#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AHNAK2	113146	genome.wustl.edu	37	14	105412985	105412985	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr14:105412985G>A	ENST00000333244.5	-	7	8922	c.8803C>T	c.(8803-8805)Ccc>Tcc	p.P2935S	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2935						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCACGTCGGGGGCCGTCACC	0.652																																						dbGAP											0													124.0	140.0	135.0					14																	105412985		1934	4124	6058	-	-	-	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8803C>T	14.37:g.105412985G>A	ENSP00000353114:p.Pro2935Ser		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P2935S	ENST00000333244.5	37	c.8803	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	g	14.87	2.664474	0.47572	.	.	ENSG00000185567	ENST00000333244	T	0.03035	4.07	4.04	3.12	0.35913	.	.	.	.	.	T	0.12433	0.0302	M	0.91872	3.25	0.09310	N	1	P	0.44429	0.835	P	0.47645	0.553	T	0.08186	-1.0734	9	0.30854	T	0.27	.	9.2736	0.37686	0.0:0.0:0.7843:0.2157	.	2935	Q8IVF2	AHNK2_HUMAN	S	2935	ENSP00000353114:P2935S	ENSP00000353114:P2935S	P	-	1	0	AHNAK2	104484030	0.426000	0.25506	0.004000	0.12327	0.001000	0.01503	1.212000	0.32394	0.803000	0.34113	0.306000	0.20318	CCC	AHNAK2	-	NULL	ENSG00000185567		0.652	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	56	0.00	0	G	NM_138420		105412985	105412985	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	missense	37	43.08	28	SNP	0.014	A
ANXA6	309	genome.wustl.edu	37	5	150508981	150508981	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr5:150508981T>C	ENST00000354546.5	-	12	1132	c.905A>G	c.(904-906)tAc>tGc	p.Y302C	ANXA6_ENST00000521512.1_Missense_Mutation_p.Y95C|ANXA6_ENST00000356496.5_Missense_Mutation_p.Y302C|ANXA6_ENST00000523714.1_Missense_Mutation_p.Y270C|ANXA6_ENST00000377751.5_Intron	NM_001155.4	NP_001146.2	P08133	ANXA6_HUMAN	annexin A6	302					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|protein homooligomerization (GO:0051260)|regulation of muscle contraction (GO:0006937)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|cholesterol binding (GO:0015485)|GTP binding (GO:0005525)|ligand-gated ion channel activity (GO:0015276)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|lung(9)	12		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GATCATGCTGTAGAGGGACTT	0.527																																						dbGAP											0													63.0	62.0	62.0					5																	150508981		2000	4174	6174	-	-	-	SO:0001583	missense	0			J03578	CCDS47315.1, CCDS54941.1	5q33.1	2008-02-05			ENSG00000197043	ENSG00000197043		"""Annexins"""	544	protein-coding gene	gene with protein product		114070		ANX6		3258820	Standard	NM_001155		Approved		uc003ltl.2	P08133	OTTHUMG00000164179	ENST00000354546.5:c.905A>G	5.37:g.150508981T>C	ENSP00000346550:p.Tyr302Cys		B7Z8A7|D3DQH4|E9PGK1|Q6ZT79	Missense_Mutation	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinVI,prints_AnnexinIV	p.Y302C	ENST00000354546.5	37	c.905	CCDS47315.1	5	.	.	.	.	.	.	.	.	.	.	T	18.24	3.579575	0.65992	.	.	ENSG00000197043	ENST00000354546;ENST00000523714;ENST00000356496;ENST00000521512;ENST00000540153	T;T;T;T	0.03330	3.97;3.97;3.97;3.97	4.95	3.71	0.42584	Annexin repeat, conserved site (1);	0.382752	0.30168	N	0.010254	T	0.14442	0.0349	M	0.82056	2.57	0.50467	D	0.999876	D;D;D	0.67145	0.996;0.994;0.989	D;P;P	0.67231	0.95;0.805;0.805	T	0.00316	-1.1823	10	0.48119	T	0.1	.	8.2767	0.31877	0.2963:0.0:0.0:0.7037	.	95;302;302	E5RK69;A6NN80;P08133	.;.;ANXA6_HUMAN	C	302;270;302;95;176	ENSP00000346550:Y302C;ENSP00000430517:Y270C;ENSP00000348889:Y302C;ENSP00000430420:Y95C	ENSP00000346550:Y302C	Y	-	2	0	ANXA6	150489174	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.570000	0.53834	1.865000	0.54081	0.418000	0.28097	TAC	ANXA6	-	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat	ENSG00000197043		0.527	ANXA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANXA6	HGNC	protein_coding	OTTHUMT00000377668.2	52	0.00	0	T	NM_001155		150508981	150508981	-1	no_errors	ENST00000354546	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	1.000	C
APH1A	51107	genome.wustl.edu	37	1	150240461	150240461	+	Silent	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr1:150240461G>T	ENST00000369109.3	-	2	368	c.180C>A	c.(178-180)acC>acA	p.T60T	C1orf54_ENST00000369102.1_5'Flank|APH1A_ENST00000360244.4_Silent_p.T60T|APH1A_ENST00000414276.2_Intron|APH1A_ENST00000461320.1_Intron	NM_001077628.2	NP_001071096.1	Q96BI3	APH1A_HUMAN	APH1A gamma secretase subunit	60					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|metanephros development (GO:0001656)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			breast(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	9	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGACCGGTCGGTCACATGGA	0.552																																						dbGAP											0													58.0	65.0	62.0					1																	150240461		1978	4143	6121	-	-	-	SO:0001819	synonymous_variant	0			AF151835	CCDS41390.1, CCDS41391.1, CCDS58025.1	1q21.2	2013-05-01	2013-05-01		ENSG00000117362	ENSG00000117362			29509	protein-coding gene	gene with protein product		607629	"""anterior pharynx defective 1 homolog A (C. elegans)"""			10810093, 12110170	Standard	NM_001077628		Approved	APH-1A, CGI-78	uc001ety.2	Q96BI3	OTTHUMG00000012545	ENST00000369109.3:c.180C>A	1.37:g.150240461G>T			B4DQK0|Q5TB22|Q5TB23|Q969R6|Q9BVG0|Q9Y386	Silent	SNP	pfam_Aph-1	p.T60	ENST00000369109.3	37	c.180	CCDS41390.1	1																																																																																			APH1A	-	pfam_Aph-1	ENSG00000117362		0.552	APH1A-002	KNOWN	basic|CCDS	protein_coding	APH1A	HGNC	protein_coding	OTTHUMT00000035048.1	24	0.00	0	G	NM_016022		150240461	150240461	-1	no_errors	ENST00000369109	ensembl	human	known	69_37n	silent	13	38.10	8	SNP	0.958	T
ATL3	25923	genome.wustl.edu	37	11	63420031	63420031	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr11:63420031A>T	ENST00000398868.3	-	4	698	c.422T>A	c.(421-423)aTg>aAg	p.M141K	RP11-697H9.2_ENST00000540307.1_RNA|ATL3_ENST00000332645.4_Missense_Mutation_p.M168K|ATL3_ENST00000538786.1_Missense_Mutation_p.M123K	NM_015459.3	NP_056274.3	Q6DD88	ATLA3_HUMAN	atlastin GTPase 3	141	GB1/RHD3-type G.				endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	11						CTGGGTATCCATCAGAACAAC	0.383																																						dbGAP											0													82.0	76.0	78.0					11																	63420031		1864	4115	5979	-	-	-	SO:0001583	missense	0				CCDS41663.1, CCDS73309.1	11q13.1	2008-09-17			ENSG00000184743	ENSG00000184743			24526	protein-coding gene	gene with protein product		609369				18270207	Standard	XM_005273891		Approved	DKFZP564J0863	uc001nxk.1	Q6DD88	OTTHUMG00000167854	ENST00000398868.3:c.422T>A	11.37:g.63420031A>T	ENSP00000381844:p.Met141Lys		Q8N7W5|Q9H8Q5|Q9UFL1	Missense_Mutation	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	p.M168K	ENST00000398868.3	37	c.503	CCDS41663.1	11	.	.	.	.	.	.	.	.	.	.	A	23.8	4.454662	0.84209	.	.	ENSG00000184743	ENST00000398868;ENST00000332645;ENST00000538786	T;T;T	0.76060	-0.99;-0.99;-0.99	5.14	5.14	0.70334	Guanylate-binding protein, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87470	0.6185	M	0.89287	3.02	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	D	0.89748	0.3938	10	0.87932	D	0	-10.1285	13.2036	0.59782	1.0:0.0:0.0:0.0	.	141	Q6DD88	ATLA3_HUMAN	K	141;168;123	ENSP00000381844:M141K;ENSP00000329034:M168K;ENSP00000437593:M123K	ENSP00000329034:M168K	M	-	2	0	ATL3	63176607	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.870000	0.92336	2.048000	0.60808	0.533000	0.62120	ATG	ATL3	-	pfam_Guanylate-bd_N	ENSG00000184743		0.383	ATL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATL3	HGNC	protein_coding	OTTHUMT00000396637.1	66	0.00	0	A	NM_015459		63420031	63420031	-1	no_errors	ENST00000332645	ensembl	human	known	69_37n	missense	25	30.56	11	SNP	1.000	T
BCKDK	10295	genome.wustl.edu	37	16	31121625	31121625	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr16:31121625G>A	ENST00000394951.1	+	7	1146	c.523G>A	c.(523-525)Gag>Aag	p.E175K	BCKDK_ENST00000219794.6_Missense_Mutation_p.E175K|BCKDK_ENST00000394950.3_Missense_Mutation_p.E175K|AC135050.1_ENST00000517000.2_RNA|BCKDK_ENST00000287507.3_Missense_Mutation_p.E175K			O14874	BCKD_HUMAN	branched chain ketoacid dehydrogenase kinase	175	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				branched-chain amino acid catabolic process (GO:0009083)|cellular amino acid catabolic process (GO:0009063)|phosphorylation (GO:0016310)|protein phosphorylation (GO:0006468)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrion (GO:0005739)	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity (GO:0047323)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|stomach(1)	2						GGGCCTACGTGAGAGCCGGAA	0.617																																						dbGAP											0													61.0	63.0	62.0					16																	31121625		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF026548	CCDS10705.1, CCDS45467.1, CCDS61917.1	16p11.2	2008-05-14			ENSG00000103507	ENSG00000103507			16902	protein-coding gene	gene with protein product		614901				1889817	Standard	NM_005881		Approved		uc002eaw.5	O14874	OTTHUMG00000047356	ENST00000394951.1:c.523G>A	16.37:g.31121625G>A	ENSP00000378405:p.Glu175Lys		A8MY43|Q6FGL4|Q96G95|Q96IN5	Missense_Mutation	SNP	pfam_BCDHK/PDK_N,pfam_ATPase-like_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core,prints_Sig_transdc_His_kin-like_C	p.E175K	ENST00000394951.1	37	c.523	CCDS10705.1	16	.	.	.	.	.	.	.	.	.	.	G	34	5.409352	0.96072	.	.	ENSG00000103507	ENST00000394951;ENST00000219794;ENST00000394950;ENST00000287507	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	5.45	5.45	0.79879	Branched-chain alpha-ketoacid dehydrogenase kinase/Pyruvate dehydrogenase kinase, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.72803	0.3506	M	0.90019	3.08	0.80722	D	1	D;D	0.61080	0.989;0.989	P;P	0.60117	0.869;0.869	T	0.78976	-0.1991	10	0.87932	D	0	-17.393	18.4154	0.90568	0.0:0.0:1.0:0.0	.	175;175	Q96G95;O14874	.;BCKD_HUMAN	K	175	ENSP00000378405:E175K;ENSP00000219794:E175K;ENSP00000378404:E175K;ENSP00000287507:E175K	ENSP00000219794:E175K	E	+	1	0	BCKDK	31029126	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.571000	0.90752	2.720000	0.93068	0.655000	0.94253	GAG	BCKDK	-	pfam_BCDHK/PDK_N,superfamily_BCDHK/PDK_N	ENSG00000103507		0.617	BCKDK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BCKDK	HGNC	protein_coding	OTTHUMT00000108514.1	35	0.00	0	G	NM_005881		31121625	31121625	+1	no_errors	ENST00000219794	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	1.000	A
BTK	695	genome.wustl.edu	37	X	100629586	100629586	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chrX:100629586T>C	ENST00000308731.7	-	3	341	c.178A>G	c.(178-180)Aag>Gag	p.K60E	BTK_ENST00000464567.1_5'UTR|BTK_ENST00000372880.1_Missense_Mutation_p.K60E	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	60	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						CAAGTGATCTTCTCAACATCT	0.408									Agammaglobulinemia, X-linked																													dbGAP											0													239.0	225.0	230.0					X																	100629586		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Bruton Type Agammaglobulinemia	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.178A>G	X.37:g.100629586T>C	ENSP00000308176:p.Lys60Glu		B2RAW1|Q32ML5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif	p.K60E	ENST00000308731.7	37	c.178	CCDS14482.1	X	.	.	.	.	.	.	.	.	.	.	T	17.78	3.473202	0.63737	.	.	ENSG00000010671	ENST00000372880;ENST00000308731	T;T	0.75260	-0.92;-0.92	6.08	6.08	0.98989	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.76962	0.4061	L	0.46157	1.445	0.80722	D	1	P;B;B	0.36577	0.558;0.042;0.027	P;B;B	0.47645	0.553;0.229;0.095	T	0.77773	-0.2462	10	0.56958	D	0.05	.	13.8045	0.63223	0.0:0.0:0.0:1.0	.	60;60;60	Q5JY90;B2RAW1;Q06187	.;.;BTK_HUMAN	E	60	ENSP00000361971:K60E;ENSP00000308176:K60E	ENSP00000308176:K60E	K	-	1	0	BTK	100516242	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.883000	0.69721	2.058000	0.61347	0.486000	0.48141	AAG	BTK	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000010671		0.408	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	HGNC	protein_coding	OTTHUMT00000057532.2	116	0.00	0	T	NM_000061		100629586	100629586	-1	no_errors	ENST00000308731	ensembl	human	known	69_37n	missense	32	46.67	28	SNP	1.000	C
CCDC144B	284047	genome.wustl.edu	37	17	18498077	18498077	+	RNA	SNP	C	C	G			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr17:18498077C>G	ENST00000442583.1	-	0	881							Q3MJ40	C144B_HUMAN	coiled-coil domain containing 144B (pseudogene)											NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(6)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	36						ACATAAAATTCTCATAAACAG	0.388																																						dbGAP											0													24.0	41.0	36.0					17																	18498077		1784	4035	5819	-	-	-			0			AK093811		17p11.2	2012-11-19	2011-09-02		ENSG00000154874	ENSG00000154874			26704	pseudogene	pseudogene			"""coiled-coil domain containing 144B"""			11997339	Standard	NR_036647		Approved	FLJ36492	uc002guc.2	Q3MJ40	OTTHUMG00000059531		17.37:g.18498077C>G			Q6P5Q3|Q8N200	RNA	SNP	-	NULL	ENST00000442583.1	37	NULL		17																																																																																			CCDC144B	-	-	ENSG00000154874		0.388	CCDC144B-006	KNOWN	basic	processed_transcript	CCDC144B	HGNC	pseudogene	OTTHUMT00000132102.1	73	0.00	0	C	NM_182568		18498077	18498077	-1	no_errors	ENST00000425214	ensembl	human	known	69_37n	rna	7	84.78	39	SNP	0.063	G
CCDC39	339829	genome.wustl.edu	37	3	180334625	180334625	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr3:180334625C>A	ENST00000442201.2	-	17	2514	c.2395G>T	c.(2395-2397)Gtg>Ttg	p.V799L	CCDC39_ENST00000273654.4_3'UTR|TTC14_ENST00000382584.4_Intron	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	799					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TGTTTGGTCACTCTTTCTAAT	0.313																																						dbGAP											0													171.0	152.0	158.0					3																	180334625		1816	4067	5883	-	-	-	SO:0001583	missense	0			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.2395G>T	3.37:g.180334625C>A	ENSP00000405708:p.Val799Leu		B4E2H1	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.V799L	ENST00000442201.2	37	c.2395	CCDS46964.1	3	.	.	.	.	.	.	.	.	.	.	C	14.75	2.629380	0.46944	.	.	ENSG00000145075	ENST00000442201	T	0.76709	-1.04	4.96	4.07	0.47477	.	.	.	.	.	T	0.75332	0.3835	L	0.57536	1.79	0.80722	D	1	P	0.51449	0.945	P	0.46339	0.513	T	0.72187	-0.4366	9	0.15952	T	0.53	.	13.8509	0.63496	0.0:0.9252:0.0:0.0748	.	799	Q9UFE4	CCD39_HUMAN	L	799	ENSP00000405708:V799L	ENSP00000405708:V799L	V	-	1	0	CCDC39	181817319	1.000000	0.71417	0.998000	0.56505	0.717000	0.41224	3.178000	0.50879	1.278000	0.44430	0.460000	0.39030	GTG	CCDC39	-	NULL	ENSG00000145075		0.313	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC39	HGNC	protein_coding	OTTHUMT00000349783.3	186	0.00	0	C	XM_291028		180334625	180334625	-1	no_errors	ENST00000442201	ensembl	human	known	69_37n	missense	55	39.78	37	SNP	1.000	A
CCT3	7203	genome.wustl.edu	37	1	156287325	156287325	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr1:156287325A>C	ENST00000295688.3	-	9	1053	c.773T>G	c.(772-774)aTt>aGt	p.I258S	CCT3_ENST00000368261.3_Missense_Mutation_p.I213S|CCT3_ENST00000368259.2_Missense_Mutation_p.I220S|CCT3_ENST00000472765.2_Missense_Mutation_p.I213S	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	258					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					CTCTCGTGTAATCTCAATGTC	0.463																																						dbGAP											0													190.0	187.0	188.0					1																	156287325		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.773T>G	1.37:g.156287325A>C	ENSP00000295688:p.Ile258Ser		A6NE14|Q5SZY1|Q9BR64	Splice_Site	SNP	-	NULL	ENST00000295688.3	37	c.NULL	CCDS1140.2	1	.	.	.	.	.	.	.	.	.	.	A	28.4	4.918896	0.92249	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765	T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39	6.15	6.15	0.99193	.	0.000000	0.85682	D	0.000000	D	0.90817	0.7116	H	0.94542	3.55	0.80722	D	1	D;D;P	0.76494	0.999;0.963;0.92	D;P;P	0.66351	0.943;0.774;0.727	D	0.93159	0.6556	10	0.87932	D	0	-17.1236	14.7406	0.69451	1.0:0.0:0.0:0.0	.	220;257;258	P49368-2;E9PAQ6;P49368	.;.;TCPG_HUMAN	S	258;220;213;213	ENSP00000295688:I258S;ENSP00000357242:I220S;ENSP00000357244:I213S;ENSP00000431543:I213S	ENSP00000295688:I258S	I	-	2	0	CCT3	154553949	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.296000	0.96104	2.363000	0.80096	0.523000	0.50628	ATT	CCT3	-	-	ENSG00000163468		0.463	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT3	HGNC	protein_coding	OTTHUMT00000060602.3	69	0.00	0	A	NM_005998		156287325	156287325	-1	no_errors	ENST00000480049	ensembl	human	known	69_37n	splice_site	30	42.31	22	SNP	1.000	C
CEP152	22995	genome.wustl.edu	37	15	49059319	49059320	+	Nonsense_Mutation	DNP	TC	TC	AA			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	T|C	T|C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr15:49059319_49059320TC>AA	ENST00000380950.2	-	17	2404_2405	c.2217_2218GA>TT	c.(2215-2220)gaGAag>gaTTag	p.739_740EK>D*	CEP152_ENST00000325747.5_Nonsense_Mutation_p.646_647EK>D*|CEP152_ENST00000559398.1_5'Flank|CEP152_ENST00000399334.3_Nonsense_Mutation_p.739_740EK>D*	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	739					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		AGATTATCCTTCTCTCTGCACA	0.416																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.2217_2218delinsAA	15.37:g.49059319_49059320delinsAA	ENSP00000370337:p.E739_K740delinsD*		E7ER66|Q17RV1|Q6NTA0	Nonsense_Mutation|Missense_Mutation	SNP	NULL	p.K740*|p.E739D	ENST00000380950.2	37	c.2218|c.2217	CCDS58361.1	15																																																																																			CEP152	-	NULL	ENSG00000103995		0.416	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP152	HGNC	protein_coding	OTTHUMT00000417365.1	62|61	0.00	0	T|C	NM_014985		49059319|49059320	49059319|49059320	-1	no_errors	ENST00000380950	ensembl	human	known	69_37n	nonsense|missense	31	36.73	18	SNP	1.000	A
CHN2	1124	genome.wustl.edu	37	7	29440430	29440430	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr7:29440430A>G	ENST00000222792.6	+	6	1092	c.562A>G	c.(562-564)Aca>Gca	p.T188A	CHN2_ENST00000539389.1_Intron|CHN2_ENST00000495789.2_Missense_Mutation_p.T201A|CHN2_ENST00000539406.1_Missense_Mutation_p.T263A|CHN2_ENST00000435288.2_Intron|CHN2_ENST00000546235.1_Missense_Mutation_p.T173A	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2	188					positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						TGAAGAACACACAGCGGTGGA	0.448																																					Ovarian(1;44 48 13232 18918 31480)	dbGAP											0													50.0	46.0	47.0					7																	29440430		2203	4300	6503	-	-	-	SO:0001583	missense	0			L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.562A>G	7.37:g.29440430A>G	ENSP00000222792:p.Thr188Ala		A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SH2,superfamily_Rho_GTPase_activation_prot,smart_SH2,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_SH2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_DAG/PE-bd	p.T263A	ENST00000222792.6	37	c.787	CCDS5420.1	7	.	.	.	.	.	.	.	.	.	.	A	9.676	1.147917	0.21288	.	.	ENSG00000106069	ENST00000539406;ENST00000222792;ENST00000495789;ENST00000546235;ENST00000446446	T;T;T;T;D	0.86694	-0.58;-0.48;-0.49;-0.48;-2.16	6.17	-4.58	0.03410	.	1.136120	0.06173	N	0.678002	T	0.65842	0.2730	N	0.08118	0	0.23795	N	0.996823	B;B;B;B;B	0.06786	0.001;0.0;0.001;0.0;0.0	B;B;B;B;B	0.08055	0.002;0.0;0.003;0.0;0.001	T	0.57365	-0.7824	10	0.08381	T	0.77	.	3.103	0.06333	0.3825:0.2951:0.0587:0.2638	.	173;201;263;188;188	B7Z1W9;B7Z1V0;F5H003;A4D1A2;P52757	.;.;.;.;CHIO_HUMAN	A	263;188;201;173;39	ENSP00000444063:T263A;ENSP00000222792:T188A;ENSP00000438587:T201A;ENSP00000442812:T173A;ENSP00000396867:T39A	ENSP00000222792:T188A	T	+	1	0	CHN2	29406955	0.026000	0.19158	0.076000	0.20297	0.041000	0.13682	0.094000	0.15107	-0.341000	0.08376	0.533000	0.62120	ACA	CHN2	-	NULL	ENSG00000106069		0.448	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHN2	HGNC	protein_coding	OTTHUMT00000214228.2	33	0.00	0	A	NM_004067		29440430	29440430	+1	no_errors	ENST00000539406	ensembl	human	known	69_37n	missense	19	26.92	7	SNP	0.010	G
CHRM3	1131	genome.wustl.edu	37	1	240072278	240072278	+	Silent	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr1:240072278C>A	ENST00000255380.4	+	5	2306	c.1527C>A	c.(1525-1527)atC>atA	p.I509I		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	509	Agonist binding. {ECO:0000250}.				cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CATACAACATCATGGTTCTGG	0.512																																						dbGAP											0													159.0	136.0	144.0					1																	240072278		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1527C>A	1.37:g.240072278C>A			Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Musac_M3_rcpt,prints_Musac_rcpt,prints_7TM_GPCR_Rhodpsn	p.I509	ENST00000255380.4	37	c.1527	CCDS1616.1	1																																																																																			CHRM3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000133019		0.512	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM3	HGNC	protein_coding	OTTHUMT00000095644.2	47	0.00	0	C	NM_000740		240072278	240072278	+1	no_errors	ENST00000255380	ensembl	human	known	69_37n	silent	28	15.15	5	SNP	1.000	A
CNGA3	1261	genome.wustl.edu	37	2	99013589	99013589	+	Silent	SNP	C	C	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr2:99013589C>T	ENST00000272602.2	+	7	1995	c.1956C>T	c.(1954-1956)aaC>aaT	p.N652N	CNGA3_ENST00000409937.1_Silent_p.N656N|CNGA3_ENST00000436404.2_Silent_p.N634N|CNGA3_ENST00000393504.1_Silent_p.N652N			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	652					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						CTGAGTACAACGCCACCCAGA	0.627																																						dbGAP											0													40.0	39.0	39.0					2																	99013589		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1956C>T	2.37:g.99013589C>T			E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Silent	SNP	pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.N652	ENST00000272602.2	37	c.1956	CCDS2034.1	2																																																																																			CNGA3	-	NULL	ENSG00000144191		0.627	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGA3	HGNC	protein_coding	OTTHUMT00000252986.1	22	0.00	0	C	NM_001298		99013589	99013589	+1	no_errors	ENST00000272602	ensembl	human	known	69_37n	silent	4	71.43	10	SNP	0.000	T
COL1A2	1278	genome.wustl.edu	37	7	94057753	94057753	+	Silent	SNP	C	C	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr7:94057753C>T	ENST00000297268.6	+	50	4146	c.3675C>T	c.(3673-3675)caC>caT	p.H1225H		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	1225	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	ACAAGAAACACGTCTGGCTAG	0.453										HNSCC(75;0.22)																												dbGAP											0													74.0	75.0	74.0					7																	94057753		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.3675C>T	7.37:g.94057753C>T			P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_Fibrinogen_a/b/g_C,smart_Fib_collagen_C	p.H1225	ENST00000297268.6	37	c.3675	CCDS34682.1	7																																																																																			COL1A2	-	pfam_Fib_collagen_C,smart_Fib_collagen_C	ENSG00000164692		0.453	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A2	HGNC	protein_coding	OTTHUMT00000309045.2	49	0.00	0	C	NM_000089		94057753	94057753	+1	no_errors	ENST00000297268	ensembl	human	known	69_37n	silent	31	20.51	8	SNP	0.861	T
COMP	1311	genome.wustl.edu	37	19	18897364	18897364	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr19:18897364G>A	ENST00000222271.2	-	11	1276	c.1232C>T	c.(1231-1233)cCc>cTc	p.P411L	COMP_ENST00000425807.1_Missense_Mutation_p.P358L|COMP_ENST00000542601.2_Missense_Mutation_p.P378L	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	411					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)			breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						GCTCTTCTGGGGACAGTTGTC	0.597																																						dbGAP											0													150.0	112.0	125.0					19																	18897364		2203	4300	6503	-	-	-	SO:0001583	missense	0			L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.1232C>T	19.37:g.18897364G>A	ENSP00000222271:p.Pro411Leu		B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Missense_Mutation	SNP	pfam_Thrombospondin_C,pfam_EGF-like_Ca-bd,pfam_Thbs/COMP_coiled-coil,pfam_Thrombospondin_3-like_rpt,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.P411L	ENST00000222271.2	37	c.1232	CCDS12385.1	19	.	.	.	.	.	.	.	.	.	.	G	21.6	4.169989	0.78452	.	.	ENSG00000105664	ENST00000542601;ENST00000222271;ENST00000425807;ENST00000454701	D;D;D	0.99382	-5.8;-5.8;-5.8	3.14	3.14	0.36123	.	0.000000	0.64402	U	0.000001	D	0.99254	0.9740	M	0.84585	2.705	0.80722	D	1	D;D	0.76494	0.997;0.999	D;P	0.63877	0.919;0.883	D	0.98710	1.0704	10	0.62326	D	0.03	-11.9474	12.9555	0.58425	0.0:0.0:1.0:0.0	.	358;411	B4DKJ3;P49747	.;COMP_HUMAN	L	378;411;358;398	ENSP00000439156:P378L;ENSP00000222271:P411L;ENSP00000403792:P358L	ENSP00000222271:P411L	P	-	2	0	COMP	18758364	1.000000	0.71417	0.997000	0.53966	0.837000	0.47467	9.378000	0.97191	1.609000	0.50190	0.313000	0.20887	CCC	COMP	-	pfam_Thrombospondin_3-like_rpt	ENSG00000105664		0.597	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COMP	HGNC	protein_coding	OTTHUMT00000403457.1	61	0.00	0	G	NM_000095		18897364	18897364	-1	no_errors	ENST00000222271	ensembl	human	known	69_37n	missense	24	38.46	15	SNP	0.998	A
COQ3	51805	genome.wustl.edu	37	6	99842022	99842022	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr6:99842022C>A	ENST00000254759.3	-	1	58	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	COQ3_ENST00000369242.1_5'UTR|COQ3_ENST00000479163.1_5'UTR	NM_017421.3	NP_059117.3	Q9NZJ6	COQ3_HUMAN	coenzyme Q3 methyltransferase	12					glycerol metabolic process (GO:0006071)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	2-polyprenyl-6-methoxy-1,4-benzoquinone methyltransferase activity (GO:0008425)|3-demethylubiquinone-9 3-O-methyltransferase activity (GO:0008689)|hexaprenyldihydroxybenzoate methyltransferase activity (GO:0004395)|O-methyltransferase activity (GO:0008171)			cervix(1)|lung(5)|upper_aerodigestive_tract(2)	8		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0625)		AAAAACCAACCCCCGGAGGAG	0.562																																						dbGAP											0													52.0	54.0	53.0					6																	99842022		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF193016	CCDS5042.1	6q21	2013-05-01	2013-05-01		ENSG00000132423	ENSG00000132423	2.1.1.114		18175	protein-coding gene	gene with protein product	"""polyprenyldihydroxybenzoate methyltransferase"""	605196	"""coenzyme Q3 homolog, methyltransferase (yeast)"", ""coenzyme Q3 homolog, methyltransferase (S. cerevisiae)"""			10777520	Standard	NM_017421		Approved	bA9819.1	uc003ppk.3	Q9NZJ6	OTTHUMG00000015264	ENST00000254759.3:c.34G>T	6.37:g.99842022C>A	ENSP00000254759:p.Gly12Cys		B3KPX0|Q5T061|Q6P4F0|Q8IXG6|Q96BG1|Q9H0N1	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_Methyltransf_12,pfam_Mycolic_cyclopropane_synthase,pfam_UbiE/COQ5_MeTrFase,pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_SAM-MeTfrase_NodS-related,tigrfam_UbiG_MeTrfase	p.G12C	ENST00000254759.3	37	c.34	CCDS5042.1	6	.	.	.	.	.	.	.	.	.	.	C	13.79	2.342387	0.41498	.	.	ENSG00000132423	ENST00000254759	T	0.24538	1.85	4.09	-2.12	0.07165	.	1.586590	0.03595	N	0.232446	T	0.03783	0.0107	N	0.08118	0	0.20196	N	0.999925	B	0.10296	0.003	B	0.06405	0.002	T	0.36016	-0.9765	10	0.51188	T	0.08	-14.4815	4.154	0.10251	0.1588:0.3744:0.0:0.4667	.	12	Q9NZJ6	COQ3_HUMAN	C	12	ENSP00000254759:G12C	ENSP00000254759:G12C	G	-	1	0	COQ3	99948743	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.921000	0.04008	-0.434000	0.07275	0.561000	0.74099	GGT	COQ3	-	NULL	ENSG00000132423		0.562	COQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ3	HGNC	protein_coding	OTTHUMT00000041602.1	30	0.00	0	C	NM_017421		99842022	99842022	-1	no_errors	ENST00000254759	ensembl	human	known	69_37n	missense	10	44.44	8	SNP	0.000	A
CTAGE5	4253	genome.wustl.edu	37	14	39818099	39818099	+	Silent	SNP	T	T	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr14:39818099T>A	ENST00000280083.3	+	23	2480	c.2166T>A	c.(2164-2166)ccT>ccA	p.P722P	CTAGE5_ENST00000556148.1_Silent_p.P647P|CTAGE5_ENST00000396165.4_Silent_p.P693P|RP11-407N17.3_ENST00000553728.1_Silent_p.P1257P|CTAGE5_ENST00000341749.3_Silent_p.P710P|CTAGE5_ENST00000341502.5_Silent_p.P722P|CTAGE5_ENST00000348007.3_Silent_p.P679P|CTAGE5_ENST00000396158.2_Silent_p.P727P|CTAGE5_ENST00000553383.1_3'UTR|RP11-407N17.3_ENST00000603904.1_Silent_p.P693P|CTAGE5_ENST00000557038.1_Silent_p.P642P|CTAGE5_ENST00000553352.1_Silent_p.P693P			O15320	CTGE5_HUMAN	CTAGE family, member 5	722	Pro-rich.				positive regulation of catalytic activity (GO:0043085)	membrane (GO:0016020)	enzyme activator activity (GO:0008047)		CTAGE5/SIP1(2)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		TCCCCCCACCTCCTCCAGGAG	0.502																																						dbGAP											0													93.0	100.0	98.0					14																	39818099		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U94780	CCDS9673.1, CCDS9674.1, CCDS9675.1, CCDS9676.1, CCDS58316.1, CCDS58317.1	14q21.1	2009-09-11	2004-08-24	2004-08-26	ENSG00000150527	ENSG00000150527			7057	protein-coding gene	gene with protein product		602132	"""meningioma expressed antigen 6 (coiled-coil proline-rich)"""	MGEA, MGEA6		9356211, 11149944	Standard	NM_203355		Approved	MEA6, cTAGE-5A, cTAGE-5B, cTAGE-5C, cTAGE-5D, MGEA11	uc001wvi.4	O15320	OTTHUMG00000140258	ENST00000280083.3:c.2166T>A	14.37:g.39818099T>A			B3KRA6|B4DQS6|D3DSA6|G3XAC5|O00169|Q6MZN2|Q6P2R8|Q86TF6|Q8IX92|Q8IX93	Silent	SNP	NULL	p.P727	ENST00000280083.3	37	c.2181	CCDS9674.1	14																																																																																			CTAGE5	-	NULL	ENSG00000150527		0.502	CTAGE5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CTAGE5	HGNC	protein_coding	OTTHUMT00000276771.2	36	0.00	0	T	NM_005930		39818099	39818099	+1	no_errors	ENST00000396158	ensembl	human	known	69_37n	silent	28	21.95	9	SNP	0.922	A
RNF166	115992	genome.wustl.edu	37	16	88773618	88773618	+	5'Flank	SNP	G	G	T	rs201342028		TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr16:88773618G>T	ENST00000312838.4	-	0	0				CTU2_ENST00000453996.2_Splice_Site_p.R48M|CTU2_ENST00000567949.1_Splice_Site_p.R48M|CTU2_ENST00000378384.3_5'UTR|RNF166_ENST00000567844.1_5'Flank|CTU2_ENST00000312060.5_Splice_Site_p.R48M	NM_178841.3	NP_849163.1	Q96A37	RN166_HUMAN	ring finger protein 166								zinc ion binding (GO:0008270)			endometrium(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0476)		GCCTTCTGCAGGTGAGGCCTG	0.537																																						dbGAP											0													122.0	95.0	104.0					16																	88773618		2198	4300	6498	-	-	-	SO:0001631	upstream_gene_variant	0			AK057106	CCDS10969.1, CCDS54056.1, CCDS54057.1	16q24.3	2013-01-09			ENSG00000158717	ENSG00000158717		"""RING-type (C3HC4) zinc fingers"""	28856	protein-coding gene	gene with protein product						12477932	Standard	NM_178841		Approved	MGC2647, MGC14381	uc002flk.3	Q96A37	OTTHUMG00000137863		16.37:g.88773618G>T	Exception_encountered		B3KQ03|D3DX75|H3BTU8|Q96DM0	Missense_Mutation	SNP	pfam_Thiouridylase_cyt_su2	p.R48M	ENST00000312838.4	37	c.143	CCDS10969.1	16	.	.	.	.	.	.	.	.	.	.	G	21.8	4.197399	0.79015	.	.	ENSG00000174177	ENST00000312060;ENST00000453996	T;T	0.51325	0.71;0.71	4.21	2.2	0.27929	.	0.116521	0.64402	U	0.000019	T	0.61451	0.2348	M	0.77313	2.365	0.80722	D	1	D;D	0.76494	0.999;0.992	D;P	0.65443	0.935;0.77	T	0.64037	-0.6501	10	0.66056	D	0.02	.	7.0384	0.25006	0.343:0.0:0.657:0.0	.	48;48	Q2VPK5-5;Q2VPK5	.;CTU2_HUMAN	M	48	ENSP00000308617:R48M;ENSP00000388320:R48M	ENSP00000308617:R48M	R	+	2	0	CTU2	87301119	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.165000	0.58196	1.889000	0.54706	0.655000	0.94253	AGG	CTU2	-	NULL	ENSG00000174177		0.537	RNF166-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTU2	HGNC	protein_coding	OTTHUMT00000269544.1	84	0.00	0	G	NM_178841		88773618	88773618	+1	no_errors	ENST00000567949	ensembl	human	known	69_37n	missense	21	48.78	20	SNP	1.000	T
DENND4B	9909	genome.wustl.edu	37	1	153915527	153915527	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr1:153915527G>T	ENST00000361217.4	-	3	815	c.397C>A	c.(397-399)Ctg>Atg	p.L133M		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	133	MABP. {ECO:0000255|PROSITE- ProRule:PRU00831}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGAGGGGCCAGGTTTGCTGAG	0.632																																						dbGAP											0													63.0	74.0	71.0					1																	153915527		1959	4142	6101	-	-	-	SO:0001583	missense	0			AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.397C>A	1.37:g.153915527G>T	ENSP00000354597:p.Leu133Met		Q5T4K0	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.L133M	ENST00000361217.4	37	c.397	CCDS44228.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.98|17.98	3.520986|3.520986	0.64747|0.64747	.|.	.|.	ENSG00000198837|ENSG00000198837	ENST00000361217;ENST00000368646|ENST00000472932	T;T|.	0.24350|.	1.86;1.86|.	4.69|4.69	3.78|3.78	0.43462|0.43462	MABP domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.52008|0.52008	0.1708|0.1708	L|L	0.61218|0.61218	1.895|1.895	0.46954|0.46954	D|D	0.999264|0.999264	D|.	0.76494|.	0.999|.	D|.	0.66716|.	0.946|.	T|T	0.53056|0.53056	-0.8492|-0.8492	9|5	0.72032|.	D|.	0.01|.	-3.5699|-3.5699	11.7141|11.7141	0.51641|0.51641	0.088:0.0:0.9119:0.0|0.088:0.0:0.9119:0.0	.|.	133|.	O75064|.	DEN4B_HUMAN|.	M|H	133;144|38	ENSP00000354597:L133M;ENSP00000357635:L144M|.	ENSP00000354597:L133M|.	L|P	-|-	1|2	2|0	DENND4B|DENND4B	152182151|152182151	0.994000|0.994000	0.37717|0.37717	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	0.249000|0.249000	0.18216|0.18216	1.170000|1.170000	0.42753|0.42753	0.563000|0.563000	0.77884|0.77884	CTG|CCT	DENND4B	-	pfscan_uDENN_dom	ENSG00000198837		0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4B	HGNC	protein_coding	OTTHUMT00000090278.2	53	0.00	0	G	XM_375806		153915527	153915527	-1	no_errors	ENST00000361217	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	1.000	T
DGCR8	54487	genome.wustl.edu	37	22	20074049	20074049	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr22:20074049T>G	ENST00000351989.3	+	2	992	c.563T>G	c.(562-564)cTg>cGg	p.L188R	DGCR8_ENST00000407755.1_Missense_Mutation_p.L188R|MIR1306_ENST00000408439.1_RNA|DGCR8_ENST00000383024.2_Missense_Mutation_p.L188R|MIR3618_ENST00000580330.1_RNA	NM_022720.6	NP_073557.3	Q8WYQ5	DGCR8_HUMAN	DGCR8 microprocessor complex subunit	188	Necessary for interaction with NCL.|Necessary for nuclear localization and retention.				gene expression (GO:0010467)|primary miRNA processing (GO:0031053)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			NS(2)|breast(1)|endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	Colorectal(54;0.0993)					GAGAATGAGCTGGATCAGGAA	0.517																																						dbGAP											0													139.0	136.0	137.0					22																	20074049		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF165527, AB050770	CCDS13773.1, CCDS54501.1	22q11.2	2013-05-02	2013-05-02		ENSG00000128191	ENSG00000128191			2847	protein-coding gene	gene with protein product		609030	"""chromosome 22 open reading frame 12"", ""DiGeorge syndrome critical region gene 8"""	C22orf12		21454614	Standard	NM_001190326		Approved	DGCRK6, Gy1, pasha	uc002zri.3	Q8WYQ5	OTTHUMG00000150503	ENST00000351989.3:c.563T>G	22.37:g.20074049T>G	ENSP00000263209:p.Leu188Arg		B2R8G1|Q6DCB2|Q6MZE9|Q6Y2L0|Q96G39|Q96GP8|Q9H6L8|Q9H6T7|Q9NRW2	Missense_Mutation	SNP	pfam_Ds-RNA-bd,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_Ds-RNA-bd,pfscan_WW_Rsp5_WWP,pfscan_Ds-RNA-bd	p.L188R	ENST00000351989.3	37	c.563	CCDS13773.1	22	.	.	.	.	.	.	.	.	.	.	T	12.82	2.052788	0.36181	.	.	ENSG00000128191	ENST00000351989;ENST00000383024;ENST00000407755	T;T;T	0.32988	1.44;1.43;1.43	5.42	4.38	0.52667	.	0.428769	0.25313	N	0.031567	T	0.17066	0.0410	N	0.08118	0	0.36285	D	0.856057	B;B	0.25667	0.131;0.08	B;B	0.27608	0.081;0.037	T	0.14144	-1.0483	10	0.33141	T	0.24	-10.1843	11.6336	0.51189	0.1331:0.0:0.0:0.8669	.	188;188	Q8WYQ5-3;Q8WYQ5	.;DGCR8_HUMAN	R	188	ENSP00000263209:L188R;ENSP00000372488:L188R;ENSP00000384726:L188R	ENSP00000263209:L188R	L	+	2	0	DGCR8	18454049	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.018000	0.49625	1.057000	0.40506	0.402000	0.26972	CTG	DGCR8	-	NULL	ENSG00000128191		0.517	DGCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGCR8	HGNC	protein_coding	OTTHUMT00000318654.1	45	0.00	0	T			20074049	20074049	+1	no_errors	ENST00000351989	ensembl	human	known	69_37n	missense	11	50.00	11	SNP	1.000	G
DMRTC2	63946	genome.wustl.edu	37	19	42355733	42355733	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr19:42355733G>T	ENST00000269945.3	+	9	1124	c.1073G>T	c.(1072-1074)gGc>gTc	p.G358V	DMRTC2_ENST00000596827.1_Missense_Mutation_p.G409V	NM_001040283.1	NP_001035373.1	Q8IXT2	DMRTD_HUMAN	DMRT-like family C2	358					male meiosis I (GO:0007141)|positive regulation of histone H3-K9 dimethylation (GO:1900111)|positive regulation of histone H3-K9 trimethylation (GO:1900114)|sex differentiation (GO:0007548)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|XY body (GO:0001741)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	10						CTGCATATTGGCCGTCTGGGG	0.577																																						dbGAP											0													80.0	66.0	71.0					19																	42355733		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ291669	CCDS33034.1	19q13.2	2008-07-16				ENSG00000142025			13911	protein-coding gene	gene with protein product		614806				11863363	Standard	NM_001040283		Approved		uc002ors.3	Q8IXT2		ENST00000269945.3:c.1073G>T	19.37:g.42355733G>T	ENSP00000269945:p.Gly358Val		Q8N6Q2|Q96M39|Q96SD4	Missense_Mutation	SNP	pfam_DM_DNA-bd,superfamily_DM_DNA-bd,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.G358V	ENST00000269945.3	37	c.1073	CCDS33034.1	19	.	.	.	.	.	.	.	.	.	.	G	20.5	4.007830	0.75046	.	.	ENSG00000142025	ENST00000269945	.	.	.	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000005	T	0.78635	0.4314	M	0.74258	2.255	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80585	-0.1317	9	0.87932	D	0	-10.7999	15.029	0.71691	0.0:0.0:1.0:0.0	.	409;358	B4DX56;Q8IXT2	.;DMRTD_HUMAN	V	358	.	ENSP00000269945:G358V	G	+	2	0	DMRTC2	47047573	1.000000	0.71417	0.992000	0.48379	0.853000	0.48598	3.163000	0.50763	2.706000	0.92434	0.655000	0.94253	GGC	DMRTC2	-	NULL	ENSG00000142025		0.577	DMRTC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRTC2	HGNC	protein_coding	OTTHUMT00000463045.1	49	0.00	0	G	NM_001040283		42355733	42355733	+1	no_errors	ENST00000269945	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	0.996	T
DSPP	1834	genome.wustl.edu	37	4	88535974	88535974	+	Silent	SNP	T	T	C			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr4:88535974T>C	ENST00000282478.7	+	4	2193	c.2160T>C	c.(2158-2160)aaT>aaC	p.N720N	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.N720N			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	720	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagtaatagtaacagca	0.488																																						dbGAP											0													87.0	97.0	93.0					4																	88535974		1662	3005	4667	-	-	-	SO:0001819	synonymous_variant	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2160T>C	4.37:g.88535974T>C			A8MUI0|O95815	Silent	SNP	NULL	p.N720	ENST00000282478.7	37	c.2160	CCDS43248.1	4																																																																																			DSPP	-	NULL	ENSG00000152591		0.488	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	111	0.00	0	T	NM_014208		88535974	88535974	+1	no_errors	ENST00000282478	ensembl	human	known	69_37n	silent	82	38.35	51	SNP	0.729	C
E2F1	1869	genome.wustl.edu	37	20	32268216	32268216	+	Frame_Shift_Del	DEL	G	G	-			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr20:32268216delG	ENST00000343380.5	-	2	407	c.268delC	c.(268-270)cggfs	p.R91fs		NM_005225.2	NP_005216.1	Q01094	E2F1_HUMAN	E2F transcription factor 1	91	Cyclin A/CDK2 binding.|Interaction with BIRC2/c-IAP1.			KRRLDLETDHQYLAESSGPARGR -> RTPGTPRRQRRLCP PRRPGRAPC (in Ref. 8; AAD14150). {ECO:0000305}.	anoikis (GO:0043276)|apoptotic process (GO:0006915)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|DNA damage checkpoint (GO:0000077)|forebrain development (GO:0030900)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|mRNA stabilization (GO:0048255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(2)|breast(1)|endometrium(3)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	16						TCCAGCCTCCGCTTCACCTGT	0.617																																						dbGAP											0													53.0	44.0	47.0					20																	32268216		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS13224.1	20q11	2008-05-14			ENSG00000101412	ENSG00000101412			3113	protein-coding gene	gene with protein product		189971		RBBP3		8964493	Standard	NM_005225		Approved	RBP3	uc002wzu.4	Q01094	OTTHUMG00000032265	ENST00000343380.5:c.268delC	20.37:g.32268216delG	ENSP00000345571:p.Arg91fs		Q13143|Q92768	Frame_Shift_Del	DEL	pfam_E2F_TDP	p.R90fs	ENST00000343380.5	37	c.268	CCDS13224.1	20																																																																																			E2F1	-	NULL	ENSG00000101412		0.617	E2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F1	HGNC	protein_coding	OTTHUMT00000078731.2	42	0.00	0	G			32268216	32268216	-1	no_errors	ENST00000343380	ensembl	human	known	69_37n	frame_shift_del	12	14.29	2	DEL	1.000	-
EIF4A3	9775	genome.wustl.edu	37	17	78113839	78113839	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr17:78113839T>A	ENST00000269349.3	-	5	694	c.473A>T	c.(472-474)cAt>cTt	p.H158L		NM_014740.3	NP_055555.1	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A3	158	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cytokine-mediated signaling pathway (GO:0019221)|embryonic cranial skeleton morphogenesis (GO:0048701)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|mRNA binding (GO:0003729)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			CGCGACAACATGCTGTCCGTA	0.512																																						dbGAP											0													92.0	76.0	81.0					17																	78113839		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004386	CCDS11767.1	17q25.3	2010-02-10	2010-02-10	2006-11-27		ENSG00000141543		"""DEAD-boxes"""	18683	protein-coding gene	gene with protein product		608546	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 48"", ""eukaryotic translation initiation factor 4A, isoform 3"""	DDX48		10623621, 14730019	Standard	NM_014740		Approved	KIAA0111, EIF4AIII	uc002jxs.3	P38919		ENST00000269349.3:c.473A>T	17.37:g.78113839T>A	ENSP00000269349:p.His158Leu		Q15033|Q6IBQ2|Q96A18	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.H158L	ENST00000269349.3	37	c.473	CCDS11767.1	17	.	.	.	.	.	.	.	.	.	.	T	19.22	3.786170	0.70337	.	.	ENSG00000141543	ENST00000269349	T	0.05081	3.5	5.67	5.67	0.87782	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.045721	0.85682	D	0.000000	T	0.27205	0.0667	M	0.84846	2.72	0.80722	D	1	D	0.63046	0.992	D	0.66351	0.943	T	0.02457	-1.1156	10	0.87932	D	0	-4.3603	13.8561	0.63527	0.0:0.0:0.0:1.0	.	158	P38919	IF4A3_HUMAN	L	158	ENSP00000269349:H158L	ENSP00000269349:H158L	H	-	2	0	EIF4A3	75728434	1.000000	0.71417	0.798000	0.32154	0.307000	0.27823	7.587000	0.82613	2.161000	0.67846	0.533000	0.62120	CAT	EIF4A3	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000141543		0.512	EIF4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A3	HGNC	protein_coding	OTTHUMT00000437446.1	35	0.00	0	T	NM_014740		78113839	78113839	-1	no_errors	ENST00000269349	ensembl	human	known	69_37n	missense	35	22.22	10	SNP	0.999	A
PDXDC2P	283970	genome.wustl.edu	37	16	70010458	70010458	+	RNA	SNP	G	G	A	rs3206834	byFrequency	TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr16:70010458G>A	ENST00000531894.1	-	0	3925				RP11-419C5.2_ENST00000525562.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)										GAGGGTGGAAGGGGAATAAGA	0.512													g|||	1754	0.35024	0.0809	0.5187	5008	,	,		5105	0.2609		0.6292	False		,,,				2504	0.3998					dbGAP											0																																										-	-	-			0					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70010458G>A			A8K9Z5	Missense_Mutation	SNP	pfam_NPIP	p.L274F	ENST00000531894.1	37	c.820		16	1018	0.4661172161172161	104	0.21138211382113822	208	0.574585635359116	267	0.46678321678321677	439	0.579155672823219	.	8.557	0.876801	0.17395	.	.	ENSG00000226232	ENST00000532298	T	0.62105	0.05	.	.	.	.	.	.	.	.	T	0.00012	0.0000	.	.	.	.	.	.	.	.	.	.	.	.	T	0.48139	-0.9061	3	0.87932	D	0	.	.	.	.	rs3206834;rs3206834	.	.	.	F	274	ENSP00000448651:L274F	ENSP00000448651:L274F	L	-	1	0	RP11-419C5.2	68567959	0.006000	0.16342	0.013000	0.15412	0.013000	0.08279	0.150000	0.16263	0.107000	0.17824	0.109000	0.15622	CTT	RP11-419C5.2	-	pfam_NPIP	ENSG00000226232		0.512	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226232	Clone_based_vega_gene	processed_transcript	OTTHUMT00000395258.1	9	0.00	0	G			70010458	70010458	-1	no_errors	ENST00000532298	ensembl	human	novel	69_37n	missense	10	44.44	8	SNP	0.014	A
ESYT3	83850	genome.wustl.edu	37	3	138186958	138186958	+	Silent	SNP	G	G	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr3:138186958G>A	ENST00000389567.4	+	12	1416	c.1230G>A	c.(1228-1230)ctG>ctA	p.L410L		NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	410					lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						GGTTTGTCCTGAATGACACAA	0.582																																						dbGAP											0													60.0	58.0	59.0					3																	138186958		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.1230G>A	3.37:g.138186958G>A			A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_C2_dom	p.L410	ENST00000389567.4	37	c.1230	CCDS3101.2	3																																																																																			ESYT3	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000158220		0.582	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT3	HGNC	protein_coding	OTTHUMT00000303993.1	51	0.00	0	G	NM_031913		138186958	138186958	+1	no_errors	ENST00000389567	ensembl	human	known	69_37n	silent	18	33.33	9	SNP	1.000	A
F8	2157	genome.wustl.edu	37	X	154133268	154133268	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chrX:154133268A>C	ENST00000360256.4	-	16	5604	c.5404T>G	c.(5404-5406)Tat>Gat	p.Y1802D		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1802	F5/8 type A 3.|Plastocyanin-like 5.		Y -> C (in HEMA; moderate). {ECO:0000269|PubMed:10404764, ECO:0000269|PubMed:15682412}.		acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TAGAAGGAATAGGGACGAGAG	0.363																																						dbGAP											0													102.0	91.0	95.0					X																	154133268		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.5404T>G	X.37:g.154133268A>C	ENSP00000353393:p.Tyr1802Asp		Q14286|Q5HY69	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.Y1802D	ENST00000360256.4	37	c.5404	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	A	18.96	3.733326	0.69189	.	.	ENSG00000185010	ENST00000360256	D	0.99060	-5.38	4.97	4.97	0.65823	Cupredoxin (2);	0.259510	0.39615	N	0.001306	D	0.99168	0.9712	M	0.80422	2.495	0.46336	D	0.998991	D	0.89917	1.0	D	0.83275	0.996	D	0.99513	1.0956	10	0.87932	D	0	-6.7826	12.8619	0.57918	1.0:0.0:0.0:0.0	.	1802	P00451	FA8_HUMAN	D	1802	ENSP00000353393:Y1802D	ENSP00000353393:Y1802D	Y	-	1	0	F8	153786462	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.525000	0.90583	1.780000	0.52325	0.408000	0.27601	TAT	F8	-	superfamily_Cupredoxin	ENSG00000185010		0.363	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	67	0.00	0	A			154133268	154133268	-1	no_errors	ENST00000360256	ensembl	human	known	69_37n	missense	75	14.61	13	SNP	1.000	C
FAM13B	51306	genome.wustl.edu	37	5	137289986	137289986	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr5:137289986C>G	ENST00000033079.3	-	14	1972	c.1521G>C	c.(1519-1521)atG>atC	p.M507I	FAM13B_ENST00000420893.2_Missense_Mutation_p.M507I|FAM13B_ENST00000425075.2_Missense_Mutation_p.M411I	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	507					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						GGTGATGATTCATTCTTCCAG	0.448																																						dbGAP											0													90.0	88.0	89.0					5																	137289986		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1521G>C	5.37:g.137289986C>G	ENSP00000033079:p.Met507Ile		D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.M507I	ENST00000033079.3	37	c.1521	CCDS4195.1	5	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888358	0.91814	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	D;T;D	0.95342	-3.68;1.73;-3.68	5.49	5.49	0.81192	.	0.041428	0.85682	D	0.000000	D	0.96682	0.8917	M	0.61703	1.905	0.58432	D	0.999994	D;P;D	0.71674	0.998;0.908;0.997	D;D;D	0.79784	0.993;0.922;0.985	D	0.96636	0.9470	10	0.54805	T	0.06	-9.5532	18.3606	0.90372	0.0:1.0:0.0:0.0	.	411;507;507	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	I	507;411;507	ENSP00000033079:M507I;ENSP00000394669:M411I;ENSP00000388521:M507I	ENSP00000033079:M507I	M	-	3	0	FAM13B	137317885	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.899000	0.75682	2.576000	0.86940	0.585000	0.79938	ATG	FAM13B	-	NULL	ENSG00000031003		0.448	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13B	HGNC	protein_coding	OTTHUMT00000251279.1	22	0.00	0	C			137289986	137289986	-1	no_errors	ENST00000033079	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	1.000	G
FAM186A	121006	genome.wustl.edu	37	12	50745684	50745684	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr12:50745684G>C	ENST00000327337.5	-	4	4930	c.4931C>G	c.(4930-4932)gCc>gGc	p.A1644G	FAM186A_ENST00000543111.1_Missense_Mutation_p.A1644G|FAM186A_ENST00000543096.1_5'Flank	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1644																	CAGTGCCTGGGCCTGCTGAGG	0.612																																					NSCLC(138;1796 1887 12511 19463 37884)	dbGAP											0													26.0	27.0	27.0					12																	50745684		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4931C>G	12.37:g.50745684G>C	ENSP00000329995:p.Ala1644Gly			Missense_Mutation	SNP	NULL	p.A1644G	ENST00000327337.5	37	c.4931	CCDS44878.1	12	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894093	0.52121	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.04809	3.55;3.55	4.23	-1.39	0.08997	.	.	.	.	.	T	0.08088	0.0202	N	0.19112	0.55	0.09310	N	1	D;P	0.76494	0.999;0.939	D;P	0.73708	0.981;0.565	T	0.37596	-0.9699	9	0.28530	T	0.3	.	9.2111	0.37320	0.5839:0.0:0.4161:0.0	.	1644;1644	F5GYN0;A6NE01	.;F186A_HUMAN	G	1644	ENSP00000441337:A1644G;ENSP00000329995:A1644G	ENSP00000329995:A1644G	A	-	2	0	FAM186A	49031951	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-0.705000	0.05052	-0.412000	0.07519	0.313000	0.20887	GCC	FAM186A	-	NULL	ENSG00000185958		0.612	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM186A	HGNC	protein_coding	OTTHUMT00000396838.1	88	0.00	0	G	XM_001718353		50745684	50745684	-1	no_errors	ENST00000327337	ensembl	human	known	69_37n	missense	53	25.35	18	SNP	0.000	C
FMO1	2326	genome.wustl.edu	37	1	171251333	171251333	+	Silent	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr1:171251333C>A	ENST00000354841.4	+	6	1175	c.1044C>A	c.(1042-1044)ggC>ggA	p.G348G	FMO1_ENST00000402921.2_Silent_p.G285G|FMO1_ENST00000367750.3_Silent_p.G348G|FMO1_ENST00000469112.1_3'UTR	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	348					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	TTGAAGATGGCCAGGCCTCAC	0.458																																						dbGAP											0													157.0	136.0	143.0					1																	171251333		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.1044C>A	1.37:g.171251333C>A			A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Silent	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.G348	ENST00000354841.4	37	c.1044	CCDS1294.1	1																																																																																			FMO1	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase_1,prints_Flavin_mOase_2	ENSG00000010932		0.458	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO1	HGNC	protein_coding	OTTHUMT00000086212.1	52	0.00	0	C	NM_002021		171251333	171251333	+1	no_errors	ENST00000354841	ensembl	human	known	69_37n	silent	19	34.48	10	SNP	0.984	A
FOS	2353	genome.wustl.edu	37	14	75748073	75748073	+	Silent	SNP	C	C	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr14:75748073C>T	ENST00000303562.4	+	4	1298	c.1089C>T	c.(1087-1089)agC>agT	p.S363S	FOS_ENST00000555347.1_Silent_p.S215S|FOS_ENST00000555686.1_Silent_p.S249S|FOS_ENST00000535987.1_Silent_p.S327S	NM_005252.3	NP_005243.1	P01100	FOS_HUMAN	FBJ murine osteosarcoma viral oncogene homolog	363					aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hormone stimulus (GO:0032870)|cellular response to reactive oxygen species (GO:0034614)|conditioned taste aversion (GO:0001661)|DNA methylation (GO:0006306)|Fc-epsilon receptor signaling pathway (GO:0038095)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gravity (GO:0009629)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|skeletal muscle cell differentiation (GO:0035914)|sleep (GO:0030431)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	double-stranded DNA binding (GO:0003690)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(585;0.0138)|all_epithelial(191;0.0263)|all_neural(303;0.112)		BRCA - Breast invasive adenocarcinoma(234;0.0117)	Nadroparin(DB08813)|Pseudoephedrine(DB00852)	AGGGCAGCAGCAGCAATGAGC	0.647																																						dbGAP											0													41.0	42.0	42.0					14																	75748073		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			K00650	CCDS9841.1	14q24.3	2013-01-10	2009-07-23			ENSG00000170345		"""basic leucine zipper proteins"""	3796	protein-coding gene	gene with protein product		164810	"""v-fos FBJ murine osteosarcoma viral oncogene homolog"""			16123044, 16055710, 15926923	Standard	NM_005252		Approved	c-fos, AP-1	uc001xrn.3	P01100		ENST00000303562.4:c.1089C>T	14.37:g.75748073C>T			A8K4E2|B4DQ65|P18849	Silent	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.S363	ENST00000303562.4	37	c.1089	CCDS9841.1	14																																																																																			FOS	-	NULL	ENSG00000170345		0.647	FOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOS	HGNC	protein_coding	OTTHUMT00000415044.1	10	0.00	0	C	NM_005252		75748073	75748073	+1	no_errors	ENST00000303562	ensembl	human	known	69_37n	silent	7	50.00	7	SNP	1.000	T
FOXP1	27086	genome.wustl.edu	37	3	71026978	71026978	+	Splice_Site	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr3:71026978C>A	ENST00000318789.4	-	15	1874		c.e15+1		FOXP1_ENST00000484350.1_Splice_Site|FOXP1_ENST00000491238.1_Splice_Site|FOXP1_ENST00000493089.1_Splice_Site|FOXP1_ENST00000468577.1_Splice_Site|FOXP1_ENST00000498215.1_Splice_Site|FOXP1_ENST00000475937.1_Splice_Site	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		GGAGTATCTACCTGACGAAAT	0.473			T	PAX5	ALL																																	dbGAP		Dom	yes		3	3p14.1	27086	forkhead box P1		L	0													159.0	140.0	146.0					3																	71026978		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.1348+1G>T	3.37:g.71026978C>A			A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	Splice_Site	SNP	-	e10+1	ENST00000318789.4	37	c.1348+1	CCDS2914.1	3	.	.	.	.	.	.	.	.	.	.	C	23.8	4.456266	0.84317	.	.	ENSG00000114861	ENST00000318789;ENST00000358280;ENST00000318796;ENST00000475937;ENST00000339693;ENST00000497355;ENST00000491238;ENST00000493089;ENST00000498215;ENST00000484350;ENST00000468577	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5666	0.99351	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FOXP1	71109668	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.487000	0.81328	2.854000	0.98071	0.655000	0.94253	.	FOXP1	-	-	ENSG00000114861		0.473	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FOXP1	HGNC	protein_coding	OTTHUMT00000352250.1	80	0.00	0	C	NM_032682	Intron	71026978	71026978	-1	no_errors	ENST00000318789	ensembl	human	known	69_37n	splice_site	39	40.00	26	SNP	1.000	A
FRG1B	284802	genome.wustl.edu	37	20	29612327	29612327	+	Intron	SNP	C	C	T	rs75344482	byFrequency	TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr20:29612327C>T	ENST00000278882.3	+	1	257				FRG1B_ENST00000439954.2_Intron|FRG1B_ENST00000468180.2_Intron|FRG1B_ENST00000358464.4_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ACAGGATAGACGGGCGGGTGA	0.652													.|||	2	0.000399361	0.0	0.0	5008	,	,		18124	0.0		0.0	False		,,,				2504	0.002					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-124+214C>T	20.37:g.29612327C>T			C4AME5	RNA	SNP	-	NULL	ENST00000278882.3	37	NULL		20																																																																																			FRG1B	-	-	ENSG00000149531		0.652	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	8	0.00	0	C	NR_003579		29612327	29612327	+1	no_errors	ENST00000482423	ensembl	human	known	69_37n	rna	10	41.18	7	SNP	0.000	T
FSD2	123722	genome.wustl.edu	37	15	83451590	83451590	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr15:83451590G>T	ENST00000334574.8	-	4	1104	c.923C>A	c.(922-924)aCa>aAa	p.T308K	FSD2_ENST00000541889.1_Missense_Mutation_p.T308K			A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing 2	308										breast(2)|central_nervous_system(1)|large_intestine(5)|lung(10)	18						CTCCTCTATTGTTTCCATCAG	0.378																																						dbGAP											0													306.0	289.0	294.0					15																	83451590		1896	4117	6013	-	-	-	SO:0001583	missense	0			AK122875	CCDS45332.1, CCDS61738.1	15q25.2	2013-02-11	2006-01-11	2006-01-11		ENSG00000186628		"""Fibronectin type III domain containing"""	18024	protein-coding gene	gene with protein product			"""SPRY domain containing 1"""	SPRYD1			Standard	NM_001007122		Approved	RP11-127F21	uc002bjd.2	A1L4K1		ENST00000334574.8:c.923C>A	15.37:g.83451590G>T	ENSP00000335651:p.Thr308Lys		B3KVG1|B7ZM02	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.T308K	ENST00000334574.8	37	c.923	CCDS45332.1	15	.	.	.	.	.	.	.	.	.	.	G	18.80	3.700073	0.68501	.	.	ENSG00000186628	ENST00000334574;ENST00000541889	T;T	0.63913	0.42;-0.07	6.04	5.12	0.69794	.	0.108638	0.64402	D	0.000012	T	0.70962	0.3284	M	0.66939	2.045	0.35231	D	0.776965	P;P	0.52692	0.955;0.9	P;B	0.52598	0.703;0.435	T	0.81439	-0.0932	10	0.72032	D	0.01	-13.9101	14.9374	0.70967	0.0:0.0:0.7409:0.2591	.	308;308	B7ZM02;A1L4K1	.;FSD2_HUMAN	K	308	ENSP00000335651:T308K;ENSP00000444078:T308K	ENSP00000335651:T308K	T	-	2	0	FSD2	81248644	1.000000	0.71417	0.721000	0.30653	0.937000	0.57800	2.992000	0.49417	1.550000	0.49438	0.561000	0.74099	ACA	FSD2	-	NULL	ENSG00000186628		0.378	FSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FSD2	HGNC	protein_coding	OTTHUMT00000418385.1	176	0.00	0	G	NM_001007122		83451590	83451590	-1	no_errors	ENST00000334574	ensembl	human	known	69_37n	missense	99	24.43	32	SNP	0.938	T
GLI3	2737	genome.wustl.edu	37	7	42079679	42079679	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr7:42079679G>T	ENST00000395925.3	-	7	1070	c.986C>A	c.(985-987)tCa>tAa	p.S329*	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	329					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GCCACTTGCTGAAGAGCTGCT	0.418									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																													dbGAP											0													161.0	142.0	148.0					7																	42079679		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.986C>A	7.37:g.42079679G>T	ENSP00000379258:p.Ser329*		A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S329*	ENST00000395925.3	37	c.986	CCDS5465.1	7	.	.	.	.	.	.	.	.	.	.	G	39	7.350652	0.98228	.	.	ENSG00000106571	ENST00000395925	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.6584	0.95853	0.0:0.0:1.0:0.0	.	.	.	.	X	329	.	ENSP00000379258:S329X	S	-	2	0	GLI3	42046204	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.857000	0.99534	2.646000	0.89796	0.655000	0.94253	TCA	GLI3	-	NULL	ENSG00000106571		0.418	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI3	HGNC	protein_coding	OTTHUMT00000250806.3	74	0.00	0	G	NM_000168		42079679	42079679	-1	no_errors	ENST00000395925	ensembl	human	known	69_37n	nonsense	66	18.52	15	SNP	1.000	T
HACE1	57531	genome.wustl.edu	37	6	105224704	105224704	+	Splice_Site	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr6:105224704C>A	ENST00000262903.4	-	17	2053		c.e17-1		HACE1_ENST00000517995.1_Splice_Site|HACE1_ENST00000369125.2_Intron	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1						cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		CACCTTGACCCTGAATTCAAG	0.308																																						dbGAP											0													79.0	72.0	74.0					6																	105224704		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.1777-1G>T	6.37:g.105224704C>A			A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Splice_Site	SNP	-	e17-1	ENST00000262903.4	37	c.1777-1	CCDS5050.1	6	.	.	.	.	.	.	.	.	.	.	C	19.88	3.908999	0.72868	.	.	ENSG00000085382	ENST00000262903;ENST00000518503;ENST00000518402	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5457	0.95295	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HACE1	105331397	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.076000	0.76806	2.673000	0.90976	0.655000	0.94253	.	HACE1	-	-	ENSG00000085382		0.308	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HACE1	HGNC	protein_coding	OTTHUMT00000041643.2	48	0.00	0	C	XM_045095	Intron	105224704	105224704	-1	no_errors	ENST00000262903	ensembl	human	known	69_37n	splice_site	5	75.00	15	SNP	1.000	A
HIBADH	11112	genome.wustl.edu	37	7	27578011	27578011	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr7:27578011A>G	ENST00000265395.2	-	6	850	c.644T>C	c.(643-645)cTg>cCg	p.L215P		NM_152740.3	NP_689953.1	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase	215					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	3-hydroxyisobutyrate dehydrogenase activity (GO:0008442)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(4)|kidney(2)|lung(3)|ovary(2)|prostate(1)	12			GBM - Glioblastoma multiforme(3;0.0368)			AATAGCTAACAGCATGTTGTT	0.338																																						dbGAP											0													108.0	107.0	107.0					7																	27578011		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF529362	CCDS5414.1	7p15	2009-06-12			ENSG00000106049	ENSG00000106049	1.1.1.31		4907	protein-coding gene	gene with protein product		608475					Standard	NM_152740		Approved	NS5ATP1	uc003szf.3	P31937	OTTHUMG00000097035	ENST00000265395.2:c.644T>C	7.37:g.27578011A>G	ENSP00000265395:p.Leu215Pro		Q546Z2|Q9UDN3	Missense_Mutation	SNP	pfam_6PGDH_NADP-bd,pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_NADP_OxRdtase_F420,superfamily_6-PGluconate_DH_C-like,tigrfam_IsoBut3OH_DH	p.L215P	ENST00000265395.2	37	c.644	CCDS5414.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.7|22.7	4.327131|4.327131	0.81690|0.81690	.|.	.|.	ENSG00000106049|ENSG00000106049	ENST00000425715|ENST00000265395	.|T	.|0.47869	.|0.83	6.17|6.17	5.02|5.02	0.67125|0.67125	.|Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78020|0.78020	0.4218|0.4218	H|H	0.96777|0.96777	3.88|3.88	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.76071	.|0.987	D|D	0.84354|0.84354	0.0534|0.0534	5|10	.|0.87932	.|D	.|0	0.0329|0.0329	12.5464|12.5464	0.56201|0.56201	0.9354:0.0:0.0646:0.0|0.9354:0.0:0.0646:0.0	.|.	.|215	.|P31937	.|3HIDH_HUMAN	R|P	158|215	.|ENSP00000265395:L215P	.|ENSP00000265395:L215P	C|L	-|-	1|2	0|0	HIBADH|HIBADH	27544536|27544536	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.169000|9.169000	0.94788|0.94788	1.146000|1.146000	0.42352|0.42352	0.533000|0.533000	0.62120|0.62120	TGT|CTG	HIBADH	-	superfamily_6-PGluconate_DH_C-like,tigrfam_IsoBut3OH_DH	ENSG00000106049		0.338	HIBADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIBADH	HGNC	protein_coding	OTTHUMT00000214132.1	102	0.00	0	A	NM_152740		27578011	27578011	-1	no_errors	ENST00000265395	ensembl	human	known	69_37n	missense	28	62.67	47	SNP	1.000	G
HSD3B7	80270	genome.wustl.edu	37	16	30997512	30997512	+	Silent	SNP	G	G	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr16:30997512G>A	ENST00000297679.5	+	3	402	c.309G>A	c.(307-309)gaG>gaA	p.E103E	HSD3B7_ENST00000353250.5_Silent_p.E103E|HSD3B7_ENST00000262520.6_Silent_p.E103E|AC135048.1_ENST00000602217.1_Missense_Mutation_p.L8F	NM_025193.3	NP_079469.2	Q9H2F3	3BHS7_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7	103					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|cholest-5-ene-3-beta,7-alpha-diol 3-beta-dehydrogenase activity (GO:0047016)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						CCATCCATGAGGTCAACGTGC	0.617																																						dbGAP											0													71.0	57.0	61.0					16																	30997512		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF277719	CCDS10698.1, CCDS45466.1	16p11.2	2011-09-14			ENSG00000099377	ENSG00000099377	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	18324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 3"""	607764				11067870, 19027726	Standard	NM_001142777		Approved	C(27)-3BETA-HSD, SDR11E3	uc002eaf.2	Q9H2F3	OTTHUMG00000132417	ENST00000297679.5:c.309G>A	16.37:g.30997512G>A			Q96M28|Q9BSN9	Silent	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Polysac_CapD-like,pfam_dTDP_dehydrorham_reduct,pfam_NmrA	p.E103	ENST00000297679.5	37	c.309	CCDS10698.1	16																																																																																			HSD3B7	-	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Polysac_CapD-like,pfam_dTDP_dehydrorham_reduct,pfam_NmrA	ENSG00000099377		0.617	HSD3B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD3B7	HGNC	protein_coding	OTTHUMT00000255554.2	34	0.00	0	G			30997512	30997512	+1	no_errors	ENST00000297679	ensembl	human	known	69_37n	silent	10	28.57	4	SNP	0.211	A
IGKV6-21	28906	genome.wustl.edu	37	2	89459492	89459492	+	RNA	SNP	A	A	C			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr2:89459492A>C	ENST00000390256.2	-	0	148									immunoglobulin kappa variable 6-21 (non-functional)																		ACAGACTGAAAGTCTGGAGAC	0.443																																						dbGAP											0													14.0	16.0	15.0					2																	89459492		1767	4009	5776	-	-	-			0			X63399		2p11.2	2012-02-10	2008-09-10		ENSG00000211611	ENSG00000211611		"""Immunoglobulins / IGK locus"""	5836	other	immunoglobulin gene			"""immunoglobulin kappa variable 6-21"""				Standard	NG_000834		Approved	IGKV621, A26			OTTHUMG00000151654		2.37:g.89459492A>C				Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.F29V	ENST00000390256.2	37	c.85		2																																																																																			IGKV6-21	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000211611		0.443	IGKV6-21-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV6-21	HGNC	IG_V_gene	OTTHUMT00000323403.1	36	0.00	0	A	NG_000834		89459492	89459492	-1	no_stop_codon	ENST00000390256	ensembl	human	known	69_37n	missense	26	42.22	19	SNP	0.394	C
ITIH1	3697	genome.wustl.edu	37	3	52821620	52821620	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr3:52821620C>A	ENST00000273283.2	+	16	1940	c.1916C>A	c.(1915-1917)cCc>cAc	p.P639H	ITIH1_ENST00000540715.1_Missense_Mutation_p.P497H|ITIH1_ENST00000537050.1_Missense_Mutation_p.P351H|ITIH1_ENST00000542827.1_Intron|ITIH1_ENST00000405128.3_5'Flank	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	639	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		ATGCTGGGACCCAGAAGGAGT	0.537																																						dbGAP											0													188.0	162.0	171.0					3																	52821620		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.1916C>A	3.37:g.52821620C>A	ENSP00000273283:p.Pro639His		A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,superfamily_PsdUridine_synth_cat_dom,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.P639H	ENST00000273283.2	37	c.1916	CCDS2864.1	3	.	.	.	.	.	.	.	.	.	.	C	10.25	1.297273	0.23650	.	.	ENSG00000055957	ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133	T;T;T;T	0.03441	4.83;4.7;4.53;3.93	4.19	1.19	0.21007	.	0.566851	0.17636	N	0.167213	T	0.03651	0.0104	L	0.39898	1.24	0.29838	N	0.829425	B;B;B	0.13145	0.003;0.007;0.002	B;B;B	0.17979	0.02;0.003;0.003	T	0.32428	-0.9907	10	0.21014	T	0.42	-6.4448	10.236	0.43284	0.5961:0.4039:0.0:0.0	.	497;240;639	F5H165;Q9P1C5;P19827	.;.;ITIH1_HUMAN	H	639;497;351;192	ENSP00000273283:P639H;ENSP00000443973:P497H;ENSP00000443847:P351H;ENSP00000395836:P192H	ENSP00000273283:P639H	P	+	2	0	ITIH1	52796660	0.990000	0.36364	1.000000	0.80357	0.856000	0.48823	0.227000	0.17795	0.231000	0.21079	-0.467000	0.05162	CCC	ITIH1	-	NULL	ENSG00000055957		0.537	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH1	HGNC	protein_coding	OTTHUMT00000317522.1	78	0.00	0	C	NM_002215		52821620	52821620	+1	no_errors	ENST00000273283	ensembl	human	known	69_37n	missense	36	33.33	18	SNP	1.000	A
KIDINS220	57498	genome.wustl.edu	37	2	8874805	8874805	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr2:8874805A>G	ENST00000256707.3	-	28	3977	c.3796T>C	c.(3796-3798)Tgg>Cgg	p.W1266R	KIDINS220_ENST00000427284.1_Missense_Mutation_p.W1247R|KIDINS220_ENST00000418530.1_Missense_Mutation_p.W1167R|KIDINS220_ENST00000473731.1_Missense_Mutation_p.W1247R	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	1266					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AAAAGGTGCCAGTCTCCAAAA	0.299																																						dbGAP											0													97.0	90.0	92.0					2																	8874805		1851	4091	5942	-	-	-	SO:0001583	missense	0			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.3796T>C	2.37:g.8874805A>G	ENSP00000256707:p.Trp1266Arg		A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Missense_Mutation	SNP	pfam_KAP_NTPase,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.W1266R	ENST00000256707.3	37	c.3796	CCDS42650.1	2	.	.	.	.	.	.	.	.	.	.	A	24.8	4.569315	0.86439	.	.	ENSG00000134313	ENST00000496383;ENST00000541927;ENST00000256707;ENST00000427284;ENST00000418530;ENST00000473731;ENST00000489024	T;T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34;1.34	5.96	5.96	0.96718	Sterile alpha motif/pointed domain (2);	0.000000	0.85682	D	0.000000	T	0.63931	0.2553	M	0.81942	2.565	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.999;0.999;0.999	D;D;D;D;D	0.97110	0.996;0.999;1.0;0.999;0.999	T	0.68534	-0.5383	10	0.87932	D	0	.	16.4484	0.83959	1.0:0.0:0.0:0.0	.	1210;1210;1167;1266;120	B4DK94;E9PH70;Q9ULH0-2;Q9ULH0;B4DG84	.;.;.;KDIS_HUMAN;.	R	956;893;1266;1247;1167;1247;1210	ENSP00000420364:W956R;ENSP00000256707:W1266R;ENSP00000411849:W1247R;ENSP00000414923:W1167R;ENSP00000418974:W1247R;ENSP00000419964:W1210R	ENSP00000256707:W1266R	W	-	1	0	KIDINS220	8792256	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.894000	0.92506	2.285000	0.76669	0.533000	0.62120	TGG	KIDINS220	-	superfamily_SAM/pointed	ENSG00000134313		0.299	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIDINS220	HGNC	protein_coding	OTTHUMT00000323408.2	114	0.00	0	A	NM_020738		8874805	8874805	-1	no_errors	ENST00000256707	ensembl	human	known	69_37n	missense	29	35.56	16	SNP	1.000	G
KIF19	124602	genome.wustl.edu	37	17	72338053	72338053	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr17:72338053C>A	ENST00000389916.4	+	3	297	c.159C>A	c.(157-159)gaC>gaA	p.D53E		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	53	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						ATCCCGACGACATCCTGCGGG	0.647																																						dbGAP											0													127.0	124.0	125.0					17																	72338053		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.159C>A	17.37:g.72338053C>A	ENSP00000374566:p.Asp53Glu		A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D53E	ENST00000389916.4	37	c.159	CCDS32718.2	17	.	.	.	.	.	.	.	.	.	.	C	22.3	4.270410	0.80469	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.74315	-0.74;-0.83	5.5	4.53	0.55603	Kinesin, motor domain (4);	.	.	.	.	T	0.73729	0.3624	L	0.33624	1.015	0.49389	D	0.999785	D;D;P;P	0.76494	0.987;0.999;0.753;0.575	D;D;B;B	0.70716	0.964;0.97;0.381;0.343	T	0.68965	-0.5270	9	0.15066	T	0.55	.	7.1817	0.25776	0.0:0.712:0.0:0.288	.	53;53;53;53	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	E	53	ENSP00000449134:D53E;ENSP00000374566:D53E	ENSP00000374566:D53E	D	+	3	2	KIF19	69849648	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	1.321000	0.33678	1.333000	0.45449	0.549000	0.68633	GAC	KIF19	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000196169		0.647	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF19	HGNC	protein_coding	OTTHUMT00000319644.2	32	0.00	0	C	NM_153209		72338053	72338053	+1	no_errors	ENST00000389916	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	1.000	A
LCT	3938	genome.wustl.edu	37	2	136579592	136579592	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr2:136579592T>A	ENST00000264162.2	-	5	994	c.984A>T	c.(982-984)aaA>aaT	p.K328N	AC011893.3_ENST00000437007.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	328	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GACATTACCTTTTCTTGGAAC	0.318																																						dbGAP											0													129.0	130.0	130.0					2																	136579592		2203	4300	6503	-	-	-	SO:0001583	missense	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.984A>T	2.37:g.136579592T>A	ENSP00000264162:p.Lys328Asn		Q4ZG58	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.K328N	ENST00000264162.2	37	c.984	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	T	15.50	2.851777	0.51270	.	.	ENSG00000115850	ENST00000264162	T	0.28895	1.59	5.44	4.3	0.51218	.	0.670270	0.15423	N	0.263126	T	0.25005	0.0607	L	0.40543	1.245	0.29057	N	0.884156	B	0.18610	0.029	B	0.16722	0.016	T	0.14008	-1.0488	10	0.42905	T	0.14	-33.6813	8.7116	0.34387	0.0:0.09:0.0:0.91	.	328	P09848	LPH_HUMAN	N	328	ENSP00000264162:K328N	ENSP00000264162:K328N	K	-	3	2	LCT	136296062	0.978000	0.34361	0.940000	0.37924	0.978000	0.69477	1.312000	0.33574	1.103000	0.41568	0.533000	0.62120	AAA	LCT	-	NULL	ENSG00000115850		0.318	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	82	0.00	0	T	NM_002299		136579592	136579592	-1	no_errors	ENST00000264162	ensembl	human	known	69_37n	missense	41	32.79	20	SNP	0.995	A
LRRC37B	114659	genome.wustl.edu	37	17	30349516	30349516	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr17:30349516C>T	ENST00000341671.7	+	1	1356	c.1351C>T	c.(1351-1353)Ctt>Ttt	p.L451F	LRRC37B_ENST00000584368.1_Missense_Mutation_p.L463F|LRRC37B_ENST00000543378.2_Missense_Mutation_p.L369F|LRRC37B_ENST00000327564.7_Missense_Mutation_p.L478F|LRRC37B_ENST00000394713.3_Missense_Mutation_p.L451F|LRRC37B_ENST00000581786.1_3'UTR	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B	451						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				AGACCCGGGGCTTGCCATAAC	0.537																																						dbGAP											0													96.0	101.0	99.0					17																	30349516		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.1351C>T	17.37:g.30349516C>T	ENSP00000340519:p.Leu451Phe		Q17RC9|Q5YKG6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L451F	ENST00000341671.7	37	c.1351	CCDS32609.1	17	.	.	.	.	.	.	.	.	.	.	N	10.33	1.321577	0.23994	.	.	ENSG00000185158	ENST00000543378;ENST00000327564;ENST00000394713;ENST00000341671	T;T;T;T	0.67171	-0.18;-0.25;0.85;-0.24	1.4	0.283	0.15696	.	.	.	.	.	T	0.57562	0.2062	M	0.80332	2.49	0.09310	N	1	B;P	0.48694	0.349;0.914	B;B	0.33568	0.097;0.166	T	0.54207	-0.8328	9	0.56958	D	0.05	.	4.6017	0.12357	0.3746:0.6253:0.0:0.0	.	451;451	Q17RC9;Q96QE4	.;LR37B_HUMAN	F	369;478;451;451	ENSP00000443345:L369F;ENSP00000332536:L478F;ENSP00000378202:L451F;ENSP00000340519:L451F	ENSP00000332536:L478F	L	+	1	0	LRRC37B	27373629	0.000000	0.05858	0.001000	0.08648	0.063000	0.16089	-0.054000	0.11826	0.123000	0.18342	0.186000	0.17326	CTT	LRRC37B	-	NULL	ENSG00000185158		0.537	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37B	HGNC	protein_coding	OTTHUMT00000446508.1	86	0.00	0	C	NM_052888		30349516	30349516	+1	no_errors	ENST00000341671	ensembl	human	known	69_37n	missense	47	39.74	31	SNP	0.001	T
MAP1LC3B2	643246	genome.wustl.edu	37	12	117014080	117014080	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr12:117014080G>T	ENST00000556529.1	+	1	425	c.333G>T	c.(331-333)atG>atT	p.M111I	MAP1LC3B2_ENST00000306985.4_Missense_Mutation_p.M111I			A6NCE7	MP3B2_HUMAN	microtubule-associated protein 1 light chain 3 beta 2	111					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|microtubule (GO:0005874)				breast(1)|large_intestine(2)|lung(3)	6						TCCTGTACATGGTCTGTGCCT	0.438																																						dbGAP											0													172.0	165.0	167.0					12																	117014080		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS41841.1	12q24.22	2014-02-12			ENSG00000171471	ENSG00000171471			34390	protein-coding gene	gene with protein product							Standard	NM_001085481		Approved	ATG8G	uc009zwk.1	A6NCE7		ENST00000556529.1:c.333G>T	12.37:g.117014080G>T	ENSP00000450524:p.Met111Ile			Missense_Mutation	SNP	pfam_Atg8_ubiquitin-like,pfam_Autophagy-rel_prot_12	p.M111I	ENST00000556529.1	37	c.333	CCDS41841.1	12	.	.	.	.	.	.	.	.	.	.	g	6.527	0.465514	0.12402	.	.	ENSG00000171471	ENST00000306985;ENST00000556529	T;T	0.39997	1.05;1.05	2.39	2.39	0.29439	.	0.045219	0.85682	D	0.000000	T	0.25827	0.0629	N	0.25890	0.77	0.51482	D	0.999923	B	0.15930	0.015	B	0.21917	0.037	T	0.04961	-1.0915	10	0.09338	T	0.73	-15.4374	10.6017	0.45371	0.0:0.0:1.0:0.0	.	111	A6NCE7	MP3B2_HUMAN	I	111	ENSP00000305059:M111I;ENSP00000450524:M111I	ENSP00000305059:M111I	M	+	3	0	MAP1LC3B2	115498463	1.000000	0.71417	0.168000	0.22838	0.197000	0.23852	6.584000	0.74057	1.376000	0.46267	0.375000	0.23000	ATG	MAP1LC3B2	-	pfam_Atg8_ubiquitin-like,pfam_Autophagy-rel_prot_12	ENSG00000171471		0.438	MAP1LC3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1LC3B2	HGNC	protein_coding	OTTHUMT00000413900.1	79	0.00	0	G	NM_001085481		117014080	117014080	+1	no_errors	ENST00000306985	ensembl	human	known	69_37n	missense	57	16.18	11	SNP	1.000	T
MLH1	4292	genome.wustl.edu	37	3	37091999	37091999	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr3:37091999C>A	ENST00000231790.2	+	19	2342	c.2126C>A	c.(2125-2127)cCa>cAa	p.P709Q	MLH1_ENST00000455445.2_Missense_Mutation_p.P468Q|MLH1_ENST00000435176.1_Missense_Mutation_p.P611Q|MLH1_ENST00000536378.1_Intron|MLH1_ENST00000539477.1_Missense_Mutation_p.P468Q|MLH1_ENST00000458205.2_Missense_Mutation_p.P468Q	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	709				Missing (in Ref. 4; AAA85687). {ECO:0000305}.	ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						GGCTCCATTCCAAACTCCTGG	0.473		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													dbGAP	yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	1	Whole gene deletion(1)	ovary(1)											95.0	85.0	88.0					3																	37091999		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.2126C>A	3.37:g.37091999C>A	ENSP00000231790:p.Pro709Gln		B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_C,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,tigrfam_DNA_mismatch_repair_N	p.P709Q	ENST00000231790.2	37	c.2126	CCDS2663.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.03|16.03	3.008508|3.008508	0.54361|0.54361	.|.	.|.	ENSG00000076242|ENSG00000076242	ENST00000231790;ENST00000383761;ENST00000421440;ENST00000458205;ENST00000539477;ENST00000455445;ENST00000435176|ENST00000396438;ENST00000456676;ENST00000413740	D;D;D;D;D|D	0.90444|0.95853	-2.67;-2.67;-2.67;-2.67;-2.67|-3.83	5.41|5.41	3.59|3.59	0.41128|0.41128	.|.	0.847151|.	0.10782|.	N|.	0.634785|.	D|D	0.93321|0.93321	0.7871|0.7871	L|L	0.47716|0.47716	1.5|1.5	0.09310|0.09310	N|N	1|1	B;B;B;B;B|.	0.20052|.	0.012;0.041;0.006;0.024;0.0|.	B;B;B;B;B|.	0.19946|.	0.019;0.027;0.013;0.019;0.004|.	D|D	0.84720|0.84720	0.0739|0.0739	10|7	0.13470|0.25751	T|T	0.59|0.34	0.8998|0.8998	9.8566|9.8566	0.41090|0.41090	0.0:0.7868:0.1389:0.0743|0.0:0.7868:0.1389:0.0743	.|.	611;709;468;709;709|.	E9PCU2;B2R6K0;B4DI13;Q53GX1;P40692|.	.;.;.;.;MLH1_HUMAN|.	Q|K	709;504;127;468;468;468;611|107;632;105	ENSP00000231790:P709Q;ENSP00000402667:P468Q;ENSP00000443665:P468Q;ENSP00000398272:P468Q;ENSP00000402564:P611Q|ENSP00000416476:Q105K	ENSP00000231790:P709Q|ENSP00000379715:Q107K	P|Q	+|+	2|1	0|0	MLH1|MLH1	37067003|37067003	0.004000|0.004000	0.15560|0.15560	0.030000|0.030000	0.17652|0.17652	0.936000|0.936000	0.57629|0.57629	1.349000|1.349000	0.33998|0.33998	0.645000|0.645000	0.30675|0.30675	0.650000|0.650000	0.86243|0.86243	CCA|CAA	MLH1	-	NULL	ENSG00000076242		0.473	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLH1	HGNC	protein_coding	OTTHUMT00000253337.2	49	0.00	0	C	NM_000249		37091999	37091999	+1	no_errors	ENST00000231790	ensembl	human	known	69_37n	missense	25	34.21	13	SNP	0.052	A
MTMR11	10903	genome.wustl.edu	37	1	149903191	149903191	+	Silent	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr1:149903191G>T	ENST00000439741.2	-	13	1501	c.1251C>A	c.(1249-1251)ccC>ccA	p.P417P	SF3B4_ENST00000271628.8_5'Flank|MTMR11_ENST00000492824.1_Intron|MTMR11_ENST00000406732.3_Intron|MTMR11_ENST00000361405.6_Intron|MTMR11_ENST00000369140.3_Silent_p.P345P	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11	417	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.						phosphatase activity (GO:0016791)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			GAGTCAGGAAGGGATGTCCAG	0.537																																						dbGAP											0													74.0	73.0	73.0					1																	149903191		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.1251C>A	1.37:g.149903191G>T			B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	Silent	SNP	pfam_Myotubularin_assoc,pfam_Myotub-related	p.P417	ENST00000439741.2	37	c.1251	CCDS53360.1	1	.	.	.	.	.	.	.	.	.	.	G	8.889	0.953576	0.18431	.	.	ENSG00000014914	ENST00000405710	.	.	.	6.17	0.856	0.19019	.	.	.	.	.	T	0.33498	0.0865	.	.	.	0.80722	D	1	P	0.39326	0.668	B	0.37346	0.247	T	0.21586	-1.0241	7	0.66056	D	0.02	.	10.3998	0.44222	0.3425:0.0:0.6575:0.0	.	244	F8W8W0	.	I	244	.	ENSP00000384228:L244I	L	-	1	0	MTMR11	148169815	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	1.138000	0.31491	-0.079000	0.12707	0.655000	0.94253	CTT	MTMR11	-	NULL	ENSG00000014914		0.537	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR11	HGNC	protein_coding		67	0.00	0	G	NM_181873		149903191	149903191	-1	no_errors	ENST00000439741	ensembl	human	known	69_37n	silent	33	10.81	4	SNP	1.000	T
MYRIP	25924	genome.wustl.edu	37	3	40192594	40192594	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr3:40192594A>C	ENST00000302541.6	+	4	730	c.388A>C	c.(388-390)Aag>Cag	p.K130Q	MYRIP_ENST00000459828.1_3'UTR|MYRIP_ENST00000539167.1_5'UTR|MYRIP_ENST00000396217.3_Intron|MYRIP_ENST00000444716.1_Missense_Mutation_p.K130Q|MYRIP_ENST00000425621.1_Missense_Mutation_p.K130Q	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	130				K -> E (in Ref. 3; BAG54185). {ECO:0000305}.	intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		GAGCCGCTTCAAGCGCTTTGG	0.473																																						dbGAP											0													36.0	38.0	37.0					3																	40192594		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.388A>C	3.37:g.40192594A>C	ENSP00000301972:p.Lys130Gln		B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Missense_Mutation	SNP	pfam_Myelin-assoc_OBP,superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	p.K130Q	ENST00000302541.6	37	c.388	CCDS2689.1	3	.	.	.	.	.	.	.	.	.	.	A	29.7	5.028341	0.93518	.	.	ENSG00000170011	ENST00000444716;ENST00000302541;ENST00000425621	T;T;T	0.77620	-1.11;-1.11;-1.11	5.82	5.82	0.92795	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.85673	0.5751	M	0.63843	1.955	0.80722	D	1	D;D;D	0.71674	0.996;0.998;0.996	D;D;D	0.77004	0.974;0.989;0.967	D	0.85443	0.1156	9	.	.	.	.	14.1342	0.65276	1.0:0.0:0.0:0.0	.	130;130;130	B3KWW4;G3XAI8;Q8NFW9	.;.;MYRIP_HUMAN	Q	130	ENSP00000398665:K130Q;ENSP00000301972:K130Q;ENSP00000389323:K130Q	.	K	+	1	0	MYRIP	40167598	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.665000	0.74442	2.225000	0.72522	0.460000	0.39030	AAG	MYRIP	-	superfamily_Znf_FYVE_PHD	ENSG00000170011		0.473	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYRIP	HGNC	protein_coding	OTTHUMT00000254181.2	38	0.00	0	A	NM_015460		40192594	40192594	+1	no_errors	ENST00000302541	ensembl	human	known	69_37n	missense	13	38.10	8	SNP	1.000	C
NHS	4810	genome.wustl.edu	37	X	17743644	17743644	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chrX:17743644C>A	ENST00000380060.3	+	6	1693	c.1355C>A	c.(1354-1356)gCa>gAa	p.A452E	NHS_ENST00000398097.3_Missense_Mutation_p.A296E	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	473					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					CAAAGCATTGCAGCTTCCCTT	0.517																																						dbGAP											0													190.0	160.0	170.0					X																	17743644		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.1355C>A	X.37:g.17743644C>A	ENSP00000369400:p.Ala452Glu		B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	NULL	p.A452E	ENST00000380060.3	37	c.1355	CCDS14181.1	X	.	.	.	.	.	.	.	.	.	.	C	15.92	2.975932	0.53720	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.58506	0.37;0.33	5.97	5.01	0.66863	.	0.413235	0.29715	N	0.011383	T	0.64681	0.2620	M	0.71206	2.165	0.39894	D	0.973802	P;P;P;D	0.57571	0.867;0.779;0.779;0.98	B;B;B;P	0.55303	0.369;0.369;0.369;0.773	T	0.69928	-0.5012	10	0.72032	D	0.01	-5.9854	6.0609	0.19837	0.0:0.7563:0.0:0.2437	.	473;294;296;452	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	E	452;296;294	ENSP00000369400:A452E;ENSP00000381170:A296E	ENSP00000369397:A294E	A	+	2	0	NHS	17653565	0.994000	0.37717	0.998000	0.56505	0.974000	0.67602	3.023000	0.49666	2.527000	0.85204	0.600000	0.82982	GCA	NHS	-	NULL	ENSG00000188158		0.517	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHS	HGNC	protein_coding	OTTHUMT00000059120.1	47	0.00	0	C	NM_198270		17743644	17743644	+1	no_errors	ENST00000380060	ensembl	human	known	69_37n	missense	26	36.59	15	SNP	0.994	A
OGDH	4967	genome.wustl.edu	37	7	44735647	44735647	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr7:44735647G>C	ENST00000222673.5	+	13	1734	c.1692G>C	c.(1690-1692)aaG>aaC	p.K564N	OGDH_ENST00000543843.1_Missense_Mutation_p.K515N|OGDH_ENST00000439616.2_Missense_Mutation_p.K414N|OGDH_ENST00000449767.1_Missense_Mutation_p.K560N|OGDH_ENST00000444676.1_Missense_Mutation_p.K579N|OGDH_ENST00000447398.1_Missense_Mutation_p.K575N	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	564					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	AGTATGATAAGATCTGTGAGG	0.512																																						dbGAP											0													97.0	89.0	92.0					7																	44735647		2203	4300	6503	-	-	-	SO:0001583	missense	0			D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.1692G>C	7.37:g.44735647G>C	ENSP00000222673:p.Lys564Asn		B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.K564N	ENST00000222673.5	37	c.1692	CCDS34627.1	7	.	.	.	.	.	.	.	.	.	.	G	10.57	1.385997	0.25031	.	.	ENSG00000105953	ENST00000439616;ENST00000449767;ENST00000447398;ENST00000444676;ENST00000222673;ENST00000543843	D;D;D;D;D;D	0.96554	-4.05;-4.05;-4.05;-4.05;-4.05;-4.05	4.87	3.99	0.46301	Dehydrogenase, E1 component (1);	0.043829	0.85682	N	0.000000	D	0.89726	0.6798	N	0.12502	0.225	0.52501	D	0.999952	B;B;B;B;B;B	0.19583	0.009;0.037;0.004;0.018;0.002;0.018	B;B;B;B;B;B	0.24006	0.05;0.05;0.05;0.05;0.02;0.05	D	0.84093	0.0391	10	0.18710	T	0.47	-42.2151	9.5007	0.39015	0.1634:0.0:0.8366:0.0	.	359;414;560;575;466;564	B4E3E9;E9PFG7;E9PBM1;E9PDF2;A2VCT2;Q02218	.;.;.;.;.;ODO1_HUMAN	N	414;560;575;579;564;515	ENSP00000398576:K414N;ENSP00000392878:K560N;ENSP00000388183:K575N;ENSP00000414662:K579N;ENSP00000222673:K564N;ENSP00000443821:K515N	ENSP00000222673:K564N	K	+	3	2	OGDH	44702172	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.327000	0.65881	1.281000	0.44480	0.655000	0.94253	AAG	OGDH	-	pfam_DH_E1,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000105953		0.512	OGDH-001	KNOWN	basic|CCDS	protein_coding	OGDH	HGNC	protein_coding	OTTHUMT00000339391.1	44	0.00	0	G			44735647	44735647	+1	no_errors	ENST00000222673	ensembl	human	known	69_37n	missense	13	61.76	21	SNP	1.000	C
NRCAM	4897	genome.wustl.edu	37	7	107834872	107834872	+	Splice_Site	SNP	C	C	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr7:107834872C>T	ENST00000425651.2	-	13	1463	c.1464G>A	c.(1462-1464)tgG>tgA	p.W488*	NRCAM_ENST00000413765.2_Splice_Site_p.W469*|NRCAM_ENST00000379024.4_Splice_Site_p.W469*|NRCAM_ENST00000351718.4_Splice_Site_p.W482*|NRCAM_ENST00000379022.4_Splice_Site_p.W488*|NRCAM_ENST00000379028.3_Splice_Site_p.W488*	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	488	Ig-like 5.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						CTCCTTTAAACCTTCATTACA	0.333																																						dbGAP											0													35.0	33.0	34.0					7																	107834872		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.1464-1G>A	7.37:g.107834872C>T			A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.W488*	ENST00000425651.2	37	c.1464	CCDS47686.1	7	.	.	.	.	.	.	.	.	.	.	C	43	10.014315	0.99318	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022;ENST00000445979	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	.	.	.	X	488;488;469;488;482;469;488;488;482	.	ENSP00000325269:W482X	W	-	3	0	NRCAM	107622108	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.294000	0.78760	2.832000	0.97577	0.655000	0.94253	TGG	NRCAM	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000091129		0.333	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NRCAM	HGNC	protein_coding	OTTHUMT00000337942.2	14	0.00	0	C	NM_001037132	Nonsense_Mutation	107834872	107834872	-1	no_errors	ENST00000379028	ensembl	human	known	69_37n	nonsense	12	40.00	8	SNP	1.000	T
NOBOX	135935	genome.wustl.edu	37	7	144096125	144096125	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr7:144096125G>T	ENST00000467773.1	-	8	1386	c.1387C>A	c.(1387-1389)Ccc>Acc	p.P463T	NOBOX_ENST00000483238.1_Missense_Mutation_p.P431T|NOBOX_ENST00000223140.5_Missense_Mutation_p.P346T	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	463	Pro-rich.				oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					ATCAGTTGGGGGGTGTGGACA	0.642																																						dbGAP											0													10.0	11.0	11.0					7																	144096125		1914	4134	6048	-	-	-	SO:0001583	missense	0					7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.1387C>A	7.37:g.144096125G>T	ENSP00000419457:p.Pro463Thr		A6NCD3|A8MZN5	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.P463T	ENST00000467773.1	37	c.1387		7	.	.	.	.	.	.	.	.	.	.	G	8.445	0.851652	0.17034	.	.	ENSG00000106410	ENST00000483238;ENST00000467773;ENST00000223140	D;D;D	0.94897	-3.47;-3.52;-3.55	4.78	0.683	0.17998	.	0.604283	0.16452	N	0.213827	D	0.93913	0.8052	M	0.65498	2.005	0.09310	N	1	D	0.63046	0.992	P	0.55011	0.766	D	0.86775	0.1975	10	0.56958	D	0.05	-5.3791	3.9747	0.09468	0.3881:0.0:0.4557:0.1562	.	463	O60393	NOBOX_HUMAN	T	431;463;346	ENSP00000419565:P431T;ENSP00000419457:P463T;ENSP00000223140:P346T	ENSP00000223140:P346T	P	-	1	0	NOBOX	143727058	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-0.720000	0.04969	-0.177000	0.10690	-0.345000	0.07892	CCC	NOBOX	-	NULL	ENSG00000106410		0.642	NOBOX-002	KNOWN	basic	protein_coding	NOBOX	HGNC	protein_coding	OTTHUMT00000350095.1	8	0.00	0	G	XM_001134420		144096125	144096125	-1	no_errors	ENST00000467773	ensembl	human	known	69_37n	missense	9	40.00	6	SNP	0.000	T
OR10T2	128360	genome.wustl.edu	37	1	158368836	158368836	+	Silent	SNP	G	G	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr1:158368836G>A	ENST00000334438.1	-	1	420	c.421C>T	c.(421-423)Ctg>Ttg	p.L141L		NM_001004475.1	NP_001004475.1	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T, member 2	141						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_hematologic(112;0.0378)					TCCAACCCCAGCCTTTTGTTT	0.473																																						dbGAP											0													102.0	101.0	101.0					1																	158368836		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB065643	CCDS30895.1	1q23.1	2012-08-09			ENSG00000186306	ENSG00000186306		"""GPCR / Class A : Olfactory receptors"""	14816	protein-coding gene	gene with protein product							Standard	NM_001004475		Approved		uc010pih.2	Q8NGX3	OTTHUMG00000017521	ENST00000334438.1:c.421C>T	1.37:g.158368836G>A			Q6IF98	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L141	ENST00000334438.1	37	c.421	CCDS30895.1	1																																																																																			OR10T2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000186306		0.473	OR10T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10T2	HGNC	protein_coding	OTTHUMT00000046371.1	63	0.00	0	G	NM_001004475		158368836	158368836	-1	no_errors	ENST00000334438	ensembl	human	known	69_37n	silent	19	42.42	14	SNP	0.000	A
OR13J1	392309	genome.wustl.edu	37	9	35870156	35870156	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr9:35870156C>A	ENST00000377981.2	-	1	305	c.243G>T	c.(241-243)atG>atT	p.M81I		NM_001004487.1	NP_001004487.1	Q8NGT2	O13J1_HUMAN	olfactory receptor, family 13, subfamily J, member 1	81						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_epithelial(49;0.169)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00494)|STAD - Stomach adenocarcinoma(86;0.194)			GGTGGACCAGCATCAGAGGCA	0.582																																						dbGAP											0													128.0	120.0	122.0					9																	35870156		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35011.1	9p13.3	2013-09-24			ENSG00000168828	ENSG00000168828		"""GPCR / Class A : Olfactory receptors"""	15108	protein-coding gene	gene with protein product							Standard	NM_001004487		Approved		uc011lph.2	Q8NGT2	OTTHUMG00000019879	ENST00000377981.2:c.243G>T	9.37:g.35870156C>A	ENSP00000367219:p.Met81Ile		B2RN66|Q6IF20|Q96R40	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M81I	ENST00000377981.2	37	c.243	CCDS35011.1	9	.	.	.	.	.	.	.	.	.	.	C	13.47	2.245851	0.39697	.	.	ENSG00000168828	ENST00000377981	T	0.05513	3.43	4.68	4.68	0.58851	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	T	0.23886	0.0578	M	0.79258	2.445	0.42258	D	0.992002	D	0.56521	0.976	D	0.66351	0.943	T	0.00147	-1.1990	10	0.40728	T	0.16	.	15.9177	0.79535	0.0:1.0:0.0:0.0	.	81	Q8NGT2	O13J1_HUMAN	I	81	ENSP00000367219:M81I	ENSP00000367219:M81I	M	-	3	0	OR13J1	35860156	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.149000	0.31626	2.890000	0.99128	0.650000	0.86243	ATG	OR13J1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000168828		0.582	OR13J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13J1	HGNC	protein_coding	OTTHUMT00000052381.1	53	0.00	0	C			35870156	35870156	-1	no_errors	ENST00000377981	ensembl	human	known	69_37n	missense	47	33.80	24	SNP	1.000	A
OR52B2	255725	genome.wustl.edu	37	11	6190716	6190716	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr11:6190716G>T	ENST00000530810.1	-	1	922	c.841C>A	c.(841-843)Ctt>Att	p.L281I	RP11-290F24.3_ENST00000529961.1_RNA	NM_001004052.1	NP_001004052.1	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B, member 2	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(15)	21		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCCACATAAAGATTGGCCAGC	0.443																																					NSCLC(5;186 261 1778 7098 14207)	dbGAP											0													93.0	89.0	90.0					11																	6190716		1954	4149	6103	-	-	-	SO:0001583	missense	0			AB065763	CCDS53598.1	11p15.4	2012-08-09				ENSG00000255307		"""GPCR / Class A : Olfactory receptors"""	15207	protein-coding gene	gene with protein product							Standard	NM_001004052		Approved		uc010qzy.2	Q96RD2		ENST00000530810.1:c.841C>A	11.37:g.6190716G>T	ENSP00000432011:p.Leu281Ile		Q8NGM7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L281I	ENST00000530810.1	37	c.841	CCDS53598.1	11	.	.	.	.	.	.	.	.	.	.	G	12.85	2.062104	0.36373	.	.	ENSG00000255307	ENST00000530810	T	0.00241	8.46	5.19	5.19	0.71726	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00356	0.0011	N	0.25031	0.7	0.30601	N	0.760478	D	0.76494	0.999	D	0.87578	0.998	T	0.81037	-0.1114	9	0.38643	T	0.18	.	17.8823	0.88844	0.0:0.0:1.0:0.0	.	281	Q96RD2	O52B2_HUMAN	I	281	ENSP00000432011:L281I	ENSP00000432011:L281I	L	-	1	0	OR52B2	6147292	0.000000	0.05858	1.000000	0.80357	0.145000	0.21501	-0.111000	0.10807	2.706000	0.92434	0.453000	0.30009	CTT	OR52B2	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000255307		0.443	OR52B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52B2	HGNC	protein_coding	OTTHUMT00000385977.1	47	0.00	0	G	NM_001004052		6190716	6190716	-1	no_errors	ENST00000530810	ensembl	human	known	69_37n	missense	15	31.82	7	SNP	1.000	T
OR7C1	26664	genome.wustl.edu	37	19	14910104	14910104	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr19:14910104G>T	ENST00000248073.2	-	1	919	c.845C>A	c.(844-846)aCc>aAc	p.T282N	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	282					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						CAGCATGGGGGTGACCATGGT	0.527																																						dbGAP											0													95.0	90.0	92.0					19																	14910104		2203	4300	6503	-	-	-	SO:0001583	missense	0			X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.845C>A	19.37:g.14910104G>T	ENSP00000248073:p.Thr282Asn		Q15621|Q6IFP2|Q96R94	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T282N	ENST00000248073.2	37	c.845	CCDS12317.1	19	.	.	.	.	.	.	.	.	.	.	g	11.54	1.670372	0.29693	.	.	ENSG00000127530	ENST00000248073	T	0.27890	1.64	3.64	3.64	0.41730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35870	U	0.002927	T	0.55924	0.1951	M	0.88450	2.955	0.09310	N	0.999995	D	0.67145	0.996	D	0.67548	0.952	T	0.50767	-0.8789	10	0.87932	D	0	.	9.2808	0.37727	0.0:0.2215:0.7785:0.0	.	282	O76099	OR7C1_HUMAN	N	282	ENSP00000248073:T282N	ENSP00000248073:T282N	T	-	2	0	OR7C1	14771104	0.000000	0.05858	0.983000	0.44433	0.105000	0.19272	0.742000	0.26216	2.024000	0.59613	0.543000	0.68304	ACC	OR7C1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000127530		0.527	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7C1	HGNC	protein_coding	OTTHUMT00000466519.1	53	0.00	0	G			14910104	14910104	-1	no_errors	ENST00000248073	ensembl	human	known	69_37n	missense	25	44.44	20	SNP	0.461	T
P4HA1	5033	genome.wustl.edu	37	10	74769591	74769591	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr10:74769591C>A	ENST00000307116.2	-	14	1624	c.1508G>T	c.(1507-1509)tGt>tTt	p.C503F	P4HA1_ENST00000394890.2_Missense_Mutation_p.C503F|P4HA1_ENST00000440381.1_Missense_Mutation_p.C485F|P4HA1_ENST00000412021.2_Missense_Mutation_p.C503F|P4HA1_ENST00000263556.3_Missense_Mutation_p.C503F|P4HA1_ENST00000373008.2_Missense_Mutation_p.C503F			P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha polypeptide I	503	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				collagen fibril organization (GO:0030199)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|procollagen-proline 4-dioxygenase complex (GO:0016222)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TAGCACTGGACAGGCTGCATG	0.368																																					Colon(147;367 2405 2662 52127)	dbGAP											0													83.0	81.0	82.0					10																	74769591		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7320.1, CCDS41537.1, CCDS44432.1	10q21.3-q23.1	2008-12-09	2008-12-09		ENSG00000122884	ENSG00000122884	1.14.11.2		8546	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(I)"""	176710	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I"""	P4HA		2556027	Standard	NM_001017962		Approved	C-P4Halpha(I)	uc001jtg.3	P13674	OTTHUMG00000018449	ENST00000307116.2:c.1508G>T	10.37:g.74769591C>A	ENSP00000307318:p.Cys503Phe		C9JL12|Q15082|Q15083|Q5VSQ5	Missense_Mutation	SNP	pfam_Pro_4_hyd_alph_N,pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.C503F	ENST00000307116.2	37	c.1508		10	.	.	.	.	.	.	.	.	.	.	C	26.4	4.730631	0.89390	.	.	ENSG00000122884	ENST00000307116;ENST00000373008;ENST00000412021;ENST00000394890;ENST00000263556;ENST00000440381	T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	5.47	5.47	0.80525	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	D	0.92312	0.7561	H	0.96489	3.83	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.993;0.993	D	0.94419	0.7639	10	0.87932	D	0	0.415	18.934	0.92577	0.0:1.0:0.0:0.0	.	485;503;503	C9JL12;Q5VSQ6;P13674	.;.;P4HA1_HUMAN	F	503;503;503;503;503;485	ENSP00000307318:C503F;ENSP00000362099:C503F;ENSP00000411688:C503F;ENSP00000378353:C503F;ENSP00000263556:C503F;ENSP00000414464:C485F	ENSP00000263556:C503F	C	-	2	0	P4HA1	74439597	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.391000	0.79828	2.593000	0.87608	0.655000	0.94253	TGT	P4HA1	-	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	ENSG00000122884		0.368	P4HA1-001	KNOWN	basic	protein_coding	P4HA1	HGNC	protein_coding	OTTHUMT00000048601.1	59	0.00	0	C	NM_000917		74769591	74769591	-1	no_errors	ENST00000263556	ensembl	human	known	69_37n	missense	32	27.27	12	SNP	1.000	A
PAGE1	8712	genome.wustl.edu	37	X	49459370	49459370	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chrX:49459370C>T	ENST00000376150.3	-	2	136	c.4G>A	c.(4-6)Ggt>Agt	p.G2S		NM_003785.3	NP_003776.2	O75459	PAGE1_HUMAN	P antigen family, member 1 (prostate associated)	2					cellular defense response (GO:0006968)					endometrium(1)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	7	Ovarian(276;0.236)					CTTAGAAAACCCATATTTCAC	0.373																																						dbGAP											0													70.0	58.0	62.0					X																	49459370		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF058989	CCDS14327.1	Xp11.23	2009-06-17	2005-01-26	2005-01-27	ENSG00000068985	ENSG00000068985			4107	protein-coding gene	gene with protein product		300288	"""G antigen, family B, 1 (prostate associated)"""	GAGEB1		9651357, 9724777	Standard	NM_003785		Approved	PAGE-1, GAGE-9, CT16.3	uc004dom.3	O75459	OTTHUMG00000033224	ENST00000376150.3:c.4G>A	X.37:g.49459370C>T	ENSP00000365320:p.Gly2Ser		Q6FGM3|Q9BSS7	Missense_Mutation	SNP	pfam_GAGE	p.G2S	ENST00000376150.3	37	c.4	CCDS14327.1	X	.	.	.	.	.	.	.	.	.	.	C	3.499	-0.102296	0.06967	.	.	ENSG00000068985	ENST00000376150	T	0.07216	3.21	1.63	0.459	0.16678	.	.	.	.	.	T	0.02494	0.0076	N	0.04636	-0.2	0.09310	N	1	B	0.20780	0.048	B	0.16289	0.015	T	0.44406	-0.9330	9	0.02654	T	1	.	2.9627	0.05897	0.0:0.3079:0.0:0.6921	.	2	O75459	GAGB1_HUMAN	S	2	ENSP00000365320:G2S	ENSP00000365320:G2S	G	-	1	0	PAGE1	49346081	0.895000	0.30542	0.005000	0.12908	0.032000	0.12392	0.177000	0.16801	0.048000	0.15891	-0.422000	0.05995	GGT	PAGE1	-	pfam_GAGE	ENSG00000068985		0.373	PAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAGE1	HGNC	protein_coding	OTTHUMT00000081210.1	58	0.00	0	C			49459370	49459370	-1	no_errors	ENST00000376150	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	0.005	T
PDPR	55066	genome.wustl.edu	37	16	70162893	70162893	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr16:70162893C>G	ENST00000288050.4	+	6	1432	c.475C>G	c.(475-477)Ccc>Gcc	p.P159A	PDPR_ENST00000398122.3_Missense_Mutation_p.P59A|PDPR_ENST00000568530.1_Missense_Mutation_p.P159A	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	159					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		GATCATCTCCCCCAAGAAAGT	0.552																																						dbGAP											0													56.0	58.0	57.0					16																	70162893		1825	4009	5834	-	-	-	SO:0001583	missense	0				CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.475C>G	16.37:g.70162893C>G	ENSP00000288050:p.Pro159Ala		A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_FAD_bind_dom	p.P159A	ENST00000288050.4	37	c.475	CCDS45520.1	16	.	.	.	.	.	.	.	.	.	.	C	15.55	2.865528	0.51588	.	.	ENSG00000090857	ENST00000288050;ENST00000398122	T;T	0.79845	-1.31;-1.31	4.5	3.54	0.40534	FAD dependent oxidoreductase (1);	0.114328	0.64402	D	0.000011	T	0.74935	0.3782	L	0.46157	1.445	0.80722	D	1	B	0.28820	0.224	B	0.31812	0.136	T	0.72293	-0.4336	10	0.52906	T	0.07	.	11.3044	0.49325	0.0:0.9098:0.0:0.0902	.	159	Q8NCN5	PDPR_HUMAN	A	159;59	ENSP00000288050:P159A;ENSP00000381190:P59A	ENSP00000288050:P159A	P	+	1	0	PDPR	68720394	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	5.353000	0.66034	0.871000	0.35750	0.557000	0.71058	CCC	PDPR	-	pfam_FAD-dep_OxRdtase,pfam_FAD_bind_dom	ENSG00000090857		0.552	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDPR	HGNC	protein_coding	OTTHUMT00000434502.1	76	0.00	0	C	NM_017990		70162893	70162893	+1	no_errors	ENST00000288050	ensembl	human	known	69_37n	missense	50	27.54	19	SNP	1.000	G
PHOSPHO2	493911	genome.wustl.edu	37	2	170557587	170557587	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr2:170557587C>T	ENST00000359744.3	+	4	494	c.106C>T	c.(106-108)Cgt>Tgt	p.R36C	KLHL23_ENST00000602521.1_Intron|KLHL23_ENST00000272797.4_Intron	NM_001008489.3|NM_001199285.1|NM_001199286.1|NM_001199288.1	NP_001008489.1|NP_001186214.1|NP_001186215.1|NP_001186217.1	Q8TCD6	PHOP2_HUMAN	phosphatase, orphan 2	36							metal ion binding (GO:0046872)|pyridoxal phosphatase activity (GO:0033883)			breast(1)|large_intestine(1)|lung(6)|skin(2)	10						TATTGAACTACGTGATTCTTA	0.348																																						dbGAP											0													95.0	97.0	97.0					2																	170557587		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022324	CCDS33319.1	2q31.1	2008-02-05			ENSG00000144362	ENSG00000144362			28316	protein-coding gene	gene with protein product						16054448	Standard	NM_001199285		Approved	MGC22679	uc021vsh.1	Q8TCD6	OTTHUMG00000153981	ENST00000359744.3:c.106C>T	2.37:g.170557587C>T	ENSP00000352782:p.Arg36Cys		B2RC30|D3DPC7	Missense_Mutation	SNP	pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,pirsf_Pase_PHOSPHO-typ,tigrfam_PyrdxlP_Pase-rel,tigrfam_HAD-SF_hydro_IB_PSP-like	p.R36C	ENST00000359744.3	37	c.106	CCDS33319.1	2	.	.	.	.	.	.	.	.	.	.	C	11.12	1.544717	0.27563	.	.	ENSG00000144362	ENST00000359744;ENST00000438838;ENST00000438710;ENST00000449906	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.24	-3.01	0.05463	HAD-like domain (1);	0.573160	0.16867	U	0.196262	T	0.55401	0.1918	L	0.58510	1.815	0.09310	N	1	D	0.57571	0.98	P	0.55303	0.773	T	0.61078	-0.7135	10	0.40728	T	0.16	.	18.6012	0.91248	0.6506:0.3494:0.0:0.0	.	36	Q8TCD6	PHOP2_HUMAN	C	36	ENSP00000352782:R36C;ENSP00000393983:R36C;ENSP00000411844:R36C;ENSP00000416790:R36C	ENSP00000352782:R36C	R	+	1	0	PHOSPHO2	170265833	0.000000	0.05858	0.019000	0.16419	0.212000	0.24457	-0.451000	0.06795	-0.242000	0.09667	-0.989000	0.02550	CGT	PHOSPHO2	-	pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,pirsf_Pase_PHOSPHO-typ,tigrfam_PyrdxlP_Pase-rel,tigrfam_HAD-SF_hydro_IB_PSP-like	ENSG00000144362		0.348	PHOSPHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHOSPHO2	HGNC	protein_coding	OTTHUMT00000333304.1	49	0.00	0	C	NM_001008489		170557587	170557587	+1	no_errors	ENST00000359744	ensembl	human	known	69_37n	missense	20	37.50	12	SNP	0.001	T
PITPNC1	26207	genome.wustl.edu	37	17	65548392	65548392	+	Nonsense_Mutation	SNP	A	A	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr17:65548392A>T	ENST00000581322.1	+	3	217	c.217A>T	c.(217-219)Aga>Tga	p.R73*	PITPNC1_ENST00000580974.1_Nonsense_Mutation_p.R73*|PITPNC1_ENST00000335257.6_Nonsense_Mutation_p.R73*|PITPNC1_ENST00000299954.9_Nonsense_Mutation_p.R73*			Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein, cytoplasmic 1	73					phospholipid transport (GO:0015914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)			breast(1)|kidney(2)|large_intestine(3)|liver(2)|lung(4)|prostate(2)|skin(3)	17	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			TAGTTGGGCTAGAGCTGTTGT	0.403																																						dbGAP											0													108.0	105.0	106.0					17																	65548392		1930	4141	6071	-	-	-	SO:0001587	stop_gained	0			AF171102	CCDS58587.1, CCDS58588.1	17q24.3	2008-02-05							21045	protein-coding gene	gene with protein product		605134				10531358	Standard	NM_012417		Approved	RDGBB1, RDGBB, RDGB-BETA	uc002jgc.4	Q9UKF7		ENST00000581322.1:c.217A>T	17.37:g.65548392A>T	ENSP00000464006:p.Arg73*		A8K473|J3QR20|Q96I07	Nonsense_Mutation	SNP	pfam_PI_transfer,prints_PI_transfer	p.R73*	ENST00000581322.1	37	c.217	CCDS58588.1	17	.	.	.	.	.	.	.	.	.	.	A	41	8.967402	0.99019	.	.	ENSG00000154217	ENST00000335257;ENST00000299954	.	.	.	5.74	3.4	0.38934	.	0.049643	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.3862	12.5496	0.56220	0.5167:0.4833:0.0:0.0	.	.	.	.	X	73	.	ENSP00000299954:R73X	R	+	1	2	PITPNC1	62978854	0.429000	0.25530	0.982000	0.44146	0.985000	0.73830	1.090000	0.30902	0.445000	0.26639	0.460000	0.39030	AGA	PITPNC1	-	pfam_PI_transfer	ENSG00000154217		0.403	PITPNC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PITPNC1	HGNC	protein_coding	OTTHUMT00000447194.1	53	0.00	0	A	NM_012417		65548392	65548392	+1	no_errors	ENST00000335257	ensembl	human	known	69_37n	nonsense	31	46.55	27	SNP	0.839	T
PITRM1	10531	genome.wustl.edu	37	10	3181120	3181120	+	Missense_Mutation	SNP	C	C	T	rs534536142	byFrequency	TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr10:3181120C>T	ENST00000224949.4	-	25	2927	c.2893G>A	c.(2893-2895)Gct>Act	p.A965T	PITRM1-AS1_ENST00000441377.1_RNA|PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000380989.2_Missense_Mutation_p.A966T|PITRM1_ENST00000380994.1_Missense_Mutation_p.A523T|PITRM1_ENST00000464395.1_5'UTR|PITRM1_ENST00000451104.2_Missense_Mutation_p.A867T|PITRM1-AS1_ENST00000601046.1_RNA			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	965					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						GCGACAGGAGCATCTACGGTT	0.478													C|||	2	0.000399361	0.0015	0.0	5008	,	,		21742	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													188.0	189.0	188.0					10																	3181120		2010	4181	6191	-	-	-	SO:0001583	missense	0			AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.2893G>A	10.37:g.3181120C>T	ENSP00000224949:p.Ala965Thr		B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	pfam_Peptidase_M16C_assoc,pfam_Peptidase_M16_C,pfam_Pept_M16_N,superfamily_Metalloenz_metal-bd	p.A966T	ENST00000224949.4	37	c.2896	CCDS59208.1	10	.	.	.	.	.	.	.	.	.	.	c	12.16	1.854644	0.32791	.	.	ENSG00000107959	ENST00000224949;ENST00000380980;ENST00000380989;ENST00000380994;ENST00000451104;ENST00000455371	T;T;T;T;T	0.10005	2.92;2.92;2.92;2.92;2.92	5.54	3.52	0.40303	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.222919	0.46758	D	0.000267	T	0.23727	0.0574	M	0.80183	2.485	0.36163	D	0.848259	B;P;P;P;P;P	0.44090	0.154;0.826;0.763;0.763;0.736;0.763	B;B;P;P;P;P	0.49597	0.103;0.287;0.493;0.493;0.543;0.616	T	0.31558	-0.9939	10	0.40728	T	0.16	-14.5411	12.9813	0.58567	0.4309:0.5691:0.0:0.0	.	958;867;966;965;900;958	E9PDX6;E7ES23;C9JSL2;Q5JRX3;E9PDX7;B4DH07	.;.;.;PREP_HUMAN;.;.	T	965;958;966;523;867;146	ENSP00000224949:A965T;ENSP00000370377:A966T;ENSP00000370382:A523T;ENSP00000401201:A867T;ENSP00000399307:A146T	ENSP00000224949:A965T	A	-	1	0	PITRM1	3171120	0.984000	0.35163	0.292000	0.24919	0.051000	0.14879	1.104000	0.31074	1.271000	0.44313	0.462000	0.41574	GCT	PITRM1	-	superfamily_Metalloenz_metal-bd	ENSG00000107959		0.478	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PITRM1	HGNC	protein_coding	OTTHUMT00000046469.2	69	0.00	0	C			3181120	3181120	-1	no_errors	ENST00000380989	ensembl	human	known	69_37n	missense	41	26.32	15	SNP	0.996	T
PKDREJ	10343	genome.wustl.edu	37	22	46657363	46657363	+	Silent	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr22:46657363G>T	ENST00000253255.5	-	1	1856	c.1857C>A	c.(1855-1857)acC>acA	p.T619T		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	619	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		AGTACAGGATGGTCCCCAGGG	0.438																																						dbGAP											0													69.0	76.0	74.0					22																	46657363		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.1857C>A	22.37:g.46657363G>T			B1AJY3|O95850	Silent	SNP	pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_LipOase_LH2,pfam_Ion_trans_dom,superfamily_Lipase_LipOase,smart_GPS_dom,smart_LipOase_LH2,pfscan_LipOase_LH2,pfscan_REJ-like,prints_PKD_2	p.T619	ENST00000253255.5	37	c.1857	CCDS14073.1	22																																																																																			PKDREJ	-	pfam_PKD/REJ-like,pfscan_REJ-like	ENSG00000130943		0.438	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKDREJ	HGNC	protein_coding	OTTHUMT00000318466.1	20	0.00	0	G	NM_006071		46657363	46657363	-1	no_errors	ENST00000253255	ensembl	human	known	69_37n	silent	6	40.00	4	SNP	0.000	T
RBM20	282996	genome.wustl.edu	37	10	112581284	112581284	+	Silent	SNP	A	A	C			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr10:112581284A>C	ENST00000369519.3	+	11	2965	c.2907A>C	c.(2905-2907)gtA>gtC	p.V969V		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	969					heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						TCAAGGCCGTAGGGAATGGGG	0.522																																						dbGAP											0													114.0	109.0	111.0					10																	112581284		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.2907A>C	10.37:g.112581284A>C			A6NIP5|B5A868|Q5JVI1	Silent	SNP	smart_Znf_U1,smart_RRM_dom,pfscan_Znf_C2H2_matrin,pfscan_RRM_dom	p.V969	ENST00000369519.3	37	c.2907	CCDS44477.1	10																																																																																			RBM20	-	NULL	ENSG00000203867		0.522	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM20	HGNC	protein_coding	OTTHUMT00000050339.2	59	0.00	0	A	NM_001134363		112581284	112581284	+1	no_errors	ENST00000369519	ensembl	human	known	69_37n	silent	5	54.55	6	SNP	0.000	C
RERE	473	genome.wustl.edu	37	1	8421833	8421833	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr1:8421833G>C	ENST00000337907.3	-	18	2640	c.2006C>G	c.(2005-2007)aCa>aGa	p.T669R	RERE_ENST00000400907.2_Intron|RERE_ENST00000400908.2_Missense_Mutation_p.T669R|RERE_ENST00000476556.1_Missense_Mutation_p.T115R|RERE_ENST00000377464.1_Missense_Mutation_p.T401R	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	669					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CTGCGTTTTTGTCTTCTTGGA	0.562																																						dbGAP											0													94.0	90.0	91.0					1																	8421833		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.2006C>G	1.37:g.8421833G>C	ENSP00000338629:p.Thr669Arg		O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	pfam_Atrophin-like,pfam_BAH_dom,pfam_ELM2_dom,pfam_Znf_GATA,superfamily_Homeodomain-like,smart_BAH_dom,smart_SANT/Myb,smart_Znf_GATA,pfscan_BAH_dom,pfscan_ELM2_dom	p.T669R	ENST00000337907.3	37	c.2006	CCDS95.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.156297	0.94686	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908;ENST00000505225	T;T;T;T	0.61859	0.07;3.36;3.36;0.07	5.44	5.44	0.79542	.	.	.	.	.	T	0.48314	0.1493	N	0.22421	0.69	0.51012	D	0.999906	P;B	0.43542	0.81;0.395	B;B	0.44224	0.444;0.247	T	0.35748	-0.9776	9	0.13470	T	0.59	-17.3285	18.2489	0.89996	0.0:0.0:1.0:0.0	.	401;669	B1AKN3;Q9P2R6	.;RERE_HUMAN	R	669;401;115;669;89	ENSP00000338629:T669R;ENSP00000366684:T401R;ENSP00000422246:T115R;ENSP00000383700:T669R	ENSP00000338629:T669R	T	-	2	0	RERE	8344420	1.000000	0.71417	0.993000	0.49108	0.975000	0.68041	9.801000	0.99128	2.576000	0.86940	0.561000	0.74099	ACA	RERE	-	pfam_Atrophin-like	ENSG00000142599		0.562	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RERE	HGNC	protein_coding	OTTHUMT00000004916.1	89	0.00	0	G			8421833	8421833	-1	no_errors	ENST00000337907	ensembl	human	known	69_37n	missense	32	21.95	9	SNP	1.000	C
RIN3	79890	genome.wustl.edu	37	14	93119023	93119023	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr14:93119023G>T	ENST00000216487.7	+	6	1788	c.1629G>T	c.(1627-1629)atG>atT	p.M543I	RIN3_ENST00000418924.2_3'UTR	NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	543					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				TGTCTGTCATGGCCACCGACC	0.632																																						dbGAP											0													38.0	36.0	37.0					14																	93119023		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		ENST00000216487.7:c.1629G>T	14.37:g.93119023G>T	ENSP00000216487:p.Met543Ile		Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	Missense_Mutation	SNP	pfam_VPS9,smart_SH2,smart_VPS9_subgr,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.M543I	ENST00000216487.7	37	c.1629	CCDS32144.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.886|6.886	0.532945|0.532945	0.13188|0.13188	.|.	.|.	ENSG00000100599|ENSG00000100599	ENST00000556418|ENST00000216487;ENST00000428147	.|T	.|0.05319	.|3.46	4.58|4.58	-1.08|-1.08	0.09936|0.09936	.|.	.|1.573190	.|0.03907	.|N	.|0.281242	T|T	0.03783|0.03783	0.0107|0.0107	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.15930	.|0.015;0.001;0.001;0.004	.|B;B;B;B	.|0.19946	.|0.027;0.001;0.002;0.006	T|T	0.43956|0.43956	-0.9359|-0.9359	5|10	.|0.22109	.|T	.|0.4	0.5577|0.5577	6.8306|6.8306	0.23907|0.23907	0.4956:0.2523:0.2521:0.0|0.4956:0.2523:0.2521:0.0	.|.	.|543;589;468;543	.|Q8TB24-4;Q86U22;Q6ZRC2;Q8TB24	.|.;.;.;RIN3_HUMAN	C|I	60|543;467	.|ENSP00000216487:M543I	.|ENSP00000216487:M543I	G|M	+|+	1|3	0|0	RIN3|RIN3	92188776|92188776	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.012000|0.012000	0.07955|0.07955	-3.121000|-3.121000	0.00595|0.00595	-0.175000|-0.175000	0.10725|0.10725	-0.258000|-0.258000	0.10820|0.10820	GGC|ATG	RIN3	-	NULL	ENSG00000100599		0.632	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN3	HGNC	protein_coding	OTTHUMT00000412269.1	12	0.00	0	G			93119023	93119023	+1	no_errors	ENST00000216487	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	0.000	T
RYR1	6261	genome.wustl.edu	37	19	39038978	39038978	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr19:39038978T>A	ENST00000359596.3	+	89	12200	c.12200T>A	c.(12199-12201)cTc>cAc	p.L4067H	RYR1_ENST00000355481.4_Missense_Mutation_p.L4062H|RYR1_ENST00000360985.3_Missense_Mutation_p.L4062H			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4067					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TTCCTGAAACTCAAGGACATT	0.537																																						dbGAP											0													183.0	140.0	154.0					19																	39038978		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.12200T>A	19.37:g.39038978T>A	ENSP00000352608:p.Leu4067His		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.L4067H	ENST00000359596.3	37	c.12200	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	T	13.95	2.389379	0.42410	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.72051	-0.62;-0.62;-0.62	4.36	4.36	0.52297	.	0.000000	0.53938	U	0.000043	D	0.84687	0.5527	M	0.84511	2.7	0.58432	D	0.999991	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.997	D	0.87490	0.2426	10	0.87932	D	0	.	13.681	0.62484	0.0:0.0:0.0:1.0	.	4062;4062;4067	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	H	4067;4062;4062	ENSP00000352608:L4067H;ENSP00000347667:L4062H;ENSP00000354254:L4062H	ENSP00000347667:L4062H	L	+	2	0	RYR1	43730818	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.761000	0.85260	1.976000	0.57569	0.459000	0.35465	CTC	RYR1	-	NULL	ENSG00000196218		0.537	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	60	0.00	0	T			39038978	39038978	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	missense	44	24.14	14	SNP	1.000	A
SDCCAG8	10806	genome.wustl.edu	37	1	243419510	243419510	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr1:243419510A>G	ENST00000366541.3	+	1	153	c.35A>G	c.(34-36)gAg>gGg	p.E12G	CEP170_ENST00000366542.1_5'Flank|SDCCAG8_ENST00000355875.4_Missense_Mutation_p.E12G|CEP170_ENST00000366543.1_5'Flank|SDCCAG8_ENST00000391846.1_Missense_Mutation_p.E12G|SDCCAG8_ENST00000343783.6_5'UTR|CEP170_ENST00000366544.1_5'Flank	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	12					establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		ACCCTGGAGGAGATTCTGGGG	0.612																																						dbGAP											0													79.0	78.0	78.0					1																	243419510		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.35A>G	1.37:g.243419510A>G	ENSP00000355499:p.Glu12Gly		O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	NULL	p.E12G	ENST00000366541.3	37	c.35	CCDS31075.1	1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.604899	0.87157	.	.	ENSG00000054282	ENST00000355875;ENST00000391846;ENST00000366541	T;T	0.58652	0.32;0.48	5.42	5.42	0.78866	.	0.162448	0.38326	N	0.001732	T	0.63546	0.2520	L	0.54323	1.7	0.80722	D	1	D	0.57257	0.979	P	0.54270	0.747	T	0.64694	-0.6347	10	0.48119	T	0.1	-8.8762	11.777	0.51991	1.0:0.0:0.0:0.0	.	12	Q86SQ7	SDCG8_HUMAN	G	12	ENSP00000348137:E12G;ENSP00000355499:E12G	ENSP00000348137:E12G	E	+	2	0	SDCCAG8	241486133	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.007000	0.57093	2.280000	0.76307	0.460000	0.39030	GAG	SDCCAG8	-	NULL	ENSG00000054282		0.612	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDCCAG8	HGNC	protein_coding	OTTHUMT00000096485.1	39	0.00	0	A	NM_006642		243419510	243419510	+1	no_errors	ENST00000366541	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	1.000	G
SEMA3D	223117	genome.wustl.edu	37	7	84628938	84628938	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr7:84628938G>T	ENST00000284136.6	-	17	2195	c.2152C>A	c.(2152-2154)Caa>Aaa	p.Q718K	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	718					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						CTAAGGATTTGGATGTAGTCT	0.507																																					Ovarian(63;442 1191 17318 29975 31528)	dbGAP											0													176.0	148.0	157.0					7																	84628938		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.2152C>A	7.37:g.84628938G>T	ENSP00000284136:p.Gln718Lys		A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Ig_V-set,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.Q718K	ENST00000284136.6	37	c.2152	CCDS34676.1	7	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930995	0.52866	.	.	ENSG00000153993	ENST00000284136	T	0.32988	1.43	5.73	5.73	0.89815	.	0.053601	0.85682	D	0.000000	T	0.33644	0.0870	L	0.55990	1.75	0.80722	D	1	B	0.31581	0.329	B	0.25987	0.065	T	0.10590	-1.0623	10	0.59425	D	0.04	.	19.9002	0.96983	0.0:0.0:1.0:0.0	.	718	O95025	SEM3D_HUMAN	K	718	ENSP00000284136:Q718K	ENSP00000284136:Q718K	Q	-	1	0	SEMA3D	84466874	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.356000	0.73046	2.709000	0.92574	0.655000	0.94253	CAA	SEMA3D	-	NULL	ENSG00000153993		0.507	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3D	HGNC	protein_coding	OTTHUMT00000336084.2	93	0.00	0	G	NM_152754		84628938	84628938	-1	no_errors	ENST00000284136	ensembl	human	known	69_37n	missense	56	17.39	12	SNP	1.000	T
SLC38A10	124565	genome.wustl.edu	37	17	79220110	79220110	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr17:79220110C>T	ENST00000374759.3	-	16	2989	c.2606G>A	c.(2605-2607)gGc>gAc	p.G869D		NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	869					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CTCCTCTGGGCCCCCGGCTTC	0.667																																						dbGAP											0													49.0	53.0	51.0					17																	79220110		1840	4074	5914	-	-	-	SO:0001583	missense	0			BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.2606G>A	17.37:g.79220110C>T	ENSP00000363891:p.Gly869Asp		Q6ZRC5|Q8NA99|Q96C66	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.G869D	ENST00000374759.3	37	c.2606	CCDS42397.1	17	.	.	.	.	.	.	.	.	.	.	C	8.134	0.783820	0.16189	.	.	ENSG00000157637	ENST00000374759;ENST00000540966	T;T	0.47869	3.09;0.83	3.65	-1.34	0.09143	.	2587.340000	0.00166	N	0.000000	T	0.27731	0.0682	N	0.22421	0.69	0.09310	N	1	B	0.15473	0.013	B	0.16289	0.015	T	0.04307	-1.0961	10	0.12103	T	0.63	.	0.2761	0.00238	0.2036:0.2167:0.2037:0.3759	.	869	Q9HBR0	S38AA_HUMAN	D	869;255	ENSP00000363891:G869D;ENSP00000437601:G255D	ENSP00000363891:G869D	G	-	2	0	SLC38A10	76834705	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.422000	0.21296	-0.062000	0.13088	0.467000	0.42956	GGC	SLC38A10	-	NULL	ENSG00000157637		0.667	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A10	HGNC	protein_coding	OTTHUMT00000397747.1	18	0.00	0	C	NM_138570		79220110	79220110	-1	no_errors	ENST00000374759	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	0.000	T
SMAD4	4089	genome.wustl.edu	37	18	48604754	48604754	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr18:48604754G>T	ENST00000342988.3	+	12	2114	c.1576G>T	c.(1576-1578)Gaa>Taa	p.E526*	SMAD4_ENST00000588745.1_Nonsense_Mutation_p.E430*|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Nonsense_Mutation_p.E526*	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	526	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.E526*(3)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TTGCTGGATTGAAATTCACTT	0.488																																						dbGAP											41	Whole gene deletion(36)|Substitution - Nonsense(3)|Unknown(2)	pancreas(26)|upper_aerodigestive_tract(3)|large_intestine(3)|lung(3)|breast(3)|stomach(2)|oesophagus(1)											90.0	88.0	89.0					18																	48604754		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1576G>T	18.37:g.48604754G>T	ENSP00000341551:p.Glu526*		A8K405	Nonsense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.E526*	ENST00000342988.3	37	c.1576	CCDS11950.1	18	.	.	.	.	.	.	.	.	.	.	G	42	9.522520	0.99195	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	.	.	.	6.08	6.08	0.98989	.	0.094045	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.4362	0.94796	0.0:0.0:1.0:0.0	.	.	.	.	X	526	.	ENSP00000341551:E526X	E	+	1	0	SMAD4	46858752	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.633000	0.98432	2.890000	0.99128	0.655000	0.94253	GAA	SMAD4	-	pfam_SMAD_dom_Dwarfin-type,superfamily_SMAD_FHA_domain,smart_SMAD_dom_Dwarfin-type,pfscan_SMAD_dom_Dwarfin-type	ENSG00000141646		0.488	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD4	HGNC	protein_coding	OTTHUMT00000255993.3	41	0.00	0	G	NM_005359		48604754	48604754	+1	no_errors	ENST00000342988	ensembl	human	known	69_37n	nonsense	7	41.67	5	SNP	1.000	T
SOX6	55553	genome.wustl.edu	37	11	16007910	16007910	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr11:16007910C>T	ENST00000352083.6	-	15	2100	c.2023G>A	c.(2023-2025)Gcc>Acc	p.A675T	SOX6_ENST00000528429.1_Missense_Mutation_p.A675T|SOX6_ENST00000396356.3_Missense_Mutation_p.A655T|SOX6_ENST00000527619.1_Missense_Mutation_p.A651T|SOX6_ENST00000528252.1_Missense_Mutation_p.A648T|SOX6_ENST00000316399.6_Missense_Mutation_p.A655T			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	675					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						CTTAGCCGGGCCTGCTCTTCA	0.448																																						dbGAP											0													159.0	157.0	158.0					11																	16007910		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.2023G>A	11.37:g.16007910C>T	ENSP00000339876:p.Ala675Thr		Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.A675T	ENST00000352083.6	37	c.2023		11	.	.	.	.	.	.	.	.	.	.	C	33	5.254246	0.95336	.	.	ENSG00000110693	ENST00000316399;ENST00000352083;ENST00000396356;ENST00000528252;ENST00000527619;ENST00000528429	D;D;D;D;D;D	0.98060	-4.69;-4.69;-4.69;-4.69;-4.69;-4.69	5.38	5.38	0.77491	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	D	0.000000	D	0.98283	0.9431	L	0.56124	1.755	0.80722	D	1	D;D;D	0.71674	0.982;0.991;0.998	D;D;D	0.78314	0.967;0.98;0.991	D	0.99734	1.1013	10	0.72032	D	0.01	.	19.1245	0.93376	0.0:1.0:0.0:0.0	.	655;675;651	P35712-3;P35712;P35712-2	.;SOX6_HUMAN;.	T	655;675;655;648;651;675	ENSP00000324948:A655T;ENSP00000339876:A675T;ENSP00000379644:A655T;ENSP00000432134:A648T;ENSP00000434455:A651T;ENSP00000433233:A675T	ENSP00000324948:A655T	A	-	1	0	SOX6	15964486	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.530000	0.85305	0.655000	0.94253	GCC	SOX6	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	ENSG00000110693		0.448	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	SOX6	HGNC	protein_coding	OTTHUMT00000386811.1	122	0.00	0	C	NM_033326		16007910	16007910	-1	no_errors	ENST00000352083	ensembl	human	known	69_37n	missense	59	43.81	46	SNP	1.000	T
SPTA1	6708	genome.wustl.edu	37	1	158639531	158639531	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr1:158639531C>A	ENST00000368147.4	-	13	1825	c.1645G>T	c.(1645-1647)Gat>Tat	p.D549Y		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	549					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TTCTCTGAATCATAATGGTCA	0.413																																						dbGAP											0													237.0	220.0	225.0					1																	158639531		1905	4117	6022	-	-	-	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1645G>T	1.37:g.158639531C>A	ENSP00000357129:p.Asp549Tyr		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.D549Y	ENST00000368147.4	37	c.1645	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	16.02	3.004435	0.54254	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.53206	0.63;0.63	4.72	4.72	0.59763	.	0.000000	0.33253	N	0.005109	T	0.52025	0.1709	M	0.71206	2.165	0.48901	D	0.99972	D	0.63046	0.992	D	0.70487	0.969	T	0.53085	-0.8488	10	0.07482	T	0.82	.	15.5763	0.76392	0.0:1.0:0.0:0.0	.	549	P02549	SPTA1_HUMAN	Y	549	ENSP00000357130:D549Y;ENSP00000357129:D549Y	ENSP00000357129:D549Y	D	-	1	0	SPTA1	156906155	1.000000	0.71417	1.000000	0.80357	0.258000	0.26162	4.135000	0.57997	2.618000	0.88619	0.655000	0.94253	GAT	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.413	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	90	0.00	0	C	NM_003126		158639531	158639531	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	missense	36	28.00	14	SNP	1.000	A
SV2B	9899	genome.wustl.edu	37	15	91769862	91769862	+	Silent	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr15:91769862G>T	ENST00000394232.1	+	2	839	c.369G>T	c.(367-369)ggG>ggT	p.G123G	SV2B_ENST00000545111.2_Intron|SV2B_ENST00000557291.1_Intron|SV2B_ENST00000330276.4_Silent_p.G123G	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	123					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			TGGCCGATGGGGTGGAAGTGT	0.522																																						dbGAP											0													122.0	95.0	104.0					15																	91769862		2198	4298	6496	-	-	-	SO:0001819	synonymous_variant	0			AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.369G>T	15.37:g.91769862G>T			B4DH30|C6G489|O94840|Q6IAR8	Silent	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2_chordata	p.G123	ENST00000394232.1	37	c.369	CCDS10370.1	15																																																																																			SV2B	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2_chordata	ENSG00000185518		0.522	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2B	HGNC	protein_coding	OTTHUMT00000313494.3	84	0.00	0	G	NM_014848		91769862	91769862	+1	no_errors	ENST00000330276	ensembl	human	known	69_37n	silent	32	33.33	16	SNP	0.593	T
TECPR2	9895	genome.wustl.edu	37	14	102843158	102843158	+	Frame_Shift_Del	DEL	A	A	-	rs568514843		TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr14:102843158delA	ENST00000359520.7	+	2	326	c.100delA	c.(100-102)atcfs	p.I34fs	TECPR2_ENST00000561228.1_3'UTR|TECPR2_ENST00000558678.1_Frame_Shift_Del_p.I34fs	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	34					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						TTTCCGCTCTATCGTGGTCTA	0.537																																						dbGAP											0													125.0	103.0	110.0					14																	102843158		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.100delA	14.37:g.102843158delA	ENSP00000352510:p.Ile34fs		A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Frame_Shift_Del	DEL	pfam_Beta-propeller_rpt_TECPR,superfamily_WD40_repeat_dom,superfamily_Reg_csome_cond/b-lactamase_inh,smart_WD40_repeat,smart_Beta-propeller_rpt_TECPR	p.I34fs	ENST00000359520.7	37	c.100	CCDS32162.1	14																																																																																			TECPR2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000196663		0.537	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECPR2	HGNC	protein_coding	OTTHUMT00000415056.2	44	0.00	0	A	NM_014844		102843158	102843158	+1	no_errors	ENST00000359520	ensembl	human	known	69_37n	frame_shift_del	17	40.00	12	DEL	0.000	-
TFDP2	7029	genome.wustl.edu	37	3	141678678	141678678	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr3:141678678C>G	ENST00000489671.1	-	11	1319	c.889G>C	c.(889-891)Gag>Cag	p.E297Q	TFDP2_ENST00000397991.4_Missense_Mutation_p.E269Q|TFDP2_ENST00000317104.7_Missense_Mutation_p.E221Q|TFDP2_ENST00000477292.1_Missense_Mutation_p.E161Q|TFDP2_ENST00000486111.1_Missense_Mutation_p.E237Q|TFDP2_ENST00000467072.1_Missense_Mutation_p.E237Q|TFDP2_ENST00000310282.6_Missense_Mutation_p.E237Q|TFDP2_ENST00000479040.1_Missense_Mutation_p.E236Q|TFDP2_ENST00000495310.1_Missense_Mutation_p.E200Q|TFDP2_ENST00000499676.2_Missense_Mutation_p.E237Q			Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization partner 2)	297	DCB2.				gene expression (GO:0010467)|heart development (GO:0007507)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			kidney(1)|upper_aerodigestive_tract(2)	3						AAAAGATACTCAAACCTGCAT	0.408																																						dbGAP											0													89.0	84.0	85.0					3																	141678678		1929	4153	6082	-	-	-	SO:0001583	missense	0			U18422	CCDS43159.1, CCDS54647.1, CCDS54648.1, CCDS54649.1, CCDS54650.1	3q23	2011-05-24			ENSG00000114126	ENSG00000114126			11751	protein-coding gene	gene with protein product		602160				7784053, 9027491	Standard	NM_001178138		Approved	Dp-2	uc003eun.4	Q14188	OTTHUMG00000164975	ENST00000489671.1:c.889G>C	3.37:g.141678678C>G	ENSP00000420616:p.Glu297Gln		B7Z8C8|B7Z8L5|D3DNG1|E9PFC3|F8WAI2|Q13331|Q14187|Q6R754|Q8WU88|Q9UG28	Missense_Mutation	SNP	pfam_Transc_factor_DP_C,pfam_E2F_TDP,pirsf_Transcription_factor_DP_subgr	p.E297Q	ENST00000489671.1	37	c.889	CCDS54650.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.126840|5.126840	0.94429|0.94429	.|.	.|.	ENSG00000114126|ENSG00000114126	ENST00000499676;ENST00000489671;ENST00000486111;ENST00000477292;ENST00000495310;ENST00000467072;ENST00000317104;ENST00000310282;ENST00000479040;ENST00000397991;ENST00000467667|ENST00000474279	T;T;T;T;T;T;T;T;T;T;T|.	0.51325|.	1.7;1.66;1.7;0.75;0.71;1.7;1.72;1.7;1.7;1.67;1.37|.	5.69|5.69	5.69|5.69	0.88448|0.88448	Transcription factor DP, C-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.83519|.	0.5272|.	M|M	0.85630|0.85630	2.765|2.765	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;0.999;0.996|.	D;D;D|.	0.80764|.	0.994;0.994;0.976|.	D|.	0.84467|.	0.0597|.	10|.	0.87932|.	D|.	0|.	-8.7194|-8.7194	19.8084|19.8084	0.96538|0.96538	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	200;297;237|.	B7Z8L5;Q14188;Q14188-5|.	.;TFDP2_HUMAN;.|.	Q|S	237;297;237;161;200;237;221;237;236;269;237|10	ENSP00000439782:E237Q;ENSP00000420616:E297Q;ENSP00000420599:E237Q;ENSP00000418971:E161Q;ENSP00000419036:E200Q;ENSP00000418590:E237Q;ENSP00000315668:E221Q;ENSP00000309622:E237Q;ENSP00000417585:E236Q;ENSP00000381078:E269Q;ENSP00000417726:E237Q|.	ENSP00000309622:E237Q|.	E|X	-|-	1|2	0|2	TFDP2|TFDP2	143161368|143161368	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.954000|0.954000	0.61252|0.61252	7.333000|7.333000	0.79214|0.79214	2.687000|2.687000	0.91594|0.91594	0.462000|0.462000	0.41574|0.41574	GAG|TGA	TFDP2	-	pfam_Transc_factor_DP_C,pirsf_Transcription_factor_DP_subgr	ENSG00000114126		0.408	TFDP2-001	KNOWN	basic|CCDS	protein_coding	TFDP2	HGNC	protein_coding	OTTHUMT00000353294.4	50	0.00	0	C	NM_006286		141678678	141678678	-1	no_errors	ENST00000489671	ensembl	human	known	69_37n	missense	24	36.84	14	SNP	1.000	G
TIMM8B	26521	genome.wustl.edu	37	11	111957438	111957438	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr11:111957438G>T	ENST00000504148.2	-	1	81	c.10C>A	c.(10-12)Ctg>Atg	p.L4M	SDHD_ENST00000528048.1_5'Flank|SDHD_ENST00000532699.1_5'Flank|SDHD_ENST00000528182.1_5'Flank|SDHD_ENST00000525291.1_5'Flank|TIMM8B_ENST00000541231.1_Missense_Mutation_p.L19M|SDHD_ENST00000375549.3_5'Flank|SDHD_ENST00000526592.1_5'Flank|TIMM8B_ENST00000507614.1_5'UTR|SDHD_ENST00000528021.1_5'Flank	NM_012459.2	NP_036591.2	Q9Y5J9	TIM8B_HUMAN	translocase of inner mitochondrial membrane 8 homolog B (yeast)	4					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein transport (GO:0072321)|protein targeting to mitochondrion (GO:0006626)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space protein transporter complex (GO:0042719)	zinc ion binding (GO:0008270)			large_intestine(1)	1		all_cancers(61;1.84e-10)|all_epithelial(67;9.33e-06)|Melanoma(852;4.01e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;6.01e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.03e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0512)		GCTTCGCCCAGCTCCGCCATT	0.657											OREG0021332	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													19.0	16.0	17.0					11																	111957438		2201	4295	6496	-	-	-	SO:0001583	missense	0			AF150087	CCDS8357.1, CCDS8357.2	11q23.1-q23.2	2010-11-23	2001-11-28		ENSG00000150779	ENSG00000150779			11818	protein-coding gene	gene with protein product	"""mitochondrial import inner membrane translocase subunit Tim8 B"""	606659	"""translocase of inner mitochondrial membrane 8 (yeast) homolog B"""			10552927	Standard	NM_012459		Approved	TIM8B, DDP2, FLJ21744, MGC102866, MGC117373	uc001pmx.3	Q9Y5J9	OTTHUMG00000162261	ENST00000504148.2:c.10C>A	11.37:g.111957438G>T	ENSP00000422122:p.Leu4Met	1439	B0YJA5|Q3KQS9|Q9UN04	Missense_Mutation	SNP	pfam_Tim8/9/10/13_Znf-like,superfamily_Tim8/9/10/13_Znf-like	p.L19M	ENST00000504148.2	37	c.55		11	.	.	.	.	.	.	.	.	.	.	G	11.71	1.719983	0.30503	.	.	ENSG00000150779	ENST00000504148;ENST00000541231	D;D	0.85088	-1.94;-1.81	5.37	2.25	0.28309	.	0.236468	0.37669	N	0.001993	T	0.67951	0.2948	.	.	.	0.25913	N	0.983208	P	0.44734	0.842	B	0.29176	0.099	T	0.62656	-0.6808	9	0.41790	T	0.15	-12.38	4.995	0.14233	0.2243:0.0:0.6091:0.1667	.	4	Q9Y5J9	TIM8B_HUMAN	M	4;19	ENSP00000422122:L4M;ENSP00000438455:L19M	ENSP00000422122:L4M	L	-	1	2	TIMM8B	111462648	0.548000	0.26473	0.917000	0.36280	0.393000	0.30537	0.788000	0.26872	0.816000	0.34421	0.655000	0.94253	CTG	TIMM8B	-	NULL	ENSG00000150779		0.657	TIMM8B-001	KNOWN	basic|appris_principal	protein_coding	TIMM8B	HGNC	protein_coding	OTTHUMT00000368270.2	16	0.00	0	G	NM_012459		111957438	111957438	-1	no_errors	ENST00000541231	ensembl	human	known	69_37n	missense	1	85.71	6	SNP	0.987	T
TKT	7086	genome.wustl.edu	37	3	53269083	53269083	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr3:53269083A>T	ENST00000462138.1	-	5	633	c.545T>A	c.(544-546)cTa>cAa	p.L182Q	TKT_ENST00000423525.2_Missense_Mutation_p.L182Q|TKT_ENST00000423516.1_Missense_Mutation_p.L190Q|TKT_ENST00000461139.1_5'Flank|TKT_ENST00000296289.6_Missense_Mutation_p.L135Q			P29401	TKT_HUMAN	transketolase	182					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|glyceraldehyde-3-phosphate biosynthetic process (GO:0046166)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|regulation of growth (GO:0040008)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|peroxisome (GO:0005777)|vesicle (GO:0031982)	cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|transketolase activity (GO:0004802)			endometrium(5)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)		ATTGATGTCTAGAATGGCCAC	0.587																																					Colon(133;1506 2347 35238 42177)	dbGAP											0													100.0	101.0	101.0					3																	53269083		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2871.1, CCDS58834.1	3p14.3	2008-07-31	2008-07-31		ENSG00000163931	ENSG00000163931	2.2.1.1		11834	protein-coding gene	gene with protein product	"""Wernicke-Korsakoff syndrome"""	606781				1567394	Standard	NM_001064		Approved		uc011beq.2	P29401	OTTHUMG00000158192	ENST00000462138.1:c.545T>A	3.37:g.53269083A>T	ENSP00000417773:p.Leu182Gln		A8K089|B4DE31|E7EPA7|Q8TBA3|Q96HH3	Missense_Mutation	SNP	pfam_Transketolase_N,pfam_Transketolase-like_Pyr-bd,pfam_Transketolase_C,pfam_DH_E1,superfamily_Transketo_C/Pyr-ferredox_oxred,smart_Transketolase-like_Pyr-bd	p.L182Q	ENST00000462138.1	37	c.545	CCDS2871.1	3	.	.	.	.	.	.	.	.	.	.	A	23.1	4.378332	0.82682	.	.	ENSG00000163931	ENST00000462138;ENST00000423525;ENST00000423516;ENST00000296289;ENST00000414014	T;T;T;T	0.32988	1.43;1.43;1.43;1.43	5.54	5.54	0.83059	Transketolase, N-terminal (1);	0.327706	0.33235	N	0.005124	T	0.58666	0.2138	M	0.81112	2.525	0.47698	D	0.999498	D;D;D	0.89917	0.995;1.0;0.999	D;D;D	0.78314	0.977;0.991;0.991	T	0.64685	-0.6349	10	0.87932	D	0	.	15.6763	0.77326	1.0:0.0:0.0:0.0	.	190;99;182	E7EPA7;B3KSI4;P29401	.;.;TKT_HUMAN	Q	182;182;190;135;16	ENSP00000417773:L182Q;ENSP00000405455:L182Q;ENSP00000391481:L190Q;ENSP00000296289:L135Q	ENSP00000296289:L135Q	L	-	2	0	TKT	53244123	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	9.339000	0.96797	2.107000	0.64212	0.533000	0.62120	CTA	TKT	-	pfam_Transketolase_N,pfam_DH_E1	ENSG00000163931		0.587	TKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TKT	HGNC	protein_coding	OTTHUMT00000350356.1	29	0.00	0	A			53269083	53269083	-1	no_errors	ENST00000423525	ensembl	human	known	69_37n	missense	10	50.00	10	SNP	0.997	T
TMEM132B	114795	genome.wustl.edu	37	12	126138566	126138566	+	Silent	SNP	C	C	G	rs187755188		TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr12:126138566C>G	ENST00000299308.3	+	9	2555	c.2547C>G	c.(2545-2547)acC>acG	p.T849T	TMEM132B_ENST00000535886.1_Silent_p.T361T	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	849						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		AAAGCACAACCCCCCAGTCTC	0.517																																						dbGAP											0													54.0	55.0	55.0					12																	126138566		1949	4138	6087	-	-	-	SO:0001819	synonymous_variant	0			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.2547C>G	12.37:g.126138566C>G			A2RRG8|Q8NA73|Q96JN9|Q96PY1	Silent	SNP	NULL	p.T849	ENST00000299308.3	37	c.2547	CCDS41859.1	12																																																																																			TMEM132B	-	NULL	ENSG00000139364		0.517	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM132B	HGNC	protein_coding	OTTHUMT00000400043.1	33	0.00	0	C	NM_052907		126138566	126138566	+1	no_errors	ENST00000299308	ensembl	human	known	69_37n	silent	15	28.57	6	SNP	0.779	G
TRAPPC8	22878	genome.wustl.edu	37	18	29488954	29488954	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr18:29488954A>C	ENST00000283351.4	-	7	1220	c.885T>G	c.(883-885)ttT>ttG	p.F295L	TRAPPC8_ENST00000582513.1_Missense_Mutation_p.F295L|TRAPPC8_ENST00000582539.1_Missense_Mutation_p.F241L	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	295					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GGTGAGCTCTAAAGTTATTTG	0.373																																						dbGAP											0													73.0	67.0	69.0					18																	29488954		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.885T>G	18.37:g.29488954A>C	ENSP00000283351:p.Phe295Leu		A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	NULL	p.F295L	ENST00000283351.4	37	c.885	CCDS11901.1	18	.	.	.	.	.	.	.	.	.	.	A	12.35	1.912227	0.33721	.	.	ENSG00000153339	ENST00000283351	T	0.06608	3.28	5.67	-0.263	0.12954	.	0.238872	0.38005	N	0.001850	T	0.02929	0.0087	N	0.11201	0.11	0.30923	N	0.72782	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.43475	-0.9389	10	0.08837	T	0.75	.	11.9642	0.53025	0.607:0.0:0.393:0.0	.	295;295	Q6PCC9;Q9Y2L5	.;TPPC8_HUMAN	L	295	ENSP00000283351:F295L	ENSP00000283351:F295L	F	-	3	2	TRAPPC8	27742952	0.996000	0.38824	0.999000	0.59377	0.986000	0.74619	0.467000	0.22035	0.043000	0.15746	-0.280000	0.10049	TTT	TRAPPC8	-	NULL	ENSG00000153339		0.373	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	TRAPPC8	HGNC	protein_coding	OTTHUMT00000255355.1	52	0.00	0	A	NM_014939		29488954	29488954	-1	no_errors	ENST00000283351	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	0.988	C
TREML4	285852	genome.wustl.edu	37	6	41196189	41196189	+	Silent	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr6:41196189C>A	ENST00000341495.2	+	1	128	c.24C>A	c.(22-24)acC>acA	p.T8T	TREML4_ENST00000448827.2_Silent_p.T8T	NM_198153.2	NP_937796.1	Q6UXN2	TRML4_HUMAN	triggering receptor expressed on myeloid cells-like 4	8						extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(1)|lung(4)|skin(1)	8	Ovarian(28;0.0327)|Colorectal(47;0.196)					GGGTCCACACCTGCTGCTTCC	0.597																																						dbGAP											0													40.0	41.0	40.0					6																	41196189		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF534826	CCDS34446.1	6p21.1	2013-01-11			ENSG00000188056	ENSG00000188056		"""Immunoglobulin superfamily / V-set domain containing"""	30807	protein-coding gene	gene with protein product	"""TREM like transcript 4"""	614664				12645956	Standard	NM_198153		Approved	TLT4	uc003oqc.3	Q6UXN2	OTTHUMG00000016408	ENST00000341495.2:c.24C>A	6.37:g.41196189C>A			B7ZL92	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.T8	ENST00000341495.2	37	c.24	CCDS34446.1	6																																																																																			TREML4	-	NULL	ENSG00000188056		0.597	TREML4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TREML4	HGNC	protein_coding	OTTHUMT00000043873.2	52	0.00	0	C			41196189	41196189	+1	no_errors	ENST00000341495	ensembl	human	known	69_37n	silent	29	30.95	13	SNP	0.315	A
TRIM42	287015	genome.wustl.edu	37	3	140401895	140401895	+	Silent	SNP	C	C	G			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr3:140401895C>G	ENST00000286349.3	+	2	1124	c.933C>G	c.(931-933)acC>acG	p.T311T		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	311						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TGCTCTGCACCTTCTGCAAGT	0.567																																						dbGAP											0													264.0	225.0	238.0					3																	140401895		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.933C>G	3.37:g.140401895C>G			A1L4B4|Q8N832|Q8NDL3	Silent	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Znf_B-box,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.T311	ENST00000286349.3	37	c.933	CCDS3113.1	3																																																																																			TRIM42	-	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	ENSG00000155890		0.567	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	HGNC	protein_coding	OTTHUMT00000359531.2	89	0.00	0	C	NM_152616		140401895	140401895	+1	no_errors	ENST00000286349	ensembl	human	known	69_37n	silent	27	32.50	13	SNP	0.166	G
TSHZ2	128553	genome.wustl.edu	37	20	51870893	51870893	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr20:51870893A>T	ENST00000371497.5	+	2	1783	c.896A>T	c.(895-897)cAt>cTt	p.H299L	TSHZ2_ENST00000603338.2_Missense_Mutation_p.H296L|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.H296L	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	299					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AAAACAAAACATTACCAAAAA	0.443																																						dbGAP											0													62.0	62.0	62.0					20																	51870893		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.896A>T	20.37:g.51870893A>T	ENSP00000360552:p.His299Leu		B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.H299L	ENST00000371497.5	37	c.896	CCDS33490.1	20	.	.	.	.	.	.	.	.	.	.	A	23.3	4.394534	0.83011	.	.	ENSG00000182463	ENST00000371497;ENST00000329613	T;T	0.80566	-1.39;-1.39	5.5	5.5	0.81552	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	D	0.88596	0.6479	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89536	0.3789	10	0.66056	D	0.02	-3.4583	15.8895	0.79286	1.0:0.0:0.0:0.0	.	299	Q9NRE2	TSH2_HUMAN	L	299;296	ENSP00000360552:H299L;ENSP00000333114:H296L	ENSP00000333114:H296L	H	+	2	0	TSHZ2	51304300	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.904000	0.92590	2.206000	0.71126	0.523000	0.50628	CAT	TSHZ2	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000182463		0.443	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6	32	0.00	0	A	NM_173485		51870893	51870893	+1	no_errors	ENST00000371497	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	1.000	T
TUBE1	51175	genome.wustl.edu	37	6	112395935	112395935	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr6:112395935C>A	ENST00000368662.5	-	9	1009	c.931G>T	c.(931-933)Gat>Tat	p.D311Y	TUBE1_ENST00000604814.1_5'UTR	NM_016262.4	NP_057346.1	Q9UJT0	TBE_HUMAN	tubulin, epsilon 1	311					centrosome cycle (GO:0007098)|protein polymerization (GO:0051258)	microtubule (GO:0005874)|pericentriolar material (GO:0000242)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	12		all_cancers(87;0.0101)|all_hematologic(75;0.000258)|Colorectal(196;0.0466)|all_epithelial(87;0.1)		all cancers(137;0.0217)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0636)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)	Vinblastine(DB00570)	ATGTTAACATCTGTCAGTGTA	0.333																																						dbGAP											0													80.0	77.0	78.0					6																	112395935		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF201334	CCDS5100.1	6q21	2005-11-03			ENSG00000074935	ENSG00000074935		"""Tubulins"""	20775	protein-coding gene	gene with protein product		607345				10620804	Standard	NM_016262		Approved	dJ142L7.2, FLJ22589, TUBE	uc003pvq.3	Q9UJT0	OTTHUMG00000015382	ENST00000368662.5:c.931G>T	6.37:g.112395935C>A	ENSP00000357651:p.Asp311Tyr		Q5H8W8|Q8NEG3	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Epsilon_tubulin,prints_Tubulin	p.D311Y	ENST00000368662.5	37	c.931	CCDS5100.1	6	.	.	.	.	.	.	.	.	.	.	C	22.7	4.322850	0.81580	.	.	ENSG00000074935	ENST00000368662	D	0.81821	-1.54	5.03	5.03	0.67393	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.88250	0.6386	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.89429	0.3715	10	0.87932	D	0	.	18.7171	0.91679	0.0:1.0:0.0:0.0	.	311	Q9UJT0	TBE_HUMAN	Y	311	ENSP00000357651:D311Y	ENSP00000357651:D311Y	D	-	1	0	TUBE1	112502628	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	7.640000	0.83355	2.484000	0.83849	0.511000	0.50034	GAT	TUBE1	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom	ENSG00000074935		0.333	TUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBE1	HGNC	protein_coding	OTTHUMT00000041867.1	38	0.00	0	C	NM_016262		112395935	112395935	-1	no_errors	ENST00000368662	ensembl	human	known	69_37n	missense	5	50.00	5	SNP	1.000	A
UGT2B4	7363	genome.wustl.edu	37	4	70346546	70346546	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr4:70346546C>A	ENST00000305107.6	-	6	1439	c.1393G>T	c.(1393-1395)Gaa>Taa	p.E465*	UGT2B4_ENST00000512583.1_3'UTR|UGT2B4_ENST00000506580.1_5'UTR|AC108078.1_ENST00000583573.1_RNA|UGT2B4_ENST00000381096.3_Nonsense_Mutation_p.E329*	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	465					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	ATGACAAATTCAATCCAGAAG	0.453																																						dbGAP											0													125.0	124.0	124.0					4																	70346546		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.1393G>T	4.37:g.70346546C>A	ENSP00000305221:p.Glu465*		A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Nonsense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.E465*	ENST00000305107.6	37	c.1393	CCDS43234.1	4	.	.	.	.	.	.	.	.	.	.	C	20.9	4.073411	0.76415	.	.	ENSG00000156096	ENST00000305107;ENST00000381096	.	.	.	2.11	2.11	0.27256	.	0.000000	0.64402	U	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	10.2729	0.43493	0.0:1.0:0.0:0.0	.	.	.	.	X	465;329	.	ENSP00000305221:E465X	E	-	1	0	UGT2B4	70381135	1.000000	0.71417	0.998000	0.56505	0.573000	0.36030	6.866000	0.75506	1.508000	0.48769	0.305000	0.20034	GAA	UGT2B4	-	pfam_UDP_glucos_trans	ENSG00000156096		0.453	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B4	HGNC	protein_coding	OTTHUMT00000365526.1	59	0.00	0	C	NM_021139		70346546	70346546	-1	no_errors	ENST00000305107	ensembl	human	known	69_37n	nonsense	33	37.74	20	SNP	1.000	A
WWC3	55841	genome.wustl.edu	37	X	10092351	10092351	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chrX:10092351G>A	ENST00000380861.4	+	13	2189	c.1798G>A	c.(1798-1800)Gga>Aga	p.G600R	WWC3_ENST00000454666.1_Missense_Mutation_p.G600R	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	600					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)	p.G600R(1)		NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						GGCCAGTAACGGAGATCCCCA	0.607																																						dbGAP											1	Substitution - Missense(1)	lung(1)											113.0	94.0	101.0					X																	10092351		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.1798G>A	X.37:g.10092351G>A	ENSP00000370242:p.Gly600Arg		A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.G600R	ENST00000380861.4	37	c.1798	CCDS14136.1	X	.	.	.	.	.	.	.	.	.	.	G	8.333	0.827032	0.16749	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000543412	T;T	0.18960	2.18;2.18	5.28	4.1	0.47936	C2 calcium/lipid-binding domain, CaLB (1);	0.540257	0.21370	N	0.075647	T	0.12944	0.0314	N	0.24115	0.695	0.23101	N	0.998299	B	0.23249	0.082	B	0.14023	0.01	T	0.25187	-1.0139	9	.	.	.	-2.7723	9.746	0.40446	0.1262:0.0:0.8738:0.0	.	600	Q9ULE0	WWC3_HUMAN	R	600;600;95	ENSP00000370242:G600R;ENSP00000399584:G600R	.	G	+	1	0	WWC3	10052351	1.000000	0.71417	0.007000	0.13788	0.050000	0.14768	4.882000	0.63121	0.716000	0.32124	0.513000	0.50165	GGA	WWC3	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000047644		0.607	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC3	HGNC	protein_coding	OTTHUMT00000055725.1	48	0.00	0	G	NM_015691		10092351	10092351	+1	no_errors	ENST00000380861	ensembl	human	known	69_37n	missense	16	46.67	14	SNP	0.813	A
ZBTB47	92999	genome.wustl.edu	37	3	42699991	42699991	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr3:42699991G>C	ENST00000232974.6	+	2	425	c.144G>C	c.(142-144)caG>caC	p.Q48H	ZBTB47_ENST00000505904.1_5'Flank|ZBTB47_ENST00000457842.3_5'UTR			Q9UFB7	ZBT47_HUMAN	zinc finger and BTB domain containing 47	48	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(3)|ovary(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.216)		TCTTCACCCAGAACAAGCAGC	0.602																																						dbGAP											0													84.0	78.0	80.0					3																	42699991		692	1591	2283	-	-	-	SO:0001583	missense	0			AB033016	CCDS46805.1, CCDS46805.2	3p22.1	2013-01-08	2006-09-19	2006-09-19	ENSG00000114853	ENSG00000114853		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26955	protein-coding gene	gene with protein product			"""zinc finger protein 651"""	ZNF651		10574461	Standard	NM_145166		Approved	KIAA1190, DKFZp434N0615	uc003clu.2	Q9UFB7	OTTHUMG00000156207	ENST00000232974.6:c.144G>C	3.37:g.42699991G>C	ENSP00000232974:p.Gln48His		H7BXD3|Q6ZSY6|Q8WTY8|Q9ULN0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.Q48H	ENST00000232974.6	37	c.144	CCDS46805.2	3	.	.	.	.	.	.	.	.	.	.	G	17.36	3.368926	0.61624	.	.	ENSG00000114853	ENST00000232974;ENST00000542870	T	0.22945	1.93	4.72	4.72	0.59763	.	0.148044	0.47455	D	0.000231	T	0.35219	0.0924	N	0.21545	0.675	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.20773	-1.0265	10	0.87932	D	0	-31.1147	13.1564	0.59520	0.0804:0.0:0.9196:0.0	.	48	F5H6L2	.	H	48	ENSP00000232974:Q48H	ENSP00000232974:Q48H	Q	+	3	2	ZBTB47	42674995	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.635000	0.37134	2.164000	0.68074	0.603000	0.83216	CAG	ZBTB47	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000114853		0.602	ZBTB47-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB47	HGNC	protein_coding	OTTHUMT00000343485.3	38	0.00	0	G	NM_145166		42699991	42699991	+1	no_errors	ENST00000232974	ensembl	human	known	69_37n	missense	16	40.74	11	SNP	1.000	C
ZNF408	79797	genome.wustl.edu	37	11	46726161	46726161	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1X9-01A-12D-A159-09	TCGA-D8-A1X9-10A-01D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5f65c3a-b922-4a81-863d-59b72b08d1bf	451900d1-a2da-4536-8db3-b56433500ab8	g.chr11:46726161A>T	ENST00000311764.2	+	5	1141	c.911A>T	c.(910-912)tAc>tTc	p.Y304F		NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	304					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CCGCATGGCTACCTGGCCAAG	0.602																																					Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)	dbGAP											0													61.0	57.0	58.0					11																	46726161		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.911A>T	11.37:g.46726161A>T	ENSP00000309606:p.Tyr304Phe			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y304F	ENST00000311764.2	37	c.911	CCDS7923.1	11	.	.	.	.	.	.	.	.	.	.	A	11.98	1.801207	0.31869	.	.	ENSG00000175213	ENST00000311764	T	0.09350	2.99	5.43	-3.85	0.04243	.	1.491450	0.04508	N	0.382321	T	0.06371	0.0164	L	0.27053	0.805	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.39583	-0.9607	10	0.10377	T	0.69	0.0948	5.7295	0.18032	0.2824:0.0:0.4634:0.2542	.	296;304	B4DXY4;Q9H9D4	.;ZN408_HUMAN	F	304	ENSP00000309606:Y304F	ENSP00000309606:Y304F	Y	+	2	0	ZNF408	46682737	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.340000	0.07821	-0.589000	0.05874	0.383000	0.25322	TAC	ZNF408	-	NULL	ENSG00000175213		0.602	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF408	HGNC	protein_coding	OTTHUMT00000390485.2	25	0.00	0	A	NM_024741		46726161	46726161	+1	no_errors	ENST00000311764	ensembl	human	known	69_37n	missense	8	38.46	5	SNP	0.000	T
