#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB4	5244	genome.wustl.edu	37	7	87037370	87037370	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr7:87037370G>T	ENST00000265723.4	-	25	3373	c.3262C>A	c.(3262-3264)Ccc>Acc	p.P1088T	ABCB4_ENST00000359206.3_Missense_Mutation_p.P1088T|ABCB4_ENST00000545634.1_Missense_Mutation_p.P1088T|ABCB4_ENST00000453593.1_Missense_Mutation_p.P1041T|ABCB4_ENST00000358400.3_Missense_Mutation_p.P1041T	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	1088	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	CCCGCCAAGGGGTCGTAGAAC	0.512																																						dbGAP											0													77.0	81.0	79.0					7																	87037370		2203	4300	6503	-	-	-	SO:0001583	missense	0			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.3262C>A	7.37:g.87037370G>T	ENSP00000265723:p.Pro1088Thr		A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,pfam_Zeta_toxin_domain,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.P1088T	ENST00000265723.4	37	c.3262	CCDS5606.1	7	.	.	.	.	.	.	.	.	.	.	G	16.76	3.213344	0.58452	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.94966	-3.57;-3.57;-3.57;-3.57;-3.57	5.19	4.31	0.51392	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.109437	0.64402	D	0.000005	D	0.96288	0.8789	M	0.83774	2.66	0.58432	D	0.999998	P;P;P	0.50066	0.931;0.84;0.868	P;P;P	0.55087	0.749;0.523;0.768	D	0.96151	0.9108	10	0.54805	T	0.06	-6.0284	14.0091	0.64483	0.0733:0.0:0.9267:0.0	.	1041;1088;1088	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	T	1088;1041;1088;1041;1088	ENSP00000352135:P1088T;ENSP00000351172:P1041T;ENSP00000265723:P1088T;ENSP00000392983:P1041T;ENSP00000437465:P1088T	ENSP00000265723:P1088T	P	-	1	0	ABCB4	86875306	1.000000	0.71417	0.979000	0.43373	0.846000	0.48090	6.467000	0.73547	1.321000	0.45227	0.655000	0.94253	CCC	ABCB4	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000005471		0.512	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	HGNC	protein_coding	OTTHUMT00000336083.1	9	0.00	0	G	NM_000443		87037370	87037370	-1	no_errors	ENST00000265723	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	1.000	T
ADCY9	115	genome.wustl.edu	37	16	4057514	4057514	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr16:4057514C>G	ENST00000294016.3	-	3	2277	c.1739G>C	c.(1738-1740)cGc>cCc	p.R580P	ADCY9_ENST00000571889.1_5'UTR	NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	580					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						ACAGCTGCAGCGAGACTCCTT	0.517																																						dbGAP											0													108.0	95.0	100.0					16																	4057514		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.1739G>C	16.37:g.4057514C>G	ENSP00000294016:p.Arg580Pro		A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R580P	ENST00000294016.3	37	c.1739	CCDS32382.1	16	.	.	.	.	.	.	.	.	.	.	C	8.268	0.812604	0.16537	.	.	ENSG00000162104	ENST00000294016	D	0.82803	-1.65	5.55	-4.26	0.03755	.	0.683068	0.15331	N	0.267984	T	0.58736	0.2143	N	0.08118	0	0.19575	N	0.999963	B	0.02656	0.0	B	0.01281	0.0	T	0.43360	-0.9396	10	0.30078	T	0.28	.	6.2502	0.20842	0.0:0.3623:0.2472:0.3905	.	580	O60503	ADCY9_HUMAN	P	580	ENSP00000294016:R580P	ENSP00000294016:R580P	R	-	2	0	ADCY9	3997515	0.352000	0.24895	0.089000	0.20774	0.970000	0.65996	0.269000	0.18589	-1.078000	0.03117	-0.852000	0.03032	CGC	ADCY9	-	NULL	ENSG00000162104		0.517	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY9	HGNC	protein_coding	OTTHUMT00000438076.1	32	0.00	0	C			4057514	4057514	-1	no_errors	ENST00000294016	ensembl	human	known	69_37n	missense	23	30.30	10	SNP	0.063	G
AGRN	375790	genome.wustl.edu	37	1	984735	984735	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr1:984735A>T	ENST00000379370.2	+	25	4468	c.4418A>T	c.(4417-4419)gAg>gTg	p.E1473V		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	1473	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		GTGGATGGTGAGACCCCTGTT	0.701																																						dbGAP											0													49.0	55.0	53.0					1																	984735		2202	4300	6502	-	-	-	SO:0001583	missense	0			XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.4418A>T	1.37:g.984735A>T	ENSP00000368678:p.Glu1473Val		Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Agrin_NtA,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,pfam_EGF_laminin,pfam_SEA,pfam_EGF-like_dom,superfamily_TIMP-like_OB-fold,superfamily_ConA-like_lec_gl,smart_FacI_MAC,smart_Fol_N,smart_Prot_inh_Kazal,smart_EGF-like,smart_EGF_laminin,smart_SEA,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Agrin_NtA,pfscan_SEA	p.E1473V	ENST00000379370.2	37	c.4418	CCDS30551.1	1	.	.	.	.	.	.	.	.	.	.	a	17.18	3.324503	0.60634	.	.	ENSG00000188157	ENST00000379370	T	0.77489	-1.1	4.37	4.37	0.52481	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.000000	0.64402	U	0.000006	D	0.84732	0.5537	L	0.60904	1.88	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84614	0.0680	10	0.42905	T	0.14	-27.1878	13.544	0.61693	1.0:0.0:0.0:0.0	.	1473	O00468	AGRIN_HUMAN	V	1473	ENSP00000368678:E1473V	ENSP00000368678:E1473V	E	+	2	0	AGRN	974598	1.000000	0.71417	0.363000	0.25875	0.005000	0.04900	5.042000	0.64202	1.740000	0.51718	0.392000	0.25879	GAG	AGRN	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000188157		0.701	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGRN	HGNC	protein_coding	OTTHUMT00000097990.2	20	0.00	0	A	NM_198576		984735	984735	+1	no_errors	ENST00000379370	ensembl	human	known	69_37n	missense	21	29.03	9	SNP	1.000	T
ALKBH3	221120	genome.wustl.edu	37	11	43940636	43940636	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr11:43940636G>A	ENST00000302708.4	+	9	1129	c.718G>A	c.(718-720)Gat>Aat	p.D240N	ALKBH3-AS1_ENST00000527960.1_RNA|ALKBH3-AS1_ENST00000528285.1_RNA|ALKBH3-AS1_ENST00000499194.1_RNA|ALKBH3-AS1_ENST00000534287.1_RNA|RP11-613D13.4_ENST00000526408.1_RNA|ALKBH3_ENST00000532410.1_3'UTR	NM_139178.3	NP_631917.1	Q96Q83	ALKB3_HUMAN	alkB, alkylation repair homolog 3 (E. coli)	240	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA repair (GO:0006281)|oxidative single-stranded DNA demethylation (GO:0035552)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)			endometrium(2)|kidney(1)|lung(4)|prostate(1)	8					Vitamin C(DB00126)	GATACCCTTGGATCATGGGAC	0.423								Direct reversal of damage																														dbGAP											0													207.0	171.0	183.0					11																	43940636		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB042029	CCDS7906.1	11p11.2	2013-10-11			ENSG00000166199	ENSG00000166199		"""Alkylation repair homologs"""	30141	protein-coding gene	gene with protein product		610603				22055184	Standard	NM_139178		Approved	DEPC-1	uc001mxs.2	Q96Q83	OTTHUMG00000166417	ENST00000302708.4:c.718G>A	11.37:g.43940636G>A	ENSP00000302232:p.Asp240Asn		A6NDJ1|Q3SYI0|Q6NX57|Q96BU8	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase	p.D240N	ENST00000302708.4	37	c.718	CCDS7906.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.77|11.77	1.736849|1.736849	0.30774|0.30774	.|.	.|.	ENSG00000166199|ENSG00000166199	ENST00000302708|ENST00000532129	T|.	0.10763|.	2.84|.	5.91|5.91	5.91|5.91	0.95273|0.95273	Oxoglutarate/iron-dependent oxygenase (2);|.	0.268908|.	0.42682|.	D|.	0.000678|.	T|T	0.38506|0.38506	0.1043|0.1043	N|N	0.04724|0.04724	-0.175|-0.175	0.80722|0.80722	D|D	1|1	B|.	0.12013|.	0.005|.	B|.	0.14578|.	0.011|.	T|T	0.30475|0.30475	-0.9977|-0.9977	10|5	0.20046|.	T|.	0.44|.	-11.2744|-11.2744	15.7986|15.7986	0.78433|0.78433	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	240|.	Q96Q83|.	ALKB3_HUMAN|.	N|E	240|109	ENSP00000302232:D240N|.	ENSP00000302232:D240N|.	D|G	+|+	1|2	0|0	ALKBH3|ALKBH3	43897212|43897212	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.676000|3.676000	0.54612|0.54612	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	GAT|GGA	ALKBH3	-	pfam_Oxoglu/Fe-dep_dioxygenase	ENSG00000166199		0.423	ALKBH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALKBH3	HGNC	protein_coding	OTTHUMT00000389693.1	43	0.00	0	G	NM_139178		43940636	43940636	+1	no_errors	ENST00000302708	ensembl	human	known	69_37n	missense	46	24.59	15	SNP	1.000	A
ANPEP	290	genome.wustl.edu	37	15	90342682	90342682	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr15:90342682T>G	ENST00000300060.6	-	13	2241	c.1928A>C	c.(1927-1929)cAg>cCg	p.Q643P	ANPEP_ENST00000558177.1_5'UTR	NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	643	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	CAGCTGAGTCTGAATCTTCCT	0.592																																					NSCLC(30;827 977 2459 19669 26125)	dbGAP											0													138.0	126.0	130.0					15																	90342682		2200	4299	6499	-	-	-	SO:0001583	missense	0			M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.1928A>C	15.37:g.90342682T>G	ENSP00000300060:p.Gln643Pro		Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.Q643P	ENST00000300060.6	37	c.1928	CCDS10356.1	15	.	.	.	.	.	.	.	.	.	.	T	14.21	2.467304	0.43839	.	.	ENSG00000166825	ENST00000300060	T	0.05513	3.43	5.07	3.94	0.45596	.	0.394448	0.26207	N	0.025717	T	0.11367	0.0277	M	0.69823	2.125	0.33790	D	0.625338	P	0.44986	0.847	P	0.49887	0.625	T	0.09862	-1.0655	10	0.27785	T	0.31	.	4.8173	0.13372	0.1642:0.092:0.0:0.7438	.	643	P15144	AMPN_HUMAN	P	643	ENSP00000300060:Q643P	ENSP00000300060:Q643P	Q	-	2	0	ANPEP	88143686	1.000000	0.71417	0.972000	0.41901	0.611000	0.37282	4.894000	0.63206	1.918000	0.55548	0.460000	0.39030	CAG	ANPEP	-	NULL	ENSG00000166825		0.592	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANPEP	HGNC	protein_coding	OTTHUMT00000313425.1	48	0.00	0	T			90342682	90342682	-1	no_errors	ENST00000300060	ensembl	human	known	69_37n	missense	52	33.33	26	SNP	0.988	G
APMAP	57136	genome.wustl.edu	37	20	24954310	24954310	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr20:24954310G>C	ENST00000217456.2	-	4	682	c.392C>G	c.(391-393)aCc>aGc	p.T131S	APMAP_ENST00000447138.1_Missense_Mutation_p.T131S|RNU6-1257P_ENST00000384625.1_RNA	NM_020531.2	NP_065392.1	Q9HDC9	APMAP_HUMAN	adipocyte plasma membrane associated protein	131					biosynthetic process (GO:0009058)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	arylesterase activity (GO:0004064)|strictosidine synthase activity (GO:0016844)										CCGGGCAATGGTCTCTATTTC	0.443																																						dbGAP											0													106.0	93.0	97.0					20																	24954310		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033767	CCDS13166.1	20p11.2	2012-07-20	2012-07-20	2012-07-20	ENSG00000101474	ENSG00000101474			13238	protein-coding gene	gene with protein product		615884	"""chromosome 20 open reading frame 3"""	C20orf3		10945474, 11583587, 20552250	Standard	NM_020531		Approved	BSCv	uc002wty.3	Q9HDC9	OTTHUMG00000032107	ENST00000217456.2:c.392C>G	20.37:g.24954310G>C	ENSP00000217456:p.Thr131Ser		A8K514|B4DXG1|Q6UVZ8|Q9GZS8|Q9NUB2	Missense_Mutation	SNP	pfam_Strictosidine_synth_cons-reg,pfam_SGL	p.T131S	ENST00000217456.2	37	c.392	CCDS13166.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.29|10.29	1.309484|1.309484	0.23821|0.23821	.|.	.|.	ENSG00000101474|ENSG00000101474	ENST00000451442|ENST00000217456;ENST00000447138	.|T;T	.|0.29917	.|1.55;1.55	5.43|5.43	2.45|2.45	0.29901|0.29901	.|Six-bladed beta-propeller, TolB-like (1);	.|0.151895	.|0.64402	.|D	.|0.000014	T|T	0.31544|0.31544	0.0800|0.0800	M|M	0.70275|0.70275	2.135|2.135	0.42996|0.42996	D|D	0.994507|0.994507	.|B;D;B	.|0.53151	.|0.095;0.958;0.048	.|B;P;B	.|0.45276	.|0.049;0.475;0.034	T|T	0.13737|0.13737	-1.0498|-1.0498	5|10	.|0.19147	.|T	.|0.46	-3.085|-3.085	8.8053|8.8053	0.34934|0.34934	0.2466:0.0:0.7534:0.0|0.2466:0.0:0.7534:0.0	.|.	.|131;115;131	.|Q9HDC9-2;A2A2F9;Q9HDC9	.|.;.;APMAP_HUMAN	A|S	116|131	.|ENSP00000217456:T131S;ENSP00000415373:T131S	.|ENSP00000217456:T131S	P|T	-|-	1|2	0|0	C20orf3|C20orf3	24902310|24902310	0.999000|0.999000	0.42202|0.42202	0.853000|0.853000	0.33588|0.33588	0.812000|0.812000	0.45895|0.45895	2.983000|2.983000	0.49345|0.49345	0.279000|0.279000	0.22186|0.22186	0.655000|0.655000	0.94253|0.94253	CCA|ACC	APMAP	-	NULL	ENSG00000101474		0.443	APMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APMAP	HGNC	protein_coding	OTTHUMT00000078380.2	47	0.00	0	G	NM_020531		24954310	24954310	-1	no_errors	ENST00000217456	ensembl	human	known	69_37n	missense	41	30.51	18	SNP	0.942	C
ATP9A	10079	genome.wustl.edu	37	20	50238710	50238710	+	Splice_Site	SNP	A	A	T			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr20:50238710A>T	ENST00000338821.5	-	19	2282	c.2018T>A	c.(2017-2019)gTt>gAt	p.V673D	ATP9A_ENST00000402822.1_Splice_Site_p.V552D|ATP9A_ENST00000311637.5_Splice_Site_p.V537D	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	673					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CAGCATCCAAACCTGAAATCA	0.498																																						dbGAP											0													193.0	145.0	162.0					20																	50238710		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.2017-1T>A	20.37:g.50238710A>T			E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.V673D	ENST00000338821.5	37	c.2018	CCDS33489.1	20	.	.	.	.	.	.	.	.	.	.	A	19.46	3.832639	0.71258	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	D;D;D	0.84298	-1.83;-1.83;-1.83	5.12	5.12	0.69794	HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.94118	0.8114	H	0.94345	3.525	0.80722	D	1	D;D	0.64830	0.983;0.994	P;D	0.69654	0.773;0.965	D	0.95654	0.8709	10	0.87932	D	0	-22.8018	14.9058	0.70718	1.0:0.0:0.0:0.0	.	552;673	O75110-2;O75110	.;ATP9A_HUMAN	D	537;673;552	ENSP00000309086:V537D;ENSP00000342481:V673D;ENSP00000385875:V552D	ENSP00000309086:V537D	V	-	2	0	ATP9A	49672117	1.000000	0.71417	0.927000	0.36925	0.486000	0.33341	8.962000	0.93254	1.931000	0.55961	0.533000	0.62120	GTT	ATP9A	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000054793		0.498	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP9A	HGNC	protein_coding	OTTHUMT00000106494.1	30	0.00	0	A	NM_006045	Missense_Mutation	50238710	50238710	-1	no_errors	ENST00000338821	ensembl	human	known	69_37n	missense	30	41.18	21	SNP	0.998	T
BRCA1	672	genome.wustl.edu	37	17	41223090	41223090	+	Frame_Shift_Del	DEL	G	G	-			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr17:41223090delG	ENST00000357654.3	-	15	4959	c.4841delC	c.(4840-4842)ccafs	p.P1614fs	BRCA1_ENST00000346315.3_Intron|BRCA1_ENST00000351666.3_Frame_Shift_Del_p.P431fs|BRCA1_ENST00000471181.2_Frame_Shift_Del_p.P1635fs|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000309486.4_Frame_Shift_Del_p.P1318fs|BRCA1_ENST00000468300.1_Frame_Shift_Del_p.P510fs|BRCA1_ENST00000491747.2_Frame_Shift_Del_p.P510fs|BRCA1_ENST00000354071.3_Intron|BRCA1_ENST00000591534.1_Frame_Shift_Del_p.P105fs|BRCA1_ENST00000352993.3_Frame_Shift_Del_p.P472fs|BRCA1_ENST00000493795.1_Frame_Shift_Del_p.P1567fs	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1614					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AGCAGCAGCTGGACTCTGGGC	0.478			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0													147.0	136.0	140.0					17																	41223090		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.4841delC	17.37:g.41223090delG	ENSP00000350283:p.Pro1614fs		O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Frame_Shift_Del	DEL	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_RING	p.P1635fs	ENST00000357654.3	37	c.4904	CCDS11453.1	17																																																																																			BRCA1	-	pirsf_BRCA1,superfamily_BRCT_dom	ENSG00000012048		0.478	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	50	0.00	0	G	NM_007294		41223090	41223090	-1	no_errors	ENST00000471181	ensembl	human	known	69_37n	frame_shift_del	49	31.94	23	DEL	0.000	-
SMCO2	341346	genome.wustl.edu	37	12	27654981	27654981	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr12:27654981G>A	ENST00000535986.1	+	8	959	c.959G>A	c.(958-960)cGc>cAc	p.R320H	SMCO2_ENST00000416383.1_Missense_Mutation_p.R320H|SMCO2_ENST00000298876.4_Missense_Mutation_p.R270H			A6NFE2	SMCO2_HUMAN	single-pass membrane protein with coiled-coil domains 2	320						integral component of membrane (GO:0016021)											CTTGGGTGCCGCACCACATGG	0.443																																						dbGAP											0													159.0	136.0	143.0					12																	27654981		682	1590	2272	-	-	-	SO:0001583	missense	0				CCDS44852.1	12p11.23	2013-03-11	2013-03-11	2013-03-11	ENSG00000165935	ENSG00000165935			34448	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 70"""	C12orf70			Standard	NM_001145010		Approved	LOC341346	uc010sjq.2	A6NFE2	OTTHUMG00000169205	ENST00000535986.1:c.959G>A	12.37:g.27654981G>A	ENSP00000441688:p.Arg320His			Missense_Mutation	SNP	NULL	p.R320H	ENST00000535986.1	37	c.959	CCDS44852.1	12	.	.	.	.	.	.	.	.	.	.	G	3.379	-0.126795	0.06795	.	.	ENSG00000165935	ENST00000298876;ENST00000416383;ENST00000535986	.	.	.	4.28	-2.09	0.07232	.	0.832143	0.10241	N	0.698461	T	0.27313	0.0670	L	0.34521	1.04	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.28681	-1.0036	9	0.87932	D	0	0.1539	5.0236	0.14374	0.5297:0.167:0.3034:0.0	.	320	A6NFE2	CL070_HUMAN	H	270;320;320	.	ENSP00000298876:R270H	R	+	2	0	C12orf70	27546248	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.728000	0.04925	-0.298000	0.08921	-0.733000	0.03571	CGC	C12orf70	-	NULL	ENSG00000165935		0.443	SMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf70	HGNC	protein_coding	OTTHUMT00000402867.1	52	0.00	0	G	NM_001145010		27654981	27654981	+1	no_errors	ENST00000416383	ensembl	human	known	69_37n	missense	68	26.88	25	SNP	0.000	A
C15orf53	400359	genome.wustl.edu	37	15	38990578	38990578	+	Silent	SNP	C	C	G			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr15:38990578C>G	ENST00000318792.1	+	2	382	c.372C>G	c.(370-372)ccC>ccG	p.P124P		NM_207444.2	NP_997327.1	Q8NAA6	CO053_HUMAN	chromosome 15 open reading frame 53	124										endometrium(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	6		all_cancers(109;1.75e-13)|all_epithelial(112;1.02e-11)|Lung NSC(122;1.9e-09)|all_lung(180;4.04e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)		GBM - Glioblastoma multiforme(113;8.39e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0321)		CTTCCAGCCCCTCCTACCTAA	0.542																																						dbGAP											0													46.0	47.0	47.0					15																	38990578		2200	4297	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS10048.1	15q14	2007-11-21			ENSG00000175779	ENSG00000175779			33796	protein-coding gene	gene with protein product							Standard	NM_207444		Approved	FLJ35695	uc001zkf.1	Q8NAA6	OTTHUMG00000129841	ENST00000318792.1:c.372C>G	15.37:g.38990578C>G				Silent	SNP	NULL	p.P124	ENST00000318792.1	37	c.372	CCDS10048.1	15																																																																																			C15orf53	-	NULL	ENSG00000175779		0.542	C15orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf53	HGNC	protein_coding	OTTHUMT00000252081.1	20	0.00	0	C	NM_207444		38990578	38990578	+1	no_errors	ENST00000318792	ensembl	human	known	69_37n	silent	11	42.11	8	SNP	0.000	G
CCDC74A	90557	genome.wustl.edu	37	2	132288293	132288293	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr2:132288293G>C	ENST00000295171.6	+	3	575	c.437G>C	c.(436-438)gGa>gCa	p.G146A	CCDC74A_ENST00000409856.3_Intron|CCDC74A_ENST00000467992.2_Missense_Mutation_p.G248A	NM_001258304.1|NM_001258305.1|NM_138770.2	NP_001245233.1|NP_001245234.1|NP_620125.1	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	146										endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						CACAGGCCAGGAGGCAAGCGT	0.642																																						dbGAP											0													102.0	95.0	97.0					2																	132288293		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS2167.1, CCDS58732.1, CCDS74578.1	2q21.1	2008-02-05		2006-02-16	ENSG00000163040	ENSG00000163040			25197	protein-coding gene	gene with protein product						12477932	Standard	NM_138770		Approved	FLJ40345	uc002ttb.4	Q96AQ1	OTTHUMG00000131667	ENST00000295171.6:c.437G>C	2.37:g.132288293G>C	ENSP00000295171:p.Gly146Ala		Q6P4I5	Missense_Mutation	SNP	NULL	p.G146A	ENST00000295171.6	37	c.437	CCDS2167.1	2	.	.	.	.	.	.	.	.	.	.	.	8.479	0.859429	0.17178	.	.	ENSG00000163040	ENST00000295171;ENST00000467992	T;T	0.47528	1.98;0.84	2.28	2.28	0.28536	.	.	.	.	.	T	0.33265	0.0857	L	0.38175	1.15	0.09310	N	1	D	0.58970	0.984	P	0.45506	0.483	T	0.14172	-1.0482	9	0.02654	T	1	.	8.0745	0.30708	0.0:0.0:1.0:0.0	.	146	Q96AQ1	CC74A_HUMAN	A	146;248	ENSP00000295171:G146A;ENSP00000444610:G248A	ENSP00000295171:G146A	G	+	2	0	CCDC74A	132004763	0.000000	0.05858	0.001000	0.08648	0.124000	0.20399	-0.335000	0.07873	1.281000	0.44480	0.194000	0.17425	GGA	CCDC74A	-	NULL	ENSG00000163040		0.642	CCDC74A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC74A	HGNC	protein_coding	OTTHUMT00000254570.2	31	0.00	0	G	NM_138770		132288293	132288293	+1	no_errors	ENST00000295171	ensembl	human	known	69_37n	missense	32	15.79	6	SNP	0.006	C
CNKSR1	10256	genome.wustl.edu	37	1	26508367	26508367	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr1:26508367A>C	ENST00000374253.5	+	4	451	c.412A>C	c.(412-414)Aat>Cat	p.N138H	CNKSR1_ENST00000361530.6_Missense_Mutation_p.N138H|CNKSR1_ENST00000531191.1_5'UTR|CNKSR1_ENST00000480348.2_3'UTR	NM_006314.2	NP_006305.2	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras 1	138	CRIC. {ECO:0000255|PROSITE- ProRule:PRU00621}.				Ras protein signal transduction (GO:0007265)|Rho protein signal transduction (GO:0007266)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|plasma membrane (GO:0005886)	protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	28		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		CTCCCACTTAAATGATTTCTC	0.517																																					NSCLC(180;1396 2109 28270 30756 34275)	dbGAP											0													123.0	102.0	109.0					1																	26508367		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100153	CCDS276.1, CCDS72732.1	1p35.3	2013-01-10			ENSG00000142675	ENSG00000142675		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19700	protein-coding gene	gene with protein product		603272				9814705	Standard	NM_006314		Approved	CNK1, KSR, CNK	uc001blm.4	Q969H4	OTTHUMG00000007541	ENST00000374253.5:c.412A>C	1.37:g.26508367A>C	ENSP00000363371:p.Asn138His		B1AMW9|O95381	Missense_Mutation	SNP	pfam_CRIC_domain_Chordata,pfam_Pleckstrin_homology,pfam_SAM_type1,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.N138H	ENST00000374253.5	37	c.412		1	.	.	.	.	.	.	.	.	.	.	A	18.33	3.600072	0.66332	.	.	ENSG00000142675	ENST00000361530;ENST00000422547;ENST00000374253	T;T	0.15017	2.46;2.46	5.1	5.1	0.69264	CRIC domain (1);CRIC domain, Chordata (1);	0.247449	0.46442	D	0.000292	T	0.38825	0.1055	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.17868	-1.0355	10	0.62326	D	0.03	-21.2488	10.575	0.45223	0.8384:0.1615:0.0:0.0	.	138;138	Q969H4;Q53GM7	CNKR1_HUMAN;.	H	138	ENSP00000354609:N138H;ENSP00000363371:N138H	ENSP00000354609:N138H	N	+	1	0	CNKSR1	26380954	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	3.144000	0.50616	2.142000	0.66516	0.528000	0.53228	AAT	CNKSR1	-	pfam_CRIC_domain_Chordata	ENSG00000142675		0.517	CNKSR1-007	KNOWN	basic	protein_coding	CNKSR1	HGNC	protein_coding	OTTHUMT00000089943.2	39	0.00	0	A	NM_006314		26508367	26508367	+1	no_errors	ENST00000374253	ensembl	human	known	69_37n	missense	41	16.33	8	SNP	1.000	C
CEP350	9857	genome.wustl.edu	37	1	180062936	180062936	+	Missense_Mutation	SNP	A	A	G	rs568617101		TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr1:180062936A>G	ENST00000367607.3	+	34	8114	c.7696A>G	c.(7696-7698)Att>Gtt	p.I2566V	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2566					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						AATATCTCACATTCCAGAAAA	0.328																																						dbGAP											0													55.0	61.0	59.0					1																	180062936		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.7696A>G	1.37:g.180062936A>G	ENSP00000356579:p.Ile2566Val		O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.I2566V	ENST00000367607.3	37	c.7696	CCDS1336.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.923|9.923	1.212777|1.212777	0.22289|0.22289	.|.	.|.	ENSG00000135837|ENSG00000135837	ENST00000429851|ENST00000367607;ENST00000417046	T|T;T	0.72942|0.74526	-0.7|-0.85;-0.85	5.72|5.72	3.25|3.25	0.37280|0.37280	.|Cytoskeleton-associated protein, Gly-rich domain (2);	.|0.000000	.|0.49916	.|D	.|0.000138	T|T	0.59770|0.59770	0.2218|0.2218	L|L	0.33245|0.33245	0.995|0.995	0.27143|0.27143	N|N	0.961599|0.961599	.|B;B	.|0.14438	.|0.01;0.01	.|B;B	.|0.19391	.|0.017;0.025	T|T	0.45673|0.45673	-0.9245|-0.9245	6|9	.|.	.|.	.|.	.|.	7.7184|7.7184	0.28719|0.28719	0.5939:0.2745:0.0:0.1316|0.5939:0.2745:0.0:0.1316	.|.	.|2566;2566	.|E7EU22;Q5VT06	.|.;CE350_HUMAN	R|V	740|2566;30	ENSP00000412460:H740R|ENSP00000356579:I2566V;ENSP00000401608:I30V	.|.	H|I	+|+	2|1	0|0	CEP350|CEP350	178329559|178329559	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.791000|0.791000	0.44710|0.44710	3.406000|3.406000	0.52637|0.52637	0.361000|0.361000	0.24292|0.24292	0.533000|0.533000	0.62120|0.62120	CAT|ATT	CEP350	-	superfamily_CAP-Gly_domain	ENSG00000135837		0.328	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	26	0.00	0	A	NM_014810		180062936	180062936	+1	no_errors	ENST00000367607	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	1.000	G
DOCK8	81704	genome.wustl.edu	37	9	390476	390476	+	Silent	SNP	C	C	T			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr9:390476C>T	ENST00000453981.1	+	24	2992	c.2880C>T	c.(2878-2880)ttC>ttT	p.F960F	DOCK8_ENST00000382331.1_Silent_p.F262F|DOCK8_ENST00000469391.1_Silent_p.F860F|DOCK8_ENST00000432829.2_Silent_p.F892F|DOCK8_ENST00000382329.1_Silent_p.F427F			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	960					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TTTAGCATTTCCATGAGGAGC	0.393																																						dbGAP											0													187.0	163.0	171.0					9																	390476		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.2880C>T	9.37:g.390476C>T			A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Silent	SNP	pfam_DOCK,pfam_DUF3398,superfamily_ARM-type_fold	p.F960	ENST00000453981.1	37	c.2880	CCDS6440.2	9																																																																																			DOCK8	-	NULL	ENSG00000107099		0.393	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	HGNC	protein_coding	OTTHUMT00000171792.5	99	0.00	0	C	XM_036307		390476	390476	+1	no_errors	ENST00000453981	ensembl	human	known	69_37n	silent	134	14.65	23	SNP	1.000	T
DSPP	1834	genome.wustl.edu	37	4	88537123	88537123	+	Silent	SNP	C	C	T	rs372453629	byFrequency	TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr4:88537123C>T	ENST00000282478.7	+	4	3342	c.3309C>T	c.(3307-3309)agC>agT	p.S1103S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1103S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1103	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcgacagcagcgacagcagcg	0.547													c|||	2714	0.541933	0.5439	0.6254	5008	,	,		13665	0.5903		0.5467	False		,,,				2504	0.4254					dbGAP											0													12.0	19.0	17.0					4																	88537123		1097	2123	3220	-	-	-	SO:0001819	synonymous_variant	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3309C>T	4.37:g.88537123C>T			A8MUI0|O95815	Silent	SNP	NULL	p.S1103	ENST00000282478.7	37	c.3309	CCDS43248.1	4																																																																																			DSPP	-	NULL	ENSG00000152591		0.547	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	12	0.00	0	C	NM_014208		88537123	88537123	+1	no_errors	ENST00000282478	ensembl	human	known	69_37n	silent	7	46.15	6	SNP	0.989	T
ESPNP	284729	genome.wustl.edu	37	1	17029281	17029281	+	RNA	SNP	G	G	C	rs137866947	byFrequency	TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr1:17029281G>C	ENST00000492551.1	-	0	1084					NR_026567.1				espin pseudogene																		TCCCACAGGAGGCTTGGGAGA	0.647													g|||	134	0.0267572	0.0144	0.0476	5008	,	,		12509	0.0		0.0547	False		,,,				2504	0.0276					dbGAP											0																																										-	-	-			0			AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17029281G>C				RNA	SNP	-	NULL	ENST00000492551.1	37	NULL		1																																																																																			ESPNP	-	-	ENSG00000116219		0.647	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	HGNC	pseudogene	OTTHUMT00000326311.1	10	0.00	0	G			17029281	17029281	-1	no_errors	ENST00000492551	ensembl	human	known	69_37n	rna	7	41.67	5	SNP	1.000	C
FAM166A	401565	genome.wustl.edu	37	9	140138642	140138642	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr9:140138642G>C	ENST00000344774.4	-	6	900	c.846C>G	c.(844-846)ttC>ttG	p.F282L		NM_001001710.1	NP_001001710.1	Q6J272	F166A_HUMAN	family with sequence similarity 166, member A	282						nucleus (GO:0005634)				kidney(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(2)	15						ACCCCATGTAGAAGGGGATCA	0.592																																						dbGAP											0													111.0	91.0	98.0					9																	140138642		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC132916	CCDS35186.1	9q34.3	2008-08-08			ENSG00000188163	ENSG00000188163			33818	protein-coding gene	gene with protein product							Standard	XR_245332		Approved		uc004cmi.1	Q6J272	OTTHUMG00000159545	ENST00000344774.4:c.846C>G	9.37:g.140138642G>C	ENSP00000344729:p.Phe282Leu		A6NND9|Q8N830	Missense_Mutation	SNP	pfam_UPF0573/UPF0605	p.F282L	ENST00000344774.4	37	c.846	CCDS35186.1	9	.	.	.	.	.	.	.	.	.	.	G	16.24	3.066457	0.55539	.	.	ENSG00000188163	ENST00000344774	.	.	.	4.99	4.99	0.66335	.	0.072447	0.56097	D	0.000030	T	0.72503	0.3468	M	0.65975	2.015	0.80722	D	1	D	0.61697	0.99	P	0.57620	0.824	T	0.70839	-0.4763	9	0.31617	T	0.26	-21.8862	16.0952	0.81114	0.0:0.0:1.0:0.0	.	282	Q6J272	F166A_HUMAN	L	282	.	ENSP00000344729:F282L	F	-	3	2	FAM166A	139258463	1.000000	0.71417	1.000000	0.80357	0.126000	0.20510	3.160000	0.50739	2.474000	0.83562	0.549000	0.68633	TTC	FAM166A	-	NULL	ENSG00000188163		0.592	FAM166A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM166A	HGNC	protein_coding	OTTHUMT00000356125.1	37	0.00	0	G	NM_001001710		140138642	140138642	-1	no_errors	ENST00000344774	ensembl	human	known	69_37n	missense	46	12.96	7	SNP	1.000	C
FAM171B	165215	genome.wustl.edu	37	2	187626600	187626600	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr2:187626600G>T	ENST00000304698.5	+	8	1734	c.1531G>T	c.(1531-1533)Gaa>Taa	p.E511*		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	511						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						TGCTCAAGATGAAAAGAGGTA	0.428																																						dbGAP											0													78.0	73.0	74.0					2																	187626600		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.1531G>T	2.37:g.187626600G>T	ENSP00000304108:p.Glu511*		Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Nonsense_Mutation	SNP	pfam_Uncharacterised_FAM171	p.E511*	ENST00000304698.5	37	c.1531	CCDS33347.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.777506	0.96929	.	.	ENSG00000144369	ENST00000304698	.	.	.	5.12	4.16	0.48862	.	0.533456	0.20758	N	0.086210	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-19.1491	6.388	0.21572	0.105:0.2564:0.6386:0.0	.	.	.	.	X	511	.	ENSP00000304108:E511X	E	+	1	0	FAM171B	187334845	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.806000	0.47947	2.627000	0.88993	0.655000	0.94253	GAA	FAM171B	-	pfam_Uncharacterised_FAM171	ENSG00000144369		0.428	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171B	HGNC	protein_coding	OTTHUMT00000334679.1	36	0.00	0	G	NM_177454		187626600	187626600	+1	no_errors	ENST00000304698	ensembl	human	known	69_37n	nonsense	33	36.54	19	SNP	1.000	T
SPATA31D5P	347127	genome.wustl.edu	37	9	84531130	84531130	+	RNA	SNP	C	C	G			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr9:84531130C>G	ENST00000527857.1	+	0	1152					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		TTTCCTTCCACTATTGCACCA	0.458																																						dbGAP											0																																										-	-	-			0					9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84531130C>G				RNA	SNP	-	NULL	ENST00000527857.1	37	NULL		9																																																																																			FAM75D5	-	-	ENSG00000240632		0.458	SPATA31D5P-002	KNOWN	basic	processed_transcript	FAM75D5	HGNC	pseudogene	OTTHUMT00000052810.2	46	0.00	0	C	NR_026851		84531130	84531130	+1	no_errors	ENST00000527857	ensembl	human	known	69_37n	rna	36	18.18	8	SNP	0.000	G
FAM83A	84985	genome.wustl.edu	37	8	124221764	124221764	+	3'UTR	SNP	G	G	A			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr8:124221764G>A	ENST00000518448.1	+	0	5155				FAM83A_ENST00000276699.6_3'UTR|FAM83A_ENST00000546351.1_Splice_Site|FAM83A_ENST00000522648.1_Splice_Site			Q86UY5	FA83A_HUMAN	family with sequence similarity 83, member A											breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(2)|skin(1)	17	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			TTGTTTCACAGCTGACGGCTG	0.428																																						dbGAP											0													79.0	66.0	70.0					8																	124221764		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC052300	CCDS6339.1, CCDS6340.1, CCDS75784.1	8q24.13	2014-03-13			ENSG00000147689	ENSG00000147689			28210	protein-coding gene	gene with protein product						22886303	Standard	XM_005251087		Approved	MGC14128, BJ-TSA-9	uc003ypx.3	Q86UY5	OTTHUMG00000165083	ENST00000518448.1:c.*1836G>A	8.37:g.124221764G>A			Q71HL2|Q8N7I1|Q96I47	Splice_Site	SNP	-	e4-1	ENST00000518448.1	37	c.875-1	CCDS6340.1	8	.	.	.	.	.	.	.	.	.	.	G	5.343	0.248610	0.10130	.	.	ENSG00000147689	ENST00000546351;ENST00000522648	.	.	.	3.0	-0.0856	0.13685	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.0392	0.19724	0.0:0.4347:0.3687:0.1966	.	.	.	.	.	-1	.	.	.	+	.	.	FAM83A	124290945	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.482000	0.06544	-0.022000	0.13986	0.491000	0.48974	.	FAM83A	-	-	ENSG00000147689		0.428	FAM83A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83A	HGNC	protein_coding	OTTHUMT00000381737.1	36	0.00	0	G	NM_032899		124221764	124221764	+1	no_errors	ENST00000522648	ensembl	human	known	69_37n	splice_site	45	34.78	24	SNP	0.000	A
FMO1	2326	genome.wustl.edu	37	1	171250104	171250104	+	Silent	SNP	C	C	T			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr1:171250104C>T	ENST00000354841.4	+	5	938	c.807C>T	c.(805-807)taC>taT	p.Y269Y	FMO1_ENST00000367750.3_Silent_p.Y269Y|FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000402921.2_Silent_p.Y206Y	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	269					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	ATGCAAATTACGGCTTAATAC	0.453																																						dbGAP											0													89.0	86.0	87.0					1																	171250104		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.807C>T	1.37:g.171250104C>T			A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Silent	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.Y269	ENST00000354841.4	37	c.807	CCDS1294.1	1																																																																																			FMO1	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase	ENSG00000010932		0.453	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO1	HGNC	protein_coding	OTTHUMT00000086212.1	42	0.00	0	C	NM_002021		171250104	171250104	+1	no_errors	ENST00000354841	ensembl	human	known	69_37n	silent	46	11.54	6	SNP	0.996	T
FREM3	166752	genome.wustl.edu	37	4	144545312	144545312	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr4:144545312C>T	ENST00000329798.5	-	4	5601	c.5602G>A	c.(5602-5604)Gta>Ata	p.V1868I		NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	1868					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						AACTCCAGTACAGCCATGAGA	0.438																																						dbGAP											0													193.0	166.0	174.0					4																	144545312		692	1591	2283	-	-	-	SO:0001583	missense	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.5602G>A	4.37:g.144545312C>T	ENSP00000332886:p.Val1868Ile			Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.V1868I	ENST00000329798.5	37	c.5602	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	C	11.57	1.677028	0.29783	.	.	ENSG00000183090	ENST00000329798	T	0.27890	1.64	4.27	4.27	0.50696	.	0.388490	0.22757	N	0.056019	T	0.38108	0.1028	L	0.53561	1.675	0.25822	N	0.984278	.	.	.	.	.	.	T	0.19712	-1.0297	8	0.23302	T	0.38	-0.7353	15.6064	0.76676	0.0:1.0:0.0:0.0	.	.	.	.	I	1868	ENSP00000332886:V1868I	ENSP00000332886:V1868I	V	-	1	0	FREM3	144764762	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	2.035000	0.41155	2.194000	0.70268	0.650000	0.86243	GTA	FREM3	-	NULL	ENSG00000183090		0.438	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	58	0.00	0	C	XM_094074		144545312	144545312	-1	no_errors	ENST00000329798	ensembl	human	putative	69_37n	missense	71	20.22	18	SNP	1.000	T
CMTR2	55783	genome.wustl.edu	37	16	71318994	71318994	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr16:71318994A>C	ENST00000338099.5	-	3	1166	c.830T>G	c.(829-831)tTt>tGt	p.F277C	CMTR2_ENST00000434935.2_Missense_Mutation_p.F277C			Q8IYT2	CMTR2_HUMAN	cap methyltransferase 2	277	Adrift-type SAM-dependent 2'-O-MTase. {ECO:0000255|PROSITE-ProRule:PRU00946}.				7-methylguanosine mRNA capping (GO:0006370)|cap2 mRNA methylation (GO:0097310)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)										AAACATAGTAAACATCTTTAG	0.398																																						dbGAP											0													79.0	81.0	80.0					16																	71318994		2198	4300	6498	-	-	-	SO:0001583	missense	0			BC035005	CCDS10898.1	16q22.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000180917	ENSG00000180917			25635	protein-coding gene	gene with protein product	"""adrift homolog (Drosophila)"""		"""FtsJ methyltransferase domain containing 1"""	FTSJD1		21310715	Standard	NM_018348		Approved	FLJ11171, AFT, MTr2	uc010cga.3	Q8IYT2	OTTHUMG00000137587	ENST00000338099.5:c.830T>G	16.37:g.71318994A>C	ENSP00000337512:p.Phe277Cys		B2RCD5|D3DWS1|Q8NE77|Q8NFR5|Q9H8Z4|Q9NUS3|Q9NXF5	Missense_Mutation	SNP	pfam_rRNA_MeTrfase_FtsJ_dom	p.F277C	ENST00000338099.5	37	c.830	CCDS10898.1	16	.	.	.	.	.	.	.	.	.	.	A	16.38	3.106592	0.56291	.	.	ENSG00000180917	ENST00000338099;ENST00000434935	T;T	0.38887	1.11;1.11	5.95	5.95	0.96441	Ribosomal RNA methyltransferase RrmJ/FtsJ (1);	0.000000	0.85682	D	0.000000	T	0.74435	0.3716	H	0.94462	3.54	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82246	-0.0552	10	0.87932	D	0	-1.0974	15.5864	0.76485	1.0:0.0:0.0:0.0	.	277	Q8IYT2	FTSJ1_HUMAN	C	277	ENSP00000337512:F277C;ENSP00000411148:F277C	ENSP00000337512:F277C	F	-	2	0	FTSJD1	69876495	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	8.962000	0.93254	2.279000	0.76181	0.402000	0.26972	TTT	FTSJD1	-	pfam_rRNA_MeTrfase_FtsJ_dom	ENSG00000180917		0.398	CMTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJD1	HGNC	protein_coding	OTTHUMT00000268984.2	20	0.00	0	A	NM_018348		71318994	71318994	-1	no_errors	ENST00000338099	ensembl	human	known	69_37n	missense	37	26.00	13	SNP	1.000	C
GCC2	9648	genome.wustl.edu	37	2	109086705	109086705	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr2:109086705C>A	ENST00000309863.6	+	6	1634	c.920C>A	c.(919-921)tCa>tAa	p.S307*		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	307					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						AAAGCCACCTCAAATGCAAAC	0.323																																						dbGAP											0													98.0	104.0	102.0					2																	109086705		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.920C>A	2.37:g.109086705C>A	ENSP00000307939:p.Ser307*		A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Nonsense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,smart_GRIP,pfscan_GRIP	p.S307*	ENST00000309863.6	37	c.920	CCDS33268.1	2	.	.	.	.	.	.	.	.	.	.	C	39	7.521393	0.98335	.	.	ENSG00000135968	ENST00000435553;ENST00000309863;ENST00000409896;ENST00000393318	.	.	.	5.31	4.19	0.49359	.	0.631659	0.15505	N	0.258820	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	.	3.9102	0.09199	0.0:0.6619:0.0:0.3381	.	.	.	.	X	307;307;270;52	.	ENSP00000307939:S307X	S	+	2	0	GCC2	108453137	0.005000	0.15991	0.528000	0.27938	0.822000	0.46500	0.807000	0.27140	2.638000	0.89438	0.467000	0.42956	TCA	GCC2	-	superfamily_tRNA-bd_arm	ENSG00000135968		0.323	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC2	HGNC	protein_coding	OTTHUMT00000358516.3	27	0.00	0	C	NM_014635		109086705	109086705	+1	no_errors	ENST00000309863	ensembl	human	known	69_37n	nonsense	26	23.53	8	SNP	0.671	A
GSTP1	2950	genome.wustl.edu	37	11	67352214	67352214	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr11:67352214C>G	ENST00000398606.3	+	4	452	c.203C>G	c.(202-204)aCc>aGc	p.T68S	GSTP1_ENST00000498765.1_3'UTR|GSTP1_ENST00000398603.1_Missense_Mutation_p.T68S	NM_000852.3	NP_000843.1	P09211	GSTP1_HUMAN	glutathione S-transferase pi 1	68	GST N-terminal.				cellular response to lipopolysaccharide (GO:0071222)|central nervous system development (GO:0007417)|common myeloid progenitor cell proliferation (GO:0035726)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biosynthetic process (GO:0009890)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of leukocyte proliferation (GO:0070664)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|nitric oxide storage (GO:0035732)|positive regulation of superoxide anion generation (GO:0032930)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of stress-activated MAPK cascade (GO:0032872)|response to reactive oxygen species (GO:0000302)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|TRAF2-GSTP1 complex (GO:0097057)|vesicle (GO:0031982)	dinitrosyl-iron complex binding (GO:0035731)|glutathione transferase activity (GO:0004364)|JUN kinase binding (GO:0008432)|kinase regulator activity (GO:0019207)|nitric oxide binding (GO:0070026)|S-nitrosoglutathione binding (GO:0035730)			central_nervous_system(1)|cervix(1)|endometrium(4)|lung(2)|ovary(1)	9					Busulfan(DB01008)|Carboplatin(DB00958)|Chlorambucil(DB00291)|Cisplatin(DB00515)|Clomipramine(DB01242)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	CAGTCCAATACCATCCTGCGT	0.607																																						dbGAP											0													92.0	102.0	99.0					11																	67352214		2016	4169	6185	-	-	-	SO:0001583	missense	0			U12472	CCDS41679.1	11q13.2	2014-09-17	2008-07-18		ENSG00000084207	ENSG00000084207	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4638	protein-coding gene	gene with protein product		134660		FAEES3, GST3		1885604, 7587384, 19915149	Standard	NM_000852		Approved	GSTP	uc001omf.3	P09211	OTTHUMG00000137430	ENST00000398606.3:c.203C>G	11.37:g.67352214C>G	ENSP00000381607:p.Thr68Ser		O00460|Q15690|Q5TZY3	Missense_Mutation	SNP	pfam_GST_C,pfam_Glutathione_S-Trfase_N,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_pi	p.T68S	ENST00000398606.3	37	c.203	CCDS41679.1	11	.	.	.	.	.	.	.	.	.	.	C	12.80	2.047298	0.36085	.	.	ENSG00000084207	ENST00000398606;ENST00000398603	T;T	0.06218	3.33;3.33	5.65	3.7	0.42460	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.261154	0.30771	N	0.008905	T	0.04543	0.0124	N	0.12853	0.265	0.23704	N	0.997065	B	0.06786	0.001	B	0.14023	0.01	T	0.13202	-1.0518	9	0.46703	T	0.11	-26.3316	12.8942	0.58089	0.0:0.6899:0.3101:0.0	.	68	P09211	GSTP1_HUMAN	S	68	ENSP00000381607:T68S;ENSP00000381604:T68S	ENSP00000381604:T68S	T	+	2	0	GSTP1	67108790	1.000000	0.71417	0.990000	0.47175	0.404000	0.30871	3.772000	0.55325	1.383000	0.46405	0.650000	0.86243	ACC	GSTP1	-	pfam_Glutathione_S-Trfase_N,superfamily_Thioredoxin-like_fold	ENSG00000084207		0.607	GSTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTP1	HGNC	protein_coding	OTTHUMT00000268504.1	15	0.00	0	C	NM_000852		67352214	67352214	+1	no_errors	ENST00000398606	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	1.000	G
GYG2	8908	genome.wustl.edu	37	X	2761348	2761348	+	Silent	SNP	G	G	A			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chrX:2761348G>A	ENST00000381163.3	+	4	477	c.195G>A	c.(193-195)acG>acA	p.T65T	GYG2_ENST00000398806.3_Silent_p.T34T|GYG2_ENST00000338623.5_Silent_p.T65T|GYG2_ENST00000542787.1_Silent_p.T65T|GYG2_ENST00000381161.1_Intron	NM_001079855.1|NM_001184702.1|NM_003918.2	NP_001073324.1|NP_001171631.1|NP_003909.2	O15488	GLYG2_HUMAN	glycogenin 2	65					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	glycogenin glucosyltransferase activity (GO:0008466)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ACAGGCTGACGAGGAAGCTGG	0.577																																						dbGAP											0													70.0	46.0	54.0					X																	2761348		2203	4294	6497	-	-	-	SO:0001819	synonymous_variant	0			U94361	CCDS14121.1, CCDS48074.1	Xp22.3	2013-02-22			ENSG00000056998	ENSG00000056998	2.4.1.186	"""Glycosyltransferase family 8 domain containing"""	4700	protein-coding gene	gene with protein product	"""glycogenin glucosyltransferase"""	300198				9857012	Standard	NM_001079855		Approved	GN-2	uc004cqs.1	O15488	OTTHUMG00000021079	ENST00000381163.3:c.195G>A	X.37:g.2761348G>A			B7WNN6|O15485|O15486|O15487|O15489|O15490	Silent	SNP	pfam_Glyco_trans_8	p.T65	ENST00000381163.3	37	c.195	CCDS14121.1	X																																																																																			GYG2	-	pfam_Glyco_trans_8	ENSG00000056998		0.577	GYG2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GYG2	HGNC	protein_coding	OTTHUMT00000055645.1	34	0.00	0	G	NM_003918		2761348	2761348	+1	no_errors	ENST00000381163	ensembl	human	known	69_37n	silent	44	11.76	6	SNP	0.908	A
HERC2P2	400322	genome.wustl.edu	37	15	23299924	23299924	+	RNA	SNP	C	C	T	rs201796824		TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr15:23299924C>T	ENST00000560464.1	-	0	4363									hect domain and RLD 2 pseudogene 2																		CCAGGCAAGCCGGACGCATTC	0.577																																						dbGAP											0																																										-	-	-			0			AF041080		15q11.2	2014-03-18			ENSG00000140181				4870	pseudogene	pseudogene						9730612	Standard	NR_002824		Approved	D15F37S3	uc001yvq.2		OTTHUMG00000171926		15.37:g.23299924C>T				RNA	SNP	-	NULL	ENST00000560464.1	37	NULL		15																																																																																			HERC2P2	-	-	ENSG00000140181		0.577	HERC2P2-001	KNOWN	basic	processed_transcript	HERC2P2	HGNC	pseudogene	OTTHUMT00000415936.1	16	0.00	0	C			23299924	23299924	-1	no_errors	ENST00000560464	ensembl	human	known	69_37n	rna	11	31.25	5	SNP	1.000	T
HERC2P2	400322	genome.wustl.edu	37	15	23299928	23299928	+	RNA	SNP	C	C	T	rs200546965		TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr15:23299928C>T	ENST00000560464.1	-	0	4359									hect domain and RLD 2 pseudogene 2																		GCAAGCCGGACGCATTCCCGG	0.572																																						dbGAP											0																																										-	-	-			0			AF041080		15q11.2	2014-03-18			ENSG00000140181				4870	pseudogene	pseudogene						9730612	Standard	NR_002824		Approved	D15F37S3	uc001yvq.2		OTTHUMG00000171926		15.37:g.23299928C>T				RNA	SNP	-	NULL	ENST00000560464.1	37	NULL		15																																																																																			HERC2P2	-	-	ENSG00000140181		0.572	HERC2P2-001	KNOWN	basic	processed_transcript	HERC2P2	HGNC	pseudogene	OTTHUMT00000415936.1	14	0.00	0	C			23299928	23299928	-1	no_errors	ENST00000560464	ensembl	human	known	69_37n	rna	10	33.33	5	SNP	0.986	T
HLA-F	3134	genome.wustl.edu	37	6	29692856	29692856	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr6:29692856C>T	ENST00000376861.1	+	5	1043	c.659C>T	c.(658-660)gCc>gTc	p.A220V	HLA-F_ENST00000440587.2_Missense_Mutation_p.A102V|HLA-F_ENST00000259951.7_Missense_Mutation_p.A220V|HLA-F_ENST00000434407.2_Intron|HLA-F_ENST00000334668.4_Missense_Mutation_p.A220V			P30511	HLAF_HUMAN	major histocompatibility complex, class I, F	220	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						GACCATGAGGCCACCCTGAGG	0.592																																						dbGAP											0													56.0	55.0	55.0					6																	29692856		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY253269	CCDS43437.1, CCDS43438.1, CCDS43439.1	6p21.3	2013-01-11			ENSG00000204642	ENSG00000204642		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4963	protein-coding gene	gene with protein product		143110				1688605	Standard	NM_018950		Approved		uc003nno.4	P30511	OTTHUMG00000031156	ENST00000376861.1:c.659C>T	6.37:g.29692856C>T	ENSP00000366057:p.Ala220Val		Q5JQI8|Q5JQJ1|Q5SPT5|Q860R0|Q8MGQ1|Q8WLP5|Q95HC0|Q9TP68	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.A220V	ENST00000376861.1	37	c.659	CCDS43438.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	17.74|17.74	3.464606|3.464606	0.63513|0.63513	.|.	.|.	ENSG00000204642|ENSG00000204642	ENST00000376861;ENST00000449921;ENST00000334668;ENST00000259951;ENST00000399258;ENST00000440587|ENST00000429294	T;T;T;T|.	0.02863|.	4.13;4.13;4.13;4.13|.	1.92|1.92	-3.07|-3.07	0.05363|0.05363	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);|.	0.719528|.	0.11038|.	U|.	0.606444|.	T|T	0.02012|0.02012	0.0063|0.0063	N|N	0.01297|0.01297	-0.9|-0.9	0.20489|0.20489	N|N	0.999898|0.999898	D;B;B|.	0.89917|.	1.0;0.001;0.02|.	D;B;B|.	0.87578|.	0.998;0.0;0.0|.	T|T	0.43475|0.43475	-0.9389|-0.9389	10|5	0.87932|.	D|.	0|.	.|.	5.3485|5.3485	0.16022|0.16022	0.0:0.4427:0.0:0.5573|0.0:0.4427:0.0:0.5573	.|.	220;220;220|.	A8MVU7;P30511;P30511-3|.	.;HLAF_HUMAN;.|.	V|S	220;197;220;220;134;102|99	ENSP00000366057:A220V;ENSP00000334263:A220V;ENSP00000259951:A220V;ENSP00000404130:A102V|.	ENSP00000259951:A220V|.	A|P	+|+	2|1	0|0	HLA-F|HLA-F	29800835|29800835	0.683000|0.683000	0.27633|0.27633	0.641000|0.641000	0.29422|0.29422	0.963000|0.963000	0.63663|0.63663	-0.205000|-0.205000	0.09411|0.09411	-0.855000|-0.855000	0.04125|0.04125	0.436000|0.436000	0.28706|0.28706	GCC|CCA	HLA-F	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000204642		0.592	HLA-F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-F	HGNC	protein_coding	OTTHUMT00000195083.1	43	0.00	0	C	NM_018950		29692856	29692856	+1	no_errors	ENST00000259951	ensembl	human	known	69_37n	missense	46	31.88	22	SNP	0.857	T
IGLC3	3539	genome.wustl.edu	37	22	23248691	23248691	+	RNA	SNP	C	C	T	rs555279361		TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr22:23248691C>T	ENST00000390325.2	+	0	180				IGLJ3_ENST00000390324.2_RNA			P0CG06	LAC3_HUMAN	immunoglobulin lambda constant 3 (Kern-Oz+ marker)						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										ACCCTCCAAACAAAGCAACAA	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		25221	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													70.0	67.0	68.0					22																	23248691		2201	4296	6497	-	-	-			0			J00254		22q11.2	2012-02-08			ENSG00000211679	ENSG00000211679		"""Immunoglobulins / IGL locus"""	5857	other	immunoglobulin gene				IGLC			Standard	NG_000002		Approved			P0CG06	OTTHUMG00000151217		22.37:g.23248691C>T			A0M8Q4|P80423	Silent	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.N60	ENST00000390325.2	37	c.180		22																																																																																			IGLC3	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000211679		0.592	IGLC3-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGLC3	HGNC	IG_C_gene	OTTHUMT00000321821.3	36	0.00	0	C	NG_000002		23248691	23248691	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390325	ensembl	human	known	69_37n	silent	34	15.00	6	SNP	0.993	T
IMPG1	3617	genome.wustl.edu	37	6	76728458	76728458	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr6:76728458G>T	ENST00000369950.3	-	7	973	c.784C>A	c.(784-786)Cta>Ata	p.L262I	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				TTTCCTGCTAGCTCCTGGTAA	0.552																																					Pancreas(37;839 1141 2599 26037)	dbGAP											0													149.0	138.0	141.0					6																	76728458		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.784C>A	6.37:g.76728458G>T	ENSP00000358966:p.Leu262Ile			Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.L262I	ENST00000369950.3	37	c.784	CCDS4985.1	6	.	.	.	.	.	.	.	.	.	.	G	18.89	3.720190	0.68844	.	.	ENSG00000112706	ENST00000369950	T	0.55413	0.52	6.17	2.42	0.29668	SEA (3);	0.257952	0.27155	N	0.020663	T	0.40272	0.1110	M	0.62266	1.93	0.80722	D	1	P	0.50272	0.933	P	0.51833	0.681	T	0.27571	-1.0070	10	0.40728	T	0.16	.	5.6684	0.17709	0.2279:0.3141:0.4581:0.0	.	262	Q17R60	IMPG1_HUMAN	I	262	ENSP00000358966:L262I	ENSP00000358966:L262I	L	-	1	2	IMPG1	76785178	0.989000	0.36119	0.777000	0.31699	0.985000	0.73830	0.841000	0.27613	0.161000	0.19458	0.655000	0.94253	CTA	IMPG1	-	pfam_SEA,smart_SEA,pfscan_SEA	ENSG00000112706		0.552	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG1	HGNC	protein_coding	OTTHUMT00000041288.1	45	0.00	0	G	NM_001563		76728458	76728458	-1	no_errors	ENST00000369950	ensembl	human	known	69_37n	missense	51	13.56	8	SNP	0.872	T
KIF2A	3796	genome.wustl.edu	37	5	61642964	61642964	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr5:61642964A>G	ENST00000401507.3	+	2	383	c.72A>G	c.(70-72)atA>atG	p.I24M	KIF2A_ENST00000506857.1_5'UTR|KIF2A_ENST00000509663.2_Intron|KIF2A_ENST00000407818.3_Missense_Mutation_p.I24M|KIF2A_ENST00000381103.2_Missense_Mutation_p.I4M	NM_001243953.1|NM_004520.4	NP_001230882.1|NP_004511.2	O00139	KIF2A_HUMAN	kinesin heavy chain member 2A	24	Globular. {ECO:0000255}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|nervous system development (GO:0007399)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	15		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		TAGGCCGAATACATCAAGCAA	0.313																																						dbGAP											0													94.0	86.0	89.0					5																	61642964		2203	4298	6501	-	-	-	SO:0001583	missense	0			BC031828	CCDS3980.2, CCDS47216.1, CCDS58949.1	5q12-q13	2008-02-05	2006-09-26	2006-09-26	ENSG00000068796	ENSG00000068796		"""Kinesins"""	6318	protein-coding gene	gene with protein product		602591	"""kinesin heavy chain member 2"""	KIF2		9177777	Standard	NM_001098511		Approved	HK2	uc003jsz.4	O00139	OTTHUMG00000097755	ENST00000401507.3:c.72A>G	5.37:g.61642964A>G	ENSP00000385622:p.Ile24Met		A5YM42|A5YM54|B4DY54|D3DW97|E9PB70|Q7Z5I3|Q8N5Q7	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.I24M	ENST00000401507.3	37	c.72	CCDS3980.2	5	.	.	.	.	.	.	.	.	.	.	A	17.39	3.378837	0.61735	.	.	ENSG00000068796	ENST00000401507;ENST00000381103;ENST00000514082;ENST00000407818	T;T;T;T	0.78595	-1.04;-1.03;1.55;-1.19	5.54	4.36	0.52297	.	0.000000	0.85682	D	0.000000	D	0.85212	0.5645	M	0.71581	2.175	0.80722	D	1	D;D;D;D	0.89917	0.97;0.983;1.0;0.97	P;P;D;P	0.73708	0.77;0.885;0.981;0.77	D	0.85034	0.0919	10	0.66056	D	0.02	.	9.7048	0.40209	0.6143:0.0:0.0:0.3857	.	24;24;24;4	B4DM85;O00139-4;O00139;E9PB70	.;.;KIF2A_HUMAN;.	M	24;4;24;24	ENSP00000385622:I24M;ENSP00000370493:I4M;ENSP00000423542:I24M;ENSP00000385000:I24M	ENSP00000370493:I4M	I	+	3	3	KIF2A	61678721	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.740000	0.55082	0.914000	0.36822	-0.468000	0.05107	ATA	KIF2A	-	NULL	ENSG00000068796		0.313	KIF2A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2A	HGNC	protein_coding	OTTHUMT00000317989.1	57	0.00	0	A	NM_004520		61642964	61642964	+1	no_errors	ENST00000407818	ensembl	human	known	69_37n	missense	28	33.33	14	SNP	1.000	G
KIF5C	3800	genome.wustl.edu	37	2	149868144	149868144	+	Missense_Mutation	SNP	G	G	T	rs533785428		TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr2:149868144G>T	ENST00000435030.1	+	25	3196	c.2828G>T	c.(2827-2829)cGa>cTa	p.R943L	KIF5C_ENST00000464066.1_3'UTR|KIF5C_ENST00000414838.2_Missense_Mutation_p.R848L|KIF5C_ENST00000397413.1_Missense_Mutation_p.R711L			O60282	KIF5C_HUMAN	kinesin family member 5C	943	Globular.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		CATGCCATTCGAGGGGGAGGA	0.517																																						dbGAP											0													61.0	64.0	63.0					2																	149868144		1899	4118	6017	-	-	-	SO:0001583	missense	0			AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.2828G>T	2.37:g.149868144G>T	ENSP00000393379:p.Arg943Leu		O95079|Q2YDC5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R943L	ENST00000435030.1	37	c.2828		2	.	.	.	.	.	.	.	.	.	.	G	33	5.275116	0.95459	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436;ENST00000397413	T;D;D	0.82433	-1.27;-1.61;-1.58	5.98	5.98	0.97165	.	0.000000	0.64402	D	0.000011	D	0.88991	0.6588	.	.	.	0.58432	D	0.999998	P;D	0.60160	0.792;0.987	B;P	0.55749	0.222;0.783	D	0.87468	0.2412	8	.	.	.	.	20.4293	0.99080	0.0:0.0:1.0:0.0	.	943;251	O60282;Q59GB8	KIF5C_HUMAN;.	L	943;848;846;711	ENSP00000393379:R943L;ENSP00000410115:R848L;ENSP00000380560:R711L	.	R	+	2	0	KIF5C	149576390	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.472000	0.97709	2.833000	0.97629	0.655000	0.94253	CGA	KIF5C	-	NULL	ENSG00000168280		0.517	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	KIF5C	HGNC	protein_coding	OTTHUMT00000332562.3	27	0.00	0	G	NM_004522		149868144	149868144	+1	no_errors	ENST00000435030	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	1.000	T
KIFC1	3833	genome.wustl.edu	37	6	33371565	33371565	+	Silent	SNP	T	T	C			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr6:33371565T>C	ENST00000428849.2	+	6	865	c.415T>C	c.(415-417)Tta>Cta	p.L139L	KIFC1_ENST00000486695.1_3'UTR	NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	139					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						AGCCTGGGACTTAAAGGGTCA	0.502																																						dbGAP											0													73.0	71.0	72.0					6																	33371565		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.415T>C	6.37:g.33371565T>C			O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L139	ENST00000428849.2	37	c.415	CCDS34430.1	6																																																																																			KIFC1	-	NULL	ENSG00000237649		0.502	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFC1	HGNC	protein_coding	OTTHUMT00000076417.1	19	0.00	0	T	NM_002263		33371565	33371565	+1	no_errors	ENST00000428849	ensembl	human	known	69_37n	silent	15	34.78	8	SNP	0.830	C
KIF6	221458	genome.wustl.edu	37	6	39507890	39507890	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr6:39507890G>A	ENST00000287152.7	-	13	1628	c.1534C>T	c.(1534-1536)Cgc>Tgc	p.R512C	KIF6_ENST00000373213.4_Missense_Mutation_p.R351C|KIF6_ENST00000538893.1_Intron|KIF6_ENST00000373216.3_Missense_Mutation_p.R512C|KIF6_ENST00000373215.3_Missense_Mutation_p.R512C	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	512			R -> H (in dbSNP:rs2273063).		ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TTTCCTAGGCGGAAGGGTGGG	0.498																																						dbGAP											0													192.0	195.0	194.0					6																	39507890		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.1534C>T	6.37:g.39507890G>A	ENSP00000287152:p.Arg512Cys		Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R512C	ENST00000287152.7	37	c.1534	CCDS4844.1	6	.	.	.	.	.	.	.	.	.	.	G	12.91	2.078949	0.36662	.	.	ENSG00000164627	ENST00000287152;ENST00000373216;ENST00000373213;ENST00000373215	T;T;T;T	0.72167	-0.61;-0.62;-0.45;-0.63	6.04	2.62	0.31277	.	.	.	.	.	T	0.31949	0.0813	N	0.19112	0.55	0.09310	N	1	P;P;P	0.50443	0.61;0.935;0.476	B;B;B	0.40782	0.235;0.34;0.118	T	0.19679	-1.0298	9	0.56958	D	0.05	.	2.259	0.04062	0.1226:0.1801:0.495:0.2024	.	512;512;512	E7EUN7;Q6ZMV9-3;Q6ZMV9	.;.;KIF6_HUMAN	C	512;512;351;512	ENSP00000287152:R512C;ENSP00000362312:R512C;ENSP00000362309:R351C;ENSP00000362311:R512C	ENSP00000287152:R512C	R	-	1	0	KIF6	39615868	0.038000	0.19896	0.015000	0.15790	0.054000	0.15201	1.255000	0.32909	1.505000	0.48720	0.563000	0.77884	CGC	KIF6	-	NULL	ENSG00000164627		0.498	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF6	HGNC	protein_coding	OTTHUMT00000040455.2	80	0.00	0	G	NM_145027		39507890	39507890	-1	no_errors	ENST00000287152	ensembl	human	known	69_37n	missense	68	26.09	24	SNP	0.000	A
LILRA1	11024	genome.wustl.edu	37	19	55106797	55106797	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr19:55106797C>A	ENST00000251372.3	+	5	773	c.591C>A	c.(589-591)tgC>tgA	p.C197*	LILRB1_ENST00000396321.2_Intron|LILRA1_ENST00000453777.1_Nonsense_Mutation_p.C197*|LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	197	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)	p.C197*(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		CGTACAGGTGCTATGCTTATG	0.582																																						dbGAP											1	Substitution - Nonsense(1)	large_intestine(1)											165.0	169.0	168.0					19																	55106797		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.591C>A	19.37:g.55106797C>A	ENSP00000251372:p.Cys197*		O75018|Q3MJA6	Nonsense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	p.C197*	ENST00000251372.3	37	c.591	CCDS12901.1	19	.	.	.	.	.	.	.	.	.	.	C	18.63	3.665467	0.67700	.	.	ENSG00000104974	ENST00000251372;ENST00000453777	.	.	.	2.24	0.774	0.18521	.	0.000000	0.53938	D	0.000044	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.2096	0.10505	0.0:0.6407:0.0:0.3593	.	.	.	.	X	197	.	ENSP00000251372:C197X	C	+	3	2	LILRA1	59798609	0.244000	0.23889	0.024000	0.17045	0.024000	0.10985	0.456000	0.21859	0.027000	0.15297	0.194000	0.17425	TGC	LILRA1	-	smart_Ig_sub,pirsf_A1B_glyco/leuk_Ig-like_rcpt	ENSG00000104974		0.582	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA1	HGNC	protein_coding	OTTHUMT00000140807.2	83	0.00	0	C	NM_006863		55106797	55106797	+1	no_errors	ENST00000251372	ensembl	human	known	69_37n	nonsense	79	28.83	32	SNP	0.137	A
LRRC8C	84230	genome.wustl.edu	37	1	90180366	90180366	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr1:90180366C>A	ENST00000370454.4	+	3	2492	c.2237C>A	c.(2236-2238)cCg>cAg	p.P746Q	RP11-302M6.4_ENST00000370453.5_Intron|LRRC8C_ENST00000479252.1_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	746					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.P746L(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		GTACTTTCACCGAAAATTGGA	0.393																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											71.0	73.0	72.0					1																	90180366		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.2237C>A	1.37:g.90180366C>A	ENSP00000359483:p.Pro746Gln		B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.P746Q	ENST00000370454.4	37	c.2237	CCDS725.1	1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.431963	0.62844	.	.	ENSG00000171488	ENST00000370454	T	0.26957	1.7	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.33235	0.0856	L	0.54863	1.705	0.80722	D	1	D	0.60160	0.987	P	0.53760	0.734	T	0.01512	-1.1336	10	0.56958	D	0.05	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	746	Q8TDW0	LRC8C_HUMAN	Q	746	ENSP00000359483:P746Q	ENSP00000359483:P746Q	P	+	2	0	LRRC8C	89952954	1.000000	0.71417	0.957000	0.39632	0.993000	0.82548	7.445000	0.80570	2.941000	0.99782	0.655000	0.94253	CCG	LRRC8C	-	NULL	ENSG00000171488		0.393	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8C	HGNC	protein_coding	OTTHUMT00000028435.2	41	0.00	0	C	NM_032270		90180366	90180366	+1	no_errors	ENST00000370454	ensembl	human	known	69_37n	missense	40	27.27	15	SNP	1.000	A
MYO16	23026	genome.wustl.edu	37	13	109496701	109496701	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr13:109496701G>C	ENST00000357550.2	+	9	1083	c.1042G>C	c.(1042-1044)Gtg>Ctg	p.V348L	MYO16_ENST00000356711.2_Missense_Mutation_p.V348L|MYO16_ENST00000251041.5_Missense_Mutation_p.V348L	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CAGTCCCCTGGTGTTACCAAT	0.383																																						dbGAP											0													86.0	81.0	83.0					13																	109496701		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.1042G>C	13.37:g.109496701G>C	ENSP00000350160:p.Val348Leu			Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V348L	ENST00000357550.2	37	c.1042	CCDS32008.1	13	.	.	.	.	.	.	.	.	.	.	G	17.08	3.297711	0.60086	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857	T;T;T	0.80304	-1.36;-1.36;-1.12	5.8	5.8	0.92144	.	0.431976	0.16537	U	0.210123	T	0.80177	0.4575	L	0.57536	1.79	0.80722	D	1	B;B	0.27498	0.18;0.129	B;B	0.29862	0.108;0.058	T	0.74191	-0.3745	9	.	.	.	.	19.0392	0.92991	0.0:0.0:1.0:0.0	.	348;348	Q9Y6X6-2;Q9Y6X6	.;MYO16_HUMAN	L	348;348;348;348;136	ENSP00000349145:V348L;ENSP00000350160:V348L;ENSP00000251041:V348L	.	V	+	1	0	MYO16	108294702	1.000000	0.71417	0.995000	0.50966	0.800000	0.45204	3.519000	0.53458	2.740000	0.93945	0.650000	0.86243	GTG	MYO16	-	NULL	ENSG00000041515		0.383	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	HGNC	protein_coding	OTTHUMT00000045746.1	39	0.00	0	G	NM_015011		109496701	109496701	+1	no_errors	ENST00000356711	ensembl	human	known	69_37n	missense	44	18.52	10	SNP	1.000	C
NCAPD3	23310	genome.wustl.edu	37	11	134090556	134090556	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr11:134090556T>A	ENST00000534548.2	-	2	193	c.129A>T	c.(127-129)gaA>gaT	p.E43D		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	43					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		TGATCTCTGCTTCTATGCTGG	0.423																																						dbGAP											0													205.0	177.0	186.0					11																	134090556		2201	4297	6498	-	-	-	SO:0001583	missense	0			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.129A>T	11.37:g.134090556T>A	ENSP00000433681:p.Glu43Asp		A6NFS2|Q4KMQ9	Missense_Mutation	SNP	superfamily_ARM-type_fold,pirsf_Condns_HCP-6	p.E43D	ENST00000534548.2	37	c.129	CCDS31723.1	11	.	.	.	.	.	.	.	.	.	.	T	18.29	3.592388	0.66219	.	.	ENSG00000151503	ENST00000534548;ENST00000525485	T	0.28069	1.63	5.56	3.18	0.36537	.	0.092585	0.64402	D	0.000001	T	0.36936	0.0985	M	0.63843	1.955	0.80722	D	1	D	0.54772	0.968	P	0.50896	0.653	T	0.05801	-1.0863	10	0.33141	T	0.24	-7.5644	9.158	0.37005	0.0:0.2939:0.0:0.7061	.	43	P42695	CNDD3_HUMAN	D	43	ENSP00000433681:E43D	ENSP00000436037:E43D	E	-	3	2	NCAPD3	133595766	0.681000	0.27614	1.000000	0.80357	0.870000	0.49936	-0.054000	0.11826	0.382000	0.24878	-0.408000	0.06270	GAA	NCAPD3	-	pirsf_Condns_HCP-6	ENSG00000151503		0.423	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD3	HGNC	protein_coding	OTTHUMT00000393575.2	43	0.00	0	T	NM_015261		134090556	134090556	-1	no_errors	ENST00000534548	ensembl	human	known	69_37n	missense	103	10.34	12	SNP	1.000	A
OR10K1	391109	genome.wustl.edu	37	1	158435435	158435435	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr1:158435435T>G	ENST00000289451.2	+	1	164	c.84T>G	c.(82-84)ttT>ttG	p.F28L		NM_001004473.1	NP_001004473.1	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K, member 1	28						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	27	all_hematologic(112;0.0378)					AGCTGCTCTTTGTTATCTTCC	0.502																																						dbGAP											0													118.0	101.0	107.0					1																	158435435		2203	4298	6501	-	-	-	SO:0001583	missense	0			AP002532	CCDS30897.1	1q23.1	2012-08-09			ENSG00000173285	ENSG00000173285		"""GPCR / Class A : Olfactory receptors"""	14693	protein-coding gene	gene with protein product							Standard	NM_001004473		Approved		uc010pij.2	Q8NGX5	OTTHUMG00000017517	ENST00000289451.2:c.84T>G	1.37:g.158435435T>G	ENSP00000289451:p.Phe28Leu		Q6IFS2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F28L	ENST00000289451.2	37	c.84	CCDS30897.1	1	.	.	.	.	.	.	.	.	.	.	t	16.09	3.023806	0.54683	.	.	ENSG00000173285	ENST00000289451	T	0.04454	3.62	4.26	-3.78	0.04333	.	0.000000	0.39210	U	0.001429	T	0.08980	0.0222	M	0.82517	2.595	0.09310	N	1	D	0.76494	0.999	D	0.75484	0.986	T	0.00759	-1.1578	10	0.72032	D	0.01	.	11.8729	0.52531	0.0:0.5202:0.0:0.4798	.	28	Q8NGX5	O10K1_HUMAN	L	28	ENSP00000289451:F28L	ENSP00000289451:F28L	F	+	3	2	OR10K1	156702059	0.000000	0.05858	0.007000	0.13788	0.816000	0.46133	-2.119000	0.01324	-1.042000	0.03262	-0.379000	0.06801	TTT	OR10K1	-	prints_7TM_GPCR_Rhodpsn	ENSG00000173285		0.502	OR10K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10K1	HGNC	protein_coding	OTTHUMT00000046367.1	36	0.00	0	T			158435435	158435435	+1	no_errors	ENST00000289451	ensembl	human	known	69_37n	missense	51	21.54	14	SNP	0.008	G
OTOP2	92736	genome.wustl.edu	37	17	72920980	72920980	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr17:72920980G>A	ENST00000580223.1	+	1	283	c.253G>A	c.(253-255)Gtg>Atg	p.V85M	OTOP2_ENST00000331427.4_Missense_Mutation_p.V85M|USH1G_ENST00000319642.1_5'Flank			Q7RTS6	OTOP2_HUMAN	otopetrin 2	85						integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					CCTCCGAACCGTGCGCTGCCC	0.662																																						dbGAP											0													46.0	27.0	33.0					17																	72920980		2202	4296	6498	-	-	-	SO:0001583	missense	0			BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.253G>A	17.37:g.72920980G>A	ENSP00000463837:p.Val85Met			Missense_Mutation	SNP	pfam_Otopetrin	p.V85M	ENST00000580223.1	37	c.253	CCDS11708.1	17	.	.	.	.	.	.	.	.	.	.	G	7.548	0.662014	0.14645	.	.	ENSG00000183034	ENST00000331427	T	0.09630	2.96	4.12	1.94	0.25998	.	0.856680	0.10278	N	0.693909	T	0.04227	0.0117	N	0.08118	0	0.09310	N	0.999994	D	0.56287	0.975	B	0.34722	0.188	T	0.35525	-0.9785	10	0.33940	T	0.23	-8.8185	7.6192	0.28175	0.0:0.1222:0.4718:0.4059	.	85	Q7RTS6	OTOP2_HUMAN	M	85	ENSP00000332528:V85M	ENSP00000332528:V85M	V	+	1	0	OTOP2	70432575	0.001000	0.12720	0.025000	0.17156	0.014000	0.08584	0.383000	0.20651	0.920000	0.36970	-0.315000	0.08773	GTG	OTOP2	-	NULL	ENSG00000183034		0.662	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP2	HGNC	protein_coding	OTTHUMT00000445306.1	9	0.00	0	G	NM_178160		72920980	72920980	+1	no_errors	ENST00000331427	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	0.657	A
PANX3	116337	genome.wustl.edu	37	11	124489712	124489712	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr11:124489712G>C	ENST00000284288.2	+	4	1127	c.1060G>C	c.(1060-1062)Gat>Cat	p.D354H		NM_052959.2	NP_443191.1	Q96QZ0	PANX3_HUMAN	pannexin 3	354					cell-cell signaling (GO:0007267)|ion transport (GO:0006811)|protein hexamerization (GO:0034214)|transmembrane transport (GO:0055085)	gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|urinary_tract(1)	26	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		TGTGTTGAAGGATACAACCAC	0.438																																						dbGAP											0													150.0	130.0	137.0					11																	124489712		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF406650	CCDS8447.1	11q24.2	2011-12-02			ENSG00000154143	ENSG00000154143		"""Ion channels / Pannexins"""	20573	protein-coding gene	gene with protein product		608422					Standard	NM_052959		Approved	Px3	uc001qah.3	Q96QZ0	OTTHUMG00000165925	ENST00000284288.2:c.1060G>C	11.37:g.124489712G>C	ENSP00000284288:p.Asp354His			Missense_Mutation	SNP	pfam_Innexin,pfscan_Innexin	p.D354H	ENST00000284288.2	37	c.1060	CCDS8447.1	11	.	.	.	.	.	.	.	.	.	.	G	18.12	3.552072	0.65311	.	.	ENSG00000154143	ENST00000284288	T	0.18338	2.22	5.4	5.4	0.78164	.	0.387677	0.27189	N	0.020511	T	0.26810	0.0656	L	0.36672	1.1	0.42183	D	0.991699	D	0.65815	0.995	P	0.54460	0.753	T	0.00726	-1.1592	10	0.31617	T	0.26	-17.1838	19.1781	0.93611	0.0:0.0:1.0:0.0	.	354	Q96QZ0	PANX3_HUMAN	H	354	ENSP00000284288:D354H	ENSP00000284288:D354H	D	+	1	0	PANX3	123994922	1.000000	0.71417	0.998000	0.56505	0.778000	0.44026	5.321000	0.65846	2.532000	0.85374	0.561000	0.74099	GAT	PANX3	-	pfscan_Innexin	ENSG00000154143		0.438	PANX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANX3	HGNC	protein_coding	OTTHUMT00000387064.1	41	0.00	0	G			124489712	124489712	+1	no_errors	ENST00000284288	ensembl	human	known	69_37n	missense	34	32.00	16	SNP	1.000	C
PLXNB3	5365	genome.wustl.edu	37	X	153040401	153040401	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chrX:153040401A>G	ENST00000361971.5	+	24	4112	c.3998A>G	c.(3997-3999)tAc>tGc	p.Y1333C	PLXNB3_ENST00000538966.1_Missense_Mutation_p.Y1356C|PLXNB3_ENST00000538282.1_Silent_p.L967L|SRPK3_ENST00000489426.1_5'Flank|PLXNB3_ENST00000538776.1_Missense_Mutation_p.Y986C	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1333					axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					TTCCTGGACTACCGCACCTAC	0.687																																						dbGAP											0													55.0	56.0	56.0					X																	153040401		2202	4292	6494	-	-	-	SO:0001583	missense	0			AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.3998A>G	X.37:g.153040401A>G	ENSP00000355378:p.Tyr1333Cys		B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.Y1356C	ENST00000361971.5	37	c.4067	CCDS14729.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.67|17.67	3.448047|3.448047	0.63178|0.63178	.|.	.|.	ENSG00000198753|ENSG00000198753	ENST00000411613|ENST00000538966;ENST00000361971;ENST00000538776	.|T;T;T	.|0.18810	.|2.19;2.19;2.19	5.21|5.21	5.21|5.21	0.72293|0.72293	.|Plexin, cytoplasmic RasGAP domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.54224|0.54224	0.1845|0.1845	M|M	0.91818|0.91818	3.245|3.245	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	T|T	0.65100|0.65100	-0.6250|-0.6250	5|10	.|0.87932	.|D	.|0	.|.	13.0556|13.0556	0.58977|0.58977	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|986;1356;1333	.|B7Z3H9;F5H773;Q9ULL4	.|.;.;PLXB3_HUMAN	A|C	39|1356;1333;986	.|ENSP00000442736:Y1356C;ENSP00000355378:Y1333C;ENSP00000445569:Y986C	.|ENSP00000355378:Y1333C	T|Y	+|+	1|2	0|0	PLXNB3|PLXNB3	152693595|152693595	1.000000|1.000000	0.71417|0.71417	0.969000|0.969000	0.41365|0.41365	0.422000|0.422000	0.31414|0.31414	7.293000|7.293000	0.78740|0.78740	1.723000|1.723000	0.51488|0.51488	0.430000|0.430000	0.28490|0.28490	ACC|TAC	PLXNB3	-	pfam_Plexin_cytoplasmic_RasGAP_dom	ENSG00000198753		0.687	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLXNB3	HGNC	protein_coding	OTTHUMT00000061063.1	8	0.00	0	A			153040401	153040401	+1	no_errors	ENST00000538966	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	0.998	G
PMPCA	23203	genome.wustl.edu	37	9	139313014	139313014	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr9:139313014A>C	ENST00000371717.3	+	9	1007	c.998A>C	c.(997-999)gAc>gCc	p.D333A	PMPCA_ENST00000462616.1_3'UTR|PMPCA_ENST00000399219.3_Missense_Mutation_p.D202A	NM_001282946.1|NM_015160.1	NP_001269875.1|NP_055975.1	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	333					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	14		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		CAGGAGGAGGACTTCATCCCC	0.637																																						dbGAP											0													76.0	68.0	70.0					9																	139313014		2203	4300	6503	-	-	-	SO:0001583	missense	0			D21064	CCDS35180.1, CCDS65192.1	9q34.3	2008-02-05	2003-06-13	2003-06-20	ENSG00000165688	ENSG00000165688			18667	protein-coding gene	gene with protein product		613036	"""inositol polyphosphate-5-phosphatase, 72 kD"""	INPP5E		8590280, 7788527	Standard	NM_015160		Approved	KIAA0123, Alpha-MPP	uc004chl.3	Q10713	OTTHUMG00000020926	ENST00000371717.3:c.998A>C	9.37:g.139313014A>C	ENSP00000360782:p.Asp333Ala		B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	p.D333A	ENST00000371717.3	37	c.998	CCDS35180.1	9	.	.	.	.	.	.	.	.	.	.	a	17.70	3.454419	0.63290	.	.	ENSG00000165688	ENST00000371717;ENST00000399219;ENST00000444897	T;T;T	0.38077	1.16;1.16;1.16	5.23	5.23	0.72850	Peptidase M16, C-terminal (1);Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.66489	0.2794	M	0.90145	3.09	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.79108	0.986;0.992;0.992;0.992	T	0.74802	-0.3541	10	0.87932	D	0	.	14.3064	0.66386	1.0:0.0:0.0:0.0	.	202;333;41;333	B4DKL3;Q5SXM9;Q5SXN9;Q10713	.;.;.;MPPA_HUMAN	A	333;202;41	ENSP00000360782:D333A;ENSP00000416702:D202A;ENSP00000408393:D41A	ENSP00000360782:D333A	D	+	2	0	PMPCA	138432835	1.000000	0.71417	0.336000	0.25522	0.223000	0.24884	9.033000	0.93741	1.981000	0.57761	0.454000	0.30748	GAC	PMPCA	-	pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	ENSG00000165688		0.637	PMPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMPCA	HGNC	protein_coding	OTTHUMT00000055054.1	23	0.00	0	A	NM_015160		139313014	139313014	+1	no_errors	ENST00000371717	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	0.999	C
POTEJ	653781	genome.wustl.edu	37	2	131414573	131414573	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr2:131414573A>C	ENST00000409602.1	+	15	2292	c.2240A>C	c.(2239-2241)aAg>aCg	p.K747T		NM_001277083.1	NP_001264012.1	P0CG39	POTEJ_HUMAN	POTE ankyrin domain family, member J	747	Actin-like.				retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				lung(5)	5						GACATGGAGAAGATCTGGCAC	0.612																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS59432.1	2q21.1	2013-01-10			ENSG00000222038	ENSG00000222038		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37094	protein-coding gene	gene with protein product						16364570	Standard	NM_001277083		Approved	POTE2beta	uc021vor.2	P0CG39	OTTHUMG00000154050	ENST00000409602.1:c.2240A>C	2.37:g.131414573A>C	ENSP00000387176:p.Lys747Thr			Missense_Mutation	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-like	p.K747T	ENST00000409602.1	37	c.2240	CCDS59432.1	2	.	.	.	.	.	.	.	.	.	.	.	10.67	1.414940	0.25465	.	.	ENSG00000222038	ENST00000409602	D	0.94966	-3.57	0.736	0.736	0.18307	.	.	.	.	.	D	0.96346	0.8808	M	0.93898	3.47	0.26220	N	0.979167	.	.	.	.	.	.	D	0.91304	0.5069	7	0.87932	D	0	.	5.3835	0.16204	0.9999:0.0:1.0E-4:0.0	.	.	.	.	T	747	ENSP00000387176:K747T	ENSP00000387176:K747T	K	+	2	0	POTEJ	131131043	1.000000	0.71417	0.188000	0.23233	0.190000	0.23558	6.230000	0.72301	0.115000	0.18071	0.113000	0.15668	AAG	POTEJ	-	pfam_Actin-like,smart_Actin-like	ENSG00000222038		0.612	POTEJ-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEJ	HGNC	protein_coding	OTTHUMT00000333665.1	22	0.00	0	A	XM_929706		131414573	131414573	+1	no_errors	ENST00000409602	ensembl	human	novel	69_37n	missense	24	31.43	11	SNP	1.000	C
SMC1B	27127	genome.wustl.edu	37	22	45802482	45802482	+	Silent	SNP	G	G	A			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr22:45802482G>A	ENST00000357450.4	-	4	473	c.474C>T	c.(472-474)atC>atT	p.I158I	SMC1B_ENST00000404354.3_Silent_p.I158I	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	158					meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		CTGAAGTGCTGATTTCCTCAA	0.318																																						dbGAP											0													80.0	72.0	74.0					22																	45802482		1798	4074	5872	-	-	-	SO:0001819	synonymous_variant	0			AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.474C>T	22.37:g.45802482G>A			A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Silent	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_t-SNARE,smart_SMC_hinge	p.I158	ENST00000357450.4	37	c.474	CCDS43027.1	22																																																																																			SMC1B	-	pfam_RecF/RecN/SMC	ENSG00000077935		0.318	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1B	HGNC	protein_coding	OTTHUMT00000322256.2	57	0.00	0	G	NM_148674		45802482	45802482	-1	no_errors	ENST00000357450	ensembl	human	known	69_37n	silent	99	15.25	18	SNP	1.000	A
SPTAN1	6709	genome.wustl.edu	37	9	131367318	131367318	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr9:131367318C>G	ENST00000372731.4	+	30	3835	c.3725C>G	c.(3724-3726)gCt>gGt	p.A1242G	SPTAN1_ENST00000358161.5_Missense_Mutation_p.A1242G|SPTAN1_ENST00000372739.3_Missense_Mutation_p.A1242G	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1242					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						TTTAGAGATGCTGATGAAACC	0.368																																					NSCLC(120;833 1744 2558 35612 37579)	dbGAP											0													79.0	71.0	74.0					9																	131367318		2203	4300	6503	-	-	-	SO:0001583	missense	0			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.3725C>G	9.37:g.131367318C>G	ENSP00000361816:p.Ala1242Gly		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_EF-hand,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,smart_EF_hand_Ca-bd,prints_Spectrin_alpha_SH3,prints_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain	p.A1242G	ENST00000372731.4	37	c.3725	CCDS6905.1	9	.	.	.	.	.	.	.	.	.	.	C	19.95	3.921927	0.73213	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.60040	0.22;0.22;0.22	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.76499	0.3996	M	0.66439	2.03	0.80722	D	1	D;D;D;D	0.63046	0.992;0.959;0.99;0.992	D;P;D;D	0.77004	0.983;0.679;0.98;0.989	T	0.77011	-0.2746	10	0.87932	D	0	.	20.2019	0.98263	0.0:1.0:0.0:0.0	.	1242;1222;1242;1242	A6NG51;Q13813-3;Q13813-2;Q13813	.;.;.;SPTA2_HUMAN	G	1242;1242;1242;1222	ENSP00000350882:A1242G;ENSP00000361816:A1242G;ENSP00000361824:A1242G	ENSP00000350882:A1242G	A	+	2	0	SPTAN1	130407139	1.000000	0.71417	0.982000	0.44146	0.849000	0.48306	7.487000	0.81328	2.776000	0.95493	0.655000	0.94253	GCT	SPTAN1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000197694		0.368	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	HGNC	protein_coding	OTTHUMT00000054472.1	22	0.00	0	C	NM_003127		131367318	131367318	+1	no_errors	ENST00000358161	ensembl	human	known	69_37n	missense	22	21.43	6	SNP	1.000	G
STARD10	10809	genome.wustl.edu	37	11	72468901	72468901	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr11:72468901C>T	ENST00000334805.6	-	5	1407	c.488G>A	c.(487-489)cGa>cAa	p.R163Q	STARD10_ENST00000538437.1_Intron|STARD10_ENST00000538536.1_Missense_Mutation_p.R117Q|STARD10_ENST00000545082.1_Missense_Mutation_p.R134Q|ARAP1_ENST00000359373.5_Intron|STARD10_ENST00000543304.1_Missense_Mutation_p.R163Q	NM_006645.2	NP_006636.2	Q9Y365	PCTL_HUMAN	StAR-related lipid transfer (START) domain containing 10	163	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				bile acid secretion (GO:0032782)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)	cytosol (GO:0005829)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|microvillus (GO:0005902)	lipid binding (GO:0008289)			endometrium(4)|large_intestine(1)|lung(2)|prostate(1)	8			BRCA - Breast invasive adenocarcinoma(5;7.08e-07)			GGACACAGCTCGGACCAAGTC	0.572																																						dbGAP											0													91.0	98.0	96.0					11																	72468901		1992	4176	6168	-	-	-	SO:0001583	missense	0			AF039696	CCDS41688.1	11q13	2011-09-12	2007-08-16	2003-02-07		ENSG00000214530		"""StAR-related lipid transfer (START) domain containing"""	10666	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 28"", ""START domain containing 10"""	SDCCAG28		9610721	Standard	NM_006645		Approved	NY-CO-28, CGI-52, PCTP2	uc001otb.3	Q9Y365		ENST00000334805.6:c.488G>A	11.37:g.72468901C>T	ENSP00000335247:p.Arg163Gln		O60532	Missense_Mutation	SNP	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd	p.R163Q	ENST00000334805.6	37	c.488	CCDS41688.1	11	.	.	.	.	.	.	.	.	.	.	C	33	5.259532	0.95368	.	.	ENSG00000214530	ENST00000537351;ENST00000543304;ENST00000334805;ENST00000538536;ENST00000545082;ENST00000544767;ENST00000537947;ENST00000536728;ENST00000542989	T;T;T;T;T;T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54	5.75	3.82	0.43975	Lipid-binding START (3);START-like domain (1);	0.000000	0.64402	U	0.000003	D	0.85965	0.5820	M	0.93763	3.455	0.49051	D	0.99974	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.87435	0.2391	10	0.87932	D	0	-28.0828	8.9176	0.35592	0.1479:0.7732:0.0:0.0789	.	117;163	F5GY11;Q9Y365	.;PCTL_HUMAN	Q	70;163;163;117;134;94;163;94;163	ENSP00000445708:R70Q;ENSP00000438792:R163Q;ENSP00000335247:R163Q;ENSP00000440016:R117Q;ENSP00000443548:R134Q;ENSP00000438357:R94Q;ENSP00000445657:R163Q;ENSP00000442414:R94Q;ENSP00000443597:R163Q	ENSP00000335247:R163Q	R	-	2	0	STARD10	72146549	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.049000	0.71053	1.432000	0.47375	0.655000	0.94253	CGA	STARD10	-	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd	ENSG00000214530		0.572	STARD10-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STARD10	HGNC	protein_coding	OTTHUMT00000397254.1	36	0.00	0	C			72468901	72468901	-1	no_errors	ENST00000334805	ensembl	human	known	69_37n	missense	47	21.31	13	SNP	1.000	T
STK10	6793	genome.wustl.edu	37	5	171533635	171533635	+	Silent	SNP	C	C	T			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr5:171533635C>T	ENST00000176763.5	-	6	1120	c.777G>A	c.(775-777)acG>acA	p.T259T		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	259	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ACTTAGAGGGCGTGAGCAGCG	0.662											OREG0017039	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													70.0	65.0	66.0					5																	171533635		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.777G>A	5.37:g.171533635C>T		1893	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Silent	SNP	pfam_PKK,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.T259	ENST00000176763.5	37	c.777	CCDS34290.1	5																																																																																			STK10	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000072786		0.662	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK10	HGNC	protein_coding	OTTHUMT00000372374.2	38	0.00	0	C	NM_005990		171533635	171533635	-1	no_errors	ENST00000176763	ensembl	human	known	69_37n	silent	22	36.84	14	SNP	0.364	T
TCF20	6942	genome.wustl.edu	37	22	42564676	42564676	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr22:42564676G>T	ENST00000359486.3	-	4	6002	c.5866C>A	c.(5866-5868)Cag>Aag	p.Q1956K	TCF20_ENST00000404876.1_Missense_Mutation_p.Q246K|TCF20_ENST00000335626.4_Intron	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1956					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						CGCTCCGACTGCTCTGTGCTG	0.657											OREG0026603	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													37.0	33.0	34.0					22																	42564676		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.5866C>A	22.37:g.42564676G>T	ENSP00000352463:p.Gln1956Lys	909	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	smart_Znf_PHD	p.Q1956K	ENST00000359486.3	37	c.5866	CCDS14033.1	22	.	.	.	.	.	.	.	.	.	.	G	33	5.272164	0.95429	.	.	ENSG00000100207	ENST00000359486;ENST00000404876	T;T	0.67345	0.09;-0.26	5.8	5.8	0.92144	.	0.000000	0.56097	D	0.000038	T	0.77136	0.4086	L	0.43152	1.355	0.58432	D	0.999995	P	0.49447	0.924	P	0.62298	0.9	T	0.77582	-0.2534	10	0.87932	D	0	-12.045	20.0467	0.97609	0.0:0.0:1.0:0.0	.	1956	Q9UGU0	TCF20_HUMAN	K	1956;246	ENSP00000352463:Q1956K;ENSP00000385531:Q246K	ENSP00000352463:Q1956K	Q	-	1	0	TCF20	40894620	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.374000	0.73132	2.749000	0.94314	0.655000	0.94253	CAG	TCF20	-	NULL	ENSG00000100207		0.657	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	HGNC	protein_coding	OTTHUMT00000320531.1	18	0.00	0	G	NM_181492		42564676	42564676	-1	no_errors	ENST00000359486	ensembl	human	known	69_37n	missense	23	30.30	10	SNP	1.000	T
TET2	54790	genome.wustl.edu	37	4	106155404	106155406	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr4:106155404_106155406delCTC	ENST00000540549.1	+	3	1165_1167	c.305_307delCTC	c.(304-309)tctctc>ttc	p.102_103SL>F	TET2_ENST00000513237.1_In_Frame_Del_p.123_124SL>F|TET2_ENST00000380013.4_In_Frame_Del_p.102_103SL>F|TET2_ENST00000545826.1_In_Frame_Del_p.102_103SL>F|TET2_ENST00000413648.2_In_Frame_Del_p.102_103SL>F|TET2_ENST00000394764.1_In_Frame_Del_p.102_103SL>F|TET2_ENST00000305737.2_In_Frame_Del_p.102_103SL>F			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	102					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		AGTGAACCTTCTCTCTCTGGGCT	0.424			"""Mis N, F"""		MDS																																	dbGAP		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0																																										-	-	-	SO:0001651	inframe_deletion	0			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.305_307delCTC	4.37:g.106155404_106155406delCTC	ENSP00000442788:p.Ser102_Leu103delinsPhe		B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	In_Frame_Del	DEL	NULL	p.SL102in_frame_delF	ENST00000540549.1	37	c.305_307	CCDS47120.1	4																																																																																			TET2	-	NULL	ENSG00000168769		0.424	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2	20	0.00	0	CTC	NM_017628		106155404	106155406	+1	no_errors	ENST00000380013	ensembl	human	known	69_37n	in_frame_del	18	21.74	5	DEL	1.000:1.000:1.000	-
TJP1	7082	genome.wustl.edu	37	15	30011076	30011076	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr15:30011076C>G	ENST00000346128.6	-	21	3744	c.3270G>C	c.(3268-3270)caG>caC	p.Q1090H	TJP1_ENST00000545208.2_Missense_Mutation_p.Q1010H|TJP1_ENST00000400011.2_Missense_Mutation_p.Q1014H|TJP1_ENST00000356107.6_Missense_Mutation_p.Q1090H	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1090					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		AATATGACCACTGTTCTTCAT	0.473																																					Melanoma(77;681 1843 6309 6570)	dbGAP											0													246.0	243.0	244.0					15																	30011076		2093	4209	6302	-	-	-	SO:0001583	missense	0				CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.3270G>C	15.37:g.30011076C>G	ENSP00000281537:p.Gln1090His		B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	pfam_PDZ,pfam_ZU5,pfam_Guanylate_kin,pfam_SH3_2,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_ZU5,pfscan_PDZ,pfscan_SH3_domain,pfscan_ZU5,pfscan_Guanylate_kin,prints_ZonOcculS1,prints_ZonOcculdens	p.Q1090H	ENST00000346128.6	37	c.3270	CCDS42007.1	15	.	.	.	.	.	.	.	.	.	.	C	11.22	1.574649	0.28092	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T	0.07216	3.21;3.26	6.06	-1.75	0.08031	.	0.167430	0.56097	N	0.000034	T	0.06917	0.0176	L	0.47716	1.5	0.80722	D	1	B;B;B;B	0.15930	0.0;0.015;0.001;0.002	B;B;B;B	0.13407	0.002;0.009;0.002;0.004	T	0.18840	-1.0324	10	0.49607	T	0.09	.	7.4352	0.27152	0.0:0.3939:0.2768:0.3293	.	1083;1010;1090;1014	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	H	1090;1014;1090;1010;1010	ENSP00000281537:Q1090H;ENSP00000382890:Q1014H	ENSP00000281537:Q1090H	Q	-	3	2	TJP1	27798368	1.000000	0.71417	0.984000	0.44739	0.485000	0.33311	0.733000	0.26087	-0.261000	0.09405	-0.793000	0.03317	CAG	TJP1	-	NULL	ENSG00000104067		0.473	TJP1-001	KNOWN	basic|CCDS	protein_coding	TJP1	HGNC	protein_coding	OTTHUMT00000268237.3	87	0.00	0	C	NM_003257		30011076	30011076	-1	no_errors	ENST00000346128	ensembl	human	known	69_37n	missense	61	35.11	33	SNP	0.990	G
TMPRSS11D	9407	genome.wustl.edu	37	4	68725377	68725377	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr4:68725377T>C	ENST00000283916.6	-	2	126	c.28A>G	c.(28-30)Act>Gct	p.T10A	UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11D_ENST00000545541.1_Intron|TMPRSS11D_ENST00000509584.1_Intron	NM_004262.2	NP_004253.1	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	10					proteolysis (GO:0006508)|respiratory gaseous exchange (GO:0007585)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						AATCTTGAAGTCGAAGTTACA	0.388																																						dbGAP											0													95.0	85.0	88.0					4																	68725377		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002134	CCDS3518.1	4q13.2	2010-04-13			ENSG00000153802	ENSG00000153802		"""Serine peptidases / Transmembrane"""	24059	protein-coding gene	gene with protein product	"""airway trypsin like protease"""	605369				9565616, 9070615	Standard	XM_005265710		Approved		uc003hdq.3	O60235	OTTHUMG00000129300	ENST00000283916.6:c.28A>G	4.37:g.68725377T>C	ENSP00000283916:p.Thr10Ala		Q08AF6	Missense_Mutation	SNP	pirsf_Pept_S1A_HAT/DESC1,pfam_Peptidase_S1_S6,pfam_SEA,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_SEA,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_SEA,pfscan_Peptidase_S1_S6	p.T10A	ENST00000283916.6	37	c.28	CCDS3518.1	4	.	.	.	.	.	.	.	.	.	.	T	1.133	-0.651925	0.03506	.	.	ENSG00000153802	ENST00000283916	D	0.87491	-2.26	5.19	-1.47	0.08772	.	1.051600	0.07439	N	0.896948	T	0.64405	0.2595	N	0.02011	-0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.53450	-0.8437	10	0.14656	T	0.56	.	5.7032	0.17893	0.0:0.486:0.1916:0.3224	.	10	O60235	TM11D_HUMAN	A	10	ENSP00000283916:T10A	ENSP00000283916:T10A	T	-	1	0	TMPRSS11D	68407972	0.000000	0.05858	0.000000	0.03702	0.165000	0.22458	-0.138000	0.10374	-0.121000	0.11787	0.460000	0.39030	ACT	TMPRSS11D	-	pirsf_Pept_S1A_HAT/DESC1	ENSG00000153802		0.388	TMPRSS11D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS11D	HGNC	protein_coding	OTTHUMT00000251430.3	24	0.00	0	T	NM_004262		68725377	68725377	-1	no_errors	ENST00000283916	ensembl	human	known	69_37n	missense	39	17.02	8	SNP	0.000	C
TMEM155	132332	genome.wustl.edu	37	4	122682813	122682813	+	Missense_Mutation	SNP	G	G	A	rs566239107		TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr4:122682813G>A	ENST00000337677.5	-	5	650	c.92C>T	c.(91-93)gCg>gTg	p.A31V	AC079341.1_ENST00000424958.1_5'Flank|TMEM155_ENST00000394396.1_Missense_Mutation_p.A31V|TMEM155_ENST00000394394.1_Missense_Mutation_p.A31V	NM_152399.2	NP_689612.2	Q4W5P6	TM155_HUMAN	transmembrane protein 155	31						extracellular region (GO:0005576)				breast(1)|lung(5)	6						CTGTAGAATCGCACCAGATGG	0.423													G|||	1	0.000199681	0.0	0.0	5008	,	,		16724	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													75.0	74.0	74.0					4																	122682813		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055396	CCDS3721.1	4q27	2008-02-05			ENSG00000164112	ENSG00000164112			26418	protein-coding gene	gene with protein product							Standard	NM_152399		Approved	FLJ30834	uc003idx.1	Q4W5P6	OTTHUMG00000133035	ENST00000337677.5:c.92C>T	4.37:g.122682813G>A	ENSP00000336987:p.Ala31Val		D3DNW9|Q96NI2	Missense_Mutation	SNP	NULL	p.A31V	ENST00000337677.5	37	c.92	CCDS3721.1	4	.	.	.	.	.	.	.	.	.	.	G	10.42	1.346109	0.24426	.	.	ENSG00000164112	ENST00000394396;ENST00000337677;ENST00000394394;ENST00000514885	T;T;T;T	0.57436	0.54;0.54;0.54;0.4	5.23	-1.09	0.09904	.	0.403409	0.18216	N	0.148047	T	0.22513	0.0543	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25572	-1.0128	10	0.87932	D	0	-0.4822	8.6103	0.33797	0.5243:0.0:0.4757:0.0	.	31	Q4W5P6	TM155_HUMAN	V	31	ENSP00000377919:A31V;ENSP00000336987:A31V;ENSP00000377917:A31V;ENSP00000422869:A31V	ENSP00000336987:A31V	A	-	2	0	TMEM155	122902263	0.034000	0.19679	0.097000	0.21041	0.994000	0.84299	-0.255000	0.08769	-0.047000	0.13423	-0.238000	0.12139	GCG	TMEM155	-	NULL	ENSG00000164112		0.423	TMEM155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM155	HGNC	protein_coding	OTTHUMT00000256637.2	41	0.00	0	G	NM_152399		122682813	122682813	-1	no_errors	ENST00000337677	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	0.062	A
TP53	7157	genome.wustl.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	GRCh37	CM941329	TP53	M							102.0	91.0	94.0					17																	7578263		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R196*	ENST00000269305.4	37	c.586	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	60	0.00	0	G	NM_000546		7578263	7578263	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	35	37.50	21	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179477304	179477304	+	Splice_Site	SNP	C	C	G			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr2:179477304C>G	ENST00000591111.1	-	216	45250		c.e216-1		TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342992.6_Splice_Site|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Splice_Site|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Splice_Site|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Splice_Site|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Splice_Site			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATGGAGGATCTGAAAAAGAA	0.393																																						dbGAP											0													80.0	69.0	72.0					2																	179477304		1902	4120	6022	-	-	-	SO:0001630	splice_region_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.45026-1G>C	2.37:g.179477304C>G			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Splice_Site	SNP	-	e214-1	ENST00000591111.1	37	c.42245-1		2	.	.	.	.	.	.	.	.	.	.	C	17.60	3.430601	0.62844	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.85	0.96736	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TTN	179185549	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	7.770000	0.85390	2.697000	0.92050	0.563000	0.77884	.	TTN	-	-	ENSG00000155657		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	80	0.00	0	C	NM_133378	Intron	179477304	179477304	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	splice_site	82	24.55	27	SNP	1.000	G
VPS13D	55187	genome.wustl.edu	37	1	12374322	12374322	+	Silent	SNP	C	C	A			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr1:12374322C>A	ENST00000358136.3	+	30	7216	c.7086C>A	c.(7084-7086)atC>atA	p.I2362I	VPS13D_ENST00000356315.4_Silent_p.I2362I	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TCAGCTGTATCTTTCAGCCCG	0.498																																						dbGAP											0													135.0	115.0	122.0					1																	12374322		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.7086C>A	1.37:g.12374322C>A				Missense_Mutation	SNP	pfam_VPSAP,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.S1185Y	ENST00000358136.3	37	c.3554	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	C	1.069	-0.670379	0.03403	.	.	ENSG00000048707	ENST00000011700	.	.	.	5.32	3.34	0.38264	.	.	.	.	.	T	0.58864	0.2152	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52756	-0.8533	4	.	.	.	.	9.3241	0.37982	0.1428:0.7791:0.0:0.0782	.	.	.	.	Y	1185	.	.	S	+	2	0	VPS13D	12296909	1.000000	0.71417	0.998000	0.56505	0.088000	0.18126	1.726000	0.38085	0.537000	0.28751	0.561000	0.74099	TCT	VPS13D	-	NULL	ENSG00000048707		0.498	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	51	0.00	0	C	NM_015378		12374322	12374322	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000011700	ensembl	human	novel	69_37n	missense	57	14.71	10	SNP	1.000	A
VSTM2A	222008	genome.wustl.edu	37	7	54610496	54610497	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr7:54610496_54610497delTC	ENST00000407838.3	+	1	479_480	c.73_74delTC	c.(73-75)tctfs	p.S25fs	VSTM2A_ENST00000302287.3_Frame_Shift_Del_p.S25fs|VSTM2A_ENST00000402613.3_Frame_Shift_Del_p.S25fs|VSTM2A_ENST00000402026.2_Frame_Shift_Del_p.S24fs|VSTM2A_ENST00000404951.1_Frame_Shift_Del_p.S25fs	NM_182546.2	NP_872352.2	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2A	25						extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(12)|prostate(1)	16			STAD - Stomach adenocarcinoma(5;0.0525)			AGGGCTTTCTTCTCAAGGTAAG	0.401																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC028404	CCDS5512.2, CCDS75604.1	7p11.2	2013-01-11	2007-08-10	2007-08-10	ENSG00000170419	ENSG00000170419		"""Immunoglobulin superfamily / V-set domain containing"""	28499	protein-coding gene	gene with protein product			"""V-set and transmembrane domain containing 2"""	VSTM2		12477932	Standard	XM_006715663		Approved	MGC33530	uc010kzf.3	Q8TAG5	OTTHUMG00000129271	ENST00000407838.3:c.73_74delTC	7.37:g.54610498_54610499delTC	ENSP00000384967:p.Ser25fs		A4D2E9|B5MC94	Frame_Shift_Del	DEL	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	p.Q25fs	ENST00000407838.3	37	c.70_71	CCDS5512.2	7																																																																																			VSTM2A	-	NULL	ENSG00000170419		0.401	VSTM2A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VSTM2A	HGNC	protein_coding	OTTHUMT00000318694.1	139	0.00	0	TC	NM_182546		54610496	54610497	+1	no_errors	ENST00000402026	ensembl	human	known	69_37n	frame_shift_del	154	17.28	33	DEL	1.000:1.000	-
ZNF263	10127	genome.wustl.edu	37	16	3336103	3336103	+	Silent	SNP	C	C	T			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chr16:3336103C>T	ENST00000219069.5	+	4	1599	c.723C>T	c.(721-723)ctC>ctT	p.L241L	ZNF263_ENST00000574253.1_Intron|ZNF263_ENST00000538765.1_Intron|ZNF263_ENST00000573578.1_3'UTR	NM_005741.4	NP_005732.2	O14978	ZN263_HUMAN	zinc finger protein 263	241	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(4)|urinary_tract(3)	20						AGAGGGCCCTCTCCAGGGACA	0.537																																						dbGAP											0													166.0	160.0	162.0					16																	3336103		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AC004232	CCDS10499.1	16p13.3	2013-01-09			ENSG00000006194	ENSG00000006194		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13056	protein-coding gene	gene with protein product		604191				9256059	Standard	NM_005741		Approved	FPM315, ZKSCAN12, ZSCAN44	uc002cuq.3	O14978	OTTHUMG00000129323	ENST00000219069.5:c.723C>T	16.37:g.3336103C>T			B2R634|O43387|Q96H95	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.L241	ENST00000219069.5	37	c.723	CCDS10499.1	16																																																																																			ZNF263	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000006194		0.537	ZNF263-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF263	HGNC	protein_coding	OTTHUMT00000251463.2	41	0.00	0	C			3336103	3336103	+1	no_errors	ENST00000219069	ensembl	human	known	69_37n	silent	55	17.91	12	SNP	0.828	T
ZNF81	347344	genome.wustl.edu	37	X	47774912	47774912	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chrX:47774912C>A	ENST00000376954.1	+	6	1235	c.867C>A	c.(865-867)ttC>ttA	p.F289L	ZNF81_ENST00000338637.7_Missense_Mutation_p.F289L			P51508	ZNF81_HUMAN	zinc finger protein 81	289					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				GGTCACATTTCTTTGCTCCTC	0.383																																						dbGAP											0													50.0	45.0	46.0					X																	47774912		1848	4084	5932	-	-	-	SO:0001583	missense	0			AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.867C>A	X.37:g.47774912C>A	ENSP00000366153:p.Phe289Leu		Q6RX22|Q96QH6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F289L	ENST00000376954.1	37	c.867	CCDS43933.1	X	.	.	.	.	.	.	.	.	.	.	C	0.001	-2.905542	0.00057	.	.	ENSG00000197779	ENST00000376954;ENST00000338637	T;T	0.07800	3.16;3.16	3.92	3.05	0.35203	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.734122	0.11239	N	0.584785	T	0.01627	0.0052	N	0.00355	-1.605	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44128	-0.9348	10	0.02654	T	1	.	4.6712	0.12691	0.0:0.6327:0.2418:0.1255	.	289	P51508	ZNF81_HUMAN	L	289	ENSP00000366153:F289L;ENSP00000341151:F289L	ENSP00000341151:F289L	F	+	3	2	ZNF81	47659856	0.000000	0.05858	0.082000	0.20525	0.303000	0.27691	-1.437000	0.02419	1.010000	0.39314	0.600000	0.82982	TTC	ZNF81	-	pfscan_Znf_C2H2	ENSG00000197779		0.383	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF81	HGNC	protein_coding	OTTHUMT00000056455.2	21	0.00	0	C	NM_007137		47774912	47774912	+1	no_errors	ENST00000338637	ensembl	human	known	69_37n	missense	23	23.33	7	SNP	0.004	A
ZNF75D	7626	genome.wustl.edu	37	X	134426226	134426226	+	Silent	SNP	G	G	T			TCGA-D8-A27M-01A-11D-A16D-09	TCGA-D8-A27M-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	cb9257f9-ca3f-4c14-a680-6632175dd526	d57d98db-8901-497c-b97e-1fc813a6d1ab	g.chrX:134426226G>T	ENST00000370766.3	-	4	3294	c.585C>A	c.(583-585)acC>acA	p.T195T	ZNF75D_ENST00000494295.1_Intron|ZNF75D_ENST00000370764.1_Intron	NM_007131.3	NP_009062.2	P51815	ZN75D_HUMAN	zinc finger protein 75D	195					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						ATACAGGCTGGGTTTCTTTGT	0.458																																						dbGAP											0													125.0	113.0	117.0					X																	134426226		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			S43109	CCDS14648.1, CCDS55503.1	Xq26	2013-01-09	2008-06-11	2008-06-11	ENSG00000186376	ENSG00000186376		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13145	protein-coding gene	gene with protein product		314997	"""zinc finger protein 75 (D8C6)"""	ZNF82, ZNF75		1505955	Standard	XM_005262469		Approved	ZKSCAN24, D8C6, ZSCAN28	uc004eyo.3	P51815	OTTHUMG00000022482	ENST00000370766.3:c.585C>A	X.37:g.134426226G>T			A6NK62|B3KRI7|Q5JPG0|Q6LDE0	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.T195	ENST00000370766.3	37	c.585	CCDS14648.1	X																																																																																			ZNF75D	-	NULL	ENSG00000186376		0.458	ZNF75D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF75D	HGNC	protein_coding	OTTHUMT00000058415.1	65	0.00	0	G	NM_007131		134426226	134426226	-1	no_errors	ENST00000370766	ensembl	human	known	69_37n	silent	103	13.45	16	SNP	0.029	T
