Q9NWR9	Missense_Mutation	SNP	NULL	p.L74V	ENST00000261475.5	37	c.220	CCDS9654.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.69|19.69	3.874436|3.874436	0.72180|0.72180	.|.	.|.	ENSG00000092020|ENSG00000092020	ENST00000555614|ENST00000261475;ENST00000554361;ENST00000555644;ENST00000557278	.|T	.|0.61627	.|0.09	5.8|5.8	4.65|4.65	0.58169|0.58169	.|.	.|0.071281	.|0.56097	.|D	.|0.000022	T|T	0.64735|0.64735	0.2625|0.2625	L|L	0.49571|0.49571	1.57|1.57	0.51012|0.51012	D|D	0.999904|0.999904	.|P;D;D	.|0.69078	.|0.592;0.997;0.982	.|B;D;P	.|0.68039	.|0.302;0.955;0.723	T|T	0.61048|0.61048	-0.7141|-0.7141	5|10	.|0.28530	.|T	.|0.3	-4.7334|-4.7334	8.1979|8.1979	0.31407|0.31407	0.7866:0.0:0.2134:0.0|0.7866:0.0:0.2134:0.0	.|.	.|74;74;74	.|G3V2K1;Q86US5;Q969Q6	.|.;.;P2R3C_HUMAN	S|V	12|74	.|ENSP00000450716:L74V	.|ENSP00000261475:L74V	I|L	-|-	2|1	0|2	PPP2R3C|PPP2R3C	34649553|34649553	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	3.743000|3.743000	0.55104|0.55104	1.008000|1.008000	0.39264|0.39264	0.528000|0.528000	0.53228|0.53228	ATT|TTA	PPP2R3C	-	NULL	ENSG00000092020		0.333	PPP2R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R3C	HGNC	protein_coding	OTTHUMT00000276687.1	150	0.00	0	A	NM_017917		35579802	35579802	-1	no_errors	ENST00000261475	ensembl	human	known	69_37n	missense	72	21.74	20	SNP	1.000	C
PRAMEF2	65122	genome.wustl.edu	37	1	12919911	12919911	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr1:12919911G>A	ENST00000240189.2	+	3	738	c.651G>A	c.(649-651)tgG>tgA	p.W217*		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	217					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ACACGTGCTGGCCACATCTGA	0.373																																						dbGAP											0													99.0	106.0	104.0					1																	12919911		2201	4293	6494	-	-	-	SO:0001587	stop_gained	0				CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.651G>A	1.37:g.12919911G>A	ENSP00000240189:p.Trp217*			Nonsense_Mutation	SNP	NULL	p.W217*	ENST00000240189.2	37	c.651	CCDS149.1	1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.004587	0.35320	.	.	ENSG00000120952	ENST00000240189	.	.	.	0.842	0.842	0.18927	.	0.096661	0.44285	D	0.000474	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	5.0452	0.14480	0.0:0.0:1.0:0.0	.	.	.	.	X	217	.	ENSP00000240189:W217X	W	+	3	0	PRAMEF2	12842498	0.000000	0.05858	0.014000	0.15608	0.017000	0.09413	-1.683000	0.01934	0.759000	0.33084	0.194000	0.17425	TGG	PRAMEF2	-	NULL	ENSG00000120952		0.373	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF2	HGNC	protein_coding	OTTHUMT00000005517.1	147	0.00	0	G	NM_023014		12919911	12919911	+1	no_errors	ENST00000240189	ensembl	human	known	69_37n	nonsense	33	21.43	9	SNP	0.016	A
PRKG2	5593	genome.wustl.edu	37	4	82027041	82027041	+	Silent	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr4:82027041G>C	ENST00000395578.1	-	16	2105	c.1989C>G	c.(1987-1989)ctC>ctG	p.L663L	PRKG2_ENST00000418486.2_Silent_p.L634L|PRKG2_ENST00000545647.1_Silent_p.L243L|PRKG2_ENST00000264399.1_Silent_p.L663L|PRKG2_ENST00000509169.1_5'UTR			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	663	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						CAATTCCTTTGAGAATCAAAT	0.423																																						dbGAP											0													117.0	113.0	114.0					4																	82027041		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.1989C>G	4.37:g.82027041G>C			B4DMX3|E7EPE6|O00125|O60916	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_cGMP-dependent_protein_kinase,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_cat_dom,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin	p.L663	ENST00000395578.1	37	c.1989	CCDS3589.1	4																																																																																			PRKG2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_cGMP-dependent_protein_kinase,pfscan_Prot_kinase_cat_dom	ENSG00000138669		0.423	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG2	HGNC	protein_coding	OTTHUMT00000252639.1	127	0.00	0	G	NM_006259		82027041	82027041	-1	no_errors	ENST00000264399	ensembl	human	known	69_37n	silent	43	21.82	12	SNP	0.996	C
PSG5	5673	genome.wustl.edu	37	19	43690498	43690498	+	Silent	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr19:43690498G>A	ENST00000366175.3	-	1	190	c.60C>T	c.(58-60)ctC>ctT	p.L20L	PSG5_ENST00000407356.1_Silent_p.L20L|PSG5_ENST00000599812.1_Silent_p.L20L|PSG5_ENST00000401992.1_5'UTR|PSG5_ENST00000404580.1_Silent_p.L20L|PSG5_ENST00000342951.6_Silent_p.L20L|PSG5_ENST00000407568.1_Silent_p.L20L			Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5	20				L -> V (in Ref. 3; AAA36514). {ECO:0000305}.	female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(18)|prostate(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(69;0.00899)				CCTCACCTGTGAGCAGGAGCC	0.572																																						dbGAP											0													86.0	86.0	86.0					19																	43690498		2203	4292	6495	-	-	-	SO:0001819	synonymous_variant	0				CCDS12617.1	19q13.2	2013-01-29			ENSG00000204941	ENSG00000204941		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9522	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta 1 glycoprotein"""	176394				2735907	Standard	NM_002781		Approved	FL-NCA-3, PSG	uc002ovx.3	Q15238	OTTHUMG00000151539	ENST00000366175.3:c.60C>T	19.37:g.43690498G>A			Q15239|Q96QJ1|Q9UQ75	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L20	ENST00000366175.3	37	c.60	CCDS12617.1	19																																																																																			PSG5	-	NULL	ENSG00000204941		0.572	PSG5-001	KNOWN	basic|CCDS	protein_coding	PSG5	HGNC	protein_coding	OTTHUMT00000323055.1	142	0.00	0	G	NM_002781		43690498	43690498	-1	no_errors	ENST00000342951	ensembl	human	known	69_37n	silent	104	26.24	37	SNP	0.062	A
RAB25	57111	genome.wustl.edu	37	1	156039538	156039538	+	Silent	SNP	G	G	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr1:156039538G>T	ENST00000361084.5	+	4	751	c.510G>T	c.(508-510)ctG>ctT	p.L170L	RAB25_ENST00000487325.1_3'UTR	NM_020387.2	NP_065120.2	P57735	RAB25_HUMAN	RAB25, member RAS oncogene family	170					positive regulation of cell proliferation (GO:0008284)|protein transport (GO:0015031)|pseudopodium organization (GO:0031268)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5	Hepatocellular(266;0.158)|all_neural(408;0.195)					AGACTGTCCTGAAAGGTTAGA	0.517																																						dbGAP											0													227.0	219.0	222.0					1																	156039538		1991	4155	6146	-	-	-	SO:0001819	synonymous_variant	0			AF083124	CCDS41413.1	1q22	2008-07-03			ENSG00000132698	ENSG00000132698		"""RAB, member RAS oncogene"""	18238	protein-coding gene	gene with protein product		612942				11697911	Standard	NM_020387		Approved	CATX-8	uc001fnc.3	P57735	OTTHUMG00000017457	ENST00000361084.5:c.510G>T	1.37:g.156039538G>T			Q5VYA2|Q8NG24|Q96GB1|Q9BT12	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L170	ENST00000361084.5	37	c.510	CCDS41413.1	1																																																																																			RAB25	-	pfam_Small_GTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000132698		0.517	RAB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB25	HGNC	protein_coding	OTTHUMT00000046185.1	77	0.00	0	G			156039538	156039538	+1	no_errors	ENST00000361084	ensembl	human	known	69_37n	silent	42	14.29	7	SNP	1.000	T
RALGDS	5900	genome.wustl.edu	37	9	135977080	135977080	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr9:135977080A>G	ENST00000372050.3	-	16	2302	c.2281T>C	c.(2281-2283)Tcc>Ccc	p.S761P	RALGDS_ENST00000372047.3_Missense_Mutation_p.S749P|RALGDS_ENST00000393157.3_Missense_Mutation_p.S760P|RALGDS_ENST00000469972.1_5'UTR|RALGDS_ENST00000393160.3_Missense_Mutation_p.S706P|RALGDS_ENST00000542690.1_Missense_Mutation_p.S832P|RALGDS_ENST00000372062.3_Missense_Mutation_p.S732P	NM_006266.2	NP_006257.1	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	761	Poly-Ser.				neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		GCTGAGGAGGACGAGGTGCTG	0.632			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																Melanoma(189;762 2088 15384 21931 52515)	dbGAP		Dom	yes		9	9q34.3	5900	ral guanine nucleotide dissociation stimulator		L	0													74.0	69.0	70.0					9																	135977080		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037729	CCDS6959.1, CCDS43897.1, CCDS65172.1, CCDS65173.1, CCDS65174.1	9q34.3	2009-04-08			ENSG00000160271	ENSG00000160271			9842	protein-coding gene	gene with protein product		601619				7972015	Standard	NM_006266		Approved	RGF, RalGEF, RGDS	uc004ccr.3	Q12967	OTTHUMG00000020858	ENST00000372050.3:c.2281T>C	9.37:g.135977080A>G	ENSP00000361120:p.Ser761Pro		B7Z753|E7ER93|E7ERZ0|Q5T7V4|Q6KH11|Q6PCE1|Q6ZSD5|Q9HAX7|Q9HAY1|Q9HCT1|Q9P2N8	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_Ras-assoc,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S832P	ENST00000372050.3	37	c.2494	CCDS6959.1	9	.	.	.	.	.	.	.	.	.	.	A	13.07	2.128545	0.37533	.	.	ENSG00000160271	ENST00000372050;ENST00000372047;ENST00000393160;ENST00000393157;ENST00000542690;ENST00000372062	T;T;T;T;T;T	0.39997	1.54;1.05;1.54;1.52;1.69;1.05	5.12	5.12	0.69794	.	0.081112	0.51477	D	0.000088	T	0.61937	0.2387	M	0.72118	2.19	0.50467	D	0.999876	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.997;0.997;0.999;0.999;0.999	D;D;D;D;D;D;D	0.79784	0.988;0.993;0.922;0.946;0.993;0.993;0.96	T	0.60885	-0.7174	10	0.33141	T	0.24	.	14.388	0.66958	1.0:0.0:0.0:0.0	.	832;732;749;706;760;749;761	F5H6M6;E7ER93;Q8TEK9;Q6KH11;E7ERZ0;Q6PCE1;Q12967	.;.;.;.;.;.;GNDS_HUMAN	P	761;749;706;760;832;732	ENSP00000361120:S761P;ENSP00000361117:S749P;ENSP00000376867:S706P;ENSP00000376864:S760P;ENSP00000437518:S832P;ENSP00000361132:S732P	ENSP00000361117:S749P	S	-	1	0	RALGDS	134966901	1.000000	0.71417	0.298000	0.25002	0.144000	0.21451	7.399000	0.79935	2.048000	0.60808	0.379000	0.24179	TCC	RALGDS	-	NULL	ENSG00000160271		0.632	RALGDS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALGDS	HGNC	protein_coding	OTTHUMT00000054837.1	59	0.00	0	A	NM_006266		135977080	135977080	-1	no_errors	ENST00000542690	ensembl	human	known	69_37n	missense	39	32.76	19	SNP	0.994	G
RANBP17	64901	genome.wustl.edu	37	5	170319487	170319487	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr5:170319487G>T	ENST00000523189.1	+	4	517	c.353G>T	c.(352-354)gGg>gTg	p.G118V		NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	118					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ACTAAGTTGGGGTGGTTTGAG	0.408			T	TRD@	ALL																																	dbGAP		Dom	yes		5	5q34	64901	RAN binding protein 17		L	0													191.0	182.0	185.0					5																	170319487		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.353G>T	5.37:g.170319487G>T	ENSP00000427975:p.Gly118Val		Q8IU74	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.G118V	ENST00000523189.1	37	c.353	CCDS34287.1	5	.	.	.	.	.	.	.	.	.	.	G	28.6	4.932381	0.92389	.	.	ENSG00000204764	ENST00000523189;ENST00000545246;ENST00000519944	T	0.66099	-0.19	5.92	5.92	0.95590	Armadillo-type fold (1);	0.000000	0.64402	D	0.000004	D	0.84051	0.5387	M	0.90369	3.11	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.91635	0.924;0.999	D	0.85759	0.1348	10	0.62326	D	0.03	-12.0434	19.9157	0.97061	0.0:0.0:1.0:0.0	.	118;168	Q9H2T7;B4DQG2	RBP17_HUMAN;.	V	118;36;36	ENSP00000427975:G118V	ENSP00000373770:G118V	G	+	2	0	RANBP17	170252065	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.386000	0.97228	2.813000	0.96785	0.561000	0.74099	GGG	RANBP17	-	superfamily_ARM-type_fold	ENSG00000204764		0.408	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RANBP17	HGNC	protein_coding	OTTHUMT00000372036.1	111	0.00	0	G	NM_022897		170319487	170319487	+1	no_errors	ENST00000523189	ensembl	human	known	69_37n	missense	62	28.74	25	SNP	1.000	T
RB1	5925	genome.wustl.edu	37	13	49050875	49050875	+	Nonsense_Mutation	SNP	T	T	A	rs148327780		TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr13:49050875T>A	ENST00000267163.4	+	25	2697	c.2559T>A	c.(2557-2559)tgT>tgA	p.C853*	RB1_ENST00000484879.1_3'UTR	NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	853	Domain C; mediates interaction with E4F1.|Interaction with LIMD1.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(11)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AGATGGTATGTAACAGCGACC	0.373		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												dbGAP	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	26	Whole gene deletion(15)|Unknown(11)	bone(11)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)											96.0	95.0	96.0					13																	49050875		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2559T>A	13.37:g.49050875T>A	ENSP00000267163:p.Cys853*		A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	pfam_Rb_C,pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,superfamily_Cyclin-like,superfamily_FH2_actin-bd,smart_Cyclin-like	p.C853*	ENST00000267163.4	37	c.2559	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	T	41	8.636906	0.98895	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.84	4.66	0.58398	.	0.176442	0.52532	D	0.000078	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	7.9923	0.30248	0.0:0.2217:0.0:0.7783	.	.	.	.	X	832;853	.	ENSP00000267163:C853X	C	+	3	2	RB1	47948876	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	1.896000	0.39789	1.035000	0.39972	0.482000	0.46254	TGT	RB1	-	pfam_Rb_C	ENSG00000139687		0.373	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	67	0.00	0	T			49050875	49050875	+1	no_errors	ENST00000267163	ensembl	human	known	69_37n	nonsense	19	62.00	31	SNP	1.000	A
SAMD14	201191	genome.wustl.edu	37	17	48195601	48195601	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr17:48195601C>G	ENST00000330175.4	-	3	451	c.134G>C	c.(133-135)cGg>cCg	p.R45P	SAMD14_ENST00000503131.1_Missense_Mutation_p.R45P|SAMD14_ENST00000503734.1_5'UTR	NM_001257359.1	NP_001244288.1	Q8IZD0	SAM14_HUMAN	sterile alpha motif domain containing 14	45										breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	15						GCGGGATGGCCGGTGTCTCCG	0.642																																						dbGAP											0													43.0	47.0	46.0					17																	48195601		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11560.1, CCDS58562.1	17q21.33	2013-01-10				ENSG00000167100		"""Sterile alpha motif (SAM) domain containing"""	27312	protein-coding gene	gene with protein product						8619474	Standard	NM_174920		Approved	FLJ36890	uc002iqg.4	Q8IZD0		ENST00000330175.4:c.134G>C	17.37:g.48195601C>G	ENSP00000329144:p.Arg45Pro		A5D8V1|Q8N2X0	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.R45P	ENST00000330175.4	37	c.134	CCDS58562.1	17	.	.	.	.	.	.	.	.	.	.	C	18.78	3.696904	0.68386	.	.	ENSG00000167100	ENST00000330175;ENST00000285206;ENST00000503131	.	.	.	5.29	5.29	0.74685	.	0.000000	0.56097	D	0.000028	T	0.68384	0.2995	L	0.41710	1.295	0.41074	D	0.985475	D;D	0.89917	0.999;1.0	D;D	0.87578	0.993;0.998	T	0.68659	-0.5350	9	0.46703	T	0.11	-19.6477	15.8415	0.78848	0.0:1.0:0.0:0.0	.	45;45	Q8IZD0;Q8IZD0-2	SAM14_HUMAN;.	P	45;57;45	.	ENSP00000285206:R57P	R	-	2	0	SAMD14	45550600	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	4.642000	0.61383	2.461000	0.83175	0.557000	0.71058	CGG	SAMD14	-	NULL	ENSG00000167100		0.642	SAMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD14	HGNC	protein_coding	OTTHUMT00000366661.1	27	0.00	0	C	NM_174920		48195601	48195601	-1	no_errors	ENST00000503131	ensembl	human	known	69_37n	missense	90	23.08	27	SNP	1.000	G
SCN10A	6336	genome.wustl.edu	37	3	38768498	38768498	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr3:38768498C>T	ENST00000449082.2	-	16	2685	c.2686G>A	c.(2686-2688)Gac>Aac	p.D896N		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	896					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GTGAGGTTGTCAGCACTGAAA	0.532																																						dbGAP											0													112.0	108.0	109.0					3																	38768498		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.2686G>A	3.37:g.38768498C>T	ENSP00000390600:p.Asp896Asn		A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.D896N	ENST00000449082.2	37	c.2686	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.181494	0.94885	.	.	ENSG00000185313	ENST00000449082	D	0.96716	-4.1	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	D	0.98507	0.9502	M	0.91818	3.245	0.48975	D	0.999731	D	0.89917	1.0	D	0.87578	0.998	D	0.99609	1.0980	10	0.87932	D	0	.	18.1018	0.89508	0.0:1.0:0.0:0.0	.	896	Q9Y5Y9	SCNAA_HUMAN	N	896	ENSP00000390600:D896N	ENSP00000390600:D896N	D	-	1	0	SCN10A	38743502	1.000000	0.71417	0.952000	0.39060	0.863000	0.49368	4.805000	0.62561	2.527000	0.85204	0.561000	0.74099	GAC	SCN10A	-	NULL	ENSG00000185313		0.532	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	56	0.00	0	C	NM_006514		38768498	38768498	-1	no_errors	ENST00000449082	ensembl	human	known	69_37n	missense	29	32.56	14	SNP	1.000	T
SF3B6	51639	genome.wustl.edu	37	2	24291326	24291326	+	Silent	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr2:24291326C>T	ENST00000233468.4	-	3	366	c.153G>A	c.(151-153)ggG>ggA	p.G51G		NM_016047.3	NP_057131.1														NS(1)|kidney(1)|large_intestine(1)|lung(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGTGTGTTCCCCCTGGAGA	0.373																																						dbGAP											0													132.0	122.0	125.0					2																	24291326		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000233468.4:c.153G>A	2.37:g.24291326C>T				Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G51	ENST00000233468.4	37	c.153	CCDS1707.1	2																																																																																			AC008073.5	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000115128		0.373	SF3B14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B14	Clone_based_vega_gene	protein_coding	OTTHUMT00000246826.1	53	0.00	0	C			24291326	24291326	-1	no_errors	ENST00000233468	ensembl	human	known	69_37n	silent	29	35.56	16	SNP	1.000	T
SCN7A	6332	genome.wustl.edu	37	2	167330816	167330816	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr2:167330816T>A	ENST00000409855.1	-	3	399	c.273A>T	c.(271-273)agA>agT	p.R91S		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	91					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	CCGCATTGAATCTGAAGATTG	0.323																																						dbGAP											0													58.0	55.0	56.0					2																	167330816		1784	3977	5761	-	-	-	SO:0001583	missense	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.273A>T	2.37:g.167330816T>A	ENSP00000386796:p.Arg91Ser			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.R91S	ENST00000409855.1	37	c.273	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	T	18.07	3.542123	0.65198	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992;ENST00000441411	D;D;D	0.98550	-4.99;-4.34;-4.95	4.52	2.17	0.27698	.	0.000000	0.56097	D	0.000030	D	0.98611	0.9535	M	0.89658	3.05	0.32223	N	0.574944	D	0.63880	0.993	D	0.72338	0.977	D	0.97089	0.9789	10	0.87932	D	0	.	3.7753	0.08657	0.1648:0.1602:0.0:0.675	.	91	Q01118	SCN7A_HUMAN	S	91	ENSP00000386796:R91S;ENSP00000413699:R91S;ENSP00000403846:R91S	ENSP00000259060:R91S	R	-	3	2	SCN7A	167039062	0.013000	0.17824	1.000000	0.80357	0.942000	0.58702	-1.084000	0.03393	0.377000	0.24735	0.383000	0.25322	AGA	SCN7A	-	NULL	ENSG00000136546		0.323	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	76	0.00	0	T			167330816	167330816	-1	no_errors	ENST00000409855	ensembl	human	known	69_37n	missense	29	26.83	11	SNP	0.998	A
SIM1	6492	genome.wustl.edu	37	6	100896383	100896383	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr6:100896383C>G	ENST00000369208.3	-	7	1497	c.715G>C	c.(715-717)Gac>Cac	p.D239H	SIM1_ENST00000262901.4_Missense_Mutation_p.D239H			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	239	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		AGCTTCATGTCCAGGCTGGCG	0.612																																						dbGAP											0													52.0	41.0	45.0					6																	100896383		2203	4300	6503	-	-	-	SO:0001583	missense	0			U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.715G>C	6.37:g.100896383C>G	ENSP00000358210:p.Asp239His		Q5TDP7	Missense_Mutation	SNP	pfam_SIM_C,pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,pfscan_HLH_DNA-bd	p.D239H	ENST00000369208.3	37	c.715	CCDS5045.1	6	.	.	.	.	.	.	.	.	.	.	C	32	5.119488	0.94385	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.24350	1.86;1.86	5.57	5.57	0.84162	PAS (2);	0.041897	0.85682	D	0.000000	T	0.62356	0.2421	H	0.95850	3.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75581	-0.3268	10	0.87932	D	0	.	19.5581	0.95361	0.0:1.0:0.0:0.0	.	239	P81133	SIM1_HUMAN	H	239	ENSP00000358210:D239H;ENSP00000262901:D239H	ENSP00000262901:D239H	D	-	1	0	SIM1	101003104	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.614000	0.88457	0.655000	0.94253	GAC	SIM1	-	smart_PAS,pfscan_PAS	ENSG00000112246		0.612	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIM1	HGNC	protein_coding	OTTHUMT00000041628.3	35	0.00	0	C	NM_005068		100896383	100896383	-1	no_errors	ENST00000262901	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	G
SLC15A5	729025	genome.wustl.edu	37	12	16425679	16425679	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr12:16425679C>T	ENST00000344941.3	-	2	399	c.400G>A	c.(400-402)Gat>Aat	p.D134N		NM_001170798.1	NP_001164269.1	A6NIM6	S15A5_HUMAN	solute carrier family 15, member 5	134					peptide transport (GO:0015833)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(2)|lung(1)	3						AGATAGAAATCTTCCAAGGGA	0.423																																						dbGAP											0													146.0	132.0	136.0					12																	16425679		692	1591	2283	-	-	-	SO:0001583	missense	0					12p12.3	2013-07-18			ENSG00000188991	ENSG00000188991		"""Solute carriers"""	33455	protein-coding gene	gene with protein product						21044875	Standard	NM_001170798		Approved		uc021qvs.1	A6NIM6	OTTHUMG00000168793	ENST00000344941.3:c.400G>A	12.37:g.16425679C>T	ENSP00000340402:p.Asp134Asn			Missense_Mutation	SNP	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt	p.D134N	ENST00000344941.3	37	c.400		12	.	.	.	.	.	.	.	.	.	.	C	13.17	2.157194	0.38119	.	.	ENSG00000188991	ENST00000344941	T	0.80566	-1.39	5.34	4.44	0.53790	.	0.184464	0.46758	N	0.000279	T	0.78438	0.4283	L	0.39245	1.2	0.40044	D	0.975691	.	.	.	.	.	.	T	0.73949	-0.3821	8	0.19147	T	0.46	.	14.4389	0.67301	0.0:0.928:0.0:0.072	.	.	.	.	N	134	ENSP00000340402:D134N	ENSP00000340402:D134N	D	-	1	0	SLC15A5	16316946	1.000000	0.71417	0.071000	0.20095	0.500000	0.33767	4.670000	0.61583	1.224000	0.43551	0.655000	0.94253	GAT	SLC15A5	-	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt	ENSG00000188991		0.423	SLC15A5-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	SLC15A5	HGNC	protein_coding	OTTHUMT00000401119.2	86	0.00	0	C	XM_001129090		16425679	16425679	-1	no_errors	ENST00000344941	ensembl	human	novel	69_37n	missense	40	27.27	15	SNP	1.000	T
SLC30A7	148867	genome.wustl.edu	37	1	101376704	101376704	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr1:101376704G>C	ENST00000370112.4	+	4	569	c.382G>C	c.(382-384)Gag>Cag	p.E128Q	SLC30A7_ENST00000357650.4_Missense_Mutation_p.E128Q	NM_001144884.1|NM_133496.4	NP_001138356.1|NP_598003.2	Q8NEW0	ZNT7_HUMAN	solute carrier family 30 (zinc transporter), member 7	128					cellular protein metabolic process (GO:0044267)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	cation transmembrane transporter activity (GO:0008324)			endometrium(3)|large_intestine(2)|lung(10)	15		all_epithelial(167;0.000445)|all_lung(203;0.00645)|Lung NSC(277;0.0119)		Epithelial(280;0.0437)|all cancers(265;0.0498)|COAD - Colon adenocarcinoma(174;0.162)|Colorectal(144;0.19)|Lung(183;0.201)		AGAAGGAGTTGAGGTATAGTA	0.279																																					NSCLC(91;473 1491 3102 16827 21633)	dbGAP											0													83.0	80.0	81.0					1																	101376704		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF233345	CCDS776.1	1p21.1	2013-05-22			ENSG00000162695	ENSG00000162695		"""Solute carriers"""	19306	protein-coding gene	gene with protein product		611149				12446736	Standard	NM_133496		Approved	ZnTL2, ZNT7	uc001dto.2	Q8NEW0	OTTHUMG00000011815	ENST00000370112.4:c.382G>C	1.37:g.101376704G>C	ENSP00000359130:p.Glu128Gln		B2R949|D3DT61|Q8TCH2	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.E128Q	ENST00000370112.4	37	c.382	CCDS776.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.157208	0.94686	.	.	ENSG00000162695	ENST00000370112;ENST00000357650	T;T	0.65732	-0.17;-0.17	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.67353	0.2884	L	0.52126	1.63	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.56625	-0.7948	10	0.10902	T	0.67	-11.646	20.8794	0.99867	0.0:0.0:1.0:0.0	.	128	Q8NEW0	ZNT7_HUMAN	Q	128	ENSP00000359130:E128Q;ENSP00000350278:E128Q	ENSP00000350278:E128Q	E	+	1	0	SLC30A7	101149292	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.285000	0.95894	2.941000	0.99782	0.655000	0.94253	GAG	SLC30A7	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000162695		0.279	SLC30A7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	SLC30A7	HGNC	protein_coding	OTTHUMT00000032711.1	206	0.00	0	G	NM_133496		101376704	101376704	+1	no_errors	ENST00000357650	ensembl	human	known	69_37n	missense	89	25.62	31	SNP	1.000	C
SLC35B2	347734	genome.wustl.edu	37	6	44224198	44224198	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr6:44224198C>T	ENST00000393812.3	-	3	384	c.241G>A	c.(241-243)Gtg>Atg	p.V81M	SLC35B2_ENST00000538577.1_Intron|SLC35B2_ENST00000393810.1_Intron|SLC35B2_ENST00000537814.1_Intron|SLC35B2_ENST00000495706.1_5'UTR|MIR4647_ENST00000583964.1_RNA	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	81					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TTGCCAAACACACAAGCTTTC	0.572																																						dbGAP											0													55.0	61.0	59.0					6																	44224198		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.241G>A	6.37:g.44224198C>T	ENSP00000377401:p.Val81Met		B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Missense_Mutation	SNP	pfam_UAA,pfam_DMT	p.V81M	ENST00000393812.3	37	c.241	CCDS34462.1	6	.	.	.	.	.	.	.	.	.	.	c	28.0	4.883323	0.91740	.	.	ENSG00000157593	ENST00000393812;ENST00000341553	T	0.34472	1.36	4.26	4.26	0.50523	.	0.062950	0.64402	D	0.000006	T	0.38719	0.1051	L	0.36672	1.1	0.80722	D	1	D	0.59357	0.985	P	0.61328	0.887	T	0.36939	-0.9727	10	0.66056	D	0.02	-26.1723	16.8933	0.86093	0.0:1.0:0.0:0.0	.	81	Q8TB61	S35B2_HUMAN	M	81	ENSP00000377401:V81M	ENSP00000342455:V81M	V	-	1	0	SLC35B2	44332176	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.719000	0.68462	2.191000	0.70037	0.561000	0.74099	GTG	SLC35B2	-	NULL	ENSG00000157593		0.572	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35B2	HGNC	protein_coding	OTTHUMT00000040724.2	36	0.00	0	C			44224198	44224198	-1	no_errors	ENST00000393812	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	1.000	T
SLC7A3	84889	genome.wustl.edu	37	X	70148349	70148349	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chrX:70148349C>T	ENST00000374299.3	-	4	808	c.664G>A	c.(664-666)Gag>Aag	p.E222K	SLC7A3_ENST00000298085.4_Missense_Mutation_p.E222K			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	222					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	TCGTAGTCCTCTTCTGTGAGC	0.498																																						dbGAP											0													74.0	53.0	60.0					X																	70148349		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.664G>A	X.37:g.70148349C>T	ENSP00000363417:p.Glu222Lys		D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	pfam_AA-permease_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	p.E222K	ENST00000374299.3	37	c.664	CCDS14404.1	X	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400601	0.62177	.	.	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.88277	-2.36;-2.36	4.95	-0.397	0.12423	Amino acid permease domain (1);	0.497416	0.23545	N	0.047024	D	0.85444	0.5698	M	0.80422	2.495	0.09310	N	1	B	0.10296	0.003	B	0.20577	0.03	T	0.76288	-0.3014	10	0.62326	D	0.03	.	2.9037	0.05714	0.1274:0.4981:0.1228:0.2516	.	222	Q8WY07	CTR3_HUMAN	K	222	ENSP00000363417:E222K;ENSP00000298085:E222K	ENSP00000298085:E222K	E	-	1	0	SLC7A3	70065074	0.001000	0.12720	0.001000	0.08648	0.926000	0.56050	0.034000	0.13776	-0.088000	0.12506	0.436000	0.28706	GAG	SLC7A3	-	pfam_AA-permease_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	ENSG00000165349		0.498	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A3	HGNC	protein_coding	OTTHUMT00000057080.1	50	0.00	0	C	NM_032803		70148349	70148349	-1	no_errors	ENST00000298085	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	0.033	T
SLCO4A1	28231	genome.wustl.edu	37	20	61299501	61299501	+	Silent	SNP	C	C	T	rs148463271	byFrequency	TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr20:61299501C>T	ENST00000370507.1	+	8	1872	c.1776C>T	c.(1774-1776)ttC>ttT	p.F592F	SLCO4A1_ENST00000470412.1_3'UTR|RP11-93B14.5_ENST00000433126.1_RNA|RP11-93B14.5_ENST00000411824.1_RNA|RP11-93B14.5_ENST00000451648.1_RNA|SLCO4A1_ENST00000217159.1_Silent_p.F592F			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	592					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TCTTTACATTCCTCAGCAGCA	0.517											OREG0026115	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	5	0.000998403	0.0	0.0	5008	,	,		21218	0.005		0.0	False		,,,				2504	0.0				Pancreas(168;741 2006 10379 40139 45334)	dbGAP											0													144.0	142.0	143.0					20																	61299501		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.1776C>T	20.37:g.61299501C>T		1052	Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Silent	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.F592	ENST00000370507.1	37	c.1776	CCDS13501.1	20	4	0.0018315018315018315	0	0.0	0	0.0	4	0.006993006993006993	0	0.0	C	14.97	2.693541	0.48202	.	.	ENSG00000101187	ENST00000370512	.	.	.	4.94	3.96	0.45880	.	.	.	.	.	T	0.52354	0.1729	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51903	-0.8646	5	0.22109	T	0.4	.	14.8691	0.70441	0.0:0.8552:0.1448:0.0	.	.	.	.	S	578	.	ENSP00000359543:P578S	P	+	1	0	SLCO4A1	60769946	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.253000	0.51469	1.003000	0.39130	0.491000	0.48974	CCT	SLCO4A1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000101187		0.517	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO4A1	HGNC	protein_coding	OTTHUMT00000080048.2	113	0.00	0	C	NM_016354		61299501	61299501	+1	no_errors	ENST00000217159	ensembl	human	known	69_37n	silent	44	26.67	16	SNP	1.000	T
SMC1B	27127	genome.wustl.edu	37	22	45755687	45755687	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr22:45755687C>T	ENST00000357450.4	-	18	2859	c.2860G>A	c.(2860-2862)Gag>Aag	p.E954K	SMC1B_ENST00000404354.3_Missense_Mutation_p.E954K	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	954					meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TAGAATACCTCCACTTCAATG	0.413																																						dbGAP											0													133.0	114.0	120.0					22																	45755687		1949	4136	6085	-	-	-	SO:0001583	missense	0			AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.2860G>A	22.37:g.45755687C>T	ENSP00000350036:p.Glu954Lys		A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_t-SNARE,smart_SMC_hinge	p.E954K	ENST00000357450.4	37	c.2860	CCDS43027.1	22	.	.	.	.	.	.	.	.	.	.	C	16.41	3.115215	0.56505	.	.	ENSG00000077935	ENST00000357450;ENST00000404354	T;T	0.79247	-1.25;-1.11	5.53	5.53	0.82687	.	0.110360	0.39687	N	0.001298	T	0.76343	0.3974	M	0.64404	1.975	0.42251	D	0.991976	B;B	0.09022	0.002;0.002	B;B	0.15484	0.013;0.008	T	0.70887	-0.4750	10	0.20519	T	0.43	.	19.4728	0.94969	0.0:1.0:0.0:0.0	.	954;954	Q8NDV3-2;Q8NDV3-3	.;.	K	954	ENSP00000350036:E954K;ENSP00000385902:E954K	ENSP00000350036:E954K	E	-	1	0	SMC1B	44134351	0.994000	0.37717	1.000000	0.80357	0.656000	0.38851	2.648000	0.46647	2.608000	0.88229	0.561000	0.74099	GAG	SMC1B	-	pfam_RecF/RecN/SMC,superfamily_t-SNARE	ENSG00000077935		0.413	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1B	HGNC	protein_coding	OTTHUMT00000322256.2	92	0.00	0	C	NM_148674		45755687	45755687	-1	no_errors	ENST00000357450	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	1.000	T
SPTLC3	55304	genome.wustl.edu	37	20	13029712	13029712	+	Silent	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr20:13029712C>G	ENST00000399002.2	+	2	511	c.237C>G	c.(235-237)ctC>ctG	p.L79L	SPTLC3_ENST00000476791.1_3'UTR|SPTLC3_ENST00000378194.4_Silent_p.L79L	NM_018327.2	NP_060797.2	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base subunit 3	79					small molecule metabolic process (GO:0044281)|sphingoid biosynthetic process (GO:0046520)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(1)|endometrium(1)|large_intestine(7)|lung(14)|skin(1)|urinary_tract(1)	25						TTGGCTATCTCAGAGACTTTT	0.398																																						dbGAP											0													116.0	121.0	119.0					20																	13029712		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL109983	CCDS13115.2	20p12.1	2011-07-05	2006-12-21	2006-12-21	ENSG00000172296	ENSG00000172296	2.3.1.50		16253	protein-coding gene	gene with protein product		611120	"""chromosome 20 open reading frame 38"", ""serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2)"""	C20orf38, SPTLC2L		17023427	Standard	NM_018327		Approved	LCB2B, FLJ11112, hLCB2b	uc002wod.1	Q9NUV7	OTTHUMG00000031899	ENST00000399002.2:c.237C>G	20.37:g.13029712C>G			A2A2I4|B9EK64|Q05DQ8|Q5T1U4|Q9H1L1|Q9H1Z0	Silent	SNP	pfam_Aminotransferase_I/II,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom	p.L79	ENST00000399002.2	37	c.237	CCDS13115.2	20																																																																																			SPTLC3	-	NULL	ENSG00000172296		0.398	SPTLC3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTLC3	HGNC	protein_coding	OTTHUMT00000254544.1	104	0.00	0	C	NM_018327		13029712	13029712	+1	no_errors	ENST00000399002	ensembl	human	known	69_37n	silent	35	32.69	17	SNP	1.000	G
SREK1	140890	genome.wustl.edu	37	5	65459733	65459733	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr5:65459733C>T	ENST00000380918.3	+	7	1181	c.521C>T	c.(520-522)tCa>tTa	p.S174L	SREK1_ENST00000334121.6_Missense_Mutation_p.S290L|SREK1_ENST00000284041.3_3'UTR	NM_139168.3	NP_631907.1	Q8WXA9	SREK1_HUMAN	splicing regulatory glutamine/lysine-rich protein 1	174					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)	9						TCATTTATCTCAGCAGCTATT	0.388																																					GBM(10;31 347 27684 38976 41583)	dbGAP											0													143.0	132.0	136.0					5																	65459733		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF459094	CCDS3991.1, CCDS43323.1, CCDS75253.1	5q11.2-q12.1	2013-02-12	2010-09-08	2010-09-08	ENSG00000153914	ENSG00000153914		"""RNA binding motif (RRM) containing"""	17882	protein-coding gene	gene with protein product	"""serine-arginine-rich splicing regulatory protein 508"""	609268	"""splicing factor, arginine/serine-rich 12"""	SFRS12		12043562	Standard	NM_001077199		Approved	DKFZp564B176, SRrp86, SRrp508	uc003jun.4	Q8WXA9	OTTHUMG00000097809	ENST00000380918.3:c.521C>T	5.37:g.65459733C>T	ENSP00000370305:p.Ser174Leu		A4FTW3|Q2M1J0|Q86X37	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S290L	ENST00000380918.3	37	c.869	CCDS3991.1	5	.	.	.	.	.	.	.	.	.	.	C	17.60	3.429526	0.62844	.	.	ENSG00000153914	ENST00000334121;ENST00000537482;ENST00000380918	T;T	0.50277	2.5;0.75	5.63	5.63	0.86233	.	0.360398	0.28470	N	0.015230	T	0.62612	0.2442	M	0.62723	1.935	0.53005	D	0.999963	D;P;D	0.60575	0.972;0.948;0.988	P;P;P	0.55545	0.53;0.588;0.778	T	0.63844	-0.6545	10	0.59425	D	0.04	.	19.3017	0.94146	0.0:1.0:0.0:0.0	.	174;174;290	Q69YM5;Q8WXA9;Q8WXA9-2	.;SREK1_HUMAN;.	L	290;290;174	ENSP00000334538:S290L;ENSP00000370305:S174L	ENSP00000334538:S290L	S	+	2	0	SREK1	65495489	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.463000	0.80869	2.654000	0.90174	0.561000	0.74099	TCA	SREK1	-	NULL	ENSG00000153914		0.388	SREK1-002	KNOWN	basic|CCDS	protein_coding	SREK1	HGNC	protein_coding	OTTHUMT00000381118.1	73	0.00	0	C	NM_001077199		65459733	65459733	+1	no_errors	ENST00000334121	ensembl	human	known	69_37n	missense	37	11.63	5	SNP	1.000	T
STEAP1B	256227	genome.wustl.edu	37	7	22478332	22478332	+	Intron	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr7:22478332C>T	ENST00000406890.2	-	5	800				STEAP1B_ENST00000404369.4_Missense_Mutation_p.A269T	NM_207342.2	NP_997225.1	Q6NZ63	STEAL_HUMAN	STEAP family member 1B							integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(2)	4						agtttagtggcctgaaagttg	0.443																																						dbGAP											0													100.0	89.0	92.0					7																	22478332		692	1591	2283	-	-	-	SO:0001627	intron_variant	0				CCDS55094.1, CCDS56469.1	7p15.3	2011-05-19			ENSG00000105889	ENSG00000105889			41907	protein-coding gene	gene with protein product							Standard	NM_207342		Approved		uc010kum.2	Q6NZ63	OTTHUMG00000152529	ENST00000406890.2:c.706-18877G>A	7.37:g.22478332C>T			B5MCI2	Missense_Mutation	SNP	pfam_Fe3_Rdtase_TM_dom	p.A269T	ENST00000406890.2	37	c.805	CCDS55094.1	7	.	.	.	.	.	.	.	.	.	.	C	10.94	1.492914	0.26774	.	.	ENSG00000105889	ENST00000404369	T	0.11169	2.8	0.916	-1.79	0.07932	.	.	.	.	.	T	0.10380	0.0254	N	0.08118	0	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.22487	-1.0215	9	0.26408	T	0.33	.	4.0858	0.09947	0.0:0.4871:0.0:0.5129	.	269	B5MCI2	.	T	269	ENSP00000384370:A269T	ENSP00000384370:A269T	A	-	1	0	STEAP1B	22444857	0.074000	0.21230	0.002000	0.10522	0.001000	0.01503	-0.181000	0.09740	-0.650000	0.05423	-1.429000	0.01096	GCC	STEAP1B	-	NULL	ENSG00000105889		0.443	STEAP1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	STEAP1B	HGNC	protein_coding	OTTHUMT00000326617.2	66	0.00	0	C			22478332	22478332	-1	no_errors	ENST00000404369	ensembl	human	putative	69_37n	missense	39	23.53	12	SNP	0.004	T
STK32A	202374	genome.wustl.edu	37	5	146703558	146703558	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr5:146703558G>A	ENST00000397936.3	+	5	691	c.358G>A	c.(358-360)Gaa>Aaa	p.E120K	STK32A_ENST00000398523.3_Missense_Mutation_p.E120K|STK32A_ENST00000541094.1_Missense_Mutation_p.E120K|STK32A_ENST00000398521.3_Missense_Mutation_p.E120K	NM_001112724.1	NP_001106195.1	Q8WU08	ST32A_HUMAN	serine/threonine kinase 32A	120	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCACTTCAAGGAAGAAACAGT	0.522																																						dbGAP											0													66.0	70.0	68.0					5																	146703558		2153	4287	6440	-	-	-	SO:0001583	missense	0				CCDS47299.1, CCDS75351.1	5q32	2008-02-05			ENSG00000169302	ENSG00000169302			28317	protein-coding gene	gene with protein product						12477932	Standard	NM_001112724		Approved	MGC22688, YANK1	uc010jgn.1	Q8WU08	OTTHUMG00000163411	ENST00000397936.3:c.358G>A	5.37:g.146703558G>A	ENSP00000381030:p.Glu120Lys		B3KSY0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E120K	ENST00000397936.3	37	c.358	CCDS47299.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.277908	0.95459	.	.	ENSG00000169302	ENST00000397936;ENST00000541094;ENST00000398521;ENST00000398523	T;T;T;T	0.31247	1.5;2.83;2.83;1.5	5.48	5.48	0.80851	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.48767	D	0.000170	T	0.63803	0.2542	M	0.86953	2.85	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.995	D;D;D;D	0.83275	0.996;0.996;0.992;0.944	T	0.70044	-0.4980	10	0.87932	D	0	.	19.3474	0.94370	0.0:0.0:1.0:0.0	.	120;120;120;120	B7Z9H7;Q8WU08;Q8WU08-3;Q8WU08-2	.;ST32A_HUMAN;.;.	K	120	ENSP00000381030:E120K;ENSP00000443156:E120K;ENSP00000381533:E120K;ENSP00000381535:E120K	ENSP00000381030:E120K	E	+	1	0	STK32A	146683751	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	9.765000	0.98953	2.584000	0.87258	0.561000	0.74099	GAA	STK32A	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000169302		0.522	STK32A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	STK32A	HGNC	protein_coding	OTTHUMT00000373306.1	45	0.00	0	G	NM_145001		146703558	146703558	+1	no_errors	ENST00000397936	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	1.000	A
SYNM	23336	genome.wustl.edu	37	15	99666992	99666992	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr15:99666992C>G	ENST00000560674.1	+	3	612	c.143C>G	c.(142-144)cCg>cGg	p.P48R	RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000328642.7_Missense_Mutation_p.P333R|SYNM_ENST00000561323.1_3'UTR|SYNM_ENST00000336292.6_Missense_Mutation_p.P333R			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	334	Coil 1A.|Interaction with DMD and UTRN.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						GAAAACATGCCGTCAGGTAAG	0.393																																					Pancreas(125;1071 1762 21750 40003 40381)	dbGAP											0													78.0	76.0	77.0					15																	99666992		1891	4107	5998	-	-	-	SO:0001583	missense	0			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.143C>G	15.37:g.99666992C>G	ENSP00000453040:p.Pro48Arg		A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	pfam_F	p.P333R	ENST00000560674.1	37	c.998		15	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884153	0.51908	.	.	ENSG00000182253	ENST00000336292;ENST00000328642	D;D	0.86297	-2.1;-2.05	5.83	3.88	0.44766	.	.	.	.	.	D	0.92067	0.7486	.	.	.	0.33507	D	0.590594	D;D	0.89917	0.996;1.0	D;D	0.77004	0.924;0.989	D	0.93046	0.6461	8	0.87932	D	0	.	8.7385	0.34543	0.1492:0.768:0.0:0.0828	.	334;333	O15061;C9JIE4	SYNEM_HUMAN;.	R	333	ENSP00000336775:P333R;ENSP00000330469:P333R	ENSP00000330469:P333R	P	+	2	0	SYNM	97484515	0.656000	0.27385	0.112000	0.21494	0.021000	0.10359	2.200000	0.42724	0.738000	0.32606	-0.182000	0.12963	CCG	SYNM	-	NULL	ENSG00000182253		0.393	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	SYNM	HGNC	protein_coding	OTTHUMT00000415698.2	81	0.00	0	C	NM_145728		99666992	99666992	+1	no_errors	ENST00000336292	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	0.469	G
TBC1D8	11138	genome.wustl.edu	37	2	101646084	101646084	+	Silent	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr2:101646084C>T	ENST00000376840.4	-	12	2045	c.2046G>A	c.(2044-2046)gtG>gtA	p.V682V	TBC1D8_ENST00000409318.1_Silent_p.V697V			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	682	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						CTACCACATTCACCGCACTCT	0.562																																						dbGAP											0													82.0	88.0	86.0					2																	101646084		2145	4261	6406	-	-	-	SO:0001819	synonymous_variant	0			AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.2046G>A	2.37:g.101646084C>T			A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Silent	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.V697	ENST00000376840.4	37	c.2091	CCDS46375.1	2																																																																																			TBC1D8	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000204634		0.562	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D8	HGNC	protein_coding	OTTHUMT00000376092.1	56	0.00	0	C	NM_007063		101646084	101646084	-1	no_errors	ENST00000409318	ensembl	human	known	69_37n	silent	21	43.24	16	SNP	1.000	T
TJP2	9414	genome.wustl.edu	37	9	71855021	71855021	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr9:71855021C>G	ENST00000377245.4	+	17	2732	c.2524C>G	c.(2524-2526)Caa>Gaa	p.Q842E	TJP2_ENST00000348208.4_Missense_Mutation_p.Q842E|TJP2_ENST00000453658.2_Missense_Mutation_p.Q819E|TJP2_ENST00000539225.1_Missense_Mutation_p.Q873E|TJP2_ENST00000265384.7_Missense_Mutation_p.Q842E|TJP2_ENST00000535702.1_Missense_Mutation_p.Q846E	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	842	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.			Q -> H (in Ref. 1; AAA61300). {ECO:0000305}.	apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						GTTATTTGATCAAGCCAACAA	0.343																																						dbGAP											0													65.0	64.0	64.0					9																	71855021		2203	4300	6503	-	-	-	SO:0001583	missense	0			L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.2524C>G	9.37:g.71855021C>G	ENSP00000366453:p.Gln842Glu		A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Missense_Mutation	SNP	pfam_PDZ,pfam_Guanylate_kin,pfam_SH3_2,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin,prints_ZonOcculS2,prints_ZonOcculdens	p.Q873E	ENST00000377245.4	37	c.2617	CCDS6627.1	9	.	.	.	.	.	.	.	.	.	.	C	29.4	5.006758	0.93287	.	.	ENSG00000119139	ENST00000453658;ENST00000377245;ENST00000348208;ENST00000265384;ENST00000535702;ENST00000539225	T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03	5.93	5.93	0.95920	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.000000	0.85682	D	0.000000	T	0.64260	0.2582	L	0.56396	1.775	0.80722	D	1	D;D;D;D;D	0.76494	0.99;0.997;0.983;0.985;0.999	D;D;P;D;D	0.80764	0.979;0.954;0.826;0.94;0.994	T	0.63690	-0.6580	10	0.87932	D	0	.	20.3539	0.98825	0.0:1.0:0.0:0.0	.	873;846;842;842;842	F5H301;F5H886;Q9UDY2-2;Q9UDY2;Q9UDY2-5	.;.;.;ZO2_HUMAN;.	E	819;842;842;842;846;873	ENSP00000392178:Q819E;ENSP00000366453:Q842E;ENSP00000345893:Q842E;ENSP00000265384:Q842E;ENSP00000442090:Q846E;ENSP00000438262:Q873E	ENSP00000265384:Q842E	Q	+	1	0	TJP2	71044841	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	6.080000	0.71299	2.826000	0.97356	0.655000	0.94253	CAA	TJP2	-	pfam_Guanylate_kin,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_Guanylate_kin	ENSG00000119139		0.343	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP2	HGNC	protein_coding	OTTHUMT00000052572.2	68	0.00	0	C	NM_201629		71855021	71855021	+1	no_errors	ENST00000539225	ensembl	human	known	69_37n	missense	21	51.16	22	SNP	1.000	G
TMTC1	83857	genome.wustl.edu	37	12	29709842	29709842	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr12:29709842G>A	ENST00000539277.1	-	10	1682	c.1624C>T	c.(1624-1626)Cag>Tag	p.Q542*	TMTC1_ENST00000552618.1_Nonsense_Mutation_p.Q566*|TMTC1_ENST00000551659.1_Nonsense_Mutation_p.Q604*|TMTC1_ENST00000381224.2_Nonsense_Mutation_p.Q496*|TMTC1_ENST00000256062.5_Nonsense_Mutation_p.Q434*|TMTC1_ENST00000319685.8_5'UTR	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	542						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GGATGGAGCTGGAGAGCCCTC	0.502																																						dbGAP											0													224.0	187.0	199.0					12																	29709842		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.1624C>T	12.37:g.29709842G>A	ENSP00000442046:p.Gln542*		D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Nonsense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,pfam_DUF1736,pfam_PIK-rel_kinase_FAT,pfam_TPR-3,smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q434*	ENST00000539277.1	37	c.1300	CCDS53772.1	12	.	.	.	.	.	.	.	.	.	.	G	42	9.698432	0.99241	.	.	ENSG00000133687	ENST00000540901;ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	.	.	.	5.48	5.48	0.80851	.	0.414263	0.26542	N	0.023789	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-16.6694	12.9681	0.58497	0.0:0.0:0.8384:0.1616	.	.	.	.	X	305;434;604;566;542;496	.	.	Q	-	1	0	TMTC1	29601109	1.000000	0.71417	0.998000	0.56505	0.928000	0.56348	3.480000	0.53172	2.576000	0.86940	0.655000	0.94253	CAG	TMTC1	-	pfam_PIK-rel_kinase_FAT,smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000133687		0.502	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	TMTC1	HGNC	protein_coding	OTTHUMT00000403509.1	163	0.00	0	G	NM_031920		29709842	29709842	-1	no_errors	ENST00000256062	ensembl	human	known	69_37n	nonsense	69	34.91	37	SNP	0.993	A
TONSL	4796	genome.wustl.edu	37	8	145665449	145665449	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr8:145665449C>T	ENST00000409379.3	-	11	1464	c.1435G>A	c.(1435-1437)Gag>Aag	p.E479K	AC084125.4_ENST00000442850.1_RNA|AC084125.4_ENST00000544423.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	479	Glu-rich.				cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						GCTTCGCTCTCCGCTGTGGCT	0.677																																						dbGAP											0													23.0	25.0	24.0					8																	145665449		2199	4274	6473	-	-	-	SO:0001583	missense	0				CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.1435G>A	8.37:g.145665449C>T	ENSP00000386239:p.Glu479Lys		B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.E479K	ENST00000409379.3	37	c.1435	CCDS34968.2	8	.	.	.	.	.	.	.	.	.	.	C	0.793	-0.758296	0.03019	.	.	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.46063	0.88	5.32	4.24	0.50183	.	0.288787	0.42294	D	0.000733	T	0.17789	0.0427	N	0.08118	0	0.09310	N	1	B	0.18166	0.026	B	0.11329	0.006	T	0.23332	-1.0191	10	0.06494	T	0.89	-7.4674	8.1868	0.31343	0.0:0.8082:0.0:0.1918	.	479	Q96HA7	TONSL_HUMAN	K	479	ENSP00000386239:E479K	ENSP00000386239:E479K	E	-	1	0	TONSL	145636257	0.006000	0.16342	0.005000	0.12908	0.001000	0.01503	0.469000	0.22067	2.499000	0.84300	0.655000	0.94253	GAG	TONSL	-	NULL	ENSG00000160949		0.677	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TONSL	HGNC	protein_coding	OTTHUMT00000329668.2	16	0.00	0	C	NM_013432		145665449	145665449	-1	no_errors	ENST00000409379	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	0.004	T
TP53	7157	genome.wustl.edu	37	17	7577141	7577141	+	Missense_Mutation	SNP	C	C	T	rs193920774		TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr17:7577141C>T	ENST00000269305.4	-	8	986	c.797G>A	c.(796-798)gGa>gAa	p.G266E	TP53_ENST00000420246.2_Missense_Mutation_p.G266E|TP53_ENST00000359597.4_Missense_Mutation_p.G266E|TP53_ENST00000445888.2_Missense_Mutation_p.G266E|TP53_ENST00000455263.2_Missense_Mutation_p.G266E|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	266	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G266E(50)|p.G266V(42)|p.0?(8)|p.?(3)|p.G266fs*79(3)|p.G262_F270delGNLLGRNSF(2)|p.G266A(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.G266T(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCTGTTCCGTCCCAGTAGATT	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	121	Substitution - Missense(95)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(6)|Unknown(3)	lung(23)|oesophagus(10)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(9)|breast(9)|upper_aerodigestive_tract(8)|ovary(8)|urinary_tract(7)|pancreas(6)|skin(5)|central_nervous_system(4)|stomach(4)|bone(4)|liver(4)|endometrium(3)|vulva(1)|kidney(1)|thyroid(1)|cervix(1)|eye(1)|genital_tract(1)|biliary_tract(1)											50.0	44.0	46.0					17																	7577141		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.797G>A	17.37:g.7577141C>T	ENSP00000269305:p.Gly266Glu		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.G266E	ENST00000269305.4	37	c.797	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	25.2	4.614795	0.87359	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99898	-7.61;-7.61;-7.61;-7.61;-7.61;-7.61	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99906	0.9955	M	0.92367	3.3	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.998	D	0.96190	0.9137	10	0.87932	D	0	-13.0798	16.1198	0.81342	0.0:1.0:0.0:0.0	.	266;266;266;266	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	E	266;266;266;266;266;255;134	ENSP00000352610:G266E;ENSP00000269305:G266E;ENSP00000398846:G266E;ENSP00000391127:G266E;ENSP00000391478:G266E;ENSP00000425104:G134E	ENSP00000269305:G266E	G	-	2	0	TP53	7517866	1.000000	0.71417	0.996000	0.52242	0.744000	0.42396	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	GGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	62	0.00	0	C	NM_000546		7577141	7577141	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	11	42.11	8	SNP	1.000	T
TRIO	7204	genome.wustl.edu	37	5	14290927	14290927	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr5:14290927G>A	ENST00000344204.4	+	5	667	c.643G>A	c.(643-645)Gaa>Aaa	p.E215K	TRIO_ENST00000537187.1_Missense_Mutation_p.E215K|TRIO_ENST00000509967.2_Missense_Mutation_p.E166K	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	215					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					AGAATGGATTGAAATCAGAGT	0.453																																						dbGAP											0													74.0	72.0	72.0					5																	14290927		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.643G>A	5.37:g.14290927G>A	ENSP00000339299:p.Glu215Lys		D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.E215K	ENST00000344204.4	37	c.643	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	G	19.45	3.830045	0.71258	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967	D;D;D	0.83914	-1.78;-1.78;-1.78	5.32	5.32	0.75619	Cellular retinaldehyde-binding/triple function, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.89121	0.6625	M	0.79258	2.445	0.80722	D	1	P;P	0.52170	0.951;0.646	P;B	0.55112	0.769;0.175	D	0.87974	0.2738	10	0.34782	T	0.22	.	18.9865	0.92773	0.0:0.0:1.0:0.0	.	166;215	F5H228;O75962	.;TRIO_HUMAN	K	215;215;166	ENSP00000339299:E215K;ENSP00000446348:E215K;ENSP00000445592:E166K	ENSP00000339299:E215K	E	+	1	0	TRIO	14343927	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.863000	0.87023	2.501000	0.84356	0.557000	0.71058	GAA	TRIO	-	superfamily_CRAL-TRIO_dom	ENSG00000038382		0.453	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	83	0.00	0	G	NM_007118		14290927	14290927	+1	no_errors	ENST00000344204	ensembl	human	known	69_37n	missense	31	24.39	10	SNP	1.000	A
UTRN	7402	genome.wustl.edu	37	6	144844314	144844314	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr6:144844314G>A	ENST00000367545.3	+	40	5896	c.5896G>A	c.(5896-5898)Gat>Aat	p.D1966N		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1966					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		AATGTACAGTGATCGGAAAGG	0.373																																						dbGAP											0													75.0	72.0	73.0					6																	144844314		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.5896G>A	6.37:g.144844314G>A	ENSP00000356515:p.Asp1966Asn		Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.D1966N	ENST00000367545.3	37	c.5896	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	G	22.1	4.242212	0.79912	.	.	ENSG00000152818	ENST00000367545	T	0.34859	1.34	5.65	5.65	0.86999	.	0.000000	0.56097	D	0.000037	T	0.28863	0.0716	M	0.70275	2.135	0.80722	D	1	P	0.36144	0.539	B	0.28709	0.093	T	0.31668	-0.9935	10	0.72032	D	0.01	.	19.7116	0.96098	0.0:0.0:1.0:0.0	.	1966	P46939	UTRO_HUMAN	N	1966	ENSP00000356515:D1966N	ENSP00000356515:D1966N	D	+	1	0	UTRN	144886007	1.000000	0.71417	0.996000	0.52242	0.727000	0.41649	6.946000	0.75953	2.660000	0.90430	0.591000	0.81541	GAT	UTRN	-	pirsf_Dystrophin/utrophin	ENSG00000152818		0.373	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	90	0.00	0	G			144844314	144844314	+1	no_errors	ENST00000367545	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	1.000	A
WDR43	23160	genome.wustl.edu	37	2	29169540	29169540	+	Silent	SNP	C	C	T	rs572315435		TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr2:29169540C>T	ENST00000407426.3	+	18	1985	c.1929C>T	c.(1927-1929)gcC>gcT	p.A643A		NM_015131.1	NP_055946.1	Q15061	WDR43_HUMAN	WD repeat domain 43	643						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	20	Acute lymphoblastic leukemia(172;0.155)					atgaggatgccgaaggaaaag	0.393													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19321	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													82.0	89.0	87.0					2																	29169540		1972	4151	6123	-	-	-	SO:0001819	synonymous_variant	0			D87716	CCDS46251.1	2p23.3	2013-01-09			ENSG00000163811	ENSG00000163811		"""WD repeat domain containing"""	28945	protein-coding gene	gene with protein product	"""UTP5, small subunit (SSU) processome component, homolog (yeast)"""					7584026, 7584028, 17699751	Standard	NM_015131		Approved	KIAA0007, NET12, UTP5	uc002rmo.2	Q15061	OTTHUMG00000152015	ENST00000407426.3:c.1929C>T	2.37:g.29169540C>T			Q15395|Q92577	Silent	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A643	ENST00000407426.3	37	c.1929	CCDS46251.1	2																																																																																			WDR43	-	NULL	ENSG00000163811		0.393	WDR43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR43	HGNC	protein_coding	OTTHUMT00000324865.1	101	0.00	0	C	XM_087089		29169540	29169540	+1	no_errors	ENST00000407426	ensembl	human	known	69_37n	silent	63	27.59	24	SNP	0.000	T
CFAP44	55779	genome.wustl.edu	37	3	113152517	113152517	+	Splice_Site	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr3:113152517C>G	ENST00000295868.2	-	2	158		c.e2-1		WDR52_ENST00000393845.2_Splice_Site|WDR52-AS1_ENST00000498480.1_RNA	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						TTCATTTCCTCTGTAAGTACA	0.383																																						dbGAP											0													116.0	113.0	114.0					3																	113152517		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0																														ENST00000295868.2:c.5-1G>C	3.37:g.113152517C>G				Splice_Site	SNP	-	e1-1	ENST00000295868.2	37	c.1-1	CCDS2972.1	3																																																																																			WDR52	-	-	ENSG00000206530		0.383	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR52	HGNC	protein_coding	OTTHUMT00000354128.3	138	0.00	0	C		Intron	113152517	113152517	-1	no_errors	ENST00000393845	ensembl	human	known	69_37n	splice_site	67	35.58	37	SNP	0.003	G
WNT2B	7482	genome.wustl.edu	37	1	113057694	113057694	+	Silent	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr1:113057694C>T	ENST00000369684.4	+	2	866	c.381C>T	c.(379-381)gtC>gtT	p.V127V	WNT2B_ENST00000256640.5_Silent_p.V35V|WNT2B_ENST00000478360.1_3'UTR|RP4-671G15.2_ENST00000608357.1_RNA|WNT2B_ENST00000369686.5_Silent_p.V108V	NM_024494.2	NP_078613.1	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family, member 2B	127					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|chondrocyte differentiation (GO:0002062)|cornea development in camera-type eye (GO:0061303)|forebrain regionalization (GO:0021871)|hematopoietic stem cell proliferation (GO:0071425)|iris morphogenesis (GO:0061072)|lens development in camera-type eye (GO:0002088)|lung induction (GO:0060492)|male gonad development (GO:0008584)|mesenchymal-epithelial cell signaling (GO:0060638)|neuron differentiation (GO:0030182)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|stomach(1)	18	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACCACACCGTCTTTGGCCGTG	0.587																																						dbGAP											0													73.0	52.0	59.0					1																	113057694		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB045116	CCDS847.1, CCDS846.1	1p13	2008-07-18			ENSG00000134245	ENSG00000134245		"""Wingless-type MMTV integration sites"""	12781	protein-coding gene	gene with protein product	"""XWNT2, Xenopus, homolog of"", ""wingless-type MMTV integration site family, member 13"""	601968		WNT13		8761309, 10944466	Standard	NM_024494		Approved	XWNT2	uc001ecb.3	Q93097	OTTHUMG00000011157	ENST00000369684.4:c.381C>T	1.37:g.113057694C>T			O14903|Q5TEH9|Q5TEI2|Q9HDC1|Q9HDC2	Silent	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt2	p.V127	ENST00000369684.4	37	c.381	CCDS847.1	1																																																																																			WNT2B	-	pfam_Wnt,smart_Wnt,prints_Wnt2	ENSG00000134245		0.587	WNT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT2B	HGNC	protein_coding	OTTHUMT00000030692.1	35	0.00	0	C	NM_004185		113057694	113057694	+1	no_errors	ENST00000369684	ensembl	human	known	69_37n	silent	20	23.08	6	SNP	1.000	T
YPEL2	388403	genome.wustl.edu	37	17	57430827	57430827	+	Silent	SNP	G	G	A			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr17:57430827G>A	ENST00000312655.4	+	2	375	c.57G>A	c.(55-57)cgG>cgA	p.R19R	YPEL2_ENST00000585166.1_Silent_p.R19R|YPEL2_ENST00000581865.1_Intron	NM_001005404.3	NP_001005404.1	Q96QA6	YPEL2_HUMAN	yippee-like 2 (Drosophila)	19						nucleus (GO:0005634)				endometrium(1)|large_intestine(1)|lung(3)	5	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					CCTGCCACCGGACCTACAGCT	0.547																																					Melanoma(86;1113 1364 8518 42220 42625)	dbGAP											0													165.0	134.0	144.0					17																	57430827		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF305195	CCDS32695.1	17q23	2004-02-20				ENSG00000175155			18326	protein-coding gene	gene with protein product		609723					Standard	NM_001005404		Approved	FKSG4	uc002ixm.1	Q96QA6		ENST00000312655.4:c.57G>A	17.37:g.57430827G>A			A0PK16|A2RUG4|Q65ZA0|Q8N3W2	Silent	SNP	pfam_Yippee	p.R19	ENST00000312655.4	37	c.57	CCDS32695.1	17																																																																																			YPEL2	-	pfam_Yippee	ENSG00000175155		0.547	YPEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YPEL2	HGNC	protein_coding	OTTHUMT00000446032.1	52	0.00	0	G	XM_371070		57430827	57430827	+1	no_errors	ENST00000312655	ensembl	human	known	69_37n	silent	182	17.27	38	SNP	0.990	A
ZAK	51776	genome.wustl.edu	37	2	173955764	173955764	+	Missense_Mutation	SNP	C	C	T	rs565333842		TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr2:173955764C>T	ENST00000375213.3	+	2	83	c.5C>T	c.(4-6)tCg>tTg	p.S2L	MLTK_ENST00000338983.3_Missense_Mutation_p.S2L|MLTK_ENST00000431503.2_Intron|MLTK_ENST00000539448.1_Missense_Mutation_p.S2L|MLTK_ENST00000409176.2_Missense_Mutation_p.S2L	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN		2					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										TATGAGATGTCGTCTCTCGGT	0.363													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18338	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													81.0	82.0	82.0					2																	173955764		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000375213.3:c.5C>T	2.37:g.173955764C>T	ENSP00000364361:p.Ser2Leu		B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SAM_type1,pfam_SAM_2,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S2L	ENST00000375213.3	37	c.5	CCDS42777.1	2	.	.	.	.	.	.	.	.	.	.	C	13.98	2.399850	0.42512	.	.	ENSG00000091436	ENST00000539448;ENST00000409176;ENST00000338983;ENST00000375213;ENST00000422149	T;T;T;T;T	0.79247	-1.06;-0.98;-1.06;-0.98;-1.25	5.66	5.66	0.87406	Protein kinase-like domain (1);	0.243755	0.43416	D	0.000568	T	0.61375	0.2342	N	0.11201	0.11	0.80722	D	1	B;B;B;B	0.22080	0.064;0.014;0.038;0.013	B;B;B;B	0.14578	0.011;0.004;0.005;0.004	T	0.60782	-0.7195	10	0.62326	D	0.03	.	13.0192	0.58775	0.0:0.9265:0.0:0.0735	.	2;2;2;2	Q9NYL2-2;Q9NYL2;D4Q8H0;Q9NYL2-3	.;MLTK_HUMAN;.;.	L	2	ENSP00000439414:S2L;ENSP00000387259:S2L;ENSP00000340257:S2L;ENSP00000364361:S2L;ENSP00000411923:S2L	ENSP00000340257:S2L	S	+	2	0	AC013461.1	173664010	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.928000	0.48908	2.675000	0.91044	0.655000	0.94253	TCG	AC013461.1	-	superfamily_Kinase-like_dom	ENSG00000091436		0.363	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAK	Clone_based_vega_gene	protein_coding	OTTHUMT00000255401.1	78	0.00	0	C			173955764	173955764	+1	no_errors	ENST00000375213	ensembl	human	known	69_37n	missense	54	27.03	20	SNP	1.000	T
ZBTB3	79842	genome.wustl.edu	37	11	62520917	62520917	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr11:62520917G>T	ENST00000394807.3	-	2	495	c.370C>A	c.(370-372)Cca>Aca	p.P124T		NM_024784.3	NP_079060.1	Q9H5J0	ZBTB3_HUMAN	zinc finger and BTB domain containing 3	124	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|ovary(2)|prostate(2)	24						CCAAAGGCTGGGGCTGTGACA	0.542																																						dbGAP											0													92.0	91.0	92.0					11																	62520917		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK027045	CCDS8034.1	11q12.3	2013-01-09				ENSG00000185670		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	22918	protein-coding gene	gene with protein product							Standard	NM_024784		Approved	FLJ23392	uc001nuz.3	Q9H5J0		ENST00000394807.3:c.370C>A	11.37:g.62520917G>T	ENSP00000378286:p.Pro124Thr			Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.P124T	ENST00000394807.3	37	c.370	CCDS8034.1	11	.	.	.	.	.	.	.	.	.	.	G	15.72	2.918159	0.52546	.	.	ENSG00000185670	ENST00000394807;ENST00000527994	T;T	0.66099	-0.19;-0.19	5.82	5.82	0.92795	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.183333	0.47455	D	0.000223	T	0.67674	0.2918	N	0.21373	0.66	0.37337	D	0.910211	D	0.71674	0.998	D	0.69824	0.966	T	0.68164	-0.5481	10	0.32370	T	0.25	.	17.6516	0.88165	0.0:0.0:1.0:0.0	.	124	Q9H5J0	ZBTB3_HUMAN	T	124;74	ENSP00000378286:P124T;ENSP00000432731:P74T	ENSP00000378286:P124T	P	-	1	0	ZBTB3	62277493	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	1.943000	0.40253	2.767000	0.95098	0.555000	0.69702	CCA	ZBTB3	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000185670		0.542	ZBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB3	HGNC	protein_coding	OTTHUMT00000395342.1	53	0.00	0	G	NM_024784		62520917	62520917	-1	no_errors	ENST00000394807	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	0.987	T
ZNF799	90576	genome.wustl.edu	37	19	12501963	12501963	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr19:12501963C>T	ENST00000430385.3	-	4	1449	c.1249G>A	c.(1249-1251)Gca>Aca	p.A417T	CTD-3105H18.14_ENST00000435033.1_Intron|ZNF799_ENST00000419318.1_Missense_Mutation_p.A385T	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	417					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						GGTTTCTCTGCAGTGTGAGTC	0.413																																						dbGAP											0													112.0	115.0	114.0					19																	12501963		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1249G>A	19.37:g.12501963C>T	ENSP00000411084:p.Ala417Thr			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A417T	ENST00000430385.3	37	c.1249	CCDS45989.1	19	.	.	.	.	.	.	.	.	.	.	C	12.74	2.029434	0.35797	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	T;T	0.17854	2.25;2.25	1.31	0.217	0.15264	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12263	0.0298	N	0.20304	0.555	0.21499	N	0.999668	P	0.38565	0.637	P	0.45099	0.469	T	0.24333	-1.0163	9	0.87932	D	0	.	2.0491	0.03567	0.3089:0.4787:0.0:0.2124	.	417	Q96GE5	ZN799_HUMAN	T	385;417	ENSP00000415278:A385T;ENSP00000411084:A417T	ENSP00000415278:A385T	A	-	1	0	ZNF799	12362963	0.002000	0.14202	0.004000	0.12327	0.124000	0.20399	1.729000	0.38115	0.117000	0.18138	0.430000	0.28490	GCA	ZNF799	-	pfscan_Znf_C2H2	ENSG00000196466		0.413	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF799	HGNC	protein_coding	OTTHUMT00000344099.2	117	0.00	0	C	NM_001080821		12501963	12501963	-1	no_errors	ENST00000430385	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	0.950	T
ZNF569	148266	genome.wustl.edu	37	19	37904775	37904775	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A275-01A-21D-A16D-09	TCGA-C8-A275-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7751a837-2656-4e3b-9182-556314c4f6a3	8775eb88-4ca6-43b1-b4c1-00767ac1b3de	g.chr19:37904775C>G	ENST00000316950.6	-	6	1342	c.785G>C	c.(784-786)aGa>aCa	p.R262T	ZNF569_ENST00000392150.2_Missense_Mutation_p.R103T|ZNF569_ENST00000392149.2_Missense_Mutation_p.R262T	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	262					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGTATGAATTCTTTGATGTCT	0.328																																						dbGAP											0													74.0	81.0	78.0					19																	37904775		2203	4298	6501	-	-	-	SO:0001583	missense	0			AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.785G>C	19.37:g.37904775C>G	ENSP00000325018:p.Arg262Thr		A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R262T	ENST00000316950.6	37	c.785	CCDS12503.1	19	.	.	.	.	.	.	.	.	.	.	C	13.82	2.352093	0.41700	.	.	ENSG00000196437	ENST00000316950;ENST00000392150	T;T	0.25414	1.8;1.8	3.8	3.8	0.43715	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.39909	N	0.001236	T	0.22244	0.0536	L	0.51853	1.615	0.32940	D	0.518289	B;B	0.33413	0.411;0.411	B;B	0.29785	0.107;0.107	T	0.38972	-0.9636	10	0.66056	D	0.02	.	10.3319	0.43827	0.1975:0.8025:0.0:0.0	.	103;262	Q17RR6;Q5MCW4	.;ZN569_HUMAN	T	262;103	ENSP00000325018:R262T;ENSP00000375993:R103T	ENSP00000325018:R262T	R	-	2	0	ZNF569	42596615	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	-0.102000	0.10956	2.104000	0.64026	0.591000	0.81541	AGA	ZNF569	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196437		0.328	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF569	HGNC	protein_coding	OTTHUMT00000109594.2	86	0.00	0	C	NM_152484		37904775	37904775	-1	no_errors	ENST00000316950	ensembl	human	known	69_37n	missense	82	18.81	19	SNP	0.998	G
