#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AGTPBP1	23287	genome.wustl.edu	37	9	88272487	88272487	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr9:88272487G>A	ENST00000357081.3	-	10	916	c.772C>T	c.(772-774)Cgc>Tgc	p.R258C	AGTPBP1_ENST00000376083.3_Missense_Mutation_p.R258C|AGTPBP1_ENST00000376081.4_Intron|AGTPBP1_ENST00000337006.4_Missense_Mutation_p.P187L|AGTPBP1_ENST00000432218.1_Missense_Mutation_p.R96C|AGTPBP1_ENST00000376080.1_Missense_Mutation_p.P187L|AGTPBP1_ENST00000491784.1_5'UTR|AGTPBP1_ENST00000376109.3_Missense_Mutation_p.R310C			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	258					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						TTATCATGGCGGTGCCAATCT	0.353																																						dbGAP											0													89.0	77.0	81.0					9																	88272487		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.772C>T	9.37:g.88272487G>A	ENSP00000349592:p.Arg258Cys		B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.R310C	ENST00000357081.3	37	c.928		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.138222|5.138222	0.94560|0.94560	.|.	.|.	ENSG00000135049|ENSG00000135049	ENST00000337006;ENST00000376080|ENST00000357081;ENST00000376083;ENST00000376109;ENST00000432218	.|T;T;T;T	.|0.49432	.|0.78;0.78;0.78;0.78	5.55|5.55	5.55|5.55	0.83447|0.83447	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.048620	.|0.85682	.|D	.|0.000000	T|T	0.69324|0.69324	0.3098|0.3098	M|M	0.66939|0.66939	2.045|2.045	0.50813|0.50813	D|D	0.99989|0.99989	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.87578	.|0.966;0.95;0.998;0.967	T|T	0.71467|0.71467	-0.4584|-0.4584	6|10	0.87932|0.87932	D|D	0|0	-9.2031|-9.2031	19.502|19.502	0.95098|0.95098	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|310;258;96;258	.|Q9UPW5-3;Q9UPW5;B4DHX2;Q9UPW5-2	.|.;CBPC1_HUMAN;.;.	L|C	187|258;258;310;96	.|ENSP00000349592:R258C;ENSP00000365251:R258C;ENSP00000365277:R310C;ENSP00000402804:R96C	ENSP00000338512:P187L|ENSP00000349592:R258C	P|R	-|-	2|1	0|0	AGTPBP1|AGTPBP1	87462307|87462307	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.328000|6.328000	0.72915|0.72915	2.600000|2.600000	0.87896|0.87896	0.650000|0.650000	0.86243|0.86243	CCG|CGC	AGTPBP1	-	superfamily_ARM-type_fold	ENSG00000135049		0.353	AGTPBP1-004	KNOWN	basic	protein_coding	AGTPBP1	HGNC	protein_coding	OTTHUMT00000052893.1	50	0.00	0	G	NM_015239		88272487	88272487	-1	no_errors	ENST00000376109	ensembl	human	known	69_37n	missense	26	25.71	9	SNP	1.000	A
ASAP2	8853	genome.wustl.edu	37	2	9467980	9467980	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr2:9467980A>G	ENST00000281419.3	+	7	966	c.626A>G	c.(625-627)aAg>aGg	p.K209R	ASAP2_ENST00000315273.4_Missense_Mutation_p.K209R	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	209					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						AACGAAATCAAGATTAAAAAG	0.348																																						dbGAP											0													120.0	116.0	118.0					2																	9467980		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.626A>G	2.37:g.9467980A>G	ENSP00000281419:p.Lys209Arg		D6W4Y8	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_ArfGAP,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP	p.K209R	ENST00000281419.3	37	c.626	CCDS1661.1	2	.	.	.	.	.	.	.	.	.	.	A	28.9	4.960502	0.92791	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.04454	3.62;3.62	5.13	5.13	0.70059	.	0.046396	0.85682	D	0.000000	T	0.18923	0.0454	M	0.72353	2.195	0.80722	D	1	D;D	0.67145	0.988;0.996	P;D	0.65140	0.736;0.932	T	0.00156	-1.1978	10	0.72032	D	0.01	.	15.0699	0.72026	1.0:0.0:0.0:0.0	.	209;209	O43150-2;O43150	.;ASAP2_HUMAN	R	209	ENSP00000281419:K209R;ENSP00000316404:K209R	ENSP00000281419:K209R	K	+	2	0	ASAP2	9385431	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.413000	0.90235	2.281000	0.76405	0.528000	0.53228	AAG	ASAP2	-	NULL	ENSG00000151693		0.348	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASAP2	HGNC	protein_coding	OTTHUMT00000237522.1	119	0.00	0	A	NM_003887		9467980	9467980	+1	no_errors	ENST00000281419	ensembl	human	known	69_37n	missense	112	10.40	13	SNP	1.000	G
CCKAR	886	genome.wustl.edu	37	4	26491823	26491823	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr4:26491823C>G	ENST00000295589.3	-	1	261	c.67G>C	c.(67-69)Gaa>Caa	p.E23Q		NM_000730.2	NP_000721.1	P32238	CCKAR_HUMAN	cholecystokinin A receptor	23					axonogenesis (GO:0007409)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|feeding behavior (GO:0007631)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cholecystokinin receptor activity (GO:0004951)			NS(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|pancreas(1)|skin(1)	29		Breast(46;0.0503)			Ceruletide(DB00403)	GTCTCATTTTCGAGCCCGAGT	0.483																																						dbGAP											0													115.0	97.0	103.0					4																	26491823		2203	4300	6503	-	-	-	SO:0001583	missense	0			L19315	CCDS3438.1	4p15.2	2013-09-20			ENSG00000163394	ENSG00000163394		"""GPCR / Class A : Cholecystokinin receptors"""	1570	protein-coding gene	gene with protein product		118444					Standard	NM_000730		Approved		uc003gse.1	P32238	OTTHUMG00000128567	ENST00000295589.3:c.67G>C	4.37:g.26491823C>G	ENSP00000295589:p.Glu23Gln		B2R9Z5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_CholecystokininA_recpt_N,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Cholcy_rcpt_A,prints_Cholcskin_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Gastrin_rcpt,prints_NPY_rcpt	p.E23Q	ENST00000295589.3	37	c.67	CCDS3438.1	4	.	.	.	.	.	.	.	.	.	.	C	14.69	2.610550	0.46527	.	.	ENSG00000163394	ENST00000295589	T	0.52526	0.66	5.27	4.42	0.53409	Cholecystokinin A receptor, N-terminal (2);	0.151828	0.43579	D	0.000542	T	0.43033	0.1229	L	0.60455	1.87	0.33390	D	0.575952	P	0.40534	0.72	B	0.41412	0.356	T	0.51631	-0.8681	10	0.16896	T	0.51	.	10.6755	0.45783	0.0:0.913:0.0:0.087	.	23	P32238	CCKAR_HUMAN	Q	23	ENSP00000295589:E23Q	ENSP00000295589:E23Q	E	-	1	0	CCKAR	26100921	0.774000	0.28592	0.115000	0.21578	0.971000	0.66376	1.594000	0.36697	2.477000	0.83638	0.655000	0.94253	GAA	CCKAR	-	pfam_CholecystokininA_recpt_N,prints_Cholcy_rcpt_A	ENSG00000163394		0.483	CCKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCKAR	HGNC	protein_coding	OTTHUMT00000250418.2	50	0.00	0	C			26491823	26491823	-1	no_errors	ENST00000295589	ensembl	human	known	69_37n	missense	52	11.86	7	SNP	0.649	G
CENPW	387103	genome.wustl.edu	37	6	126669611	126669611	+	Splice_Site	SNP	G	G	A			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr6:126669611G>A	ENST00000368328.4	+	3	340		c.e3-1		CENPW_ENST00000368326.1_Splice_Site|CENPW_ENST00000368325.1_Splice_Site			Q5EE01	CENPW_HUMAN	centromere protein W						CENP-A containing nucleosome assembly (GO:0034080)|chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|kinetochore (GO:0000776)|nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(2)|large_intestine(1)|lung(3)	6						CCCTCTTACAGGTAATTCTAA	0.289																																						dbGAP											0													75.0	75.0	75.0					6																	126669611		2202	4290	6492	-	-	-	SO:0001630	splice_region_variant	0			BC039556	CCDS34529.1, CCDS69196.1, CCDS75516.1	6q22.32	2013-11-05	2010-04-16	2010-04-16	ENSG00000203760	ENSG00000203760			21488	protein-coding gene	gene with protein product	"""cancer-upregulated gene 2"""	611264	"""chromosome 6 open reading frame 173"""	C6orf173		17610844, 19070575	Standard	NM_001286524		Approved	CUG2	uc003qao.3	Q5EE01	OTTHUMG00000015518	ENST00000368328.4:c.241-1G>A	6.37:g.126669611G>A			A6NIR0|A6NJC2	Splice_Site	SNP	-	e3-1	ENST00000368328.4	37	c.286-1	CCDS34529.1	6	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478567	0.63849	.	.	ENSG00000203760	ENST00000368326;ENST00000368325;ENST00000368328	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7568	0.69572	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CENPW	126711304	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	5.347000	0.65998	2.549000	0.85964	0.591000	0.81541	.	CENPW	-	-	ENSG00000203760		0.289	CENPW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPW	HGNC	protein_coding	OTTHUMT00000042104.1	79	0.00	0	G		Intron	126669611	126669611	+1	no_errors	ENST00000368325	ensembl	human	known	69_37n	splice_site	29	32.56	14	SNP	1.000	A
FBXO34	55030	genome.wustl.edu	37	14	55817206	55817206	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr14:55817206T>C	ENST00000313833.4	+	2	343	c.98T>C	c.(97-99)gTa>gCa	p.V33A	FBXO34_ENST00000440021.1_Missense_Mutation_p.V33A|FBXO34_ENST00000555087.1_3'UTR	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	33										breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						CAAAAGGCTGTAAATGATGAA	0.463																																						dbGAP											0													116.0	109.0	112.0					14																	55817206		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.98T>C	14.37:g.55817206T>C	ENSP00000313159:p.Val33Ala		Q2VPB5|Q4VBP5|Q86TY4	Missense_Mutation	SNP	superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.V33A	ENST00000313833.4	37	c.98	CCDS32086.1	14	.	.	.	.	.	.	.	.	.	.	T	0.965	-0.702070	0.03255	.	.	ENSG00000178974	ENST00000313833;ENST00000440021	T;T	0.27890	1.64;1.64	5.0	1.17	0.20885	.	2.427540	0.02794	N	0.122370	T	0.16214	0.0390	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13176	-1.0519	10	0.15952	T	0.53	-1.5739	1.189	0.01861	0.1459:0.2747:0.1414:0.438	.	33	Q9NWN3	FBX34_HUMAN	A	33	ENSP00000313159:V33A;ENSP00000394117:V33A	ENSP00000313159:V33A	V	+	2	0	FBXO34	54886959	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.497000	0.22514	0.041000	0.15688	0.533000	0.62120	GTA	FBXO34	-	NULL	ENSG00000178974		0.463	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO34	HGNC	protein_coding	OTTHUMT00000411322.1	35	0.00	0	T			55817206	55817206	+1	no_errors	ENST00000313833	ensembl	human	known	69_37n	missense	58	10.77	7	SNP	0.000	C
IGFBP4	3487	genome.wustl.edu	37	17	38610201	38610201	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr17:38610201G>A	ENST00000269593.4	+	3	804	c.529G>A	c.(529-531)Gag>Aag	p.E177K	IGFBP4_ENST00000542955.1_Missense_Mutation_p.E77K	NM_001552.2	NP_001543.2	P22692	IBP4_HUMAN	insulin-like growth factor binding protein 4	177	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|DNA metabolic process (GO:0006259)|inflammatory response (GO:0006954)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			CTGCCAGAGCGAGCTGCACCG	0.642																																					GBM(160;940 3581 26177)	dbGAP											0													50.0	54.0	53.0					17																	38610201		2203	4300	6503	-	-	-	SO:0001583	missense	0			M38177	CCDS11367.1	17q21.2	2014-09-16	2001-11-28		ENSG00000141753	ENSG00000141753			5473	protein-coding gene	gene with protein product	"""IGF-binding protein 4"""	146733	"""insulin-like growth factor-binding protein 4"""			1707125, 1704481	Standard	NM_001552		Approved	IBP4, BP-4, HT29-IGFBP, IGFBP-4	uc002hus.3	P22692	OTTHUMG00000133326	ENST00000269593.4:c.529G>A	17.37:g.38610201G>A	ENSP00000269593:p.Glu177Lys		A0N9W2|B4E351|Q5U012|Q9UCL6	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_IGFBP-like,superfamily_Thyroglobulin_1,superfamily_Growth_fac_rcpt,smart_IGFBP-like,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1,prints_IGFBP_1-6_chordata,prints_IGFBP-4	p.E177K	ENST00000269593.4	37	c.529	CCDS11367.1	17	.	.	.	.	.	.	.	.	.	.	G	27.9	4.872015	0.91587	.	.	ENSG00000141753	ENST00000542955;ENST00000269593	T;T	0.65732	-0.17;-0.17	5.91	5.91	0.95273	Thyroglobulin type-1 (3);	0.050493	0.85682	D	0.000000	T	0.77545	0.4146	L	0.61218	1.895	0.49299	D	0.999777	D	0.89917	1.0	D	0.72625	0.978	T	0.77156	-0.2691	10	0.56958	D	0.05	-8.0733	18.0867	0.89460	0.0:0.0:1.0:0.0	.	177	P22692	IBP4_HUMAN	K	77;177	ENSP00000437734:E77K;ENSP00000269593:E177K	ENSP00000269593:E177K	E	+	1	0	IGFBP4	35863727	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	8.446000	0.90329	2.793000	0.96121	0.655000	0.94253	GAG	IGFBP4	-	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,pfscan_Thyroglobulin_1,prints_IGFBP_1-6_chordata	ENSG00000141753		0.642	IGFBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFBP4	HGNC	protein_coding	OTTHUMT00000257134.1	50	0.00	0	G	NM_001552		38610201	38610201	+1	no_errors	ENST00000269593	ensembl	human	known	69_37n	missense	53	19.70	13	SNP	1.000	A
KCNAB1	7881	genome.wustl.edu	37	3	156249278	156249278	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr3:156249278G>A	ENST00000490337.1	+	13	1226	c.1162G>A	c.(1162-1164)Gcc>Acc	p.A388T	KCNAB1_ENST00000471742.1_Missense_Mutation_p.A377T|KCNAB1_ENST00000389636.5_Missense_Mutation_p.A359T|KCNAB1_ENST00000497291.1_3'UTR|KCNAB1_ENST00000302490.8_Missense_Mutation_p.A370T|KCNAB1_ENST00000389634.5_Missense_Mutation_p.A341T	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	388					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			AAACCTTGGTGCCATTCAGGC	0.532																																						dbGAP											0													199.0	169.0	179.0					3																	156249278		2203	4300	6503	-	-	-	SO:0001583	missense	0			U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.1162G>A	3.37:g.156249278G>A	ENSP00000419952:p.Ala388Thr		A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_K_chnl_volt-dep_bsu_KCNAB-rel,prints_K_chnl_volt-dep_bsu_KCNAB1,prints_K_chnl_volt-dep_bsu_KCNAB3,tigrfam_K_chnl_volt-dep_bsu_KCNAB	p.A388T	ENST00000490337.1	37	c.1162	CCDS3174.1	3	.	.	.	.	.	.	.	.	.	.	g	34	5.397218	0.96009	.	.	ENSG00000169282	ENST00000490337;ENST00000389636;ENST00000471742;ENST00000302490;ENST00000389634	T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45	4.96	4.96	0.65561	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.63522	0.2518	M	0.91768	3.24	0.80722	D	1	P;D;D;P;P	0.59767	0.904;0.979;0.986;0.903;0.921	P;P;D;P;P	0.63793	0.869;0.844;0.918;0.74;0.831	T	0.74372	-0.3687	10	0.87932	D	0	-9.8943	18.2074	0.89859	0.0:0.0:1.0:0.0	.	359;341;370;377;388	B7Z8E5;F8W6W4;B3KPZ4;Q14722-3;Q14722	.;.;.;.;KCAB1_HUMAN	T	388;359;377;370;341	ENSP00000419952:A388T;ENSP00000374287:A359T;ENSP00000418956:A377T;ENSP00000305858:A370T;ENSP00000374285:A341T	ENSP00000305858:A370T	A	+	1	0	KCNAB1	157731972	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.330000	0.96422	2.274000	0.75844	0.457000	0.33378	GCC	KCNAB1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,tigrfam_K_chnl_volt-dep_bsu_KCNAB	ENSG00000169282		0.532	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	KCNAB1	HGNC	protein_coding	OTTHUMT00000351411.1	72	0.00	0	G	NM_003471		156249278	156249278	+1	no_errors	ENST00000490337	ensembl	human	known	69_37n	missense	52	31.58	24	SNP	1.000	A
KIAA1462	57608	genome.wustl.edu	37	10	30336682	30336683	+	Frame_Shift_Ins	INS	-	-	G	rs138575264	byFrequency	TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr10:30336682_30336683insG	ENST00000375377.1	-	2	160_161	c.59_60insC	c.(58-60)ccafs	p.P20fs		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	20					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						CGCGTGATGCTGGGGGGTCTCT	0.604																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.60dupC	10.37:g.30336688_30336688dupG	ENSP00000364526:p.Pro20fs		Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Frame_Shift_Ins	INS	NULL	p.A21fs	ENST00000375377.1	37	c.60_59	CCDS41500.1	10																																																																																			KIAA1462	-	NULL	ENSG00000165757		0.604	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1462	HGNC	protein_coding	OTTHUMT00000047409.1	24	0.00	0	-	NM_020848		30336682	30336683	-1	no_errors	ENST00000375377	ensembl	human	known	69_37n	frame_shift_ins	23	23.33	7	INS	0.000:0.001	G
KIAA2022	340533	genome.wustl.edu	37	X	73960046	73960046	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chrX:73960046C>T	ENST00000055682.6	-	3	4957	c.4346G>A	c.(4345-4347)cGt>cAt	p.R1449H		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1449					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GGATTTGTGACGATACAACTT	0.448																																						dbGAP											0													213.0	174.0	187.0					X																	73960046		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.4346G>A	X.37:g.73960046C>T	ENSP00000055682:p.Arg1449His		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.R1449H	ENST00000055682.6	37	c.4346	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	C	19.78	3.891432	0.72524	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.56275	0.47;0.47	5.36	5.36	0.76844	.	0.145914	0.64402	D	0.000005	T	0.65739	0.2720	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69285	-0.5185	10	0.87932	D	0	-7.3287	18.1933	0.89813	0.0:1.0:0.0:0.0	.	1449	Q5QGS0	K2022_HUMAN	H	1449	ENSP00000362567:R1449H;ENSP00000055682:R1449H	ENSP00000055682:R1449H	R	-	2	0	KIAA2022	73876771	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.487000	0.81328	2.234000	0.73211	0.544000	0.68410	CGT	KIAA2022	-	NULL	ENSG00000050030		0.448	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	113	0.00	0	C	NM_001008537		73960046	73960046	-1	no_errors	ENST00000055682	ensembl	human	known	69_37n	missense	85	29.75	36	SNP	1.000	T
KIF4B	285643	genome.wustl.edu	37	5	154396151	154396151	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr5:154396151A>G	ENST00000435029.4	+	1	2892	c.2732A>G	c.(2731-2733)gAg>gGg	p.E911G		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	911	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CATTTTTCTGAGATAGAGACA	0.453																																						dbGAP											0													73.0	72.0	73.0					5																	154396151		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2732A>G	5.37:g.154396151A>G	ENSP00000387875:p.Glu911Gly			Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E911G	ENST00000435029.4	37	c.2732	CCDS47324.1	5	.	.	.	.	.	.	.	.	.	.	a	3.360	-0.130624	0.06753	.	.	ENSG00000226650	ENST00000435029	T	0.69926	-0.44	1.76	0.562	0.17290	.	.	.	.	.	T	0.56077	0.1961	L	0.55990	1.75	0.26942	N	0.966221	B	0.02656	0.0	B	0.06405	0.002	T	0.49908	-0.8889	9	0.49607	T	0.09	.	4.9481	0.14000	0.8182:0.0:0.1818:0.0	.	911	Q2VIQ3	KIF4B_HUMAN	G	911	ENSP00000387875:E911G	ENSP00000387875:E911G	E	+	2	0	KIF4B	154376344	1.000000	0.71417	0.273000	0.24645	0.316000	0.28119	3.366000	0.52343	0.153000	0.19213	0.455000	0.32223	GAG	KIF4B	-	NULL	ENSG00000226650		0.453	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4B	HGNC	protein_coding	OTTHUMT00000377478.1	62	0.00	0	A			154396151	154396151	+1	no_errors	ENST00000435029	ensembl	human	known	69_37n	missense	45	30.77	20	SNP	0.772	G
LRRC16A	55604	genome.wustl.edu	37	6	25450164	25450164	+	Missense_Mutation	SNP	G	G	A	rs555687744		TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr6:25450164G>A	ENST00000329474.6	+	6	778	c.410G>A	c.(409-411)cGc>cAc	p.R137H	LRRC16A_ENST00000377969.3_5'UTR	NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	137					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						CCATCTGAGCGCCTGGCTAGT	0.473																																						dbGAP											0													45.0	47.0	46.0					6																	25450164		1846	4085	5931	-	-	-	SO:0001583	missense	0			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.410G>A	6.37:g.25450164G>A	ENSP00000331983:p.Arg137His		B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.R137H	ENST00000329474.6	37	c.410	CCDS54973.1	6	.	.	.	.	.	.	.	.	.	.	G	33	5.244522	0.95272	.	.	ENSG00000079691	ENST00000329474;ENST00000399313	T	0.21361	2.01	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.43831	0.1265	M	0.76838	2.35	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.20273	-1.0280	10	0.46703	T	0.11	.	20.0965	0.97849	0.0:0.0:1.0:0.0	.	137;137;137	Q5VZK9;B2RTQ5;Q5VZK9-2	LR16A_HUMAN;.;.	H	137	ENSP00000331983:R137H	ENSP00000331983:R137H	R	+	2	0	LRRC16A	25558143	1.000000	0.71417	0.995000	0.50966	0.979000	0.70002	6.966000	0.76073	2.824000	0.97209	0.655000	0.94253	CGC	LRRC16A	-	NULL	ENSG00000079691		0.473	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC16A	HGNC	protein_coding	OTTHUMT00000040045.2	37	0.00	0	G	NM_017640		25450164	25450164	+1	no_errors	ENST00000329474	ensembl	human	novel	69_37n	missense	32	33.33	16	SNP	1.000	A
MYLK4	340156	genome.wustl.edu	37	6	2689172	2689172	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr6:2689172G>A	ENST00000274643.7	-	4	596	c.254C>T	c.(253-255)cCg>cTg	p.P85L	MYLK4_ENST00000268446.5_Missense_Mutation_p.P85L	NM_001012418.3	NP_001012418.2	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4	85						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				AAATGGGGCCGGAGGAGCCGG	0.502																																						dbGAP											0													119.0	128.0	125.0					6																	2689172		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34330.1	6p25.2	2008-01-23			ENSG00000145949	ENSG00000145949			27972	protein-coding gene	gene with protein product	"""caMLCK like"""						Standard	NM_001012418		Approved	SgK085	uc003mty.4	Q86YV6	OTTHUMG00000014121	ENST00000274643.7:c.254C>T	6.37:g.2689172G>A	ENSP00000274643:p.Pro85Leu		A2RUC0|Q5TAW2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P85L	ENST00000274643.7	37	c.254	CCDS34330.1	6	.	.	.	.	.	.	.	.	.	.	G	13.44	2.239084	0.39598	.	.	ENSG00000145949	ENST00000268446;ENST00000274643	T;T	0.68181	0.01;-0.31	5.23	5.23	0.72850	.	0.318740	0.22054	N	0.065265	T	0.52141	0.1716	L	0.52011	1.625	0.47819	D	0.999527	B	0.27679	0.185	B	0.20577	0.03	T	0.58335	-0.7654	10	0.87932	D	0	.	18.1489	0.89668	0.0:0.0:1.0:0.0	.	85	Q86YV6	MYLK4_HUMAN	L	85	ENSP00000268446:P85L;ENSP00000274643:P85L	ENSP00000268446:P85L	P	-	2	0	MYLK4	2634171	0.998000	0.40836	0.995000	0.50966	0.141000	0.21300	6.631000	0.74277	2.610000	0.88304	0.655000	0.94253	CCG	MYLK4	-	NULL	ENSG00000145949		0.502	MYLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYLK4	HGNC	protein_coding	OTTHUMT00000039632.2	47	0.00	0	G	NM_001012418		2689172	2689172	-1	no_errors	ENST00000268446	ensembl	human	known	69_37n	missense	52	10.34	6	SNP	0.991	A
MDGA1	266727	genome.wustl.edu	37	6	37620076	37620076	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr6:37620076G>C	ENST00000434837.3	-	7	2201	c.1023C>G	c.(1021-1023)atC>atG	p.I341M	MDGA1_ENST00000505425.1_Missense_Mutation_p.I341M|MDGA1_ENST00000297153.7_Missense_Mutation_p.I341M	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	341	Ig-like 4.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						CACTCTCTTTGATCACGTCAG	0.557																																						dbGAP											0													40.0	45.0	43.0					6																	37620076		2158	4255	6413	-	-	-	SO:0001583	missense	0			AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.1023C>G	6.37:g.37620076G>C	ENSP00000402584:p.Ile341Met		A6NHG0|Q8NBE3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Ig-like	p.I341M	ENST00000434837.3	37	c.1023	CCDS47417.1	6	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860373	0.71834	.	.	ENSG00000112139	ENST00000434837;ENST00000297153;ENST00000505425	T;T;T	0.57436	0.4;0.55;0.42	5.33	5.33	0.75918	Immunoglobulin-like (1);	0.000000	0.51477	D	0.000094	T	0.51092	0.1654	L	0.34521	1.04	0.43199	D	0.995046	D	0.62365	0.991	P	0.59115	0.852	T	0.51748	-0.8666	10	0.48119	T	0.1	.	18.0107	0.89222	0.0:0.0:1.0:0.0	.	341	Q8NFP4	MDGA1_HUMAN	M	341	ENSP00000402584:I341M;ENSP00000297153:I341M;ENSP00000422042:I341M	ENSP00000297153:I341M	I	-	3	3	MDGA1	37728054	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.010000	0.88615	2.496000	0.84212	0.655000	0.94253	ATC	MDGA1	-	pfscan_Ig-like	ENSG00000112139		0.557	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDGA1	HGNC	protein_coding	OTTHUMT00000040419.3	16	0.00	0	G			37620076	37620076	-1	no_errors	ENST00000297153	ensembl	human	known	69_37n	missense	7	87.93	51	SNP	1.000	C
PLSCR2	57047	genome.wustl.edu	37	3	146171892	146171892	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr3:146171892G>A	ENST00000497985.1	-	7	1038	c.599C>T	c.(598-600)cCa>cTa	p.P200L	PLSCR2_ENST00000336685.2_Missense_Mutation_p.P127L	NM_001199978.1	NP_001186907.1	Q9NRY7	PLS2_HUMAN	phospholipid scramblase 2	200					phospholipid scrambling (GO:0017121)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid scramblase activity (GO:0017128)			endometrium(2)|large_intestine(5)|lung(7)|stomach(1)	15						TGTTAGACATGGGTGCCAGGT	0.363																																						dbGAP											0													100.0	102.0	101.0					3																	146171892		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS56284.1, CCDS3134.1, CCDS75029.1	3q24	2008-07-18			ENSG00000163746	ENSG00000163746			16494	protein-coding gene	gene with protein product		607610				10930526	Standard	NM_001199978		Approved		uc003evw.2	Q9NRY7	OTTHUMG00000159429	ENST00000497985.1:c.599C>T	3.37:g.146171892G>A	ENSP00000420132:p.Pro200Leu		B4DXC3|J3KR76|Q0VAQ1|Q6NSW9|Q7Z4L7	Missense_Mutation	SNP	pfam_Scramblase,superfamily_Tubby_C-like	p.P127L	ENST00000497985.1	37	c.380	CCDS56284.1	3	.	.	.	.	.	.	.	.	.	.	.	7.341	0.620887	0.14193	.	.	ENSG00000163746	ENST00000336685;ENST00000535500;ENST00000497985;ENST00000489015	T;T;T	0.16897	2.31;2.31;2.31	3.57	1.56	0.23342	.	0.454964	0.15307	U	0.269294	T	0.14614	0.0353	L	0.48935	1.535	0.41082	D	0.985534	B;B	0.23540	0.087;0.022	B;B	0.33690	0.168;0.046	T	0.05305	-1.0893	10	0.11485	T	0.65	.	7.1985	0.25866	0.1772:0.1422:0.6806:0.0	.	220;127	Q7Z4L7;Q9NRY7	.;PLS2_HUMAN	L	127;219;200;127	ENSP00000338707:P127L;ENSP00000420132:P200L;ENSP00000418444:P127L	ENSP00000338707:P127L	P	-	2	0	PLSCR2	147654582	0.993000	0.37304	0.680000	0.29994	0.371000	0.29859	2.448000	0.44926	0.837000	0.34925	0.407000	0.27541	CCA	PLSCR2	-	pfam_Scramblase	ENSG00000163746		0.363	PLSCR2-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	PLSCR2	HGNC	protein_coding	OTTHUMT00000355264.1	84	0.00	0	G	NM_020359		146171892	146171892	-1	no_errors	ENST00000336685	ensembl	human	known	69_37n	missense	67	18.29	15	SNP	0.704	A
POU4F2	5458	genome.wustl.edu	37	4	147561811	147561811	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr4:147561811G>A	ENST00000281321.3	+	2	1329	c.1081G>A	c.(1081-1083)Gaa>Aaa	p.E361K	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	361					axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					GCGCTCGCTCGAAGCCTACTT	0.597																																						dbGAP											0													70.0	74.0	72.0					4																	147561811		2203	4300	6503	-	-	-	SO:0001583	missense	0			U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.1081G>A	4.37:g.147561811G>A	ENSP00000281321:p.Glu361Lys		B1PJR6|B2RC84|Q13883|Q14987	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.E361K	ENST00000281321.3	37	c.1081	CCDS34074.1	4	.	.	.	.	.	.	.	.	.	.	G	22.1	4.241953	0.79912	.	.	ENSG00000151615	ENST00000281321	D	0.97575	-4.44	5.49	5.49	0.81192	Homeodomain-related (1);Homeobox (3);POU (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98157	0.9391	M	0.72118	2.19	0.80722	D	1	D	0.71674	0.998	D	0.66602	0.945	D	0.99038	1.0823	10	0.87932	D	0	.	19.37	0.94480	0.0:0.0:1.0:0.0	.	361	Q12837	PO4F2_HUMAN	K	361	ENSP00000281321:E361K	ENSP00000281321:E361K	E	+	1	0	POU4F2	147781261	1.000000	0.71417	0.956000	0.39512	0.969000	0.65631	9.841000	0.99482	2.595000	0.87683	0.561000	0.74099	GAA	POU4F2	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_POU	ENSG00000151615		0.597	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F2	HGNC	protein_coding	OTTHUMT00000367020.1	25	0.00	0	G	NM_004575		147561811	147561811	+1	no_errors	ENST00000281321	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	1.000	A
RASGEF1C	255426	genome.wustl.edu	37	5	179563506	179563506	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr5:179563506G>A	ENST00000393371.2	-	3	606	c.310C>T	c.(310-312)Cgg>Tgg	p.R104W	RASGEF1C_ENST00000522500.1_5'UTR|RASGEF1C_ENST00000519883.1_5'Flank|RASGEF1C_ENST00000361132.4_Missense_Mutation_p.R104W			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	104	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCGAACTTCCGGACCCGGGCC	0.687																																						dbGAP											0													31.0	26.0	28.0					5																	179563506		2157	4237	6394	-	-	-	SO:0001583	missense	0			AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.310C>T	5.37:g.179563506G>A	ENSP00000377037:p.Arg104Trp		D3DWQ7|Q7Z4T0|Q8NA49	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R104W	ENST00000393371.2	37	c.310	CCDS4452.1	5	.	.	.	.	.	.	.	.	.	.	G	19.02	3.746759	0.69418	.	.	ENSG00000146090	ENST00000361132;ENST00000393371	T;T	0.51574	0.7;0.7	4.33	3.45	0.39498	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (2);	0.068430	0.64402	D	0.000015	T	0.58192	0.2105	M	0.76838	2.35	0.80722	D	1	D	0.56746	0.977	P	0.55011	0.766	T	0.60939	-0.7163	10	0.87932	D	0	.	7.2493	0.26140	0.0936:0.0:0.7383:0.168	.	104	Q8N431	RGF1C_HUMAN	W	104	ENSP00000354963:R104W;ENSP00000377037:R104W	ENSP00000354963:R104W	R	-	1	2	RASGEF1C	179496112	0.999000	0.42202	0.928000	0.36995	0.796000	0.44982	1.440000	0.35024	0.959000	0.37980	0.436000	0.28706	CGG	RASGEF1C	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,pfscan_Ras-like_Gua-exchang_fac_N	ENSG00000146090		0.687	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RASGEF1C	HGNC	protein_coding	OTTHUMT00000253506.2	14	0.00	0	G	NM_175062		179563506	179563506	-1	no_errors	ENST00000361132	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	1.000	A
RPA3	6119	genome.wustl.edu	37	7	7680043	7680043	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr7:7680043C>T	ENST00000223129.4	-	5	1178	c.7G>A	c.(7-9)Gac>Aac	p.D3N	RPA3_ENST00000401447.1_5'Flank|RPA3_ENST00000406109.1_Intron|RPA3_ENST00000396682.2_Missense_Mutation_p.D3N	NM_002947.3	NP_002938.1	P35244	RFA3_HUMAN	replication protein A3, 14kDa	3					base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of cell proliferation (GO:0042127)|regulation of mitotic cell cycle (GO:0007346)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.202)		TCCATCATGTCCACCATGATT	0.587								Direct reversal of damage;Nucleotide excision repair (NER)																													Colon(148;376 1816 25359 26011 31717)	dbGAP											0													88.0	77.0	80.0					7																	7680043		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5356.1	7p21.3	2013-09-23	2002-08-29		ENSG00000106399	ENSG00000106399			10291	protein-coding gene	gene with protein product		179837	"""replication protein A3 (14kD)"""			8454588	Standard	NM_002947		Approved	REPA3	uc003sri.3	P35244	OTTHUMG00000023748	ENST00000223129.4:c.7G>A	7.37:g.7680043C>T	ENSP00000223129:p.Asp3Asn		Q549U6	Missense_Mutation	SNP	pfam_Rep_factor-A_3,superfamily_NA-bd_OB-fold-like	p.D3N	ENST00000223129.4	37	c.7	CCDS5356.1	7	.	.	.	.	.	.	.	.	.	.	C	15.30	2.791434	0.50102	.	.	ENSG00000106399	ENST00000223129;ENST00000396682	.	.	.	5.08	5.08	0.68730	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.195513	0.53938	D	0.000053	T	0.55449	0.1921	M	0.62723	1.935	0.80722	D	1	P	0.50528	0.936	B	0.39660	0.306	T	0.59156	-0.7507	9	0.35671	T	0.21	-21.3337	17.7854	0.88536	0.0:1.0:0.0:0.0	.	3	P35244	RFA3_HUMAN	N	3	.	ENSP00000223129:D3N	D	-	1	0	RPA3	7646568	1.000000	0.71417	0.993000	0.49108	0.042000	0.13812	3.749000	0.55150	2.808000	0.96608	0.655000	0.94253	GAC	RPA3	-	superfamily_NA-bd_OB-fold-like	ENSG00000106399		0.587	RPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA3	HGNC	protein_coding	OTTHUMT00000324778.2	33	0.00	0	C	NM_002947		7680043	7680043	-1	no_errors	ENST00000223129	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	1.000	T
SEMA6D	80031	genome.wustl.edu	37	15	48052559	48052559	+	Silent	SNP	G	G	A			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr15:48052559G>A	ENST00000316364.5	+	3	607	c.168G>A	c.(166-168)agG>agA	p.R56R	SEMA6D_ENST00000358066.4_Silent_p.R56R|SEMA6D_ENST00000354744.4_Silent_p.R56R|SEMA6D_ENST00000389432.2_Silent_p.R56R|SEMA6D_ENST00000389428.3_Silent_p.R56R|SEMA6D_ENST00000536845.2_Silent_p.R56R|SEMA6D_ENST00000558014.1_Silent_p.R56R|SEMA6D_ENST00000537942.1_Silent_p.R56R|SEMA6D_ENST00000389425.3_Silent_p.R56R|SEMA6D_ENST00000355997.3_Silent_p.R56R|SEMA6D_ENST00000558816.1_Silent_p.R56R|SEMA6D_ENST00000389433.2_Silent_p.R56R	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	56	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CGCAGCACAGGCTGGACTTTC	0.393																																						dbGAP											0													101.0	96.0	98.0					15																	48052559		2198	4297	6495	-	-	-	SO:0001819	synonymous_variant	0			AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.168G>A	15.37:g.48052559G>A			A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Silent	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.R56	ENST00000316364.5	37	c.168	CCDS32225.1	15																																																																																			SEMA6D	-	superfamily_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000137872		0.393	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA6D	HGNC	protein_coding	OTTHUMT00000416868.1	71	0.00	0	G	NM_024966		48052559	48052559	+1	no_errors	ENST00000316364	ensembl	human	known	69_37n	silent	47	27.69	18	SNP	1.000	A
SHANK2	22941	genome.wustl.edu	37	11	70507831	70507831	+	Intron	SNP	C	C	G			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr11:70507831C>G	ENST00000423696.2	-	6	753				SHANK2_ENST00000357171.3_Missense_Mutation_p.M14I|SHANK2_ENST00000409161.1_Missense_Mutation_p.M13I|SHANK2_ENST00000449116.2_Missense_Mutation_p.M14I|SHANK2_ENST00000449833.2_Missense_Mutation_p.M14I|SHANK2_ENST00000409530.1_Missense_Mutation_p.M13I|SHANK2_ENST00000338508.4_Intron			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			AGCCCGTCATCATCACCGCGG	0.547																																						dbGAP											0													127.0	129.0	128.0					11																	70507831		2200	4294	6494	-	-	-	SO:0001627	intron_variant	0			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.717-48G>C	11.37:g.70507831C>G			C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,pfam_PDZ,superfamily_PDZ,superfamily_SAM/pointed,smart_PDZ,smart_SAM,pfscan_PDZ,pfscan_SAM	p.M14I	ENST00000423696.2	37	c.42		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	18.42|18.42	3.620945|3.620945	0.66787|0.66787	.|.	.|.	ENSG00000162105|ENSG00000162105	ENST00000412252|ENST00000449833;ENST00000409161;ENST00000409530;ENST00000449116;ENST00000357171	.|T;T;T;T;T	.|0.54071	.|2.5;2.5;1.0;0.59;1.0	4.56|4.56	4.56|4.56	0.56223|0.56223	.|.	.|.	.|.	.|.	.|.	T|T	0.36880|0.36880	0.0983|0.0983	N|N	0.08118|0.08118	0|0	0.32600|0.32600	N|N	0.525998|0.525998	.|B;B	.|0.19445	.|0.036;0.019	.|B;B	.|0.18871	.|0.011;0.023	T|T	0.46693|0.46693	-0.9173|-0.9173	5|9	.|0.54805	.|T	.|0.06	.|.	17.342|17.342	0.87299|0.87299	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|14;14	.|B7ZKU9;Q9UPX8-4	.|.;.	H|I	13|14;13;13;14;14	.|ENSP00000399423:M14I;ENSP00000386491:M13I;ENSP00000387324:M13I;ENSP00000394939:M14I;ENSP00000349694:M14I	.|ENSP00000349694:M14I	D|M	-|-	1|3	0|0	SHANK2|SHANK2	70185479|70185479	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	3.180000|3.180000	0.50895|0.50895	2.081000|2.081000	0.62600|0.62600	0.491000|0.491000	0.48974|0.48974	GAT|ATG	SHANK2	-	NULL	ENSG00000162105		0.547	SHANK2-203	KNOWN	basic	protein_coding	SHANK2	HGNC	protein_coding		33	0.00	0	C	NM_012309		70507831	70507831	-1	no_errors	ENST00000449833	ensembl	human	known	69_37n	missense	33	31.25	15	SNP	1.000	G
TSHZ2	128553	genome.wustl.edu	37	20	51872712	51872712	+	Silent	SNP	C	C	T			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr20:51872712C>T	ENST00000371497.5	+	2	3602	c.2715C>T	c.(2713-2715)taC>taT	p.Y905Y	TSHZ2_ENST00000329613.6_Silent_p.Y902Y|TSHZ2_ENST00000603338.2_Silent_p.Y902Y|RP4-678D15.1_ENST00000606932.1_RNA	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	905					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			ACGTCAAGTACCAGCTTAGGA	0.493																																						dbGAP											0													70.0	70.0	70.0					20																	51872712		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2715C>T	20.37:g.51872712C>T			B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.Y905	ENST00000371497.5	37	c.2715	CCDS33490.1	20																																																																																			TSHZ2	-	superfamily_Homeodomain-like,smart_Homeodomain	ENSG00000182463		0.493	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6	44	0.00	0	C	NM_173485		51872712	51872712	+1	no_errors	ENST00000371497	ensembl	human	known	69_37n	silent	62	42.73	47	SNP	1.000	T
ZNF721	170960	genome.wustl.edu	37	4	437075	437075	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27W-01A-11D-A16D-09	TCGA-D8-A27W-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b045d675-286b-4cf8-aed4-c7ff81a78919	ce2ab463-47c2-4a91-840f-99210850f23d	g.chr4:437075C>T	ENST00000338977.5	-	2	1193	c.1145G>A	c.(1144-1146)tGt>tAt	p.C382Y	ZNF721_ENST00000506646.1_Intron|ZNF721_ENST00000511833.2_Missense_Mutation_p.C394Y|ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721	382					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						GGCTTTGCCACACTCTTCACA	0.428																																						dbGAP											0													88.0	94.0	92.0					4																	437075		2135	4266	6401	-	-	-	SO:0001583	missense	0			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.1145G>A	4.37:g.437075C>T	ENSP00000340524:p.Cys382Tyr		Q69YG7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C394Y	ENST00000338977.5	37	c.1181		4	.	.	.	.	.	.	.	.	.	.	C	13.52	2.261088	0.39995	.	.	ENSG00000182903	ENST00000338977;ENST00000511833	D;D	0.85861	-2.04;-2.04	0.71	0.71	0.18157	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.88966	0.6581	H	0.95712	3.71	0.38045	D	0.93557	P;P;P	0.46912	0.886;0.824;0.789	P;P;B	0.45794	0.493;0.493;0.36	D	0.89084	0.3478	9	0.72032	D	0.01	.	7.2684	0.26242	0.0:0.9999:0.0:1.0E-4	.	382;394;394	Q8TF20;D9N162;Q8TF20-2	ZN721_HUMAN;.;.	Y	382;394	ENSP00000340524:C382Y;ENSP00000428878:C394Y	ENSP00000340524:C382Y	C	-	2	0	ZNF721	427075	0.987000	0.35691	0.010000	0.14722	0.025000	0.11179	5.281000	0.65609	0.677000	0.31305	0.194000	0.17425	TGT	ZNF721	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000182903		0.428	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	ZNF721	HGNC	protein_coding	OTTHUMT00000357939.1	99	0.00	0	C	NM_133474		437075	437075	-1	no_errors	ENST00000511833	ensembl	human	known	69_37n	missense	141	12.42	20	SNP	0.998	T
