#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCG1	9619	genome.wustl.edu	37	21	43645822	43645822	+	Silent	SNP	G	G	A			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr21:43645822G>A	ENST00000361802.2	+	2	229	c.84G>A	c.(82-84)tcG>tcA	p.S28S	ABCG1_ENST00000343687.3_Silent_p.S39S|ABCG1_ENST00000398457.2_Silent_p.S30S|ABCG1_ENST00000462050.1_3'UTR|ABCG1_ENST00000398449.3_Silent_p.S28S|ABCG1_ENST00000347800.2_Silent_p.S25S	NM_004915.3	NP_004906.3	P45844	ABCG1_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 1	28					amyloid precursor protein catabolic process (GO:0042987)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|detection of hormone stimulus (GO:0009720)|glycoprotein transport (GO:0034436)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of cholesterol efflux (GO:0010875)|regulation of cholesterol esterification (GO:0010872)|regulation of transcription, DNA-templated (GO:0006355)|response to high density lipoprotein particle (GO:0055099)|response to lipid (GO:0033993)|response to organic substance (GO:0010033)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|glycoprotein transporter activity (GO:0034437)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sterol-transporting ATPase activity (GO:0034041)|toxin transporter activity (GO:0019534)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(3)|prostate(2)|stomach(1)	29					Adenosine triphosphate(DB00171)	AGCCCAAGTCGGTGTGTGTCT	0.478																																						dbGAP											0													143.0	131.0	135.0					21																	43645822		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U34919	CCDS13681.1, CCDS13682.1, CCDS13683.1, CCDS42937.1, CCDS42938.1	21q22.3	2012-03-14			ENSG00000160179	ENSG00000160179		"""ATP binding cassette transporters / subfamily G"""	73	protein-coding gene	gene with protein product	"""ATP-binding cassette transporter 8"""	603076				8659545, 16870176	Standard	NM_016818		Approved	ABC8	uc002zaq.3	P45844	OTTHUMG00000086791	ENST00000361802.2:c.84G>A	21.37:g.43645822G>A			Q86SU8|Q96L76|Q9BXK6|Q9BXK7|Q9BXK8|Q9BXK9|Q9BXL0|Q9BXL1|Q9BXL2|Q9BXL3|Q9BXL4	Silent	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Pigment_permease	p.S28	ENST00000361802.2	37	c.84	CCDS13682.1	21																																																																																			ABCG1	-	NULL	ENSG00000160179		0.478	ABCG1-006	KNOWN	basic|CCDS	protein_coding	ABCG1	HGNC	protein_coding	OTTHUMT00000195318.2	95	0.00	0	G	NM_207174		43645822	43645822	+1	no_errors	ENST00000361802	ensembl	human	known	69_37n	silent	30	49.15	29	SNP	0.008	A
ADAMTS20	80070	genome.wustl.edu	37	12	43833862	43833862	+	Silent	SNP	G	G	A	rs550143996		TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr12:43833862G>A	ENST00000389420.3	-	17	2300	c.2301C>T	c.(2299-2301)gaC>gaT	p.D767D	ADAMTS20_ENST00000395541.2_5'Flank|ADAMTS20_ENST00000553158.1_Silent_p.D767D	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	767	Spacer.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TCCCTTCAGCGTCAGATAATG	0.279																																						dbGAP											0													25.0	21.0	22.0					12																	43833862		2187	4267	6454	-	-	-	SO:0001819	synonymous_variant	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.2301C>T	12.37:g.43833862G>A			A6NNC9|J3QT00	Silent	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.D767	ENST00000389420.3	37	c.2301	CCDS31778.2	12																																																																																			ADAMTS20	-	pfam_ADAM_spacer1	ENSG00000173157		0.279	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	62	0.00	0	G	NM_025003		43833862	43833862	-1	no_errors	ENST00000389420	ensembl	human	known	69_37n	silent	30	26.83	11	SNP	0.172	A
ADARB2	105	genome.wustl.edu	37	10	1279721	1279721	+	Silent	SNP	T	T	C			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr10:1279721T>C	ENST00000381312.1	-	6	1753	c.1428A>G	c.(1426-1428)cgA>cgG	p.R476R	ADARB2_ENST00000469464.1_5'UTR	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	476	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GGATGTTCTCTCGCAGCCGGT	0.542																																						dbGAP											0													148.0	127.0	134.0					10																	1279721		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.1428A>G	10.37:g.1279721T>C			B2RPJ5|Q5VUT6|Q5VW42	Silent	SNP	pfam_A_deamin,pfam_Ds-RNA-bd,smart_Ds-RNA-bd,smart_A_deamin,pfscan_Ds-RNA-bd,pfscan_A_deamin	p.R476	ENST00000381312.1	37	c.1428	CCDS7058.1	10																																																																																			ADARB2	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin	ENSG00000185736		0.542	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADARB2	HGNC	protein_coding	OTTHUMT00000046426.1	52	0.00	0	T	NM_018702		1279721	1279721	-1	no_errors	ENST00000381312	ensembl	human	known	69_37n	silent	48	18.64	11	SNP	0.529	C
ADH5	128	genome.wustl.edu	37	4	100003129	100003129	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr4:100003129C>T	ENST00000296412.8	-	3	303	c.253G>A	c.(253-255)Gcg>Acg	p.A85T	ADH5_ENST00000512991.1_5'UTR	NM_000671.3	NP_000662.3			alcohol dehydrogenase 5 (class III), chi polypeptide											endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)		TCCTTACCCGCCTTCAGCTTA	0.413																																						dbGAP											0													65.0	61.0	62.0					4																	100003129		1876	4114	5990	-	-	-	SO:0001583	missense	0			M29872	CCDS47111.1	4q23	2012-07-13	2003-06-19		ENSG00000197894	ENSG00000197894	1.1.1.284	"""Alcohol dehydrogenases"""	253	protein-coding gene	gene with protein product		103710	"""formaldehyde dehydrogenase"""	FDH		1446828, 6424546	Standard	NM_000671		Approved	ADH-3, ADHX	uc003hui.3	P11766	OTTHUMG00000161230	ENST00000296412.8:c.253G>A	4.37:g.100003129C>T	ENSP00000296412:p.Ala85Thr			Missense_Mutation	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like,tigrfam_ADH_3	p.A85T	ENST00000296412.8	37	c.253	CCDS47111.1	4	.	.	.	.	.	.	.	.	.	.	C	11.74	1.729837	0.30684	.	.	ENSG00000197894	ENST00000296412	T	0.04862	3.54	5.18	3.36	0.38483	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.162260	0.53938	D	0.000043	T	0.03915	0.0110	N	0.13327	0.33	0.35373	D	0.789245	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.37337	-0.9710	9	.	.	.	.	11.3914	0.49817	0.0:0.4686:0.4606:0.0708	.	85;85	Q5U043;P11766	.;ADHX_HUMAN	T	85	ENSP00000296412:A85T	.	A	-	1	0	ADH5	100222152	1.000000	0.71417	0.958000	0.39756	0.048000	0.14542	0.992000	0.29667	1.414000	0.47017	0.650000	0.86243	GCG	ADH5	-	pfam_ADH_GroES-like,superfamily_GroES-like,tigrfam_ADH_3	ENSG00000197894		0.413	ADH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADH5	HGNC	protein_coding	OTTHUMT00000364224.1	116	0.00	0	C	NM_000671		100003129	100003129	-1	no_errors	ENST00000296412	ensembl	human	known	69_37n	missense	44	30.16	19	SNP	0.725	T
ARID5B	84159	genome.wustl.edu	37	10	63759999	63759999	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr10:63759999A>T	ENST00000279873.7	+	4	1062	c.652A>T	c.(652-654)Agg>Tgg	p.R218W		NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	218					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					AGTGGTCAGCAGGAACCCTCA	0.502																																						dbGAP											0													93.0	78.0	83.0					10																	63759999		2203	4300	6503	-	-	-	SO:0001583	missense	0			M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.652A>T	10.37:g.63759999A>T	ENSP00000279873:p.Arg218Trp		B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.R218W	ENST00000279873.7	37	c.652	CCDS31208.1	10	.	.	.	.	.	.	.	.	.	.	A	19.10	3.762366	0.69763	.	.	ENSG00000150347	ENST00000279873	T	0.18016	2.24	5.65	5.65	0.86999	.	0.265904	0.43579	D	0.000545	T	0.18341	0.0440	N	0.22421	0.69	0.80722	D	1	P;P	0.42584	0.599;0.784	P;B	0.45474	0.482;0.445	T	0.01711	-1.1290	10	0.87932	D	0	-10.7566	15.8734	0.79141	1.0:0.0:0.0:0.0	.	218;218	Q14865-3;Q14865	.;ARI5B_HUMAN	W	218	ENSP00000279873:R218W	ENSP00000279873:R218W	R	+	1	2	ARID5B	63430005	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.967000	0.76079	2.147000	0.66899	0.459000	0.35465	AGG	ARID5B	-	NULL	ENSG00000150347		0.502	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID5B	HGNC	protein_coding	OTTHUMT00000048233.1	60	0.00	0	A	XM_084482		63759999	63759999	+1	no_errors	ENST00000279873	ensembl	human	known	69_37n	missense	23	34.29	12	SNP	1.000	T
CFAP69	79846	genome.wustl.edu	37	7	89933315	89933315	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr7:89933315G>T	ENST00000389297.4	+	18	2334	c.2083G>T	c.(2083-2085)Gaa>Taa	p.E695*	C7orf63_ENST00000316089.8_Intron|C7orf63_ENST00000497910.1_Nonsense_Mutation_p.E677*	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		695										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						TAGCTTTCAAGAAGAGCAAAA	0.323																																						dbGAP											0													148.0	132.0	137.0					7																	89933315		692	1591	2283	-	-	-	SO:0001587	stop_gained	0																														ENST00000389297.4:c.2083G>T	7.37:g.89933315G>T	ENSP00000373948:p.Glu695*		A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.E695*	ENST00000389297.4	37	c.2083	CCDS43613.2	7	.	.	.	.	.	.	.	.	.	.	G	41	8.886792	0.98990	.	.	ENSG00000105792	ENST00000389297;ENST00000497910	.	.	.	5.57	5.57	0.84162	.	0.189708	0.45361	D	0.000374	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-16.0261	10.6394	0.45584	0.1166:0.0:0.8834:0.0	.	.	.	.	X	695;677	.	ENSP00000373948:E695X	E	+	1	0	C7orf63	89771251	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	3.446000	0.52928	2.641000	0.89580	0.655000	0.94253	GAA	C7orf63	-	NULL	ENSG00000105792		0.323	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf63	HGNC	protein_coding	OTTHUMT00000139891.4	92	0.00	0	G			89933315	89933315	+1	no_errors	ENST00000389297	ensembl	human	known	69_37n	nonsense	35	22.22	10	SNP	1.000	T
CACNA1E	777	genome.wustl.edu	37	1	181685255	181685255	+	Silent	SNP	C	C	A			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr1:181685255C>A	ENST00000367573.2	+	10	1305	c.1305C>A	c.(1303-1305)atC>atA	p.I435I	CACNA1E_ENST00000367570.1_Silent_p.I435I|CACNA1E_ENST00000357570.5_Silent_p.I386I|CACNA1E_ENST00000358338.5_Silent_p.I386I|CACNA1E_ENST00000360108.3_Silent_p.I435I|CACNA1E_ENST00000526775.1_Silent_p.I435I|CACNA1E_ENST00000367567.4_Silent_p.I42I	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	435					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.I435I(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GTGTTGATATCTCCTCTGTGG	0.502																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											75.0	85.0	82.0					1																	181685255		1961	4142	6103	-	-	-	SO:0001819	synonymous_variant	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1305C>A	1.37:g.181685255C>A			B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.I435	ENST00000367573.2	37	c.1305	CCDS55664.1	1																																																																																			CACNA1E	-	NULL	ENSG00000198216		0.502	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	79	0.00	0	C	NM_000721		181685255	181685255	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	silent	33	28.26	13	SNP	1.000	A
CDAN1	146059	genome.wustl.edu	37	15	43025328	43025328	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr15:43025328C>T	ENST00000356231.3	-	9	1447	c.1424G>A	c.(1423-1425)tGg>tAg	p.W475*		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	475					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		CTCAAAATCCCAGCCAGGCTC	0.552																																						dbGAP											0													137.0	114.0	122.0					15																	43025328		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.1424G>A	15.37:g.43025328C>T	ENSP00000348564:p.Trp475*		Q6NYD0|Q7Z7L5|Q969N3	Nonsense_Mutation	SNP	NULL	p.W475*	ENST00000356231.3	37	c.1424	CCDS32209.1	15	.	.	.	.	.	.	.	.	.	.	C	38	6.920307	0.97936	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.342	20.5568	0.99304	0.0:1.0:0.0:0.0	.	.	.	.	X	475;473	.	ENSP00000267892:W473X	W	-	2	0	CDAN1	40812620	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.223000	0.78033	2.861000	0.98227	0.655000	0.94253	TGG	CDAN1	-	NULL	ENSG00000140326		0.552	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDAN1	HGNC	protein_coding	OTTHUMT00000431103.1	85	0.00	0	C	XM_085300		43025328	43025328	-1	no_errors	ENST00000356231	ensembl	human	known	69_37n	nonsense	33	10.81	4	SNP	1.000	T
CEP250	11190	genome.wustl.edu	37	20	34091216	34091216	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr20:34091216G>T	ENST00000397527.1	+	30	5739	c.5019G>T	c.(5017-5019)caG>caT	p.Q1673H	CEP250_ENST00000342580.4_Missense_Mutation_p.Q1617H	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1673	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			TCGAGGATCAGAGGACCCGGC	0.577																																						dbGAP											0													113.0	122.0	119.0					20																	34091216		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.5019G>T	20.37:g.34091216G>T	ENSP00000380661:p.Gln1673His		E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	superfamily_Prefoldin	p.Q1673H	ENST00000397527.1	37	c.5019	CCDS13255.1	20	.	.	.	.	.	.	.	.	.	.	G	4.968	0.179816	0.09443	.	.	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000422671	T;T;T	0.50001	2.84;2.83;0.76	4.51	-2.12	0.07165	.	0.105878	0.42548	D	0.000695	T	0.26412	0.0645	N	0.20986	0.625	0.27126	N	0.962018	P	0.44006	0.824	B	0.41036	0.346	T	0.28933	-1.0028	10	0.30854	T	0.27	.	6.2342	0.20754	0.4221:0.0:0.4417:0.1363	.	1673	Q9BV73	CP250_HUMAN	H	1673;1617;161	ENSP00000380661:Q1673H;ENSP00000341541:Q1617H;ENSP00000395992:Q161H	ENSP00000341541:Q1617H	Q	+	3	2	CEP250	33554630	0.967000	0.33354	0.988000	0.46212	0.318000	0.28184	0.487000	0.22356	-0.249000	0.09569	-1.804000	0.00617	CAG	CEP250	-	NULL	ENSG00000126001		0.577	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	HGNC	protein_coding	OTTHUMT00000078877.7	37	0.00	0	G	NM_007186		34091216	34091216	+1	no_errors	ENST00000397527	ensembl	human	known	69_37n	missense	12	74.47	35	SNP	0.936	T
CROCCP2	84809	genome.wustl.edu	37	1	16949316	16949316	+	lincRNA	SNP	G	G	A	rs56112942		TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr1:16949316G>A	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											gtgaaaccccgtctctactaa	0.542																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16949316G>A			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.542	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	9	0.00	0	G	NR_026752.1		16949316	16949316	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	21	22.22	6	SNP	0.121	A
DCP1A	55802	genome.wustl.edu	37	3	53326791	53326791	+	Frame_Shift_Del	DEL	G	G	-			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr3:53326791delG	ENST00000607628.1	-	7	800	c.691delC	c.(691-693)caafs	p.Q231fs	DCP1A_ENST00000294241.6_Frame_Shift_Del_p.Q231fs|Y_RNA_ENST00000384175.1_RNA|DCP1A_ENST00000606822.1_Frame_Shift_Del_p.Q193fs|DCP1A_ENST00000480258.1_5'UTR	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	231					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		ACTGCTGGTTGTTCCTTTGGC	0.468																																						dbGAP											0													51.0	49.0	50.0					3																	53326791		1882	4120	6002	-	-	-	SO:0001589	frameshift_variant	0			AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.691delC	3.37:g.53326791delG	ENSP00000475920:p.Gln231fs		B4DHN9|U3KQM8	RNA	DEL	-	NULL	ENST00000607628.1	37	NULL		3																																																																																			DCP1A	-	-	ENSG00000162290		0.468	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	DCP1A	HGNC	protein_coding		44	0.00	0	G	NM_018403		53326791	53326791	-1	no_errors	ENST00000294241	ensembl	human	known	69_37n	rna	12	14.29	2	DEL	1.000	-
ELL2	22936	genome.wustl.edu	37	5	95242412	95242412	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr5:95242412T>C	ENST00000237853.4	-	5	905	c.556A>G	c.(556-558)Atg>Gtg	p.M186V	ELL2_ENST00000431061.2_Intron|ELL2_ENST00000506628.1_5'UTR	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	186					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		GCAGGGTTCATGGGGGTTGAC	0.473																																						dbGAP											0													179.0	166.0	170.0					5																	95242412		2203	4300	6503	-	-	-	SO:0001583	missense	0			U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.556A>G	5.37:g.95242412T>C	ENSP00000237853:p.Met186Val		B4DNK7	Missense_Mutation	SNP	pfam_RNA_pol_II_elong_fac_ELL,pfam_Occludin_RNApol2_elong_fac_ELL	p.M186V	ENST00000237853.4	37	c.556	CCDS4080.1	5	.	.	.	.	.	.	.	.	.	.	T	13.04	2.117608	0.37339	.	.	ENSG00000118985	ENST00000237853	T	0.27720	1.65	5.9	5.9	0.94986	.	0.130243	0.64402	D	0.000002	T	0.09247	0.0228	N	0.00289	-1.7	0.80722	D	1	B	0.10296	0.003	B	0.13407	0.009	T	0.33394	-0.9870	10	0.14252	T	0.57	-3.9357	15.9847	0.80142	0.0:0.0:0.0:1.0	.	186	O00472	ELL2_HUMAN	V	186	ENSP00000237853:M186V	ENSP00000237853:M186V	M	-	1	0	ELL2	95268168	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.120000	0.50430	2.254000	0.74563	0.482000	0.46254	ATG	ELL2	-	pfam_RNA_pol_II_elong_fac_ELL	ENSG00000118985		0.473	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL2	HGNC	protein_coding	OTTHUMT00000242846.1	118	0.00	0	T	NM_012081		95242412	95242412	-1	no_errors	ENST00000237853	ensembl	human	known	69_37n	missense	30	50.00	30	SNP	1.000	C
FAM157B	100132403	genome.wustl.edu	37	9	141107536	141107537	+	lincRNA	INS	-	-	GCA	rs367832601|rs554298933|rs370981092		TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr9:141107536_141107537insGCA	ENST00000446912.2	+	0	19_20							P0CG42	F157B_HUMAN	family with sequence similarity 157, member B																		CGgcagcggcggcagcagcagc	0.545																																						dbGAP											0																																										-	-	-			0					9q34	2013-01-24			ENSG00000233013	ENSG00000233013			34080	other	unknown							Standard	NM_001145249		Approved		uc011mfe.1	P0CG42	OTTHUMG00000021000		9.37:g.141107543_141107545dupGCA				RNA	INS	-	NULL	ENST00000446912.2	37	NULL		9																																																																																			FAM157B	-	-	ENSG00000233013		0.545	FAM157B-001	KNOWN	mRNA_end_NF|basic	lincRNA	FAM157B	HGNC	lincRNA	OTTHUMT00000055378.2	23	0.00	0	-	NM_001145249		141107536	141107537	+1	no_errors	ENST00000446912	ensembl	human	known	69_37n	rna	26	23.53	8	INS	0.033:0.036	GCA
FCHO1	23149	genome.wustl.edu	37	19	17887068	17887068	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr19:17887068C>T	ENST00000596536.1	+	17	1478	c.1195C>T	c.(1195-1197)Cgc>Tgc	p.R399C	FCHO1_ENST00000595033.1_Missense_Mutation_p.R349C|FCHO1_ENST00000597512.1_Missense_Mutation_p.R406C|FCHO1_ENST00000594202.1_Missense_Mutation_p.R399C|FCHO1_ENST00000600676.1_Missense_Mutation_p.R399C|FCHO1_ENST00000252771.7_Missense_Mutation_p.R399C|FCHO1_ENST00000596951.1_Missense_Mutation_p.R399C|FCHO1_ENST00000389133.4_Missense_Mutation_p.R399C|FCHO1_ENST00000539407.1_Missense_Mutation_p.R399C	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	399	Mediates interaction with the adaptor protein complex AP-2.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						CACCATGAAACGCCATTCTTC	0.547																																						dbGAP											0													295.0	246.0	263.0					19																	17887068		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.1195C>T	19.37:g.17887068C>T	ENSP00000470731:p.Arg399Cys		A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_FCH,superfamily_Clathrin_mu_C,smart_FCH,pfscan_FCH	p.R399C	ENST00000596536.1	37	c.1195	CCDS32955.1	19	.	.	.	.	.	.	.	.	.	.	C	22.5	4.304627	0.81136	.	.	ENSG00000130475	ENST00000252771;ENST00000389133;ENST00000539407	T;T;T	0.41065	1.01;1.01;1.01	4.74	4.74	0.60224	.	0.154925	0.41938	D	0.000797	T	0.52403	0.1732	L	0.45581	1.43	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.59703	0.732;0.862	T	0.56068	-0.8040	10	0.87932	D	0	-18.4291	13.226	0.59914	0.0:1.0:0.0:0.0	.	399;399	O14526;O14526-2	FCHO1_HUMAN;.	C	399	ENSP00000252771:R399C;ENSP00000373785:R399C;ENSP00000437978:R399C	ENSP00000252771:R399C	R	+	1	0	FCHO1	17748068	0.996000	0.38824	0.926000	0.36857	0.960000	0.62799	1.512000	0.35812	2.163000	0.67991	0.561000	0.74099	CGC	FCHO1	-	NULL	ENSG00000130475		0.547	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FCHO1	HGNC	protein_coding	OTTHUMT00000466946.2	90	0.00	0	C	NM_015122		17887068	17887068	+1	no_errors	ENST00000252771	ensembl	human	known	69_37n	missense	43	26.67	16	SNP	1.000	T
FGF3	2248	genome.wustl.edu	37	11	69625283	69625283	+	Silent	SNP	G	G	A			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr11:69625283G>A	ENST00000334134.2	-	3	600	c.510C>T	c.(508-510)cgC>cgT	p.R170R		NM_005247.2	NP_005238.1	P11487	FGF3_HUMAN	fibroblast growth factor 3	170					anatomical structure morphogenesis (GO:0009653)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cardiac muscle tissue development (GO:0055026)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|post-anal tail morphogenesis (GO:0036342)|semicircular canal morphogenesis (GO:0048752)|signal transduction (GO:0007165)|thymus development (GO:0048538)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	growth factor activity (GO:0008083)	p.R170R(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	13			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)			TCTGTGTGCGGCGGGTCTTGA	0.682																																						dbGAP											1	Substitution - coding silent(1)	ovary(1)											21.0	24.0	23.0					11																	69625283		2193	4270	6463	-	-	-	SO:0001819	synonymous_variant	0				CCDS8195.1	11q13	2010-06-25	2010-06-25		ENSG00000186895	ENSG00000186895			3681	protein-coding gene	gene with protein product	"""INT-2 proto-oncogene protein"", ""oncogene INT2"", ""V-INT2 murine mammary tumor virus integration site oncogene homolog"", ""murine mammary tumor virus integration site 2, mouse"""	164950	"""fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog)"""	INT2			Standard	NM_005247		Approved	HBGF-3	uc001oph.3	P11487	OTTHUMG00000167888	ENST00000334134.2:c.510C>T	11.37:g.69625283G>A			Q0VG69	Silent	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_GF_heparin-bd,prints_IL1_HBGF	p.R170	ENST00000334134.2	37	c.510	CCDS8195.1	11																																																																																			FGF3	-	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF	ENSG00000186895		0.682	FGF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF3	HGNC	protein_coding	OTTHUMT00000396835.1	20	0.00	0	G	NM_005247		69625283	69625283	-1	no_errors	ENST00000334134	ensembl	human	known	69_37n	silent	30	16.67	6	SNP	0.999	A
GFPT1	2673	genome.wustl.edu	37	2	69569326	69569326	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr2:69569326C>G	ENST00000357308.4	-	13	1339	c.1161G>C	c.(1159-1161)ttG>ttC	p.L387F	GFPT1_ENST00000361060.5_Missense_Mutation_p.L369F	NM_001244710.1	NP_001231639.1	Q06210	GFPT1_HUMAN	glutamine--fructose-6-phosphate transaminase 1	387	Isomerase.|SIS 1. {ECO:0000255|PROSITE- ProRule:PRU00797}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|circadian regulation of gene expression (GO:0032922)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glucosamine biosynthetic process (GO:0006042)|glutamine metabolic process (GO:0006541)|negative regulation of glycogen biosynthetic process (GO:0045719)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|protein N-linked glycosylation via asparagine (GO:0018279)|response to sucrose (GO:0009744)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			endometrium(1)|large_intestine(3)|lung(5)|skin(3)	12						CAATAAGAATCAAACGCCGGC	0.343																																						dbGAP											0													134.0	146.0	142.0					2																	69569326		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33216.1, CCDS58713.1	2p13	2014-09-17	2010-05-11		ENSG00000198380	ENSG00000198380	2.6.1.16		4241	protein-coding gene	gene with protein product		138292	"""glutamine-fructose-6-phosphate transaminase 1"""	GFPT		1460020	Standard	NM_002056		Approved	GFAT, GFA, GFAT1	uc002sfi.2	Q06210	OTTHUMG00000152666	ENST00000357308.4:c.1161G>C	2.37:g.69569326C>G	ENSP00000349860:p.Leu387Phe		Q53QE6|Q9BXF8	Missense_Mutation	SNP	pfam_SIS,pfam_GATase_dom,tigrfam_GlmS_trans	p.L387F	ENST00000357308.4	37	c.1161	CCDS58713.1	2	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972189	0.53614	.	.	ENSG00000198380	ENST00000357308;ENST00000361060	T;T	0.75154	-0.91;-0.91	5.02	3.22	0.36961	.	0.000000	0.85682	D	0.000000	T	0.80232	0.4585	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.78406	-0.2216	10	0.56958	D	0.05	-8.4519	8.167	0.31233	0.0:0.7204:0.1314:0.1483	.	369	Q06210-2	.	F	387;369	ENSP00000349860:L387F;ENSP00000354347:L369F	ENSP00000349860:L387F	L	-	3	2	GFPT1	69422830	0.979000	0.34478	1.000000	0.80357	0.985000	0.73830	0.053000	0.14184	0.711000	0.32018	-0.232000	0.12228	TTG	GFPT1	-	pfam_SIS,tigrfam_GlmS_trans	ENSG00000198380		0.343	GFPT1-201	KNOWN	basic|CCDS	protein_coding	GFPT1	HGNC	protein_coding		87	0.00	0	C			69569326	69569326	-1	no_errors	ENST00000357308	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	1.000	G
GSTM4	2948	genome.wustl.edu	37	1	110201636	110201637	+	Missense_Mutation	DNP	TT	TT	GA			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr1:110201636_110201637TT>GA	ENST00000369836.4	+	7	780_781	c.471_472TT>GA	c.(469-474)gaTTtc>gaGAtc	p.157_158DF>EI	GSTM4_ENST00000369833.1_Missense_Mutation_p.116_117DF>EI|GSTM4_ENST00000336075.5_Missense_Mutation_p.96_97DF>EI|GSTM4_ENST00000495742.1_3'UTR|GSTM4_ENST00000326729.5_Missense_Mutation_p.157_158DF>EI	NM_000850.4	NP_000841.1	Q03013	GSTM4_HUMAN	glutathione S-transferase mu 4	157	GST C-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	enzyme binding (GO:0019899)|glutathione binding (GO:0043295)|glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)			endometrium(3)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0123)|Colorectal(144;0.0129)|Epithelial(280;0.0147)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.0471)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	CCTTTGTAGATTTCCTCGCCTA	0.485																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			M96234	CCDS806.1, CCDS807.1	1p13.3	2012-06-22	2008-11-26		ENSG00000168765	ENSG00000168765	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4636	protein-coding gene	gene with protein product		138333	"""glutathione S-transferase M4"""			8276420	Standard	NM_000850		Approved		uc001dyf.3	Q03013	OTTHUMG00000011642	Exception_encountered	1.37:g.110201636_110201637delinsGA	ENSP00000358851:p.D157_F158delinsEI		A8K765|Q05465|Q32NC1|Q4JNT8|Q6FH87	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_mu	p.D157E|p.F158I	ENST00000369836.4	37	c.471|c.472	CCDS807.1	1																																																																																			GSTM4	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	ENSG00000168765		0.485	GSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTM4	HGNC	protein_coding	OTTHUMT00000032187.1	175	0.00	0	T	NM_000850		110201636|110201637	110201636|110201637	+1	no_errors	ENST00000369836	ensembl	human	known	69_37n	missense	61|62	20.78|18.42	16|14	SNP	1.000	G|A
HEATR5A	25938	genome.wustl.edu	37	14	31792818	31792818	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr14:31792818T>A	ENST00000389961.3	-	23	3721	c.3722A>T	c.(3721-3723)cAt>cTt	p.H1241L	HEATR5A_ENST00000439727.1_Missense_Mutation_p.H954L|HEATR5A_ENST00000543095.2_Missense_Mutation_p.H1247L|HEATR5A_ENST00000439348.1_Missense_Mutation_p.H1241L			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1241										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		AATGTCAAAATGTGCACTGTT	0.368																																						dbGAP											0													100.0	85.0	90.0					14																	31792818		1880	4111	5991	-	-	-	SO:0001583	missense	0			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.3722A>T	14.37:g.31792818T>A	ENSP00000374611:p.His1241Leu		Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.H1241L	ENST00000389961.3	37	c.3722		14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.3|25.3	4.622696|4.622696	0.87460|0.87460	.|.	.|.	ENSG00000129493|ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095|ENST00000538864	T;T;T;T|.	0.44083|.	0.93;0.93;0.93;0.93|.	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	0.105878|.	0.64402|.	D|.	0.000004|.	T|T	0.79707|0.79707	0.4492|0.4492	M|M	0.87097|0.87097	2.86|2.86	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.85130|.	0.996;0.997|.	T|T	0.82918|0.82918	-0.0219|-0.0219	10|5	0.87932|.	D|.	0|.	.|.	15.4784|15.4784	0.75504|0.75504	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1241;1241|.	Q86XA9-2;Q86XA9|.	.;HTR5A_HUMAN|.	L|F	1241;1241;954;1247|875	ENSP00000374611:H1241L;ENSP00000405407:H1241L;ENSP00000408681:H954L;ENSP00000437968:H1247L|.	ENSP00000374611:H1241L|.	H|I	-|-	2|1	0|0	HEATR5A|HEATR5A	30862569|30862569	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.906000|0.906000	0.53458|0.53458	7.344000|7.344000	0.79328|0.79328	2.056000|2.056000	0.61249|0.61249	0.254000|0.254000	0.18369|0.18369	CAT|ATT	HEATR5A	-	NULL	ENSG00000129493		0.368	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	HEATR5A	HGNC	protein_coding		127	0.00	0	T	NM_015473		31792818	31792818	-1	no_errors	ENST00000389961	ensembl	human	known	69_37n	missense	45	26.23	16	SNP	1.000	A
HIVEP3	59269	genome.wustl.edu	37	1	42049672	42049672	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr1:42049672T>C	ENST00000372583.1	-	4	1682	c.797A>G	c.(796-798)gAg>gGg	p.E266G	HIVEP3_ENST00000372584.1_Missense_Mutation_p.E266G|HIVEP3_ENST00000429157.2_Missense_Mutation_p.E266G|HIVEP3_ENST00000247584.5_Missense_Mutation_p.E266G	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	266	Acidic 1.|No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				AGGGATCCGCTCCATCTCCAG	0.577																																						dbGAP											0													65.0	62.0	63.0					1																	42049672		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.797A>G	1.37:g.42049672T>C	ENSP00000361664:p.Glu266Gly		A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E266G	ENST00000372583.1	37	c.797	CCDS463.1	1	.	.	.	.	.	.	.	.	.	.	T	12.74	2.028314	0.35797	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.06687	3.28;3.27;3.27;3.28	5.15	5.15	0.70609	.	0.000000	0.53938	D	0.000057	T	0.07052	0.0179	N	0.24115	0.695	0.45378	D	0.998368	B;B	0.30563	0.285;0.188	B;B	0.30943	0.122;0.057	T	0.44034	-0.9354	10	0.22109	T	0.4	-2.4571	14.8132	0.70010	0.0:0.0:0.0:1.0	.	266;266	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	G	266	ENSP00000361665:E266G;ENSP00000361664:E266G;ENSP00000247584:E266G;ENSP00000410828:E266G	ENSP00000247584:E266G	E	-	2	0	HIVEP3	41822259	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	1.898000	0.39809	2.172000	0.68678	0.533000	0.62120	GAG	HIVEP3	-	NULL	ENSG00000127124		0.577	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	HGNC	protein_coding	OTTHUMT00000016978.1	58	0.00	0	T	NM_024503		42049672	42049672	-1	no_errors	ENST00000247584	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	1.000	C
HSD17B7P2	158160	genome.wustl.edu	37	10	38652501	38652501	+	RNA	SNP	A	A	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr10:38652501A>T	ENST00000494540.1	+	0	491					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		GGACTTCAGGAGGTGTTTGAG	0.443																																						dbGAP											0																																										-	-	-			0					10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38652501A>T				RNA	SNP	-	NULL	ENST00000494540.1	37	NULL		10																																																																																			HSD17B7P2	-	-	ENSG00000099251		0.443	HSD17B7P2-001	KNOWN	basic	processed_transcript	HSD17B7P2	HGNC	pseudogene	OTTHUMT00000047631.2	97	0.00	0	A	NR_003086		38652501	38652501	+1	no_errors	ENST00000494540	ensembl	human	known	69_37n	rna	45	31.82	21	SNP	1.000	T
KCNB2	9312	genome.wustl.edu	37	8	73848355	73848355	+	Silent	SNP	A	A	G			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr8:73848355A>G	ENST00000523207.1	+	3	1353	c.765A>G	c.(763-765)tcA>tcG	p.S255S		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	255					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	TCTTATCCTCACCAAATAAAT	0.438																																						dbGAP											0													166.0	150.0	155.0					8																	73848355		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.765A>G	8.37:g.73848355A>G			Q7Z7D0|Q9BXD3	Silent	SNP	pfam_K_chnl_volt-dep_Kv2,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv2.2,prints_K_chnl_volt-dep_Kv2,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv8	p.S255	ENST00000523207.1	37	c.765	CCDS6209.1	8																																																																																			KCNB2	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000182674		0.438	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNB2	HGNC	protein_coding	OTTHUMT00000378998.1	94	0.00	0	A	NM_004770		73848355	73848355	+1	no_errors	ENST00000523207	ensembl	human	known	69_37n	silent	88	16.82	18	SNP	0.921	G
KIF26B	55083	genome.wustl.edu	37	1	245851145	245851145	+	Silent	SNP	C	C	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr1:245851145C>T	ENST00000407071.2	+	12	5300	c.4860C>T	c.(4858-4860)ggC>ggT	p.G1620G	KIF26B_ENST00000366518.4_Silent_p.G1239G	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1620					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GTGCCAGCGGCAGCGGCACCA	0.687																																						dbGAP											0													10.0	16.0	14.0					1																	245851145		1928	4143	6071	-	-	-	SO:0001819	synonymous_variant	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.4860C>T	1.37:g.245851145C>T			Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G1620	ENST00000407071.2	37	c.4860	CCDS44342.1	1																																																																																			KIF26B	-	NULL	ENSG00000162849		0.687	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	12	0.00	0	C	XM_371354		245851145	245851145	+1	no_errors	ENST00000407071	ensembl	human	known	69_37n	silent	27	20.59	7	SNP	0.988	T
KXD1	79036	genome.wustl.edu	37	19	18679394	18679394	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr19:18679394A>T	ENST00000602094.1	+	5	1944	c.484A>T	c.(484-486)Atc>Ttc	p.I162F	KXD1_ENST00000601630.1_Missense_Mutation_p.I181F|KXD1_ENST00000539106.1_Missense_Mutation_p.I162F|KXD1_ENST00000595073.1_Missense_Mutation_p.I162F|KXD1_ENST00000599319.1_Missense_Mutation_p.I162F|AC005253.4_ENST00000593791.1_RNA|KXD1_ENST00000540691.1_Missense_Mutation_p.I162F|KXD1_ENST00000222307.4_Missense_Mutation_p.I162F			Q9BQD3	KXDL1_HUMAN	KxDL motif containing 1	162					vesicle-mediated transport (GO:0016192)	BLOC-1 complex (GO:0031083)											CTCCCCAGCCATCAACGGCCG	0.662																																						dbGAP											0													78.0	74.0	75.0					19																	18679394		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098346	CCDS12381.1	19p13.11	2011-11-24	2011-11-24	2011-11-24	ENSG00000105700	ENSG00000105700			28420	protein-coding gene	gene with protein product		615178	"""chromosome 19 open reading frame 50"""	C19orf50		21159114	Standard	NM_001171948		Approved	FLJ25480, MGC2749, KXDL	uc002njo.3	Q9BQD3		ENST00000602094.1:c.484A>T	19.37:g.18679394A>T	ENSP00000472836:p.Ile162Phe		O76098	Missense_Mutation	SNP	pfam_Uncharacterised_KxDL	p.I162F	ENST00000602094.1	37	c.484	CCDS12381.1	19	.	.	.	.	.	.	.	.	.	.	A	7.720	0.697041	0.15106	.	.	ENSG00000105700	ENST00000540691;ENST00000539106;ENST00000222307	T;T;T	0.50001	0.76;0.76;0.76	4.9	-3.3	0.05003	.	0.466534	0.24012	N	0.042366	T	0.21103	0.0508	N	0.08118	0	0.26288	N	0.97816	B	0.25169	0.119	B	0.23716	0.048	T	0.11518	-1.0584	10	0.48119	T	0.1	-24.1098	7.4277	0.27109	0.3058:0.1287:0.5655:0.0	.	162	Q9BQD3	CS050_HUMAN	F	162	ENSP00000443549:I162F;ENSP00000438903:I162F;ENSP00000222307:I162F	ENSP00000222307:I162F	I	+	1	0	C19orf50	18540394	0.000000	0.05858	0.055000	0.19348	0.030000	0.12068	-0.362000	0.07602	-0.379000	0.07906	-0.366000	0.07423	ATC	KXD1	-	NULL	ENSG00000105700		0.662	KXD1-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	KXD1	HGNC	protein_coding	OTTHUMT00000465107.1	36	0.00	0	A	NM_024069		18679394	18679394	+1	no_errors	ENST00000222307	ensembl	human	known	69_37n	missense	16	40.74	11	SNP	0.462	T
LRIG2	9860	genome.wustl.edu	37	1	113616189	113616189	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr1:113616189T>A	ENST00000361127.5	+	1	359	c.161T>A	c.(160-162)cTg>cAg	p.L54Q	RP11-31F15.2_ENST00000421157.1_lincRNA	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	54	LRRNT.				innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		ATTCCTCTCCTGGACTGCAGT	0.662											OREG0013684	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													69.0	79.0	76.0					1																	113616189		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.161T>A	1.37:g.113616189T>A	ENSP00000355396:p.Leu54Gln	1451	Q9NSN2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L54Q	ENST00000361127.5	37	c.161	CCDS30808.1	1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.353505	0.82243	.	.	ENSG00000198799	ENST00000361127	T	0.64260	-0.09	4.93	4.93	0.64822	.	0.214476	0.29646	N	0.011579	T	0.64616	0.2614	L	0.52573	1.65	0.42316	D	0.992233	D	0.69078	0.997	D	0.68765	0.96	T	0.70059	-0.4976	10	0.87932	D	0	.	10.8949	0.47017	0.0:0.0:0.0:1.0	.	54	O94898	LRIG2_HUMAN	Q	54	ENSP00000355396:L54Q	ENSP00000355396:L54Q	L	+	2	0	LRIG2	113417712	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	3.219000	0.51200	2.066000	0.61787	0.460000	0.39030	CTG	LRIG2	-	NULL	ENSG00000198799		0.662	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	HGNC	protein_coding	OTTHUMT00000033549.2	32	0.00	0	T	NM_014813		113616189	113616189	+1	no_errors	ENST00000361127	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	1.000	A
LRRC23	10233	genome.wustl.edu	37	12	7014914	7014914	+	Missense_Mutation	SNP	C	C	A	rs116430099	byFrequency	TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr12:7014914C>A	ENST00000007969.8	+	2	337	c.117C>A	c.(115-117)ttC>ttA	p.F39L	LRRC23_ENST00000429740.1_Missense_Mutation_p.F39L|LRRC23_ENST00000436789.1_Missense_Mutation_p.F39L|LRRC23_ENST00000443597.2_Missense_Mutation_p.F39L|LRRC23_ENST00000323702.5_Missense_Mutation_p.F39L|LRRC23_ENST00000449039.1_3'UTR|LRRC23_ENST00000433346.1_Missense_Mutation_p.F39L	NM_001135217.1|NM_201650.2	NP_001128689.1|NP_964013.1	Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23	39										NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						gggaagagTTCCCTGAGGAAG	0.557																																						dbGAP											0													55.0	60.0	58.0					12																	7014914		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000007969.8:c.117C>A	12.37:g.7014914C>A	ENSP00000007969:p.Phe39Leu		A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	Missense_Mutation	SNP	pfam_Leu-rich_rpt	p.F39L	ENST00000007969.8	37	c.117	CCDS8569.1	12	.	.	.	.	.	.	.	.	.	.	C	0.550	-0.849946	0.02651	.	.	ENSG00000010626	ENST00000433346;ENST00000007969;ENST00000323702;ENST00000443597;ENST00000415834;ENST00000436789;ENST00000429740	T;T;T;T;T;T;T	0.64085	2.03;0.18;-0.08;0.18;1.04;2.05;1.62	3.78	-1.7	0.08159	.	.	.	.	.	T	0.26521	0.0648	N	0.03608	-0.345	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.0	T	0.18587	-1.0332	9	0.08179	T	0.78	3.6521	1.239	0.01959	0.1658:0.3057:0.3247:0.2039	.	39;39;39;39	E9PDZ4;Q53EV4-2;Q53EV4;C9JKE8	.;.;LRC23_HUMAN;.	L	39	ENSP00000402554:F39L;ENSP00000007969:F39L;ENSP00000317464:F39L;ENSP00000390932:F39L;ENSP00000408066:F39L;ENSP00000396049:F39L;ENSP00000397192:F39L	ENSP00000007969:F39L	F	+	3	2	LRRC23	6885175	0.000000	0.05858	0.000000	0.03702	0.403000	0.30841	-1.255000	0.02872	-0.348000	0.08286	0.561000	0.74099	TTC	LRRC23	-	NULL	ENSG00000010626		0.557	LRRC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC23	HGNC	protein_coding	OTTHUMT00000345214.1	34	0.00	0	C	NM_006992		7014914	7014914	+1	no_errors	ENST00000007969	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	0.000	A
MAP6	4135	genome.wustl.edu	37	11	75298409	75298409	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr11:75298409C>T	ENST00000304771.3	-	4	2887	c.2137G>A	c.(2137-2139)Gtg>Atg	p.V713M	MAP6_ENST00000526740.1_Missense_Mutation_p.V384M|CTD-2530H12.4_ENST00000527803.1_RNA|MAP6_ENST00000526689.1_5'Flank	NM_033063.1	NP_149052.1	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6	713	Pro-rich.				dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|microtubule cytoskeleton organization (GO:0000226)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	19	Ovarian(111;0.11)					TGATTCTTCACGGACTCGGGG	0.493																																					Esophageal Squamous(181;1115 2007 8647 17065 22697)	dbGAP											0													144.0	147.0	146.0					11																	75298409		2200	4293	6493	-	-	-	SO:0001583	missense	0			AK123340	CCDS31641.1, CCDS44686.1	11q13.5	2005-10-11			ENSG00000171533	ENSG00000171533			6868	protein-coding gene	gene with protein product		601783				10516426, 12231625	Standard	NM_207577		Approved	KIAA1878, STOP, FLJ41346	uc001owu.3	Q96JE9	OTTHUMG00000165343	ENST00000304771.3:c.2137G>A	11.37:g.75298409C>T	ENSP00000307093:p.Val713Met		A7E2A1|Q6P3T0|Q6ZWB8	Missense_Mutation	SNP	pfam_STOP/FAM154	p.V713M	ENST00000304771.3	37	c.2137	CCDS31641.1	11	.	.	.	.	.	.	.	.	.	.	C	16.48	3.136011	0.56936	.	.	ENSG00000171533	ENST00000304771;ENST00000526740;ENST00000545476	T	0.50813	0.73	4.68	-4.49	0.03504	.	1.900540	0.02623	N	0.103373	T	0.28400	0.0702	L	0.34521	1.04	0.09310	N	1	B	0.30211	0.273	B	0.17098	0.017	T	0.05550	-1.0878	10	0.34782	T	0.22	0.107	1.1601	0.01804	0.1422:0.3535:0.2158:0.2884	.	713	Q96JE9	MAP6_HUMAN	M	713;384;384	ENSP00000307093:V713M	ENSP00000307093:V713M	V	-	1	0	MAP6	74976057	0.005000	0.15991	0.000000	0.03702	0.160000	0.22226	-0.269000	0.08596	-0.727000	0.04888	0.655000	0.94253	GTG	MAP6	-	NULL	ENSG00000171533		0.493	MAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP6	HGNC	protein_coding	OTTHUMT00000383527.1	125	0.00	0	C	NM_033063		75298409	75298409	-1	no_errors	ENST00000304771	ensembl	human	known	69_37n	missense	34	26.09	12	SNP	0.000	T
C9orf3	84909	genome.wustl.edu	37	9	97848305	97848305	+	Intron	SNP	C	C	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr9:97848305C>T	ENST00000375315.2	+	16	2464				MIR3074_ENST00000384885.2_RNA|C9orf3_ENST00000297979.5_Intron|MIR23B_ENST00000384832.1_RNA|MIR27B_ENST00000385129.1_RNA	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3						leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		GACCCGCCCTCCGGTGCCTAC	0.587																																						dbGAP											0													41.0	42.0	42.0					9																	97848305		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.2458-659C>T	9.37:g.97848305C>T			Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	RNA	SNP	-	NULL	ENST00000375315.2	37	NULL	CCDS55328.1	9																																																																																			MIR24-1	-	-	ENSG00000207617		0.587	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR24-1	HGNC	protein_coding		25	0.00	0	C	NM_032823		97848305	97848305	-1	no_errors	ENST00000384885	ensembl	human	known	69_37n	rna	21	34.38	11	SNP	1.000	T
MTOR	2475	genome.wustl.edu	37	1	11187116	11187116	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr1:11187116C>A	ENST00000361445.4	-	45	6378	c.6302G>T	c.(6301-6303)tGg>tTg	p.W2101L	MTOR_ENST00000376838.1_Missense_Mutation_p.W306L	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2101	Sufficient for interaction with the FKBP1A/rapamycin complex. {ECO:0000250}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	ATAGAGGTCCCAGGCTTGGGT	0.493																																						dbGAP											0													116.0	105.0	109.0					1																	11187116		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.6302G>T	1.37:g.11187116C>A	ENSP00000354558:p.Trp2101Leu		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_FKBP_rapamycin-assoc_FKBP12-bd,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_FKBP_rapamycin-assoc_FKBP12-bd,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.W2101L	ENST00000361445.4	37	c.6302	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	31	5.089579	0.94149	.	.	ENSG00000198793	ENST00000361445;ENST00000376838	T;T	0.80214	-1.35;-1.35	5.4	5.4	0.78164	Protein kinase-like domain (1);FKBP12-rapamycin-associated protein, FKBP12-rapamycin-binding (3);	0.000000	0.85682	D	0.000000	D	0.93145	0.7817	H	0.95079	3.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94628	0.7819	10	0.62326	D	0.03	-17.558	19.196	0.93689	0.0:1.0:0.0:0.0	.	2101	P42345	MTOR_HUMAN	L	2101;306	ENSP00000354558:W2101L;ENSP00000366034:W306L	ENSP00000354558:W2101L	W	-	2	0	MTOR	11109703	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.456000	0.80751	2.531000	0.85337	0.650000	0.86243	TGG	MTOR	-	pfam_FKBP_rapamycin-assoc_FKBP12-bd,superfamily_Kinase-like_dom,superfamily_FKBP_rapamycin-assoc_FKBP12-bd	ENSG00000198793		0.493	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	100	0.00	0	C	NM_004958		11187116	11187116	-1	no_errors	ENST00000361445	ensembl	human	known	69_37n	missense	27	38.64	17	SNP	1.000	A
MTF2	22823	genome.wustl.edu	37	1	93602437	93602437	+	Silent	SNP	C	C	G			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr1:93602437C>G	ENST00000370298.4	+	15	1924	c.1635C>G	c.(1633-1635)ctC>ctG	p.L545L	MTF2_ENST00000471953.1_3'UTR|MTF2_ENST00000540243.1_Silent_p.L443L|MTF2_ENST00000545708.1_Silent_p.L443L|MTF2_ENST00000370303.4_Silent_p.L488L	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2	545					chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		AGTTACAACTCAATCATCTAA	0.388																																						dbGAP											0													110.0	107.0	108.0					1																	93602437		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.1635C>G	1.37:g.93602437C>G			A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.L545	ENST00000370298.4	37	c.1635	CCDS742.1	1																																																																																			MTF2	-	NULL	ENSG00000143033		0.388	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTF2	HGNC	protein_coding	OTTHUMT00000028075.3	65	0.00	0	C	NM_007358		93602437	93602437	+1	no_errors	ENST00000370298	ensembl	human	known	69_37n	silent	31	26.19	11	SNP	0.762	G
MYH8	4626	genome.wustl.edu	37	17	10298721	10298721	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr17:10298721A>T	ENST00000403437.2	-	34	4785	c.4691T>A	c.(4690-4692)aTc>aAc	p.I1564N	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1564					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CTCAAGCTGGATACGCAGAAT	0.388									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																													dbGAP											0													97.0	84.0	89.0					17																	10298721		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.4691T>A	17.37:g.10298721A>T	ENSP00000384330:p.Ile1564Asn		Q14910	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.I1564N	ENST00000403437.2	37	c.4691	CCDS11153.1	17	.	.	.	.	.	.	.	.	.	.	A	15.03	2.711921	0.48517	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.78246	-1.16	4.85	4.85	0.62838	Myosin tail (1);	0.177402	0.26677	U	0.023072	T	0.79569	0.4468	M	0.75447	2.3	0.37041	D	0.897165	B	0.23650	0.089	B	0.31245	0.126	T	0.82208	-0.0571	10	0.66056	D	0.02	.	14.6106	0.68514	1.0:0.0:0.0:0.0	.	1564	P13535	MYH8_HUMAN	N	1564	ENSP00000384330:I1564N	ENSP00000252173:I1564N	I	-	2	0	MYH8	10239446	0.866000	0.29940	0.999000	0.59377	0.957000	0.61999	2.753000	0.47524	2.039000	0.60335	0.528000	0.53228	ATC	MYH8	-	pfam_Myosin_tail,superfamily_t-SNARE	ENSG00000133020		0.388	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2	97	0.00	0	A	NM_002472		10298721	10298721	-1	no_errors	ENST00000403437	ensembl	human	known	69_37n	missense	16	38.46	10	SNP	0.980	T
NDUFV1	4723	genome.wustl.edu	37	11	67377893	67377893	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr11:67377893G>C	ENST00000322776.6	+	5	705	c.552G>C	c.(550-552)aaG>aaC	p.K184N	DOC2GP_ENST00000495263.1_RNA|NDUFV1_ENST00000529927.1_Missense_Mutation_p.K175N|NDUFV1_ENST00000532303.1_Missense_Mutation_p.K83N|NDUFV1_ENST00000526169.1_3'UTR|NDUFV1_ENST00000415352.2_Missense_Mutation_p.K177N	NM_001166102.1|NM_007103.3	NP_001159574.1|NP_009034.2	P49821	NDUV1_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa	184					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(3)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	16						TGATTGGCAAGAATGCTTGTG	0.577																																						dbGAP											0													192.0	174.0	180.0					11																	67377893		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF092131	CCDS8173.1, CCDS53669.1	11q13	2011-07-04	2002-08-29		ENSG00000167792	ENSG00000167792	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7716	protein-coding gene	gene with protein product	"""complex I 51kDa subunit"", ""NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial"""	161015	"""NADH dehydrogenase (ubiquinone) flavoprotein 1 (51kD)"""			1478657	Standard	NM_007103		Approved	CI-51K	uc001omj.2	P49821	OTTHUMG00000166215	ENST00000322776.6:c.552G>C	11.37:g.67377893G>C	ENSP00000322450:p.Lys184Asn		O60924|O60940|Q16104|Q6IBR3|Q96BF8|Q96HS7	Missense_Mutation	SNP	pfam_NADH_UbQ_OxRdtase_51kDa_su,pfam_NADH-UbQ_OxRdtase_Fsu_4Fe4S-bd,pfam_Soluble_ligand-bd,smart_NADH-UbQ_OxRdtase_Fsu_4Fe4S-bd,tigrfam_NADH-UbQ_OxRdtase_suF	p.K184N	ENST00000322776.6	37	c.552	CCDS8173.1	11	.	.	.	.	.	.	.	.	.	.	G	14.38	2.517110	0.44763	.	.	ENSG00000167792	ENST00000322776;ENST00000532303;ENST00000532244;ENST00000529927;ENST00000532343;ENST00000415352;ENST00000533075;ENST00000529867	D;D;D;D;D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31	4.42	1.46	0.22682	NADH:ubiquinone oxidoreductase, 51kDa subunit (1);	0.176781	0.44483	D	0.000451	D	0.89639	0.6773	M	0.82132	2.575	0.48288	D	0.999621	P;B;B;P	0.46912	0.562;0.208;0.208;0.886	P;B;B;P	0.59424	0.744;0.115;0.115;0.857	D	0.85443	0.1156	10	0.87932	D	0	-26.0338	1.3045	0.02085	0.2601:0.1471:0.4424:0.1504	.	83;177;175;184	B4DE93;G3V0I5;P49821-2;P49821	.;.;.;NDUV1_HUMAN	N	184;83;83;175;83;177;177;172	ENSP00000322450:K184N;ENSP00000432015:K83N;ENSP00000435202:K83N;ENSP00000436766:K175N;ENSP00000431751:K83N;ENSP00000395368:K177N;ENSP00000437267:K177N;ENSP00000434438:K172N	ENSP00000322450:K184N	K	+	3	2	NDUFV1	67134469	1.000000	0.71417	0.986000	0.45419	0.946000	0.59487	0.836000	0.27545	0.128000	0.18479	0.561000	0.74099	AAG	NDUFV1	-	pfam_NADH_UbQ_OxRdtase_51kDa_su,tigrfam_NADH-UbQ_OxRdtase_suF	ENSG00000167792		0.577	NDUFV1-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	NDUFV1	HGNC	protein_coding	OTTHUMT00000388406.1	77	0.00	0	G	NM_007103		67377893	67377893	+1	no_errors	ENST00000322776	ensembl	human	known	69_37n	missense	52	27.78	20	SNP	0.974	C
NINL	22981	genome.wustl.edu	37	20	25481635	25481635	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr20:25481635C>G	ENST00000278886.6	-	8	946	c.873G>C	c.(871-873)gaG>gaC	p.E291D	NINL_ENST00000422516.1_Missense_Mutation_p.E291D	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	291					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						GGCAGCCGCTCTCCTCTGGGA	0.607																																						dbGAP											0													144.0	93.0	111.0					20																	25481635		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.873G>C	20.37:g.25481635C>G	ENSP00000278886:p.Glu291Asp		A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.E291D	ENST00000278886.6	37	c.873	CCDS33452.1	20	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350787	0.41599	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.38077	1.42;1.16	5.0	4.04	0.47022	.	0.138955	0.46145	D	0.000310	T	0.51312	0.1667	M	0.77103	2.36	0.44036	D	0.996762	P;D	0.67145	0.487;0.996	B;P	0.60609	0.122;0.877	T	0.51568	-0.8689	10	0.42905	T	0.14	-23.1724	6.5147	0.22242	0.177:0.7312:0.0:0.0918	.	291;291	Q9Y2I6-2;Q9Y2I6	.;NINL_HUMAN	D	291	ENSP00000278886:E291D;ENSP00000410431:E291D	ENSP00000278886:E291D	E	-	3	2	NINL	25429635	0.907000	0.30839	0.922000	0.36590	0.106000	0.19336	0.570000	0.23653	1.325000	0.45301	0.563000	0.77884	GAG	NINL	-	NULL	ENSG00000101004		0.607	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	HGNC	protein_coding	OTTHUMT00000078445.3	32	0.00	0	C	NM_025176		25481635	25481635	-1	no_errors	ENST00000278886	ensembl	human	known	69_37n	missense	32	28.89	13	SNP	0.989	G
NKPD1	284353	genome.wustl.edu	37	19	45662102	45662102	+	5'Flank	SNP	G	G	A			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr19:45662102G>A	ENST00000438936.2	-	0	0				NKPD1_ENST00000317951.4_Silent_p.V116V			Q17RQ9	NKPD1_HUMAN	NTPase, KAP family P-loop domain containing 1							integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|prostate(2)|urinary_tract(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		GTTCCTTGGGGACAGTGGAGG	0.711																																						dbGAP											0													14.0	20.0	18.0					19																	45662102		692	1591	2283	-	-	-	SO:0001631	upstream_gene_variant	0			AK090919		19q13.32	2012-07-02		2012-07-02	ENSG00000179846	ENSG00000179846			24739	protein-coding gene	gene with protein product						14702039	Standard	NM_198478		Approved	FLJ33600	uc010xxi.2	Q17RQ9	OTTHUMG00000160521		19.37:g.45662102G>A	Exception_encountered		B7ZLG6|D6RH15|Q8N2A2	Silent	SNP	pfam_KAP_NTPase	p.V116	ENST00000438936.2	37	c.348		19																																																																																			NKPD1	-	NULL	ENSG00000179846		0.711	NKPD1-001	KNOWN	basic	protein_coding	NKPD1	HGNC	protein_coding	OTTHUMT00000360950.2	14	0.00	0	G	NM_198478		45662102	45662102	-1	no_errors	ENST00000317951	ensembl	human	known	69_37n	silent	18	33.33	9	SNP	0.069	A
NOMO2	283820	genome.wustl.edu	37	16	18544464	18544464	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr16:18544464G>T	ENST00000381474.3	-	12	1323	c.1258C>A	c.(1258-1260)Ccg>Acg	p.P420T	NOMO2_ENST00000543392.1_Missense_Mutation_p.P253T|NOMO2_ENST00000330537.6_Missense_Mutation_p.P420T	NM_001004060.1	NP_001004060.1	Q5JPE7	NOMO2_HUMAN	NODAL modulator 2	420						endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(4)|kidney(1)|large_intestine(2)|liver(3)|lung(5)|ovary(3)|prostate(1)|skin(1)	20						ACGGTGTCCGGGAAGCGAATG	0.448																																						dbGAP											0													272.0	202.0	225.0					16																	18544464		2197	4300	6497	-	-	-	SO:0001583	missense	0			AL512687	CCDS10570.1, CCDS32394.1	16p12.3	2008-02-05			ENSG00000185164	ENSG00000185164			22652	protein-coding gene	gene with protein product		609158				15257293	Standard	NM_001004060		Approved	NOMO, PM5	uc002dfe.3	Q5JPE7	OTTHUMG00000131366	ENST00000381474.3:c.1258C>A	16.37:g.18544464G>T	ENSP00000370883:p.Pro420Thr		Q4G177	Missense_Mutation	SNP	pfam_DUF2012,superfamily_Carb-bd-like_fold,superfamily_CarboxyPept-like_regulatory,superfamily_Collagen-bd_Cna_B-typ_dom	p.P420T	ENST00000381474.3	37	c.1258	CCDS32394.1	16	.	.	.	.	.	.	.	.	.	.	.	17.11	3.306107	0.60305	.	.	ENSG00000185164	ENST00000330537;ENST00000381474;ENST00000543392	T;T;T	0.04275	3.69;3.68;3.66	2.75	2.75	0.32379	.	0.000000	0.85682	D	0.000000	T	0.16685	0.0401	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.941	T	0.07908	-1.0748	10	0.22706	T	0.39	-14.3176	12.8726	0.57972	0.0:0.0:1.0:0.0	.	253;420	Q4G177;Q5JPE7	.;NOMO2_HUMAN	T	420;420;253	ENSP00000331851:P420T;ENSP00000370883:P420T;ENSP00000439970:P253T	ENSP00000331851:P420T	P	-	1	0	NOMO2	18451965	1.000000	0.71417	0.921000	0.36526	0.794000	0.44872	8.693000	0.91288	1.514000	0.48869	0.455000	0.32223	CCG	NOMO2	-	NULL	ENSG00000185164		0.448	NOMO2-002	KNOWN	basic|CCDS	protein_coding	NOMO2	HGNC	protein_coding	OTTHUMT00000435858.1	140	0.00	0	G	NM_001004060		18544464	18544464	-1	no_errors	ENST00000381474	ensembl	human	known	69_37n	missense	94	17.54	20	SNP	1.000	T
NOP2	4839	genome.wustl.edu	37	12	6666267	6666267	+	Silent	SNP	G	G	C			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr12:6666267G>C	ENST00000322166.5	-	16	2452	c.2331C>G	c.(2329-2331)ccC>ccG	p.P777P	NOP2_ENST00000399466.2_Silent_p.P773P|IFFO1_ENST00000396840.2_5'Flank|NOP2_ENST00000537442.1_Silent_p.P777P|NOP2_ENST00000382421.3_Silent_p.P810P|IFFO1_ENST00000336604.4_5'Flank|NOP2_ENST00000541778.1_Silent_p.P773P|NOP2_ENST00000545200.1_3'UTR|NOP2_ENST00000542015.1_5'Flank|IFFO1_ENST00000356896.4_5'Flank	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	P46087	NOP2_HUMAN	NOP2 nucleolar protein	777					positive regulation of cell proliferation (GO:0008284)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	19						GAGGCCCCTTGGGGGTATCAT	0.587																																						dbGAP											0													59.0	62.0	61.0					12																	6666267		1875	4100	5975	-	-	-	SO:0001819	synonymous_variant	0				CCDS44811.1, CCDS58202.1, CCDS58203.1, CCDS58204.1	12p13	2012-12-10	2012-12-10	2008-10-13	ENSG00000111641	ENSG00000111641		"""NOP2/Sun domain containing"""	7867	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 1"""	164031	"""nucleolar protein 1 (120kD)"", ""nucleolar protein 1, 120kDa"", ""nucleolar protein 2 homolog (yeast)"", ""NOP2 nucleolar protein homolog (yeast)"""	NOL1		8088812	Standard	NM_006170		Approved	NOP120, NSUN1, p120	uc021qtz.2	P46087	OTTHUMG00000169163	ENST00000322166.5:c.2331C>G	12.37:g.6666267G>C			A1A4Z3|B3KPD6|Q05BA7|Q0P5S5|Q3KQS4|Q58F30	Silent	SNP	pfam_Fmu/NOL1/Nop2p,pfam_P120R,pfam_rRNA_MeTrfase_FtsJ_dom,prints_RCMT,prints_RCMT_NOP2,tigrfam_Nop2p	p.P777	ENST00000322166.5	37	c.2331	CCDS58203.1	12																																																																																			NOP2	-	NULL	ENSG00000111641		0.587	NOP2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP2	HGNC	protein_coding	OTTHUMT00000402614.1	24	0.00	0	G	NM_006170		6666267	6666267	-1	no_errors	ENST00000322166	ensembl	human	known	69_37n	silent	22	18.52	5	SNP	0.000	C
NUP210	23225	genome.wustl.edu	37	3	13364839	13364839	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr3:13364839C>T	ENST00000254508.5	-	34	4820	c.4738G>A	c.(4738-4740)Gcc>Acc	p.A1580T		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1580					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					TCTCCCACGGCAACAATCACT	0.582																																						dbGAP											0													137.0	138.0	138.0					3																	13364839		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.4738G>A	3.37:g.13364839C>T	ENSP00000254508:p.Ala1580Thr		A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,superfamily_Cadherin-like,smart_Big_2	p.A1580T	ENST00000254508.5	37	c.4738	CCDS33704.1	3	.	.	.	.	.	.	.	.	.	.	C	1.643	-0.515898	0.04200	.	.	ENSG00000132182	ENST00000254508	T	0.04502	3.61	5.54	-2.58	0.06228	.	0.950977	0.08883	N	0.879742	T	0.01061	0.0035	N	0.00289	-1.7	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47209	-0.9135	10	0.07325	T	0.83	-13.1743	7.6826	0.28522	0.1256:0.5987:0.0:0.2757	.	1580	Q8TEM1	PO210_HUMAN	T	1580	ENSP00000254508:A1580T	ENSP00000254508:A1580T	A	-	1	0	NUP210	13339839	0.035000	0.19736	0.000000	0.03702	0.707000	0.40811	-0.101000	0.10973	-0.753000	0.04721	-0.345000	0.07892	GCC	NUP210	-	NULL	ENSG00000132182		0.582	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	NUP210	HGNC	protein_coding	OTTHUMT00000340085.1	79	0.00	0	C	NM_024923		13364839	13364839	-1	no_errors	ENST00000254508	ensembl	human	known	69_37n	missense	36	20.00	9	SNP	0.000	T
OR2J1	442185	genome.wustl.edu	37	6	29069001	29069001	+	Frame_Shift_Del	DEL	T	T	-			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr6:29069001delT	ENST00000377171.3	+	1	616	c.282delT	c.(280-282)tctfs	p.S94fs				Q9GZK6	OR2J1_HUMAN	olfactory receptor, family 2, subfamily J, member 1 (gene/pseudogene)	94						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|lung(6)	7						AGACCATCTCTTATGCTGGTT	0.483																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0					6p22.2-p21.31	2012-08-09	2011-08-30	2004-05-28	ENSG00000204702	ENSG00000204702		"""GPCR / Class A : Olfactory receptors"""	8259	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily J, member 1 pseudogene"", ""olfactory receptor, family 2, subfamily J, member 1"""	OR2J1P			Standard	NG_004683		Approved	OR6-5, hs6M1-4, dJ80I19.2		Q9GZK6	OTTHUMG00000031280	ENST00000377171.3:c.282delT	6.37:g.29069001delT	ENSP00000366376:p.Ser94fs		A2AAS1|B0V1T2|Q9GZK1	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Y95fs	ENST00000377171.3	37	c.282		6																																																																																			OR2J1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000204702		0.483	OR2J1-001	KNOWN	basic|appris_principal	protein_coding	OR2J1	HGNC	protein_coding	OTTHUMT00000076612.2	67	0.00	0	T	NG_004683		29069001	29069001	+1	no_errors	ENST00000377171	ensembl	human	known	69_37n	frame_shift_del	13	13.33	2	DEL	0.169	-
OR5D13	390142	genome.wustl.edu	37	11	55541620	55541620	+	Missense_Mutation	SNP	G	G	A	rs7124871	byFrequency	TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr11:55541620G>A	ENST00000361760.1	+	1	707	c.707G>A	c.(706-708)cGc>cAc	p.R236H		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	236			R -> L (in dbSNP:rs7124871).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R236H(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				GCAAGTGGGCGCCAGAAAACT	0.408													G|||	3	0.000599042	0.0	0.0014	5008	,	,		20084	0.0		0.002	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	pancreas(1)											131.0	116.0	121.0					11																	55541620		2200	4296	6496	-	-	-	SO:0001583	missense	0			BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.707G>A	11.37:g.55541620G>A	ENSP00000354800:p.Arg236His		Q6IF68|Q6IFC9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R236H	ENST00000361760.1	37	c.707	CCDS31507.1	11	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631432	0.28978	.	.	ENSG00000198877	ENST00000361760	T	0.00333	8.07	3.82	2.85	0.33270	GPCR, rhodopsin-like superfamily (1);	0.690085	0.10966	N	0.614455	T	0.00356	0.0011	M	0.81239	2.535	0.09310	N	1	B	0.24823	0.112	B	0.24269	0.052	T	0.39800	-0.9596	10	0.54805	T	0.06	-0.5898	6.2567	0.20877	0.1054:0.0:0.7013:0.1933	.	236	Q8NGL4	OR5DD_HUMAN	H	236	ENSP00000354800:R236H	ENSP00000354800:R236H	R	+	2	0	OR5D13	55298196	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.634000	0.05477	0.679000	0.31345	0.486000	0.48141	CGC	OR5D13	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000198877		0.408	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D13	HGNC	protein_coding	OTTHUMT00000391511.1	90	0.00	0	G	NM_001001967		55541620	55541620	+1	no_errors	ENST00000361760	ensembl	human	known	69_37n	missense	27	36.96	17	SNP	0.003	A
OTOF	9381	genome.wustl.edu	37	2	26739336	26739336	+	Silent	SNP	G	G	A			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr2:26739336G>A	ENST00000272371.2	-	5	585	c.459C>T	c.(457-459)ctC>ctT	p.L153L	OTOF_ENST00000403946.3_Silent_p.L153L	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	153					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGAGCCTGGGAGCAGTCCAT	0.637																																					GBM(102;732 1451 20652 24062 31372)	dbGAP											0													76.0	83.0	80.0					2																	26739336		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.459C>T	2.37:g.26739336G>A			B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Silent	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.L153	ENST00000272371.2	37	c.459	CCDS1725.1	2																																																																																			OTOF	-	NULL	ENSG00000115155		0.637	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3	43	0.00	0	G			26739336	26739336	-1	no_errors	ENST00000272371	ensembl	human	known	69_37n	silent	23	36.11	13	SNP	0.839	A
PCDHA9	9752	genome.wustl.edu	37	5	140230345	140230345	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr5:140230345G>T	ENST00000532602.1	+	1	3298	c.2265G>T	c.(2263-2265)agG>agT	p.R755S	PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.R755S|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	755	5 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCAGAGGAGGCAGAGGGTGT	0.647																																					Melanoma(55;1800 1972 14909)	dbGAP											0													88.0	83.0	85.0					5																	140230345		2197	4272	6469	-	-	-	SO:0001583	missense	0			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2265G>T	5.37:g.140230345G>T	ENSP00000436042:p.Arg755Ser		O15053|Q2M3S5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R755S	ENST00000532602.1	37	c.2265	CCDS54920.1	5	.	.	.	.	.	.	.	.	.	.	G	4.656	0.121887	0.08931	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.14266	2.52;2.52	4.61	0.797	0.18654	.	0.000000	0.29239	U	0.012740	T	0.12008	0.0292	M	0.64080	1.96	0.09310	N	1	B;P	0.34724	0.021;0.465	B;B	0.31101	0.015;0.124	T	0.14839	-1.0458	10	0.72032	D	0.01	.	5.7455	0.18118	0.3761:0.1918:0.4321:0.0	.	755;755	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	S	755	ENSP00000436042:R755S;ENSP00000367362:R755S	ENSP00000367362:R755S	R	+	3	2	PCDHA9	140210529	0.000000	0.05858	0.165000	0.22776	0.643000	0.38383	-0.012000	0.12699	-0.087000	0.12528	-0.339000	0.08088	AGG	PCDHA9	-	NULL	ENSG00000204961		0.647	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA9	HGNC	protein_coding	OTTHUMT00000372896.2	33	0.00	0	G	NM_031857		140230345	140230345	+1	no_errors	ENST00000532602	ensembl	human	known	69_37n	missense	46	20.69	12	SNP	0.040	T
PCDHB11	56125	genome.wustl.edu	37	5	140580879	140580879	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr5:140580879G>C	ENST00000354757.3	+	1	1532	c.1532G>C	c.(1531-1533)gGc>gCc	p.G511A	PCDHB11_ENST00000536699.1_Missense_Mutation_p.G146A	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	511	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACAGACAACGGCCACCTGTTC	0.662																																						dbGAP											0													97.0	108.0	104.0					5																	140580879		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.1532G>C	5.37:g.140580879G>C	ENSP00000346802:p.Gly511Ala		B4DSF7|Q2M223	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G511A	ENST00000354757.3	37	c.1532	CCDS4253.1	5	.	.	.	.	.	.	.	.	.	.	g	19.07	3.756462	0.69648	.	.	ENSG00000197479	ENST00000536699;ENST00000354757	D;D	0.91407	-2.84;-2.84	2.51	2.51	0.30379	Cadherin (5);Cadherin-like (1);	.	.	.	.	D	0.96460	0.8845	H	0.96208	3.785	0.45330	D	0.998324	D	0.89917	1.0	D	0.97110	1.0	D	0.97193	0.9859	9	0.87932	D	0	.	13.0572	0.58988	0.0:0.0:1.0:0.0	.	511	Q9Y5F2	PCDBB_HUMAN	A	146;511	ENSP00000440344:G146A;ENSP00000346802:G511A	ENSP00000346802:G511A	G	+	2	0	PCDHB11	140561063	1.000000	0.71417	0.029000	0.17559	0.022000	0.10575	5.340000	0.65958	1.412000	0.46977	0.298000	0.19748	GGC	PCDHB11	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000197479		0.662	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB11	HGNC	protein_coding	OTTHUMT00000251813.1	30	0.00	0	G	NM_018931		140580879	140580879	+1	no_errors	ENST00000354757	ensembl	human	known	69_37n	missense	29	38.78	19	SNP	0.975	C
PCNXL3	399909	genome.wustl.edu	37	11	65384797	65384797	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr11:65384797G>C	ENST00000355703.3	+	3	957	c.418G>C	c.(418-420)Gtg>Ctg	p.V140L		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	140						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						CCAGCACTCTGTGTTTGGCTT	0.612																																						dbGAP											0													64.0	69.0	67.0					11																	65384797		2101	4224	6325	-	-	-	SO:0001583	missense	0			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.418G>C	11.37:g.65384797G>C	ENSP00000347931:p.Val140Leu		Q6MZN8	Missense_Mutation	SNP	pfam_Pecanex	p.V140L	ENST00000355703.3	37	c.418	CCDS44650.1	11	.	.	.	.	.	.	.	.	.	.	G	14.24	2.476705	0.44044	.	.	ENSG00000197136	ENST00000355703	T	0.61627	0.09	5.17	4.26	0.50523	.	0.335459	0.17313	N	0.178812	T	0.33789	0.0875	N	0.11427	0.14	0.27527	N	0.9512	B	0.02656	0.0	B	0.01281	0.0	T	0.17319	-1.0373	10	0.12430	T	0.62	.	9.5978	0.39584	0.0972:0.0:0.9028:0.0	.	140	Q9H6A9	PCX3_HUMAN	L	140	ENSP00000347931:V140L	ENSP00000347931:V140L	V	+	1	0	PCNXL3	65141373	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	3.690000	0.54713	1.176000	0.42840	0.561000	0.74099	GTG	PCNXL3	-	NULL	ENSG00000197136		0.612	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	HGNC	protein_coding	OTTHUMT00000390321.1	103	0.00	0	G	NM_032223		65384797	65384797	+1	no_errors	ENST00000355703	ensembl	human	known	69_37n	missense	48	30.43	21	SNP	0.992	C
PDCD6IP	10015	genome.wustl.edu	37	3	33895477	33895477	+	Frame_Shift_Del	DEL	T	T	-			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr3:33895477delT	ENST00000307296.3	+	14	2374	c.1997delT	c.(1996-1998)cttfs	p.L666fs	PDCD6IP_ENST00000457054.2_Frame_Shift_Del_p.L671fs			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	666	Interaction with EIAV p9.|Self-association.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						TTTGTTGAACTTGTAGCTAAT	0.343																																						dbGAP											0													55.0	52.0	53.0					3																	33895477		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.1997delT	3.37:g.33895477delT	ENSP00000307387:p.Leu666fs		C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Frame_Shift_Del	DEL	pfam_BRO1_dom,pfscan_BRO1_dom	p.V672fs	ENST00000307296.3	37	c.2012	CCDS2660.1	3																																																																																			PDCD6IP	-	NULL	ENSG00000170248		0.343	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PDCD6IP	HGNC	protein_coding	OTTHUMT00000253251.2	59	0.00	0	T			33895477	33895477	+1	no_errors	ENST00000457054	ensembl	human	known	69_37n	frame_shift_del	18	10.00	2	DEL	1.000	-
PDE4DIP	9659	genome.wustl.edu	37	1	145075854	145075854	+	Silent	SNP	G	G	C	rs1663853	byFrequency	TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr1:145075854G>C	ENST00000530740.1	-	1	47	c.9C>G	c.(7-9)ggC>ggG	p.G3G	PDE4DIP_ENST00000369348.3_Silent_p.G3G|PDE4DIP_ENST00000369345.4_Silent_p.G3G|PDE4DIP_ENST00000369359.4_Silent_p.G3G			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	0					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CGCTGTCTGTGCCCTTCATGG	0.667			T	PDGFRB	MPD																																	dbGAP		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0																																										-	-	-	SO:0001819	synonymous_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000530740.1:c.9C>G	1.37:g.145075854G>C			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	pfam_Spindle_assoc	p.G3	ENST00000530740.1	37	c.9		1																																																																																			PDE4DIP	-	NULL	ENSG00000178104		0.667	PDE4DIP-036	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000384663.2	11	0.00	0	G	NM_022359		145075854	145075854	-1	no_errors	ENST00000369348	ensembl	human	known	69_37n	silent	28	45.10	23	SNP	0.048	C
PLCL1	5334	genome.wustl.edu	37	2	198950898	198950898	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr2:198950898T>A	ENST00000428675.1	+	2	3055	c.2657T>A	c.(2656-2658)aTc>aAc	p.I886N	PLCL1_ENST00000437704.2_Missense_Mutation_p.I788N	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	886					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	ATTGATGACATCTTTAAAATA	0.428																																						dbGAP											0													69.0	61.0	63.0					2																	198950898		2203	4300	6503	-	-	-	SO:0001583	missense	0			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2657T>A	2.37:g.198950898T>A	ENSP00000402861:p.Ile886Asn		Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,prints_Pinositol_PLipase_C,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.I886N	ENST00000428675.1	37	c.2657	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	T	12.00	1.805770	0.31961	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.17528	2.27;2.28	5.41	4.26	0.50523	.	0.690999	0.14136	N	0.339080	T	0.15565	0.0375	L	0.38175	1.15	0.43947	D	0.996617	B;B	0.34103	0.437;0.437	B;B	0.36378	0.171;0.223	T	0.04991	-1.0913	9	.	.	.	.	11.5033	0.50450	0.0:0.0699:0.0:0.9301	.	886;812	Q15111;B4DYZ4	PLCL1_HUMAN;.	N	886;788	ENSP00000402861:I886N;ENSP00000414138:I788N	.	I	+	2	0	PLCL1	198659143	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	6.135000	0.71696	1.070000	0.40811	-0.346000	0.07831	ATC	PLCL1	-	NULL	ENSG00000115896		0.428	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	HGNC	protein_coding	OTTHUMT00000340210.1	51	0.00	0	T	NM_006226		198950898	198950898	+1	no_errors	ENST00000428675	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	1.000	A
PLEC	5339	genome.wustl.edu	37	8	145006612	145006612	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr8:145006612T>C	ENST00000322810.4	-	16	2513	c.2344A>G	c.(2344-2346)Agc>Ggc	p.S782G	PLEC_ENST00000436759.2_Missense_Mutation_p.S672G|PLEC_ENST00000354958.2_Missense_Mutation_p.S623G|PLEC_ENST00000356346.3_Missense_Mutation_p.S631G|PLEC_ENST00000354589.3_Missense_Mutation_p.S645G|PLEC_ENST00000527096.1_Missense_Mutation_p.S668G|PLEC_ENST00000345136.3_Missense_Mutation_p.S645G|PLEC_ENST00000398774.2_Missense_Mutation_p.S613G|PLEC_ENST00000357649.2_Missense_Mutation_p.S649G	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	782	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TTGCGGTCGCTCCAGTCGAAG	0.627																																						dbGAP											0													68.0	80.0	76.0					8																	145006612		2103	4220	6323	-	-	-	SO:0001583	missense	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.2344A>G	8.37:g.145006612T>C	ENSP00000323856:p.Ser782Gly		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.S782G	ENST00000322810.4	37	c.2344	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	T	14.30	2.495314	0.44352	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096;ENST00000528025	D;D;D;D;D;D;D;D;D;D	0.95690	-3.78;-3.78;-3.78;-3.78;-3.78;-3.78;-3.78;-3.78;-3.78;-3.78	4.08	2.92	0.33932	.	0.070251	0.53938	N	0.000049	D	0.93006	0.7774	M	0.65498	2.005	0.52501	D	0.999951	B;B;B;B;B;B;B;B	0.14438	0.003;0.01;0.003;0.002;0.003;0.002;0.003;0.003	B;B;B;B;B;B;B;B	0.04013	0.001;0.001;0.001;0.0;0.001;0.001;0.001;0.001	D	0.89356	0.3664	10	0.59425	D	0.04	.	8.6445	0.33996	0.0:0.0953:0.0:0.9047	.	672;631;623;782;613;645;649;645	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	G	645;649;645;613;782;623;631;672;668;689	ENSP00000344848:S645G;ENSP00000350277:S649G;ENSP00000346602:S645G;ENSP00000381756:S613G;ENSP00000323856:S782G;ENSP00000347044:S623G;ENSP00000348702:S631G;ENSP00000388180:S672G;ENSP00000434583:S668G;ENSP00000437303:S689G	ENSP00000323856:S782G	S	-	1	0	PLEC	145078600	1.000000	0.71417	0.987000	0.45799	0.967000	0.64934	4.683000	0.61679	0.731000	0.32448	0.372000	0.22366	AGC	PLEC	-	smart_Spectrin/alpha-actinin	ENSG00000178209		0.627	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	32	0.00	0	T	NM_000445		145006612	145006612	-1	no_errors	ENST00000322810	ensembl	human	known	69_37n	missense	50	19.35	12	SNP	1.000	C
PRKRIR	5612	genome.wustl.edu	37	11	76062798	76062798	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr11:76062798G>A	ENST00000260045.3	-	5	1501	c.1396C>T	c.(1396-1398)Cga>Tga	p.R466*	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	466					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						ACAAATGCTCGGCCAGCTATA	0.333																																						dbGAP											0													42.0	44.0	43.0					11																	76062798		2192	4289	6481	-	-	-	SO:0001587	stop_gained	0			AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.1396C>T	11.37:g.76062798G>A	ENSP00000260045:p.Arg466*		A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Nonsense_Mutation	SNP	pfam_Znf_C2CH,pfam_HATC,superfamily_RNaseH-like_dom,smart_Znf_C2CH,pfscan_Znf_C2CH	p.R466*	ENST00000260045.3	37	c.1396	CCDS8243.1	11	.	.	.	.	.	.	.	.	.	.	G	58	32.971544	0.99980	.	.	ENSG00000137492	ENST00000529901;ENST00000260045	.	.	.	4.99	0.677	0.17964	.	0.437967	0.26708	N	0.022917	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	8.8174	0.35004	0.0681:0.0:0.5501:0.3818	.	.	.	.	X	291;466	.	ENSP00000260045:R466X	R	-	1	2	PRKRIR	75740446	0.998000	0.40836	0.989000	0.46669	0.985000	0.73830	1.689000	0.37700	-0.036000	0.13669	-0.196000	0.12772	CGA	PRKRIR	-	superfamily_RNaseH-like_dom	ENSG00000137492		0.333	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKRIR	HGNC	protein_coding	OTTHUMT00000383188.1	37	0.00	0	G	NM_004705		76062798	76062798	-1	no_errors	ENST00000260045	ensembl	human	known	69_37n	nonsense	8	46.67	7	SNP	0.988	A
PSMA7	5688	genome.wustl.edu	37	20	60714888	60714888	+	Silent	SNP	C	C	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr20:60714888C>T	ENST00000370873.4	-	3	423	c.297G>A	c.(295-297)gaG>gaA	p.E99E	PSMA7_ENST00000484488.1_5'UTR|PSMA7_ENST00000370861.1_Silent_p.E29E|PSMA7_ENST00000370858.3_Silent_p.E99E	NM_002792.3	NP_002783.1	O14818	PSA7_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 7	99					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	identical protein binding (GO:0042802)|threonine-type endopeptidase activity (GO:0004298)			large_intestine(1)|lung(2)	3	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			TGACCGGGTCCTCCACAGTCA	0.627																																						dbGAP											0													68.0	57.0	60.0					20																	60714888		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF022815	CCDS13489.1	20q13.33	2008-07-02			ENSG00000101182	ENSG00000101182		"""Proteasome (prosome, macropain) subunits"""	9536	protein-coding gene	gene with protein product	"""proteasome subunit XAPC7"", ""proteasome subunit RC6-1"""	606607				8764072	Standard	NM_002792		Approved	XAPC7, C6, HSPC, RC6-1	uc002ybx.2	O14818	OTTHUMG00000032895	ENST00000370873.4:c.297G>A	20.37:g.60714888C>T			B2R515|Q5JXJ2|Q9BR53|Q9H4K5|Q9UEU8	Missense_Mutation	SNP	pfam_Proteasome_sua/b	p.R25K	ENST00000370873.4	37	c.74	CCDS13489.1	20	.	.	.	.	.	.	.	.	.	.	.	4.825	0.153333	0.09185	.	.	ENSG00000101182	ENST00000442551	.	.	.	5.68	3.7	0.42460	.	.	.	.	.	T	0.61236	0.2331	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56902	-0.7902	4	.	.	.	.	10.4112	0.44294	0.135:0.7957:0.0:0.0693	.	.	.	.	K	25	.	.	R	-	2	0	PSMA7	60148283	1.000000	0.71417	1.000000	0.80357	0.382000	0.30200	1.387000	0.34430	0.708000	0.31955	0.655000	0.94253	AGG	PSMA7	-	pfam_Proteasome_sua/b	ENSG00000101182		0.627	PSMA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMA7	HGNC	protein_coding	OTTHUMT00000079975.1	26	0.00	0	C	NM_002792		60714888	60714888	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000442551	ensembl	human	known	69_37n	missense	48	14.29	8	SNP	1.000	T
RHOT1	55288	genome.wustl.edu	37	17	30536424	30536424	+	Intron	SNP	G	G	C			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr17:30536424G>C	ENST00000333942.6	+	18	1978				RHOT1_ENST00000583994.1_Missense_Mutation_p.E472Q|RHOT1_ENST00000581094.1_3'UTR|RHOT1_ENST00000394692.2_Missense_Mutation_p.E599Q|RHOT1_ENST00000545287.2_Intron|RHOT1_ENST00000358365.3_Missense_Mutation_p.E599Q|RHOT1_ENST00000354266.3_Intron	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1						cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				TGATAGAATAGAGAATTTGAG	0.343																																						dbGAP											0													89.0	91.0	90.0					17																	30536424		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.1739+1096G>C	17.37:g.30536424G>C			A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Missense_Mutation	SNP	pfam_MIRO-like,pfam_EF_hand_assoc_2,pfam_EF_hand_assoc_1,pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_EF_hand_Ca-bd,pirsf_Small_GTPase_Miro,pfscan_EF_HAND_2,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E599Q	ENST00000333942.6	37	c.1795	CCDS32612.1	17	.	.	.	.	.	.	.	.	.	.	G	8.386	0.838629	0.16891	.	.	ENSG00000126858	ENST00000358365;ENST00000394692	T;T	0.73575	-0.76;-0.71	5.95	4.98	0.66077	.	0.233522	0.35262	N	0.003326	T	0.55049	0.1896	.	.	.	0.80722	D	1	B;B	0.22414	0.0;0.069	B;B	0.18871	0.0;0.023	T	0.49615	-0.8921	9	0.11794	T	0.64	-10.3246	10.0787	0.42377	0.0884:0.0:0.9116:0.0	.	599;599	Q8IXI2-2;Q8IXI2-3	.;.	Q	599	ENSP00000351132:E599Q;ENSP00000378184:E599Q	ENSP00000351132:E599Q	E	+	1	0	RHOT1	27560537	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.652000	0.37313	2.824000	0.97209	0.655000	0.94253	GAG	RHOT1	-	pirsf_Small_GTPase_Miro	ENSG00000126858		0.343	RHOT1-001	KNOWN	basic|CCDS	protein_coding	RHOT1	HGNC	protein_coding	OTTHUMT00000447097.1	91	0.00	0	G	NM_018307		30536424	30536424	+1	no_errors	ENST00000358365	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	1.000	C
RAD51C	5889	genome.wustl.edu	37	17	56801450	56801450	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr17:56801450C>A	ENST00000337432.4	+	7	1025	c.954C>A	c.(952-954)gaC>gaA	p.D318E	RAD51C_ENST00000583539.1_Missense_Mutation_p.D318E	NM_058216.1	NP_478123.1	O43502	RA51C_HUMAN	RAD51 paralog C	318					blood coagulation (GO:0007596)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|female meiosis sister chromatid cohesion (GO:0007066)|male meiosis I (GO:0007141)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|reciprocal meiotic recombination (GO:0007131)|sister chromatid cohesion (GO:0007062)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|Rad51C-XRCC3 complex (GO:0033065)|replication fork (GO:0005657)	ATP binding (GO:0005524)|crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			upper_aerodigestive_tract(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TTCATTGGGACCGAAAGCAAA	0.383								Homologous recombination	Hereditary Breast-Ovarian Cancer, non-BRCA1/2																													dbGAP											0													127.0	117.0	120.0					17																	56801450		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	BRCAX	AF029670	CCDS11611.1, CCDS45745.1	17q25.1	2014-09-17	2013-07-02		ENSG00000108384	ENSG00000108384		"""Fanconi anemia, complementation groups"""	9820	protein-coding gene	gene with protein product		602774	"""RAD51 (S. cerevisiae) homolog C"", ""RAD51 homolog C (S. cerevisiae)"""			9469824, 22167183	Standard	NM_058216		Approved	RAD51L2, FANCO	uc002iwu.3	O43502	OTTHUMG00000141292	ENST00000337432.4:c.954C>A	17.37:g.56801450C>A	ENSP00000336701:p.Asp318Glu		O43503|Q3B783	Missense_Mutation	SNP	pfam_DNA_recomb/repair_Rad51_C,pfam_Circ_KaiC/RadA,superfamily_DNA_repair_Rad51/TF_NusA_a-hlx,pirsf_DNA_recomb/repair_RecA-like,pfscan_DNA_recomb_RecA/RadB_ATP-bd	p.D318E	ENST00000337432.4	37	c.954	CCDS11611.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.412|5.412	0.261179|0.261179	0.10239|0.10239	.|.	.|.	ENSG00000108384|ENSG00000108384	ENST00000337432|ENST00000413590	T|.	0.38722|.	1.12|.	5.98|5.98	0.412|0.412	0.16397|0.16397	ATPase, AAA+ type, core (1);DNA recombination and repair protein Rad51, C-terminal (1);|.	0.252069|.	0.46758|.	N|.	0.000277|.	T|T	0.32436|0.32436	0.0829|0.0829	N|N	0.17082|0.17082	0.46|0.46	0.80722|0.80722	D|D	1|1	B;B|.	0.06786|.	0.0;0.001|.	B;B|.	0.09377|.	0.002;0.004|.	T|T	0.04693|0.04693	-1.0933|-1.0933	10|5	0.38643|.	T|.	0.18|.	-8.1464|-8.1464	4.272|4.272	0.10791|0.10791	0.2826:0.4943:0.0:0.2231|0.2826:0.4943:0.0:0.2231	.|.	309;318|.	B4E0G0;O43502|.	.;RA51C_HUMAN|.	E|T	318|198	ENSP00000336701:D318E|.	ENSP00000336701:D318E|.	D|P	+|+	3|1	2|0	RAD51C|RAD51C	54156449|54156449	0.951000|0.951000	0.32395|0.32395	0.940000|0.940000	0.37924|0.37924	0.979000|0.979000	0.70002|0.70002	0.001000|0.001000	0.13038|0.13038	-0.104000|-0.104000	0.12154|0.12154	0.655000|0.655000	0.94253|0.94253	GAC|CCG	RAD51C	-	pfam_DNA_recomb/repair_Rad51_C,pirsf_DNA_recomb/repair_RecA-like	ENSG00000108384		0.383	RAD51C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAD51C	HGNC	protein_coding	OTTHUMT00000280540.2	89	0.00	0	C	NM_058216		56801450	56801450	+1	no_errors	ENST00000337432	ensembl	human	known	69_37n	missense	46	24.59	15	SNP	0.980	A
WDR74	54663	genome.wustl.edu	37	11	62609178	62609178	+	5'UTR	SNP	A	A	G			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr11:62609178A>G	ENST00000525239.1	-	0	103				WDR74_ENST00000525752.1_5'Flank|WDR74_ENST00000540620.1_5'Flank|WDR74_ENST00000278856.4_5'Flank|WDR74_ENST00000311713.7_5'Flank|WDR74_ENST00000529106.1_5'Flank|RNU2-2P_ENST00000410396.1_RNA			Q6RFH5	WDR74_HUMAN	WD repeat domain 74						blastocyst formation (GO:0001825)|RNA metabolic process (GO:0016070)	nucleolus (GO:0005730)|nucleus (GO:0005634)				kidney(2)|large_intestine(1)|liver(1)|lung(3)|ovary(1)	8						tcctatttccaaaaatccatt	0.453																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS44630.1	11q12.3	2013-01-09				ENSG00000133316		"""WD repeat domain containing"""	25529	protein-coding gene	gene with protein product							Standard	NM_018093		Approved	FLJ10439	uc001nvm.2	Q6RFH5		ENST00000525239.1:c.-435T>C	11.37:g.62609178A>G			A8K8G5|Q9BRC9|Q9H6X8|Q9NVY2	RNA	SNP	-	NULL	ENST00000525239.1	37	NULL	CCDS44630.1	11																																																																																			RNU2-2	-	-	ENSG00000222328		0.453	WDR74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNU2-2	HGNC	protein_coding	OTTHUMT00000395678.1	23	0.00	0	A	NM_018093		62609178	62609178	-1	no_errors	ENST00000410396	ensembl	human	known	69_37n	rna	21	22.22	6	SNP	0.932	G
SBNO1	55206	genome.wustl.edu	37	12	123798175	123798175	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr12:123798175A>T	ENST00000602398.1	-	24	3339	c.3212T>A	c.(3211-3213)tTt>tAt	p.F1071Y	SBNO1_ENST00000420886.2_Missense_Mutation_p.F1071Y|SBNO1_ENST00000267176.4_Missense_Mutation_p.F1070Y|SBNO1_ENST00000602750.1_Missense_Mutation_p.F1070Y			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	1071					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		ACCTTTAAAAAATTCTCCAGG	0.308																																						dbGAP											0													48.0	49.0	49.0					12																	123798175		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.3212T>A	12.37:g.123798175A>T	ENSP00000473665:p.Phe1071Tyr		Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	pfam_Helicase/UvrB_dom,superfamily_Prismane-like	p.F1071Y	ENST00000602398.1	37	c.3212	CCDS53844.1	12	.	.	.	.	.	.	.	.	.	.	A	27.1	4.799640	0.90538	.	.	ENSG00000139697	ENST00000420886;ENST00000267176	T;T	0.37752	1.18;1.18	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.63838	0.2545	M	0.87269	2.87	0.80722	D	1	D;D;P	0.65815	0.995;0.994;0.953	D;P;P	0.64506	0.926;0.879;0.887	T	0.69866	-0.5029	10	0.54805	T	0.06	-13.1926	15.6824	0.77381	1.0:0.0:0.0:0.0	.	1071;1070;182	A3KN83;A3KN83-2;B3KUC1	SBNO1_HUMAN;.;.	Y	1071;1070	ENSP00000387361:F1071Y;ENSP00000267176:F1070Y	ENSP00000267176:F1070Y	F	-	2	0	SBNO1	122364128	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	9.009000	0.93606	2.116000	0.64780	0.482000	0.46254	TTT	SBNO1	-	NULL	ENSG00000139697		0.308	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO1	HGNC	protein_coding	OTTHUMT00000467684.1	71	0.00	0	A	NM_018183		123798175	123798175	-1	no_errors	ENST00000420886	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	1.000	T
SLC1A3	6507	genome.wustl.edu	37	5	36608580	36608580	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr5:36608580C>T	ENST00000265113.4	+	2	531	c.55C>T	c.(55-57)Cag>Tag	p.Q19*	SLC1A3_ENST00000506725.1_3'UTR|SLC1A3_ENST00000381918.3_Nonsense_Mutation_p.Q19*	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	19					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGAGAGATTCCAGCAGGGAGT	0.448																																						dbGAP											0													130.0	128.0	129.0					5																	36608580		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.55C>T	5.37:g.36608580C>T	ENSP00000265113:p.Gln19*		B2R5T3|Q4JCQ8	Nonsense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.Q19*	ENST00000265113.4	37	c.55	CCDS3919.1	5	.	.	.	.	.	.	.	.	.	.	C	42	9.278641	0.99123	.	.	ENSG00000079215	ENST00000265113;ENST00000513903;ENST00000427100;ENST00000416645;ENST00000505202;ENST00000513646;ENST00000381918	.	.	.	5.69	5.69	0.88448	.	0.166440	0.49916	D	0.000138	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-14.3001	19.812	0.96551	0.0:1.0:0.0:0.0	.	.	.	.	X	19	.	ENSP00000265113:Q19X	Q	+	1	0	SLC1A3	36644337	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.192000	0.65115	2.685000	0.91497	0.655000	0.94253	CAG	SLC1A3	-	NULL	ENSG00000079215		0.448	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC1A3	HGNC	protein_coding	OTTHUMT00000207579.2	56	0.00	0	C	NM_004172		36608580	36608580	+1	no_errors	ENST00000265113	ensembl	human	known	69_37n	nonsense	42	20.75	11	SNP	1.000	T
SEC24A	10802	genome.wustl.edu	37	5	133997101	133997101	+	Silent	SNP	C	C	A			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr5:133997101C>A	ENST00000398844.2	+	2	678	c.390C>A	c.(388-390)gcC>gcA	p.A130A	SEC24A_ENST00000322887.4_Silent_p.A130A	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	130	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTCCTGAAGCCAACCTGCCAC	0.483																																						dbGAP											0													118.0	117.0	117.0					5																	133997101		1997	4164	6161	-	-	-	SO:0001819	synonymous_variant	0			AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.390C>A	5.37:g.133997101C>A			A8MVW3|Q8WUV2|Q96GP7	Silent	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom	p.A130	ENST00000398844.2	37	c.390	CCDS43363.1	5																																																																																			SEC24A	-	NULL	ENSG00000113615		0.483	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24A	HGNC	protein_coding	OTTHUMT00000371563.1	90	0.00	0	C			133997101	133997101	+1	no_errors	ENST00000398844	ensembl	human	known	69_37n	silent	50	38.27	31	SNP	0.004	A
SNAPC1	6617	genome.wustl.edu	37	14	62235358	62235358	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr14:62235358C>T	ENST00000216294.4	+	4	538	c.434C>T	c.(433-435)tCa>tTa	p.S145L	RP11-618G20.1_ENST00000555937.1_RNA	NM_003082.3	NP_003073.1	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex, polypeptide 1, 43kDa	145	SNAPC3-binding.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		ACATAGCTGTCATATAGGATG	0.308																																					NSCLC(27;223 907 37180 39193 46568)	dbGAP											0													63.0	63.0	63.0					14																	62235358		2203	4296	6499	-	-	-	SO:0001583	missense	0			Z47542	CCDS9755.1	14q22	2008-08-11	2002-08-29		ENSG00000023608	ENSG00000023608			11134	protein-coding gene	gene with protein product		600591	"""small nuclear RNA activating complex, polypeptide 1, 43kD"""			9644240	Standard	NM_003082		Approved	SNAP43, PTFgamma	uc001xft.3	Q16533	OTTHUMG00000140343	ENST00000216294.4:c.434C>T	14.37:g.62235358C>T	ENSP00000216294:p.Ser145Leu			Missense_Mutation	SNP	pfam_SNAPc_SNAP43	p.S145L	ENST00000216294.4	37	c.434	CCDS9755.1	14	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971318	0.74246	.	.	ENSG00000023608	ENST00000216294	.	.	.	5.53	5.53	0.82687	.	0.397092	0.25975	N	0.027118	T	0.60170	0.2248	L	0.54323	1.7	0.33406	D	0.57794	D	0.53619	0.961	P	0.53450	0.726	T	0.65014	-0.6271	9	0.26408	T	0.33	-11.2916	16.1581	0.81680	0.1338:0.8662:0.0:0.0	.	145	Q16533	SNPC1_HUMAN	L	145	.	ENSP00000216294:S145L	S	+	2	0	SNAPC1	61305111	1.000000	0.71417	1.000000	0.80357	0.654000	0.38779	1.976000	0.40579	2.770000	0.95276	0.655000	0.94253	TCA	SNAPC1	-	pfam_SNAPc_SNAP43	ENSG00000023608		0.308	SNAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPC1	HGNC	protein_coding	OTTHUMT00000276976.2	72	0.00	0	C	NM_003082		62235358	62235358	+1	no_errors	ENST00000216294	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	1.000	T
SORBS2	8470	genome.wustl.edu	37	4	186545132	186545132	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr4:186545132T>C	ENST00000284776.7	-	13	1948	c.1439A>G	c.(1438-1440)tAc>tGc	p.Y480C	SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000431808.1_Missense_Mutation_p.Y480C|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000418609.1_Missense_Mutation_p.Y384C|SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000355634.5_Missense_Mutation_p.Y580C	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	480					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		CTCGCTCTCGTACTGCAGAAT	0.597																																					Esophageal Squamous(153;41 2433 9491 36028)	dbGAP											0													91.0	82.0	85.0					4																	186545132		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.1439A>G	4.37:g.186545132T>C	ENSP00000284776:p.Tyr480Cys		A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.Y480C	ENST00000284776.7	37	c.1439	CCDS3845.1	4	.	.	.	.	.	.	.	.	.	.	T	12.64	1.997356	0.35226	.	.	ENSG00000154556	ENST00000284776;ENST00000431808;ENST00000418609;ENST00000355634	T;T;T;T	0.38401	1.25;1.25;1.14;1.24	5.77	5.77	0.91146	.	0.271361	0.37623	N	0.002008	T	0.55752	0.1940	L	0.50333	1.59	0.50171	D	0.999854	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.996;0.997	T	0.57533	-0.7795	10	0.72032	D	0.01	-24.7978	16.0858	0.81049	0.0:0.0:0.0:1.0	.	384;580;480	B7Z3X6;B3KPQ7;O94875	.;.;SRBS2_HUMAN	C	480;480;384;580	ENSP00000284776:Y480C;ENSP00000411764:Y480C;ENSP00000397482:Y384C;ENSP00000347852:Y580C	ENSP00000284776:Y480C	Y	-	2	0	SORBS2	186782126	1.000000	0.71417	0.941000	0.38009	0.041000	0.13682	6.155000	0.71833	2.194000	0.70268	0.379000	0.24179	TAC	SORBS2	-	NULL	ENSG00000154556		0.597	SORBS2-001	KNOWN	basic|CCDS	protein_coding	SORBS2	HGNC	protein_coding	OTTHUMT00000347944.3	43	0.00	0	T	NM_003603		186545132	186545132	-1	no_errors	ENST00000284776	ensembl	human	known	69_37n	missense	32	21.95	9	SNP	0.995	C
SOS2	6655	genome.wustl.edu	37	14	50605424	50605424	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr14:50605424T>C	ENST00000216373.5	-	18	3138	c.2864A>G	c.(2863-2865)aAt>aGt	p.N955S	SOS2_ENST00000543680.1_Missense_Mutation_p.N922S	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	955	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					CTTACTGAAATTGATTAAATC	0.299																																						dbGAP											0													71.0	69.0	69.0					14																	50605424		2202	4297	6499	-	-	-	SO:0001583	missense	0			L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.2864A>G	14.37:g.50605424T>C	ENSP00000216373:p.Asn955Ser		B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Histone_core_D,superfamily_Ras_GEF_dom,superfamily_Histone-fold,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.N955S	ENST00000216373.5	37	c.2864	CCDS9697.1	14	.	.	.	.	.	.	.	.	.	.	T	23.0	4.357244	0.82243	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	T;T	0.59502	0.26;0.26	5.6	5.6	0.85130	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine-nucleotide exchange factor, conserved site (1);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.78685	0.4322	M	0.90977	3.165	0.80722	D	1	P;D	0.65815	0.942;0.995	P;P	0.60286	0.64;0.872	T	0.83025	-0.0165	10	0.51188	T	0.08	.	15.7763	0.78220	0.0:0.0:0.0:1.0	.	922;955	B7ZKT6;Q07890	.;SOS2_HUMAN	S	955;922	ENSP00000216373:N955S;ENSP00000445328:N922S	ENSP00000216373:N955S	N	-	2	0	SOS2	49675174	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.642000	0.83385	2.133000	0.65898	0.533000	0.62120	AAT	SOS2	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000100485		0.299	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOS2	HGNC	protein_coding	OTTHUMT00000276878.2	87	0.00	0	T			50605424	50605424	-1	no_errors	ENST00000216373	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	1.000	C
SPATA18	132671	genome.wustl.edu	37	4	52951104	52951104	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr4:52951104G>T	ENST00000295213.4	+	11	1876	c.1502G>T	c.(1501-1503)aGt>aTt	p.S501I	SPATA18_ENST00000419395.2_Missense_Mutation_p.S469I	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	501					cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			CGATCTGTAAGTCGTTGTCGA	0.388																																						dbGAP											0													99.0	100.0	100.0					4																	52951104		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.1502G>T	4.37:g.52951104G>T	ENSP00000295213:p.Ser501Ile		B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Missense_Mutation	SNP	NULL	p.S501I	ENST00000295213.4	37	c.1502	CCDS3489.1	4	.	.	.	.	.	.	.	.	.	.	G	9.490	1.100422	0.20552	.	.	ENSG00000163071	ENST00000295213;ENST00000419395	D;D	0.88975	-2.45;-2.45	5.02	-3.5	0.04710	.	0.405920	0.32204	N	0.006426	T	0.81427	0.4820	N	0.22421	0.69	0.25193	N	0.990111	B;B	0.26809	0.16;0.16	B;B	0.33799	0.17;0.11	T	0.71230	-0.4654	10	0.62326	D	0.03	-5.3839	15.1595	0.72771	0.0:0.7133:0.1745:0.1122	.	469;501	Q8TC71-2;Q8TC71	.;MIEAP_HUMAN	I	501;469	ENSP00000295213:S501I;ENSP00000415309:S469I	ENSP00000295213:S501I	S	+	2	0	SPATA18	52645861	0.001000	0.12720	0.937000	0.37676	0.265000	0.26407	-1.335000	0.02662	-0.488000	0.06726	-0.929000	0.02709	AGT	SPATA18	-	NULL	ENSG00000163071		0.388	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA18	HGNC	protein_coding	OTTHUMT00000250597.2	76	0.00	0	G	NM_145263		52951104	52951104	+1	no_errors	ENST00000295213	ensembl	human	known	69_37n	missense	39	23.53	12	SNP	0.611	T
TAF4	6874	genome.wustl.edu	37	20	60581738	60581738	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr20:60581738G>A	ENST00000252996.4	-	7	2050	c.2051C>T	c.(2050-2052)cCg>cTg	p.P684L		NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	684	Poly-Pro.|TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CGAGGTGGGCGGTGGCGGCTG	0.692																																						dbGAP											0													22.0	29.0	26.0					20																	60581738		2189	4267	6456	-	-	-	SO:0001583	missense	0			Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.2051C>T	20.37:g.60581738G>A	ENSP00000252996:p.Pro684Leu		A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Missense_Mutation	SNP	pfam_TAF4,pfam_TAFH_NHR1,superfamily_Histone-fold,smart_TAFH_NHR1,pfscan_TAFH_NHR1	p.P684L	ENST00000252996.4	37	c.2051	CCDS33500.1	20	.	.	.	.	.	.	.	.	.	.	G	13.91	2.378846	0.42207	.	.	ENSG00000130699	ENST00000252996;ENST00000436129	T;T	0.24723	1.85;1.84	4.08	4.08	0.47627	TAFH/NHR1 (2);	1.163210	0.06892	U	0.804349	T	0.20618	0.0496	N	0.22421	0.69	0.50467	D	0.999874	B	0.26635	0.155	B	0.17722	0.019	T	0.05241	-1.0897	10	0.62326	D	0.03	-17.0955	12.0663	0.53590	0.0:0.0:1.0:0.0	.	684	O00268	TAF4_HUMAN	L	684;548	ENSP00000252996:P684L;ENSP00000399091:P548L	ENSP00000252996:P684L	P	-	2	0	TAF4	60015133	0.877000	0.30153	0.359000	0.25824	0.869000	0.49853	0.251000	0.18257	2.550000	0.86006	0.563000	0.77884	CCG	TAF4	-	smart_TAFH_NHR1,pfscan_TAFH_NHR1	ENSG00000130699		0.692	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF4	HGNC	protein_coding	OTTHUMT00000079968.2	13	0.00	0	G	NM_003185		60581738	60581738	-1	no_errors	ENST00000252996	ensembl	human	known	69_37n	missense	34	22.73	10	SNP	0.494	A
TBC1D2	55357	genome.wustl.edu	37	9	101006299	101006299	+	Silent	SNP	G	G	C			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr9:101006299G>C	ENST00000375064.1	-	3	662	c.624C>G	c.(622-624)ctC>ctG	p.L208L	TBC1D2_ENST00000375066.5_Silent_p.L208L|TBC1D2_ENST00000342112.5_5'UTR	NM_001267571.1	NP_001254500.1	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	208					positive regulation of Rab GTPase activity (GO:0032851)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)	cadherin binding (GO:0045296)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		CCAGGTGCTTGAGGGAAATAT	0.587																																						dbGAP											0													32.0	31.0	31.0					9																	101006299		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY026527	CCDS35080.1, CCDS59137.1, CCDS75865.1	9q22.32	2011-11-30			ENSG00000095383	ENSG00000095383			18026	protein-coding gene	gene with protein product	"""prostate antigen recognized and identified by SEREX"""	609871					Standard	NM_018421		Approved	PARIS1, TBC1D2A, Armus	uc011lvb.2	Q9BYX2	OTTHUMG00000020343	ENST00000375064.1:c.624C>G	9.37:g.101006299G>C			B3KWD1|B4DQ05|B9A6J7|Q59EU0|Q5TBQ5|Q6IPC7|Q7L1K8|Q8WYT1|Q9H6A2|Q9NSH4	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Pleckstrin_homology,smart_Rab-GTPase-TBC_dom,pfscan_Pleckstrin_homology,pfscan_Rab-GTPase-TBC_dom	p.L208	ENST00000375064.1	37	c.624		9																																																																																			TBC1D2	-	NULL	ENSG00000095383		0.587	TBC1D2-001	KNOWN	basic|appris_principal	protein_coding	TBC1D2	HGNC	protein_coding	OTTHUMT00000053366.1	28	0.00	0	G	NM_018421		101006299	101006299	-1	no_errors	ENST00000375066	ensembl	human	known	69_37n	silent	21	41.67	15	SNP	1.000	C
UBE4B	10277	genome.wustl.edu	37	1	10163139	10163139	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr1:10163139A>G	ENST00000253251.8	+	5	1408	c.569A>G	c.(568-570)aAc>aGc	p.N190S	UBE4B_ENST00000343090.6_Missense_Mutation_p.N190S|UBE4B_ENST00000377157.3_Missense_Mutation_p.N74S					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		TTTAAGCAGAACCCAAAAGAA	0.448																																						dbGAP											0													93.0	90.0	91.0					1																	10163139		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.569A>G	1.37:g.10163139A>G	ENSP00000253251:p.Asn190Ser			Missense_Mutation	SNP	pfam_Ub_conjug_fac_E4_core,pfam_Ubox_domain,smart_Ubox_domain	p.N190S	ENST00000253251.8	37	c.569	CCDS110.1	1	.	.	.	.	.	.	.	.	.	.	A	16.83	3.230691	0.58777	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.49432	0.89;0.91;0.78	5.98	4.84	0.62591	.	0.042366	0.85682	D	0.000000	T	0.37073	0.0990	L	0.39898	1.24	0.35797	D	0.822838	B;B	0.32302	0.363;0.356	B;B	0.33454	0.138;0.164	T	0.34453	-0.9828	10	0.08599	T	0.76	-35.6388	13.4854	0.61361	0.8696:0.1304:0.0:0.0	.	190;190	O95155;O95155-2	UBE4B_HUMAN;.	S	190;74;190	ENSP00000253251:N190S;ENSP00000366362:N74S;ENSP00000343001:N190S	ENSP00000253251:N190S	N	+	2	0	UBE4B	10085726	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.820000	0.69250	1.063000	0.40649	0.528000	0.53228	AAC	UBE4B	-	NULL	ENSG00000130939		0.448	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE4B	HGNC	protein_coding	OTTHUMT00000005017.1	66	0.00	0	A	NM_006048		10163139	10163139	+1	no_errors	ENST00000343090	ensembl	human	known	69_37n	missense	11	35.29	6	SNP	1.000	G
USP53	54532	genome.wustl.edu	37	4	120213924	120213924	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr4:120213924A>T	ENST00000274030.6	+	19	3959	c.2780A>T	c.(2779-2781)aAg>aTg	p.K927M	USP53_ENST00000450251.1_Missense_Mutation_p.K927M	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53											breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						TTGCCACCAAAGAAATATGCT	0.438																																						dbGAP											0													61.0	56.0	58.0					4																	120213924		1886	4123	6009	-	-	-	SO:0001583	missense	0			BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	ENST00000274030.6:c.2780A>T	4.37:g.120213924A>T	ENSP00000274030:p.Lys927Met			Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.K927M	ENST00000274030.6	37	c.2780	CCDS43265.1	4	.	.	.	.	.	.	.	.	.	.	A	21.6	4.175486	0.78564	.	.	ENSG00000145390	ENST00000274030;ENST00000450251	T;T	0.63417	-0.04;-0.04	5.54	5.54	0.83059	.	0.164157	0.43110	D	0.000619	T	0.76478	0.3993	M	0.63843	1.955	0.38108	D	0.937479	D	0.89917	1.0	D	0.87578	0.998	T	0.81102	-0.1085	10	0.87932	D	0	-23.5026	14.2552	0.66048	1.0:0.0:0.0:0.0	.	927	Q70EK8	UBP53_HUMAN	M	927	ENSP00000274030:K927M;ENSP00000409906:K927M	ENSP00000274030:K927M	K	+	2	0	USP53	120433372	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.331000	0.72929	2.103000	0.63969	0.477000	0.44152	AAG	USP53	-	NULL	ENSG00000145390		0.438	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP53	HGNC	protein_coding	OTTHUMT00000364564.2	54	0.00	0	A	XM_052597		120213924	120213924	+1	no_errors	ENST00000274030	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	1.000	T
YIF1B	90522	genome.wustl.edu	37	19	38798137	38798137	+	Silent	SNP	G	G	T			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr19:38798137G>T	ENST00000339413.6	-	7	765	c.720C>A	c.(718-720)ggC>ggA	p.G240G	YIF1B_ENST00000329420.8_Silent_p.G225G|YIF1B_ENST00000587361.1_5'Flank|YIF1B_ENST00000392124.3_Silent_p.G209G|YIF1B_ENST00000337679.8_Silent_p.G237G|YIF1B_ENST00000592694.1_Silent_p.G209G|YIF1B_ENST00000591755.1_Silent_p.G237G|YIF1B_ENST00000591784.1_Silent_p.G209G|YIF1B_ENST00000592246.1_Silent_p.G174G	NM_001039672.2|NM_001039673.2	NP_001034761.1|NP_001034762.1	Q5BJH7	YIF1B_HUMAN	Yip1 interacting factor homolog B (S. cerevisiae)	240						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)	10	all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CGAAGAGCAGGCCCATGAGGA	0.642																																						dbGAP											0													72.0	68.0	69.0					19																	38798137		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL833382	CCDS12512.1, CCDS33010.1, CCDS46066.1, CCDS46067.1	19q13.2	2008-02-05							30511	protein-coding gene	gene with protein product						12975309	Standard	NM_001039672		Approved	FinGER8	uc002ohz.2	Q5BJH7		ENST00000339413.6:c.720C>A	19.37:g.38798137G>T			H7BXS8|Q5JPC2|Q8WY70|Q96C02|Q96IC4	Missense_Mutation	SNP	pfam_Hrf1	p.A169D	ENST00000339413.6	37	c.506	CCDS33010.1	19																																																																																			YIF1B	-	NULL	ENSG00000167645		0.642	YIF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YIF1B	HGNC	protein_coding	OTTHUMT00000460511.1	37	0.00	0	G	NM_033557		38798137	38798137	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000588002	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
ZNF518B	85460	genome.wustl.edu	37	4	10446040	10446040	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr4:10446040G>C	ENST00000326756.3	-	3	2351	c.1913C>G	c.(1912-1914)tCt>tGt	p.S638C		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	638					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						AGAGCTCAGAGAAAATACTGA	0.413																																						dbGAP											0													122.0	122.0	122.0					4																	10446040		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.1913C>G	4.37:g.10446040G>C	ENSP00000317614:p.Ser638Cys		Q96LN8	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S638C	ENST00000326756.3	37	c.1913	CCDS33960.1	4	.	.	.	.	.	.	.	.	.	.	G	25.5	4.649166	0.87958	.	.	ENSG00000178163	ENST00000326756	T	0.04317	3.65	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000007	T	0.19287	0.0463	L	0.50333	1.59	0.41598	D	0.988839	D	0.89917	1.0	D	0.87578	0.998	T	0.00007	-1.2494	10	0.87932	D	0	-19.5963	19.609	0.95594	0.0:0.0:1.0:0.0	.	638	Q9C0D4	Z518B_HUMAN	C	638	ENSP00000317614:S638C	ENSP00000317614:S638C	S	-	2	0	ZNF518B	10055138	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.158000	0.64917	2.882000	0.98803	0.655000	0.94253	TCT	ZNF518B	-	NULL	ENSG00000178163		0.413	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF518B	HGNC	protein_coding	OTTHUMT00000359040.1	76	0.00	0	G	NM_053042		10446040	10446040	-1	no_errors	ENST00000326756	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	1.000	C
ZNF555	148254	genome.wustl.edu	37	19	2852854	2852854	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr19:2852854C>G	ENST00000334241.4	+	4	929	c.791C>G	c.(790-792)gCt>gGt	p.A264G	AC006130.3_ENST00000589365.1_RNA|ZNF555_ENST00000591539.1_Missense_Mutation_p.A263G	NM_001172775.1|NM_152791.4	NP_001166246.1|NP_690004.4	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	264					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)|urinary_tract(4)	23				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTGGGAAAGCTTTCAGTTAT	0.413																																						dbGAP											0													72.0	64.0	67.0					19																	2852854		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832140	CCDS12096.1, CCDS59329.1	19p13.3	2013-09-20			ENSG00000186300	ENSG00000186300		"""Zinc fingers, C2H2-type"", ""-"""	28382	protein-coding gene	gene with protein product						12477932	Standard	NM_152791		Approved	MGC26707	uc002lwo.3	Q8NEP9	OTTHUMG00000180500	ENST00000334241.4:c.791C>G	19.37:g.2852854C>G	ENSP00000334853:p.Ala264Gly		A8KA89|K7EQM2|Q8NA46|Q96MP1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A264G	ENST00000334241.4	37	c.791	CCDS12096.1	19	.	.	.	.	.	.	.	.	.	.	C	13.74	2.328520	0.41197	.	.	ENSG00000186300	ENST00000334241;ENST00000382127	T	0.01059	5.39	3.06	3.06	0.35304	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02012	0.0063	N	0.20845	0.615	0.22552	N	0.998998	D;D	0.59767	0.958;0.986	P;P	0.58970	0.756;0.849	T	0.54925	-0.8220	9	0.72032	D	0.01	.	7.5537	0.27812	0.2555:0.7445:0.0:0.0	.	264;263	Q8NEP9;A8KA89	ZN555_HUMAN;.	G	264;263	ENSP00000334853:A264G	ENSP00000334853:A264G	A	+	2	0	ZNF555	2803854	0.000000	0.05858	0.984000	0.44739	0.985000	0.73830	0.672000	0.25187	1.720000	0.51447	0.561000	0.74099	GCT	ZNF555	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186300		0.413	ZNF555-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF555	HGNC	protein_coding	OTTHUMT00000451637.3	63	0.00	0	C	NM_152791		2852854	2852854	+1	no_errors	ENST00000334241	ensembl	human	known	69_37n	missense	28	26.32	10	SNP	0.992	G
ZNF619	285267	genome.wustl.edu	37	3	40528692	40528692	+	Missense_Mutation	SNP	C	C	T	rs372214247		TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr3:40528692C>T	ENST00000314686.5	+	6	1048	c.643C>T	c.(643-645)Ccc>Tcc	p.P215S	ZNF619_ENST00000447116.2_Missense_Mutation_p.P271S|ZNF619_ENST00000521353.1_Missense_Mutation_p.P271S|ZNF619_ENST00000429348.2_Missense_Mutation_p.P231S|ZNF619_ENST00000456778.1_Missense_Mutation_p.P187S|ZNF619_ENST00000520737.1_3'UTR|ZNF619_ENST00000522736.1_Missense_Mutation_p.P222S|ZNF619_ENST00000432264.2_Missense_Mutation_p.P231S			Q8N2I2	ZN619_HUMAN	zinc finger protein 619	215					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		TAATGAGAAGCCCTACACATG	0.423																																						dbGAP											0													63.0	63.0	63.0					3																	40528692		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075245	CCDS46801.1, CCDS46802.1, CCDS46803.1	3p21.33	2013-01-08			ENSG00000177873	ENSG00000177873		"""Zinc fingers, C2H2-type"", ""-"""	26910	protein-coding gene	gene with protein product							Standard	NM_001145083		Approved	FLJ90764	uc011azb.2	Q8N2I2	OTTHUMG00000131391	ENST00000314686.5:c.643C>T	3.37:g.40528692C>T	ENSP00000322529:p.Pro215Ser		B4E271|C9JRN5|D4PHA2|E9PCD9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P271S	ENST00000314686.5	37	c.811		3	.	.	.	.	.	.	.	.	.	.	C	13.98	2.398259	0.42512	.	.	ENSG00000177873	ENST00000314686;ENST00000447116;ENST00000429348;ENST00000456778;ENST00000522736;ENST00000521353;ENST00000432264	T;T;T;T;T;T;T	0.16743	2.32;2.32;2.32;2.32;2.32;2.32;2.32	2.64	1.71	0.24356	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.28300	0.0699	L	0.49455	1.56	0.28821	N	0.89766	D;D;D;D;D;D	0.71674	0.994;0.994;0.994;0.991;0.997;0.998	P;P;P;P;P;P	0.59546	0.797;0.584;0.723;0.713;0.723;0.859	T	0.08806	-1.0704	9	0.66056	D	0.02	.	9.0816	0.36556	0.0:0.7718:0.2282:0.0	.	187;231;271;173;222;215	B4E271;C9JRN5;E9PCD9;B7Z9B3;Q17RW3;Q8N2I2	.;.;.;.;.;ZN619_HUMAN	S	215;271;231;187;222;271;231	ENSP00000322529:P215S;ENSP00000411132:P271S;ENSP00000398024:P231S;ENSP00000397232:P187S;ENSP00000428004:P222S;ENSP00000430705:P271S;ENSP00000388710:P231S	ENSP00000322529:P215S	P	+	1	0	ZNF619	40503696	0.018000	0.18449	0.404000	0.26397	0.527000	0.34593	1.651000	0.37302	0.425000	0.26087	0.563000	0.77884	CCC	ZNF619	-	pfscan_Znf_C2H2	ENSG00000177873		0.423	ZNF619-001	KNOWN	basic	protein_coding	ZNF619	HGNC	protein_coding	OTTHUMT00000254180.2	48	0.00	0	C	NM_173656		40528692	40528692	+1	no_errors	ENST00000447116	ensembl	human	known	69_37n	missense	11	35.29	6	SNP	1.000	T
ZNF658	26149	genome.wustl.edu	37	9	40774928	40774928	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1Y0-01A-11D-A14K-09	TCGA-D8-A1Y0-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	33ff7870-fa76-4e48-a223-a8e2441d8f53	95048722-2664-4839-9814-dfa4aeb66198	g.chr9:40774928T>G	ENST00000602553.1	-	5	641	c.347A>C	c.(346-348)cAg>cCg	p.Q116P	ZNF658_ENST00000441795.1_Missense_Mutation_p.Q114P|ZNF658_ENST00000377626.3_Missense_Mutation_p.Q116P			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	116					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TAAAACTTTCTGTCCTTCTTT	0.358																																						dbGAP											0													30.0	33.0	32.0					9																	40774928		2195	4285	6480	-	-	-	SO:0001583	missense	0			AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.347A>C	9.37:g.40774928T>G	ENSP00000473484:p.Gln116Pro		Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q116P	ENST00000602553.1	37	c.347	CCDS35023.1	9	.	.	.	.	.	.	.	.	.	.	t	4.509	0.094487	0.08632	.	.	ENSG00000196409	ENST00000441795;ENST00000377626	T;T	0.06294	3.48;3.32	1.77	1.77	0.24775	.	.	.	.	.	T	0.03053	0.0090	N	0.08118	0	0.09310	N	1	B;P	0.42993	0.044;0.797	B;B	0.37888	0.065;0.26	T	0.45116	-0.9283	9	0.28530	T	0.3	.	7.5705	0.27904	0.0:0.0:0.0:1.0	.	116;116	Q5TYW1-2;Q5TYW1	.;ZN658_HUMAN	P	114;116	ENSP00000408462:Q114P;ENSP00000366853:Q116P	ENSP00000366853:Q116P	Q	-	2	0	ZNF658	40764928	0.001000	0.12720	0.013000	0.15412	0.083000	0.17756	0.832000	0.27490	1.092000	0.41356	0.321000	0.21382	CAG	ZNF658	-	NULL	ENSG00000196409		0.358	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF658	HGNC	protein_coding	OTTHUMT00000467800.1	69	0.00	0	T	NM_033160		40774928	40774928	-1	no_errors	ENST00000377626	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.002	G
