#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AAK1	22848	genome.wustl.edu	37	2	69870081	69870081	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr2:69870081C>T	ENST00000409085.4	-	2	468	c.92G>A	c.(91-93)gGc>gAc	p.G31D	AAK1_ENST00000406297.3_Missense_Mutation_p.G31D|AAK1_ENST00000409068.1_Missense_Mutation_p.G31D	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	31	Gly-rich.				endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						GTAGCCACTGCCCAGGCCCGA	0.632																																						dbGAP											0													25.0	27.0	26.0					2																	69870081		1988	4146	6134	-	-	-	SO:0001583	missense	0			AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.92G>A	2.37:g.69870081C>T	ENSP00000386456:p.Gly31Asp		Q4ZFZ3|Q53RX6|Q9UPV4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.G31D	ENST00000409085.4	37	c.92	CCDS1893.2	2	.	.	.	.	.	.	.	.	.	.	C	25.7	4.661857	0.88251	.	.	ENSG00000115977	ENST00000409068;ENST00000409085;ENST00000406297	T;T;T	0.34859	1.34;1.34;1.34	4.55	4.55	0.56014	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.52741	0.1753	L	0.48642	1.525	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;1.0	D;P;D;D	0.91635	0.998;0.841;0.999;0.998	T	0.53982	-0.8361	10	0.59425	D	0.04	-8.4126	14.8735	0.70478	0.0:1.0:0.0:0.0	.	31;31;31;31	B7ZLC4;D6W5G0;Q2M2I8-2;Q2M2I8	.;.;.;AAK1_HUMAN	D	31	ENSP00000386342:G31D;ENSP00000386456:G31D;ENSP00000385181:G31D	ENSP00000385181:G31D	G	-	2	0	AAK1	69723585	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.675000	0.68123	2.359000	0.80004	0.563000	0.77884	GGC	AAK1	-	superfamily_Kinase-like_dom	ENSG00000115977		0.632	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AAK1	HGNC	protein_coding	OTTHUMT00000251847.4	28	0.00	0	C	NM_014911		69870081	69870081	-1	no_errors	ENST00000409085	ensembl	human	known	69_37n	missense	14	34.78	8	SNP	1.000	T
ADARB1	104	genome.wustl.edu	37	21	46596033	46596033	+	Silent	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr21:46596033G>A	ENST00000360697.3	+	2	432	c.417G>A	c.(415-417)ttG>ttA	p.L139L	ADARB1_ENST00000437626.1_Intron|ADARB1_ENST00000348831.4_Silent_p.L139L|ADARB1_ENST00000539173.1_Silent_p.L139L|ADARB1_ENST00000389863.4_Silent_p.L139L			P78563	RED1_HUMAN	adenosine deaminase, RNA-specific, B1	139	DRBM 1. {ECO:0000255|PROSITE- ProRule:PRU00266}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|positive regulation of viral genome replication (GO:0045070)|regulation of cell cycle (GO:0051726)|RNA processing (GO:0006396)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA adenosine deaminase activity (GO:0003726)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(1)	17				Colorectal(79;0.115)		AGAAGGCCTTGAGGTCTTTCG	0.537																																						dbGAP											0													83.0	75.0	78.0					21																	46596033		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U76420	CCDS33589.1, CCDS33590.1, CCDS42970.1	21q22.3	2012-03-22	2010-06-24		ENSG00000197381	ENSG00000197381	3.5.-.-		226	protein-coding gene	gene with protein product	"""RED1 homolog (rat)"""	601218	"""adenosine deaminase, RNA-specific, B1 (homolog of rat RED1)"""			9143496, 14759252	Standard	NR_027672		Approved	ADAR2, DRADA2, ADAR2g, DRABA2, RED1, hRED1, ADAR2a-L1, ADAR2a-L2, ADAR2a-L3, ADAR2a, ADAR2b, ADAR2c, ADAR2d	uc002zgy.2	P78563	OTTHUMG00000090295	ENST00000360697.3:c.417G>A	21.37:g.46596033G>A			A6NFK8|A6NJ84|C3TTQ1|C3TTQ2|C9JUP4|G5E9B4|O00395|O00465|O00691|O00692|P78555|Q4AE79|Q6P0M9|Q8NFD1	Silent	SNP	pfam_A_deamin,pfam_Ds-RNA-bd,superfamily_Cytokine_IL1-like,smart_Ds-RNA-bd,smart_A_deamin,pfscan_Ds-RNA-bd,pfscan_A_deamin	p.L139	ENST00000360697.3	37	c.417	CCDS33589.1	21																																																																																			ADARB1	-	pfam_Ds-RNA-bd,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd	ENSG00000197381		0.537	ADARB1-004	KNOWN	basic|CCDS	protein_coding	ADARB1	HGNC	protein_coding	OTTHUMT00000206648.2	104	0.00	0	G	NM_015833		46596033	46596033	+1	no_errors	ENST00000360697	ensembl	human	known	69_37n	silent	88	47.93	81	SNP	1.000	A
ALKBH5	54890	genome.wustl.edu	37	17	18088015	18088015	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr17:18088015A>G	ENST00000399138.4	+	1	463	c.458A>G	c.(457-459)gAg>gGg	p.E153G	ALKBH5_ENST00000541285.1_Intron|RP11-258F1.1_ENST00000583062.1_RNA|RP11-258F1.1_ENST00000577847.1_RNA	NM_017758.3	NP_060228.3	Q6P6C2	ALKB5_HUMAN	AlkB family member 5, RNA demethylase	153					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|oxidative single-stranded RNA demethylation (GO:0035553)|response to hypoxia (GO:0001666)|spermatogenesis (GO:0007283)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidative RNA demethylase activity (GO:0035515)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|skin(1)	10	all_neural(463;0.228)					CCCGGCCAGGAGCGCCTCTAC	0.672																																					Ovarian(166;154 1953 40235 46283 46309)	dbGAP											0													25.0	30.0	28.0					17																	18088015		1903	4072	5975	-	-	-	SO:0001583	missense	0			AK000315	CCDS42272.1	17p11.2	2014-07-23	2014-07-23	2006-02-09	ENSG00000091542	ENSG00000091542	1.14.11.-	"""Alkylation repair homologs"""	25996	protein-coding gene	gene with protein product		613303	"""oxoglutarate and iron-dependent oxygenase domain containing"", ""alkB, alkylation repair homolog 5 (E. coli)"""	OFOXD1		11997338, 24778178	Standard	NM_017758		Approved	FLJ20308	uc010cpw.3	Q6P6C2	OTTHUMG00000059397	ENST00000399138.4:c.458A>G	17.37:g.18088015A>G	ENSP00000382091:p.Glu153Gly		B4DVJ4|D3DXC6|Q9NXD6	Missense_Mutation	SNP	NULL	p.E153G	ENST00000399138.4	37	c.458	CCDS42272.1	17	.	.	.	.	.	.	.	.	.	.	A	26.3	4.727931	0.89390	.	.	ENSG00000091542	ENST00000261650;ENST00000500385;ENST00000399138	T	0.25579	1.79	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.48169	0.1485	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.44159	-0.9346	10	0.41790	T	0.15	-18.6039	14.3043	0.66375	1.0:0.0:0.0:0.0	.	153	Q6P6C2-2	.	G	153;142;153	ENSP00000382091:E153G	ENSP00000261650:E153G	E	+	2	0	ALKBH5	18028740	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.068000	0.93961	1.969000	0.57287	0.533000	0.62120	GAG	ALKBH5	-	NULL	ENSG00000091542		0.672	ALKBH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALKBH5	HGNC	protein_coding	OTTHUMT00000132069.3	17	0.00	0	A	NM_017758		18088015	18088015	+1	no_errors	ENST00000399138	ensembl	human	known	69_37n	missense	16	36.00	9	SNP	1.000	G
ANK3	288	genome.wustl.edu	37	10	61819102	61819102	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr10:61819102C>T	ENST00000280772.2	-	41	12873	c.12682G>A	c.(12682-12684)Gac>Aac	p.D4228N	ANK3_ENST00000355288.2_Missense_Mutation_p.D852N|RP11-388P9.2_ENST00000414383.1_RNA|ANK3_ENST00000373827.2_Missense_Mutation_p.D1712N|ANK3_ENST00000503366.1_Missense_Mutation_p.D1719N	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	4228					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CCATACCTGTCATCCAGTCGA	0.393																																						dbGAP											0													170.0	153.0	159.0					10																	61819102		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.12682G>A	10.37:g.61819102C>T	ENSP00000280772:p.Asp4228Asn		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.D4228N	ENST00000280772.2	37	c.12682	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	C	15.81	2.942890	0.53079	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000373820;ENST00000355288;ENST00000503366;ENST00000395299;ENST00000373817	T;T;T;T;T	0.71934	-0.26;-0.61;0.45;0.16;-0.61	5.56	4.65	0.58169	.	0.000000	0.37857	U	0.001912	T	0.68165	0.2971	N	0.17082	0.46	0.80722	D	1	B;B;B;D;B;B;B	0.55605	0.012;0.001;0.001;0.972;0.001;0.001;0.073	B;B;B;P;B;B;B	0.57911	0.005;0.001;0.001;0.829;0.002;0.001;0.027	T	0.67662	-0.5613	10	0.34782	T	0.22	.	14.8163	0.70036	0.0:0.9294:0.0:0.0706	.	1719;852;1712;4228;953;852;251	E9PE32;A8KA62;Q5CZH9;Q12955;F5GXK0;B1AQT2;B1AQT0	.;.;.;ANK3_HUMAN;.;.;.	N	4228;1712;310;852;1719;1698;953	ENSP00000280772:D4228N;ENSP00000362933:D1712N;ENSP00000362926:D310N;ENSP00000347436:D852N;ENSP00000425236:D1719N	ENSP00000280772:D4228N	D	-	1	0	ANK3	61489108	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.120000	0.50430	2.623000	0.88846	0.455000	0.32223	GAC	ANK3	-	NULL	ENSG00000151150		0.393	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	218	0.00	0	C	NM_020987		61819102	61819102	-1	no_errors	ENST00000280772	ensembl	human	known	69_37n	missense	154	23.76	48	SNP	1.000	T
ANP32E	81611	genome.wustl.edu	37	1	150204143	150204143	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr1:150204143C>T	ENST00000314136.8	-	2	545	c.176G>A	c.(175-177)cGg>cAg	p.R59Q	ANP32E_ENST00000436748.2_Missense_Mutation_p.R59Q|ANP32E_ENST00000369119.3_Missense_Mutation_p.R11Q|ANP32E_ENST00000369116.4_Intron|ANP32E_ENST00000533654.1_Missense_Mutation_p.R59Q|ANP32E_ENST00000369114.5_Missense_Mutation_p.R59Q|ANP32E_ENST00000369115.2_Intron	NM_001136478.2|NM_001280559.1|NM_030920.3	NP_001129950.1|NP_001267488.1|NP_112182.1	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	59					histone exchange (GO:0043486)|negative regulation of catalytic activity (GO:0043086)	cytoplasmic membrane-bounded vesicle (GO:0016023)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	histone binding (GO:0042393)|phosphatase inhibitor activity (GO:0019212)			breast(3)|endometrium(3)|lung(7)|skin(1)|urinary_tract(1)	15	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCTGGGAAGCCGGGCCAGCGA	0.413																																						dbGAP											0													101.0	99.0	100.0					1																	150204143		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092672	CCDS946.1, CCDS44214.1, CCDS44215.1, CCDS60245.1	1q22	2008-02-05			ENSG00000143401	ENSG00000143401		"""ANP32 acidic nuclear phosphoproteins"""	16673	protein-coding gene	gene with protein product		609611				12438741	Standard	NM_030920		Approved	LANPL, MGC5350, LANP-L	uc001etw.3	Q9BTT0	OTTHUMG00000012547	ENST00000314136.8:c.176G>A	1.37:g.150204143C>T	ENSP00000324074:p.Arg59Gln		B4E0I6|E9PEA6|Q5TB18|Q5TB20|Q8N1S4|Q8WWW9	Missense_Mutation	SNP	pfam_Leu-rich_rpt	p.R59Q	ENST00000314136.8	37	c.176	CCDS946.1	1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.784361	0.49997	.	.	ENSG00000143401	ENST00000314136;ENST00000369119;ENST00000436748;ENST00000369114;ENST00000533654	T;T;T;T;T	0.00321	8.11;8.11;8.11;8.11;8.11	6.06	0.95	0.19572	.	0.257337	0.39759	N	0.001265	T	0.00039	0.0001	N	0.04880	-0.145	0.58432	D	0.999997	P;P;B;B	0.35612	0.512;0.493;0.16;0.307	B;B;B;B	0.19946	0.023;0.027;0.015;0.015	T	0.62632	-0.6813	10	0.41790	T	0.15	.	9.7953	0.40731	0.0:0.4713:0.0:0.5287	.	59;59;59;11	E9PLC4;E9PEA6;Q9BTT0;Q5TB20	.;.;AN32E_HUMAN;.	Q	59;11;59;59;59	ENSP00000324074:R59Q;ENSP00000358115:R11Q;ENSP00000393718:R59Q;ENSP00000358110:R59Q;ENSP00000435215:R59Q	ENSP00000324074:R59Q	R	-	2	0	ANP32E	148470767	0.799000	0.28903	0.590000	0.28732	0.995000	0.86356	1.249000	0.32839	0.137000	0.18759	0.655000	0.94253	CGG	ANP32E	-	NULL	ENSG00000143401		0.413	ANP32E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANP32E	HGNC	protein_coding	OTTHUMT00000035056.1	133	0.00	0	C	NM_030920		150204143	150204143	-1	no_errors	ENST00000314136	ensembl	human	known	69_37n	missense	240	13.31	37	SNP	0.911	T
ARHGEF28	64283	genome.wustl.edu	37	5	73178396	73178396	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr5:73178396A>G	ENST00000426542.2	+	22	2934	c.2914A>G	c.(2914-2916)Aaa>Gaa	p.K972E	ARHGEF28_ENST00000513042.2_Missense_Mutation_p.K972E|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.K659E|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.K972E|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.K972E|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.K972E|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.K972E			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	972	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										CCAGCAGAATAAAAAGTTTCA	0.274																																						dbGAP											0													13.0	13.0	13.0					5																	73178396		1755	3976	5731	-	-	-	SO:0001583	missense	0				CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.2914A>G	5.37:g.73178396A>G	ENSP00000412175:p.Lys972Glu		B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.K972E	ENST00000426542.2	37	c.2914	CCDS54870.1	5	.	.	.	.	.	.	.	.	.	.	A	27.0	4.794054	0.90453	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799	T;T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	5.68	5.68	0.88126	Dbl homology (DH) domain (5);	.	.	.	.	T	0.78629	0.4313	M	0.70595	2.14	0.49798	D	0.999824	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	1.0;1.0;0.996;0.995	T	0.81132	-0.1072	9	0.87932	D	0	.	15.9357	0.79704	1.0:0.0:0.0:0.0	.	659;972;972;972	B5MDA3;Q8N1W1;E9PC75;Q8N1W1-4	.;RGNEF_HUMAN;.;.	E	972;972;972;972;972;972;659	ENSP00000296794:K972E;ENSP00000441913:K972E;ENSP00000441436:K972E;ENSP00000287898:K972E;ENSP00000411459:K972E;ENSP00000412175:K972E;ENSP00000296799:K659E	ENSP00000287898:K972E	K	+	1	0	RP11-428C6.1	73214152	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.145000	0.94634	2.177000	0.69029	0.528000	0.53228	AAA	ARHGEF28	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000214944		0.274	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF28	HGNC	protein_coding	OTTHUMT00000368975.1	47	0.00	0	A			73178396	73178396	+1	no_errors	ENST00000545377	ensembl	human	known	69_37n	missense	30	30.23	13	SNP	1.000	G
AUTS2	26053	genome.wustl.edu	37	7	70255691	70255691	+	Silent	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr7:70255691G>A	ENST00000342771.4	+	19	3810	c.3489G>A	c.(3487-3489)gaG>gaA	p.E1163E	AUTS2_ENST00000406775.2_Silent_p.E1139E	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	1163	His-rich.									breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		AAGACTACGAGCACACGCGGC	0.692																																						dbGAP											0													44.0	51.0	49.0					7																	70255691		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.3489G>A	7.37:g.70255691G>A			A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	prints_AUTS2	p.E1163	ENST00000342771.4	37	c.3489	CCDS5539.1	7																																																																																			AUTS2	-	NULL	ENSG00000158321		0.692	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AUTS2	HGNC	protein_coding	OTTHUMT00000251971.2	36	0.00	0	G			70255691	70255691	+1	no_errors	ENST00000342771	ensembl	human	known	69_37n	silent	28	41.67	20	SNP	1.000	A
BLK	640	genome.wustl.edu	37	8	11418950	11418950	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr8:11418950C>T	ENST00000259089.4	+	11	1761	c.1169C>T	c.(1168-1170)aCg>aTg	p.T390M	BLK_ENST00000529894.1_Missense_Mutation_p.T319M|RP11-148O21.2_ENST00000533322.1_RNA	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	390	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		AGTGAATACACGGCCCAAGAG	0.557																																						dbGAP											0													75.0	63.0	67.0					8																	11418950		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.1169C>T	8.37:g.11418950C>T	ENSP00000259089:p.Thr390Met		Q16291|Q96IN1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.T390M	ENST00000259089.4	37	c.1169	CCDS5982.1	8	.	.	.	.	.	.	.	.	.	.	C	9.320	1.057779	0.19907	.	.	ENSG00000136573	ENST00000259089;ENST00000427279;ENST00000529894;ENST00000526097	D;D	0.83335	-1.71;-1.71	4.22	2.4	0.29515	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.359766	0.20165	N	0.097871	T	0.79534	0.4462	L	0.55743	1.74	0.42862	D	0.994114	P;B	0.48294	0.908;0.144	P;B	0.45474	0.482;0.059	T	0.77216	-0.2669	10	0.62326	D	0.03	.	8.0157	0.30379	0.0:0.7081:0.0:0.2919	.	226;390	E9PM44;P51451	.;BLK_HUMAN	M	390;390;319;226	ENSP00000259089:T390M;ENSP00000433663:T319M	ENSP00000259089:T390M	T	+	2	0	BLK	11456359	0.515000	0.26210	0.612000	0.29024	0.427000	0.31564	1.355000	0.34068	0.520000	0.28426	-0.254000	0.11334	ACG	BLK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000136573		0.557	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLK	HGNC	protein_coding	OTTHUMT00000207460.1	109	0.00	0	C			11418950	11418950	+1	no_errors	ENST00000259089	ensembl	human	known	69_37n	missense	28	44.00	22	SNP	0.911	T
AZIN1	51582	genome.wustl.edu	37	8	103841546	103841546	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr8:103841546C>T	ENST00000337198.5	-	11	2352	c.1189G>A	c.(1189-1191)Gat>Aat	p.D397N	AZIN1_ENST00000347770.4_Missense_Mutation_p.D397N	NM_148174.2	NP_680479.1	O14977	AZIN1_HUMAN	antizyme inhibitor 1	397					cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of catalytic activity (GO:0043086)|negative regulation of protein catabolic process (GO:0042177)|polyamine biosynthetic process (GO:0006596)|positive regulation of polyamine transmembrane transport (GO:1902269)|regulation of cellular amino acid metabolic process (GO:0006521)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|enzyme inhibitor activity (GO:0004857)|ornithine decarboxylase activator activity (GO:0042978)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	9	Lung NSC(17;0.000143)|all_lung(17;0.000294)		OV - Ovarian serous cystadenocarcinoma(57;0.000196)|STAD - Stomach adenocarcinoma(118;0.0414)			CTCTGAAAATCATTAAAAGCA	0.378																																						dbGAP											0													114.0	117.0	116.0					8																	103841546		2203	4300	6503	-	-	-	SO:0001583	missense	0			AAC25391	CCDS6295.1	8p22-q21.3	2005-03-21	2005-03-21	2005-03-21		ENSG00000155096			16432	protein-coding gene	gene with protein product	"""ornithine decarboxylase 1-like"""	607909	"""ornithine decarboxylase antizyme inhibitor"""	OAZIN		9349715, 9110174	Standard	XM_005250969		Approved	OAZI, ODC1L	uc003yky.3	O14977		ENST00000337198.5:c.1189G>A	8.37:g.103841546C>T	ENSP00000337180:p.Asp397Asn		A6NCD5|Q6IBQ7|Q96D20	Missense_Mutation	SNP	pfam_De-COase2_N,pfam_De-COase2_C,superfamily_Ala_racemase/Decarboxylase_C,prints_Orn_de-COase,prints_Orn/DAP/Arg_de-COase	p.D397N	ENST00000337198.5	37	c.1189	CCDS6295.1	8	.	.	.	.	.	.	.	.	.	.	C	17.03	3.284406	0.59867	.	.	ENSG00000155096	ENST00000337198;ENST00000347770	T;T	0.41400	1.0;1.0	5.85	5.85	0.93711	Orn/DAP/Arg decarboxylase 2, C-terminal (1);Alanine racemase/group IV decarboxylase, C-terminal (2);	0.199387	0.51477	D	0.000081	T	0.56819	0.2011	L	0.57536	1.79	0.58432	D	0.999991	P	0.46987	0.888	P	0.52424	0.698	T	0.56998	-0.7886	10	0.87932	D	0	-17.083	20.1617	0.98138	0.0:1.0:0.0:0.0	.	397	O14977	AZIN1_HUMAN	N	397	ENSP00000337180:D397N;ENSP00000321507:D397N	ENSP00000337180:D397N	D	-	1	0	AZIN1	103910722	1.000000	0.71417	0.999000	0.59377	0.057000	0.15508	3.168000	0.50801	2.772000	0.95346	0.585000	0.79938	GAT	AZIN1	-	pfam_De-COase2_C,superfamily_Ala_racemase/Decarboxylase_C,prints_Orn/DAP/Arg_de-COase	ENSG00000155096		0.378	AZIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZIN1	HGNC	protein_coding	OTTHUMT00000380133.1	162	0.00	0	C			103841546	103841546	-1	no_errors	ENST00000337198	ensembl	human	known	69_37n	missense	139	23.37	43	SNP	0.998	T
CD5L	922	genome.wustl.edu	37	1	157805906	157805906	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr1:157805906C>T	ENST00000368174.4	-	3	191	c.95G>A	c.(94-96)cGc>cAc	p.R32H	CD5L_ENST00000484609.1_5'UTR	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	32	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)	p.R32H(3)|p.R32P(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCCTTCACAGCGGTGGAGGCC	0.622																																						dbGAP											4	Substitution - Missense(4)	urinary_tract(1)|large_intestine(1)|lung(1)|endometrium(1)											43.0	46.0	45.0					1																	157805906		2203	4300	6503	-	-	-	SO:0001583	missense	0			U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.95G>A	1.37:g.157805906C>T	ENSP00000357156:p.Arg32His		A8K7M5|Q6UX63	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.R32H	ENST00000368174.4	37	c.95	CCDS1171.1	1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.256784	0.39896	.	.	ENSG00000073754	ENST00000368174	T	0.36340	1.26	4.85	1.9	0.25705	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);	0.150671	0.31312	N	0.007862	T	0.11281	0.0275	L	0.43598	1.365	0.26669	N	0.971761	P	0.50819	0.939	B	0.39027	0.288	T	0.10567	-1.0624	10	0.40728	T	0.16	.	7.7613	0.28955	0.0:0.709:0.0:0.291	.	32	O43866	CD5L_HUMAN	H	32	ENSP00000357156:R32H	ENSP00000357156:R32H	R	-	2	0	CD5L	156072530	0.000000	0.05858	0.569000	0.28460	0.331000	0.28603	-0.759000	0.04761	0.221000	0.20879	0.563000	0.77884	CGC	CD5L	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Srcr_rcpt,pfscan_Srcr_rcpt	ENSG00000073754		0.622	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD5L	HGNC	protein_coding	OTTHUMT00000058346.1	74	0.00	0	C	NM_005894		157805906	157805906	-1	no_errors	ENST00000368174	ensembl	human	known	69_37n	missense	107	16.41	21	SNP	0.807	T
CLDN10	9071	genome.wustl.edu	37	13	96086159	96086159	+	Silent	SNP	G	G	A	rs555298278	byFrequency	TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr13:96086159G>A	ENST00000376873.3	+	1	302	c.72G>A	c.(70-72)acG>acA	p.T24T		NM_001160100.1|NM_182848.3	NP_001153572.1|NP_878268.1	P78369	CLD10_HUMAN	claudin 10	26					calcium-independent cell-cell adhesion (GO:0016338)|cell adhesion (GO:0007155)|ion transport (GO:0006811)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			CTGCTACCACGTCCAATGAGT	0.587													G|||	3	0.000599042	0.0	0.0	5008	,	,		17063	0.0		0.0	False		,,,				2504	0.0031					dbGAP											0													150.0	111.0	124.0					13																	96086159		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U89916	CCDS9475.1, CCDS9476.1	13q31-q34	2008-07-18			ENSG00000134873	ENSG00000134873		"""Claudins"""	2033	protein-coding gene	gene with protein product						18025272	Standard	NM_182848		Approved	OSP-L, CPETRL3	uc001vmh.2	P78369	OTTHUMG00000017217	ENST00000376873.3:c.72G>A	13.37:g.96086159G>A			Q6IBF9|Q96N78	Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin10	p.T24	ENST00000376873.3	37	c.72	CCDS9475.1	13																																																																																			CLDN10	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000134873		0.587	CLDN10-001	KNOWN	basic|CCDS	protein_coding	CLDN10	HGNC	protein_coding	OTTHUMT00000045483.3	136	0.00	0	G	NM_006984		96086159	96086159	+1	no_errors	ENST00000376873	ensembl	human	known	69_37n	silent	118	20.67	31	SNP	0.002	A
COPS3	8533	genome.wustl.edu	37	17	17163754	17163754	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr17:17163754A>G	ENST00000268717.5	-	8	903	c.797T>C	c.(796-798)gTg>gCg	p.V266A	COPS3_ENST00000439936.2_Intron|COPS3_ENST00000539941.2_Missense_Mutation_p.V246A	NM_003653.3	NP_003644.2	Q9UNS2	CSN3_HUMAN	COP9 signalosome subunit 3	266	PCI.				cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				NS(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	13						GGTTGAATACACTTGTGCTAA	0.458																																						dbGAP											0													201.0	169.0	180.0					17																	17163754		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF031647	CCDS11183.1, CCDS56022.1	17p11.2	2013-03-14	2013-03-14		ENSG00000141030	ENSG00000141030			2239	protein-coding gene	gene with protein product		604665	"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 3"", ""COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)"""			9535219, 10191102	Standard	NM_003653		Approved	SGN3, CSN3	uc002grd.3	Q9UNS2	OTTHUMG00000059281	ENST00000268717.5:c.797T>C	17.37:g.17163754A>G	ENSP00000268717:p.Val266Ala		B2R683|B4DY81|O43191|Q7LDR6	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.V266A	ENST00000268717.5	37	c.797	CCDS11183.1	17	.	.	.	.	.	.	.	.	.	.	A	9.890	1.204065	0.22205	.	.	ENSG00000141030	ENST00000268717;ENST00000539941;ENST00000417352	T;T	0.25749	1.78;1.78	5.47	5.47	0.80525	Tetratricopeptide-like helical (1);Proteasome component (PCI) domain (1);	0.125717	0.56097	D	0.000037	T	0.06872	0.0175	N	0.00385	-1.57	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31280	-0.9949	10	0.02654	T	1	-21.0389	14.7268	0.69351	1.0:0.0:0.0:0.0	.	266	Q9UNS2	CSN3_HUMAN	A	266;246;297	ENSP00000268717:V266A;ENSP00000437606:V246A	ENSP00000268717:V266A	V	-	2	0	COPS3	17104479	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.186000	0.77722	2.074000	0.62210	0.533000	0.62120	GTG	COPS3	-	pfam_PCI_dom	ENSG00000141030		0.458	COPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS3	HGNC	protein_coding	OTTHUMT00000131603.2	353	0.00	0	A			17163754	17163754	-1	no_errors	ENST00000268717	ensembl	human	known	69_37n	missense	240	35.64	134	SNP	1.000	G
CRB2	286204	genome.wustl.edu	37	9	126125420	126125420	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr9:126125420G>A	ENST00000373631.3	+	2	372	c.371G>A	c.(370-372)cGc>cAc	p.R124H	CRB2_ENST00000359999.3_Missense_Mutation_p.R124H	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	124	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						GCCACCTGCCGCAACCTGGCC	0.652																																						dbGAP											0													28.0	24.0	25.0					9																	126125420		2197	4292	6489	-	-	-	SO:0001583	missense	0			AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.371G>A	9.37:g.126125420G>A	ENSP00000362734:p.Arg124His		A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.R124H	ENST00000373631.3	37	c.371	CCDS6852.2	9	.	.	.	.	.	.	.	.	.	.	G	13.33	2.206314	0.39003	.	.	ENSG00000148204	ENST00000359999;ENST00000373631	D;D	0.88431	-2.38;-2.38	4.89	-9.5	0.00584	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	1.186920	0.06437	N	0.725153	T	0.70360	0.3215	N	0.05259	-0.085	0.35672	D	0.813354	B;B	0.15473	0.01;0.013	B;B	0.08055	0.003;0.002	T	0.37820	-0.9689	10	0.14252	T	0.57	.	10.1047	0.42526	0.6622:0.0:0.2169:0.1209	.	124;124	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	H	124	ENSP00000353092:R124H;ENSP00000362734:R124H	ENSP00000353092:R124H	R	+	2	0	CRB2	125165241	0.000000	0.05858	0.719000	0.30619	0.979000	0.70002	-2.249000	0.01188	-1.617000	0.01570	-1.079000	0.02226	CGC	CRB2	-	pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000148204		0.652	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB2	HGNC	protein_coding	OTTHUMT00000053990.3	23	0.00	0	G	NM_173689		126125420	126125420	+1	no_errors	ENST00000373631	ensembl	human	known	69_37n	missense	9	40.00	6	SNP	0.325	A
CXorf57	55086	genome.wustl.edu	37	X	105855830	105855830	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chrX:105855830C>T	ENST00000372548.4	+	1	629	c.520C>T	c.(520-522)Cag>Tag	p.Q174*	CXorf57_ENST00000372544.2_Nonsense_Mutation_p.Q174*	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	174							poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						TAGAGCGCACCAGGAGAAACC	0.478																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.520C>T	X.37:g.105855830C>T	ENSP00000361628:p.Gln174*		H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Nonsense_Mutation	SNP	superfamily_NA-bd_OB-fold-like	p.Q174*	ENST00000372548.4	37	c.520	CCDS14519.1	X	.	.	.	.	.	.	.	.	.	.	C	22.9	4.351672	0.82132	.	.	ENSG00000147231	ENST00000372544;ENST00000372548	.	.	.	3.5	-3.6	0.04570	.	0.990001	0.08229	N	0.977952	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	0.3589	13.894	0.63757	0.0932:0.7465:0.1603:0.0	.	.	.	.	X	174	.	ENSP00000361623:Q174X	Q	+	1	0	CXorf57	105742486	0.000000	0.05858	0.000000	0.03702	0.616000	0.37450	-0.872000	0.04219	-1.117000	0.02965	-0.207000	0.12724	CAG	CXorf57	-	superfamily_NA-bd_OB-fold-like	ENSG00000147231		0.478	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf57	HGNC	protein_coding	OTTHUMT00000057800.2	41	0.00	0	C	NM_018015		105855830	105855830	+1	no_errors	ENST00000372548	ensembl	human	known	69_37n	nonsense	42	31.15	19	SNP	0.000	T
CYP4F24P	388514	genome.wustl.edu	37	19	15872088	15872088	+	lincRNA	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr19:15872088C>T	ENST00000595525.1	+	0	529																											AGCACAATGTCCCAGATGCGG	0.622																																						dbGAP											0																																										-	-	-			0																															19.37:g.15872088C>T				RNA	SNP	-	NULL	ENST00000595525.1	37	NULL		19																																																																																			CYP4F24P	-	-	ENSG00000267594		0.622	LLNLR-249E10.1-001	KNOWN	basic	lincRNA	CYP4F24P	HGNC	lincRNA	OTTHUMT00000472008.1	66	0.00	0	C			15872088	15872088	-1	no_errors	ENST00000589193	ensembl	human	known	69_37n	rna	89	12.62	13	SNP	1.000	T
DAOA	267012	genome.wustl.edu	37	13	106142353	106142353	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr13:106142353A>G	ENST00000375936.3	+	4	431	c.385A>G	c.(385-387)Atg>Gtg	p.M129V	DAOA_ENST00000329625.5_Missense_Mutation_p.M58V|DAOA-AS1_ENST00000448407.1_RNA	NM_001161812.1|NM_172370.3	NP_001155284.1|NP_758958.3	P59103	DAOA_HUMAN	D-amino acid oxidase activator	129					negative regulation of D-amino-acid oxidase activity (GO:1900758)|positive regulation of catalytic activity (GO:0043085)	Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	13	Lung NSC(43;0.01)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					tctagaacgaatgtggacctg	0.458																																						dbGAP											0													46.0	48.0	48.0					13																	106142353		1991	4184	6175	-	-	-	SO:0001583	missense	0			AY138547	CCDS41905.1, CCDS53880.1, CCDS59242.1	13q33.2	2011-08-01			ENSG00000182346	ENSG00000182346			21191	protein-coding gene	gene with protein product	"""G72 transcript"""	607408				12364586, 15057823	Standard	NM_001161814		Approved	G72	uc010tjg.2	P59103	OTTHUMG00000041333	ENST00000375936.3:c.385A>G	13.37:g.106142353A>G	ENSP00000365103:p.Met129Val		A6NKG7|Q0VAE6|Q5VX59|Q86Y17|Q8IWM4	Missense_Mutation	SNP	NULL	p.M129V	ENST00000375936.3	37	c.385	CCDS41905.1	13	.	.	.	.	.	.	.	.	.	.	A	6.551	0.469995	0.12461	.	.	ENSG00000182346	ENST00000375936;ENST00000329625	T	0.26518	1.73	2.58	1.38	0.22167	.	.	.	.	.	T	0.13286	0.0322	N	0.14661	0.345	0.09310	N	1	B;B	0.24823	0.112;0.05	B;B	0.20767	0.031;0.019	T	0.24012	-1.0172	9	0.87932	D	0	.	4.4096	0.11427	0.8395:0.0:0.1605:0.0	.	101;129	A2T115;P59103	.;DAOA_HUMAN	V	129;58	ENSP00000365103:M129V	ENSP00000329951:M58V	M	+	1	0	DAOA	104940354	0.000000	0.05858	0.005000	0.12908	0.003000	0.03518	-0.502000	0.06390	0.425000	0.26087	0.528000	0.53228	ATG	DAOA	-	NULL	ENSG00000182346		0.458	DAOA-005	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	DAOA	HGNC	protein_coding	OTTHUMT00000099040.2	100	0.00	0	A	NM_172370		106142353	106142353	+1	no_errors	ENST00000375936	ensembl	human	known	69_37n	missense	75	29.91	32	SNP	0.005	G
DLG3	1741	genome.wustl.edu	37	X	69717042	69717042	+	Intron	SNP	C	C	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chrX:69717042C>A	ENST00000374360.3	+	14	2052				DLG3_ENST00000194900.4_Missense_Mutation_p.S629Y|DLG3_ENST00000542398.1_Missense_Mutation_p.S146Y|DLG3_ENST00000461646.1_3'UTR|DLG3_ENST00000374355.3_Missense_Mutation_p.S292Y	NM_021120.3	NP_066943.2	Q92796	DLG3_HUMAN	discs, large homolog 3 (Drosophila)						axon guidance (GO:0007411)|establishment of planar polarity (GO:0001736)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphatase activity (GO:0010923)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)|tight junction (GO:0005923)	phosphatase binding (GO:0019902)	p.S292C(1)		endometrium(4)|kidney(1)|large_intestine(10)|lung(5)|pancreas(1)|urinary_tract(1)	22	Renal(35;0.156)					GGAGTGACATCCAACACCAGT	0.498																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											175.0	171.0	172.0					X																	69717042		2135	4237	6372	-	-	-	SO:0001627	intron_variant	0			U49089	CCDS14403.1, CCDS43967.1, CCDS55439.1	Xq13.1	2014-06-12	2008-12-15		ENSG00000082458	ENSG00000082458			2902	protein-coding gene	gene with protein product	"""neuroendocrine-dlg"", ""protein phosphatase 1, regulatory subunit 82"""	300189	"""discs, large homolog 3 (neuroendocrine-dlg, Drosophila)"""			9598320	Standard	NM_021120		Approved	NE-Dlg, SAP102, SAP-102, NEDLG, KIAA1232, MRX90, PPP1R82	uc004dyi.2	Q92796	OTTHUMG00000021778	ENST00000374360.3:c.1820-1328C>A	X.37:g.69717042C>A			B4E0H1|D3DVU5|Q5JUW6|Q5JUW7|Q9ULI8	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_PDZ,pfam_PDZ_assoc,pfam_MAGUK_PEST_N,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pirsf_M-assoc_guanylate_kinase,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.S629Y	ENST00000374360.3	37	c.1886	CCDS14403.1	X	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366834	0.82463	.	.	ENSG00000082458	ENST00000194900;ENST00000374355;ENST00000542398	T;T;T	0.17528	2.6;2.27;3.01	5.18	5.18	0.71444	.	0.000000	0.64402	U	0.000001	T	0.42944	0.1225	.	.	.	0.80722	D	1	D;D	0.65815	0.995;0.966	D;P	0.75484	0.986;0.707	T	0.25222	-1.0138	8	.	.	.	.	16.6183	0.84922	0.0:1.0:0.0:0.0	.	146;292	B4E0H1;Q5JUW6	.;.	Y	629;292;146	ENSP00000194900:S629Y;ENSP00000363475:S292Y;ENSP00000441393:S146Y	.	S	+	2	0	DLG3	69633767	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.601000	0.67606	2.387000	0.81309	0.594000	0.82650	TCC	DLG3	-	superfamily_SH3_domain,pirsf_M-assoc_guanylate_kinase	ENSG00000082458		0.498	DLG3-001	KNOWN	basic|CCDS	protein_coding	DLG3	HGNC	protein_coding	OTTHUMT00000057074.2	301	0.00	0	C	NM_021120		69717042	69717042	+1	no_errors	ENST00000194900	ensembl	human	known	69_37n	missense	184	37.29	110	SNP	1.000	A
DOCK9	23348	genome.wustl.edu	37	13	99461377	99461377	+	Splice_Site	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr13:99461377C>T	ENST00000376460.1	-	49	5453	c.5373G>A	c.(5371-5373)gcG>gcA	p.A1791A	DOCK9_ENST00000339416.2_Intron	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1792	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AAGAACTTACCGCTGCCTTaa	0.333																																						dbGAP											0													54.0	49.0	51.0					13																	99461377		956	2079	3035	-	-	-	SO:0001630	splice_region_variant	0			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.5373+1G>A	13.37:g.99461377C>T			B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Silent	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A1791	ENST00000376460.1	37	c.5373	CCDS45062.1	13																																																																																			DOCK9	-	NULL	ENSG00000088387		0.333	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK9	HGNC	protein_coding	OTTHUMT00000045566.1	75	0.00	0	C	NM_015296	Silent	99461377	99461377	-1	no_errors	ENST00000376460	ensembl	human	known	69_37n	silent	35	25.53	12	SNP	1.000	T
FAM166A	401565	genome.wustl.edu	37	9	140142146	140142147	+	Frame_Shift_Ins	INS	-	-	G	rs376439635		TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr9:140142146_140142147insG	ENST00000344774.4	-	1	75_76	c.21_22insC	c.(19-24)cacgatfs	p.D8fs	FAM166A_ENST00000388932.2_Frame_Shift_Ins_p.D8fs	NM_001001710.1	NP_001001710.1	Q6J272	F166A_HUMAN	family with sequence similarity 166, member A	8						nucleus (GO:0005634)				kidney(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(2)	15						GTGAAGAGATCGTGTTTCTGAG	0.634																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC132916	CCDS35186.1	9q34.3	2008-08-08			ENSG00000188163	ENSG00000188163			33818	protein-coding gene	gene with protein product							Standard	XR_245332		Approved		uc004cmi.1	Q6J272	OTTHUMG00000159545	ENST00000344774.4:c.22dupC	9.37:g.140142147_140142147dupG	ENSP00000344729:p.Asp8fs		A6NND9|Q8N830	Frame_Shift_Ins	INS	pfam_UPF0573/UPF0605	p.D7fs	ENST00000344774.4	37	c.22_21	CCDS35186.1	9																																																																																			FAM166A	-	NULL	ENSG00000188163		0.634	FAM166A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM166A	HGNC	protein_coding	OTTHUMT00000356125.1	294	0.00	0	-	NM_001001710		140142146	140142147	-1	no_errors	ENST00000344774	ensembl	human	known	69_37n	frame_shift_ins	170	25.11	57	INS	0.001:0.162	G
FCHO2	115548	genome.wustl.edu	37	5	72330517	72330517	+	Missense_Mutation	SNP	G	G	T	rs200528741		TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr5:72330517G>T	ENST00000430046.2	+	9	946	c.830G>T	c.(829-831)aGt>aTt	p.S277I	FCHO2_ENST00000287761.6_Missense_Mutation_p.S277I|FCHO2_ENST00000341845.6_Missense_Mutation_p.S277I|FCHO2_ENST00000512348.1_Missense_Mutation_p.S244I	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	277					clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		GACACTGCTAGTGCAGTTGAA	0.323																																						dbGAP											0													94.0	91.0	92.0					5																	72330517		1837	4092	5929	-	-	-	SO:0001583	missense	0			AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.830G>T	5.37:g.72330517G>T	ENSP00000393776:p.Ser277Ile		A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_FCH,smart_FCH,pfscan_FCH	p.S277I	ENST00000430046.2	37	c.830	CCDS47230.1	5	.	.	.	.	.	.	.	.	.	.	G	11.77	1.736644	0.30774	.	.	ENSG00000157107	ENST00000430046;ENST00000341845;ENST00000512348;ENST00000287761	T;T;T;T	0.54479	1.32;1.34;3.84;0.57	5.39	5.39	0.77823	.	0.756841	0.13689	N	0.369699	T	0.40719	0.1128	N	0.19112	0.55	0.35830	D	0.825232	B;B;B;B	0.22683	0.073;0.001;0.049;0.001	B;B;B;B	0.23419	0.046;0.004;0.012;0.002	T	0.41680	-0.9495	10	0.34782	T	0.22	-10.3152	14.3762	0.66879	0.0:0.0:0.8521:0.1479	.	244;244;277;277	B4DHK0;E9PG79;Q0JRZ9-2;Q0JRZ9	.;.;.;FCHO2_HUMAN	I	277;277;244;277	ENSP00000393776:S277I;ENSP00000344034:S277I;ENSP00000427296:S244I;ENSP00000287761:S277I	ENSP00000287761:S277I	S	+	2	0	FCHO2	72366273	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.768000	0.55295	2.683000	0.91414	0.655000	0.94253	AGT	FCHO2	-	NULL	ENSG00000157107		0.323	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCHO2	HGNC	protein_coding	OTTHUMT00000368795.3	144	0.00	0	G	XM_291142		72330517	72330517	+1	no_errors	ENST00000341845	ensembl	human	known	69_37n	missense	101	25.19	34	SNP	1.000	T
FRMD4B	23150	genome.wustl.edu	37	3	69244205	69244205	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr3:69244205T>G	ENST00000398540.3	-	16	1539	c.1456A>C	c.(1456-1458)Aaa>Caa	p.K486Q	FRMD4B_ENST00000478263.1_Missense_Mutation_p.K138Q|FRMD4B_ENST00000542259.1_Missense_Mutation_p.K432Q	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	486					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		TCATCTAATTTGAACGCAGTA	0.468																																						dbGAP											0													103.0	95.0	98.0					3																	69244205		1942	4156	6098	-	-	-	SO:0001583	missense	0			AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.1456A>C	3.37:g.69244205T>G	ENSP00000381549:p.Lys486Gln		Q8TAI3	Missense_Mutation	SNP	pfam_DUF3338,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,pfscan_FERM_domain	p.K486Q	ENST00000398540.3	37	c.1456	CCDS46863.1	3	.	.	.	.	.	.	.	.	.	.	T	19.74	3.883723	0.72410	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000478263	D;D	0.84660	-1.88;-1.87	5.62	5.62	0.85841	.	0.141954	0.64402	D	0.000007	D	0.89143	0.6631	M	0.69185	2.1	0.43598	D	0.995955	P;P	0.51537	0.946;0.619	P;P	0.54372	0.75;0.455	D	0.89132	0.3510	10	0.46703	T	0.11	-13.8477	16.1251	0.81386	0.0:0.0:0.0:1.0	.	330;486	B4DHD5;Q9Y2L6	.;FRM4B_HUMAN	Q	486;432;138	ENSP00000381549:K486Q;ENSP00000437658:K432Q	ENSP00000381549:K486Q	K	-	1	0	FRMD4B	69326895	1.000000	0.71417	0.984000	0.44739	0.326000	0.28443	7.648000	0.83479	2.267000	0.75376	0.477000	0.44152	AAA	FRMD4B	-	pfam_DUF3338	ENSG00000114541		0.468	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD4B	HGNC	protein_coding	OTTHUMT00000352111.1	168	0.00	0	T			69244205	69244205	-1	no_errors	ENST00000398540	ensembl	human	known	69_37n	missense	94	33.80	48	SNP	1.000	G
GATA3	2625	genome.wustl.edu	37	10	8111513	8111514	+	Frame_Shift_Ins	INS	-	-	G			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr10:8111513_8111514insG	ENST00000346208.3	+	5	1454_1455	c.999_1000insG	c.(1000-1002)gggfs	p.G334fs	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Frame_Shift_Ins_p.G335fs			P23771	GATA3_HUMAN	GATA binding protein 3	334					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.N334fs*19(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						GGAATGCCAATGGGGACCCTGT	0.569			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	1	Insertion - Frameshift(1)	NS(1)																																								-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1003dupG	10.37:g.8111517_8111517dupG	ENSP00000341619:p.Gly334fs		Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Ins	INS	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.D335fs	ENST00000346208.3	37	c.1002_1003	CCDS7083.1	10																																																																																			GATA3	-	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA	ENSG00000107485		0.569	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	150	0.00	0	-	NM_001002295		8111513	8111514	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_ins	75	29.91	32	INS	0.859:1.000	G
GGT3P	2679	genome.wustl.edu	37	22	18769201	18769201	+	RNA	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr22:18769201G>A	ENST00000412448.1	-	0	1085							A6NGU5	GGT3_HUMAN	gamma-glutamyltransferase 3 pseudogene						glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)										TCAGCCAGCCGCGGCAGGGTC	0.642																																						dbGAP											0																																										-	-	-			0					22q11.21	2008-08-05	2008-03-10	2008-03-10	ENSG00000197421	ENSG00000197421		"""Gamma-glutamyltransferases"""	4252	pseudogene	pseudogene			"""gamma-glutamyltransferase 3"""	GGT3		8104871, 18357469	Standard	NR_003267		Approved		uc002zob.1	A6NGU5	OTTHUMG00000150161		22.37:g.18769201G>A				RNA	SNP	-	NULL	ENST00000412448.1	37	NULL		22																																																																																			GGT3P	-	-	ENSG00000197421		0.642	GGT3P-002	KNOWN	basic	processed_transcript	GGT3P	HGNC	pseudogene	OTTHUMT00000341281.1	71	0.00	0	G	NR_003267		18769201	18769201	-1	no_errors	ENST00000412448	ensembl	human	known	69_37n	rna	41	18.00	9	SNP	0.098	A
GK2	2712	genome.wustl.edu	37	4	80327945	80327945	+	Silent	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr4:80327945G>A	ENST00000358842.3	-	1	1427	c.1410C>T	c.(1408-1410)agC>agT	p.S470S		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						GGCTCCAAACGCTTACTCCCT	0.473																																						dbGAP											0													104.0	103.0	103.0					4																	80327945		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.1410C>T	4.37:g.80327945G>A			Q7Z4Q4	Silent	SNP	pfam_Carb_kinase_FGGY_N,pfam_Carb_kinase_FGGY_C,tigrfam_Glycerol_kin	p.S470	ENST00000358842.3	37	c.1410	CCDS3585.1	4																																																																																			GK2	-	tigrfam_Glycerol_kin	ENSG00000196475		0.473	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GK2	HGNC	protein_coding	OTTHUMT00000252517.2	148	0.00	0	G	NM_033214		80327945	80327945	-1	no_errors	ENST00000358842	ensembl	human	known	69_37n	silent	101	27.86	39	SNP	0.000	A
GPC2	221914	genome.wustl.edu	37	7	99773285	99773286	+	Frame_Shift_Ins	INS	-	-	G			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr7:99773285_99773286insG	ENST00000292377.2	-	3	724_725	c.557_558insC	c.(556-558)cctfs	p.P186fs	STAG3_ENST00000394018.2_5'Flank|STAG3_ENST00000426455.1_5'Flank|GPC2_ENST00000471050.1_5'Flank|STAG3_ENST00000317296.5_5'Flank	NM_152742.1	NP_689955.1	Q8N158	GPC2_HUMAN	glypican 2	186					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuron differentiation (GO:0030182)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	anchored component of membrane (GO:0031225)|endoplasmic reticulum (GO:0005783)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(3)	18	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCAGGTAGTCAGGGGGGAAGCT	0.634																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BX375153	CCDS5689.1	7q22.1	2007-02-16	2007-02-15		ENSG00000213420	ENSG00000213420		"""Proteoglycans / Cell Surface : Glypicans"""	4450	protein-coding gene	gene with protein product	"""glypican proteoglycan 2, cerebroglycan proteoglycan"""		"""glypican 2 (cerebroglycan)"""			8294498	Standard	NM_152742		Approved	cerebroglycan, FLJ38962, DKFZp547M109	uc003utv.3	Q8N158	OTTHUMG00000154894	ENST00000292377.2:c.558dupC	7.37:g.99773291_99773291dupG	ENSP00000292377:p.Pro186fs		A4D2A7	Frame_Shift_Ins	INS	pfam_Glypican	p.D187fs	ENST00000292377.2	37	c.558_557	CCDS5689.1	7																																																																																			GPC2	-	pfam_Glypican	ENSG00000213420		0.634	GPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC2	HGNC	protein_coding	OTTHUMT00000337556.1	55	0.00	0	-	NM_152742		99773285	99773286	-1	no_errors	ENST00000292377	ensembl	human	known	69_37n	frame_shift_ins	40	28.57	16	INS	0.978:1.000	G
GPR126	57211	genome.wustl.edu	37	6	142711398	142711398	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr6:142711398G>A	ENST00000230173.6	+	7	1702	c.1226G>A	c.(1225-1227)gGa>gAa	p.G409E	GPR126_ENST00000367609.3_Missense_Mutation_p.G409E|GPR126_ENST00000367608.2_Missense_Mutation_p.G381E|GPR126_ENST00000296932.8_Missense_Mutation_p.G381E	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	409					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		TGGGCAGATGGAATTATCTAT	0.328																																						dbGAP											0													90.0	88.0	89.0					6																	142711398		1831	4079	5910	-	-	-	SO:0001583	missense	0			AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.1226G>A	6.37:g.142711398G>A	ENSP00000230173:p.Gly409Glu		Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_CUB,pfam_GPS_dom,pfam_Pentaxin,superfamily_CUB,superfamily_ConA-like_lec_gl,smart_CUB,smart_Pentaxin,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.G409E	ENST00000230173.6	37	c.1226	CCDS47490.1	6	.	.	.	.	.	.	.	.	.	.	G	21.8	4.202164	0.79127	.	.	ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609	T;T;T;T	0.59364	0.27;0.27;0.27;0.27	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000010	T	0.62841	0.2461	L	0.55481	1.735	0.39559	D	0.969103	D;D;D;D	0.65815	0.995;0.995;0.995;0.991	P;P;P;P	0.60117	0.869;0.869;0.869;0.743	T	0.65907	-0.6054	10	0.62326	D	0.03	.	16.4784	0.84144	0.0:0.0:1.0:0.0	.	381;409;381;409	Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4	.;.;.;GP126_HUMAN	E	409;381;381;409	ENSP00000230173:G409E;ENSP00000356580:G381E;ENSP00000296932:G381E;ENSP00000356581:G409E	ENSP00000230173:G409E	G	+	2	0	GPR126	142753091	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.066000	0.71185	2.565000	0.86533	0.655000	0.94253	GGA	GPR126	-	NULL	ENSG00000112414		0.328	GPR126-001	KNOWN	basic|CCDS	protein_coding	GPR126	HGNC	protein_coding	OTTHUMT00000042487.2	102	0.00	0	G			142711398	142711398	+1	no_errors	ENST00000367609	ensembl	human	known	69_37n	missense	29	45.28	24	SNP	1.000	A
GPR162	27239	genome.wustl.edu	37	12	6936007	6936007	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr12:6936007G>A	ENST00000311268.3	+	5	2192	c.1405G>A	c.(1405-1407)Gaa>Aaa	p.E469K	GPR162_ENST00000428545.2_Missense_Mutation_p.E185K|LEPREL2_ENST00000396725.2_RNA|GPR162_ENST00000382315.3_Missense_Mutation_p.E165K|LEPREL2_ENST00000606935.1_RNA|LEPREL2_ENST00000251761.8_RNA	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	469						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						GGAGGACGAGGAAGAGGCTGA	0.657																																						dbGAP											0													50.0	63.0	58.0					12																	6936007		2203	4300	6503	-	-	-	SO:0001583	missense	0			U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.1405G>A	12.37:g.6936007G>A	ENSP00000311528:p.Glu469Lys		Q16664|Q59EH5|Q66K56	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_GPCR_162,prints_GPCR_153/162	p.E469K	ENST00000311268.3	37	c.1405	CCDS8563.1	12	.	.	.	.	.	.	.	.	.	.	G	15.51	2.854112	0.51270	.	.	ENSG00000250510	ENST00000311268;ENST00000428545;ENST00000382315	T;T;T	0.42513	3.13;0.97;0.97	4.24	3.32	0.38043	.	.	.	.	.	T	0.29783	0.0744	N	0.22421	0.69	0.09310	N	1	B;B	0.17038	0.013;0.02	B;B	0.21917	0.037;0.012	T	0.16070	-1.0415	9	0.19147	T	0.46	.	12.9932	0.58632	0.0:0.5123:0.4877:0.0	.	185;469	Q16538-2;Q16538	.;GP162_HUMAN	K	469;185;165	ENSP00000311528:E469K;ENSP00000399670:E185K;ENSP00000371752:E165K	ENSP00000311528:E469K	E	+	1	0	GPR162	6806268	1.000000	0.71417	0.378000	0.26068	0.581000	0.36288	2.014000	0.40951	1.338000	0.45544	0.561000	0.74099	GAA	GPR162	-	NULL	ENSG00000250510		0.657	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR162	HGNC	protein_coding	OTTHUMT00000399478.1	83	0.00	0	G	NM_019858		6936007	6936007	+1	no_errors	ENST00000311268	ensembl	human	known	69_37n	missense	53	28.38	21	SNP	0.089	A
GRIN2A	2903	genome.wustl.edu	37	16	9934570	9934570	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr16:9934570C>A	ENST00000396573.2	-	8	1894	c.1585G>T	c.(1585-1587)Gtg>Ttg	p.V529L	GRIN2A_ENST00000562109.1_Missense_Mutation_p.V529L|GRIN2A_ENST00000535259.1_Missense_Mutation_p.V372L|GRIN2A_ENST00000330684.3_Missense_Mutation_p.V529L|GRIN2A_ENST00000404927.2_Missense_Mutation_p.V529L|GRIN2A_ENST00000396575.2_Missense_Mutation_p.V529L	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	529					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCCGTTTCCACAAAGGGCACA	0.483																																						dbGAP											0													132.0	104.0	113.0					16																	9934570		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1585G>T	16.37:g.9934570C>A	ENSP00000379818:p.Val529Leu		O00669|Q17RZ6	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.V529L	ENST00000396573.2	37	c.1585	CCDS10539.1	16	.	.	.	.	.	.	.	.	.	.	C	34	5.380068	0.95945	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81	5.3	5.3	0.74995	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.118716	0.56097	D	0.000027	T	0.16769	0.0403	N	0.05574	-0.02	0.80722	D	1	B;P;P	0.38711	0.427;0.483;0.643	B;B;B	0.39738	0.099;0.159;0.308	T	0.11324	-1.0592	9	.	.	.	.	17.9735	0.89120	0.0:1.0:0.0:0.0	.	372;529;529	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	L	529;529;372;529;529	ENSP00000379818:V529L;ENSP00000385872:V529L;ENSP00000441572:V372L;ENSP00000332549:V529L;ENSP00000379820:V529L	.	V	-	1	0	GRIN2A	9842071	0.998000	0.40836	0.941000	0.38009	0.978000	0.69477	3.983000	0.56916	2.469000	0.83416	0.655000	0.94253	GTG	GRIN2A	-	pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000183454		0.483	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	96	0.00	0	C			9934570	9934570	-1	no_errors	ENST00000330684	ensembl	human	known	69_37n	missense	67	27.96	26	SNP	1.000	A
GRIPAP1	56850	genome.wustl.edu	37	X	48831588	48831588	+	Silent	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chrX:48831588G>A	ENST00000376441.1	-	25	2446	c.2412C>T	c.(2410-2412)acC>acT	p.T804T	GRIPAP1_ENST00000376425.3_Silent_p.T773T|GRIPAP1_ENST00000473581.1_5'Flank|GRIPAP1_ENST00000376444.3_Silent_p.T759T	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	804						blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						GCATATTCTTGGTGAGCTGCT	0.592																																						dbGAP											0													64.0	50.0	55.0					X																	48831588		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.2412C>T	X.37:g.48831588G>A			A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Silent	SNP	superfamily_Prefoldin	p.T804	ENST00000376441.1	37	c.2412	CCDS35248.1	X																																																																																			GRIPAP1	-	NULL	ENSG00000068400		0.592	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIPAP1	HGNC	protein_coding	OTTHUMT00000080970.2	109	0.00	0	G	NM_207672		48831588	48831588	-1	no_errors	ENST00000376441	ensembl	human	known	69_37n	silent	55	20.29	14	SNP	1.000	A
GRM4	2914	genome.wustl.edu	37	6	34004103	34004103	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr6:34004103G>A	ENST00000538487.2	-	9	2227	c.1784C>T	c.(1783-1785)gCc>gTc	p.A595V	GRM4_ENST00000374177.3_Missense_Mutation_p.A479V|GRM4_ENST00000609222.1_Missense_Mutation_p.A462V|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000535756.1_Missense_Mutation_p.A462V|GRM4_ENST00000544773.2_Missense_Mutation_p.A426V|GRM4_ENST00000374181.4_Missense_Mutation_p.A595V|GRM4_ENST00000455714.2_Missense_Mutation_p.A455V	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	595					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GCCCACCACGGCCAGGAAGAG	0.642																																						dbGAP											0													51.0	47.0	49.0					6																	34004103		2203	4300	6503	-	-	-	SO:0001583	missense	0			U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.1784C>T	6.37:g.34004103G>A	ENSP00000440556:p.Ala595Val		B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_4,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_GABA_rcpt_B	p.A595V	ENST00000538487.2	37	c.1784	CCDS4787.1	6	.	.	.	.	.	.	.	.	.	.	G	26.0	4.696731	0.88830	.	.	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000545715;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	D;D;D;D;D;D;D	0.91011	-2.75;-2.77;-2.47;-2.54;-2.55;-2.75;-2.58	4.81	4.81	0.61882	GPCR, family 3, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95500	0.8538	M	0.87682	2.9	0.80722	D	1	P;P;D;D;P	0.76494	0.848;0.848;0.998;0.999;0.697	P;B;D;D;B	0.80764	0.507;0.403;0.994;0.94;0.403	D	0.96049	0.9030	10	0.87932	D	0	.	17.6697	0.88213	0.0:0.0:1.0:0.0	.	548;426;455;595;462	B7ZLU9;B7Z1T9;F5GXM5;Q14833;B3KVL9	.;.;.;GRM4_HUMAN;.	V	595;479;287;462;426;595;455	ENSP00000363296:A595V;ENSP00000363292:A479V;ENSP00000445533:A287V;ENSP00000437925:A462V;ENSP00000437730:A426V;ENSP00000440556:A595V;ENSP00000398456:A455V	ENSP00000363292:A479V	A	-	2	0	GRM4	34112081	1.000000	0.71417	0.979000	0.43373	0.860000	0.49131	9.552000	0.98115	2.494000	0.84150	0.448000	0.29417	GCC	GRM4	-	pfscan_GPCR_3_C	ENSG00000124493		0.642	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM4	HGNC	protein_coding	OTTHUMT00000040213.2	41	0.00	0	G			34004103	34004103	-1	no_errors	ENST00000374181	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	1.000	A
GRM6	2916	genome.wustl.edu	37	5	178410025	178410025	+	Silent	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr5:178410025G>A	ENST00000517717.1	-	10	2360	c.2322C>T	c.(2320-2322)ggC>ggT	p.G774G	GRM6_ENST00000231188.5_Silent_p.G774G|RP11-281O15.4_ENST00000519491.1_RNA			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	774					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		TCTCGGGCACGCCACGGGCCT	0.597																																						dbGAP											0													130.0	107.0	115.0					5																	178410025		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.2322C>T	5.37:g.178410025G>A				Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_6,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4,pfscan_GPCR_3_C	p.G774	ENST00000517717.1	37	c.2322	CCDS4442.1	5																																																																																			GRM6	-	pfam_GPCR_3_C,prints_GPCR_3,pfscan_GPCR_3_C	ENSG00000113262		0.597	GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM6	HGNC	protein_coding	OTTHUMT00000253474.2	73	0.00	0	G			178410025	178410025	-1	no_errors	ENST00000231188	ensembl	human	known	69_37n	silent	33	44.07	26	SNP	0.001	A
HELT	391723	genome.wustl.edu	37	4	185940105	185940105	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr4:185940105G>T	ENST00000515777.1	+	1	111	c.23G>T	c.(22-24)cGc>cTc	p.R8L	HELT_ENST00000505610.1_Missense_Mutation_p.R8L|HELT_ENST00000338875.4_Missense_Mutation_p.R8L			A6NFD8	HELT_HUMAN	helt bHLH transcription factor	8					central nervous system development (GO:0007417)|GABAergic neuron differentiation in basal ganglia (GO:0021858)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	14		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;8.92e-26)|Epithelial(43;3.02e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-11)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		CTCAAGGAACGCAAAGTGAGT	0.647																																						dbGAP											0													88.0	73.0	78.0					4																	185940105		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC144567	CCDS75214.1, CCDS75215.1	4q35.1	2014-07-17	2011-09-12		ENSG00000187821	ENSG00000187821		"""Basic helix-loop-helix proteins"""	33783	protein-coding gene	gene with protein product	"""megane bHLH factor"", ""HES-like"""		"""Hey-like transcription factor (zebrafish)"", ""HES/HEY-like transcription factor"""			14764602, 17611227	Standard	XM_005262989		Approved	HESL, HCM1228, Mgn, bHLHb44, MEGANE	uc011ckq.2	A6NFD8	OTTHUMG00000160484	ENST00000515777.1:c.23G>T	4.37:g.185940105G>T	ENSP00000426033:p.Arg8Leu		B2RTS5|B7ZMI7|B7ZMI8	Missense_Mutation	SNP	pfam_HLH_DNA-bd,pfam_Orange,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_Orange,pfscan_HLH_DNA-bd	p.R8L	ENST00000515777.1	37	c.23		4	.	.	.	.	.	.	.	.	.	.	G	14.12	2.440367	0.43326	.	.	ENSG00000187821	ENST00000505610;ENST00000515777;ENST00000338875	T;T;T	0.67345	-0.25;-0.26;1.74	4.73	4.73	0.59995	.	0.061993	0.64402	D	0.000012	T	0.65831	0.2729	N	0.08118	0	0.31041	N	0.716262	D;B;B	0.76494	0.999;0.007;0.012	D;B;B	0.79784	0.993;0.004;0.008	T	0.70335	-0.4900	10	0.62326	D	0.03	-9.5369	14.7306	0.69379	0.0:0.0:1.0:0.0	.	8;8;8	A6NFD8;B7ZMI7;A6NFD8-2	HELT_HUMAN;.;.	L	8	ENSP00000422140:R8L;ENSP00000426033:R8L;ENSP00000343464:R8L	ENSP00000343464:R8L	R	+	2	0	HELT	186177099	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.186000	0.72026	2.473000	0.83533	0.561000	0.74099	CGC	HELT	-	NULL	ENSG00000187821		0.647	HELT-002	NOVEL	basic|appris_candidate_longest	protein_coding	HELT	HGNC	protein_coding	OTTHUMT00000360792.1	94	0.00	0	G	NM_001300781		185940105	185940105	+1	no_errors	ENST00000338875	ensembl	human	known	69_37n	missense	52	28.77	21	SNP	1.000	T
HIST1H1E	3008	genome.wustl.edu	37	6	26156678	26156680	+	In_Frame_Del	DEL	GAA	GAA	-	rs545095988	byFrequency	TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	GAA	GAA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr6:26156678_26156680delGAA	ENST00000304218.3	+	1	120_122	c.60_62delGAA	c.(58-63)gtgaag>gtg	p.K23del	HIST1H2BD_ENST00000289316.2_5'Flank|HIST1H2BD_ENST00000377777.4_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	23					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						AGACTCCCGTGAAGAAGAAGGCC	0.65														3	0.000599042	0.0	0.0043	5008	,	,		14947	0.0		0.0	False		,,,				2504	0.0					dbGAP											0										3,4135		0,3,2066						4.3	1.0			45	0,8162		0,0,4081	no	coding	HIST1H1E	NM_005321.2		0,3,6147	A1A1,A1R,RR		0.0,0.0725,0.0244				3,12297				-	-	-	SO:0001651	inframe_deletion	0			M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.60_62delGAA	6.37:g.26156684_26156686delGAA	ENSP00000307705:p.Lys23del		Q4VB25	In_Frame_Del	DEL	pfam_Histone_H1/H5,smart_Histone_H1/H5,prints_Histone_H5	p.K23in_frame_del	ENST00000304218.3	37	c.60_62	CCDS4586.1	6																																																																																			HIST1H1E	-	prints_Histone_H5	ENSG00000168298		0.650	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1E	HGNC	protein_coding	OTTHUMT00000040084.1	17	0.00	0	GAA	NM_005321		26156678	26156680	+1	no_errors	ENST00000304218	ensembl	human	known	69_37n	in_frame_del	6	45.45	5	DEL	0.932:0.994:0.999	-
HS2ST1	9653	genome.wustl.edu	37	1	87380793	87380793	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr1:87380793T>G	ENST00000370550.5	+	1	437	c.74T>G	c.(73-75)cTc>cGc	p.L25R	SEP15_ENST00000401030.3_5'Flank|SEP15_ENST00000331835.5_5'Flank|SEP15_ENST00000370554.1_5'Flank|SEP15_ENST00000469566.1_5'Flank|HS2ST1_ENST00000370551.4_Missense_Mutation_p.L25R	NM_012262.3	NP_036394.1	Q7LGA3	HS2ST_HUMAN	heparan sulfate 2-O-sulfotransferase 1	25					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	sulfotransferase activity (GO:0008146)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)	9		Lung NSC(277;0.153)		all cancers(265;0.00699)|Epithelial(280;0.0261)		GTGGCGATGCTCTTCTTGGAA	0.602																																						dbGAP											0													68.0	75.0	73.0					1																	87380793		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007917	CCDS711.1, CCDS44171.1	1p22.3	2008-02-05			ENSG00000153936	ENSG00000153936		"""Sulfotransferases, membrane-bound"""	5193	protein-coding gene	gene with protein product		604844				9455484	Standard	NM_012262		Approved	KIAA0448	uc010osk.2	Q7LGA3	OTTHUMG00000010255	ENST00000370550.5:c.74T>G	1.37:g.87380793T>G	ENSP00000359581:p.Leu25Arg		D3DT22|O75036|Q32NB5|Q8TAC5|Q9H441|Q9NUJ9	Missense_Mutation	SNP	pfam_Sulfotransferase	p.L25R	ENST00000370550.5	37	c.74	CCDS711.1	1	.	.	.	.	.	.	.	.	.	.	T	19.28	3.796350	0.70567	.	.	ENSG00000153936	ENST00000370551;ENST00000370550	.	.	.	4.36	4.36	0.52297	.	0.286046	0.34002	N	0.004358	T	0.24198	0.0586	N	0.14661	0.345	0.80722	D	1	P	0.36733	0.567	B	0.39185	0.293	T	0.17167	-1.0378	9	0.42905	T	0.14	-1.5304	13.3814	0.60768	0.0:0.0:0.0:1.0	.	25	Q7LGA3	HS2ST_HUMAN	R	25	.	ENSP00000359581:L25R	L	+	2	0	HS2ST1	87153381	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.168000	0.77570	1.834000	0.53371	0.254000	0.18369	CTC	HS2ST1	-	NULL	ENSG00000153936		0.602	HS2ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS2ST1	HGNC	protein_coding	OTTHUMT00000028279.2	122	0.81	1	T	NM_012262		87380793	87380793	+1	no_errors	ENST00000370550	ensembl	human	known	69_37n	missense	67	29.17	28	SNP	1.000	G
IRS4	8471	genome.wustl.edu	37	X	107978764	107978764	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chrX:107978764C>T	ENST00000372129.2	-	1	887	c.811G>A	c.(811-813)Gaa>Aaa	p.E271K	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	271	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						CTGGCCACTTCGGTGTTCAGC	0.582																																						dbGAP											0													74.0	60.0	65.0					X																	107978764		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.811G>A	X.37:g.107978764C>T	ENSP00000361202:p.Glu271Lys			Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1,prints_Insln_rcpt_S1	p.E271K	ENST00000372129.2	37	c.811	CCDS14544.1	X	.	.	.	.	.	.	.	.	.	.	C	18.30	3.594631	0.66219	.	.	ENSG00000133124	ENST00000372129	T	0.46063	0.88	4.85	3.96	0.45880	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (4);	0.122224	0.53938	D	0.000058	T	0.49830	0.1580	M	0.78801	2.425	0.45899	D	0.998747	P	0.52463	0.953	P	0.45406	0.479	T	0.59413	-0.7459	10	0.72032	D	0.01	-8.9247	14.1148	0.65146	0.0:0.8526:0.1474:0.0	.	271	O14654	IRS4_HUMAN	K	271	ENSP00000361202:E271K	ENSP00000361202:E271K	E	-	1	0	IRS4	107865420	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.840000	0.69402	1.003000	0.39130	0.600000	0.82982	GAA	IRS4	-	pfam_Insln_rcpt_S1,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1,prints_Insln_rcpt_S1	ENSG00000133124		0.582	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS4	HGNC	protein_coding	OTTHUMT00000057879.1	52	0.00	0	C	NM_003604		107978764	107978764	-1	no_errors	ENST00000372129	ensembl	human	known	69_37n	missense	30	33.33	15	SNP	1.000	T
ITPR1	3708	genome.wustl.edu	37	3	4699856	4699856	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr3:4699856G>T	ENST00000443694.2	+	10	1000	c.1000G>T	c.(1000-1002)Gaa>Taa	p.E334*	ITPR1_ENST00000423119.2_Nonsense_Mutation_p.E349*|ITPR1_ENST00000456211.2_Nonsense_Mutation_p.E334*|ITPR1_ENST00000357086.4_Nonsense_Mutation_p.E349*|ITPR1_ENST00000354582.6_Nonsense_Mutation_p.E349*|ITPR1_ENST00000302640.8_Nonsense_Mutation_p.E334*|ITPR1_ENST00000544951.1_Intron			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	349	MIR 4. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GAATGCCCAAGAAAAGATGGT	0.517																																						dbGAP											0													168.0	167.0	167.0					3																	4699856		1984	4156	6140	-	-	-	SO:0001587	stop_gained	0			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.1000G>T	3.37:g.4699856G>T	ENSP00000401671:p.Glu334*		E7EPX7|E9PDE9|Q14660|Q99897	Nonsense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.E334*	ENST00000443694.2	37	c.1000	CCDS54551.1	3	.	.	.	.	.	.	.	.	.	.	G	42	9.641440	0.99227	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	.	.	.	5.19	5.19	0.71726	.	0.050490	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	18.7304	0.91733	0.0:0.0:1.0:0.0	.	.	.	.	X	349;334;349;349;349;334;334	.	ENSP00000306253:E334X	E	+	1	0	ITPR1	4674856	1.000000	0.71417	0.979000	0.43373	0.955000	0.61496	9.725000	0.98778	2.418000	0.82041	0.655000	0.94253	GAA	ITPR1	-	pfam_MIR,superfamily_MIR,smart_MIR_motif,pfscan_MIR_motif	ENSG00000150995		0.517	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	ITPR1	HGNC	protein_coding	OTTHUMT00000337982.3	159	0.00	0	G	NM_002222		4699856	4699856	+1	no_errors	ENST00000302640	ensembl	human	known	69_37n	nonsense	99	29.58	42	SNP	1.000	T
KCNK13	56659	genome.wustl.edu	37	14	90650490	90650490	+	Nonsense_Mutation	SNP	A	A	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr14:90650490A>T	ENST00000282146.4	+	2	811	c.370A>T	c.(370-372)Aaa>Taa	p.K124*		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	124					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				AGTAGGAGGAAAAATCTTTCT	0.473																																						dbGAP											0													109.0	116.0	114.0					14																	90650490		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.370A>T	14.37:g.90650490A>T	ENSP00000282146:p.Lys124*		B5TJL8|Q96E79	Nonsense_Mutation	SNP	pfam_Ion_trans_2,prints_2pore_dom_K_chnl_THIK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.K124*	ENST00000282146.4	37	c.370	CCDS9889.1	14	.	.	.	.	.	.	.	.	.	.	A	35	5.534933	0.96460	.	.	ENSG00000152315	ENST00000282146	.	.	.	5.31	5.31	0.75309	.	0.000000	0.43747	D	0.000521	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.2351	0.73422	1.0:0.0:0.0:0.0	.	.	.	.	X	124	.	ENSP00000282146:K124X	K	+	1	0	KCNK13	89720243	1.000000	0.71417	0.558000	0.28319	0.063000	0.16089	9.325000	0.96381	2.003000	0.58678	0.533000	0.62120	AAA	KCNK13	-	pfam_Ion_trans_2,prints_2pore_dom_K_chnl	ENSG00000152315		0.473	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK13	HGNC	protein_coding	OTTHUMT00000411251.1	164	0.00	0	A	NM_022054		90650490	90650490	+1	no_errors	ENST00000282146	ensembl	human	known	69_37n	nonsense	132	25.84	46	SNP	1.000	T
KIAA2022	340533	genome.wustl.edu	37	X	73964215	73964215	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chrX:73964215C>T	ENST00000055682.6	-	3	788	c.177G>A	c.(175-177)atG>atA	p.M59I		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	59					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						CTCTGGGATACATCAGGGTCT	0.532																																						dbGAP											0													59.0	58.0	58.0					X																	73964215		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.177G>A	X.37:g.73964215C>T	ENSP00000055682:p.Met59Ile		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.M59I	ENST00000055682.6	37	c.177	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	C	5.781	0.328418	0.10956	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.29397	1.57;1.57	4.87	2.11	0.27256	.	0.546557	0.21803	N	0.068896	T	0.14527	0.0351	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16958	-1.0385	10	0.18710	T	0.47	-2.3631	2.0433	0.03555	0.1352:0.4947:0.1299:0.2402	.	59	Q5QGS0	K2022_HUMAN	I	59	ENSP00000362567:M59I;ENSP00000055682:M59I	ENSP00000055682:M59I	M	-	3	0	KIAA2022	73880940	0.047000	0.20315	0.963000	0.40424	0.162000	0.22319	0.230000	0.17852	0.483000	0.27608	-0.269000	0.10298	ATG	KIAA2022	-	NULL	ENSG00000050030		0.532	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	153	0.00	0	C	NM_001008537		73964215	73964215	-1	no_errors	ENST00000055682	ensembl	human	known	69_37n	missense	108	28.29	43	SNP	0.025	T
KNDC1	85442	genome.wustl.edu	37	10	135020748	135020748	+	Silent	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr10:135020748C>T	ENST00000304613.3	+	20	3708	c.3687C>T	c.(3685-3687)tcC>tcT	p.S1229S	KNDC1_ENST00000368572.2_Silent_p.S1231S			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1229					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TGGACGAGTCCTCCTCGCTCA	0.682																																						dbGAP											0													43.0	43.0	43.0					10																	135020748		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.3687C>T	10.37:g.135020748C>T			B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_Kinase-like_dom,smart_KIND,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S1231	ENST00000304613.3	37	c.3693	CCDS7674.1	10																																																																																			KNDC1	-	superfamily_Ras_GEF_dom	ENSG00000171798		0.682	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	KNDC1	HGNC	protein_coding	OTTHUMT00000277044.3	25	0.00	0	C	NM_152643		135020748	135020748	+1	no_errors	ENST00000368572	ensembl	human	known	69_37n	silent	16	33.33	8	SNP	0.999	T
KRT76	51350	genome.wustl.edu	37	12	53167402	53167402	+	Silent	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr12:53167402G>A	ENST00000332411.2	-	3	893	c.840C>T	c.(838-840)cgC>cgT	p.R280R		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	280	Coil 1B.|Rod.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CTGCGGCAGTGCGTTTGTTGA	0.493																																						dbGAP											0													145.0	117.0	126.0					12																	53167402		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.840C>T	12.37:g.53167402G>A			B4DRR3|Q7Z795	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.R280	ENST00000332411.2	37	c.840	CCDS8838.1	12																																																																																			KRT76	-	pfam_F,prints_Keratin_II	ENSG00000185069		0.493	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT76	HGNC	protein_coding	OTTHUMT00000405928.1	168	0.00	0	G	NM_015848		53167402	53167402	-1	no_errors	ENST00000332411	ensembl	human	known	69_37n	silent	87	32.82	43	SNP	0.977	A
KRT18	3875	genome.wustl.edu	37	12	53344579	53344579	+	Silent	SNP	C	C	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr12:53344579C>A	ENST00000388835.3	+	3	756	c.546C>A	c.(544-546)atC>atA	p.I182I	KRT8_ENST00000549198.1_5'Flank|KRT8_ENST00000546897.1_5'Flank|KRT8_ENST00000552551.1_5'Flank|KRT18_ENST00000550600.1_Silent_p.I182I|KRT18_ENST00000388837.2_Silent_p.I182I|AC107016.2_ENST00000581256.1_RNA	NM_000224.2	NP_000215.1	P05783	K1C18_HUMAN	keratin 18	182	Coil 1B.|Necessary for interaction with PNN.|Rod.				anatomical structure morphogenesis (GO:0009653)|cell cycle (GO:0007049)|extrinsic apoptotic signaling pathway (GO:0097191)|Golgi to plasma membrane CFTR protein transport (GO:0043000)|hepatocyte apoptotic process (GO:0097284)|intermediate filament cytoskeleton organization (GO:0045104)|negative regulation of apoptotic process (GO:0043066)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell periphery (GO:0071944)|centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)			central_nervous_system(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	11						AGAACGACATCCATGGGCTCC	0.532																																						dbGAP											0													44.0	37.0	39.0					12																	53344579		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS31809.1	12q13	2013-01-16			ENSG00000111057	ENSG00000111057		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6430	protein-coding gene	gene with protein product		148070				1705144, 16831889	Standard	NM_000224		Approved		uc001sbg.3	P05783	OTTHUMG00000169882	ENST00000388835.3:c.546C>A	12.37:g.53344579C>A			Q53G38|Q5U0N8|Q9BW26	Silent	SNP	pfam_F,prints_Keratin_I	p.I182	ENST00000388835.3	37	c.546	CCDS31809.1	12																																																																																			KRT18	-	pfam_F,prints_Keratin_I	ENSG00000111057		0.532	KRT18-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT18	HGNC	protein_coding	OTTHUMT00000406405.1	41	0.00	0	C	NM_199187		53344579	53344579	+1	no_errors	ENST00000388835	ensembl	human	known	69_37n	silent	32	33.33	16	SNP	0.970	A
MAEL	84944	genome.wustl.edu	37	1	166974325	166974325	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr1:166974325A>G	ENST00000367872.4	+	7	905	c.661A>G	c.(661-663)Acc>Gcc	p.T221A	MAEL_ENST00000367870.2_Missense_Mutation_p.T190A|MAEL_ENST00000491055.1_3'UTR|RNA5SP65_ENST00000363166.1_RNA	NM_032858.1	NP_116247.1	Q96JY0	MAEL_HUMAN	maelstrom spermatogenic transposon silencer	221					cell differentiation (GO:0030154)|cell morphogenesis (GO:0000902)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|piRNA metabolic process (GO:0034587)|regulation of organ growth (GO:0046620)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	autosome (GO:0030849)|chromatin (GO:0000785)|chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|perinuclear region of cytoplasm (GO:0048471)|piP-body (GO:0071547)|XY body (GO:0001741)	DNA binding (GO:0003677)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(12)|skin(4)	28						TGATGATAGAACCAGAGTCAA	0.348																																						dbGAP											0													59.0	60.0	60.0					1																	166974325		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027810, DQ076156	CCDS1257.1, CCDS65712.1, CCDS72975.1	1q24.1	2013-10-11	2012-12-18		ENSG00000143194	ENSG00000143194			25929	protein-coding gene	gene with protein product	"""cancer/testis antigen 128"", ""spermatogenesis associated 35"""	611368	"""maelstrom homolog (Drosophila)"""			19693694, 18694567	Standard	NM_001286378		Approved	FLJ14904, CT128, SPATA35	uc001gdy.1	Q96JY0	OTTHUMG00000034432	ENST00000367872.4:c.661A>G	1.37:g.166974325A>G	ENSP00000356846:p.Thr221Ala		B4DY43|E9JVC3|Q49AP9|Q5VZP8|Q9UIW6	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,superfamily_CH-domain	p.T221A	ENST00000367872.4	37	c.661	CCDS1257.1	1	.	.	.	.	.	.	.	.	.	.	A	8.870	0.948973	0.18356	.	.	ENSG00000143194	ENST00000367872;ENST00000367870;ENST00000447624	T;T;T	0.39997	1.05;1.07;1.07	5.98	1.6	0.23607	.	0.622563	0.15833	N	0.242391	T	0.05090	0.0136	N	0.08118	0	0.21105	N	0.999784	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.38156	-0.9674	10	0.13108	T	0.6	.	2.2575	0.04059	0.1006:0.1602:0.3551:0.3841	.	190;221	E9JVC3;Q96JY0	.;MAEL_HUMAN	A	221;190;190	ENSP00000356846:T221A;ENSP00000356844:T190A;ENSP00000402143:T190A	ENSP00000356844:T190A	T	+	1	0	MAEL	165240949	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	0.538000	0.23160	0.400000	0.25396	-0.462000	0.05337	ACC	MAEL	-	superfamily_CH-domain	ENSG00000143194		0.348	MAEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAEL	HGNC	protein_coding	OTTHUMT00000083239.1	115	0.00	0	A	NM_032858		166974325	166974325	+1	no_errors	ENST00000367872	ensembl	human	known	69_37n	missense	134	17.68	29	SNP	0.999	G
MAGI2	9863	genome.wustl.edu	37	7	77789453	77789453	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr7:77789453C>T	ENST00000354212.4	-	16	2987	c.2734G>A	c.(2734-2736)Gcc>Acc	p.A912T	MAGI2_ENST00000419488.1_Missense_Mutation_p.A898T|MAGI2_ENST00000522391.1_Missense_Mutation_p.A912T	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	912					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CTGTGGGAGGCGAAGCCTTCA	0.577																																						dbGAP											0													120.0	102.0	108.0					7																	77789453		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2734G>A	7.37:g.77789453C>T	ENSP00000346151:p.Ala912Thr		A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_Rsp5_WWP,pfam_Guanylate_kin,superfamily_PDZ,superfamily_WW_Rsp5_WWP,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_WW_Rsp5_WWP,pfscan_PDZ,pfscan_WW_Rsp5_WWP,pfscan_Guanylate_kin	p.A912T	ENST00000354212.4	37	c.2734	CCDS5594.1	7	.	.	.	.	.	.	.	.	.	.	C	13.79	2.342462	0.41498	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.11063	2.91;2.91;2.81	5.5	2.56	0.30785	PDZ/DHR/GLGF (1);	0.201717	0.23752	U	0.044910	T	0.03053	0.0090	N	0.02011	-0.69	0.80722	D	1	B;B;B	0.14438	0.007;0.01;0.004	B;B;B	0.09377	0.003;0.004;0.001	T	0.40098	-0.9581	10	0.13108	T	0.6	.	5.0952	0.14729	0.1357:0.5758:0.0:0.2885	.	912;898;912	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	T	898;912;912;912	ENSP00000405766:A898T;ENSP00000346151:A912T;ENSP00000428389:A912T	ENSP00000346151:A912T	A	-	1	0	MAGI2	77627389	0.079000	0.21365	0.995000	0.50966	0.890000	0.51754	-0.035000	0.12205	0.696000	0.31696	0.585000	0.79938	GCC	MAGI2	-	superfamily_PDZ	ENSG00000187391		0.577	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	HGNC	protein_coding	OTTHUMT00000253197.3	155	0.00	0	C	NM_012301		77789453	77789453	-1	no_errors	ENST00000354212	ensembl	human	known	69_37n	missense	118	30.18	51	SNP	0.974	T
MAN2A1	4124	genome.wustl.edu	37	5	109091068	109091068	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr5:109091068G>T	ENST00000261483.4	+	5	1798	c.746G>T	c.(745-747)gGc>gTc	p.G249V		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	249					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		GTGACAGGTGGCTGGGTTATG	0.328																																						dbGAP											0													127.0	126.0	126.0					5																	109091068		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.746G>T	5.37:g.109091068G>T	ENSP00000261483:p.Gly249Val		Q16767	Missense_Mutation	SNP	pfam_Glyco_hydro_38_core,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Glyco_hydro-type_carb-bd,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.G249V	ENST00000261483.4	37	c.746	CCDS34209.1	5	.	.	.	.	.	.	.	.	.	.	G	26.7	4.764466	0.89932	.	.	ENSG00000112893	ENST00000261483	T	0.27557	1.66	5.58	5.58	0.84498	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.000000	0.85682	D	0.000000	T	0.73202	0.3557	H	0.98542	4.26	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84417	0.0569	10	0.87932	D	0	-13.8348	18.3357	0.90287	0.0:0.0:1.0:0.0	.	249	Q16706	MA2A1_HUMAN	V	249	ENSP00000261483:G249V	ENSP00000261483:G249V	G	+	2	0	MAN2A1	109118967	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.690000	0.98676	2.609000	0.88269	0.650000	0.86243	GGC	MAN2A1	-	pfam_Glyco_hydro_38_core,superfamily_Glyco_hydro/deAcase_b/a-brl	ENSG00000112893		0.328	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2A1	HGNC	protein_coding	OTTHUMT00000370680.1	276	0.00	0	G			109091068	109091068	+1	no_errors	ENST00000261483	ensembl	human	known	69_37n	missense	149	32.27	71	SNP	1.000	T
MFGE8	4240	genome.wustl.edu	37	15	89449997	89449997	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr15:89449997G>A	ENST00000566497.1	-	4	461	c.400C>T	c.(400-402)Cgg>Tgg	p.R134W	MFGE8_ENST00000268150.8_Missense_Mutation_p.R134W|MFGE8_ENST00000268151.7_Missense_Mutation_p.R134W|MFGE8_ENST00000542878.1_Missense_Mutation_p.R90W|MFGE8_ENST00000539437.1_Missense_Mutation_p.R126W|MFGE8_ENST00000559997.1_5'UTR			Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein	134	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of apoptotic cell clearance (GO:2000427)|single fertilization (GO:0007338)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|vesicle (GO:0031982)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	22	Lung NSC(78;0.0392)|all_lung(78;0.077)					CACATCCTCCGCAGCAGGTTC	0.582																																						dbGAP											0													98.0	78.0	85.0					15																	89449997		2200	4299	6499	-	-	-	SO:0001583	missense	0			U58516	CCDS10347.1, CCDS45345.1	15q25	2009-03-25			ENSG00000140545	ENSG00000140545			7036	protein-coding gene	gene with protein product	"""sperm surface protein hP47"""	602281	"""sperm associated antigen 10"""	SPAG10		9027496, 19204935	Standard	NM_005928		Approved	SED1, EDIL1, BA46, OAcGD3S, HsT19888, MFG-E8, hP47	uc002bng.4	Q08431	OTTHUMG00000148682	ENST00000566497.1:c.400C>T	15.37:g.89449997G>A	ENSP00000456281:p.Arg134Trp		B2R6M7|Q53FU9|Q7Z3D2|Q9BTL9	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_EGF-like_dom,superfamily_Galactose-bd-like,smart_EGF-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.R134W	ENST00000566497.1	37	c.400	CCDS10347.1	15	.	.	.	.	.	.	.	.	.	.	G	17.64	3.438947	0.63067	.	.	ENSG00000140545	ENST00000268150;ENST00000268151;ENST00000539437;ENST00000542878	D;D;D;D	0.98280	-4.84;-4.84;-4.84;-4.84	5.01	3.07	0.35406	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.210963	0.48286	D	0.000184	D	0.99115	0.9695	H	0.94385	3.53	0.47476	D	0.999436	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;1.0;0.999;0.996;0.999;0.999	D	0.99346	1.0913	10	0.72032	D	0.01	-51.4512	12.3274	0.55020	0.0:0.0:0.5639:0.4361	.	126;90;90;126;134;134	B3KTQ2;F5GZN3;B4E396;F5H7N9;Q08431-3;Q08431	.;.;.;.;.;MFGM_HUMAN	W	134;134;126;90	ENSP00000268150:R134W;ENSP00000268151:R134W;ENSP00000442386:R126W;ENSP00000444332:R90W	ENSP00000268150:R134W	R	-	1	2	MFGE8	87251001	1.000000	0.71417	0.997000	0.53966	0.756000	0.42949	3.168000	0.50801	0.770000	0.33336	0.561000	0.74099	CGG	MFGE8	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000140545		0.582	MFGE8-015	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	MFGE8	HGNC	protein_coding	OTTHUMT00000432804.1	76	0.00	0	G	NM_005928		89449997	89449997	-1	no_errors	ENST00000268150	ensembl	human	known	69_37n	missense	35	42.62	26	SNP	1.000	A
MLLT10	8028	genome.wustl.edu	37	10	22016847	22016847	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr10:22016847C>T	ENST00000307729.7	+	16	2231	c.2053C>T	c.(2053-2055)Ctc>Ttc	p.L685F	MLLT10_ENST00000446906.2_Missense_Mutation_p.L685F|MLLT10_ENST00000377059.3_Missense_Mutation_p.L685F|MLLT10_ENST00000377072.3_Missense_Mutation_p.L701F			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	685					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						CCGAGGAAGTCTCTCGCCACG	0.423			T	"""MLL, PICALM, CDK6"""	AL																																	dbGAP		Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	0													61.0	59.0	60.0					10																	22016847		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.2053C>T	10.37:g.22016847C>T	ENSP00000307411:p.Leu685Phe		B1ANA8|Q5JT37|Q5VX90|Q66K63	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.L685F	ENST00000307729.7	37	c.2053	CCDS55708.1	10	.	.	.	.	.	.	.	.	.	.	C	16.79	3.221258	0.58560	.	.	ENSG00000078403	ENST00000377072;ENST00000446906;ENST00000307729;ENST00000396529;ENST00000377059;ENST00000438473;ENST00000538639	T;T;T;T	0.09538	2.97;2.97;2.97;2.97	5.82	5.82	0.92795	.	0.119985	0.56097	D	0.000022	T	0.25158	0.0611	L	0.61218	1.895	0.51767	D	0.999931	D;P;D;P	0.56746	0.977;0.931;0.964;0.931	P;B;P;B	0.55923	0.787;0.444;0.637;0.444	T	0.00064	-1.2150	10	0.59425	D	0.04	.	14.8919	0.70614	0.1433:0.8567:0.0:0.0	.	380;685;685;701	Q5HYC6;E9PBP4;Q5VX90;P55197	.;.;.;AF10_HUMAN	F	701;685;685;520;685;344;343	ENSP00000366272:L701F;ENSP00000401406:L685F;ENSP00000307411:L685F;ENSP00000366258:L685F	ENSP00000307411:L685F	L	+	1	0	MLLT10	22056853	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.455000	0.44988	2.745000	0.94114	0.650000	0.86243	CTC	MLLT10	-	NULL	ENSG00000078403		0.423	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT10	HGNC	protein_coding	OTTHUMT00000047136.1	70	0.00	0	C			22016847	22016847	+1	no_errors	ENST00000307729	ensembl	human	known	69_37n	missense	49	12.50	7	SNP	1.000	T
MYCT1	80177	genome.wustl.edu	37	6	153019117	153019117	+	Frame_Shift_Del	DEL	T	T	-			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr6:153019117delT	ENST00000367245.5	+	1	88	c.80delT	c.(79-81)cttfs	p.L27fs	MYCT1_ENST00000529453.1_Frame_Shift_Del_p.L27fs	NM_025107.2	NP_079383.2	Q8N699	MYCT1_HUMAN	myc target 1	27						nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	20		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		ATCAAACTGCTTTTTTTCGAC	0.323																																						dbGAP											0													74.0	75.0	74.0					6																	153019117		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			AF527367	CCDS5239.1	6q25.1	2008-02-05			ENSG00000120279	ENSG00000120279			23172	protein-coding gene	gene with protein product						12477932	Standard	NM_025107		Approved	MTLC, FLJ21269	uc003qpc.4	Q8N699	OTTHUMG00000015850	ENST00000367245.5:c.80delT	6.37:g.153019117delT	ENSP00000356214:p.Leu27fs		Q8N396|Q8TBE8|Q9H763	Frame_Shift_Del	DEL	NULL	p.F29fs	ENST00000367245.5	37	c.80	CCDS5239.1	6																																																																																			MYCT1	-	NULL	ENSG00000120279		0.323	MYCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYCT1	HGNC	protein_coding	OTTHUMT00000042750.2	118	0.00	0	T	NM_025107		153019117	153019117	+1	no_errors	ENST00000367245	ensembl	human	known	69_37n	frame_shift_del	50	39.02	32	DEL	0.997	-
NACC1	112939	genome.wustl.edu	37	19	13248140	13248140	+	Silent	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr19:13248140C>T	ENST00000292431.4	+	4	1302	c.1176C>T	c.(1174-1176)ggC>ggT	p.G392G	CTC-250I14.3_ENST00000591825.1_RNA	NM_052876.3	NP_443108.1	Q96RE7	NACC1_HUMAN	nucleus accumbens associated 1, BEN and BTB (POZ) domain containing	392	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.				negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear body (GO:0016604)|nucleus (GO:0005634)				endometrium(3)|large_intestine(2)|lung(3)|skin(1)	9						TCAGCGCAGGCACGCGGCACA	0.657																																						dbGAP											0													74.0	76.0	75.0					19																	13248140		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF395817	CCDS12294.1	19p13.13	2013-01-09	2008-10-03	2008-10-03		ENSG00000160877		"""BEN domain containing"", ""BTB/POZ domain containing"""	20967	protein-coding gene	gene with protein product	"""nucleus accumbens associated 1"", ""BEN domain containing 8"""	610672	"""BTB (POZ) domain containing 14B"""	BTBD14B		12477932	Standard	NM_052876		Approved	NAC1, NAC-1, BEND8, BTBD30	uc002mwm.4	Q96RE7		ENST00000292431.4:c.1176C>T	19.37:g.13248140C>T				Silent	SNP	pfam_BTB_POZ,pfam_BEN_domain,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.G392	ENST00000292431.4	37	c.1176	CCDS12294.1	19																																																																																			NACC1	-	NULL	ENSG00000160877		0.657	NACC1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NACC1	HGNC	protein_coding	OTTHUMT00000452879.1	35	0.00	0	C	NM_052876		13248140	13248140	+1	no_errors	ENST00000292431	ensembl	human	known	69_37n	silent	22	24.14	7	SNP	1.000	T
NPAS3	64067	genome.wustl.edu	37	14	34269516	34269516	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr14:34269516C>T	ENST00000356141.4	+	12	2003	c.2003C>T	c.(2002-2004)cCg>cTg	p.P668L	NPAS3_ENST00000548645.1_Missense_Mutation_p.P638L|NPAS3_ENST00000346562.2_Missense_Mutation_p.P636L|NPAS3_ENST00000357798.5_Missense_Mutation_p.P655L|NPAS3_ENST00000551492.1_Missense_Mutation_p.P673L			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	668					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		TGGAACTACCCGCCCAACCGG	0.622																																						dbGAP											0													73.0	75.0	74.0					14																	34269516		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.2003C>T	14.37:g.34269516C>T	ENSP00000348460:p.Pro668Leu		Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pfscan_PAS,pfscan_HLH_DNA-bd	p.P668L	ENST00000356141.4	37	c.2003	CCDS53891.1	14	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321928	0.60634	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;T;T;T	0.71579	-0.58;3.17;3.18;3.18;3.17;3.04	4.97	4.08	0.47627	.	0.122741	0.56097	D	0.000036	T	0.56819	0.2011	N	0.24115	0.695	0.80722	D	1	B;B;B;B	0.18013	0.025;0.014;0.025;0.025	B;B;B;B	0.11329	0.006;0.003;0.006;0.006	T	0.52298	-0.8594	10	0.41790	T	0.15	.	13.4753	0.61306	0.0:0.9233:0.0:0.0767	.	638;668;636;655	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	L	642;673;636;638;668;655	ENSP00000448373:P642L;ENSP00000450392:P673L;ENSP00000319610:P636L;ENSP00000448916:P638L;ENSP00000348460:P668L;ENSP00000350446:P655L	ENSP00000319610:P636L	P	+	2	0	NPAS3	33339267	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	7.364000	0.79526	1.059000	0.40554	0.555000	0.69702	CCG	NPAS3	-	NULL	ENSG00000151322		0.622	NPAS3-004	KNOWN	basic|CCDS	protein_coding	NPAS3	HGNC	protein_coding	OTTHUMT00000276645.1	19	0.00	0	C			34269516	34269516	+1	no_errors	ENST00000356141	ensembl	human	known	69_37n	missense	10	41.18	7	SNP	1.000	T
NUDT10	170685	genome.wustl.edu	37	X	51076061	51076061	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chrX:51076061G>A	ENST00000376006.3	+	2	464	c.244G>A	c.(244-246)Gtc>Atc	p.V82I	NUDT10_ENST00000356450.2_Missense_Mutation_p.V82I	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	115					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					GCTCCTGGGCGTCTTCGAACA	0.627																																					NSCLC(90;1817 2035 37909 38249)	dbGAP											0													74.0	77.0	76.0					X																	51076061		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.244G>A	X.37:g.51076061G>A	ENSP00000365174:p.Val82Ile		Q8NBN1|Q8NCB9|Q8NG25	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.V82I	ENST00000376006.3	37	c.244	CCDS35278.1	X	.	.	.	.	.	.	.	.	.	.	G	5.449	0.268015	0.10349	.	.	ENSG00000122824	ENST00000376006;ENST00000356450	T;T	0.09073	3.02;3.02	3.14	-0.926	0.10455	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.436821	0.23232	N	0.050450	T	0.04952	0.0133	L	0.37561	1.115	0.36023	D	0.838846	B	0.11235	0.004	B	0.10450	0.005	T	0.44651	-0.9314	9	0.08599	T	0.76	-10.4505	6.2911	0.21061	0.5162:0.0:0.4838:0.0	.	82	Q8NFP7	NUD10_HUMAN	I	82	ENSP00000365174:V82I;ENSP00000348831:V82I	ENSP00000348831:V82I	V	+	1	0	NUDT10	51092801	0.995000	0.38212	0.839000	0.33178	0.874000	0.50279	0.447000	0.21710	-0.209000	0.10156	0.429000	0.28392	GTC	NUDT10	-	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	ENSG00000122824		0.627	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NUDT10	HGNC	protein_coding	OTTHUMT00000056578.1	163	0.00	0	G	NM_153183		51076061	51076061	+1	no_errors	ENST00000356450	ensembl	human	known	69_37n	missense	132	36.84	77	SNP	0.502	A
NUP107	57122	genome.wustl.edu	37	12	69082816	69082816	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr12:69082816C>G	ENST00000229179.4	+	2	415	c.83C>G	c.(82-84)gCt>gGt	p.A28G	NUP107_ENST00000378905.2_5'UTR|NUP107_ENST00000539906.1_5'UTR|RP11-637A17.2_ENST00000500695.2_lincRNA	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	28					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)		NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			AAACAGAGTGCTCAGAAAAGA	0.373																																						dbGAP											0													140.0	132.0	135.0					12																	69082816		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.83C>G	12.37:g.69082816C>G	ENSP00000229179:p.Ala28Gly		B4DZ67|Q6PJE1	Missense_Mutation	SNP	pfam_Nup84_Nup100	p.A28G	ENST00000229179.4	37	c.83	CCDS8985.1	12	.	.	.	.	.	.	.	.	.	.	C	17.49	3.402686	0.62288	.	.	ENSG00000111581	ENST00000229179	.	.	.	5.45	5.45	0.79879	.	0.231307	0.41001	D	0.000964	T	0.56819	0.2011	L	0.48642	1.525	0.80722	D	1	B	0.28378	0.209	B	0.28139	0.086	T	0.51911	-0.8645	8	.	.	.	-23.4413	17.1594	0.86800	0.0:1.0:0.0:0.0	.	28	P57740	NU107_HUMAN	G	28	.	.	A	+	2	0	NUP107	67369083	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	3.391000	0.52530	2.722000	0.93159	0.467000	0.42956	GCT	NUP107	-	NULL	ENSG00000111581		0.373	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP107	HGNC	protein_coding	OTTHUMT00000403195.1	149	0.00	0	C	NM_020401		69082816	69082816	+1	no_errors	ENST00000229179	ensembl	human	known	69_37n	missense	160	13.04	24	SNP	1.000	G
OBSCN	84033	genome.wustl.edu	37	1	228521466	228521466	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr1:228521466C>T	ENST00000422127.1	+	59	16083	c.16039C>T	c.(16039-16041)Cgg>Tgg	p.R5347W	OBSCN_ENST00000284548.11_Missense_Mutation_p.R5347W|OBSCN_ENST00000366707.4_Missense_Mutation_p.R2981W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R2466W|OBSCN_ENST00000570156.2_Missense_Mutation_p.R6304W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5347	Ig-like 50.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CTCGTCTGCCCGGCTGCTGGT	0.637																																						dbGAP											0													35.0	36.0	36.0					1																	228521466		1971	4069	6040	-	-	-	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.16039C>T	1.37:g.228521466C>T	ENSP00000409493:p.Arg5347Trp		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.R5347W	ENST00000422127.1	37	c.16039	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	C	11.80	1.748079	0.30955	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	5.62	3.77	0.43336	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.159753	0.40640	N	0.001056	T	0.58438	0.2122	M	0.69358	2.11	0.33811	D	0.62784	B;B	0.34255	0.445;0.391	B;B	0.30029	0.11;0.067	T	0.67300	-0.5705	10	0.72032	D	0.01	.	5.7356	0.18065	0.2547:0.5863:0.0:0.159	.	5347;5347	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	5347;5347;2981;2466	ENSP00000284548:R5347W;ENSP00000409493:R5347W;ENSP00000355668:R2981W;ENSP00000355670:R2466W	ENSP00000284548:R5347W	R	+	1	2	OBSCN	226588089	0.563000	0.26594	0.851000	0.33527	0.002000	0.02628	1.011000	0.29911	0.750000	0.32877	-0.136000	0.14681	CGG	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000154358		0.637	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		54	0.00	0	C	NM_052843		228521466	228521466	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	missense	70	27.84	27	SNP	1.000	T
OBSCN	84033	genome.wustl.edu	37	1	228537694	228537695	+	Frame_Shift_Ins	INS	-	-	T	rs56191283	byFrequency	TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr1:228537694_228537695insT	ENST00000422127.1	+	76	18296_18297	c.18252_18253insT	c.(18253-18255)tacfs	p.Y6085fs	OBSCN_ENST00000284548.11_Frame_Shift_Ins_p.Y6085fs|OBSCN_ENST00000366707.4_Frame_Shift_Ins_p.Y3719fs|OBSCN_ENST00000366709.4_Frame_Shift_Ins_p.Y3204fs|OBSCN_ENST00000570156.2_Frame_Shift_Ins_p.Y7042fs	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6085	Ig-like 52.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ACTCTGGCCAGTACATGTGCTT	0.624																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.18253dupT	1.37:g.228537695_228537695dupT	ENSP00000409493:p.Tyr6085fs		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Frame_Shift_Ins	INS	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.Y6084fs	ENST00000422127.1	37	c.18252_18253	CCDS58065.1	1																																																																																			OBSCN	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000154358		0.624	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		46	0.00	0	-	NM_052843		228537694	228537695	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	frame_shift_ins	49	15.52	9	INS	1.000:1.000	T
OR5AS1	219447	genome.wustl.edu	37	11	55798416	55798416	+	Silent	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr11:55798416C>T	ENST00000313555.1	+	1	522	c.522C>T	c.(520-522)gtC>gtT	p.V174V		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					CCAATATCGTCAATCATTTTT	0.438																																						dbGAP											0													261.0	254.0	257.0					11																	55798416		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.522C>T	11.37:g.55798416C>T			Q6IFB8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V174	ENST00000313555.1	37	c.522	CCDS31516.1	11																																																																																			OR5AS1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181785		0.438	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AS1	HGNC	protein_coding	OTTHUMT00000391538.1	239	0.00	0	C	NM_001001921		55798416	55798416	+1	no_errors	ENST00000313555	ensembl	human	known	69_37n	silent	232	25.95	82	SNP	0.014	T
PDE1B	5153	genome.wustl.edu	37	12	54943667	54943667	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr12:54943667C>T	ENST00000243052.3	+	2	447	c.11C>T	c.(10-12)tCc>tTc	p.S4F	PDE1B_ENST00000538346.1_5'Flank	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	4					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)	p.S4Y(1)		endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	ATGGAGCTGTCCCCCCGCAGT	0.627																																						dbGAP											1	Substitution - Missense(1)	lung(1)											57.0	54.0	55.0					12																	54943667		2203	4300	6503	-	-	-	SO:0001583	missense	0			U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.11C>T	12.37:g.54943667C>T	ENSP00000243052:p.Ser4Phe		Q92825|Q96KP3	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.S4F	ENST00000243052.3	37	c.11	CCDS8882.1	12	.	.	.	.	.	.	.	.	.	.	C	17.79	3.475858	0.63737	.	.	ENSG00000123360	ENST00000243052	T	0.70516	-0.49	4.15	4.15	0.48705	.	1.932320	0.03004	N	0.148638	T	0.75744	0.3891	L	0.29908	0.895	0.80722	D	1	D	0.69078	0.997	P	0.57679	0.825	T	0.65290	-0.6204	10	0.72032	D	0.01	.	11.7893	0.52059	0.0:1.0:0.0:0.0	.	4	Q01064	PDE1B_HUMAN	F	4	ENSP00000243052:S4F	ENSP00000243052:S4F	S	+	2	0	PDE1B	53229934	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.779000	0.55379	2.124000	0.65301	0.561000	0.74099	TCC	PDE1B	-	NULL	ENSG00000123360		0.627	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE1B	HGNC	protein_coding	OTTHUMT00000406203.1	34	0.00	0	C			54943667	54943667	+1	no_errors	ENST00000243052	ensembl	human	known	69_37n	missense	22	42.11	16	SNP	1.000	T
PEAK1	79834	genome.wustl.edu	37	15	77474189	77474189	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr15:77474189T>C	ENST00000560626.2	-	4	555	c.80A>G	c.(79-81)cAc>cGc	p.H27R	PEAK1_ENST00000312493.4_Missense_Mutation_p.H27R|PEAK1_ENST00000558305.1_Missense_Mutation_p.H27R			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	27					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GGGAAGCTGGTGCAAACTTTT	0.428																																						dbGAP											0													138.0	134.0	135.0					15																	77474189		1890	4099	5989	-	-	-	SO:0001583	missense	0				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.80A>G	15.37:g.77474189T>C	ENSP00000452796:p.His27Arg		Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.H27R	ENST00000560626.2	37	c.80	CCDS42062.1	15	.	.	.	.	.	.	.	.	.	.	T	18.71	3.682807	0.68157	.	.	ENSG00000173517	ENST00000312493	D	0.84660	-1.88	5.77	5.77	0.91146	.	0.000000	0.35585	U	0.003103	D	0.90981	0.7164	L	0.58810	1.83	0.58432	D	0.999992	D	0.89917	1.0	D	0.85130	0.997	D	0.91776	0.5431	10	0.87932	D	0	-12.9387	16.3818	0.83467	0.0:0.0:0.0:1.0	.	27	Q9H792	PEAK1_HUMAN	R	27	ENSP00000309230:H27R	ENSP00000309230:H27R	H	-	2	0	AC087465.1	75261244	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.812000	0.86109	2.330000	0.79161	0.528000	0.53228	CAC	PEAK1	-	NULL	ENSG00000173517		0.428	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PEAK1	Clone_based_vega_gene	protein_coding	OTTHUMT00000419483.3	215	0.00	0	T			77474189	77474189	-1	no_errors	ENST00000312493	ensembl	human	known	69_37n	missense	166	33.60	84	SNP	1.000	C
PFKFB1	5207	genome.wustl.edu	37	X	54978380	54978380	+	Silent	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chrX:54978380G>A	ENST00000375006.3	-	8	874	c.804C>T	c.(802-804)ggC>ggT	p.G268G	PFKFB1_ENST00000374992.2_Intron|PFKFB1_ENST00000545676.1_Silent_p.G203G	NM_002625.2	NP_002616.2	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1	268	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|intracellular signal transduction (GO:0035556)|organ regeneration (GO:0031100)|positive regulation of glucokinase activity (GO:0033133)|response to cAMP (GO:0051591)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase complex (GO:0043540)|cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|fructose-6-phosphate binding (GO:0070095)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)	24						CTCCGATGCGGCCTCTGATGT	0.582																																						dbGAP											0													125.0	78.0	94.0					X																	54978380		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14364.1, CCDS65273.1	Xp11.21	2012-07-13			ENSG00000158571	ENSG00000158571	2.7.1.105, 3.1.3.46		8872	protein-coding gene	gene with protein product		311790		PFRX		9119406	Standard	NM_002625		Approved		uc004dty.2	P16118	OTTHUMG00000021643	ENST00000375006.3:c.804C>T	X.37:g.54978380G>A			B2RA88|B4DUN5|Q5JXS5|Q99951	Silent	SNP	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,pfam_Zeta_toxin_domain,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.G268	ENST00000375006.3	37	c.804	CCDS14364.1	X																																																																																			PFKFB1	-	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	ENSG00000158571		0.582	PFKFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKFB1	HGNC	protein_coding	OTTHUMT00000056847.1	128	0.00	0	G			54978380	54978380	-1	no_errors	ENST00000375006	ensembl	human	known	69_37n	silent	89	31.01	40	SNP	1.000	A
PHKA1	5255	genome.wustl.edu	37	X	71823050	71823050	+	Silent	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chrX:71823050G>A	ENST00000373542.4	-	26	2995	c.2836C>T	c.(2836-2838)Ctg>Ttg	p.L946L	PHKA1_ENST00000541944.1_Silent_p.L887L|PHKA1_ENST00000339490.3_Silent_p.L946L|PHKA1_ENST00000373545.3_Silent_p.L887L|PHKA1_ENST00000373539.3_Silent_p.L946L	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	946					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					AGATTCATCAGGCCCTCTGTG	0.458																																						dbGAP											0													91.0	73.0	79.0					X																	71823050		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.2836C>T	X.37:g.71823050G>A			B7ZL05|B7ZL07|Q2M3D7	Silent	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.L946	ENST00000373542.4	37	c.2836	CCDS14421.1	X																																																																																			PHKA1	-	NULL	ENSG00000067177		0.458	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	HGNC	protein_coding	OTTHUMT00000058896.1	211	0.00	0	G			71823050	71823050	-1	no_errors	ENST00000373539	ensembl	human	known	69_37n	silent	146	31.13	66	SNP	1.000	A
PLEKHG3	26030	genome.wustl.edu	37	14	65208367	65208367	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr14:65208367C>T	ENST00000394691.1	+	16	2279	c.2132C>T	c.(2131-2133)aCc>aTc	p.T711I	PLEKHG3_ENST00000484731.2_Missense_Mutation_p.T216I|PLEKHG3_ENST00000247226.7_Missense_Mutation_p.T655I|PLEKHG3_ENST00000471182.2_Missense_Mutation_p.T244I|PLEKHG3_ENST00000492928.1_3'UTR			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	711							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		GCACTCTCCACCCGAGACCGG	0.567																																						dbGAP											0													58.0	62.0	60.0					14																	65208367		2185	4260	6445	-	-	-	SO:0001583	missense	0			AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.2132C>T	14.37:g.65208367C>T	ENSP00000378183:p.Thr711Ile		A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.T711I	ENST00000394691.1	37	c.2132		14	.	.	.	.	.	.	.	.	.	.	C	13.34	2.206542	0.39003	.	.	ENSG00000126822	ENST00000247226;ENST00000394691;ENST00000471182;ENST00000484731	D;D;D;D	0.89270	-2.49;-2.49;-2.49;-2.49	6.08	6.08	0.98989	.	0.179301	0.39985	N	0.001220	D	0.90974	0.7162	M	0.61703	1.905	0.31788	N	0.630076	D;P;D;D	0.61080	0.989;0.85;0.973;0.984	P;B;P;P	0.58266	0.836;0.424;0.567;0.792	D	0.91305	0.5070	10	0.66056	D	0.02	.	8.2634	0.31799	0.1569:0.7659:0.0:0.0771	.	244;216;711;655	A1L390-2;G3V311;A1L390;A1L390-3	.;.;PKHG3_HUMAN;.	I	655;711;244;216	ENSP00000247226:T655I;ENSP00000378183:T711I;ENSP00000450945:T244I;ENSP00000450973:T216I	ENSP00000247226:T655I	T	+	2	0	PLEKHG3	64278120	0.790000	0.28787	0.831000	0.32960	0.085000	0.17905	1.843000	0.39259	2.894000	0.99253	0.655000	0.94253	ACC	PLEKHG3	-	NULL	ENSG00000126822		0.567	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	PLEKHG3	HGNC	protein_coding	OTTHUMT00000412028.1	11	0.00	0	C	NM_015549		65208367	65208367	+1	no_errors	ENST00000394691	ensembl	human	known	69_37n	missense	7	50.00	7	SNP	0.943	T
PPAPDC1A	196051	genome.wustl.edu	37	10	122278379	122278379	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr10:122278379C>A	ENST00000398250.1	+	4	643	c.291C>A	c.(289-291)tgC>tgA	p.C97*	PPAPDC1A_ENST00000541332.1_Nonsense_Mutation_p.C97*|PPAPDC1A_ENST00000439221.1_Intron|PPAPDC1A_ENST00000398248.1_Intron|PPAPDC1A_ENST00000369073.3_Nonsense_Mutation_p.C87*	NM_001030059.1	NP_001025230.1	Q5VZY2	PPC1A_HUMAN	phosphatidic acid phosphatase type 2 domain containing 1A	97					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phospholipid dephosphorylation (GO:0046839)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	20		Lung NSC(174;0.1)|all_lung(145;0.132)		all cancers(201;0.0117)		ATGGAGTCTGCACAAACACTA	0.393																																						dbGAP											0													190.0	172.0	177.0					10																	122278379		1887	4110	5997	-	-	-	SO:0001587	stop_gained	0			AK098668	CCDS41573.1	10q26.13	2008-02-05		2005-07-15	ENSG00000203805	ENSG00000203805			23531	protein-coding gene	gene with protein product			"""phosphatidic acid phosphatase type 2 domain containing 1"""	PPAPDC1			Standard	XM_005269592		Approved		uc001lev.1	Q5VZY2	OTTHUMG00000019168	ENST00000398250.1:c.291C>A	10.37:g.122278379C>A	ENSP00000381302:p.Cys97*		A2RU82|Q08EQ2|Q0IIP2|Q495B4|Q5VZY1	Nonsense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.C97*	ENST00000398250.1	37	c.291	CCDS41573.1	10	.	.	.	.	.	.	.	.	.	.	C	36	5.877815	0.97055	.	.	ENSG00000203805	ENST00000398250;ENST00000427079;ENST00000541332;ENST00000369073	.	.	.	5.65	5.65	0.86999	.	0.042679	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-23.547	19.7204	0.96139	0.0:1.0:0.0:0.0	.	.	.	.	X	97;97;97;87	.	ENSP00000358069:C87X	C	+	3	2	PPAPDC1A	122268369	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.060000	0.49955	2.677000	0.91161	0.455000	0.32223	TGC	PPAPDC1A	-	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	ENSG00000203805		0.393	PPAPDC1A-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAPDC1A	HGNC	protein_coding		390	0.00	0	C	XM_113641		122278379	122278379	+1	no_errors	ENST00000398250	ensembl	human	known	69_37n	nonsense	246	38.71	156	SNP	1.000	A
PRAMEF11	440560	genome.wustl.edu	37	1	12887609	12887609	+	Missense_Mutation	SNP	C	C	T	rs202122733	byFrequency	TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr1:12887609C>T	ENST00000535591.1	-	3	443	c.248G>A	c.(247-249)gGg>gAg	p.G83E		NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	83					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						GAGGAAGCACCCATGGGCCAT	0.483													.|||	5	0.000998403	0.0	0.0	5008	,	,		19554	0.003		0.0	False		,,,				2504	0.002					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.248G>A	1.37:g.12887609C>T	ENSP00000439551:p.Gly83Glu			Missense_Mutation	SNP	NULL	p.G83E	ENST00000535591.1	37	c.248	CCDS53268.1	1	.	.	.	.	.	.	.	.	.	.	.	0.007	-1.980605	0.00448	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.04809	3.55;3.55	1.36	-2.73	0.05950	.	2.139880	0.01966	N	0.043673	T	0.02807	0.0084	N	0.17474	0.49	0.09310	N	1	P	0.40731	0.728	B	0.36244	0.22	T	0.23797	-1.0178	10	0.25751	T	0.34	.	0.7952	0.01065	0.1684:0.2249:0.1685:0.4381	.	83	O60813	PRA11_HUMAN	E	83;124;83	ENSP00000439551:G83E;ENSP00000391839:G83E	ENSP00000328783:G124E	G	-	2	0	PRAMEF11	12810196	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.255000	0.00073	-2.807000	0.00349	-1.483000	0.00984	GGG	PRAMEF11	-	NULL	ENSG00000204513		0.483	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF11	HGNC	protein_coding		67	0.00	0	C	XM_496341		12887609	12887609	-1	no_errors	ENST00000535591	ensembl	human	known	69_37n	missense	42	32.26	20	SNP	0.000	T
PQLC2	54896	genome.wustl.edu	37	1	19653907	19653907	+	Splice_Site	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr1:19653907G>A	ENST00000375153.3	+	7	1444		c.e7+1		PQLC2_ENST00000400548.2_Splice_Site|PQLC2_ENST00000375155.3_Splice_Site	NM_001040125.1	NP_001035214.1	Q6ZP29	LAAT1_HUMAN	PQ loop repeat containing 2						amino acid homeostasis (GO:0080144)|arginine transport (GO:0015809)|lysine transport (GO:0015819)	integral component of organelle membrane (GO:0031301)|lysosomal membrane (GO:0005765)	arginine transmembrane transporter activity (GO:0015181)|basic amino acid transmembrane transporter activity (GO:0015174)|L-lysine transmembrane transporter activity (GO:0015189)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(1)	10		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;1.89e-05)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CGACACCATCGTATCCTTCAG	0.642																																						dbGAP											0													36.0	32.0	33.0					1																	19653907		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC015324	CCDS195.2, CCDS30618.1	1p36.13	2013-10-11			ENSG00000040487	ENSG00000040487			26001	protein-coding gene	gene with protein product		614760				23169667	Standard	XM_005245915		Approved	FLJ20320	uc001bby.3	Q6ZP29	OTTHUMG00000002521	ENST00000375153.3:c.804+1G>A	1.37:g.19653907G>A			B3KWQ5|Q6ZMJ3|Q6ZP27|Q9NXC7	Splice_Site	SNP	-	e6+1	ENST00000375153.3	37	c.804+1	CCDS195.2	1	.	.	.	.	.	.	.	.	.	.	G	19.76	3.887760	0.72410	.	.	ENSG00000040487	ENST00000375155;ENST00000375153;ENST00000400548	.	.	.	4.98	4.07	0.47477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0954	0.48141	0.0908:0.0:0.9092:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PQLC2	19526494	1.000000	0.71417	0.964000	0.40570	0.941000	0.58515	7.700000	0.84556	1.101000	0.41535	0.585000	0.79938	.	PQLC2	-	-	ENSG00000040487		0.642	PQLC2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PQLC2	HGNC	protein_coding	OTTHUMT00000007255.1	19	0.00	0	G	NM_017765	Intron	19653907	19653907	+1	no_errors	ENST00000375153	ensembl	human	known	69_37n	splice_site	11	45.00	9	SNP	0.998	A
RAB30	27314	genome.wustl.edu	37	11	82708280	82708280	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr11:82708280G>C	ENST00000533486.1	-	3	363	c.79C>G	c.(79-81)Cga>Gga	p.R27G	RAB30_ENST00000532548.1_Missense_Mutation_p.R27G|RAB30_ENST00000534141.1_Missense_Mutation_p.R27G|RP11-659G9.3_ENST00000527550.1_RNA|RAB30_ENST00000527633.1_Missense_Mutation_p.R27G|RAB30_ENST00000260056.2_Missense_Mutation_p.R27G|RAB30_ENST00000525117.1_Missense_Mutation_p.R27G	NM_014488.3	NP_055303.2	Q15771	RAB30_HUMAN	RAB30, member RAS oncogene family	27					Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cis-Golgi network (GO:0005801)|Golgi cisterna (GO:0031985)|Golgi stack (GO:0005795)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13						GTGAATCTTCGGACGAGGCAC	0.483																																						dbGAP											0													113.0	96.0	102.0					11																	82708280		2203	4300	6503	-	-	-	SO:0001583	missense	0			U57092	CCDS8264.1	11q12-q14	2008-07-21				ENSG00000137502		"""RAB, member RAS oncogene"""	9770	protein-coding gene	gene with protein product		605693				8863739, 9792283	Standard	NM_014488		Approved		uc001ozu.3	Q15771		ENST00000533486.1:c.79C>G	11.37:g.82708280G>C	ENSP00000435189:p.Arg27Gly		Q6FGK1|Q6MZH2|Q96CI8	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R27G	ENST00000533486.1	37	c.79	CCDS8264.1	11	.	.	.	.	.	.	.	.	.	.	G	25.6	4.655978	0.88056	.	.	ENSG00000137502	ENST00000533486;ENST00000534141;ENST00000260056;ENST00000527633;ENST00000531021;ENST00000534301;ENST00000525117;ENST00000532548;ENST00000526205;ENST00000534103;ENST00000530224;ENST00000533276;ENST00000528379	T;T;T;T;T;T;T;T;T;T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33;-1.33;-1.33;-1.33;-1.33;-1.33;-1.33;-1.33;-1.33;-1.33	5.8	5.8	0.92144	Small GTP-binding protein domain (1);	0.071804	0.64402	D	0.000019	D	0.86406	0.5925	L	0.39147	1.195	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;0.997	D	0.83979	0.0331	9	.	.	.	.	20.0609	0.97674	0.0:0.0:1.0:0.0	.	27;27;27	E9PLM3;Q6MZH2;Q15771	.;.;RAB30_HUMAN	G	27	ENSP00000435189:R27G;ENSP00000434974:R27G;ENSP00000260056:R27G;ENSP00000435089:R27G;ENSP00000434953:R27G;ENSP00000432193:R27G;ENSP00000433243:R27G;ENSP00000437235:R27G;ENSP00000432336:R27G;ENSP00000435542:R27G;ENSP00000436282:R27G;ENSP00000434528:R27G;ENSP00000434106:R27G	.	R	-	1	2	RAB30	82385928	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.803000	0.85983	2.755000	0.94549	0.655000	0.94253	CGA	RAB30	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000137502		0.483	RAB30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB30	HGNC	protein_coding	OTTHUMT00000392141.1	179	0.00	0	G	NM_014488		82708280	82708280	-1	no_errors	ENST00000260056	ensembl	human	known	69_37n	missense	96	51.98	105	SNP	1.000	C
RAN	5901	genome.wustl.edu	37	12	131359172	131359172	+	Frame_Shift_Del	DEL	G	G	-			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr12:131359172delG	ENST00000543796.1	+	5	587	c.329delG	c.(328-330)cgafs	p.R110fs	RAN_ENST00000392369.2_Frame_Shift_Del_p.R110fs|RAN_ENST00000392367.3_Frame_Shift_Del_p.R127fs|RAN_ENST00000541630.1_Frame_Shift_Del_p.R22fs|RAN_ENST00000254675.3_Frame_Shift_Del_p.R22fs			P62826	RAN_HUMAN	RAN, member RAS oncogene family	110					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|cellular protein complex localization (GO:0034629)|DNA metabolic process (GO:0006259)|gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(2)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	Lung NSC(355;7.46e-07)|all_epithelial(31;7.36e-06)		OV - Ovarian serous cystadenocarcinoma(86;9.18e-49)|Epithelial(86;1.42e-45)|all cancers(50;6.28e-40)		GATCTGGTACGAGTGTGTGAA	0.423																																						dbGAP											0													132.0	111.0	118.0					12																	131359172		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			M31469	CCDS9271.1, CCDS73546.1	12q24.33	2014-05-09			ENSG00000132341	ENSG00000132341			9846	protein-coding gene	gene with protein product		601179				8421051	Standard	XM_005253592		Approved	ARA24, TC4, Gsp1	uc001uir.3	P62826	OTTHUMG00000134328	ENST00000543796.1:c.329delG	12.37:g.131359172delG	ENSP00000446215:p.Arg110fs		A8K3Z8|P17080|P28746|P28747|Q6IPB2|Q86V08|Q8NI90|Q9CSP3|Q9CWI7|Q9CZA2|Q9UDJ5|Q9UEU9	Frame_Shift_Del	DEL	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R110fs	ENST00000543796.1	37	c.329	CCDS9271.1	12																																																																																			RAN	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000132341		0.423	RAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAN	HGNC	protein_coding	OTTHUMT00000259441.2	150	0.00	0	G	NM_006325		131359172	131359172	+1	no_errors	ENST00000392369	ensembl	human	known	69_37n	frame_shift_del	139	20.56	37	DEL	0.998	-
RC3H2	54542	genome.wustl.edu	37	9	125621114	125621114	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr9:125621114T>C	ENST00000373670.1	-	11	2717	c.2117A>G	c.(2116-2118)tAc>tGc	p.Y706C	RC3H2_ENST00000357244.2_Missense_Mutation_p.Y706C|RC3H2_ENST00000423239.2_Missense_Mutation_p.Y706C			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	706					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						ATCTCGTTGGTACATAGGTGG	0.483																																						dbGAP											0													135.0	134.0	134.0					9																	125621114		1940	4143	6083	-	-	-	SO:0001583	missense	0			AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.2117A>G	9.37:g.125621114T>C	ENSP00000362774:p.Tyr706Cys		Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_RING,smart_Znf_CCCH,pfscan_Znf_RING	p.Y706C	ENST00000373670.1	37	c.2117	CCDS43874.1	9	.	.	.	.	.	.	.	.	.	.	T	18.71	3.681827	0.68042	.	.	ENSG00000056586	ENST00000373670;ENST00000357244;ENST00000373663;ENST00000423239	T;T;T	0.53857	0.6;0.6;0.64	5.71	5.71	0.89125	.	0.120868	0.64402	D	0.000018	T	0.61937	0.2387	L	0.32530	0.975	0.49687	D	0.999814	D;D	0.76494	0.999;0.999	D;D	0.79784	0.984;0.993	T	0.63791	-0.6557	10	0.54805	T	0.06	-4.8161	13.7222	0.62735	0.0:0.0:0.0:1.0	.	706;706	Q9HBD1;Q9HBD1-4	RC3H2_HUMAN;.	C	706;706;577;706	ENSP00000362774:Y706C;ENSP00000349783:Y706C;ENSP00000411767:Y706C	ENSP00000349783:Y706C	Y	-	2	0	RC3H2	124660935	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.947000	0.63583	2.178000	0.69098	0.533000	0.62120	TAC	RC3H2	-	NULL	ENSG00000056586		0.483	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RC3H2	HGNC	protein_coding	OTTHUMT00000053966.1	137	0.00	0	T	NM_018835		125621114	125621114	-1	no_errors	ENST00000357244	ensembl	human	known	69_37n	missense	97	29.71	41	SNP	1.000	C
RP1	6101	genome.wustl.edu	37	8	55537248	55537248	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr8:55537248C>T	ENST00000220676.1	+	4	954	c.806C>T	c.(805-807)tCa>tTa	p.S269L		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	269	Poly-Ser.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CATATGTCTTCAAGCTCAAGG	0.333																																					Colon(91;1014 1389 7634 14542 40420)	dbGAP											0													59.0	67.0	64.0					8																	55537248		2203	4295	6498	-	-	-	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.806C>T	8.37:g.55537248C>T	ENSP00000220676:p.Ser269Leu			Missense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.S269L	ENST00000220676.1	37	c.806	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	14.83	2.652032	0.47362	.	.	ENSG00000104237	ENST00000220676	T	0.28454	1.61	5.29	4.42	0.53409	.	0.152168	0.31051	N	0.008355	T	0.33235	0.0856	M	0.75264	2.295	0.30831	N	0.736689	P	0.38110	0.618	B	0.32211	0.142	T	0.48536	-0.9027	10	0.72032	D	0.01	.	13.6927	0.62556	0.0:0.9259:0.0:0.0741	.	269	P56715	RP1_HUMAN	L	269	ENSP00000220676:S269L	ENSP00000220676:S269L	S	+	2	0	RP1	55699801	0.950000	0.32346	0.869000	0.34112	0.708000	0.40852	2.426000	0.44731	1.224000	0.43551	0.655000	0.94253	TCA	RP1	-	NULL	ENSG00000104237		0.333	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	57	0.00	0	C	NM_006269		55537248	55537248	+1	no_errors	ENST00000220676	ensembl	human	known	69_37n	missense	54	21.74	15	SNP	0.988	T
RYR1	6261	genome.wustl.edu	37	19	38993592	38993592	+	Silent	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr19:38993592C>T	ENST00000359596.3	+	49	7908	c.7908C>T	c.(7906-7908)ttC>ttT	p.F2636F	RYR1_ENST00000360985.3_Silent_p.F2636F|RYR1_ENST00000355481.4_Silent_p.F2636F			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2636	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TCAACGAGTTCGCCAAGATGC	0.577																																						dbGAP											0													127.0	85.0	99.0					19																	38993592		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.7908C>T	19.37:g.38993592C>T			Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.F2636	ENST00000359596.3	37	c.7908	CCDS33011.1	19																																																																																			RYR1	-	NULL	ENSG00000196218		0.577	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	61	0.00	0	C			38993592	38993592	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	silent	25	36.59	15	SNP	0.988	T
SEC13	6396	genome.wustl.edu	37	3	10354321	10354321	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr3:10354321C>T	ENST00000350697.3	-	4	383	c.258G>A	c.(256-258)tgG>tgA	p.W86*	SEC13_ENST00000397109.3_Nonsense_Mutation_p.W72*|SEC13_ENST00000337354.4_Nonsense_Mutation_p.W89*|SEC13_ENST00000383801.2_Nonsense_Mutation_p.W132*|SEC13_ENST00000397117.1_Nonsense_Mutation_p.W72*	NM_183352.1	NP_899195.1	P55735	SEC13_HUMAN	SEC13 homolog (S. cerevisiae)	86					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)		p.W86C(2)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	17						TTTCCTCTCTCCAGATAATGA	0.582																																						dbGAP											2	Substitution - Missense(2)	lung(2)											136.0	136.0	136.0					3																	10354321		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS2599.1, CCDS46751.1, CCDS63540.1	3p25-p24	2013-01-10	2006-11-07	2006-11-07	ENSG00000157020	ENSG00000157020		"""WD repeat domain containing"""	10697	protein-coding gene	gene with protein product		600152	"""SEC13 (S. cerevisiae)-like 1"", ""SEC13-like 1 (S. cerevisiae)"""	D3S1231E, SEC13L1		7987303	Standard	NM_183352		Approved	SEC13R, npp-20	uc003bvn.3	P55735	OTTHUMG00000128671	ENST00000350697.3:c.258G>A	3.37:g.10354321C>T	ENSP00000312122:p.Trp86*		A8MV37|B4DXJ1|Q5BJF0|Q9BRM6|Q9BUG7	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W86*	ENST00000350697.3	37	c.258	CCDS2599.1	3	.	.	.	.	.	.	.	.	.	.	C	41	8.867534	0.98984	.	.	ENSG00000157020	ENST00000397109;ENST00000337354;ENST00000350697;ENST00000397117;ENST00000383801;ENST00000397105	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6633	0.77206	0.0:1.0:0.0:0.0	.	.	.	.	X	72;89;86;72;132;86	.	ENSP00000336566:W89X	W	-	3	0	SEC13	10329321	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.700000	0.84556	2.276000	0.75962	0.561000	0.74099	TGG	SEC13	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000157020		0.582	SEC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC13	HGNC	protein_coding	OTTHUMT00000250563.3	206	0.00	0	C			10354321	10354321	-1	no_errors	ENST00000350697	ensembl	human	known	69_37n	nonsense	115	28.12	45	SNP	1.000	T
SEC61A1	29927	genome.wustl.edu	37	3	127788327	127788327	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr3:127788327C>T	ENST00000243253.3	+	12	1437	c.1253C>T	c.(1252-1254)cCc>cTc	p.P418L	SEC61A1_ENST00000483956.1_3'UTR|RUVBL1_ENST00000464873.1_Intron|SEC61A1_ENST00000464451.1_Missense_Mutation_p.P424L|SEC61A1_ENST00000424880.2_Missense_Mutation_p.P298L	NM_013336.3	NP_037468.1	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit (S. cerevisiae)	418					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell growth (GO:0016049)|endoplasmic reticulum organization (GO:0007029)|posttranslational protein targeting to membrane (GO:0006620)|protein targeting to ER (GO:0045047)|response to interferon-gamma (GO:0034341)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)			central_nervous_system(1)|kidney(1)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|prostate(4)	21						AGGTACATCCCCACAGCCGCG	0.652																																						dbGAP											0													46.0	53.0	51.0					3																	127788327		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF077032	CCDS3046.1	3q21.3	2008-02-05			ENSG00000058262	ENSG00000058262			18276	protein-coding gene	gene with protein product		609213					Standard	NM_013336		Approved		uc003ekb.3	P61619	OTTHUMG00000159624	ENST00000243253.3:c.1253C>T	3.37:g.127788327C>T	ENSP00000243253:p.Pro418Leu		P38378|P57726|Q5JPF8|Q8N0Z4|Q8N3U3|Q8NC71|Q9BU16|Q9Y2R3	Missense_Mutation	SNP	pfam_SecY,pfam_Translocon_Sec61/SecY_plug_dom,superfamily_SecY_su_dom,pirsf_SecY,tigrfam_SecY	p.P418L	ENST00000243253.3	37	c.1253	CCDS3046.1	3	.	.	.	.	.	.	.	.	.	.	C	26.3	4.723911	0.89298	.	.	ENSG00000058262	ENST00000464451;ENST00000243253;ENST00000424880	.	.	.	6.06	6.06	0.98353	SecY subunit domain (2);	0.048271	0.85682	D	0.000000	D	0.86916	0.6048	H	0.94847	3.59	0.80722	D	1	D	0.55385	0.971	P	0.61940	0.896	D	0.89087	0.3480	9	0.72032	D	0.01	.	20.6244	0.99512	0.0:1.0:0.0:0.0	.	418	P61619	S61A1_HUMAN	L	424;418;298	.	ENSP00000243253:P418L	P	+	2	0	SEC61A1	129271017	1.000000	0.71417	1.000000	0.80357	0.419000	0.31324	7.818000	0.86416	2.879000	0.98667	0.650000	0.86243	CCC	SEC61A1	-	pfam_SecY,superfamily_SecY_su_dom,pirsf_SecY,tigrfam_SecY	ENSG00000058262		0.652	SEC61A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC61A1	HGNC	protein_coding	OTTHUMT00000356541.2	27	0.00	0	C	NM_013336		127788327	127788327	+1	no_errors	ENST00000243253	ensembl	human	known	69_37n	missense	6	72.73	16	SNP	1.000	T
SIGLEC7	27036	genome.wustl.edu	37	19	51647840	51647840	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr19:51647840T>G	ENST00000317643.6	+	2	680	c.611T>G	c.(610-612)cTc>cGc	p.L204R	SIGLEC7_ENST00000305628.7_Intron|SIGLEC7_ENST00000600577.1_Intron	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	204	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		GTGCTCACCCTCATCCCACAG	0.662																																						dbGAP											0													61.0	60.0	60.0					19																	51647840		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.611T>G	19.37:g.51647840T>G	ENSP00000323328:p.Leu204Arg		Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L204R	ENST00000317643.6	37	c.611	CCDS12826.1	19	.	.	.	.	.	.	.	.	.	.	.	12.74	2.027727	0.35797	.	.	ENSG00000168995	ENST00000317643	T	0.04360	3.64	2.9	1.83	0.25207	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.647993	0.12750	N	0.442253	T	0.20333	0.0489	M	0.87180	2.865	0.09310	N	0.999996	D	0.89917	1.0	D	0.87578	0.998	T	0.05750	-1.0866	10	0.87932	D	0	.	5.2262	0.15396	0.2579:0.0:0.0:0.7421	.	204	Q9Y286	SIGL7_HUMAN	R	204	ENSP00000323328:L204R	ENSP00000323328:L204R	L	+	2	0	SIGLEC7	56339652	0.247000	0.23920	0.028000	0.17463	0.013000	0.08279	1.703000	0.37846	0.328000	0.23435	0.432000	0.28606	CTC	SIGLEC7	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000168995		0.662	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC7	HGNC	protein_coding	OTTHUMT00000464226.2	55	0.00	0	T	NM_016543		51647840	51647840	+1	no_errors	ENST00000317643	ensembl	human	known	69_37n	missense	39	35.00	21	SNP	0.142	G
SLC12A6	9990	genome.wustl.edu	37	15	34530451	34530451	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr15:34530451G>C	ENST00000354181.3	-	21	3276	c.2784C>G	c.(2782-2784)ttC>ttG	p.F928L	SLC12A6_ENST00000397702.2_Missense_Mutation_p.F869L|SLC12A6_ENST00000558667.1_Missense_Mutation_p.F928L|SLC12A6_ENST00000560611.1_Missense_Mutation_p.F928L|SLC12A6_ENST00000290209.5_Missense_Mutation_p.F877L|SLC12A6_ENST00000397707.2_Missense_Mutation_p.F913L|SLC12A6_ENST00000458406.2_Missense_Mutation_p.F869L|SLC12A6_ENST00000558589.1_Missense_Mutation_p.F919L|SLC12A6_ENST00000451844.2_Missense_Mutation_p.F740L|SLC12A6_ENST00000560164.1_Missense_Mutation_p.F740L			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	928					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)			central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	GTTTCAGTAGGAATGGTAGTA	0.413																																						dbGAP											0													162.0	144.0	150.0					15																	34530451		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.2784C>G	15.37:g.34530451G>C	ENSP00000346112:p.Phe928Leu		A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	pfam_AA-permease_dom,pfam_K/Cl_cotranspt_1/3,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.F919L	ENST00000354181.3	37	c.2757	CCDS58352.1	15	.	.	.	.	.	.	.	.	.	.	G	16.05	3.013949	0.54468	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406;ENST00000451844	D;D;D;D;D	0.94184	-3.37;-3.37;-3.37;-3.37;-3.37	5.15	3.3	0.37823	.	0.000000	0.85682	D	0.000000	D	0.96128	0.8738	M	0.92122	3.275	0.58432	D	0.999998	P;D;B;B	0.56035	0.477;0.974;0.452;0.041	B;P;B;B	0.57101	0.333;0.813;0.104;0.111	D	0.95371	0.8464	10	0.87932	D	0	.	8.8827	0.35384	0.2398:0.0:0.7602:0.0	.	913;928;877;740	Q9UHW9-3;Q9UHW9;A0AV76;B3KXX3	.;S12A6_HUMAN;.;.	L	877;913;919;869;869;740	ENSP00000290209:F877L;ENSP00000380819:F913L;ENSP00000380814:F869L;ENSP00000387725:F869L;ENSP00000390199:F740L	ENSP00000290209:F877L	F	-	3	2	SLC12A6	32317743	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.783000	0.47766	0.760000	0.33108	0.655000	0.94253	TTC	SLC12A6	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000140199		0.413	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SLC12A6	HGNC	protein_coding	OTTHUMT00000417991.1	204	0.97	2	G	NM_005135		34530451	34530451	-1	no_errors	ENST00000558589	ensembl	human	known	69_37n	missense	119	42.23	87	SNP	1.000	C
SLC20A1	6574	genome.wustl.edu	37	2	113404906	113404906	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr2:113404906G>T	ENST00000272542.3	+	3	879	c.340G>T	c.(340-342)Gct>Tct	p.A114S	AC079922.3_ENST00000457336.1_lincRNA	NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	114					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						TTCAGGTTCTGCTGTGTGGCA	0.393																																						dbGAP											0													164.0	167.0	166.0					2																	113404906		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.340G>T	2.37:g.113404906G>T	ENSP00000272542:p.Ala114Ser		Q08344|Q6DHX8|Q9UQ82	Missense_Mutation	SNP	pfam_Phos_transporter	p.A114S	ENST00000272542.3	37	c.340	CCDS2099.1	2	.	.	.	.	.	.	.	.	.	.	G	18.34	3.602861	0.66445	.	.	ENSG00000144136	ENST00000272542	D	0.91180	-2.8	5.78	4.87	0.63330	.	0.048268	0.85682	D	0.000000	D	0.87680	0.6238	L	0.41027	1.25	0.80722	D	1	B	0.24186	0.099	B	0.34931	0.192	T	0.82991	-0.0182	10	0.27785	T	0.31	-10.5847	14.0257	0.64584	0.0:0.0:0.8487:0.1513	.	114	Q8WUM9	S20A1_HUMAN	S	114	ENSP00000272542:A114S	ENSP00000272542:A114S	A	+	1	0	SLC20A1	113121377	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.988000	0.88194	2.733000	0.93635	0.591000	0.81541	GCT	SLC20A1	-	pfam_Phos_transporter	ENSG00000144136		0.393	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC20A1	HGNC	protein_coding	OTTHUMT00000254086.2	304	0.00	0	G	NM_005415		113404906	113404906	+1	no_errors	ENST00000272542	ensembl	human	known	69_37n	missense	184	34.05	95	SNP	1.000	T
SLC22A25	387601	genome.wustl.edu	37	11	62996956	62996956	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr11:62996956C>A	ENST00000306494.6	-	1	168	c.169G>T	c.(169-171)Gac>Tac	p.D57Y	SLC22A10_ENST00000525620.1_Intron|SLC22A25_ENST00000403374.2_5'Flank|SLC22A10_ENST00000535888.1_Intron	NM_199352.3	NP_955384.3			solute carrier family 22, member 25											NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						GGGATAGTGTCATTGTCCAGT	0.483																																						dbGAP											0													166.0	152.0	156.0					11																	62996956		2201	4298	6499	-	-	-	SO:0001583	missense	0			AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.169G>T	11.37:g.62996956C>A	ENSP00000307443:p.Asp57Tyr			Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.D57Y	ENST00000306494.6	37	c.169	CCDS31592.1	11	.	.	.	.	.	.	.	.	.	.	C	11.56	1.675700	0.29783	.	.	ENSG00000196600	ENST00000306494;ENST00000451441	T	0.36878	1.23	3.81	0.392	0.16288	.	1.070650	0.07181	N	0.854073	T	0.58892	0.2154	M	0.89904	3.07	0.54753	D	0.999982	P;D	0.59357	0.864;0.985	P;P	0.61397	0.597;0.888	T	0.61108	-0.7129	10	0.62326	D	0.03	.	4.0794	0.09919	0.0:0.3629:0.4264:0.2107	.	55;57	A4IF29;Q6T423	.;S22AP_HUMAN	Y	57	ENSP00000307443:D57Y	ENSP00000307443:D57Y	D	-	1	0	SLC22A25	62753532	0.019000	0.18553	0.929000	0.37066	0.149000	0.21700	-0.910000	0.04054	0.682000	0.31407	0.472000	0.43445	GAC	SLC22A25	-	NULL	ENSG00000196600		0.483	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A25	HGNC	protein_coding	OTTHUMT00000383519.3	233	0.00	0	C	NM_199352		62996956	62996956	-1	no_errors	ENST00000306494	ensembl	human	known	69_37n	missense	135	37.90	83	SNP	0.902	A
SLC25A53	401612	genome.wustl.edu	37	X	103349790	103349790	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chrX:103349790C>T	ENST00000357421.4	-	2	331	c.151G>A	c.(151-153)Gtt>Att	p.V51I		NM_001012755.3	NP_001012773.2	Q5H9E4	S2553_HUMAN	solute carrier family 25, member 53	51					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)											CGGAACACAACCTTATAGATA	0.507													c|||	7	0.0018543	0.0	0.0	3775	,	,		13678	0.0		0.0	False		,,,				2504	0.0072					dbGAP											0													66.0	61.0	63.0					X																	103349790		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35363.1	Xq22.2	2013-05-22	2012-03-29	2012-03-29	ENSG00000176274	ENSG00000269743		"""Solute carriers"""	31894	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 6"""	MCART6			Standard	NM_001012755		Approved		uc004elu.3	Q5H9E4	OTTHUMG00000022124	ENST00000357421.4:c.151G>A	X.37:g.103349790C>T	ENSP00000361681:p.Val51Ile		B2RTT9	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.V51I	ENST00000357421.4	37	c.151	CCDS35363.1	X	.	.	.	.	.	.	.	.	.	.	c	10.31	1.315264	0.23908	.	.	ENSG00000176274	ENST00000357421	D	0.81821	-1.54	4.02	3.16	0.36331	Mitochondrial carrier domain (2);	0.277054	0.30771	N	0.008914	T	0.67627	0.2913	L	0.28054	0.825	0.24748	N	0.992993	B	0.25441	0.126	B	0.31946	0.138	T	0.57087	-0.7871	10	0.38643	T	0.18	-8.5712	6.0049	0.19541	0.0:0.7554:0.0:0.2446	.	51	Q5H9E4	MCAR6_HUMAN	I	51	ENSP00000361681:V51I	ENSP00000361681:V51I	V	-	1	0	MCART6	103236446	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	1.994000	0.40757	0.849000	0.35215	-0.311000	0.09066	GTT	SLC25A53	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000176274		0.507	SLC25A53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A53	HGNC	protein_coding	OTTHUMT00000057761.1	87	0.00	0	C	NM_001012755		103349790	103349790	-1	no_errors	ENST00000357421	ensembl	human	known	69_37n	missense	63	10.00	7	SNP	0.998	T
SLC26A9	115019	genome.wustl.edu	37	1	205897095	205897095	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr1:205897095C>T	ENST00000367135.3	-	9	1149	c.1036G>A	c.(1036-1038)Gtc>Atc	p.V346I	SLC26A9_ENST00000367134.2_Missense_Mutation_p.V346I|SLC26A9_ENST00000340781.4_Missense_Mutation_p.V346I	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	346					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)			NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			AGGTTGATGACGTAGCTCACG	0.627																																						dbGAP											0													99.0	84.0	89.0					1																	205897095		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.1036G>A	1.37:g.205897095C>T	ENSP00000356103:p.Val346Ile		A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.V346I	ENST00000367135.3	37	c.1036	CCDS30990.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.273486	0.95459	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.92299	-3.01;-3.01;-3.01	5.08	5.08	0.68730	Sulphate transporter (1);	0.169175	0.37178	N	0.002201	D	0.93507	0.7928	L	0.33753	1.03	0.50039	D	0.999847	D;D	0.76494	0.999;0.999	D;D	0.67382	0.951;0.951	D	0.94343	0.7572	10	0.87932	D	0	.	18.2466	0.89988	0.0:1.0:0.0:0.0	.	346;346	Q7LBE3;B1AVM8	S26A9_HUMAN;.	I	346	ENSP00000341682:V346I;ENSP00000356103:V346I;ENSP00000356102:V346I	ENSP00000341682:V346I	V	-	1	0	SLC26A9	204163718	1.000000	0.71417	0.979000	0.43373	0.945000	0.59286	5.372000	0.66156	2.640000	0.89533	0.655000	0.94253	GTC	SLC26A9	-	pfam_Sulph_transpt,tigrfam_SulP_transpt	ENSG00000174502		0.627	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A9	HGNC	protein_coding	OTTHUMT00000087742.1	65	0.00	0	C	NM_052934		205897095	205897095	-1	no_errors	ENST00000340781	ensembl	human	known	69_37n	missense	80	15.79	15	SNP	1.000	T
SLC35B2	347734	genome.wustl.edu	37	6	44224176	44224176	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr6:44224176G>T	ENST00000393812.3	-	3	406	c.263C>A	c.(262-264)gCc>gAc	p.A88D	MIR4647_ENST00000583964.1_RNA|SLC35B2_ENST00000393810.1_Intron|SLC35B2_ENST00000495706.1_5'UTR|SLC35B2_ENST00000537814.1_Intron|SLC35B2_ENST00000538577.1_Intron	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	88					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTCATCAGAGGCCTTGGGCTC	0.587																																						dbGAP											0													56.0	63.0	61.0					6																	44224176		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.263C>A	6.37:g.44224176G>T	ENSP00000377401:p.Ala88Asp		B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Missense_Mutation	SNP	pfam_UAA,pfam_DMT	p.A88D	ENST00000393812.3	37	c.263	CCDS34462.1	6	.	.	.	.	.	.	.	.	.	.	g	15.39	2.818443	0.50633	.	.	ENSG00000157593	ENST00000393812;ENST00000341553	T	0.30981	1.51	4.26	3.4	0.38934	.	0.470315	0.24061	N	0.041916	T	0.08044	0.0201	N	0.24115	0.695	0.80722	D	1	B	0.12013	0.005	B	0.10450	0.005	T	0.10965	-1.0607	10	0.13853	T	0.58	-34.5777	12.1368	0.53977	0.0831:0.0:0.9169:0.0	.	88	Q8TB61	S35B2_HUMAN	D	88	ENSP00000377401:A88D	ENSP00000342455:A88D	A	-	2	0	SLC35B2	44332154	1.000000	0.71417	0.951000	0.38953	0.976000	0.68499	5.270000	0.65547	1.006000	0.39211	0.561000	0.74099	GCC	SLC35B2	-	NULL	ENSG00000157593		0.587	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35B2	HGNC	protein_coding	OTTHUMT00000040724.2	48	0.00	0	G			44224176	44224176	-1	no_errors	ENST00000393812	ensembl	human	known	69_37n	missense	20	42.86	15	SNP	0.983	T
SMARCA4	6597	genome.wustl.edu	37	19	11113752	11113752	+	Silent	SNP	C	C	T	rs141751028		TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr19:11113752C>T	ENST00000429416.3	+	13	2141	c.1860C>T	c.(1858-1860)atC>atT	p.I620I	SMARCA4_ENST00000413806.3_Silent_p.I620I|SMARCA4_ENST00000590574.1_Silent_p.I620I|SMARCA4_ENST00000450717.3_Silent_p.I620I|SMARCA4_ENST00000444061.3_Silent_p.I620I|SMARCA4_ENST00000344626.4_Silent_p.I620I|SMARCA4_ENST00000589677.1_Silent_p.I620I|SMARCA4_ENST00000358026.2_Silent_p.I620I|SMARCA4_ENST00000541122.2_Silent_p.I620I	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	620					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TGAAGGTGATCCACGTGGAGA	0.602			"""F, N, Mis"""		NSCLC																																	dbGAP		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	1	Unknown(1)	lung(1)											87.0	84.0	85.0					19																	11113752		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.1860C>T	19.37:g.11113752C>T			B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Silent	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_HSA,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_Bromodomain,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain,prints_Bromodomain	p.I620	ENST00000429416.3	37	c.1860	CCDS12253.1	19																																																																																			SMARCA4	-	pfam_BRK_domain,smart_BRK_domain	ENSG00000127616		0.602	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SMARCA4	HGNC	protein_coding	OTTHUMT00000452638.2	75	0.00	0	C	NM_003072		11113752	11113752	+1	no_errors	ENST00000358026	ensembl	human	known	69_37n	silent	36	36.84	21	SNP	1.000	T
STAC2	342667	genome.wustl.edu	37	17	37371076	37371076	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr17:37371076G>T	ENST00000333461.5	-	7	1180	c.811C>A	c.(811-813)Cca>Aca	p.P271T		NM_198993.3	NP_945344.1	Q6ZMT1	STAC2_HUMAN	SH3 and cysteine rich domain 2	271					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			NS(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(2)	17						TCTGGTCCTGGCCCTTCACTC	0.587																																						dbGAP											0													87.0	75.0	79.0					17																	37371076		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608762	CCDS11335.1	17q21.2	2012-11-19			ENSG00000141750	ENSG00000141750			23990	protein-coding gene	gene with protein product							Standard	NM_198993		Approved	24b2	uc002hrs.3	Q6ZMT1	OTTHUMG00000179039	ENST00000333461.5:c.811C>A	17.37:g.37371076G>T	ENSP00000327509:p.Pro271Thr		Q32MA3	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_SH3_domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_SH3_domain,prints_p67phox	p.P271T	ENST00000333461.5	37	c.811	CCDS11335.1	17	.	.	.	.	.	.	.	.	.	.	g	5.617	0.298516	0.10622	.	.	ENSG00000141750	ENST00000333461	T	0.80480	-1.38	4.22	1.74	0.24563	.	1.098180	0.06918	N	0.808814	T	0.60483	0.2272	N	0.14661	0.345	0.18873	N	0.999986	B	0.02656	0.0	B	0.01281	0.0	T	0.47209	-0.9135	10	0.12766	T	0.61	1.088	2.4786	0.04581	0.5305:0.0:0.1447:0.3247	.	271	Q6ZMT1	STAC2_HUMAN	T	271	ENSP00000327509:P271T	ENSP00000327509:P271T	P	-	1	0	STAC2	34624602	0.963000	0.33076	1.000000	0.80357	0.996000	0.88848	0.437000	0.21543	0.770000	0.33336	0.556000	0.70494	CCA	STAC2	-	NULL	ENSG00000141750		0.587	STAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAC2	HGNC	protein_coding	OTTHUMT00000444533.2	98	0.00	0	G	NM_198993		37371076	37371076	-1	no_errors	ENST00000333461	ensembl	human	known	69_37n	missense	141	16.57	28	SNP	1.000	T
STARD9	57519	genome.wustl.edu	37	15	42984495	42984495	+	Silent	SNP	G	G	A	rs543385215		TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr15:42984495G>A	ENST00000290607.7	+	23	10776	c.10719G>A	c.(10717-10719)acG>acA	p.T3573T		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	3573					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						ACATCCCGACGAGCCCTGAAG	0.577													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19333	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													16.0	16.0	16.0					15																	42984495		692	1590	2282	-	-	-	SO:0001819	synonymous_variant	0			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.10719G>A	15.37:g.42984495G>A			Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Silent	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.T3573	ENST00000290607.7	37	c.10719	CCDS53935.1	15																																																																																			STARD9	-	NULL	ENSG00000159433		0.577	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	41	0.00	0	G			42984495	42984495	+1	no_errors	ENST00000290607	ensembl	human	known	69_37n	silent	16	38.46	10	SNP	0.000	A
TIAM2	26230	genome.wustl.edu	37	6	155561720	155561720	+	Silent	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr6:155561720C>T	ENST00000461783.3	+	18	4498	c.3225C>T	c.(3223-3225)ggC>ggT	p.G1075G	TIAM2_ENST00000528391.2_Silent_p.G411G|TIAM2_ENST00000367174.2_Silent_p.G451G|TIAM2_ENST00000456877.2_Silent_p.G387G|TIAM2_ENST00000275246.7_5'UTR|TIAM2_ENST00000318981.5_Silent_p.G1075G|TIAM2_ENST00000360366.4_Silent_p.G1099G|TIAM2_ENST00000529824.2_Silent_p.G1075G|TIAM2_ENST00000456144.1_Silent_p.G1075G			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	1075					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		AGGCCAACGGCATGGAAGGAC	0.582																																						dbGAP											0													81.0	73.0	76.0					6																	155561720		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.3225C>T	6.37:g.155561720C>T			B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,superfamily_HR1_rho-bd,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.G1075	ENST00000461783.3	37	c.3225	CCDS34558.1	6																																																																																			TIAM2	-	NULL	ENSG00000146426		0.582	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	TIAM2	HGNC	protein_coding	OTTHUMT00000387980.2	68	0.00	0	C	NM_012454		155561720	155561720	+1	no_errors	ENST00000456144	ensembl	human	known	69_37n	silent	29	36.96	17	SNP	0.597	T
TBP	6908	genome.wustl.edu	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000230354.6_Silent_p.Q76Q|TBP_ENST00000540980.1_Silent_p.Q56Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																						dbGAP											4	Substitution - coding silent(4)	lung(3)|prostate(1)											14.0	19.0	17.0					6																	170871052		1952	3842	5794	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A			B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q76	ENST00000392092.2	37	c.228	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	38	0.00	0	G	NM_003194		170871052	170871052	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	25	27.78	10	SNP	0.994	A
TMTC4	84899	genome.wustl.edu	37	13	101278346	101278346	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr13:101278346C>T	ENST00000376234.3	-	12	1697	c.1508G>A	c.(1507-1509)aGa>aAa	p.R503K	TMTC4_ENST00000342624.5_Missense_Mutation_p.R522K|TMTC4_ENST00000328767.5_Missense_Mutation_p.R392K|TMTC4_ENST00000462211.1_5'UTR	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	503						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCGGTAGTATCTGATGGCAGC	0.423																																						dbGAP											0													121.0	114.0	117.0					13																	101278346		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1508G>A	13.37:g.101278346C>T	ENSP00000365408:p.Arg503Lys		A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	pfam_TPR-1,pfam_DUF1736,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R522K	ENST00000376234.3	37	c.1565	CCDS41904.1	13	.	.	.	.	.	.	.	.	.	.	C	5.462	0.270373	0.10349	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767	T;T;T	0.58506	0.33;0.33;0.33	5.3	3.52	0.40303	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.463932	0.24727	N	0.036085	T	0.24509	0.0594	N	0.03238	-0.38	0.21527	N	0.999657	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.0	T	0.25813	-1.0121	10	0.05833	T	0.94	.	5.0971	0.14739	0.0:0.5791:0.0:0.4209	.	392;503;503;522	B7Z666;Q5T4D3-2;Q5T4D3;Q5T4D3-3	.;.;TMTC4_HUMAN;.	K	503;522;392	ENSP00000365408:R503K;ENSP00000343871:R522K;ENSP00000365409:R392K	ENSP00000365409:R392K	R	-	2	0	TMTC4	100076347	0.066000	0.20996	0.972000	0.41901	0.860000	0.49131	0.712000	0.25779	1.333000	0.45449	0.655000	0.94253	AGA	TMTC4	-	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000125247		0.423	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC4	HGNC	protein_coding	OTTHUMT00000045649.2	145	0.00	0	C	NM_032813		101278346	101278346	-1	no_errors	ENST00000342624	ensembl	human	known	69_37n	missense	68	34.62	36	SNP	0.967	T
TRIM51HP	440041	genome.wustl.edu	37	11	55064990	55064990	+	RNA	SNP	G	G	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr11:55064990G>T	ENST00000526016.1	-	0	435					NR_038174.2				tripartite motif-containing 51H, pseudogene																		TCCATGTTCAGGTTTCTGAGA	0.403																																						dbGAP											0																																										-	-	-			0					11q11	2012-11-02			ENSG00000166007	ENSG00000166007		"""Triparite motif-containing / Pseudogenes"""	43977	pseudogene	pseudogene							Standard	NR_038174		Approved		uc021qjb.1		OTTHUMG00000166775		11.37:g.55064990G>T				RNA	SNP	-	NULL	ENST00000526016.1	37	NULL		11																																																																																			TRIM51HP	-	-	ENSG00000166007		0.403	TRIM51HP-002	PUTATIVE	basic|exp_conf	processed_transcript	TRIM51HP	HGNC	pseudogene	OTTHUMT00000391438.1	137	0.00	0	G			55064990	55064990	-1	no_errors	ENST00000526016	ensembl	human	putative	69_37n	rna	85	17.48	18	SNP	0.008	T
TSGA13	114960	genome.wustl.edu	37	7	130357595	130357595	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr7:130357595G>A	ENST00000456951.1	-	7	1360	c.509C>T	c.(508-510)tCc>tTc	p.S170F	TSGA13_ENST00000356588.3_Missense_Mutation_p.S170F			Q96PP4	TSG13_HUMAN	testis specific, 13	170										endometrium(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	18	Melanoma(18;0.0435)					TTCTCGCTTGGATGTGGGATC	0.428																																						dbGAP											0													186.0	174.0	178.0					7																	130357595		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093329	CCDS5824.1	7q32	2008-02-04			ENSG00000213265	ENSG00000213265			12369	protein-coding gene	gene with protein product							Standard	NM_052933		Approved		uc003vqi.3	Q96PP4	OTTHUMG00000154999	ENST00000456951.1:c.509C>T	7.37:g.130357595G>A	ENSP00000406047:p.Ser170Phe		B3KSC9	Missense_Mutation	SNP	NULL	p.S170F	ENST00000456951.1	37	c.509	CCDS5824.1	7	.	.	.	.	.	.	.	.	.	.	G	13.34	2.206918	0.39003	.	.	ENSG00000213265	ENST00000456951;ENST00000418126;ENST00000356588	.	.	.	5.52	3.69	0.42338	.	1.186130	0.06171	N	0.677708	T	0.27967	0.0689	N	0.14661	0.345	0.09310	N	1	B	0.18013	0.025	B	0.15052	0.012	T	0.23619	-1.0183	9	0.30854	T	0.27	-0.0792	8.1004	0.30854	0.1898:0.0:0.8102:0.0	.	170	Q96PP4	TSG13_HUMAN	F	170	.	ENSP00000348996:S170F	S	-	2	0	TSGA13	130008135	0.243000	0.23878	0.001000	0.08648	0.003000	0.03518	1.875000	0.39578	0.780000	0.33566	-0.140000	0.14226	TCC	TSGA13	-	NULL	ENSG00000213265		0.428	TSGA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA13	HGNC	protein_coding	OTTHUMT00000337997.1	276	0.00	0	G	NM_052933		130357595	130357595	-1	no_errors	ENST00000356588	ensembl	human	known	69_37n	missense	241	10.41	28	SNP	0.002	A
ULK2	9706	genome.wustl.edu	37	17	19685246	19685246	+	Silent	SNP	C	C	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr17:19685246C>T	ENST00000395544.4	-	23	3094	c.2595G>A	c.(2593-2595)gaG>gaA	p.E865E	ULK2_ENST00000361658.2_Silent_p.E865E	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	865	CTD-like region.				autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					CCACCACACTCTCCTGGATCT	0.522																																						dbGAP											0													172.0	123.0	139.0					17																	19685246		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.2595G>A	17.37:g.19685246C>T			A8MY69|O75119	Missense_Mutation	SNP	NULL	p.E184K	ENST00000395544.4	37	c.550	CCDS11213.1	17																																																																																			ULK2	-	NULL	ENSG00000083290		0.522	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	ULK2	HGNC	protein_coding	OTTHUMT00000132375.2	106	0.00	0	C	NM_014683		19685246	19685246	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000575432	ensembl	human	novel	69_37n	missense	57	26.92	21	SNP	1.000	T
TTC25	83538	genome.wustl.edu	37	17	40091945	40091945	+	RNA	SNP	C	C	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr17:40091945C>A	ENST00000591658.1	+	0	408							Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25							cytoplasm (GO:0005737)				endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				GAGGCCTGATCGGGAATTCAG	0.498																																						dbGAP											0													70.0	67.0	68.0					17																	40091945		1939	4153	6092	-	-	-			0			AK055498	CCDS74063.1	17q21.2	2014-08-12			ENSG00000204815	ENSG00000204815		"""Tetratricopeptide (TTC) repeat domain containing"""	25280	protein-coding gene	gene with protein product							Standard	XM_006722129		Approved	DKFZP434H0115	uc002hyj.4	Q96NG3	OTTHUMG00000175837		17.37:g.40091945C>A			Q6NX40|Q6PJ04|Q9H0K5	RNA	SNP	-	NULL	ENST00000591658.1	37	NULL		17																																																																																			TTC25	-	-	ENSG00000204815		0.498	TTC25-001	KNOWN	basic	processed_transcript	TTC25	HGNC	processed_transcript	OTTHUMT00000449237.1	158	0.00	0	C	NM_031421		40091945	40091945	+1	no_errors	ENST00000377540	ensembl	human	known	69_37n	rna	135	27.66	52	SNP	1.000	A
VPS26A	9559	genome.wustl.edu	37	10	70892783	70892783	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr10:70892783G>A	ENST00000373382.1	+	3	786	c.133G>A	c.(133-135)Gga>Aga	p.G45R	VPS26A_ENST00000263559.6_Missense_Mutation_p.G45R|VPS26A_ENST00000490696.1_3'UTR|VPS26A_ENST00000541711.1_5'UTR|VPS26A_ENST00000395098.1_Missense_Mutation_p.G45R|VPS26A_ENST00000546041.1_Silent_p.T2T|VPS26A_ENST00000489794.1_Missense_Mutation_p.G20R			O75436	VP26A_HUMAN	vacuolar protein sorting 26 homolog A (S. pombe)	45					retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|vesicle (GO:0031982)	protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)	8						CTTCTATGACGGAGAATCCGT	0.343																																					Colon(90;545 1358 4729 6702 16773)	dbGAP											0													95.0	91.0	92.0					10																	70892783		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054179	CCDS7286.1, CCDS41536.1	10q21.1	2007-01-12	2007-01-12	2005-10-11	ENSG00000122958	ENSG00000122958			12711	protein-coding gene	gene with protein product		605506	"""vacuolar protein sorting 26 (yeast homolog)"", ""vacuolar protein sorting 26 (yeast)"", ""vacuolar protein sorting 26 homolog A (yeast)"""	VPS26		1638986, 9653160	Standard	NM_004896		Approved	Hbeta58, PEP8A	uc001jpb.3	O75436	OTTHUMG00000018376	ENST00000373382.1:c.133G>A	10.37:g.70892783G>A	ENSP00000362480:p.Gly45Arg		A8MZ56|B2RDD3|Q8TBH4|Q9H982	Missense_Mutation	SNP	pfam_VPS26	p.G45R	ENST00000373382.1	37	c.133	CCDS7286.1	10	.	.	.	.	.	.	.	.	.	.	G	33	5.208133	0.95033	.	.	ENSG00000122958	ENST00000373382;ENST00000263559;ENST00000395098	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.86711	0.5998	M	0.93106	3.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.987	D	0.89002	0.3422	9	0.62326	D	0.03	-2.0937	19.5924	0.95520	0.0:0.0:1.0:0.0	.	45;45	A8MZ56;O75436	.;VP26A_HUMAN	R	45	.	ENSP00000263559:G45R	G	+	1	0	VPS26A	70562789	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.763000	0.98947	2.689000	0.91719	0.655000	0.94253	GGA	VPS26A	-	pfam_VPS26	ENSG00000122958		0.343	VPS26A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS26A	HGNC	protein_coding	OTTHUMT00000048403.1	150	0.00	0	G	NM_004896		70892783	70892783	+1	no_errors	ENST00000263559	ensembl	human	known	69_37n	missense	84	38.41	53	SNP	1.000	A
YARS2	51067	genome.wustl.edu	37	12	32908185	32908185	+	Silent	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr12:32908185G>A	ENST00000324868.8	-	1	651	c.624C>T	c.(622-624)ctC>ctT	p.L208L		NM_001040436.2	NP_001035526.1	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial	208					gene expression (GO:0010467)|mitochondrial tyrosyl-tRNA aminoacylation (GO:0070184)|translation (GO:0006412)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)|tyrosine binding (GO:0072545)|tyrosine-tRNA ligase activity (GO:0004831)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	16	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	CGGGGCTCTTGAGCCGCAGCT	0.617											OREG0021729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													57.0	64.0	62.0					12																	32908185		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF132939	CCDS31770.1	12p11.21	2014-03-19	2007-02-23		ENSG00000139131	ENSG00000139131	6.1.1.1	"""Aminoacyl tRNA synthetases / Class I"""	24249	protein-coding gene	gene with protein product	"""tyrosine tRNA ligase 2, mitochondrial"""	610957				15779907, 15840810	Standard	NM_001040436		Approved	FLJ13995, CGI-04, mt-TyrRS	uc001rli.3	Q9Y2Z4	OTTHUMG00000169454	ENST00000324868.8:c.624C>T	12.37:g.32908185G>A		836	D3DUW8|Q9H817	Silent	SNP	pfam_aa-tRNA-synth_Ic,prints_Tyr-tRNA-synth,tigrfam_Tyr-tRNA-synth	p.L208	ENST00000324868.8	37	c.624	CCDS31770.1	12																																																																																			YARS2	-	pfam_aa-tRNA-synth_Ic,tigrfam_Tyr-tRNA-synth	ENSG00000139131		0.617	YARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YARS2	HGNC	protein_coding	OTTHUMT00000404153.1	40	0.00	0	G	NM_015936		32908185	32908185	-1	no_errors	ENST00000324868	ensembl	human	known	69_37n	silent	28	34.09	15	SNP	0.006	A
ZFR2	23217	genome.wustl.edu	37	19	3834981	3834981	+	Splice_Site	SNP	G	G	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr19:3834981G>A	ENST00000262961.4	-	2	64	c.54C>T	c.(52-54)agC>agT	p.S18S	ZFR2_ENST00000591965.1_5'UTR	NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	18							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GAGGCTGGGCGCTAGAACCAC	0.612																																						dbGAP											0													13.0	16.0	15.0					19																	3834981		2096	4215	6311	-	-	-	SO:0001630	splice_region_variant	0			AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.54-1C>T	19.37:g.3834981G>A				Silent	SNP	pfam_DZF,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.S18	ENST00000262961.4	37	c.54	CCDS45921.1	19																																																																																			ZFR2	-	NULL	ENSG00000105278		0.612	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR2	HGNC	protein_coding	OTTHUMT00000453648.2	21	0.00	0	G	NM_015174	Silent	3834981	3834981	-1	no_errors	ENST00000262961	ensembl	human	known	69_37n	silent	9	59.09	13	SNP	0.314	A
ZNF281	23528	genome.wustl.edu	37	1	200378223	200378223	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr1:200378223T>A	ENST00000294740.3	-	2	735	c.611A>T	c.(610-612)gAt>gTt	p.D204V	ZNF281_ENST00000367353.1_Missense_Mutation_p.D204V|ZNF281_ENST00000367352.3_Missense_Mutation_p.D168V	NM_001281293.1|NM_001281294.1|NM_012482.4	NP_001268222.1|NP_001268223.1|NP_036614.1	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	204					embryonic body morphogenesis (GO:0010172)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|endometrium(3)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	27						ATGGTGGTCATCAGTCCTGCT	0.532																																						dbGAP											0													146.0	135.0	139.0					1																	200378223		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF125158	CCDS1402.1, CCDS60384.1	1q32.1	2012-08-08			ENSG00000162702	ENSG00000162702		"""Zinc fingers, C2H2-type"""	13075	protein-coding gene	gene with protein product						10448078	Standard	NM_012482		Approved	ZBP-99	uc001gve.3	Q9Y2X9	OTTHUMG00000035724	ENST00000294740.3:c.611A>T	1.37:g.200378223T>A	ENSP00000294740:p.Asp204Val		A6NF48|B3KMX2|Q5RKW5|Q9NY92	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D204V	ENST00000294740.3	37	c.611	CCDS1402.1	1	.	.	.	.	.	.	.	.	.	.	T	12.44	1.939921	0.34283	.	.	ENSG00000162702	ENST00000294740;ENST00000367353;ENST00000367352	T;T;T	0.07800	3.17;3.17;3.16	5.58	5.58	0.84498	.	0.871111	0.09945	N	0.735484	T	0.08179	0.0204	L	0.36672	1.1	0.48341	D	0.99963	B;B	0.19583	0.037;0.037	B;B	0.21546	0.035;0.023	T	0.27938	-1.0059	10	0.28530	T	0.3	-5.2358	6.8423	0.23969	0.0:0.1289:0.0:0.8711	.	168;204	A6NF48;Q9Y2X9	.;ZN281_HUMAN	V	204;204;168	ENSP00000294740:D204V;ENSP00000356322:D204V;ENSP00000356321:D168V	ENSP00000294740:D204V	D	-	2	0	ZNF281	198644846	0.997000	0.39634	0.997000	0.53966	0.998000	0.95712	3.244000	0.51399	2.102000	0.63906	0.533000	0.62120	GAT	ZNF281	-	NULL	ENSG00000162702		0.532	ZNF281-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF281	HGNC	protein_coding	OTTHUMT00000086879.2	115	0.00	0	T	NM_012482		200378223	200378223	-1	no_errors	ENST00000294740	ensembl	human	known	69_37n	missense	111	23.45	34	SNP	0.912	A
ZNF347	84671	genome.wustl.edu	37	19	53645625	53645625	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr19:53645625G>T	ENST00000334197.7	-	5	524	c.456C>A	c.(454-456)taC>taA	p.Y152*	ZNF347_ENST00000452676.2_Nonsense_Mutation_p.Y153*|ZNF347_ENST00000601469.2_Nonsense_Mutation_p.Y153*|ZNF347_ENST00000601804.1_Intron	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	152					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		GCACTCCTTTGTAATTTCCTT	0.393																																					Melanoma(64;205 1597 17324 45721)	dbGAP											0													159.0	141.0	147.0					19																	53645625		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.456C>A	19.37:g.53645625G>T	ENSP00000334146:p.Tyr152*		B3KU77|B9EG59|G5E9N4|Q8TCN1	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y153*	ENST00000334197.7	37	c.459	CCDS33097.1	19	.	.	.	.	.	.	.	.	.	.	G	13.66	2.304199	0.40795	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	.	.	.	2.44	-1.83	0.07833	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.7135	0.08428	0.2905:0.4151:0.2944:0.0	.	.	.	.	X	152;153	.	ENSP00000334146:Y152X	Y	-	3	2	ZNF347	58337437	0.000000	0.05858	0.007000	0.13788	0.015000	0.08874	-0.634000	0.05477	-0.046000	0.13446	-0.251000	0.11542	TAC	ZNF347	-	NULL	ENSG00000197937		0.393	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF347	HGNC	protein_coding	OTTHUMT00000464170.1	141	0.00	0	G	NM_032584		53645625	53645625	-1	no_errors	ENST00000452676	ensembl	human	known	69_37n	nonsense	102	37.04	60	SNP	0.006	T
ZNF75A	7627	genome.wustl.edu	37	16	3366955	3366955	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr16:3366955G>T	ENST00000574298.1	+	5	617	c.144G>T	c.(142-144)gaG>gaT	p.E48D	ZNF75A_ENST00000498240.2_3'UTR	NM_153028.2	NP_694573.1	Q96N20	ZN75A_HUMAN	zinc finger protein 75a	48	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|lung(7)|prostate(1)	12						CCTGTCTAGAGCAAGGGGAAG	0.463																																						dbGAP											0													125.0	116.0	119.0					16																	3366955		2197	4300	6497	-	-	-	SO:0001583	missense	0			X91826	CCDS10501.1	16p13.11	2013-01-08			ENSG00000162086	ENSG00000162086		"""Zinc fingers, C2H2-type"", ""-"""	13146	protein-coding gene	gene with protein product		601473				8661144	Standard	NM_153028		Approved	FLJ31529	uc002cut.4	Q96N20	OTTHUMG00000129356	ENST00000574298.1:c.144G>T	16.37:g.3366955G>T	ENSP00000459566:p.Glu48Asp		Q0VDI8|Q92669	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E48D	ENST00000574298.1	37	c.144	CCDS10501.1	16	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816962	0.50633	.	.	ENSG00000162086	ENST00000293995	.	.	.	5.21	1.11	0.20524	Krueppel-associated box (3);	0.000000	0.41823	D	0.000812	T	0.64594	0.2612	M	0.82716	2.605	0.26081	N	0.981099	D	0.76494	0.999	D	0.76071	0.987	T	0.55673	-0.8104	9	0.66056	D	0.02	.	7.1576	0.25647	0.3558:0.0:0.6442:0.0	.	48	Q96N20	ZN75A_HUMAN	D	48	.	ENSP00000293995:E48D	E	+	3	2	ZNF75A	3306956	0.430000	0.25538	0.999000	0.59377	0.997000	0.91878	0.057000	0.14279	0.086000	0.17137	0.650000	0.86243	GAG	ZNF75A	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000162086		0.463	ZNF75A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF75A	HGNC	protein_coding	OTTHUMT00000251506.2	146	0.00	0	G	NM_153028		3366955	3366955	+1	no_errors	ENST00000574298	ensembl	human	known	69_37n	missense	85	28.57	34	SNP	1.000	T
ZP4	57829	genome.wustl.edu	37	1	238051691	238051691	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A140-01A-11D-A10Y-09	TCGA-D8-A140-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	795f051e-01c4-4b49-b179-bd18ba24433c	3294b1ce-7e97-4973-86d3-71866f5a16c7	g.chr1:238051691C>A	ENST00000366570.4	-	4	678	c.520G>T	c.(520-522)Gaa>Taa	p.E174*	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	174	P-type. {ECO:0000255|PROSITE- ProRule:PRU00779}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TTCACCTCTTCAGAGCTATAA	0.507																																					NSCLC(166;160 2029 11600 18754 19936)	dbGAP											0													131.0	112.0	118.0					1																	238051691		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.520G>T	1.37:g.238051691C>A	ENSP00000355529:p.Glu174*		B2RAE1	Nonsense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_P_trefoil,superfamily_P_trefoil,smart_P_trefoil,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.E174*	ENST00000366570.4	37	c.520	CCDS1615.1	1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.343579	0.82022	.	.	ENSG00000116996	ENST00000366570	.	.	.	4.61	2.62	0.31277	.	0.835170	0.10387	N	0.680802	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-4.5866	6.3385	0.21309	0.0:0.6603:0.0:0.3397	.	.	.	.	X	174	.	ENSP00000355529:E174X	E	-	1	0	ZP4	236118314	0.130000	0.22417	0.000000	0.03702	0.000000	0.00434	2.326000	0.43849	0.294000	0.22547	-0.345000	0.07892	GAA	ZP4	-	pfam_P_trefoil,superfamily_P_trefoil,smart_P_trefoil	ENSG00000116996		0.507	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZP4	HGNC	protein_coding	OTTHUMT00000095476.1	142	0.00	0	C			238051691	238051691	-1	no_errors	ENST00000366570	ensembl	human	known	69_37n	nonsense	166	21.33	45	SNP	0.000	A
