#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABI1	10006	genome.wustl.edu	37	10	27052815	27052815	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr10:27052815C>A	ENST00000376142.2	-	8	966	c.895G>T	c.(895-897)Gtg>Ttg	p.V299L	ABI1_ENST00000355394.4_Missense_Mutation_p.V300L|ABI1_ENST00000376139.2_Intron|ABI1_ENST00000376170.4_Intron|ABI1_ENST00000359188.4_Intron|ABI1_ENST00000376134.3_Intron|ABI1_ENST00000376137.4_Intron|ABI1_ENST00000536334.1_Intron|ABI1_ENST00000490841.2_Intron|ABI1_ENST00000376166.1_Intron|ABI1_ENST00000376138.3_Intron|ABI1_ENST00000376160.1_Intron|ABI1_ENST00000346832.5_Missense_Mutation_p.V316L|ABI1_ENST00000376140.3_Intron	NM_005470.3	NP_005461.2	Q8IZP0	ABI1_HUMAN	abl-interactor 1	299	Pro-rich.				actin polymerization or depolymerization (GO:0008154)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium morphogenesis (GO:0072673)|megakaryocyte development (GO:0035855)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|SCAR complex (GO:0031209)	cytoskeletal protein binding (GO:0008092)|protein complex binding (GO:0032403)|protein tyrosine kinase activator activity (GO:0030296)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCACCTATCACAGTGCTCACT	0.418																																						dbGAP											0													82.0	87.0	85.0					10																	27052815		2203	4300	6503	-	-	-	SO:0001583	missense	0			U87166	CCDS7150.1, CCDS31169.1, CCDS31170.1, CCDS31171.1, CCDS53497.1, CCDS53498.1, CCDS53499.1, CCDS53500.1, CCDS53501.1, CCDS73077.1, CCDS73078.1	10p12.1	2009-05-29	2004-03-17	2004-03-19	ENSG00000136754	ENSG00000136754			11320	protein-coding gene	gene with protein product		603050	"""spectrin SH3 domain binding protein 1"""	SSH3BP1		9593709, 9010225	Standard	NM_005470		Approved	E3B1, ABI-1	uc001isx.3	Q8IZP0	OTTHUMG00000017848	ENST00000376142.2:c.895G>T	10.37:g.27052815C>A	ENSP00000365312:p.Val299Leu		A9Z1Y6|B3KX62|B4DQ58|H7BXI6|O15147|O76049|O95060|Q5T2R3|Q5T2R4|Q5T2R6|Q5T2R7|Q5T2R9|Q5W070|Q5W072|Q8TB63|Q96S81|Q9NXZ9|Q9NYB8	Missense_Mutation	SNP	pfam_Abl-interactor_HHR_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,pfscan_T_SNARE_dom,prints_SH3_domain,prints_p67phox	p.V300L	ENST00000376142.2	37	c.898	CCDS7150.1	10	.	.	.	.	.	.	.	.	.	.	C	8.854	0.945254	0.18356	.	.	ENSG00000136754	ENST00000376142;ENST00000355394;ENST00000346832	T;T;T	0.37411	1.2;1.3;1.29	5.58	2.3	0.28687	.	0.885835	0.09475	N	0.797162	T	0.25158	0.0611	L	0.43152	1.355	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.12041	-1.0563	10	0.11485	T	0.65	0.0	4.2884	0.10865	0.0:0.3272:0.4059:0.2669	.	316;299	B3KX62;Q8IZP0	.;ABI1_HUMAN	L	299;300;316	ENSP00000365312:V299L;ENSP00000347555:V300L;ENSP00000279599:V316L	ENSP00000279599:V316L	V	-	1	0	ABI1	27092821	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.927000	0.28818	0.701000	0.31803	0.467000	0.42956	GTG	ABI1	-	NULL	ENSG00000136754		0.418	ABI1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABI1	HGNC	protein_coding	OTTHUMT00000047287.1	320	0.00	0	C	NM_005470		27052815	27052815	-1	no_errors	ENST00000355394	ensembl	human	known	69_37n	missense	331	18.87	77	SNP	1.000	A
ACOX1	51	genome.wustl.edu	37	17	73956312	73956312	+	Intron	SNP	C	C	G			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr17:73956312C>G	ENST00000301608.4	-	4	491				ACOX1_ENST00000293217.5_Missense_Mutation_p.Q138H|ACOX1_ENST00000591857.1_5'UTR|ACOX1_ENST00000537812.1_Missense_Mutation_p.Q100H	NM_007292.5	NP_009223.2	Q15067	ACOX1_HUMAN	acyl-CoA oxidase 1, palmitoyl						alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|peroxisome fission (GO:0016559)|positive regulation of cholesterol homeostasis (GO:2000189)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|FAD binding (GO:0071949)|fatty acid binding (GO:0005504)|flavin adenine dinucleotide binding (GO:0050660)|palmitoyl-CoA oxidase activity (GO:0016401)|PDZ domain binding (GO:0030165)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)			large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(1)	14					Flavin adenine dinucleotide(DB03147)	CCATCTCTGTCTGGGCATAAG	0.567																																						dbGAP											0													92.0	70.0	78.0					17																	73956312		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			U03254	CCDS11734.1, CCDS11735.1	17q25.1	2012-10-04	2010-04-30		ENSG00000161533	ENSG00000161533	1.3.3.6		119	protein-coding gene	gene with protein product		609751	"""acyl-Coenzyme A oxidase 1, palmitoyl"""			8159712	Standard	NM_007292		Approved	PALMCOX	uc002jqe.3	Q15067	OTTHUMG00000180027	ENST00000301608.4:c.431-2665G>C	17.37:g.73956312C>G			A8K6X8|A8KAA0|B4DK61|F5GYQ8|Q12863|Q15068|Q15101|Q16131|Q7Z3W5|Q9UD31	Missense_Mutation	SNP	pfam_Acyl-CoA_oxidase_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCo_DH/oxidase_C,superfamily_AcylCoA_DH/oxidase,pirsf_Acyl-CoA_oxidase	p.Q138H	ENST00000301608.4	37	c.414	CCDS11735.1	17	.	.	.	.	.	.	.	.	.	.	C	20.5	4.006603	0.74932	.	.	ENSG00000161533	ENST00000293217;ENST00000537812;ENST00000539791;ENST00000538781	D;D	0.94931	-3.56;-3.56	6.16	5.2	0.72013	.	0.000000	0.85682	D	0.000000	D	0.98201	0.9405	H	0.98426	4.23	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.996	D	0.98308	1.0522	10	0.87932	D	0	.	9.746	0.40446	0.0:0.7955:0.0:0.2045	.	70;100;138	F5H0M0;F5GYQ8;Q15067-2	.;.;.	H	138;100;138;70	ENSP00000293217:Q138H;ENSP00000441257:Q100H	ENSP00000293217:Q138H	Q	-	3	2	ACOX1	71467907	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.281000	0.51685	1.630000	0.50440	0.650000	0.86243	CAG	ACOX1	-	pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCoA_DH/oxidase,pirsf_Acyl-CoA_oxidase	ENSG00000161533		0.567	ACOX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACOX1	HGNC	protein_coding	OTTHUMT00000439503.1	119	0.00	0	C			73956312	73956312	-1	no_errors	ENST00000293217	ensembl	human	known	69_37n	missense	100	20.47	26	SNP	1.000	G
AKAP9	10142	genome.wustl.edu	37	7	91632139	91632139	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr7:91632139C>G	ENST00000359028.2	+	9	3169	c.2944C>G	c.(2944-2946)Cat>Gat	p.H982D	AKAP9_ENST00000358100.2_Missense_Mutation_p.H982D|AKAP9_ENST00000356239.3_Missense_Mutation_p.H970D			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	982	Glu-rich.			QKH -> PKP (in Ref. 1; AAB86384 and 2; CAB40713). {ECO:0000305}.	G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GAAACAGAAACATGGTGAGAT	0.343			T	BRAF	papillary thyroid																																	dbGAP		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													54.0	57.0	56.0					7																	91632139		2199	4295	6494	-	-	-	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.2944C>G	7.37:g.91632139C>G	ENSP00000351922:p.His982Asp		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB-like	p.H982D	ENST00000359028.2	37	c.2944		7	.	.	.	.	.	.	.	.	.	.	C	9.761	1.170155	0.21621	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	T;T;T	0.03358	3.96;3.96;3.96	5.0	4.12	0.48240	.	0.431758	0.17223	N	0.182275	T	0.06826	0.0174	M	0.64997	1.995	0.31746	N	0.63516	B;P;P;B	0.35844	0.39;0.524;0.524;0.005	B;B;B;B	0.38264	0.096;0.196;0.269;0.018	T	0.01894	-1.1252	10	0.66056	D	0.02	.	10.7697	0.46314	0.0:0.7958:0.1311:0.073	.	982;970;970;982	Q99996;Q99996-2;Q99996-3;A4D1E4	AKAP9_HUMAN;.;.;.	D	970;982;982;982;982	ENSP00000348573:H970D;ENSP00000351922:H982D;ENSP00000350813:H982D	ENSP00000348573:H970D	H	+	1	0	AKAP9	91470075	1.000000	0.71417	0.183000	0.23137	0.953000	0.61014	3.494000	0.53273	1.220000	0.43490	0.650000	0.86243	CAT	AKAP9	-	NULL	ENSG00000127914		0.343	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		108	0.00	0	C	NM_005751		91632139	91632139	+1	no_errors	ENST00000359028	ensembl	human	known	69_37n	missense	105	13.93	17	SNP	0.925	G
ATP11A	23250	genome.wustl.edu	37	13	113488902	113488902	+	Splice_Site	SNP	G	G	C			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr13:113488902G>C	ENST00000487903.1	+	15	1647		c.e15-1		ATP11A_ENST00000375645.3_Splice_Site|ATP11A_ENST00000283558.8_Splice_Site|ATP11A_ENST00000375630.2_Splice_Site			P98196	AT11A_HUMAN	ATPase, class VI, type 11A						phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				TCTCATTGCAGACTTGGCTTT	0.408																																						dbGAP											0													197.0	196.0	196.0					13																	113488902		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.1560-1G>C	13.37:g.113488902G>C			Q5VXT2	Splice_Site	SNP	-	e15-1	ENST00000487903.1	37	c.1560-1	CCDS32011.1	13	.	.	.	.	.	.	.	.	.	.	G	14.63	2.592497	0.46214	.	.	ENSG00000068650	ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558;ENST00000418678	.	.	.	4.84	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3346	0.90283	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATP11A	112536903	1.000000	0.71417	0.980000	0.43619	0.278000	0.26855	9.002000	0.93572	2.388000	0.81334	0.561000	0.74099	.	ATP11A	-	-	ENSG00000068650		0.408	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP11A	HGNC	protein_coding	OTTHUMT00000045834.3	267	0.00	0	G	NM_015205	Intron	113488902	113488902	+1	no_errors	ENST00000375630	ensembl	human	known	69_37n	splice_site	185	21.61	51	SNP	1.000	C
ATRN	8455	genome.wustl.edu	37	20	3527932	3527932	+	Splice_Site	SNP	T	T	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr20:3527932T>A	ENST00000262919.5	+	5	807	c.739T>A	c.(739-741)Ttt>Att	p.F247I	ATRN_ENST00000446916.2_Splice_Site_p.F247I	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	247	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						TTTTTACAGTTTTGATATGTG	0.388																																						dbGAP											0													155.0	145.0	148.0					20																	3527932		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.738-1T>A	20.37:g.3527932T>A			A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Plexin_repeat,pfam_CUB,superfamily_C-type_lectin_fold,superfamily_CUB,superfamily_Plexin-like_fold,smart_EGF-like,smart_CUB,smart_Plexin-like,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.F247I	ENST00000262919.5	37	c.739	CCDS13053.1	20	.	.	.	.	.	.	.	.	.	.	T	0.015	-1.562451	0.00903	.	.	ENSG00000088812	ENST00000262919;ENST00000446916;ENST00000340500	T;T	0.59638	0.25;0.25	4.99	4.99	0.66335	CUB (3);Epidermal growth factor-like, type 3 (1);	0.319628	0.32578	N	0.005908	T	0.26521	0.0648	N	0.02247	-0.625	0.37379	D	0.911947	B;B	0.09022	0.0;0.002	B;B	0.10450	0.001;0.005	T	0.30851	-0.9964	10	0.02654	T	1	-12.9764	10.6596	0.45694	0.0:0.0:0.1604:0.8396	.	247;247	O75882;O75882-2	ATRN_HUMAN;.	I	247;247;173	ENSP00000262919:F247I;ENSP00000416587:F247I	ENSP00000262919:F247I	F	+	1	0	ATRN	3475932	1.000000	0.71417	1.000000	0.80357	0.099000	0.18886	1.090000	0.30902	2.083000	0.62718	0.455000	0.32223	TTT	ATRN	-	superfamily_CUB,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	ENSG00000088812		0.388	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRN	HGNC	protein_coding	OTTHUMT00000077740.2	640	0.00	0	T	NM_139321	Missense_Mutation	3527932	3527932	+1	no_errors	ENST00000262919	ensembl	human	known	69_37n	missense	341	26.02	121	SNP	1.000	A
BZRAP1	9256	genome.wustl.edu	37	17	56384995	56384995	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr17:56384995A>C	ENST00000343736.4	-	24	5123	c.4960T>G	c.(4960-4962)Ttc>Gtc	p.F1654V	BZRAP1_ENST00000355701.3_Missense_Mutation_p.F1654V|BZRAP1_ENST00000268893.6_Missense_Mutation_p.F1594V			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1654	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCCTCTCGGAAGGGAAGCTCT	0.547																																						dbGAP											0													93.0	76.0	82.0					17																	56384995		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.4960T>G	17.37:g.56384995A>C	ENSP00000345824:p.Phe1654Val		O75111|Q8N5W3	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain	p.F1654V	ENST00000343736.4	37	c.4960	CCDS11605.1	17	.	.	.	.	.	.	.	.	.	.	A	29.5	5.009336	0.93346	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	T;T;T	0.39592	1.07;1.07;1.07	5.79	5.79	0.91817	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.70351	0.3214	M	0.89214	3.015	0.53688	D	0.999975	D;D;D	0.89917	1.0;0.997;0.997	D;D;D	0.91635	0.999;0.993;0.995	T	0.76862	-0.2802	10	0.87932	D	0	.	15.3154	0.74074	1.0:0.0:0.0:0.0	.	1654;1594;1654	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	V	1654;1654;1594	ENSP00000347929:F1654V;ENSP00000345824:F1654V;ENSP00000268893:F1594V	ENSP00000268893:F1594V	F	-	1	0	BZRAP1	53739994	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	8.726000	0.91474	2.209000	0.71365	0.533000	0.62120	TTC	BZRAP1	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000005379		0.547	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BZRAP1	HGNC	protein_coding	OTTHUMT00000443980.1	212	0.00	0	A	NM_004758		56384995	56384995	-1	no_errors	ENST00000355701	ensembl	human	known	69_37n	missense	135	16.15	26	SNP	1.000	C
CACNA1F	778	genome.wustl.edu	37	X	49065681	49065681	+	Intron	SNP	T	T	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chrX:49065681T>A	ENST00000376265.2	-	42	5048				CACNA1F_ENST00000376251.1_Intron|CACNA1F_ENST00000323022.5_Intron	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit						axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GACGAAGTATTTTACAATCAA	0.463																																						dbGAP											0													126.0	92.0	104.0					X																	49065681		2202	4299	6501	-	-	-	SO:0001627	intron_variant	0			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.4986+40A>T	X.37:g.49065681T>A			A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	NULL	p.K86I	ENST00000376265.2	37	c.257	CCDS35253.1	X	.	.	.	.	.	.	.	.	.	.	T	14.86	2.661897	0.47572	.	.	ENSG00000102001	ENST00000486943	.	.	.	4.2	3.03	0.35002	.	.	.	.	.	T	0.40322	0.1112	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.35847	-0.9772	5	0.87932	D	0	.	5.5195	0.16925	0.0:0.1248:0.0:0.8752	.	.	.	.	I	86	.	ENSP00000418961:K86I	K	-	2	0	CACNA1F	48952625	0.261000	0.24063	0.011000	0.14972	0.006000	0.05464	1.466000	0.35310	0.750000	0.32877	-0.314000	0.08810	AAA	CACNA1F	-	NULL	ENSG00000102001		0.463	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	HGNC	protein_coding	OTTHUMT00000358157.1	504	0.00	0	T	NM_005183		49065681	49065681	-1	no_start_codon	ENST00000486943	ensembl	human	putative	69_37n	missense	314	20.85	83	SNP	0.015	A
CCDC3	83643	genome.wustl.edu	37	10	13043199	13043199	+	Silent	SNP	G	G	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr10:13043199G>A	ENST00000378825.3	-	1	498	c.372C>T	c.(370-372)ctC>ctT	p.L124L	CCDC3_ENST00000378839.1_Intron	NM_031455.3	NP_113643.1	Q9BQI4	CCDC3_HUMAN	coiled-coil domain containing 3	124						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)	11		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)			GGGCTCACCTGAGGAAGAAGA	0.672																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BC051334	CCDS7093.1, CCDS60484.1	10p14	2004-02-13			ENSG00000151468	ENSG00000151468			23813	protein-coding gene	gene with protein product							Standard	NM_031455		Approved	DKFZp761F241	uc001ilq.1	Q9BQI4	OTTHUMG00000017689	ENST00000378825.3:c.372C>T	10.37:g.13043199G>A			Q5VYV8|Q5VYV9	Silent	SNP	NULL	p.L124	ENST00000378825.3	37	c.372	CCDS7093.1	10																																																																																			CCDC3	-	NULL	ENSG00000151468		0.672	CCDC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC3	HGNC	protein_coding	OTTHUMT00000046829.1	8	0.00	0	G	NM_031455		13043199	13043199	-1	no_errors	ENST00000378825	ensembl	human	known	69_37n	silent	7	36.36	4	SNP	1.000	A
CCDC69	26112	genome.wustl.edu	37	5	150566946	150566946	+	Splice_Site	SNP	C	C	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr5:150566946C>A	ENST00000355417.2	-	5	568		c.e5+1		CCDC69_ENST00000521308.1_Splice_Site	NM_015621.2	NP_056436.2	A6NI79	CCD69_HUMAN	coiled-coil domain containing 69											haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|stomach(1)	9		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCCCCTCTCACCTGCTGGGTA	0.547																																						dbGAP											0													83.0	78.0	79.0					5																	150566946		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS4312.1	5q33.1	2008-02-05			ENSG00000198624	ENSG00000198624			24487	protein-coding gene	gene with protein product						12477932	Standard	NM_015621		Approved	FLJ13705, DKFZP434C171	uc011dcq.3	A6NI79	OTTHUMG00000130127	ENST00000355417.2:c.393+1G>T	5.37:g.150566946C>A			A8K9X6	Splice_Site	SNP	-	e5+1	ENST00000355417.2	37	c.393+1	CCDS4312.1	5	.	.	.	.	.	.	.	.	.	.	C	12.14	1.847595	0.32606	.	.	ENSG00000198624	ENST00000355417	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.146	0.59461	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CCDC69	150547139	1.000000	0.71417	1.000000	0.80357	0.250000	0.25880	3.362000	0.52314	2.468000	0.83385	0.555000	0.69702	.	CCDC69	-	-	ENSG00000198624		0.547	CCDC69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC69	HGNC	protein_coding	OTTHUMT00000252435.1	254	0.39	1	C	NM_015621	Intron	150566946	150566946	-1	no_errors	ENST00000355417	ensembl	human	known	69_37n	splice_site	138	22.78	41	SNP	1.000	A
CDK5RAP1	51654	genome.wustl.edu	37	20	31961928	31961928	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr20:31961928G>A	ENST00000357886.4	-	10	1393	c.1240C>T	c.(1240-1242)Cgg>Tgg	p.R414W	CDK5RAP1_ENST00000477105.1_5'UTR|CDK5RAP1_ENST00000544843.1_Missense_Mutation_p.R400W|CDK5RAP1_ENST00000346416.2_Missense_Mutation_p.R400W|CDK5RAP1_ENST00000473997.1_Missense_Mutation_p.R310W|CDK5RAP1_ENST00000339269.5_Missense_Mutation_p.R323W			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	414					brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						GACCCCCTCCGCATGGCCTCC	0.512																																						dbGAP											0													133.0	132.0	132.0					20																	31961928		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.1240C>T	20.37:g.31961928G>A	ENSP00000350558:p.Arg414Trp		A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Missense_Mutation	SNP	pfam_rSAM,pfam_Methylthiotransferase_N,pfam_TRAM_dom,smart_Elp3/MiaB/NifB,pfscan_TRAM_dom,tigrfam_MiaB_methiolase,tigrfam_Methylthiotransferase	p.R414W	ENST00000357886.4	37	c.1240		20	.	.	.	.	.	.	.	.	.	.	G	15.72	2.917291	0.52546	.	.	ENSG00000101391	ENST00000346416;ENST00000357886;ENST00000339269;ENST00000452723;ENST00000544843	T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87	5.77	2.41	0.29592	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Radical SAM (1);	0.000000	0.85682	D	0.000000	T	0.61236	0.2331	H	0.96547	3.84	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.917;0.999;0.999;1.0;0.999;0.998	T	0.72001	-0.4422	10	0.66056	D	0.02	-13.4748	12.1453	0.54020	0.0:0.0:0.3695:0.6305	.	323;414;400;400;400;310	Q96SZ6-4;Q96SZ6;Q675N5;Q53H36;Q96SZ6-3;Q96SZ6-2	.;CK5P1_HUMAN;.;.;.;.	W	400;414;323;310;400	ENSP00000217372:R400W;ENSP00000350558:R414W;ENSP00000341840:R323W;ENSP00000408133:R310W;ENSP00000439034:R400W	ENSP00000341840:R323W	R	-	1	2	CDK5RAP1	31425589	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	1.209000	0.32357	0.715000	0.32103	0.655000	0.94253	CGG	CDK5RAP1	-	pfam_rSAM,smart_Elp3/MiaB/NifB,tigrfam_MiaB_methiolase,tigrfam_Methylthiotransferase	ENSG00000101391		0.512	CDK5RAP1-011	KNOWN	basic	protein_coding	CDK5RAP1	HGNC	protein_coding	OTTHUMT00000078697.1	205	0.00	0	G	NM_016408		31961928	31961928	-1	no_errors	ENST00000357886	ensembl	human	known	69_37n	missense	147	14.04	24	SNP	1.000	A
CEP68	23177	genome.wustl.edu	37	2	65298808	65298808	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr2:65298808C>T	ENST00000377990.2	+	3	781	c.578C>T	c.(577-579)cCt>cTt	p.P193L	CEP68_ENST00000260569.4_Missense_Mutation_p.P193L|CEP68_ENST00000546106.1_Missense_Mutation_p.P193L|RAB1A_ENST00000494188.1_Intron|CEP68_ENST00000537589.1_5'UTR|CEP68_ENST00000497039.1_3'UTR	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	193					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						GCAGCTCAGCCTTCCAGCTGC	0.632																																						dbGAP											0													63.0	56.0	58.0					2																	65298808		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.578C>T	2.37:g.65298808C>T	ENSP00000367229:p.Pro193Leu		B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Missense_Mutation	SNP	NULL	p.P193L	ENST00000377990.2	37	c.578	CCDS1880.2	2	.	.	.	.	.	.	.	.	.	.	C	1.933	-0.445550	0.04604	.	.	ENSG00000011523	ENST00000377990;ENST00000546106;ENST00000260569;ENST00000545501	T;T;T	0.12039	2.72;2.72;2.72	5.7	3.19	0.36642	.	0.440276	0.22438	N	0.060056	T	0.04452	0.0122	N	0.03608	-0.345	0.09310	N	0.999999	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.44590	-0.9318	10	0.02654	T	1	-2.0992	7.6242	0.28202	0.0:0.2984:0.0:0.7016	.	181;193;193;193;193	F5H3N9;F5H2Y2;Q76N32;Q76N32-2;Q05C09	.;.;CEP68_HUMAN;.;.	L	193;193;193;181	ENSP00000367229:P193L;ENSP00000438306:P193L;ENSP00000260569:P193L	ENSP00000260569:P193L	P	+	2	0	CEP68	65152312	0.000000	0.05858	0.018000	0.16275	0.292000	0.27327	0.125000	0.15749	0.361000	0.24292	-0.345000	0.07892	CCT	CEP68	-	NULL	ENSG00000011523		0.632	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP68	HGNC	protein_coding	OTTHUMT00000251727.2	82	0.00	0	C	NM_015147		65298808	65298808	+1	no_errors	ENST00000377990	ensembl	human	known	69_37n	missense	62	12.50	9	SNP	0.000	T
CSMD2	114784	genome.wustl.edu	37	1	34554791	34554791	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr1:34554791T>C	ENST00000373381.4	-	2	367	c.191A>G	c.(190-192)cAg>cGg	p.Q64R		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	24	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CGTGCAGTTCTGGCCTGGGAA	0.507																																						dbGAP											0													59.0	54.0	56.0					1																	34554791		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.191A>G	1.37:g.34554791T>C	ENSP00000362479:p.Gln64Arg		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.Q64R	ENST00000373381.4	37	c.191		1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.175055	0.78564	.	.	ENSG00000121904	ENST00000373381	T	0.24538	1.85	5.27	4.06	0.47325	CUB (1);	0.215361	0.31071	U	0.008303	T	0.26738	0.0654	N	0.16790	0.44	0.80722	D	1	P;D	0.56287	0.936;0.975	P;P	0.61201	0.885;0.848	T	0.02371	-1.1169	10	0.15499	T	0.54	.	11.4067	0.49902	0.0:0.0:0.151:0.849	.	24;64	Q7Z408;E7EUA6	CSMD2_HUMAN;.	R	64	ENSP00000362479:Q64R	ENSP00000241312:Q24R	Q	-	2	0	CSMD2	34327378	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.239000	0.72356	2.116000	0.64780	0.533000	0.62120	CAG	CSMD2	-	NULL	ENSG00000121904		0.507	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		225	0.44	1	T	NM_052896		34554791	34554791	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	155	11.80	21	SNP	1.000	C
CTSS	1520	genome.wustl.edu	37	1	150722597	150722597	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr1:150722597C>A	ENST00000368985.3	-	6	938	c.678G>T	c.(676-678)aaG>aaT	p.K226N	CTSS_ENST00000480760.1_Intron|CTSS_ENST00000448301.2_Missense_Mutation_p.K176N	NM_001199739.1|NM_004079.4	NP_001186668.1|NP_004070.3	P25774	CATS_HUMAN	cathepsin S	226					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|basement membrane disassembly (GO:0034769)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of inflammatory response (GO:0050729)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane (GO:0016020)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	15	all_cancers(9;6.17e-52)|all_epithelial(9;9.7e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.00146)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|Epithelial(6;5.02e-21)|all cancers(9;1.28e-20)|OV - Ovarian serous cystadenocarcinoma(6;1.09e-14)|BRCA - Breast invasive adenocarcinoma(12;0.00501)|LUSC - Lung squamous cell carcinoma(543;0.171)			GTTCAGTGTACTTTGAACATG	0.398																																						dbGAP											0													117.0	96.0	103.0					1																	150722597		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90696	CCDS968.1, CCDS55634.1	1q21	2008-02-05			ENSG00000163131	ENSG00000163131	3.4.22.27	"""Cathepsins"""	2545	protein-coding gene	gene with protein product		116845				1373132	Standard	NM_001199739		Approved		uc001evn.3	P25774	OTTHUMG00000035010	ENST00000368985.3:c.678G>T	1.37:g.150722597C>A	ENSP00000357981:p.Lys226Asn		B4DWC9|D3DV05|Q5T5I0|Q6FHS5|Q9BUG3	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,pfam_Prot_inhib_I29,smart_Prot_inhib_I29,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.K226N	ENST00000368985.3	37	c.678	CCDS968.1	1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.037124	0.35893	.	.	ENSG00000163131	ENST00000448301;ENST00000368985	D;T	0.97430	-4.38;2.03	5.55	1.6	0.23607	Peptidase C1A, papain C-terminal (2);	0.390704	0.30999	N	0.008444	D	0.87842	0.6279	N	0.12502	0.225	0.42862	D	0.994115	P;B	0.36909	0.573;0.423	B;B	0.39465	0.3;0.272	D	0.85340	0.1095	10	0.72032	D	0.01	.	8.0716	0.30693	0.0:0.6016:0.0:0.3984	.	176;226	B4DWC9;P25774	.;CATS_HUMAN	N	176;226	ENSP00000408414:K176N;ENSP00000357981:K226N	ENSP00000357981:K226N	K	-	3	2	CTSS	148989221	0.001000	0.12720	0.599000	0.28851	0.513000	0.34164	-0.403000	0.07214	0.304000	0.22809	0.467000	0.42956	AAG	CTSS	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C	ENSG00000163131		0.398	CTSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSS	HGNC	protein_coding	OTTHUMT00000084737.1	279	0.00	0	C	NM_004079		150722597	150722597	-1	no_errors	ENST00000368985	ensembl	human	known	69_37n	missense	247	18.21	55	SNP	0.946	A
CUL5	8065	genome.wustl.edu	37	11	107965573	107965573	+	Silent	SNP	C	C	T			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr11:107965573C>T	ENST00000393094.2	+	15	2218	c.1602C>T	c.(1600-1602)ggC>ggT	p.G534G		NM_003478.3	NP_003469.2	Q93034	CUL5_HUMAN	cullin 5	534					calcium ion transmembrane transport (GO:0070588)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cytosolic calcium ion homeostasis (GO:0051480)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|response to osmotic stress (GO:0006970)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul5-RING ubiquitin ligase complex (GO:0031466)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|receptor activity (GO:0004872)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		TGAATGCTGGCGCCTGGTCAA	0.328																																						dbGAP											0													48.0	52.0	51.0					11																	107965573		2200	4298	6498	-	-	-	SO:0001819	synonymous_variant	0			X81882	CCDS31668.1	11q22.3	2011-05-24			ENSG00000166266	ENSG00000166266			2556	protein-coding gene	gene with protein product		601741				8681378, 9037604	Standard	XM_005271682		Approved	VACM-1	uc001pjv.3	Q93034	OTTHUMG00000166369	ENST00000393094.2:c.1602C>T	11.37:g.107965573C>T			A8K960|O14766|Q9BZC6	Silent	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.G534	ENST00000393094.2	37	c.1602	CCDS31668.1	11																																																																																			CUL5	-	pfam_Cullin_N,superfamily_Cullin_homology,smart_Cullin_homology,pfscan_Cullin_homology	ENSG00000166266		0.328	CUL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL5	HGNC	protein_coding	OTTHUMT00000389429.1	116	0.00	0	C			107965573	107965573	+1	no_errors	ENST00000393094	ensembl	human	known	69_37n	silent	89	28.23	35	SNP	1.000	T
F7	2155	genome.wustl.edu	37	13	113771885	113771885	+	Silent	SNP	C	C	T			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr13:113771885C>T	ENST00000375581.3	+	8	815	c.780C>T	c.(778-780)aaC>aaT	p.N260N	F7_ENST00000541084.1_Silent_p.N191N|F7_ENST00000346342.3_Silent_p.N238N	NM_000131.4	NP_000122.1	P08709	FA7_HUMAN	coagulation factor VII (serum prothrombin conversion accelerator)	260	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|cellular protein metabolic process (GO:0044267)|circadian rhythm (GO:0007623)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell migration (GO:0030335)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to growth hormone (GO:0060416)|response to vitamin K (GO:0032571)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	AAATCAAGAACTGGAGGAACC	0.617																																						dbGAP											0													166.0	156.0	159.0					13																	113771885		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9528.1, CCDS9529.1, CCDS73602.1	13q34	2014-02-03			ENSG00000057593	ENSG00000057593	3.4.21.21		3544	protein-coding gene	gene with protein product	"""eptacog alfa"", ""FVII coagulation protein"", ""factor VII"""	613878				3264725, 2511201	Standard	NM_000131		Approved		uc001vsv.4	P08709	OTTHUMG00000017373	ENST00000375581.3:c.780C>T	13.37:g.113771885C>T			B0YJC8|Q14339|Q5JVF1|Q5JVF2|Q9UD52|Q9UD53|Q9UD54	Silent	SNP	pirsf_Pept_S1A_FX,pfam_Peptidase_S1_S6,pfam_GLA_domain,pfam_Peptidase_S1A_nudel,pfam_EGF-like_dom,superfamily_Pept_cys/ser_Trypsin-like,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,prints_GLA_domain,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Peptidase_S1_S6	p.N260	ENST00000375581.3	37	c.780	CCDS9528.1	13																																																																																			F7	-	pirsf_Pept_S1A_FX,pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000057593		0.617	F7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	F7	HGNC	protein_coding	OTTHUMT00000045838.4	258	0.00	0	C	NM_000131		113771885	113771885	+1	no_errors	ENST00000375581	ensembl	human	known	69_37n	silent	194	10.96	24	SNP	0.000	T
ABHD17A	81926	genome.wustl.edu	37	19	1877565	1877565	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr19:1877565C>A	ENST00000292577.7	-	4	1082	c.649G>T	c.(649-651)Ggc>Tgc	p.G217C	ABHD17A_ENST00000590661.1_Silent_p.R185R|CTB-31O20.2_ENST00000565797.1_lincRNA|ABHD17A_ENST00000250974.9_Missense_Mutation_p.G268C|CTB-31O20.9_ENST00000592720.1_lincRNA	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	217						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										ACGCGCATGCCCGAGGTGAGC	0.716																																						dbGAP											0													12.0	15.0	14.0					19																	1877565		2141	4185	6326	-	-	-	SO:0001583	missense	0			BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.649G>T	19.37:g.1877565C>A	ENSP00000292577:p.Gly217Cys		A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Missense_Mutation	SNP	pfam_Dienelactn_hydro	p.G268C	ENST00000292577.7	37	c.802	CCDS45902.1	19	.	.	.	.	.	.	.	.	.	.	c	18.47	3.630936	0.67015	.	.	ENSG00000129968	ENST00000250974;ENST00000292577	T;T	0.45668	0.89;0.89	4.36	3.3	0.37823	.	0.149237	0.64402	D	0.000013	T	0.69744	0.3145	M	0.91300	3.195	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.77148	-0.2694	10	0.87932	D	0	-17.2654	13.2018	0.59772	0.0:0.8384:0.1616:0.0	.	217;268;217	Q96GS6;Q96GS6-2;Q96GS6-3	F18A1_HUMAN;.;.	C	268;217	ENSP00000250974:G268C;ENSP00000292577:G217C	ENSP00000250974:G268C	G	-	1	0	FAM108A1	1828565	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	7.711000	0.84669	0.925000	0.37094	-0.305000	0.09177	GGC	FAM108A1	-	pfam_Dienelactn_hydro	ENSG00000129968		0.716	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM108A1	HGNC	protein_coding	OTTHUMT00000415556.2	44	0.00	0	C	NM_031213		1877565	1877565	-1	no_errors	ENST00000250974	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	1.000	A
FAM124A	220108	genome.wustl.edu	37	13	51854669	51854669	+	Silent	SNP	G	G	A	rs200609715		TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr13:51854669G>A	ENST00000322475.8	+	4	1053	c.918G>A	c.(916-918)ccG>ccA	p.P306P	FAM124A_ENST00000280057.6_Silent_p.P342P	NM_001242312.1	NP_001229241.1	Q86V42	F124A_HUMAN	family with sequence similarity 124A	306										breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|skin(1)	26		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		CTCCTTTGCCGAGCACTGCTG	0.597													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20134	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													81.0	77.0	78.0					13																	51854669		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK096364	CCDS9427.1, CCDS55900.1	13q14.3	2006-08-11			ENSG00000150510	ENSG00000150510			26413	protein-coding gene	gene with protein product						12975309	Standard	NM_145019		Approved	FLJ30707	uc001vff.2	Q86V42	OTTHUMG00000016942	ENST00000322475.8:c.918G>A	13.37:g.51854669G>A			A2A324|Q8N8P9|Q8NE66|Q96NJ9	Silent	SNP	NULL	p.P342	ENST00000322475.8	37	c.1026	CCDS55900.1	13																																																																																			FAM124A	-	NULL	ENSG00000150510		0.597	FAM124A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM124A	HGNC	protein_coding	OTTHUMT00000045019.3	171	0.00	0	G	NM_145019		51854669	51854669	+1	no_errors	ENST00000280057	ensembl	human	known	69_37n	silent	123	19.75	31	SNP	0.000	A
FAM171B	165215	genome.wustl.edu	37	2	187626606	187626606	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr2:187626606A>T	ENST00000304698.5	+	8	1740	c.1537A>T	c.(1537-1539)Agg>Tgg	p.R513W		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	513						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)	p.R513G(1)		NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						AGATGAAAAGAGGTATCTCAC	0.423																																						dbGAP											1	Substitution - Missense(1)	lung(1)											80.0	74.0	76.0					2																	187626606		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.1537A>T	2.37:g.187626606A>T	ENSP00000304108:p.Arg513Trp		Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	pfam_Uncharacterised_FAM171	p.R513W	ENST00000304698.5	37	c.1537	CCDS33347.1	2	.	.	.	.	.	.	.	.	.	.	A	15.90	2.969816	0.53614	.	.	ENSG00000144369	ENST00000304698	T	0.36699	1.24	5.12	-0.29	0.12847	.	0.169978	0.53938	D	0.000056	T	0.40119	0.1104	L	0.36672	1.1	0.40345	D	0.979078	D;D	0.76494	0.999;0.999	D;D	0.64042	0.921;0.921	T	0.11494	-1.0585	10	0.38643	T	0.18	-10.0558	8.8787	0.35360	0.3779:0.5471:0.075:0.0	.	513;514	Q6P995;A8K122	F171B_HUMAN;.	W	513	ENSP00000304108:R513W	ENSP00000304108:R513W	R	+	1	2	FAM171B	187334851	0.537000	0.26386	0.969000	0.41365	0.989000	0.77384	0.011000	0.13264	-0.190000	0.10465	0.533000	0.62120	AGG	FAM171B	-	pfam_Uncharacterised_FAM171	ENSG00000144369		0.423	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171B	HGNC	protein_coding	OTTHUMT00000334679.1	293	0.00	0	A	NM_177454		187626606	187626606	+1	no_errors	ENST00000304698	ensembl	human	known	69_37n	missense	227	28.75	92	SNP	0.944	T
GANAB	23193	genome.wustl.edu	37	11	62400200	62400200	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr11:62400200C>G	ENST00000356638.3	-	9	849	c.833G>C	c.(832-834)cGc>cCc	p.R278P	GANAB_ENST00000534422.1_5'Flank|GANAB_ENST00000540933.1_Missense_Mutation_p.R181P|GANAB_ENST00000534779.1_Missense_Mutation_p.R186P|GANAB_ENST00000346178.4_Missense_Mutation_p.R300P	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	278					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	ATTGTAGAGGCGATATGGCTC	0.547																																					Melanoma(23;1005 1074 15747 18937)	dbGAP											0													170.0	161.0	164.0					11																	62400200		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.833G>C	11.37:g.62400200C>G	ENSP00000349053:p.Arg278Pro		A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd	p.R300P	ENST00000356638.3	37	c.899	CCDS8026.1	11	.	.	.	.	.	.	.	.	.	.	C	26.9	4.777104	0.90195	.	.	ENSG00000089597	ENST00000346178;ENST00000356638;ENST00000534779;ENST00000540933	D;D;D;D	0.93247	-3.19;-3.19;-3.19;-3.19	5.19	5.19	0.71726	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.85682	D	0.000000	D	0.97807	0.9280	H	0.96111	3.77	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	1.0;1.0;0.998;0.996	D	0.98727	1.0711	10	0.87932	D	0	-17.1059	16.2545	0.82505	0.0:1.0:0.0:0.0	.	164;186;278;300	B4DIW2;E9PKU7;Q14697;Q14697-2	.;.;GANAB_HUMAN;.	P	300;278;186;181	ENSP00000340466:R300P;ENSP00000349053:R278P;ENSP00000435306:R186P;ENSP00000442962:R181P	ENSP00000340466:R300P	R	-	2	0	GANAB	62156776	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.612000	0.82975	2.706000	0.92434	0.455000	0.32223	CGC	GANAB	-	superfamily_Glyco_hydro-type_carb-bd	ENSG00000089597		0.547	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GANAB	HGNC	protein_coding	OTTHUMT00000395689.1	141	0.00	0	C	NM_198334		62400200	62400200	-1	no_errors	ENST00000346178	ensembl	human	known	69_37n	missense	82	24.77	27	SNP	1.000	G
GYG2	8908	genome.wustl.edu	37	X	2774660	2774660	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chrX:2774660C>G	ENST00000381163.3	+	7	984	c.702C>G	c.(700-702)ttC>ttG	p.F234L	GYG2_ENST00000398806.3_Missense_Mutation_p.F203L|GYG2_ENST00000338623.5_Missense_Mutation_p.F234L|GYG2_ENST00000542787.1_Missense_Mutation_p.F234L|GYG2_ENST00000381161.1_3'UTR|GYG2-AS1_ENST00000445107.1_RNA	NM_001079855.1|NM_001184702.1|NM_003918.2	NP_001073324.1|NP_001171631.1|NP_003909.2	O15488	GLYG2_HUMAN	glycogenin 2	234					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	glycogenin glucosyltransferase activity (GO:0008466)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCCCTGCCTTCAAGCAGTAAG	0.488																																						dbGAP											0													129.0	95.0	106.0					X																	2774660		2203	4299	6502	-	-	-	SO:0001583	missense	0			U94361	CCDS14121.1, CCDS48074.1	Xp22.3	2013-02-22			ENSG00000056998	ENSG00000056998	2.4.1.186	"""Glycosyltransferase family 8 domain containing"""	4700	protein-coding gene	gene with protein product	"""glycogenin glucosyltransferase"""	300198				9857012	Standard	NM_001079855		Approved	GN-2	uc004cqs.1	O15488	OTTHUMG00000021079	ENST00000381163.3:c.702C>G	X.37:g.2774660C>G	ENSP00000370555:p.Phe234Leu		B7WNN6|O15485|O15486|O15487|O15489|O15490	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.F234L	ENST00000381163.3	37	c.702	CCDS14121.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.20|14.20	2.465932|2.465932	0.43839|0.43839	.|.	.|.	ENSG00000056998|ENSG00000056998	ENST00000398806;ENST00000381163;ENST00000338623;ENST00000542787|ENST00000381157	T;T;T;T|.	0.62498|.	0.02;0.02;0.02;0.02|.	3.19|3.19	3.19|3.19	0.36642|0.36642	.|.	0.000000|.	0.64402|.	D|.	0.000015|.	T|T	0.58750|0.58750	0.2144|0.2144	L|L	0.45137|0.45137	1.4|1.4	0.39175|0.39175	D|D	0.96266|0.96266	P;D;D;P;P;P|.	0.71674|.	0.858;0.998;0.998;0.883;0.921;0.936|.	P;D;D;P;P;D|.	0.85130|.	0.858;0.991;0.997;0.893;0.857;0.939|.	T|T	0.59804|0.59804	-0.7385|-0.7385	10|5	0.59425|.	D|.	0.04|.	.|.	14.2098|14.2098	0.65756|0.65756	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	234;234;194;203;203;234|.	O15488-6;O15488-4;O15488-3;A8K8Y1;O15488-2;O15488|.	.;.;.;.;.;GLYG2_HUMAN|.	L|E	203;234;234;234|53	ENSP00000381786:F203L;ENSP00000370555:F234L;ENSP00000341273:F234L;ENSP00000446092:F234L|.	ENSP00000341273:F234L|.	F|Q	+|+	3|1	2|0	GYG2|GYG2	2784660|2784660	1.000000|1.000000	0.71417|0.71417	0.210000|0.210000	0.23637|0.23637	0.419000|0.419000	0.31324|0.31324	1.464000|1.464000	0.35288|0.35288	1.400000|1.400000	0.46741|0.46741	0.523000|0.523000	0.50628|0.50628	TTC|CAA	GYG2	-	pfam_Glyco_trans_8	ENSG00000056998		0.488	GYG2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GYG2	HGNC	protein_coding	OTTHUMT00000055645.1	158	0.00	0	C	NM_003918		2774660	2774660	+1	no_errors	ENST00000381163	ensembl	human	known	69_37n	missense	81	16.49	16	SNP	1.000	G
HPSE	10855	genome.wustl.edu	37	4	84234382	84234382	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr4:84234382A>T	ENST00000405413.2	-	5	694	c.558T>A	c.(556-558)ttT>ttA	p.F186L	HPSE_ENST00000513463.1_Intron|HPSE_ENST00000311412.5_Missense_Mutation_p.F186L|HPSE_ENST00000512196.1_Missense_Mutation_p.F186L	NM_006665.5	NP_006656.2	Q9Y251	HPSE_HUMAN	heparanase	186					carbohydrate metabolic process (GO:0005975)|cell-matrix adhesion (GO:0007160)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|positive regulation of blood coagulation (GO:0030194)|positive regulation of hair follicle development (GO:0051798)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation vascular endothelial growth factor production (GO:0010575)|proteoglycan metabolic process (GO:0006029)|regulation of hair follicle development (GO:0051797)|small molecule metabolic process (GO:0044281)|vascular wound healing (GO:0061042)	extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)	beta-glucuronidase activity (GO:0004566)|heparanase activity (GO:0030305)|protein dimerization activity (GO:0046983)|syndecan binding (GO:0045545)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	20		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Dalteparin(DB06779)|Heparin(DB01109)	CATTTAGGCCAAAGATCAAGT	0.408																																						dbGAP											0													109.0	98.0	102.0					4																	84234382		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF144325	CCDS3602.1, CCDS54774.1, CCDS56337.1	4q21.3	2008-02-05			ENSG00000173083	ENSG00000173083			5164	protein-coding gene	gene with protein product		604724				10395325, 10395326	Standard	NM_006665		Approved	HPA, HSE1, HPSE1	uc003hoj.4	Q9Y251	OTTHUMG00000130425	ENST00000405413.2:c.558T>A	4.37:g.84234382A>T	ENSP00000384262:p.Phe186Leu		A9JIG7|C7F7I3|C7F7I4|E9PCA9|E9PGR1|Q53GE5|Q9UL39	Missense_Mutation	SNP	pfam_Glyco_hydro_79,superfamily_Glycoside_hydrolase_SF	p.F186L	ENST00000405413.2	37	c.558	CCDS3602.1	4	.	.	.	.	.	.	.	.	.	.	A	19.12	3.766450	0.69878	.	.	ENSG00000173083	ENST00000311412;ENST00000405413;ENST00000512196	T;T;T	0.42900	0.96;0.96;0.96	4.57	0.848	0.18966	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.053386	0.85682	D	0.000000	T	0.63896	0.2550	M	0.89214	3.015	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.91635	0.994;0.999	T	0.62704	-0.6798	10	0.59425	D	0.04	-16.5214	8.1167	0.30946	0.7585:0.0:0.2415:0.0	.	186;186	E9PCA9;Q9Y251	.;HPSE_HUMAN	L	186	ENSP00000308107:F186L;ENSP00000384262:F186L;ENSP00000423265:F186L	ENSP00000308107:F186L	F	-	3	2	HPSE	84453406	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	2.942000	0.49018	0.017000	0.15025	0.397000	0.26171	TTT	HPSE	-	pfam_Glyco_hydro_79,superfamily_Glycoside_hydrolase_SF	ENSG00000173083		0.408	HPSE-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	HPSE	HGNC	protein_coding	OTTHUMT00000252812.2	234	0.00	0	A	NM_006665		84234382	84234382	-1	no_errors	ENST00000311412	ensembl	human	known	69_37n	missense	212	20.00	53	SNP	1.000	T
HTR5A	3361	genome.wustl.edu	37	7	154862779	154862779	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr7:154862779G>T	ENST00000287907.2	+	1	746	c.170G>T	c.(169-171)tGg>tTg	p.W57L	HTR5A-AS1_ENST00000395731.2_Missense_Mutation_p.Q79K|HTR5A-AS1_ENST00000493904.1_5'UTR|HTR5A-AS1_ENST00000543018.1_Missense_Mutation_p.Q79K	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	57					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	ACGTTCGCCTGGAACCTGCTG	0.652																																						dbGAP											0													91.0	69.0	76.0					7																	154862779		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.170G>T	7.37:g.154862779G>T	ENSP00000287907:p.Trp57Leu		Q2M2D2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_5HT5A_rcpt,prints_5HT_rcpt	p.W57L	ENST00000287907.2	37	c.170	CCDS5936.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.2|27.2	4.809164|4.809164	0.90707|0.90707	.|.	.|.	ENSG00000220575|ENSG00000157219	ENST00000395731;ENST00000543018|ENST00000287907	.|T	.|0.33654	.|1.4	4.44|4.44	4.44|4.44	0.53790|0.53790	.|GPCR, rhodopsin-like superfamily (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.54287|0.54287	0.1849|0.1849	L|L	0.46157|0.46157	1.445|1.445	0.80722|0.80722	D|D	1|1	P|D	0.46142|0.89917	0.873|1.0	B|D	0.44044|0.97110	0.439|1.0	T|T	0.58064|0.58064	-0.7702|-0.7702	8|10	0.87932|0.66056	D|D	0|0.02	.|.	17.2701|17.2701	0.87098|0.87098	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	79|57	B7Z8E6|P47898	.|5HT5A_HUMAN	K|L	79|57	.|ENSP00000287907:W57L	ENSP00000379080:Q79K|ENSP00000287907:W57L	Q|W	-|+	1|2	0|0	AC093726.4|HTR5A	154493712|154493712	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.131000|9.131000	0.94446|0.94446	2.309000|2.309000	0.77851|0.77851	0.467000|0.467000	0.42956|0.42956	CAG|TGG	HTR5A	-	pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000157219		0.652	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR5A	HGNC	protein_coding	OTTHUMT00000322240.1	124	0.00	0	G	NM_024012		154862779	154862779	+1	no_errors	ENST00000287907	ensembl	human	known	69_37n	missense	58	13.43	9	SNP	1.000	T
APOBR	55911	genome.wustl.edu	37	16	28511052	28511052	+	IGR	SNP	C	C	G			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr16:28511052C>G	ENST00000431282.1	+	0	3414				IL27_ENST00000356897.1_Missense_Mutation_p.V218L			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor						cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						AACTCCCGCACGGCCCGAGAT	0.662																																						dbGAP											0													33.0	32.0	33.0					16																	28511052		2195	4299	6494	-	-	-	SO:0001628	intergenic_variant	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83			16.37:g.28511052C>G			H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	superfamily_4_helix_cytokine-like_core	p.V218L	ENST00000431282.1	37	c.652		16	.	.	.	.	.	.	.	.	.	.	C	13.99	2.401174	0.42613	.	.	ENSG00000197272	ENST00000356897	T	0.36878	1.23	3.93	0.538	0.17150	.	0.229991	0.23014	N	0.052932	T	0.25457	0.0619	L	0.48642	1.525	0.23673	N	0.997146	B	0.23377	0.084	B	0.21360	0.034	T	0.19031	-1.0318	10	0.62326	D	0.03	-10.8065	3.8672	0.09021	0.0:0.5509:0.2:0.2491	.	218	Q8NEV9	IL27A_HUMAN	L	218	ENSP00000349365:V218L	ENSP00000349365:V218L	V	-	1	0	IL27	28418553	0.192000	0.23301	0.912000	0.35992	0.981000	0.71138	0.699000	0.25586	0.262000	0.21774	0.479000	0.44913	GTG	IL27	-	superfamily_4_helix_cytokine-like_core	ENSG00000197272		0.662	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	IL27	HGNC	protein_coding		115	0.00	0	C	NM_182804		28511052	28511052	-1	no_errors	ENST00000356897	ensembl	human	known	69_37n	missense	48	17.24	10	SNP	0.722	G
KDM3B	51780	genome.wustl.edu	37	5	137771360	137771360	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr5:137771360G>A	ENST00000314358.5	+	24	5457	c.5257G>A	c.(5257-5259)Gct>Act	p.A1753T	KDM3B_ENST00000394866.1_Missense_Mutation_p.A1409T|KDM3B_ENST00000542866.1_Missense_Mutation_p.A785T	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1753					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						CACCCTCAAGGCTCATGAATC	0.498																																						dbGAP											0													102.0	83.0	90.0					5																	137771360		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.5257G>A	5.37:g.137771360G>A	ENSP00000326563:p.Ala1753Thr		A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.A1753T	ENST00000314358.5	37	c.5257	CCDS34242.1	5	.	.	.	.	.	.	.	.	.	.	G	21.4	4.143741	0.77888	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	T;T;T	0.71817	-0.03;-0.6;-0.52	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.81612	0.4859	L	0.50333	1.59	0.80722	D	1	D;B	0.89917	1.0;0.23	D;B	0.87578	0.998;0.118	T	0.76719	-0.2856	10	0.31617	T	0.26	-5.422	20.5195	0.99215	0.0:0.0:1.0:0.0	.	1409;1753	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	T	1753;1543;1409;785	ENSP00000326563:A1753T;ENSP00000378335:A1409T;ENSP00000439462:A785T	ENSP00000326563:A1753T	A	+	1	0	KDM3B	137799259	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.863000	0.87023	2.855000	0.98099	0.655000	0.94253	GCT	KDM3B	-	NULL	ENSG00000120733		0.498	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3B	HGNC	protein_coding	OTTHUMT00000373597.1	255	0.00	0	G	NM_016604		137771360	137771360	+1	no_errors	ENST00000314358	ensembl	human	known	69_37n	missense	163	22.75	48	SNP	1.000	A
PLPPR3	79948	genome.wustl.edu	37	19	815750	815750	+	Silent	SNP	G	G	A	rs551451613	byFrequency	TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr19:815750G>A	ENST00000520876.3	-	3	255	c.177C>T	c.(175-177)ctC>ctT	p.L59L	LPPR3_ENST00000359894.2_Silent_p.L59L|MIR3187_ENST00000583431.1_RNA	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		59						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										AGGGCATGGAGAGAGTGCGGT	0.617													G|||	10	0.00199681	0.0	0.0	5008	,	,		18126	0.0		0.0	False		,,,				2504	0.0102					dbGAP											0													71.0	50.0	57.0					19																	815750		2197	4299	6496	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000520876.3:c.177C>T	19.37:g.815750G>A			Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Silent	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.L59	ENST00000520876.3	37	c.177	CCDS58636.1	19																																																																																			hsa-mir-3187	-	superfamily_P_Acid_Pase_2/haloperoxidase	ENSG00000129951		0.617	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR3	miRBase	protein_coding	OTTHUMT00000379096.3	88	0.00	0	G			815750	815750	-1	no_errors	ENST00000359894	ensembl	human	known	69_37n	silent	56	17.39	12	SNP	0.997	A
MGAM	8972	genome.wustl.edu	37	7	141705436	141705436	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr7:141705436A>G	ENST00000549489.2	+	2	201	c.106A>G	c.(106-108)Aaa>Gaa	p.K36E	MGAM_ENST00000475668.2_Missense_Mutation_p.K36E	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	36					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GCTTTTAGCCAAAGAGTCACT	0.358																																						dbGAP											0													109.0	101.0	104.0					7																	141705436		1847	4107	5954	-	-	-	SO:0001583	missense	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.106A>G	7.37:g.141705436A>G	ENSP00000447378:p.Lys36Glu		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.K36E	ENST00000549489.2	37	c.106	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	A	11.02	1.516110	0.27123	.	.	ENSG00000257335	ENST00000465654;ENST00000549489;ENST00000497673;ENST00000475668	T;D;T	0.88896	-0.72;-2.44;0.69	4.52	0.615	0.17608	.	1.999720	0.02163	N	0.058946	T	0.78672	0.4320	N	0.08118	0	0.09310	N	1	B	0.17038	0.02	B	0.14578	0.011	T	0.64859	-0.6308	10	0.16420	T	0.52	.	10.2351	0.43277	0.4842:0.5158:0.0:0.0	.	36	O43451	MGA_HUMAN	E	36	ENSP00000419372:K36E;ENSP00000447378:K36E;ENSP00000417103:K36E	ENSP00000373973:K36E	K	+	1	0	MGAM	141351905	0.004000	0.15560	0.012000	0.15200	0.263000	0.26337	0.506000	0.22658	0.101000	0.17610	0.533000	0.62120	AAA	MGAM	-	NULL	ENSG00000257335		0.358	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	538	0.19	1	A			141705436	141705436	+1	no_errors	ENST00000549489	ensembl	human	known	69_37n	missense	469	16.22	91	SNP	0.014	G
MID2	11043	genome.wustl.edu	37	X	107170052	107170052	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chrX:107170052C>G	ENST00000262843.6	+	10	2505	c.1957C>G	c.(1957-1959)Cgt>Ggt	p.R653G	RP6-191P20.4_ENST00000430140.1_RNA|MID2_ENST00000443968.2_Missense_Mutation_p.R623G	NM_012216.3|NM_052817.2	NP_036348.2|NP_438112.2	Q9UJV3	TRIM1_HUMAN	midline 2	653	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein localization to microtubule (GO:0035372)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)	19						ACACCTGAAGCGTCTGGGTGT	0.473																																						dbGAP											0													179.0	135.0	150.0					X																	107170052		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14532.2, CCDS14533.2	Xq22.1-q22.2	2013-02-11			ENSG00000080561	ENSG00000080561		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7096	protein-coding gene	gene with protein product		300204				10400986	Standard	NM_012216		Approved	FXY2, TRIM1, RNF60	uc004enl.3	Q9UJV3	OTTHUMG00000022171	ENST00000262843.6:c.1957C>G	X.37:g.107170052C>G	ENSP00000262843:p.Arg653Gly		A6NEL8|A6PVI5|Q5JYF5|Q8WWK1|Q9UJR9	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R653G	ENST00000262843.6	37	c.1957	CCDS14532.2	X	.	.	.	.	.	.	.	.	.	.	C	17.55	3.416568	0.62511	.	.	ENSG00000080561	ENST00000262843;ENST00000443968	T;T	0.70986	-0.53;-0.53	5.37	5.37	0.77165	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	D	0.89255	0.6663	H	0.97158	3.95	0.58432	D	0.999992	D;D	0.89917	1.0;0.994	D;P	0.77004	0.989;0.906	D	0.92596	0.6087	10	0.66056	D	0.02	.	15.4927	0.75624	0.0:1.0:0.0:0.0	.	653;623	Q9UJV3;Q9UJV3-2	TRIM1_HUMAN;.	G	653;623	ENSP00000262843:R653G;ENSP00000413976:R623G	ENSP00000262843:R653G	R	+	1	0	MID2	107056708	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.515000	0.67049	2.252000	0.74401	0.596000	0.82720	CGT	MID2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000080561		0.473	MID2-001	KNOWN	basic|CCDS	protein_coding	MID2	HGNC	protein_coding	OTTHUMT00000057852.2	407	0.00	0	C	NM_012216		107170052	107170052	+1	no_errors	ENST00000262843	ensembl	human	known	69_37n	missense	273	19.71	67	SNP	1.000	G
MLLT3	4300	genome.wustl.edu	37	9	20620668	20620668	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr9:20620668G>A	ENST00000380338.4	-	2	464	c.178C>T	c.(178-180)Cct>Tct	p.P60S	MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Missense_Mutation_p.P57S|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	60	YEATS. {ECO:0000255|PROSITE- ProRule:PRU00376}.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		TTTGGCCTAGGAAAGCTTTCG	0.532			T	MLL	ALL																																	dbGAP		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	0													111.0	105.0	107.0					9																	20620668		2203	4300	6503	-	-	-	SO:0001583	missense	0			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.178C>T	9.37:g.20620668G>A	ENSP00000369695:p.Pro60Ser		B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.P60S	ENST00000380338.4	37	c.178	CCDS6494.1	9	.	.	.	.	.	.	.	.	.	.	G	19.46	3.832688	0.71258	.	.	ENSG00000171843	ENST00000380338;ENST00000429426;ENST00000540751	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.75649	0.3878	L	0.52126	1.63	0.80722	D	1	P;D;D	0.64830	0.858;0.994;0.989	P;D;D	0.72075	0.722;0.976;0.955	T	0.77474	-0.2574	9	0.66056	D	0.02	-5.3501	18.8069	0.92041	0.0:0.0:1.0:0.0	.	60;57;60	B2R7B3;B7Z755;P42568	.;.;AF9_HUMAN	S	60;57;99	.	ENSP00000369695:P60S	P	-	1	0	MLLT3	20610668	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.856000	0.99531	2.422000	0.82143	0.561000	0.74099	CCT	MLLT3	-	pfam_YEATS,pfscan_YEATS	ENSG00000171843		0.532	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	HGNC	protein_coding	OTTHUMT00000051872.1	148	0.00	0	G	NM_004529		20620668	20620668	-1	no_errors	ENST00000380338	ensembl	human	known	69_37n	missense	118	13.77	19	SNP	1.000	A
MRGPRX3	117195	genome.wustl.edu	37	11	18159472	18159472	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr11:18159472G>T	ENST00000396275.2	+	3	1084	c.723G>T	c.(721-723)agG>agT	p.R241S		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						TGTTTTCCAGGATCCACCTGG	0.512																																						dbGAP											0													104.0	99.0	101.0					11																	18159472		2200	4293	6493	-	-	-	SO:0001583	missense	0				CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.723G>T	11.37:g.18159472G>T	ENSP00000379571:p.Arg241Ser		B0M0L1|Q8TDE0|Q8TDE1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.R241S	ENST00000396275.2	37	c.723	CCDS7830.1	11	.	.	.	.	.	.	.	.	.	.	G	5.064	0.197525	0.09652	.	.	ENSG00000179826	ENST00000396275;ENST00000531264	T;T	0.36340	1.26;4.36	0.966	0.966	0.19667	GPCR, rhodopsin-like superfamily (1);	0.365682	0.24020	N	0.042287	T	0.25382	0.0617	L	0.46157	1.445	0.09310	N	1	B	0.11235	0.004	B	0.19666	0.026	T	0.12066	-1.0562	10	0.25751	T	0.34	.	5.224	0.15383	0.0:0.0:1.0:0.0	.	241	Q96LB0	MRGX3_HUMAN	S	241	ENSP00000379571:R241S;ENSP00000436242:R241S	ENSP00000379571:R241S	R	+	3	2	MRGPRX3	18116048	0.000000	0.05858	0.032000	0.17829	0.034000	0.12701	-0.644000	0.05415	0.814000	0.34374	0.430000	0.28490	AGG	MRGPRX3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000179826		0.512	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX3	HGNC	protein_coding	OTTHUMT00000389767.1	388	0.00	0	G	NM_054031		18159472	18159472	+1	no_errors	ENST00000396275	ensembl	human	known	69_37n	missense	316	18.77	73	SNP	0.211	T
MYO18B	84700	genome.wustl.edu	37	22	26423470	26423470	+	Silent	SNP	A	A	T	rs372338405		TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr22:26423470A>T	ENST00000407587.2	+	43	7702	c.7533A>T	c.(7531-7533)tcA>tcT	p.S2511S	MYO18B_ENST00000536101.1_Silent_p.S2510S|MYO18B_ENST00000335473.7_Silent_p.S2510S			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2510	Poly-Ser.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						ACTCGTCCTCATCCTCCGGCT	0.582																																						dbGAP											0													57.0	61.0	59.0					22																	26423470		2059	4196	6255	-	-	-	SO:0001819	synonymous_variant	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.7533A>T	22.37:g.26423470A>T			B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	NULL	p.H460L	ENST00000407587.2	37	c.1379		22	.	.	.	.	.	.	.	.	.	.	A	8.982	0.975671	0.18736	.	.	ENSG00000133454	ENST00000543971	.	.	.	5.17	-10.3	0.00346	.	.	.	.	.	T	0.41351	0.1155	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50693	-0.8798	4	.	.	.	.	5.6245	0.17475	0.5114:0.1216:0.2985:0.0685	.	.	.	.	L	460	.	.	H	+	2	0	MYO18B	24753470	0.000000	0.05858	0.890000	0.34922	0.650000	0.38633	-3.538000	0.00438	-1.232000	0.02554	-1.235000	0.01560	CAT	MYO18B	-	NULL	ENSG00000133454		0.582	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	141	0.00	0	A	NM_032608		26423470	26423470	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000543971	ensembl	human	novel	69_37n	missense	87	30.95	39	SNP	0.558	T
MYO9A	4649	genome.wustl.edu	37	15	72338876	72338876	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr15:72338876C>T	ENST00000356056.5	-	2	501	c.29G>A	c.(28-30)cGc>cAc	p.R10H	RNU2-65P_ENST00000410162.1_RNA|MYO9A_ENST00000566885.1_Intron|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000444904.1_Missense_Mutation_p.R10H|MYO9A_ENST00000564571.1_Missense_Mutation_p.R10H|MYO9A_ENST00000424560.1_Missense_Mutation_p.R10H	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	10					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						ATCTTCAAAGCGTCGTCTTCC	0.398																																						dbGAP											0													144.0	144.0	144.0					15																	72338876		2199	4297	6496	-	-	-	SO:0001583	missense	0			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.29G>A	15.37:g.72338876C>T	ENSP00000348349:p.Arg10His		B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.R10H	ENST00000356056.5	37	c.29	CCDS10239.1	15	.	.	.	.	.	.	.	.	.	.	c	25.9	4.682187	0.88542	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904;ENST00000261864;ENST00000446448	D;D;D	0.86297	-2.09;-2.1;-2.08	5.01	5.01	0.66863	.	.	.	.	.	D	0.92485	0.7614	M	0.68317	2.08	0.80722	D	1	D;D;D	0.76494	0.993;0.997;0.999	P;D;D	0.68943	0.855;0.933;0.961	D	0.93189	0.6581	9	0.66056	D	0.02	.	17.9925	0.89172	0.0:1.0:0.0:0.0	.	10;10;10	B2RTY4-3;B7WP69;B2RTY4	.;.;MYO9A_HUMAN	H	10	ENSP00000348349:R10H;ENSP00000399162:R10H;ENSP00000398250:R10H	ENSP00000261864:R10H	R	-	2	0	MYO9A	70125930	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.741000	0.84997	2.328000	0.79073	0.454000	0.30748	CGC	MYO9A	-	NULL	ENSG00000066933		0.398	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO9A	HGNC	protein_coding	OTTHUMT00000257308.1	267	0.00	0	C	NM_006901		72338876	72338876	-1	no_errors	ENST00000424560	ensembl	human	known	69_37n	missense	183	22.46	53	SNP	1.000	T
NUMBL	9253	genome.wustl.edu	37	19	41173774	41173774	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr19:41173774C>A	ENST00000252891.4	-	10	1596	c.1429G>T	c.(1429-1431)Gtg>Ttg	p.V477L	NUMBL_ENST00000598779.1_Missense_Mutation_p.V436L|NUMBL_ENST00000540131.1_Missense_Mutation_p.V436L	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	477					adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			AACACGGCCACTTGGGCAGGT	0.697																																						dbGAP											0													8.0	9.0	9.0					19																	41173774		2174	4252	6426	-	-	-	SO:0001583	missense	0			AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1429G>T	19.37:g.41173774C>A	ENSP00000252891:p.Val477Leu		Q7Z4J9	Missense_Mutation	SNP	pfam_Numb_domain,pfam_PTyr_interaction_dom,pfam_PTB,smart_PTyr_interaction_dom,pirsf_Numb/numb-like,pfscan_PTyr_interaction_dom	p.V477L	ENST00000252891.4	37	c.1429	CCDS12561.1	19	.	.	.	.	.	.	.	.	.	.	c	9.659	1.143521	0.21205	.	.	ENSG00000105245	ENST00000252891;ENST00000540131	T;T	0.60548	0.18;0.21	4.3	3.21	0.36854	.	0.070602	0.56097	D	0.000036	T	0.42449	0.1203	L	0.38175	1.15	0.33773	D	0.623309	B;B	0.20550	0.046;0.046	B;B	0.20577	0.03;0.03	T	0.48269	-0.9050	10	0.22109	T	0.4	-18.7772	9.0118	0.36146	0.0:0.8797:0.0:0.1203	.	475;477	A8K033;Q9Y6R0	.;NUMBL_HUMAN	L	477;436	ENSP00000252891:V477L;ENSP00000442759:V436L	ENSP00000252891:V477L	V	-	1	0	NUMBL	45865614	0.956000	0.32656	1.000000	0.80357	0.575000	0.36095	1.880000	0.39628	2.245000	0.73994	0.538000	0.68166	GTG	NUMBL	-	pirsf_Numb/numb-like	ENSG00000105245		0.697	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	HGNC	protein_coding	OTTHUMT00000462749.2	15	0.00	0	C	NM_004756		41173774	41173774	-1	no_errors	ENST00000252891	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	1.000	A
PCMTD2	55251	genome.wustl.edu	37	20	62899355	62899355	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr20:62899355T>C	ENST00000308824.6	+	5	825	c.698T>C	c.(697-699)gTc>gCc	p.V233A	PCMTD2_ENST00000369758.4_Missense_Mutation_p.V206A|PCMTD2_ENST00000609372.1_Missense_Mutation_p.V83A|PCMTD2_ENST00000299468.7_Missense_Mutation_p.V233A	NM_018257.2	NP_060727.2	Q9NV79	PCMD2_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2	233						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|upper_aerodigestive_tract(1)	17	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					TCAAGACTTGTCCAGTTACGT	0.368																																						dbGAP											0													93.0	87.0	89.0					20																	62899355		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001745	CCDS13559.1, CCDS46631.1	20q13.33	2012-10-02	2005-10-06	2005-10-06	ENSG00000203880	ENSG00000203880			15882	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 36"""	C20orf36			Standard	NM_018257		Approved	FLJ10883	uc002yil.4	Q9NV79	OTTHUMG00000033029	ENST00000308824.6:c.698T>C	20.37:g.62899355T>C	ENSP00000307854:p.Val233Ala		E1P5H3|Q8IW60|Q9H4K2	Missense_Mutation	SNP	pfam_PCMT	p.V233A	ENST00000308824.6	37	c.698	CCDS13559.1	20	.	.	.	.	.	.	.	.	.	.	.	15.07	2.724928	0.48833	.	.	ENSG00000203880	ENST00000369758;ENST00000299468;ENST00000308824	T;T;T	0.55052	0.54;0.82;1.47	5.33	5.33	0.75918	.	0.192883	0.44688	D	0.000422	T	0.51890	0.1701	M	0.64404	1.975	0.80722	D	1	B;B	0.16166	0.016;0.007	B;B	0.17979	0.02;0.005	T	0.48790	-0.9004	10	0.36615	T	0.2	-27.1559	15.5882	0.76502	0.0:0.0:0.0:1.0	.	206;233	Q9NV79-2;Q9NV79	.;PCMD2_HUMAN	A	206;233;233	ENSP00000358773:V206A;ENSP00000299468:V233A;ENSP00000307854:V233A	ENSP00000299468:V233A	V	+	2	0	PCMTD2	62369799	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	3.447000	0.52936	2.149000	0.67028	0.528000	0.53228	GTC	PCMTD2	-	NULL	ENSG00000203880		0.368	PCMTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCMTD2	HGNC	protein_coding	OTTHUMT00000080301.1	300	0.00	0	T	NM_018257		62899355	62899355	+1	no_errors	ENST00000308824	ensembl	human	known	69_37n	missense	210	23.36	64	SNP	1.000	C
PLEKHN1	84069	genome.wustl.edu	37	1	906108	906108	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr1:906108G>T	ENST00000379409.2	+	5	484	c.454G>T	c.(454-456)Ggg>Tgg	p.G152W	PLEKHN1_ENST00000379407.3_Missense_Mutation_p.G152W|PLEKHN1_ENST00000379410.3_Missense_Mutation_p.G152W			Q494U1	PKHN1_HUMAN	pleckstrin homology domain containing, family N member 1	152	PH 1.									central_nervous_system(1)|endometrium(3)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	9	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.00095)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		CCCGCTCGAGGGGTCCCGAGA	0.662																																						dbGAP											0													51.0	61.0	58.0					1																	906108		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136730	CCDS4.1, CCDS53256.1	1p36.33	2013-01-11			ENSG00000187583	ENSG00000187583		"""Pleckstrin homology (PH) domain containing"""	25284	protein-coding gene	gene with protein product						11230166	Standard	NM_032129		Approved	DKFZP434H2010	uc001acd.3	Q494U1	OTTHUMG00000040756	ENST00000379409.2:c.454G>T	1.37:g.906108G>T	ENSP00000368719:p.Gly152Trp		Q494U2|Q5SV98|Q9H0M7	Missense_Mutation	SNP	smart_Pleckstrin_homology	p.G152W	ENST00000379409.2	37	c.454		1	.	.	.	.	.	.	.	.	.	.	G	12.55	1.972823	0.34848	.	.	ENSG00000187583	ENST00000379410;ENST00000379407;ENST00000379409	T;T;T	0.45668	0.89;0.89;0.89	4.91	1.9	0.25705	Pleckstrin homology domain (1);	0.688919	0.13360	N	0.393709	T	0.51363	0.1670	L	0.53249	1.67	0.26336	N	0.977431	D;D;D	0.76494	0.995;0.999;0.999	D;D;P	0.68483	0.924;0.958;0.895	T	0.32322	-0.9911	10	0.66056	D	0.02	.	4.3164	0.10995	0.204:0.19:0.606:0.0	.	152;152;152	Q494U1-3;Q494U1;Q494U1-2	.;PKHN1_HUMAN;.	W	152	ENSP00000368720:G152W;ENSP00000368717:G152W;ENSP00000368719:G152W	ENSP00000368717:G152W	G	+	1	0	PLEKHN1	895971	0.063000	0.20901	0.926000	0.36857	0.173000	0.22820	0.437000	0.21543	1.305000	0.44909	0.549000	0.68633	GGG	PLEKHN1	-	smart_Pleckstrin_homology	ENSG00000187583		0.662	PLEKHN1-005	KNOWN	basic	protein_coding	PLEKHN1	HGNC	protein_coding	OTTHUMT00000473256.1	36	0.00	0	G	NM_032129		906108	906108	+1	no_errors	ENST00000379409	ensembl	human	known	69_37n	missense	37	30.19	16	SNP	0.379	T
PIP5K1A	8394	genome.wustl.edu	37	1	151209081	151209081	+	Silent	SNP	C	C	T			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr1:151209081C>T	ENST00000368888.4	+	9	1409	c.987C>T	c.(985-987)atC>atT	p.I329I	PIP5K1A_ENST00000414290.2_Silent_p.I30I|PIP5K1A_ENST00000441902.2_Silent_p.I317I|PIP5K1A_ENST00000368890.4_Silent_p.I316I|PIP5K1A_ENST00000464105.1_3'UTR|PIP5K1A_ENST00000409426.1_Silent_p.I317I	NM_001135638.1	NP_001129110.1	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, alpha	329	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				actin cytoskeleton reorganization (GO:0031532)|activation of Rac GTPase activity (GO:0032863)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|fibroblast migration (GO:0010761)|focal adhesion assembly (GO:0048041)|glycerophospholipid metabolic process (GO:0006650)|keratinocyte differentiation (GO:0030216)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|protein targeting to plasma membrane (GO:0072661)|ruffle assembly (GO:0097178)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|kinase binding (GO:0019900)			breast(1)|central_nervous_system(1)|ovary(1)|skin(1)|stomach(1)	5	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			TGATGTCAATCCATAATATAG	0.413																																					Pancreas(80;36 1443 2325 16095 21302)	dbGAP											0													45.0	45.0	45.0					1																	151209081		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U78575	CCDS990.1, CCDS44219.1, CCDS44220.1, CCDS44221.1	1q21.3	2010-04-08			ENSG00000143398	ENSG00000143398			8994	protein-coding gene	gene with protein product		603275				8955136, 10828584	Standard	NM_003557		Approved		uc001exj.3	Q99755	OTTHUMG00000012351	ENST00000368888.4:c.987C>T	1.37:g.151209081C>T			A8K4Q0|B4DIN0|Q99754|Q99756	Silent	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.I329	ENST00000368888.4	37	c.987	CCDS44219.1	1																																																																																			PIP5K1A	-	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	ENSG00000143398		0.413	PIP5K1A-003	KNOWN	basic|CCDS	protein_coding	PIP5K1A	HGNC	protein_coding	OTTHUMT00000034425.2	125	0.00	0	C	NM_003557		151209081	151209081	+1	no_errors	ENST00000368888	ensembl	human	known	69_37n	silent	104	17.46	22	SNP	1.000	T
PROX2	283571	genome.wustl.edu	37	14	75329577	75329577	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr14:75329577T>A	ENST00000445876.1	-	1	960	c.961A>T	c.(961-963)Acc>Tcc	p.T321S	PROX2_ENST00000556489.2_Missense_Mutation_p.T321S|PROX2_ENST00000556084.2_Intron			Q3B8N5	PROX2_HUMAN	prospero homeobox 2	321					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(3)	6			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00652)		GGTTTGGGGGTCATTCTTGGA	0.517																																						dbGAP											0													76.0	81.0	79.0					14																	75329577		1853	4109	5962	-	-	-	SO:0001583	missense	0				CCDS45136.1, CCDS45136.2, CCDS73663.1	14q24.3	2012-10-02			ENSG00000119608	ENSG00000119608		"""Homeoboxes / PROS class"""	26715	protein-coding gene	gene with protein product		615094					Standard	NM_001080408		Approved	FLJ36749	uc031qpi.1	Q3B8N5	OTTHUMG00000171481	ENST00000445876.1:c.961A>T	14.37:g.75329577T>A	ENSP00000405932:p.Thr321Ser		C9J5W1|Q8N9Q3	Missense_Mutation	SNP	pfam_Prox1,superfamily_Homeodomain-like	p.T321S	ENST00000445876.1	37	c.961	CCDS45136.2	14	.	.	.	.	.	.	.	.	.	.	T	2.372	-0.344131	0.05208	.	.	ENSG00000119608	ENST00000556489;ENST00000389664;ENST00000445876	T;T	0.41065	1.01;1.01	5.66	1.43	0.22495	.	0.826207	0.10603	N	0.655386	T	0.19046	0.0457	N	0.08118	0	0.09310	N	1	B	0.19706	0.038	B	0.22753	0.041	T	0.26677	-1.0096	10	0.21014	T	0.42	0.1867	3.045	0.06151	0.1902:0.3634:0.0:0.4464	.	321	G3V3G0	.	S	321	ENSP00000451223:T321S;ENSP00000405932:T321S	ENSP00000374315:T321S	T	-	1	0	PROX2	74399330	0.001000	0.12720	0.002000	0.10522	0.367000	0.29736	0.654000	0.24918	0.249000	0.21456	0.454000	0.30748	ACC	PROX2	-	NULL	ENSG00000119608		0.517	PROX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PROX2	HGNC	protein_coding		244	0.40	1	T			75329577	75329577	-1	no_errors	ENST00000445876	ensembl	human	known	69_37n	missense	214	11.51	29	SNP	0.002	A
PTCH1	5727	genome.wustl.edu	37	9	98221930	98221930	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr9:98221930C>G	ENST00000331920.6	-	17	3138	c.2839G>C	c.(2839-2841)Gaa>Caa	p.E947Q	PTCH1_ENST00000437951.1_Missense_Mutation_p.E881Q|PTCH1_ENST00000418258.1_Missense_Mutation_p.E796Q|PTCH1_ENST00000421141.1_Missense_Mutation_p.E796Q|PTCH1_ENST00000375274.2_Missense_Mutation_p.E946Q|PTCH1_ENST00000430669.2_Missense_Mutation_p.E881Q|PTCH1_ENST00000429896.2_Missense_Mutation_p.E796Q	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	947					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				TGGACCCATTCTGGTCGGTGT	0.557																																						dbGAP											0													150.0	125.0	134.0					9																	98221930		2203	4300	6503	-	-	-	SO:0001583	missense	0			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.2839G>C	9.37:g.98221930C>G	ENSP00000332353:p.Glu947Gln		A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.E947Q	ENST00000331920.6	37	c.2839	CCDS6714.1	9	.	.	.	.	.	.	.	.	.	.	C	14.86	2.660126	0.47572	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000375275;ENST00000430669;ENST00000429896;ENST00000375274	D;D;D;D;D;D;D	0.90900	-2.74;-2.73;-2.72;-2.72;-2.73;-2.72;-2.75	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.88952	0.6577	L	0.35854	1.095	0.80722	D	1	P;P;B	0.40230	0.51;0.708;0.213	B;P;B	0.46299	0.396;0.511;0.349	D	0.85571	0.1234	10	0.15499	T	0.54	-21.3513	18.7969	0.91997	0.0:1.0:0.0:0.0	.	881;946;947	Q13635-3;Q13635-2;Q13635	.;.;PTC1_HUMAN	Q	947;881;796;796;383;881;796;946	ENSP00000332353:E947Q;ENSP00000389744:E881Q;ENSP00000399981:E796Q;ENSP00000396135:E796Q;ENSP00000410287:E881Q;ENSP00000414823:E796Q;ENSP00000364423:E946Q	ENSP00000332353:E947Q	E	-	1	0	PTCH1	97261751	1.000000	0.71417	0.967000	0.41034	0.454000	0.32378	7.320000	0.79064	2.680000	0.91292	0.563000	0.77884	GAA	PTCH1	-	pfam_Patched,tigrfam_TM_rcpt_patched	ENSG00000185920		0.557	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCH1	HGNC	protein_coding	OTTHUMT00000053229.2	398	0.00	0	C	NM_000264		98221930	98221930	-1	no_errors	ENST00000331920	ensembl	human	known	69_37n	missense	241	35.22	131	SNP	1.000	G
PTCHD3	374308	genome.wustl.edu	37	10	27700858	27700858	+	Splice_Site	SNP	C	C	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr10:27700858C>A	ENST00000438700.3	-	2	1207	c.1090G>T	c.(1090-1092)Gta>Tta	p.V364L		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	364					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						AAGTGGACTACCTGCCACAAA	0.348																																						dbGAP											0													50.0	47.0	48.0					10																	27700858		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.1090-1G>T	10.37:g.27700858C>A			I3L499|Q6ZU28	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.V364L	ENST00000438700.3	37	c.1090	CCDS31173.1	10	.	.	.	.	.	.	.	.	.	.	C	17.65	3.442048	0.63067	.	.	ENSG00000182077	ENST00000438700	D	0.91996	-2.95	4.38	1.38	0.22167	.	0.197902	0.42420	N	0.000714	D	0.91012	0.7173	M	0.82716	2.605	0.36881	D	0.889413	B	0.27910	0.193	B	0.35688	0.208	D	0.85484	0.1181	10	0.36615	T	0.2	-5.8397	6.139	0.20249	0.0:0.6789:0.1522:0.169	.	364	Q3KNS1	PTHD3_HUMAN	L	364	ENSP00000417658:V364L	ENSP00000417658:V364L	V	-	1	0	PTCHD3	27740864	0.994000	0.37717	0.972000	0.41901	0.863000	0.49368	1.097000	0.30988	0.107000	0.17824	0.555000	0.69702	GTA	PTCHD3	-	pfam_Patched	ENSG00000182077		0.348	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD3	HGNC	protein_coding	OTTHUMT00000047325.3	151	0.00	0	C	XM_370541	Missense_Mutation	27700858	27700858	-1	no_errors	ENST00000438700	ensembl	human	known	69_37n	missense	146	15.61	27	SNP	0.998	A
RANBP3	8498	genome.wustl.edu	37	19	5917932	5917932	+	Silent	SNP	C	C	T			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr19:5917932C>T	ENST00000340578.6	-	16	1590	c.1533G>A	c.(1531-1533)ctG>ctA	p.L511L	RANBP3_ENST00000034275.8_Silent_p.L443L|RANBP3_ENST00000591092.1_Silent_p.L438L|RANBP3_ENST00000439268.2_Silent_p.L506L|RANBP3_ENST00000541471.1_Silent_p.L383L	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	511	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						CGCGGCTGCGCAGGGCCAGGA	0.672																																						dbGAP											0													49.0	55.0	53.0					19																	5917932		2105	4228	6333	-	-	-	SO:0001819	synonymous_variant	0			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.1533G>A	19.37:g.5917932C>T			B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Silent	SNP	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	p.L511	ENST00000340578.6	37	c.1533	CCDS42478.1	19																																																																																			RANBP3	-	NULL	ENSG00000031823		0.672	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RANBP3	HGNC	protein_coding	OTTHUMT00000452304.1	44	0.00	0	C	NM_007322		5917932	5917932	-1	no_errors	ENST00000340578	ensembl	human	known	69_37n	silent	29	21.62	8	SNP	1.000	T
RIMKLA	284716	genome.wustl.edu	37	1	42875811	42875811	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr1:42875811T>C	ENST00000431473.3	+	4	767	c.638T>C	c.(637-639)aTg>aCg	p.M213T		NM_173642.3	NP_775913.2	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family member A	213	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)			NS(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	13						ATAGGCTCTATGCTTCGCTGC	0.527																																						dbGAP											0													134.0	128.0	130.0					1																	42875811		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC039737	CCDS466.2	1p34.2	2011-09-21	2008-10-13	2008-10-13	ENSG00000177181	ENSG00000177181	6.3.2.N6		28725	protein-coding gene	gene with protein product	"""N-acetylaspartylglutamate synthetase II"""		"""family with sequence similarity 80, member A"""	FAM80A		20657015, 21454531	Standard	NM_173642		Approved	MGC47816, RP11-157D18.1, NAAGS-II	uc001chi.2	Q8IXN7	OTTHUMG00000007335	ENST00000431473.3:c.638T>C	1.37:g.42875811T>C	ENSP00000414330:p.Met213Thr		Q5VUS5	Missense_Mutation	SNP	pfam_ATP-grasp_RimK-type,pfam_GSHS_ATP-bd,pfam_ATP-grasp_DUF201-type,pfscan_ATP-grasp,tigrfam_RpS6_RimK/Lys_biosynth_LsyX	p.M213T	ENST00000431473.3	37	c.638	CCDS466.2	1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.397231	0.83120	.	.	ENSG00000177181	ENST00000410070;ENST00000431473	.	.	.	5.74	5.74	0.90152	ATP-grasp fold (1);ATP-grasp fold, RimK-type (1);ATP-grasp fold, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.77916	0.4202	M	0.80982	2.52	0.58432	D	0.999998	D	0.63046	0.992	P	0.62298	0.9	T	0.81380	-0.0959	9	0.87932	D	0	-3.1563	14.0066	0.64468	0.0:0.0:0.0:1.0	.	213	Q8IXN7	RIMKA_HUMAN	T	89;213	.	ENSP00000387064:M89T	M	+	2	0	RIMKLA	42648398	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	7.363000	0.79516	2.191000	0.70037	0.528000	0.53228	ATG	RIMKLA	-	pfam_ATP-grasp_RimK-type,pfam_GSHS_ATP-bd,pfam_ATP-grasp_DUF201-type,pfscan_ATP-grasp,tigrfam_RpS6_RimK/Lys_biosynth_LsyX	ENSG00000177181		0.527	RIMKLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMKLA	HGNC	protein_coding	OTTHUMT00000019174.3	326	0.00	0	T	NM_173642		42875811	42875811	+1	no_errors	ENST00000431473	ensembl	human	known	69_37n	missense	335	11.14	42	SNP	1.000	C
RNF10	9921	genome.wustl.edu	37	12	120995476	120995476	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr12:120995476C>T	ENST00000325954.4	+	6	1419	c.958C>T	c.(958-960)Cat>Tat	p.H320Y	RNF10_ENST00000413266.2_Missense_Mutation_p.H320Y	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	320					negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCATCCCATTCATCTAGGAGG	0.413																																						dbGAP											0													205.0	178.0	187.0					12																	120995476		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.958C>T	12.37:g.120995476C>T	ENSP00000322242:p.His320Tyr		Q92550|Q9NPP8|Q9ULW4	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.H320Y	ENST00000325954.4	37	c.958	CCDS9201.1	12	.	.	.	.	.	.	.	.	.	.	C	1.233	-0.623633	0.03636	.	.	ENSG00000022840	ENST00000325954;ENST00000458409;ENST00000413266	D;D	0.89415	-2.48;-2.51	6.04	4.12	0.48240	.	0.308551	0.40144	N	0.001170	T	0.74199	0.3685	N	0.17082	0.46	0.26936	N	0.966353	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.57952	-0.7722	10	0.02654	T	1	.	7.0341	0.24983	0.1332:0.6723:0.122:0.0724	.	320;320	Q8N5U6-2;Q8N5U6	.;RNF10_HUMAN	Y	320	ENSP00000322242:H320Y;ENSP00000415682:H320Y	ENSP00000322242:H320Y	H	+	1	0	RNF10	119479859	1.000000	0.71417	1.000000	0.80357	0.679000	0.39708	2.755000	0.47540	1.505000	0.48720	0.563000	0.77884	CAT	RNF10	-	NULL	ENSG00000022840		0.413	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF10	HGNC	protein_coding	OTTHUMT00000401898.4	583	0.34	2	C			120995476	120995476	+1	no_errors	ENST00000413266	ensembl	human	known	69_37n	missense	359	27.27	135	SNP	1.000	T
RSPH3	83861	genome.wustl.edu	37	6	159401878	159401878	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr6:159401878G>C	ENST00000252655.1	-	6	1402	c.1213C>G	c.(1213-1215)Ctg>Gtg	p.L405V	RSPH3_ENST00000297262.3_Missense_Mutation_p.L309V|RSPH3_ENST00000367069.2_Missense_Mutation_p.L263V|RSPH3_ENST00000449822.1_Missense_Mutation_p.L167V	NM_031924.4	NP_114130.3	Q86UC2	RSPH3_HUMAN	radial spoke 3 homolog (Chlamydomonas)	405										endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|skin(1)|stomach(7)	23		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.36e-16)|BRCA - Breast invasive adenocarcinoma(81;5.92e-06)		AGGTCAGCCAGGTAACGCTGT	0.448																																						dbGAP											0													197.0	156.0	170.0					6																	159401878		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF353618	CCDS5260.1	6q25.3	2014-05-16	2008-07-04	2007-06-26	ENSG00000130363	ENSG00000130363			21054	protein-coding gene	gene with protein product		615876	"""radial spokehead-like 2"""	RSHL2		12477932	Standard	NM_031924		Approved	dJ111C20.1, RSP3	uc003qrx.3	Q86UC2	OTTHUMG00000015924	ENST00000252655.1:c.1213C>G	6.37:g.159401878G>C	ENSP00000252655:p.Leu405Val		Q96LQ5|Q96LX2|Q9BX75	Missense_Mutation	SNP	pfam_Radial_spoke_3	p.L405V	ENST00000252655.1	37	c.1213	CCDS5260.1	6	.	.	.	.	.	.	.	.	.	.	G	17.02	3.282493	0.59867	.	.	ENSG00000130363	ENST00000367069;ENST00000449822;ENST00000252655;ENST00000297262	T;T;T;T	0.26660	1.72;1.72;1.72;1.72	5.81	5.81	0.92471	.	0.068099	0.64402	D	0.000014	T	0.38374	0.1038	M	0.71581	2.175	0.47374	D	0.999403	D;D	0.69078	0.997;0.997	D;D	0.70716	0.97;0.957	T	0.06881	-1.0802	10	0.35671	T	0.21	-28.3775	12.9736	0.58525	0.0777:0.0:0.9223:0.0	.	309;405	Q86UC2-2;Q86UC2	.;RSPH3_HUMAN	V	263;167;405;309	ENSP00000356036:L263V;ENSP00000393195:L167V;ENSP00000252655:L405V;ENSP00000297262:L309V	ENSP00000252655:L405V	L	-	1	2	RSPH3	159321866	1.000000	0.71417	0.993000	0.49108	0.663000	0.39108	1.539000	0.36104	2.746000	0.94184	0.591000	0.81541	CTG	RSPH3	-	pfam_Radial_spoke_3	ENSG00000130363		0.448	RSPH3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH3	HGNC	protein_coding		504	0.00	0	G	NM_031924		159401878	159401878	-1	no_errors	ENST00000252655	ensembl	human	known	69_37n	missense	366	13.85	59	SNP	1.000	C
RTL1	388015	genome.wustl.edu	37	14	101350779	101350779	+	Missense_Mutation	SNP	C	C	T	rs376085745		TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr14:101350779C>T	ENST00000534062.1	-	1	405	c.347G>A	c.(346-348)gGa>gAa	p.G116E	MIR432_ENST00000606207.1_RNA|MIR127_ENST00000384876.1_RNA|MIR136_ENST00000385207.1_RNA|MIR433_ENST00000384837.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	116					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						ATCAGATGCTCCACTGAGTGG	0.542																																						dbGAP											0													62.0	53.0	55.0					14																	101350779		1568	3582	5150	-	-	-	SO:0001583	missense	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.347G>A	14.37:g.101350779C>T	ENSP00000435342:p.Gly116Glu		E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag,superfamily_Peptidase_aspartic	p.G116E	ENST00000534062.1	37	c.347	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	C	10.54	1.378013	0.24944	.	.	ENSG00000254656	ENST00000534062	T	0.18810	2.19	3.54	-0.282	0.12878	.	.	.	.	.	T	0.07683	0.0193	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.38112	-0.9676	9	0.02654	T	1	.	2.2498	0.04041	0.2253:0.2892:0.0:0.4855	.	116	E9PKS8	.	E	116	ENSP00000435342:G116E	ENSP00000435342:G116E	G	-	2	0	RTL1	100420532	.	.	0.000000	0.03702	0.933000	0.57130	.	.	-0.050000	0.13356	-0.367000	0.07326	GGA	RTL1	-	NULL	ENSG00000254656		0.542	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	242	0.00	0	C	NM_001134888		101350779	101350779	-1	no_errors	ENST00000534062	ensembl	human	known	69_37n	missense	138	10.97	17	SNP	0.000	T
RXRA	6256	genome.wustl.edu	37	9	137309062	137309062	+	Silent	SNP	C	C	T	rs371715828		TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr9:137309062C>T	ENST00000481739.1	+	5	721	c.669C>T	c.(667-669)acC>acT	p.T223T	RXRA_ENST00000356384.4_3'UTR|RXRA_ENST00000540193.1_Silent_p.T126T	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha	223	Hinge.				camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	TGGAGTCGACCAGCAGCGCCA	0.667																																						dbGAP											0													140.0	106.0	118.0					9																	137309062		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000481739.1:c.669C>T	9.37:g.137309062C>T			B3KY83|Q2NL52|Q2V504	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_DUF3345,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoid-X_rcpt/HNF4,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF,prints_Retinoic_acid_rcpt	p.T223	ENST00000481739.1	37	c.669	CCDS35172.1	9																																																																																			RXRA	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000186350		0.667	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RXRA	HGNC	protein_coding	OTTHUMT00000054949.1	70	0.00	0	C	NM_002957		137309062	137309062	+1	no_errors	ENST00000481739	ensembl	human	known	69_37n	silent	30	30.23	13	SNP	0.959	T
SAMD9	54809	genome.wustl.edu	37	7	92733023	92733023	+	Silent	SNP	G	G	T			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr7:92733023G>T	ENST00000379958.2	-	3	2657	c.2388C>A	c.(2386-2388)ctC>ctA	p.L796L		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	796						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			CATCAACAAGGAGTAGTACAG	0.368																																						dbGAP											0													104.0	102.0	102.0					7																	92733023		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.2388C>A	7.37:g.92733023G>T			A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Silent	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.L796	ENST00000379958.2	37	c.2388	CCDS34680.1	7																																																																																			SAMD9	-	NULL	ENSG00000205413		0.368	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9	HGNC	protein_coding	OTTHUMT00000341761.1	201	0.00	0	G	NM_017654		92733023	92733023	-1	no_errors	ENST00000379958	ensembl	human	known	69_37n	silent	194	14.85	34	SNP	0.993	T
SH3GL2	6456	genome.wustl.edu	37	9	17795652	17795652	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr9:17795652G>A	ENST00000380607.4	+	9	1090	c.970G>A	c.(970-972)Gat>Aat	p.D324N	SH3GL2_ENST00000537391.1_Missense_Mutation_p.D277N	NM_003026.2	NP_003017.1	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	324	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of receptor internalization (GO:0002090)|signal transduction (GO:0007165)|synaptic vesicle endocytosis (GO:0048488)	clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		TAACCAAATTGATGAGAACTG	0.478																																						dbGAP											0													126.0	112.0	117.0					9																	17795652		2203	4300	6503	-	-	-	SO:0001583	missense	0			X99657	CCDS6483.1	9p22	2008-02-05			ENSG00000107295	ENSG00000107295			10831	protein-coding gene	gene with protein product		604465				9169142	Standard	XM_005251549		Approved	SH3P4, SH3D2A, CNSA2, EEN-B1	uc003zna.3	Q99962	OTTHUMG00000019601	ENST00000380607.4:c.970G>A	9.37:g.17795652G>A	ENSP00000369981:p.Asp324Asn		B2R618|Q9NQK5	Missense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_2,pfam_SH3_domain,pfam_BAR_dom-cont,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,prints_SH3_domain,prints_Spectrin_alpha_SH3	p.D324N	ENST00000380607.4	37	c.970	CCDS6483.1	9	.	.	.	.	.	.	.	.	.	.	G	27.7	4.852807	0.91355	.	.	ENSG00000107295	ENST00000541215;ENST00000380607;ENST00000537391	T;T	0.34275	1.37;1.37	5.7	5.7	0.88788	Src homology-3 domain (4);Spectrin alpha chain, SH3 domain (1);Variant SH3 (1);	0.540708	0.20724	N	0.086844	T	0.58921	0.2156	L	0.56199	1.76	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	T	0.58730	-0.7585	10	0.87932	D	0	.	19.8388	0.96673	0.0:0.0:1.0:0.0	.	324	Q99962	SH3G2_HUMAN	N	153;324;277	ENSP00000369981:D324N;ENSP00000443365:D277N	ENSP00000369981:D324N	D	+	1	0	SH3GL2	17785652	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.799000	0.99117	2.695000	0.91970	0.561000	0.74099	GAT	SH3GL2	-	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_Spectrin_alpha_SH3	ENSG00000107295		0.478	SH3GL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GL2	HGNC	protein_coding	OTTHUMT00000051796.1	407	0.00	0	G	NM_003026		17795652	17795652	+1	no_errors	ENST00000380607	ensembl	human	known	69_37n	missense	370	13.15	56	SNP	1.000	A
SLC5A9	200010	genome.wustl.edu	37	1	48699331	48699331	+	Silent	SNP	G	G	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr1:48699331G>A	ENST00000438567.2	+	9	1090	c.1038G>A	c.(1036-1038)gaG>gaA	p.E346E	SLC5A9_ENST00000533824.1_Silent_p.E367E|SLC5A9_ENST00000420136.2_3'UTR|SLC5A9_ENST00000236495.5_Silent_p.E371E	NM_001011547.2	NP_001011547.2	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 9	346					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|large_intestine(4)|liver(2)|lung(11)|ovary(3)|prostate(1)|urinary_tract(1)	26						CCACAGACGAGGTGGGCTGCG	0.517																																						dbGAP											0													143.0	110.0	121.0					1																	48699331		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX648549	CCDS30709.2, CCDS44136.1	1p33	2013-07-19	2013-07-19		ENSG00000117834	ENSG00000117834		"""Solute carriers"""	22146	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 9"""				Standard	NM_001011547		Approved	SGLT4	uc001crn.2	Q2M3M2	OTTHUMG00000007959	ENST00000438567.2:c.1038G>A	1.37:g.48699331G>A			B3KY87|B7ZL45|B7ZL47|E9PAK4|E9PJ08|Q5TET3	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.G278S	ENST00000438567.2	37	c.832	CCDS30709.2	1																																																																																			SLC5A9	-	NULL	ENSG00000117834		0.517	SLC5A9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A9	HGNC	protein_coding	OTTHUMT00000022061.3	267	0.00	0	G	XM_117174		48699331	48699331	+1	no_errors	ENST00000425816	ensembl	human	known	69_37n	missense	224	19.13	53	SNP	0.992	A
SPRR3	6707	genome.wustl.edu	37	1	152975898	152975898	+	Silent	SNP	T	T	G			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr1:152975898T>G	ENST00000295367.4	+	2	444	c.402T>G	c.(400-402)ccT>ccG	p.P134P	SPRR3_ENST00000331860.3_Silent_p.P134P|SPRR3_ENST00000542696.1_Silent_p.P126P	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	134	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCAAAGTTCCTGAGCAAGGAT	0.552																																						dbGAP											0													87.0	77.0	80.0					1																	152975898		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.402T>G	1.37:g.152975898T>G			A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	pfam_Cornifin	p.P134	ENST00000295367.4	37	c.402	CCDS1033.1	1																																																																																			SPRR3	-	pfam_Cornifin	ENSG00000163209		0.552	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPRR3	HGNC	protein_coding	OTTHUMT00000038910.1	282	0.00	0	T	NM_005416		152975898	152975898	+1	no_errors	ENST00000295367	ensembl	human	known	69_37n	silent	213	10.13	24	SNP	0.897	G
SSR1	6745	genome.wustl.edu	37	6	7301667	7301667	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr6:7301667A>G	ENST00000244763.4	-	4	505	c.419T>C	c.(418-420)cTt>cCt	p.L140P	SSR1_ENST00000488834.1_5'UTR|SSR1_ENST00000479365.1_Missense_Mutation_p.L140P|SSR1_ENST00000474597.1_Missense_Mutation_p.L140P|SSR1_ENST00000397511.2_Missense_Mutation_p.L140P|RP11-69L16.4_ENST00000379928.4_RNA|SSR1_ENST00000489567.1_Intron|SSR1_ENST00000462112.1_Missense_Mutation_p.L140P|SSR1_ENST00000534851.1_Missense_Mutation_p.L113P	NM_003144.3	NP_003135.2	P43307	SSRA_HUMAN	signal sequence receptor, alpha	140					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|positive regulation of cell proliferation (GO:0008284)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(1)	9	Ovarian(93;0.0398)					GTTCAGAGGAAGAGCTGTGAA	0.448																																						dbGAP											0													91.0	97.0	95.0					6																	7301667		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4499.1	6p24.3	2010-11-24	2008-08-26		ENSG00000124783	ENSG00000124783			11323	protein-coding gene	gene with protein product	"""translocon-associated protein alpha"""	600868					Standard	NM_001292008		Approved	TRAPA	uc003mxf.4	P43307	OTTHUMG00000014202	ENST00000244763.4:c.419T>C	6.37:g.7301667A>G	ENSP00000244763:p.Leu140Pro		A8K685|Q53GX2|Q53H19|Q5TAM3|Q6IB43|Q8NBH9|Q96IA2|Q9TNQ8|Q9UN49	Missense_Mutation	SNP	pfam_TRAP_alpha	p.L140P	ENST00000244763.4	37	c.419	CCDS4499.1	6	.	.	.	.	.	.	.	.	.	.	A	26.9	4.786306	0.90367	.	.	ENSG00000124783	ENST00000474597;ENST00000244763;ENST00000397511;ENST00000534851;ENST00000479365;ENST00000462112	T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.62780	0.2456	M	0.80847	2.515	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.68621	0.959;0.959	T	0.66019	-0.6027	10	0.46703	T	0.11	.	15.5577	0.76213	1.0:0.0:0.0:0.0	.	140;140	C9J5W0;P43307	.;SSRA_HUMAN	P	140;140;140;113;140;140	ENSP00000418617:L140P;ENSP00000244763:L140P;ENSP00000380647:L140P;ENSP00000443020:L113P;ENSP00000417911:L140P;ENSP00000417290:L140P	ENSP00000244763:L140P	L	-	2	0	SSR1	7246666	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.125000	0.94402	2.263000	0.75096	0.533000	0.62120	CTT	SSR1	-	pfam_TRAP_alpha	ENSG00000124783		0.448	SSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSR1	HGNC	protein_coding	OTTHUMT00000039775.2	274	0.00	0	A			7301667	7301667	-1	no_errors	ENST00000244763	ensembl	human	known	69_37n	missense	244	14.08	40	SNP	1.000	G
SYCP2L	221711	genome.wustl.edu	37	6	10935310	10935310	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr6:10935310C>A	ENST00000283141.6	+	21	1999	c.1703C>A	c.(1702-1704)tCa>tAa	p.S568*		NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	568						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			CTATCACCATCAGAGAAAGAA	0.299																																						dbGAP											0													67.0	62.0	63.0					6																	10935310		1790	4075	5865	-	-	-	SO:0001587	stop_gained	0			AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.1703C>A	6.37:g.10935310C>A	ENSP00000283141:p.Ser568*		A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Nonsense_Mutation	SNP	NULL	p.S568*	ENST00000283141.6	37	c.1703	CCDS43423.1	6	.	.	.	.	.	.	.	.	.	.	C	34	5.326621	0.95708	.	.	ENSG00000153157	ENST00000283141	.	.	.	5.37	-4.39	0.03611	.	3.488270	0.00857	N	0.001888	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-28.7773	5.3161	0.15856	0.0:0.3357:0.285:0.3793	.	.	.	.	X	568	.	ENSP00000283141:S568X	S	+	2	0	SYCP2L	11043296	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.224000	0.02959	-0.430000	0.07318	-0.290000	0.09829	TCA	SYCP2L	-	NULL	ENSG00000153157		0.299	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2L	HGNC	protein_coding	OTTHUMT00000039845.3	319	0.00	0	C	NM_194299		10935310	10935310	+1	no_errors	ENST00000283141	ensembl	human	known	69_37n	nonsense	250	26.04	88	SNP	0.000	A
THNSL1	79896	genome.wustl.edu	37	10	25313398	25313398	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr10:25313398C>T	ENST00000524413.1	+	3	1593	c.1246C>T	c.(1246-1248)Caa>Taa	p.Q416*	THNSL1_ENST00000376356.4_Nonsense_Mutation_p.Q416*			Q8IYQ7	THNS1_HUMAN	threonine synthase-like 1 (S. cerevisiae)	416						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(5)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28					L-Threonine(DB00156)	AAGTGATTTTCAAAAAGCACA	0.358																																						dbGAP											0													113.0	114.0	114.0					10																	25313398		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK025655	CCDS7147.1	10p12.31	2008-02-05	2007-06-20		ENSG00000185875	ENSG00000185875			26160	protein-coding gene	gene with protein product		611260	"""threonine synthase-like 1 (bacterial)"""			12477932	Standard	NM_024838		Approved	FLJ22002	uc001isi.4	Q8IYQ7	OTTHUMG00000017828	ENST00000524413.1:c.1246C>T	10.37:g.25313398C>T	ENSP00000434887:p.Gln416*		B3KWL1|D3DRV3|Q5VV21	Nonsense_Mutation	SNP	pfam_Shikimate_kinase,pfam_PyrdxlP-dep_enz_bsu,superfamily_PyrdxlP-dep_enz_bsu,prints_Shikimate_kinase,tigrfam_Thr_synthase	p.Q416*	ENST00000524413.1	37	c.1246	CCDS7147.1	10	.	.	.	.	.	.	.	.	.	.	C	39	7.644041	0.98409	.	.	ENSG00000185875	ENST00000524413;ENST00000376356	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-31.9453	19.8635	0.96793	0.0:1.0:0.0:0.0	.	.	.	.	X	416	.	ENSP00000365534:Q416X	Q	+	1	0	THNSL1	25353404	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.293000	0.78740	2.700000	0.92200	0.650000	0.86243	CAA	THNSL1	-	pfam_PyrdxlP-dep_enz_bsu,superfamily_PyrdxlP-dep_enz_bsu,tigrfam_Thr_synthase	ENSG00000185875		0.358	THNSL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	THNSL1	HGNC	protein_coding	OTTHUMT00000394913.1	536	0.00	0	C	NM_024838		25313398	25313398	+1	no_errors	ENST00000376356	ensembl	human	known	69_37n	nonsense	425	18.27	95	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	GRCh37	CM941329	TP53	M							102.0	91.0	94.0					17																	7578263		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R196*	ENST00000269305.4	37	c.586	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	373	0.00	0	G	NM_000546		7578263	7578263	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	198	25.28	67	SNP	1.000	A
TRABD2A	129293	genome.wustl.edu	37	2	85097456	85097456	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr2:85097456A>C	ENST00000409520.2	-	2	604	c.562T>G	c.(562-564)Tta>Gta	p.L188V	TRABD2A_ENST00000409133.1_Missense_Mutation_p.L188V|TRABD2A_ENST00000335459.5_Missense_Mutation_p.L188V	NM_001277053.1	NP_001263982.1	Q86V40	TIKI1_HUMAN	TraB domain containing 2A	188					head development (GO:0060322)|metabolic process (GO:0008152)|negative regulation of Wnt signaling pathway (GO:0030178)|protein oxidation (GO:0018158)|Wnt signaling pathway (GO:0016055)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|Wnt-protein binding (GO:0017147)										AACAGGTCTAAGACAGGCACT	0.547																																						dbGAP											0													130.0	135.0	133.0					2																	85097456		2062	4213	6275	-	-	-	SO:0001583	missense	0			BC049209	CCDS46349.1, CCDS62946.1	2p11.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000186854	ENSG00000186854			27013	protein-coding gene	gene with protein product		614912	"""chromosome 2 open reading frame 89"""	C2orf89		12477932	Standard	NM_001080824		Approved		uc010ysl.3	Q86V40	OTTHUMG00000152922	ENST00000409520.2:c.562T>G	2.37:g.85097456A>C	ENSP00000387075:p.Leu188Val		B4DKK8|I6UMB9	Missense_Mutation	SNP	NULL	p.L188V	ENST00000409520.2	37	c.562		2	.	.	.	.	.	.	.	.	.	.	A	13.66	2.303614	0.40795	.	.	ENSG00000186854	ENST00000335459;ENST00000409520;ENST00000409133	T;T;T	0.36699	2.93;1.24;1.24	3.14	0.673	0.17941	.	0.000000	0.49916	D	0.000129	T	0.50188	0.1601	.	.	.	0.37037	D	0.896949	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.91635	0.992;0.999;0.999	T	0.49835	-0.8897	9	0.37606	T	0.19	.	5.8895	0.18899	0.7553:0.0:0.2447:0.0	.	188;188;188	Q86V40;C9IYB5;Q86V40-2	CB089_HUMAN;.;.	V	188	ENSP00000335004:L188V;ENSP00000387075:L188V;ENSP00000387183:L188V	ENSP00000335004:L188V	L	-	1	2	C2orf89	84950967	1.000000	0.71417	0.925000	0.36789	0.436000	0.31835	0.809000	0.27168	-0.038000	0.13624	0.379000	0.24179	TTA	TRABD2A	-	NULL	ENSG00000186854		0.547	TRABD2A-201	KNOWN	basic|appris_principal	protein_coding	TRABD2A	HGNC	protein_coding		181	0.00	0	A	NM_001080824		85097456	85097456	-1	no_errors	ENST00000409520	ensembl	human	known	69_37n	missense	152	11.63	20	SNP	1.000	C
UGT2A1	10941	genome.wustl.edu	37	4	70455314	70455314	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr4:70455314G>T	ENST00000503640.1	-	6	1415	c.1360C>A	c.(1360-1362)Ccc>Acc	p.P454T	UGT2A2_ENST00000457664.2_Missense_Mutation_p.P463T|UGT2A1_ENST00000286604.4_Missense_Mutation_p.P454T|UGT2A1_ENST00000512704.1_Missense_Mutation_p.P410T|UGT2A1_ENST00000514019.1_Missense_Mutation_p.P620T|UGT2A1_ENST00000502343.1_5'Flank	NM_006798.3	NP_006789.2	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus	454					cellular glucuronidation (GO:0052695)|detection of chemical stimulus (GO:0009593)|metabolic process (GO:0008152)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						CGATCCAGGGGCTTTACAGGT	0.433																																						dbGAP											0													111.0	115.0	113.0					4																	70455314		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ006054	CCDS3529.1, CCDS58901.1, CCDS58902.1	4q13	2013-03-28	2010-12-02					"""UDP glucuronosyltransferases"""	12542	protein-coding gene	gene with protein product		604716	"""UDP glycosyltransferase 2 family, polypeptide A1"", ""UDP glucuronosyltransferase 2 family, polypeptide A1"""			10359671	Standard	NM_001252274		Approved		uc011caq.2	Q9Y4X1	OTTHUMG00000184942	ENST00000503640.1:c.1360C>A	4.37:g.70455314G>T	ENSP00000424478:p.Pro454Thr		B4E2F4|D3GER1|D3GER2|E9PDM7|J3KNA3	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.P463T	ENST00000503640.1	37	c.1387	CCDS3529.1	4	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735438	0.69189	.	.	ENSG00000173610	ENST00000457664;ENST00000503640;ENST00000512704;ENST00000514019;ENST00000286604	T;T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98;-0.98	4.65	4.65	0.58169	.	0.116249	0.64402	D	0.000016	D	0.89079	0.6613	M	0.92122	3.275	.	.	.	D;D;D;D;D	0.89917	0.998;0.972;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.975;0.93;0.999;0.998;0.999	D	0.91839	0.5482	9	0.87932	D	0	.	15.8962	0.79336	0.0:0.0:1.0:0.0	.	620;620;410;463;454	E9PDM7;B4E2F4;D6RFW5;Q9Y4X1-2;Q9Y4X1	.;.;.;.;UD2A1_HUMAN	T	463;454;410;620;454	ENSP00000387888:P463T;ENSP00000424478:P454T;ENSP00000421432:P410T;ENSP00000425497:P620T;ENSP00000286604:P454T	ENSP00000286604:P454T	P	-	1	0	UGT2A1	70489903	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.525000	0.53502	2.526000	0.85167	0.579000	0.79373	CCC	UGT2A1	-	pfam_UDP_glucos_trans	ENSG00000173610		0.433	UGT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2A1	HGNC	protein_coding	OTTHUMT00000251554.3	364	0.27	1	G	NM_006798		70455314	70455314	-1	no_errors	ENST00000457664	ensembl	human	known	69_37n	missense	309	17.38	65	SNP	1.000	T
TTC29	83894	genome.wustl.edu	37	4	147724636	147724636	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr4:147724636C>G	ENST00000325106.4	-	11	1529	c.1303G>C	c.(1303-1305)Ggt>Cgt	p.G435R	TTC29_ENST00000506019.1_5'UTR|TTC29_ENST00000398886.4_Missense_Mutation_p.G461R|TTC29_ENST00000513335.1_Missense_Mutation_p.G461R	NM_031956.2	NP_114162.2	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	435										breast(2)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					TCAATGTTACCTCTGCTCTCC	0.378																																						dbGAP											0													99.0	97.0	98.0					4																	147724636		1928	4148	6076	-	-	-	SO:0001583	missense	0			AF345910	CCDS47141.1, CCDS75200.1	4q31.23	2013-01-11				ENSG00000137473		"""Tetratricopeptide (TTC) repeat domain containing"""	29936	protein-coding gene	gene with protein product						12477932	Standard	NM_031956		Approved	NYD-SP14	uc003ikw.4	Q8NA56		ENST00000325106.4:c.1303G>C	4.37:g.147724636C>G	ENSP00000316740:p.Gly435Arg		A4GU95|Q9BXB6	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR-contain_dom	p.G461R	ENST00000325106.4	37	c.1381	CCDS47141.1	4	.	.	.	.	.	.	.	.	.	.	C	5.961	0.361293	0.11296	.	.	ENSG00000137473	ENST00000513335;ENST00000398886;ENST00000325106;ENST00000504425	T;T;T;T	0.21543	2.0;2.0;2.02;2.02	5.84	3.23	0.37069	.	0.312791	0.38436	N	0.001696	T	0.10035	0.0246	N	0.08118	0	0.26497	N	0.974847	B;B;B	0.11235	0.001;0.004;0.001	B;B;B	0.09377	0.001;0.004;0.001	T	0.20107	-1.0285	10	0.46703	T	0.11	-3.0214	7.4523	0.27246	0.0:0.0815:0.138:0.7805	.	435;461;435	E7EQ14;G5E9Z5;Q8NA56	.;.;TTC29_HUMAN	R	461;461;435;435	ENSP00000423505:G461R;ENSP00000381861:G461R;ENSP00000316740:G435R;ENSP00000425778:G435R	ENSP00000316740:G435R	G	-	1	0	TTC29	147944086	0.997000	0.39634	0.078000	0.20375	0.032000	0.12392	0.999000	0.29757	0.375000	0.24679	-0.345000	0.07892	GGT	TTC29	-	NULL	ENSG00000137473		0.378	TTC29-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC29	HGNC	protein_coding		385	0.00	0	C	NM_031956		147724636	147724636	-1	no_errors	ENST00000398886	ensembl	human	known	69_37n	missense	312	12.36	44	SNP	0.983	G
XPO1	7514	genome.wustl.edu	37	2	61710129	61710129	+	Silent	SNP	A	A	G			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr2:61710129A>G	ENST00000401558.2	-	22	3502	c.2775T>C	c.(2773-2775)caT>caC	p.H925H	RP11-355B11.2_ENST00000603652.1_RNA|XPO1_ENST00000404992.2_Silent_p.H925H|RP11-355B11.2_ENST00000603028.1_RNA|RP11-355B11.2_ENST00000578974.2_RNA|RP11-355B11.2_ENST00000603199.1_RNA|XPO1_ENST00000406957.1_Silent_p.H925H|RP11-355B11.2_ENST00000605437.1_RNA	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	925					gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			CAGAAAAGATATGCTGGAGAA	0.373			Mis		CLL																																	dbGAP	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	0													74.0	81.0	78.0					2																	61710129		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.2775T>C	2.37:g.61710129A>G			A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Silent	SNP	pfam_CRM1_C_dom,pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.H925	ENST00000401558.2	37	c.2775	CCDS33205.1	2																																																																																			XPO1	-	pfam_CRM1_C_dom,superfamily_ARM-type_fold	ENSG00000082898		0.373	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO1	HGNC	protein_coding	OTTHUMT00000325872.3	254	0.00	0	A	NM_003400		61710129	61710129	-1	no_errors	ENST00000401558	ensembl	human	known	69_37n	silent	221	18.45	50	SNP	1.000	G
ZNF625	90589	genome.wustl.edu	37	19	12256170	12256170	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14N-01A-31D-A135-09	TCGA-E2-A14N-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	00c8d151-2223-4e36-8c66-6c09e42d8777	d2ad26e4-a4a8-45de-9f85-c681a2a49f43	g.chr19:12256170G>C	ENST00000355738.1	-	4	1212	c.863C>G	c.(862-864)aCt>aGt	p.T288S	ZNF625_ENST00000455799.1_3'UTR|ZNF625_ENST00000542938.1_Missense_Mutation_p.T288S|ZNF625-ZNF20_ENST00000430024.1_Intron|ZNF625_ENST00000439556.2_Missense_Mutation_p.T354S|CTC-359D24.3_ENST00000472362.1_RNA			Q96I27	ZN625_HUMAN	zinc finger protein 625	288					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|large_intestine(6)|lung(4)|skin(2)	14						TTTTTCTCCAGTGTGAGTCCT	0.443																																						dbGAP											0													107.0	101.0	103.0					19																	12256170		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007868	CCDS12269.1, CCDS12269.2	19p13.2	2013-01-08			ENSG00000257591	ENSG00000257591		"""Zinc fingers, C2H2-type"", ""-"""	30571	protein-coding gene	gene with protein product						12477932	Standard	NM_145233		Approved		uc010dyo.2	Q96I27	OTTHUMG00000156407	ENST00000355738.1:c.863C>G	19.37:g.12256170G>C	ENSP00000347977:p.Thr288Ser		A4FU45|I3L0E9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T354S	ENST00000355738.1	37	c.1061		19	.	.	.	.	.	.	.	.	.	.	G	11.88	1.771770	0.31320	.	.	ENSG00000257591	ENST00000542938;ENST00000355738;ENST00000439556	T;T;T	0.07114	3.22;3.22;3.22	1.13	-0.167	0.13347	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07098	0.0180	L	0.45744	1.44	0.80722	D	1	B;B	0.21821	0.061;0.037	B;B	0.17722	0.005;0.019	T	0.19516	-1.0303	9	0.56958	D	0.05	.	4.7406	0.13010	0.0:0.4049:0.5951:0.0	.	288;288	A8K8U0;Q96I27	.;ZN625_HUMAN	S	288;288;354	ENSP00000438436:T288S;ENSP00000347977:T288S;ENSP00000394380:T354S	ENSP00000347977:T288S	T	-	2	0	AC022415.5	12117170	0.139000	0.22563	0.901000	0.35422	0.715000	0.41141	-1.722000	0.01868	0.007000	0.14760	0.313000	0.20887	ACT	ZNF625	-	pfscan_Znf_C2H2	ENSG00000257591		0.443	ZNF625-201	KNOWN	basic	protein_coding	ZNF625	Clone_based_vega_gene	protein_coding		331	0.00	0	G	NM_145233		12256170	12256170	-1	no_errors	ENST00000439556	ensembl	human	known	69_37n	missense	277	19.01	65	SNP	1.000	C
